Physiological Roles of Eukaryotic Hanks Type Ser/Thr Kinase in Transition to Stationary Phase in Bacillus Subtilis

Home , Arginine kinase, Diguanylate cyclase

Physiological roles of Eukaryotic Hanks type Ser/Thr kinase in transition to stationary phase in Bacillus subtilis

PhD Thesis By M. Ahasanul KOBIR

Thesis Supervisor: Professor Ivan MIJAKOVIC

MICALIS UMR 1319, INRA-AgroParisTech, CBAI, F -78850 Thiverval-Grignon, FRANCE Ecole doctorale Gènes, Génomes, Cellules Discipline : Molecular genetics 30/10/2012

Thesis Jury committee

Prof. Pierre CAPY Président du jury Professor, Laboratoire Evolution Génétique et Speciation, Avenue de la Terrasse, Bat-13, BP-1, CNRS 91198 Gif-sur-Yvette Cedex, France Dr. Alexandra GRUSS Rapporteur Directeur de recherche, INRA - MICALIS UMR1319 Domaine de Vilvert, 78350 Jouy en Josas, France Dr. Anne GALINIER Rapporteur Directeur de recherche, Laboratoire de Chimie Bacterienne, UPR 9043, IFR 88, CNRS, Universite de la Mediterranee, Marseille, France Dr. Christophe GRANGEASSE Examinateur Directeur de recherche, IBCP, CNRS UMR 5086, Lyon Prof. Ivan MIJAKOVIC Directeur de Thése Prof. De Biologie Systemique, AgroParisTech Directeur de recherche,MICALIS UMR 1319, INRA

Acknowledgement

This study was carried out at the Microbiologie et Génétique Moléculaire Laboratory at Thiverval Grignon under MICALIS, UMR1319, INRA, Paris, France. This thesis has been kept on track and has been continued towards completion with the support and encouragement of several learned experts, including my well wishers, friends, colleagues and collaborators. All of them deserve special appreciations.

First of all, I would like to express my thankfulness and profound gratitude to my supervisor Professor Ivan Mijakovic for accepting me initially as a Master’s thesis student and then for PhD. My heartfelt gratitude is due to him for introducing me to the world of science. I am indebted to him for his excellent scientific guidance and constantly inspiration, encouragement, freedom to pursue my own ideas as well as open thinking attitude. He will remain ever fresh in my mind for the feelings he had for me. I shall remember his concern about me when I first came to France.

I would like to thank the president of jury Prof. Pierre Capy and the entire jury members for my PhD dissertation, who took all the trouble to review my thesis as well as their presence at the time of defense. Prof. Pierre Capy deserve special appreciation for his help and excellent cooperation in admission and also reinscription to the doctoral school under University of Paris Sud.

I want to thank Dr. Alexandra Gruss for her excellent scientific advice during my first year of research evaluation at INRA and reviewing my thesis for appropriate correction and good suggestions. My warmest gratitude is due to Dr. Anne Galinier for reviewing my thesis manuscript and correcting as well as giving me good suggestions. I also would like to thank to Dr. Christophe Grangease for the consent to be a member of the jury committee.

I would like to thank to Prof. Colin Tinsley for his help and cooperation during my master project and also giving me scientific suggestions for my project and moral support as a tutor of my PhD thesis.

I would like to thank to Dr. Sandrine Poncet for the constructive criticism, many valuable inputs and suggestions to organize my thesis. I want to thank her especially for her help to translate a part of my thesis in French.

I am also thankful to Dr. Josef Deutscher for his constant advice and encouragement for science and personal matters. I am also indebted to him for feeding me during my first week in France.

I would like to thank to Madam Elisabeth Maltase for teaching French course and also help to translate and other administrative stuffs during my PhD.

I would like to thank all co-authors of different manuscripts included in my PhD. thesis.

Especially I would like to thanks to Dr. Marie Francoise Noirot-Gros, for her support to do yeast two hybrid assay and some other in vivo assays for RecA project and partially for AbrB project in her lab, to Professor Boris Macek for the phosphoproteome analysis in Bacillus subtilis as well as for LC.MS analysis to confirm kinase specific phosphorylation in AbrB project and to Dr. Philippe Noirot for transcriptome analysis in AbrB project.

I would like to thank Dr. Vladimir Bidnenko, Dr. Natalie Pigeonneau and Magali Ventroux for their valuable contribution in this study.

I want to thank Professor Sylvie Nessler for gel-filtration assay and crystallography analysis in AbrB project. Also appreciation goes to Dr. Rosa Grenha and Samira Zouhir for sharing their results.

I also would like to thank to Dr. Mathieu Jules for training me live cell array analysis in his lab.

Further I would like to express my gratitude to all the people that I have worked at Microbiologie et Génétique Moléculaire laboratory and especially the many people working alongside to my lab for creating a great atmosphere. I would like to thank to all of my colleagues, Dr. Pierre-Yves Holtzmann, Charlotte Cousine, for their excellent company. Especially warmest gratitude is due to Dr. Lei Shi for her scientific advice and help for doing experiments in this study and also to my best friend and colleague Abderahman Derouiche for being with me during my bad days. I would like to render special thank to Anne Blivet, Stephane Tribouillet, Guy and Denise Cintrat for their help in administrative issue and media preparation. I would like to thank to my student Paula Dobrinic that I had the pleasure of supervising her work. I also would like to thank to my ex-colleague Dr. Carsten Jers, Kristina, Anna and Lorena for their friendly cooperation and excellent company. I also would like to thank Elian, Oliver Brokowski, Francine, Ramdane, Hamid, Houda, Daniala, Imane, Aurthur

2 and all other wonderful people at Microbiologie et Génétique Moléculaire laboratory for making my stay memorable.

Many thanks to Dr. Md. Zeur Rahim and Dr. Tania Rahman for their enormous love, moral support and encouragement.

Warmest gratitude is due to Farzana Siddika for mental support and inspiration and to Dr. Nurul Alam, Sayem Mia, Mosharof Hosain, Sumon, Samid, Mahfuz, Kibria, Jahid vai for their association with me during my days in France. I never felt home sick for their association with me.

Many thanks to Arif vai and vabi, Emdad, Kamal for their help to prepare good Bangladeshi food all the time and especially for preparing cocktail party for my PhD.

I very much appreciate encouragement, enormous love and support of my parents, M.A. Razzak and MRS Nurjahan Arju, my sister MRS Nasima Parveen and nephew Mahi to finish PhD.

I would like to thank INRA for their financial support for my Ph. D.

List of publications

This thesis is based on the following articles

1. Kobir A, Shi L, Boskovic A, Grangeasse C, Franjevic D, Mijakovic I.(2011)Protein phosphorylation in bacterial signal transduction.Biochim Biophys Acta.1810(10):989- 94 (Published). (chapter 1)

2. Jers C, Kobir A, Søndergaard EO, Jensen PR, Mijakovic I.(2011) Bacillus subtilis two-component system sensory kinase DegS is regulated by serine phosphorylation in its input domain. PLoS One. 6(2):e14653 ( Published). (chapter 2)

,¶ ,¶ 3. Bidnenko V , Shi L , Kobir A, Ventroux M, Pigeonneau N, Trubuil A, Noirot-Gros ,* * M and Mijakovic I (2012) Bacillus subtilis serine/threonines kinase YabT phosphorylates the recombinase RecA . PLoS One (Submitted) ( chapter 3)

4. Kobir A, Poncet S, Bidnenko V, Jers C, Zouhir S, Nessler S, Noirot-Gros M and Mijakovic I (2012) Phosphorylation of Bacillus subtilis gene regulator AbrB modulates its DNA-binding properties. (In preparation to submit in EMBO reports) (chapter 4)

Publication not part of this thesis ( Appendices I )

5. Shi L, Kobir A, Jers C and Mijakovic I ( 2010) Bacterial Protein-Tyrosine Kinases; Current Proteomics (Published )

Table of contents

Chapter 1 Pages

Introduction……………………………………………………………….

1 Phosphorylation in bacteria…………………………………………………………… 1

2. Classification of bacterial protein kinases and phosphatase……………………… . 3

2.1 Two-component systems (TCS)……………………………………………………. 4 2.2 Ser/thr kinases………………………………………………………………………. 7 2.2.1. Isocitrate Dehydrogenase Kinase Phosphatase ( IDHK/P)………………………. 7 2.2.2 HprK/P…………………………………………………………………………….. 8 2.2.3 Hanks type STKs in bacteria……………………………………………………… 9 2.2.4.Physiological roles and targets of Hanks type Ser/Thr kinase in bacteria………. 12 2.3. Tyrosine kinase……………………………………………………………………. 18 2.3.1 Physiological roles of substrates for tyrosine kinase and phosphatase...... 21 2.4. Protein Ser/Thr/Tyr phosphatase………………………………………………….. 23 2.4.1. Ser/thr phosphatases…………………………………………………………….. 23 2.4.1.1. Physiological roles of the substrates of Ser/Thr phosphatase…………………. 25 2.4.2. Protein Tyrosine phosphatases………………………………………………….. 28 3. Phosphoproteomics the systematic approach……………………………………. 30 4. Bacillus subtilis is a model organism Kobir et al., 2011………………………………………………………………………. 35 5. Outline of the thesis work……………………………………………………….. 41 Chapter 2 Jers et al., 2011 Chapter 3 Bidnenko et al., 2012……………………………………………………………….. 55 Chapter 4 Kobir et al., 2012……………………………………………………………………. 90

Chapter 5 Discussion……………………………………………………………………… 115 References……………………………………………………………………… 123 List of appendices……………………………………………………………… 148 Shi et al., 2010…………………………………………………………………. 148 Cascade project………………………………………………………………… 155

Abstract Bacillus subtilis is the model organism for low GC Gram-positive bacteria and is of great biotechnological interest. Protein phosphorylation is an important regulatory mechanism in bacteria, and it has not been extensively studied yet. Recent site-specific phosphoproteomic studies identified a large number of novel serine/threonine phosphorylation sites in B. subtilis, including a) two transition phase global gene regulators DegS and AbrB and b) RecA, that plays a major role in double-strand break repair and DNA recombination. B. subtilis disposes of several putative Ser/Thr kinases like PrkA, YbdM, YabT and a characterizd kinase PrkC, but very few physiological substrates for these have been defined so far. In vitro phosphorylation assays were used to identify which of these kinases were able to phosphorylate DegS, RecA and AbrB.

DegS phosphorylation on serine 76 by the kinase YbdM influenced its activity towards DegU both in vitro and in vivo, and expression of DegS S76D (on replacing serine to aspartate) in B. subtilis perturbed cellular processes regulated by the DegS/DegU two component system. This suggests a link between DegS phosphorylation at serine 76 and the level of DegU phosphorylation, establishing this post-translational modification as an additional trigger for this two-component system.

At the onset of sporulation, B. subtilis expresses an unusual serine/threonine kinase YabT, which exhibits a septal localization and is activated by non-sequence-specific DNA binding. Activated YabT phosphorylates RecA at the residue serine 2, which in turn promotes the formation of RecA foci at the onset of spore development. On the other hand, non- phosphorylatable RecA or inactivated YabT lead to reduced spore formation in the presence of DNA lesions. This suggests a functional similarity between B. subtilis developmental stage dependent RecA phosphorylation and its eukaryal homologous Rad51 phosphorylation, which leads to its recruitment to the lesion sites. We therefore proposed that RecA phosphorylation serves as an additional signal mechanism that promotes focus formation during spore development.

AbrB is phosphorylated by YabT, YbdM and PrkC in vitro and AbrB phosphorylation leads to reduced affinity for its target DNA and abolished binding cooperativity in vitro and in vivo. Expression of the phosphomimetic AbrB-S86D or of the non-phosphorylatable AbrB-S86A mutant protein in B. subtilis disturbed some stationary phase phenomena such as exoprotease production, competence and the onset of sporulation, probably by deregulation of AbrB-target genes and operons. We, therefore, proposed that AbrB phosphorylation as an additional regulatory mechanism needed to switch off this ambiactive gene regulator during the transition phase.

Résumé Bacillus subtilis est la bactérie modèle des bactéries Gram-positif à bas pourcentage en GC et possède un intérêt marqué en biotechnologie. Par ailleurs, la phosphorylation des protéines est un mécanisme de régulation essentiel chez les bactéries qui reste encore largement à explorer. B. subtilis possède plusieurs ser/thr kinases potentielles (PrkA, YbdM, YabT et PrkC, qui a été déjà largement caractérisée), mais très peu de substrats de ces kinases ont été mis en évidence. Récemment, des études phosphoprotéomiques ont permis d’identifier de nombreux peptides phosphorylés sur des sérines ou des thréonines chez B. subtilis, incluant: a) deux régulateurs globaux de la phase de transition, DegS et AbrB et b) RecA, qui joue un rôle essentiel dans la réparation des cassures double-brin de l’ADN et la recombinaison. Des tests de phosphorylation in vitro nous ont permis d’identifier les ser/thr kinases capables de phosphoryler DegS, RecA et AbrB. La phosphorylation de DegS sur son résidu sérine 76 par la kinase YbdM influence, in vitro et in vivo, son activité kinase vis à vis de son substrat DegU. L’expression chez B. subtilis d’un allèle codant la protéine DegS-S76D (la sérine étant remplacée par un aspartate phosphomimétique) perturbe l’ensemble des processi cellulaires régulés par le système à deux composants DegS/DegU. Ces résultats suggèrent un lien entre la phosphorylation de DegS sur sa sérine 78 et le niveau de phosphorylation de son substrat DegU, cette modification post- traductionnelle représentant un degré supplémentaire de régulation pour ce système à deux composants. Au cours du démarrage de la sporulation, B. subtilis exprime une ser/thr kinase atypique, YabT, qui localise au septum et est activée grâce à la liaison de séquences ADN non spécifiques. YabT activée phosphoryle RecA sur sa sérine 2, ce qui induit la formation de foci RecA. Dans une souche exprimant une protéine RecA non phosphorylable (RecA-S2A) ou inactivée pour yabT, la formation de spores en présence de lésions de l’ADN est diminuée. Ces résultats suggèrent une homologie fonctionnelle au cours du développement entre la phosphorylation de RecA chez B. subtilis et la phosphorylation de son homologue eukaryote Rad51, qui permet leur recrutement sur des lésions de l’ADN. Nous proposons donc que la phosphorylation de RecA serve de signal pour promouvoir la formation de foci au cours de la sporulation. In vitro, le régulateur transcriptionnel AbrB est phosphorylé par les kinases YabT, YbdM et PrkC, L’utilisation de protéines mutées AbrB-S86A (non phosphorylable) et AbrB-S86D (forme phosphomimétique) nous a permis de montrer que la phosphorylation d’AbrB diminue son affinité pour l’ADN cible. L’expression chez B. subtilis des protéines AbrB-S86A et – S86D perturbe des phénomènes mis en place au cours de la phase stationnaire comme la production d’exoprotéases, la compétence et la sporulation via la dérégulation des gènes et opérons AbrB-dépendants correspondants. Nous proposons donc que la phosphorylation d’AbrB par les Hanks-kinases constitue un mécanisme de contrôle supplémentaire nécessaire à l’inactivation de ce régulateur transcriptionnel, qui peut être activateur ou répresseur, pendant la phase de transition.

Chapter 1

Introduction

1. Protein phosphorylation in bacteria

Protein phosphorylation is the covalent attachment of a phosphate group to a protein and is one of the most common and best characterized intracellular post translational modifications in bacteria and eukaryotes, where it plays key roles in metabolic regulation and signal transduction. Although it was early detected, the idea that it might have an important role not only in the structure but also in the functioning of proteins in the cellular metabolism (Rimington et al., 1927) was slow to take root. Its direct involvement in the metabolic pathways was first described in Eukarya with the demonstration of enzymatic protein phosphorylation in 1954 (Burnett and Kennedy, 1954). A year later, the role of phosphorylation became more interesting for Nobel laureates Edwin Kerbs and Edmund Fischer (Fischer and Krebs, 1955) and Wosilait & Sutherland (Sutherland and Wosilait, 1955). They demonstrated that an enzyme involved in glycogen metabolism was regulated by the addition or removal of a phosphate, suggesting that reversible phosphorylation could control enzyme activity.

Ser/Thr/Tyr phosphorylation

non-phosphorylated

Phosphorylated

Figure: 1. These three amino acids all contain a hydroxyl group which functions as a phosphate acceptor. In this type of phosphorylation, specific kinases phosphorylates the substrates using ATP as phosphate donor and phosphatases remove the phosphate group.

During 1960s to 1970s a good number of phosphoenzymes and phosphoproteins have been characterized in a wide variety of eukaryotic systems from fungi to mammals, and thus protein phosphorylation has been definitely as a major dynamic process involved in a large array of cellular functions. Despite its importance for regulating protein function in eukaryotic cells, the existence and function of protein phosphorylation-dephosphorylation in

1 prokaryotes had long been subject to controversy ( Cozzone et al,. 1988a). It was only in the late 1970s; the first evidence for the presence of protein phosphorylation in bacteria found in 1978 with identification of serine and threonine phosphorylated proteins in Salonella typhimurium (Wang and koshland, 1978) and followed up with the work on protein phosphorylation in bacteria by Garnak & Reeves and Manai & Cozzone in 1979. They identified first example of bacterial protein kinase (Isocitrate dehydrogenase IDHK) that regulated by phosphorylation (Garnak & Reeves, 1979) and also concluded protein kinase activity in E.coli (Manai & Cozzone, 1979). Protein kinases play a vital role in information transfer within the cell. Serine, threonine, tyrosine, histidine and aspartate are the commonly phosphorylated aminoacids (Johnson et al., 2001). Bacteria are known to employ: the two-component systems, the phosphoenolpyruvate-dependent phosphotransferase system (PTS) and Ser/Thr/Tyr phosphorylation and arginine phosphorylation. The two-component systems involve a sensor kinase and a response regulator. In response to an external stimulus, the sensory kinase autophosphorylates on a histidine residue using ATP as a phosphate donor. This phosphate group is then transferred to an aspartate residue on the response regulator. The response regulator is activated by phosphorylation ultimately leading to activation or repression of transcription of specific genes (Stock et al., 2000)(Fig: 2). Although the sensory kinases are often regarded as membrane proteins receiving an external signal, it has been estimated about 20% are soluble and are sensing cytoplasmic signals (Mascher et al., 2006). The second system is the PTS in which a phosphate group from phosphoenolpyruvate is passed down a chain of specific proteins, all reversibly phosphorylated, and finally transferred to a sugar. The PTS is thus primarily involved in translocation of sugars across the membrane, but phosphorylated forms of some of its components (HPr, EIIA) also have other regulatory roles in the cell (Deutscher et al., 2005).

The third system is Ser/Thr/Tyr phosphorylation, which is at the focus of this study and is described in more detail below. The acceptance of tyrosine phosphorylation in bacteria was long been underway. Although phosphotyrosine was found as early as 1986 in E.coli( Carty et al.,1986) and Acinetobacter johnsonii (Dadssi and Cozzone, 1990), it was not characterized. In 1997 first autophosphorylating protein tyrosine kinase Ptk from Acinetobacter johnsonii was characterized (Grangeasse et al., 1997) and after that protein tyrosine phosphorylation in bacteria was generally acknowledged. Low occupancy of phosphorylation sites is known to hinder detection of tyrosine-phosphorylated proteins

(Mijakovic et al., 2003). Unlike Ser/thr phosphorylation, tyrosine phosphorylation is mediated mainly by bacteria-specific kinases, having no resemblance to eukaryal tyrosine kinases (Cozzone et al., 2004). The first endogenous substrates of tyrosine kinases were identified in 2003, and since then the number of characterized kinases and substrates have increased steadily. Other protein phosphorylation systems however exist, for example McsB, formerly thought to be a tyrosine kinase, was recently reported to be a protein arginine kinase (Fuhrmann et al., 2009) and opening up a new chapter in bacterial protein phosphorylation. Recently, from phosphoproteomic analysis 121 arginine phosphorylation sites from 87 proteins were identified in B.subtilis in vivo. It was also demonstrated that protein arginine phosphorylation is involved in the regulation of some critical cellular process such as competence, motility, protein degradation and stress response (Elsholz et al., 2012).

2. Classification of bacterial protein kinases and phosphatases

Protein kinases are responsible for the regulation of many biological phenomena. They fall into several major families that are based on the specific amino acid residues that they modify. Several classification schemes have been proposed in the literature. The first generally accepted protein kinase classification was proposed by Hanks and Hunter who performed a phylogenetic analysis of catalytic domains of eukaryotic protein kinases (on the basis of phosphate acceptor amino acids)(fig: 1) (Hanks et al., 1988 and Hunter et al, 1991). In their path paving work Tygi et al. proposed the first framework for classification of prokaryotic serine threonine kinases (Taygi et al., 2010).The most common types of protein phosphorylation, namely on the side chain of serine, threonine, tyrosine, hsitidine and aspartate residues, are found in all three kingdoms of life. Table 1: Classification of protein phosphorylation by bacterial kinases Phosphate acceptor Main bacterial kinases families Walker A motif Histidine/Aspartate Two-component systems (TCS) - Serine/Threonine Isocitrate Dehydrogenogenase - Kinase/Phosphatase (IDHK/P) Eukaryotic-Like Ser/Thr Kinases(eSTK) - Hisitidine Protein Kinase/Phosphorylase + (HprK/P)

Tyrosine Bacterial Tyrosine Kinases (BY) +

2.1. Two-component systems( TCS)

In bacterial signaling pathways, kinases are phosphorylated on histidine and aspartate residues in what are called two-component systems (TCS). Although TCS fulfills purposes similar to eukaryal STY-kinases, transducing signals from cell surfaces to bacterial chromosomes, they are far less complex than those in Eukaryotes. The first model of TCS was proposed by Nixon & his coworkers in 1986 (Nixon et al., 1986). TCS is present in both gram positive and gram-negative bacteria. About 30 to 40 complete TCSs were found in E.coli, B.subtilis and Synchosystis spp (Fabret et al., 1999, Mizuno et al., 1996 &1997) and more than 100 found in Nostoc puctiformis (Hoch et al.,2001). However, none were found in Mycoplasma genitalium or Ethanococcus jannaschii (Robinson et al.,2000). TCS also has been found lately in plants (Chang et al.,1993) and in yeast ( Maeda et al.,1994) , but they are apparently absent in animals (Robinson et al.,2000 & Stock et al., 2000). Two-component systems consist of a signal recognition sensor kinase (usually transmembrane) that autophosphorylates on a histidine in response to a specific stimulus and a response regulator (usually a transcription factor) that regulates gene expression when phosphorylated on an aspartate by the cognate sensory kinase. Generally a sensory kinase is a trans membrane protein, containing a signal input domain coupled with an autokinase domain (which is divided into a His-phosphotransferase sub domain and an ATP binding sub domain). The response regulator contains a regulator domain coupled with an output domain. When the stimulus is detected by the input domain, it activates sensory kinase resulting in catalysis of an ATP-dependent trans-auto-phosphorylation reaction in which one subunit of the dimer phosphorylates a specific histidine residue. The phosphoryl group from the phosphohistidine of sensory kinase then transfers to one of the aspartate residue of the regulatory domain of the response regulator. Regulator domain normally inhibits the output domain of the response regulator and phosphorylation relieves this inhibition freeing the output domain, which most often binds to specific DNA regions and regulates gene expression (Fig 2). In most cases, the response is transcriptional activation of genes whose products specifically respond to a given molecular signal (Hoch et al., 2000).

Figure 2: Two-component signal transduction system (based on Mijakovic, 2010).

Two-component systems are sometimes integrated into more complex signaling cascades, termed as phosphorelay systems. Phosphorelays are in fact, four component systems; they differ from the two-component systems by having a more convoluted signal transduction pathway using additional regulator and phosphotransferase domains. For example, in the sporulation phosphorelay of B. subtilis, the phosphoryl group was transferred in the order His→Asp→His→Asp (Figure 3)(Hoch et al., 2000). Previously, it was thought that the increased complexicity of phosphorelays compared to the two component systems may reflect the need to integrate both positive and negative signals into the output of the signal transduction pathway (Burbulys et al.,1991). Indeed phosphorelays are repeatedly used to regulate complex cellular phenomena such as sporulation and cell cycle control in bacteria and also are used in eukaryotic signaling (Hoch et al., 2000). Furthermore, there is also some evidence of phosphorelay-based developmental pathways regulating sporulation timing in Myxococcus xanthus (Cho et al 1999), heterocyst formation in Cyanobacteria (Hagen, et al., 1999), development and fruiting body formation in Dictyostelium (Thomason et al., 1999) and hyphal formation in Candida albicans (Calera et al., 1999).

Figure 3: Phosphorelay signal transduction system (Hoch et al., 2000)

Metaphorically, such two-component system and phosphorelays serve as the eyes and ears of bacteria, sensing various environmental inputs such as nutrient availability, pH, salinity, temperature as well as the presence of other bacteria. TCSs also found to regulate virulence and pathogenicity-related functions in some pathogenic bacteria such as Streptococcus (Federle et al., 1999), S. pneumoniae (Lange et al., 1999) Vibrio cholerae (Wong et al., 1998), Listeria monocytogenes (Cotter et al., 1999), Campylobacter jejuni (Brás et al.,1999), including toxin production in E. coli (Raivio et al.,1999 , Dorel et al.,1999) and Salmonella (Ernst et al.,1999, Wösten et al., 1999). TCSs also found to regulate cell adhesion, quorum sensing in Vibrio (Freeman et al., 1999) and Pseudomonas (Chancey et al., 1999). However, some examples of cross-talk between Histidine kinase and Ser/Thr as well as Tyr kinases are reported. In 1993, an anti-sigma-factor-SpoIIAB was identified in B.subtilis, which showed some similarities to Histidine kinases. It was shown to be a protein kinase that phosphorylates the anti-anti-sigmafactor SpoIIAA on a serine residue as a part of regulatory circuit that control sigma factor activity in sporulation (Min et al., 1993). It is also reported that kinase DivL identified in Caulobacter crescentus, which is homologous to the two- component sytem sensory kinases, can be auto-phosphorylated at Tyr-550. Upon autophosphorylation on Tyr, the response regulator CtrA is phosphorylated by DivL on aspartate residue that probably regulates cell division and differentiation (Wu et al., 1999). Another two examples of cross talk between two-component systems and serine/therionine kinase have been identified. One, in Streptococcus pneumoniae StkP phosphorylates the orphan response regulator RitR(UlijasZ et al., 2009). The response regulator CovR is phosphorylated on threonine-65 by Stk1 in group B Strepcoccus leading to reduced phosphorylation on aspartate-53 and thus reduced DNA binding (Lin et al 2009).

2.2. Serine/threonine kinases

In 1950’s protein phosphorylation on Ser and Thr residues was first found in eukaryotes (De Verdier et al., 1952 and Sutherland et al., 1955). After these initial studies of protein phosphorylation and after certain studies it became clear that protein phosphorylation is a key mechanism to regulate protein activity to control some cellular functions. So far, it became important to characterize and follow up with this work in 1988, Hanks first time characterized a new family of Ser/Thr kinases in eukaryotes which is still known as Hanks type kinases (Hanks et al., 1988). For serine and threonine phosphorylation, Bacteria mostly use this so-called Hanks type serine/threonine kinases, but also some atypical bi-functional kinases/phosphorylases exist.

2.2.1. Isocitrate Dehydrogenase Kinase

The first identified bacterial protein kinase is isocitrate dehydrogenase kinase (IDHK). Historically, since 1950s it was thought that Ser/thr/Tyr phosphorylation occurred only in Eukaryotes. However, the first bacterial protein substrate isocitrate dehydrogenase (IDH) was identified in E.coli (Garnak et al., 1979). This enzyme was found to be phosphorylated on a serine residue by a bifunctional kinase/phosphatase which lacked sequence homology with eukaryotic Ser/thr kinases (Laporte and Chang, 1985). IDH phosphorylation controls the switch between the Krebs’ and glyoxalate cycle by converting isocitrate to glyoxalate bypass. From the structural analysis of IDH, phosphorylation sites are found on serine-113 position in E.coli (Hurley et al., 1989) and serine-104 position in B. subtilis (Shing et al., 2001), which are in enzyme’s active site. IDH phosphorylation blocks isocitrate binding by disrupting this bond and by introducing electrostatic repulsion between the phosphate group and isocitrate (Dean et al., 1989 & 1990) (Figure 4). Upon IDH phosphorylation the glyoxalate bypass directly converts the acetyl-CoA to either glyoxalate or succinate through isocitrate that allows the cells to survive on simple carbon sources (acetate or fatty acids) during glucose starvation (Lorenz et al., 2002). During the cells growth on acetate approximately 75% of IDH is converted to inactive, so the Krebs cycle inhibiting with the phosphorylation on IDH that initiates isocitrate through the bypass. The presence of this kind of bypass found in plants and microorganisms but remain controversial in mammals (Laporte

et al.,1993 & Kondrashov et al.,2006). In the dephoshprylated enzyme (IDHP) this residue forms a hydrogen bond with isocitrate (Laporte et al.,1993) and activates Krebs cycle.

Figure : 4. Role of IDHK/P in Glyoxalate bypass based on (Constance et al., 1988, LaPorte et al.,1993 & Lorenz et al., 2002).

2.2.2. HPr kinase/phosphorylase

A PTS protein HPr is phosphorylated on Ser-46 by Hpr kinase/phosphorylase (Deutscher et al ., 1983). It is demonstrated that HPr phosphorylated on serine 46 interacts with CcpA, and the complex of the two binds to cre sites leading to carbon catabolite repression (Deutcher et al., 2006). This regulatory phenomenon is also linked to virulence in pathogenic strains (Deutcher et al., 2005b). Very recently it was found that HPr is also phosphorylated on serine 12 by a Ser/Thr kinase PrkC (Pietack et al.,2010). HPrK/P has dual antagonistic activities, which are regulated by several intracellular metabolites, which change their concentration in presence or absence of carbon sources (glucose, fructose, etc,) in the growth medium. These metabolites, including fructose-1,6-bisphosphatase (Jault et al., 2000), ATP (Kravanja et al., 1999) and PPi (Mijakovic et al., 2002). The concentration of F16 BP increases in glucose-growing cells and that stimulates the kinase function of HprK/P in B.subtilis. On the other hand, PPi inhibits kinase function of HPrK/P (Poncet et al., 2004). HPrK/P that via phosphorylation of HPr and Crh, regulates carbon metabolism and sugar transport that mediates carbon catabolic repression (CCR) and regulates the PTS sugar transport system. An interesting feature of this 8 protein is that the demodification is done using inorganic phosphate instead of H2O for nucleofilic attack, and hence it is a phosphorylase opposed to the normal phosphatase activity (Mijakovic et al., 2002)

2.2.3.Eukaryotic like Hanks type STKs in bacteria

Though Serine/Threonine kinases and phosphatases are present in both eukaryotes and bacteria. Bacterial Hanks type STKs are homologous to eukaryotic Ser/Thr kinases( Figure 5,B). The first characterized Hanks type STK in bacteria Pkn1 was reported in Myxococcus xanthus (Munoz-Dorado et al.,1991). It was found to autophosphorylate on serine and threonine residues after over expression in E.coli. Although it is required for the development of M. xanthus. Then Pkn2 was identified as a transmembrane Hanks type STK in M. xanthus, suggesting that it acts as like as amembrane receptor kinase that can play some important roles in bacterial cellular regulation (Udo et al., 1995). The phenotypic study of Pkn1 and Pkn2 inspired scientists to indentify more Hanks type STK to understand the signaling pathways of M. xanthus (Nariya et al., 2005 a& b ;2006). With the advantage of prokaryotic genome sequencing a number of bacterial Hanks type STKs were identified as the basis of containing characteristic signature sequence motifs resembling eukaryotic Ser/Thr kinases (Leonard et al., 1998; Shi et al., 1998; Kennelly et al., 2002; Krupa et al., 2005 & Perez et al., 2008). These enzymes are now considered ubiquitous in bacteria.

Structural and functional studies of bacterial Hanks type STKs

Eukaryotic Ser/Thr kinase superfamily is based on the conservative sequence homology between their kinase catalytic domains (Hanks et al., 1995). These domains are typically organized into 12 subdomains folded into two lobes with a catalytic active that contains specific conserved motifs (the marker for the structural conservation of eSTKs). The smaller, N-terminal lobe in gray (Figure 5 A), with ant parallel beta-sheet architecture and is responsible for nucleotide fixation and orientation (Shi et al., 1998). The larger C-terminal lobe substrate binding lobe (in green) (Figure 5A) is dominated by helical structure. It is involved in protein substrate’s binding and initiates the transfer to a phosphate group. The catalytic active site lying in a deep cleft formed between the two lobes (Fig: 5, A). This part serves as a central hub that communicates between the different parts of the molecule.

Figure: 5. Structure of the Ser/Thr kinase catalytic domain. (A) Crystal structure of the mouse PKA catalytic domain in complex with an ATP molecule and an inhibitor peptide (Protein Data Bank [PDB] accession number 1ATP). The PKA N-terminal lobe is shown in gray, and the C-terminal lobe is shown in blue. ATP is represented as sticks, with two manganese ions shown as spheres, and the inhibitor peptide is shown as a red line. (B) Superimposition of tertiary structures of PKA and the M. tuberculosis eSTK PknB (PDB accession number 1MRU). PKA is shown in blue, and PknB is shown in yellow. (C) The regulatory elements that comprise the catalytic cleft formed between the N- and C-terminal lobes of the Ser/Thr kinase catalytic domain are indicated in the structure of PKA as follows: green, P loop;yellow, catalytic loop with the catalytic Asp residue; magenta, magnesium- binding loop; orange, activation loop with the phosphorylated Thr residue; and cyan, P+1 loop. ATP is represented as sticks, with two manganese ions shown as spheres, and the inhibitor peptide is shown as a red line. (D) Primary sequence alignment between the PKA (residues 33 to 283) and PknB (residues 1 to 266) catalytic domains. The N- and C-terminal lobes of PKA are shown in gray and blue, respectively. Conserved motifs are shown in boxes, and the invariant residues are depicted in black. Other important residues are highlighted and/or shown in bold. Red and orange asterisks indicate the catalytic Asp and phosphorylated Thr residues, respectively. (Figure is updated from Pereira, 2011)

It not only directs the catalytic events, but also guides the peptide into its proper orientation so that catalysis can occur (Hanks et al., 1995). The regulatory elements that comprise the catalytic cleft formed between N-terminal and C-terminal lobes constitute the so-called activation segment. This activation segment consists of the activation loop, magnesium- binding loop and P+1 loop (Figure 5, C). The activation loop is the most important regulatory element for kinase activity as it is involved in determining substrate specifity (Hanks et al., 1995 & Kornev et al.,2010). Many kinases are activated by either phosphorylation on at least one Ser/Thr or Tyr (for tyrosine kinases) residue in the activation loop, by either autophosphorylation or transphosphorylation by other kinases (Pereira et al., 2011). Based on the structural analysis, there are two main pathways for Hanks type STK activation: direct activation and indirect activation. In the direct activation a Hanks type STK is activated by autophosphorylation of its activation loop on Ser/Thr residues (Figure 6, B). There is an example of a direct activation process M.tuberculosis Hanks type STK PknB. During the active state, this kinase form back-to-back dimer in the N-terminal lobe of dimerization interface to initiate autophosphorylation (Figure 6,A) (Ortiz-Lombardia et al., 2003; Shah et al., 2010). Similar observations were also found for PknD in M.tuberculosis (Greenstein et al., 2007) and PpkA in Pseudomonas aeruginosa (Hsu et al., 2009). From all these observations it is clear that there is a role of dimerization in the activation of Hanks type STKs, but the mechanism by which dimerization results in autophosphorylation remain unknown. In the indirect activation pathway, Hanks type STK mainly activates another soluble kinase. In this way, a Hanks type STK is activated through binding a stimuli, this binding promotes extensive conformational changes in both the αC helix in the N-terminal lobe and the activation loop in the C-terminal lobe (Pereira et al., 2011) and rearrangements of the activation loop that stimulate kinase activity (protein-protein interaction) by determining the substrate specificity. All these conformational changes bring ATP phosphate, kinase catalytic Asp residue, and the substrate phospho-acceptor residue together, allowing the transfer of gama-phosphate from ATP to phosphoacceptor Ser or Thr residue in the substrate protein (Figure 6, C),(Pereira et al., 2011). In this mechanism a front-to-front dimerization occurs through the interactions between the αG helix and the ordered activation loop of one kinase domain and the αG helix of the second kinase domain. The conformations of the two proteins suggest that one monomer functions as an activator and the other functions as a substrate. In agreement, mutagenesis studies showed that the asymmetric dimer interface mimics a trans-autophosphorylation complex (Mieczkowski, et al.,2008). So with this new

11 mechanism, an allosterically activated kinase could phosphorylate and thereby activate other kinases that are not associated with a receptor domain (Figure 6,D). There are also some evidence for the involment of dimerization in this activation mechanism. For both direct and indirect Hanks type STK activation pathways PknB from M. tuberculosis was shown as an activation model for oligomerization processes.

Hanks type kinases and phosphatases are also found in non- pathogenic bacteria. We have very little knowledge about what triggers bacterial protein phosphorylation in signal transduction pathways, many of the kinases are membrane proteins and it has been suggested that they could function as the receptor like kinases that bind extracellular signals, such a role recently shown for B.subtilis Hanks type Ser/Thr kinase PrkC that contains PASTA (pencillin-binding–protein and Ser/Thr kinase-associated) repeats which are also homologous to M. tuberculosis PknB (Barthe et al., 2010; Paracuellos et al., 2010) and this PASTA repeats are identical for a ligand of a bacterial receptor of Hanks type Ser/Thr kinase. In the phosphorylation system, PrkC harbours the PASTA domain that is involved in activation of this kinase via binding of muropeptides (Shah et al., 2008).

2.2.4.Physiological roles and targets of Hanks type Ser/Thr kinase in bacteria

Presently not many substrates of Ser/Thr kinases have been characterized in bacteria. The key to adaptation and survival is to interpret indicators of a changing environment and modulate the repertoire of expressed genes. At the end of the exponential growth phase, the fundamental challenge to survival is caused by the depletion of nutrients and onset of starvation. B. subtilis at this stage has adaptations to poor growth conditions, including enzymatic degradation of macromolecules, scavenging for nutrients, synthesis and secretion of antibiotics to kill other bacteria, motility to search new sources of nutrients, development of competence to take up exogenous DNA, and finally, in the extreme circumstances, sporulation.(Vladimir et al.,2006).

A C

B D

Figure: 6. Activation model with dimerization interface involved in bacterial eSTKs. M. tuberculosis PknB was chosen for the purpose of illustrating the hypothesized eSTK activation pathways. (A) Back-to-back dimer revealed in the crystal structure of the M.tuberculosis PknB kinase domain .Two PknB monomers interact through a dimerization interface located in the back sides of the N-terminal lobes. (B) In the presence of a ligand, two or more PknB monomers bind to a single ligand molecule through their extracellular domains. This brings the intracellular catalytic domains closer, resulting in the formation of a symmetric back-to-back dimer and in the consequent activation of the kinases by autophosphorylation. (C) Asymmetric front-to-front dimer found in the cocrystal of a mutant PknB kinase domain in complex with an ATP competitive inhibitor. This structure resembles an activation complex involving the contact between the αG helixes of two monomers (103). One of the monomers (blue) shows an ordered activation loop (red), characteristic of the active state, whereas the other monomer (green) shows a disordered activation loop (represented by a dashed line) (D) An activated kinase can directly phosphorylate a downstream protein target or activate a soluble kinase through the formation of an asymmetric front-to-front dimer, which will then phosphorylate downstream targets as part of a signaling pathway. (Figure is updated from Pereira, 2011)

With the advantage of genomic sequencing, scientists began to trace the distribution of open reading frame encoding Hanks type STKs in the microbial genome (Galperin et al., 2010). Complete characterization of their essentiality and the identification of their substrates became difficult to achieve. However, table 2 contains a list of physiological roles of listed 135 substrates of 33 biochemically characterized Hanks type Ser/thr kinases from 13 bacteria. The majority of the substrates were identified by phosphoproteomic approaches and/or in vitro kinase assays, site direct mutagenesis, and they often lack of in vivo confirmation. The regulatory function of Ser/Thr phosphorylation is very diverse and has the potential to regulate all kinds of processes within the cell.

Table 2: Physiological roles of Hanks type STKs (adapted from Pereira, 2011)

Species eSTK Substrate Function Methodology & reference Bacillus subtilis PrkC AlsD α-Acetolactate decarboxylase; central Kinase assay(KA), mass spectrometry(MS) (245) metabolism CpgA GTPase; peptidoglycan deposition KA, mutagenesis (1) EF-G Elongation factor; protein translation IM, KA (83,275,274) EF-Tu Elongation factor; protein translation KA, mutagenesis( 1) GlnA Glutamine synthetase; central metabolism KA, MS( 245) Icd Central metabolism KA, MS (245) HPr Kinase, phosphotransferase system KA, MS(245) YezB Stress KA, phospho-aminoacid analysis(p-AAa), 2D gels ( 1) YwjH Transaldolase; central metabolism KA, MS (245) YabT DegS Unknown YbdM DegS Unknown PrkA 60 KDa Putative kinase protein Chlamydia Pkn1 IncG Pathogenesis Bacterial two-hybrid, KA (322) trachomatis PknD Pkn1 eSTK Bacterial two-hybrid, IM, KA (322) Corynebacterium PknA FtsZ Cell division KA,, 2D electrophoresis, MS (269) glutamicum MurC Cell wall synthesis KA, MS, mutagenesis (77) PknG Soluble eSTK KA (78) OdhI Glutamate catabolism KA, MS (13,78,269) PknB FtsZ Cell division KA (269) OdhI Glutamate catabolism In vivo and in vitro KA(13,78,269) PknG OdhI Glutamate catabolism In vivo 2D electrophoresis, KA, MS, mutagenesis (78,216,269) PknL FtsZ Cell division KA, 2D electrophoresis, MS (269) Mycobacterium PknA EmbR Arabinan synthesis, cell wall KA ( 277) tuberculosis FadD Mycolic acid biosynthesis KA, p-AAa ( 197) 14

Species eSTK Substrate Function Methodology & reference FabH Mycolic acid pathway; cell wall biosynthesis KA, MS, mutagenesis (323) FipA Cell division under oxidative stress In vivo and in vitro KA, MS(304) FtsZ Cell division KA, MS (315,306) GlmU Cell wall synthesis KA (234) GroEL1 Heat shock protein KA, MS (31) KasA Mycolic acid biosynthesis KA, p-AAa (197) KasB Mycolic acid biosynthesis KA, p-AAa (197) MabA Mycolic acid biosynthesis KA, MS, mutagenesis (324) MurD Cell division KA (307) PknB eSTK KA (128) Rv1422 NA In vivo & in vitro KA, MS, mutagenesis (128)

Wag31 Cell division In vivo& in vitro KA,MS, mutagenesis (128) PknB EmbR Arabinan synthesis, cell wall KA (277) FadD Mycolic acid biosynthesis KA (197) GarA Glycogen recycling, tricarboxylic acid cycle PKa, mutagenesis (325) GlmU Cell wall synthesis KA (234) GroEL1 Heat shock protein KA, MS (31) KasA Mycolic acid biosynthesis KA (197) KasB Mycolic acid biosynthesis KA (197) MabA Mycolic acid biosynthesis KA, MS, mutagenesis (324) PBPA Cell wall synthesis KA,MS, mutagenesis (54) PknA eSTK IKA (128) RshA SigH anti-sigma factor, oxidative stress In vivo and in vitro KA,MS, mutagenesis (235) Rv0020c FHA-containing protein KA (94) Rv1422 NA KA,MS, mutagenesis (128) Rv1747 Putative ABC transporter KA (94) SigH Alternate sigma factor; oxidative stress In vivo and in vitro KA,MS, mutagenesis (235) PknD FadD Mycolic acid biosynthesis KA (197) FabH Mycolic acid pathway, cell wall biosynthesis KA,MS, mutagenesis (323) GarA Glycogen recycling, tricarboxylic acid cycle KA (325) GroEL1 Heat shock protein KA,MS (31) KasA Mycolic acid biosynthesis KA (197) KasB Mycolic acid biosynthesis IKA (197) MabA Mycolic acid biosynthesis KA,MS, mutagenesis( 324) Mmpl7 Membrane transporter; resistance, 2D electrophoresis, MS (242) nodulation, and cell division family Rv0516c Anti-anti-sigma factor In vivo and in KA,MS,mutagenesis (93) Rv1747 Putative ABC transporter KA (94) PknE FadD Mycolic acid biosynthesis KA (197) FabH Mycolic acid pathway, cell wall biosynthesis KA,MS, mutagenesis (323) GarA Glycogen recycling, tricarboxylic acid cycle KA (325) GroEL1 Heat shock protein KA,MS (31) KasA Mycolic acid biosynthesis KA (197) KAsB Mycolic acid biosynthesis KA (197)

Species eSTK Substrate Function Methodology & reference MabA Mycolic acid biosynthesis KA,MS, mutagenesis (324) Rv1747 Putative ABC transporter KA (94) PknF FadD Mycolic acid biosynthesis KA (199) FabH Mycolic acid synthesis, cell wall In vivo and in vitro KA,MS, mutagenesis (323) GarA Glycogen recycling, tricarboxylic acid cycle KA (325) GroEL1 Heat shock protein In vivo and in KA,MS,mutagenesis ( 28) KasA Mycolic acid biosynthesis KA (197) KasB Mycolic acid biosynthesis KA (197) Rv0020c FHA-containing protein KA (94) Rv1747 Putative ABC transporter KA (199) PknG GarA Glycogen recycling, tricarboxylic acid cycle KA,MS, mutagenesis, in vivo studies (211) PknH DacB1 Penicillin-binding protein, cell wall KA,MS, mutagenesis (342) DosS Dormancy KA,MS, mutagenesis (35) EmbR Arabinan synthesis, cell wall KA (198) FadD Mycolic acid biosynthesis KA (197) FabH Mycolic acid pathway, cell wall biosynthesis KA,MS, mutagenesis (323) GroEL1 Heat shock protein KA,MS (31) KasA Mycolic acid biosynthesis KA (197) KasB Mycolic acid biosynthesis KA (197) Rv0681 TetR class transcription factor KA, mutagenesis (342) PknI FadD Mycolic acid biosynthesis KA (197) PknJ Pyruvate Glycolysis KA kinase A EmbR Arabinan synthesis, cell wall KA (120) MmaA4 Mycolic acid biosynthesis KA (120) PepE Dipeptidase KA (120) PknK FadD Mycolic acid biosynthesis KA (197) VirS Transcriptional regulator KA, p-AAa (146) PknL FadD Mycolic acid biosynthesis KA (197) GroEL1 Heat shock protein KA,MS (298) KasA Mycolic acid biosynthesis KA (197) KasB Mycolic acid biosynthesis KA (197) MabA Mycolic acid biosynthesis KA,MS, mutagenesis ( 324) Rv2175c DNA-binding protein, putative cell wall/cell In vivo and in vitro KA,MS,mutagenesis,p-AAa, 2D division protein electrophoresis ( 32,41) Mycoplasma PrkC HMW1-3 Cytadherence PQDS (268) pneumoniae MPN474 Surface protein PQDS (268) P1 Adhesin PQDS (268) Myxococcus Pkn2 HUα Histone-like protein KA, mutagenesis ( 315) xanthus β-Lactamase Ampicillin resistance p-AAa (316) Pkn4 PFK Glycolysis KA, mutagenesis (211) Pkn8 Pkn14 Soluble eSTK KA (213)

Species eSTK Substrate Function Methodology & reference Pkn14 MrpC Transcription factor; fruiting body KA (213) development PFK Glycolysis KA mutagenesis, p-AAa (211) Pseudomonas PpkA Fha1 Protein secretion, virulence KA,MS, mutagenesis (203) aeruginosa Staphylococcus PknB AFT-2 Human transcription factor Peptide arrays,KA,MS (192) aureus MgrA Global transcriptional regulator KA (319) PurA Purine biosynthesis KA (61) SarA Transcription regulator; virulence KA,p-AAa (60) SA0498 Ribosomal protein L7/L12; central KA,p-AAa (163) metabolism SA0545 Phosphate acetyltransferase; central KA,p-AAa (163) metabolism SA0729 Triose isomerase; central metabolism KA,p-AAa (163) SA0731 Enolase; central metabolism KA,p-AAa (163) SA0944 Pyruvate dehydrogenase; central metabolism KA,p-AAa(163) SA1359 Elongation factor P; central metabolism KA,p-AAa(163) SA1499 Trigger factor; central metabolism KA,p-AAa(163) SA2340 Glyoxalase; central metabolism KA,p-AAa(163) SA2399 Fructose biphosphate aldolase; central KA,p-AAa(163) metabolism Streptococcus Stp1 CovR Response regulator; toxin expression KA (161,256) agalactiae DivIA Cell division In vivo phosphopeptide enrichment approach, KA PpaC Mn-dependent inorganic pyrophosphatase; KA,p-AAa (254) virulence PurA Purine biosynthesis KA (255) Streptococcus StkP DivIVA Cell division In vivo 2D electrophoresis, KA,MS (219) pneumoniae FtsZ Cell division MS (86) GlmM Cell wall 2D electrophoresis, KA (220) PpaC Mn-dependent inorganic pyrophosphatase; In vivo 2D electrophoresis, MS,KA (219) virulence RitR Transcriptional regulator; iron transport In vitro kinase assay (306) Spr0334 NA In vivo 2D electrophoresis, MS,KA (219) Streptococcus SP-STK SP-HLP Histone-like protein KA (125) pyogenes Streptomyces AfsK AfsR Transcriptional factor; secondary metabolism KA (199) coelicolor Yersinia spp. YpkA Eukaryotic Cytoskeleton KA actin

2.3. Tyrosine kinase Protein tyrosine phosphorylation has long been considered as specific to eukaryotes. Concerning the existence of protein phosphorylated at tyrosine in bacteria, the initial evidence was found in E.coli with the identification of phosphotyrosine in partial acid hydrolysates of proteins (Manai et al.,1982) and finally 14 years later in 1996, the first bacterial protein-tyrosine kinase was characterized in Acinetobacter johnsonii (Duclos et al.,1996). In bacteria,Ser/Thr phosphorylation is catalyzed by several different classes of proteins, but tyrosine phosphorylation is found to depend almost excusively on class, known as BY-kinase (bacterial tyrosine kinases). There are some noted exceptions, for example: I) Caulobacter crescentus sensory kinase DivL is phosphorylated on Tyr instead of histidine auto-phosphorylation and this phosphate is transferred to its response regulator CtrA that already described in section 2.1 in TCS. ii) Two proteins resembling to eukaryotic like tyrosine kinases are also identified, the first one is MasK from M. xanthus that interacts with MglA and thereby regulates motility and development (Thomasson et al.,2002) and the second one is P. Aeruginosa Waap, which is an essential sugar kinase involved in lipopolysaccharide synthesis (Zhao and Lam, et al., 2002). Very recently another novel tyrosine kinase belonging to the HAD (haloacid dehydrogenase-like hydrolase) superfamily identified in M. tuberculosis (Bach et al., 2009).

Bacterial BY kinase structure

The BY- kinase family consists of bacterial enzymes that possess tyrosine kinase activity. From sequence analysis, clearly this class of kinases only exist in bacteria not, in eukaryotes. BY kinases possess a trans membrane domain known as the N-terminal domain (approximately 80-90 kDa protein) that can function as both an anchor and a sensor, and an intracellular catalytic domain (C-terminal) in the cytoplasm that can autophosphorylate as well as phosphorylate intracellular substrates (Doublet et al., 2002). The catalytic domain consists of Walker motifs A, A’ and B and a tyrosine rich cluster at the C-terminus. The Walker motifs A, A’ and B found in the active site of BY kinases bear a high resemblance to nucleotide binding motifs of ATPases such as MinD and Soj (Mijakovic et al., 2005a). Although the sequence homology among the protein tyrosine kinases from both gram- negative and gram-positive bacteria are high, still they have architectural differences. In gram-negative bacteria, transmembrane domain and cytosolic domain are situated in a single

18 protein, while in the gram-positive bacteria, transmembrane domain and cytosolic domain are found as two separate proteins (Cozzone et al., 2004) (Figure 7). Concerning the mechanism of autophosphorylation, in gram-negative bacteria, BY kinases autophosphorylate on tyrosine residues located in the cytosolic domain following a two-step process involving a conserved tyrosine in the active site and C-terminal tyrosine rich cluster. The functioning of these kinases differs from one bacterial species to another, each having a slightly different conserved region in tyrosine rich cluster. With the studies in E.coli, it is indicated that the overall level of phosphorylation rather than a specific combination dictates it’s biological role (Paiment et al., 2002). Furthermore, in a biochemical study, it was found that BY kinase Etk, homologous to Wzc, is activated through two steps process involving conserved tyrosine in the active site and a C terminal tyrosine rich cluster (Grangeasse et al., 2002). In the first step, the conserved tyrosine side chain points into the active site thereby it blocks its activity and in the second steps, upon autophosphorylation the negatively charged phosphotyrosine rotates out of the active site and is stabilized by interaction with an arginine residue (Lee et al., 2008 & Lu et al., 2009).

In terms of phosphorylation mechanism, when looking at gram-positive bacteria, here again some differences are noted at the conserved region in tyrosine rich cluster, though they follow the common root of functioning. In this case, two distinct proteins are required for full activity of phosphorylation; one encoding transmembrane protein homologous to N terminal domain of gram-negative BY kinase and the other encoding a cytosolic protein with the kinase active site and autophosphorylated tyrosine(s)(Morona et al., 2000; Mijakovic et al., 2003). The transmembrane domain and cytosolic domain being separate from each other; they need a modulator that can modulate an interaction in between each other. On the other hand, the transmembrane modulator and cytosolic kinase communicate each other through a specific helix-helix interaction that modulates kinase activity (Soulat et al., 2006).The transmembrane modulator is considered to function as a sensor domain that upon sensing unknown signal can trigger the kinase activity (Grangeasse et al., 2007). In this activation process, the modulator protein helps to stabilize ATP binding by the hydrophobic interaction in between adenine ring and phenylalanine residue of the modulator protein. So, overall in the activation stage, after autoph.osphorylation at tyrosine rich cluster in the catalytic domain, BY kinases, use ATP as phosphoryl donor, and the degree of phosphorylation in this region determines the interaction strength with other proteins (Whitmore et al., 2012).

Both types of BY kinases are able to phosphorylate different intracellular substrates. In gram- positive bacteria, phosphorylation process involves three possible ways. i) BY kinase is activated by the C terminal fragment of the transmembrane modulator and thus phosphorylate substrate. ii) The kinase is free to dissociate from the modulator and meet other proteins that it can phosphorylate as substrates. iii) The kinase can co localize with some of its substrates, although the physiological role is not clear yet. For example, an octameric ring structure BY kinase CapA/B in Staphylococcus aureus where, CapB is found to associate in an octameric ring structure located to the membrane via interaction with its transmembrane modulator CapA. Upon autophosphorylation of CapB is expected to induce dissociation of the ring structure, while maintaining the interaction between CapA-CapB couples, allowing kinase monomers to phosphorylate its endogenous substrates.(Olivares-Illana et al.,2008). It was also suggested that BY kinases in gram-positive bacteria might dissociate from its modulator and phosphorylate intracellular substrates possible under control of alternative modulators (Mijakovic et al., 2005a). The evidence for third process was found in B. subtilis where the BY kinase PtkA colocalizes with its modulator TkmA under certain growth conditions and also under the certain growth conditions PtkA dissociates from TkmA to interact (co-localize) with its substrates (Jers et al., 2010).

Ptk gene Tkm gene Ptk gene

Figure 7: Protein and gene organisation of BY-kinases in Gram-positive and Gram-negative bacteria. In Gram-negative both transmembrane domain and the intracellular catalytic domain are found on a single polypeptide. In Gram-positive bacteria the two domains are split into a transmembrane

20 modulator and a soluble kinase. The kinase interacts with its modulator thereby resembling the Gram- negative organisation (Figure adapted from Mijakovic et al., 2005a).

2.3.1 Physiological roles of substrates for tyrosine kinase and phosphatase

Protein tyrosine phosphorylation subsequently was exposed to express as many essential cellular processes, such as exopolysaccharide production, virulence, DNA metabolism, proliferation, migration, flagellin export, adaptation to stress and production of secondary metabolites. Moreover, Protein tyrosine phosphorylation can influence both cellular localization and the overall protein interactome. Table 3 shows a number of bacterial protein substrates that are phosphorylated from BY kinase/phosphatases and their physiological roles. These data were taken from a number of global phosphoproteome studies from 18 bacteria.

Table 3. Bacterial protein tyrosine kinases and phosphatases and their functional roles(updated from Whitmore, 2012)

Tyrosine Tyrosine Organism Substrate(s) Function References Kinase Phosphatase Acinetobacter Ptp uses Ptk as Phosphorelay reactions of Ptk Ptp johnsonii endogenous substrate inner membrane proteins Acinetobacter Wzb uses Wzc as Wzc Wzb Emulsan production 210 lwoffii endogenous substrate Exopolysaccharide YwqD, TuaD, Ugd, SsbA, synthesis, teichuronic acid PtkA, YwqE, YfkJ, McsA, CtsR, YjoA, Bacillus subtilis production, DNA 186, 176 PtkB, YwlE, PtpZ YnfE, TvyG, YorK, metabolism, heat shock McsB Asd, YwpH response Caulobacter DivL — CtrA Cell division 335 crescentus Erwinia Lipid carrier di- AmsA AmsI Amylovoran production 27 amylovora /monophosphates Escherichia coli Ugd; Wzb uses Wzc as Wzc Wzb Colanic acid synthesis 259,326 K-12 CA endogenous substrate Escherichia coli Exopolysaccharide Etk Etp RpoH, RseA; Etk 117 K-12/K-30 production Escherichia coli Wzc Wzb Ugd Group 1 capsule assembly 336 K-30 CPS Klebsiella Yor5 uses Yco6 as Yco6, Wzc Yor5, Wzb Capsule synthesis 160,248 pneumonia endogenous substrate Myxococcus Aggregation, sporulation, MasK — MgIA 309 xanthus motility, development Porphyromonas Ltp1 Exopolysaccharide 173

Tyrosine Tyrosine Organism Substrate(s) Function References Kinase Phosphatase gingivalis production, heterotypic community development Pseudomonas Lipopolysaccharide WaaP 341 aeruginosa synthesis Pseudomonas Flagellin a and b 42k Flagellin export 296 aeruginosa proteins; Exopolysaccharide Pseudomonas TbpA Diguanylate cyclase production, biofilm 317 aeruginosa development Ralstonia Exopolysaccharide EpsB EpsP 113,114 solanacearum transport Salmonella PutA — P5C Proline metabolism 231 typhimurium Sinorhizobium ExoP — Succinoglycan production 126 meliloti Cap5O (UDP-acetyl- Staphylococcus CapC, PtpA, Cap5B2 mannosamine Capsule synthesis aureus PtpB dehydrogenase) Streptococcus CpsD CpsB Polysaccharide chain length 265 agalactiae Streptococcus CpsD CpsB Capsule synthesis 201 pneumoniae Streptococcus Exopolysaccharide EpsD EpsB EpsE 194 thermophilus biosynthesis Streptomyces AfsK Antibiotic production — AfsR 145,155,180 coelicolorA3(2) SCO5717 Cell growth

The first physiological role attributed to BY kinases was related to the production of exopolysaccharide where it functions as co-polymerase. This process has been extensively studied in E.coli encoded two BY kinases Wzc and Etk. It has been suggested that Wzc involve in the exopolysaccharide synthesis (Vincent et al., 2000) while BY kinase Etk is expressed by some pathogenic strains, enterotoxigenic E.coli (ETEC), enterohaemorragic E.coli (EHEC), enteroaggregative E.coli (EAEC) and enteroinvasive E.coli (EIEC) suggesting that Etk has a possible role in virulence (Ilan et al.,1999). BY kinases have been implicated in exopolysaccharide and capsule synthesis in other bacteria (Table 5).

In recent years, BY-kinases have been found to phosphorylate few distinct classes of protein substrates, i) RNA polymerase sigma factors in E.coli, for example, endogenous substrate RpoH in E.coli, where BY-kinase Etk was found to phosphorylate the heat shocked sigma factor RpoH and anti sigma factor RseA and in this way Etk participated in triggering heat shock response(Klein et al., 2003). ii) UDP-glucose dehydrogenases in E.coli and B.subtilis, UDP-glucose deydrogenase substrates participates in exopolysaccharide and its activity is enhanced upon phosphorylation. There is some evidence found where UDP is

22 phosphorylated by BY-kinase PtkA in B.subtilis (Mijakovic et al., 2003) and BY-kinase Wzc in E.coli (Grangeasse et al., 2003) thereby stimulating it’s enzyme activity (exopolysaccharide production). UDP has some other functions in different bacteria that explained in table 3. iii) Single stranded DNA binding proteins (SSBs). It has been recently demonstrated that in B.subtilis, single stranded binding protein SSB phosphorylated on tyrosine, which leads to an increased affinity for single stranded DNA (Mijakovic et al., 2006). Phosphorylation of single stranded DNA also found in E.coli and Streptococcus coelicolor knowing the role of this protein in DNA metabolism, this could have a particular importance in bacterial physiology. iv) Although the individual phosphorylation events do not seem to be strongly conserved, the general theme of phosphorylation-based activation of enzymes in sugar polymer synthesis is widespread. A phosphoglycosyl transferase EpsE was found to be phosphorylated by BY kinase EpsD in Streptococcus thermophilus (Minic et al., 2007). v) The integrase (Int) protein of coliphage HK022 has also been found to be phosphorylated on tyr-342 by BY kinase WzC and the phosphorylation of Int by Wzc down- regulates its activity (Kolot et al., 2008). vi) Recently two identified substrates, single- stranded DNA exonuclease YorK and aspartate semialdhehyde dehydrogenase Asd were phosphorylated by BY kinase PtkA in B.subtilis (Jers et al., 2010).

2.4. Protein Ser/Thr/Tyr phosphatase

2.4.1. Ser/thr phosphatases

Concerning protein phosphatases, they can found in all organisms from bacteria to human (Shi et al., 2009). In prokaryotes, the need for dedicated phosphatases was not initially appreciated in the context of two-component systems and phosphorelay signal transduction, since both phosphohistidine and aspartyl-phosphate residues undergo relatively rapid hydrolysis (Zhang et al., 1996; Sickmann et al., 2001; Soufi et al., 2008). In contrast, phosphorylated Ser, Thr, and Tyr residues are not as labile, and therefore cognate phosphatases are necessary to regulate signaling cascades (Alber et al., 2009). Bacterial Ser/Thr phosphorylation is counteracted by two classes of eukaryotic like phosphatases; the phosphoprotein phosphatase (PPP) and the protein phosphatase Mg+ or Mn2+ dependent (PPM) families. The PPP family members normally act as serine/threonine

23 phosphatases but there is an evidence where they can also dephosphorylate phosphohistidine and phosphotyrosine residues. For example, PrpE, a PPP family member in B. subtilis, exclusively removes phosphate groups from phosphotyrosines in vitro (Iwanicki et al.,

2002). The serine/threonine Mg2+ or Mn2+ dependent phosphatases of bacterial PPM family contains 11 signature motifs containing 8 conserved amino acids (Bork et al., 1996; Adler et al., 1997; Shi et al., 1998; Kennelly et al., 2002 & Zhang et al., 2004). The bacterial PPMs also can be divided into two subfamilies depending on the presence of motifs 5a and 5b (Zhang et al., 2004). One subfamily, lacking motifs 5a and 5b is represented by B.subtilis sporulation-specific phosphatase SpoIIE (Duncan et al., 1995) and the stress response phosphatases RsbU and RsbX (Yang et al., 1996; Kang et al., 1998; Dutta et al., 2003; Delumeau et al., 2004 & Obuchowski et al., 2005). On the other hand, members of the second subfamily contain all 11 signature motifs, some characterized members of this subfamily include the M. tuberculosis PstP (Wehenkel et al., 2007), Mycobacterium smegmatis MspP (Wehenkel et al., 2007), Streptococcus agalactiae STP (Rantanen et al., 2007), and Thermosynechococcus elongatus PphA (Schlicker et al., 2008). Cognate phosphatases have been characterized for both Gram-negative and Gram-positive bacteria (Table 4).

Structure Thermosynechococcus elongatus PphA is bacterial eSTP have been crystallized (Schlicker et al., 2008). The conserved catalytic core domain PphA contains a central β-sandwich (yellow), each flanked by a pair of antiparallel α helices (Blue).Three metal ions (gray) within the channel of β sandwich and a large irregular loop(red) that is flexible and involve in substrate binding and catalytic activity (Figure 8).

Figure 8: Crystal structure of the Thermosynechococcus elongatus eSTP PphA (PDB accession number 2J86) .The β-sandwich is shown in yellow, the α-helices are shown in blue, the three magnesium ions are shown in gray, and the large irregular loop is shown in red. The flap subdomain (red) appears flexible and is thought to be involved in substrate binding and catalytic activity. (Figure is updated from Pereira, 2011)

2.4.1.1. Physiological roles of the substrates of Ser/Thr phosphatase

The physiological functions of bacterial eSTPs are not as well understood as those of Hanks type Ser/Thr kinases. Table 4 contains a comprehensive list of their substrates identified to date and their physiological functions. Bacterial eSTPs have an important role in modulating the autophosphorylation state of their partner kinases (Osaki et al., 2009). For example, the kinase PknB in M. tuberculosis reduced autophosphorylation activity by the dephosphorylation of its phosphatase PstP (Boitel et al., 2003; Chopra et al., 2003), B.subtilis PrpC dephosphorylates PrkC in vitro (Obuchowski et al., 2000), B.anthracis phosphatase Ba-Stp1 dephosphorylation reduced the function of its kinase Ba-StK1 (Shakir et al., 2010). In some cases, STPs control the regulation systems of some TCS response regulator. For example, in S. pneumoniae, RitR is a response regulator of TCS that is phosphorylated by the kinase StkP and forms a ternary complex with its phosphatase PhpR by which RitR regulates its activity (Ulijasz et al., 2009). Protein Ser/Thr phosphatases also involved in cellular processes such as virulence, regulation of kinase activities and, peptidoglycan synthesis cell division and growth. For example, S. aureus eSTP has the effect

on alteration of peptidoglycan composition or structure that regulates cell wall synthesis (Beltramini et al., 2009), B. subtilis phosphatase PrpC dephosphorylation reduces stationary phase genes associated function (Gaidenko et al., 2002), Streptococcus phosphatase PppL also has effect on cell shape (Banu et al., 2010). In B. subtilis, phosphatase PrpC was also found to be involved in translation by targeting EF-Tu, EF-G and CpgA (Gaidenko et al., 2002). In M. xanthus, eSTP Pph1 has a positive role in vegetative growth, swarming and spore formation (Sickmann et al., 2001). Although the roles of eSTP in virulence are not well studied, still some evidence is found. The deletion of L. monocytogenes STP inhibited the growth in a murine model of infection (Archambaud et al., 2005). A B.anthracis STK/STP double mutant decreased ability to survive within macrophages (Shakir et al., 2010).

Table: 4 Eukaryotic Ser/Thr phosphates and their physiological roles in bacteria (Pereira, 2011

Partner Phospho-

Species eSTP Type kinase Substrate Function residue(s) Methodology Reference

Bacillus Ba- Ba-Stk1- In vitro phosphatase anthracis Stp1 PP2C Ba-Stk1 P eSTK NA assay 276

Bacillus In vitro phosphatase subtilis PrpC PP2C PrkC EF-G Translation factor NA assay 83

Small ribosome- In vitro phosphatase

CpG associated GTPase NA assay 1

In vitro phosphatase

EF-Tu Translation factor NA assay 1

Phosphotransferase In vitro phosphatase

HPr system S46 assay 286

In vitro phosphatase

PrkC-P eSTK NA assay 226

In vitro phosphatase

YezB Stress response NA assay 1

Phosphoprotein

anti-anti-sigma In vitro phosphatase

SpoIIE PPM SpoIIAA factor NA assay 222

Partner Phospho-

Species eSTP Type kinase Substrate Function residue(s) Methodology Reference

Regulation of In vitro phosphatase

RsbU PPM RsbV-P RsbV-P sigma B NA assay 337

Regulation of In vitro phosphatase

RsbX PPM RsbS-P RsbS sigma B NA assay 337

2D phosphoprotein gel

electrophoresis, in

vitro phosphatase assay,

Listeria decreased kirromycin monocytogenes Stp PPM EF-Tu Translation factor NA sensitivity 8

Mycobacterium In vitro phosphatase tuberculosis PstP PPM PknB PBPA PBP, cell wall NA assay 54

PknB-P eSTK T171/T173 Mass spectrometry 22

Phosphocarrier

protein of

Mycoplasma phosphotransfer In vitro phosphatase pneumoniae PrpC PP2C HPr system S46 assay 99

Myxococcus Negative effector Yeast two-hybrid xanthus Pph1 PP2C Pkn5 Pkn5 of development NA interaction

Staphylococcus In vitro phosphatase aureus Stp1 PP2C Stk1 Stk1-P eSTK NA assay

Streptococcus Family II inorganic In vitro phosphatase agalactiae SaSTP PP2C PpaC pyrophosphatase assay 254

In vitro phosphatase

PurA Purine biosynthesis NA assay

Streptococcus pneumoniae PhpP PP2C StkP StkP-P eSTK Coimmunoprecipitation 230

Transcriptional In vitro phosphatase

RitR regulator assay 318

Partner Phospho-

Species eSTP Type kinase Substrate Function residue(s) Methodology Reference

Streptococcus SP- In vitro phosphatase pyogenes STP PP2C SP-STK SP-HLP Histone-like protein Thr(s) assay 125

Phospho-amino acid

analysis

SP-STK- In vitro phosphatase

P eSTK NA assay 125

2.4.2. Protein Tyrosine phosphatases

Concerning the phosphotyrosine phosphatases, a number of them have been identified in bacteria. To anatagonize the protein tyrosine kinase activity, bacteria possess three different families of Protein phosphotyrosine phosphatases. The first two families share strong similarities with the eukaryotic class I and class II low molecular-weight-protein tyrosine phosphatase (Alonso et al., 2004), which contain a conserved cystine residue in the catalytic site (Shi et al., 1998). The third class in cluding manganese-dependent phosphotyrosine protein phosphatase that specially described in gram positive bacteria (Grangeasse et al., 2007) and belong to the polymerase and histidinol phosphatase (PHP) family (Morona et al., 2002).

Bacterial tyrosine phosphatases can be intimately involved in a number of cellular processes, two major process are apparent: involvement in polysaccharide production; and as secreted dephosphorylated host proteins, thereby interfering with host cell signal transduction pathways. The LMW-PTPs seems to play different roles in gram-positive and gram negative-bacteria followed by their genomic organization of genes encoding BY kinases and phosphatases. The first LMW-PTPs were isolated from A.johnsonii ( Ptp) ( Grangeasse et al., 1998), E. amylovora (AmsI) (Bugert et al., 1997) and E.coli (Wzb) (Grangeasse et al., 2002; Smart et al.,2010). In gram-negative bacteria, genes encoding LMW-PTPs are generally found upstream of the tyrosine kinase in the same operons. These phosphatases have been found to efficiently dephosphorylate BY-kinases, thereby regulating their

biological functions. Despite their abundance, phyological roles of MWP-PTPs in gram- negative bacteria remain largely unknown. Several studies demonstrated that they have a role in CPS/EPS synthesis and export. For example, AmsI from E. amylovora regulates EPS synthesis (Bugert et al., 1997), A.johnsonii Ptp dephosphorylates transmembrane autokinase Ptk, which regulates coanic acid synthesis and both E.coli Wzb and K.pneumonia Yor5 (Preneta et al., 2002) can regulate CPS production through dephosphorylation by Tyrosine kinase Wzc and Yco6, respectively.

Conversely, in gram-positive bacteria, the genes encoding the LMW-PTP are located at a remote site in the genome with respect to the BY-kinase genes. The role for LMW-PTP in gram-positives still not clear though there are some studies in Bacillus subtilis, showing that LWM-PTPs YfKj and YwiE perform a role in stress response (Musumeci et al.,2005). Furthermore, some evidence from S. coelicolor indicates that a LMW-PTP PtpA regulates secondary metabolism, such as undecylprodigiosin (Umeyama et al., 1996). Very recently Synechocysts Ptp was identified, which involved in the regulation of photosynthesis (Mukhopadhyay et al., 2011). The PHP type of phosphatase is found mainly in gram- positive bacteria and these proteins are encoded by genes immediately up or downstream of BY-kinase and modulator genes. They dephosphorylate the BY-kinases and their substrates and thereby they play a role similar in LMW-PTPs in gram-negative bacteria (Grangeasse et al., 2007). YwqE is the first PTP identified in B.subtilis. It is located in the same cps like operon with YwqC (transmembrane modulator TkmA), YwqD (Protein tyrosine kinase PtkA) and UDP- glucose dehydrogenase YwqF. PtpZ can dephosphorylate YwqD and its substrates including SsbA, SsbB and YwqF. Therefore, it is potentially involved in various important cellular process such as polysaccharide biosynthesis, bacterial DNA metabolism and DNA damage response in B.subtilis. Bacterial tyrosine phosphatase and their physiological roles are described in Table 3. Polysaccharide production (both exopolysaccharides and capsular polysaccharides) is a key virulence factor in many organisms and thus tyrosine phosphatase activity is emerging as a central player in the pathogenicity (Table 5)

Table 5. Bacterial tyrosine phosphatases involved in virulence through interaction with host

29 cell proteins (updated from Whitmore, 2012)

Organism Enzyme Activity Impact on host cell function References Tyrosine Coxiella burnetii Acp Inhibition of human neutrophils 159 phosphatase

Tyrosine Listeria monocytogenes LipA Actin cytoskeleton disruption phosphatase MPtpA Tyrosine Phagocytosis actin polymerization in Mycobacterium 141 tuberculosis and B phosphatase macrophages

Tyrosine Salmonella typhi StpA Host cytoskeleton disruption 9 phosphatase Tyrosine Salmonella‘typhimurium’ SptP Actin rearrangements 207 phosphatase Dual specific Shigella flexneri OspF Represses innate immunity 260 phosphatase Yersinia Tyrosine Cytoskeletal rearrangements; YopH 20 pseudotuberculosis phosphatase inhibition of phagocytosis

3. Phosphoproteomics–the systematic approach

Phosphoproteomics is relatively a new branch of proteomics studies, by which we can identify proteins containing phosphate group as a post translation modification. As early as 1986, the first phosphoproteomics study was parformed in bacteria, identifiying 128 phosphoproteins (phosphorylated on serine/threonine/tyrosine) in E. coli by two dimensional (2D) gel electrophoresis of radialabelled proteins (Cortay et al., 1986). Until 2007, 2D gel- approach was the only available technique for the study of protein phosphorylation on a global scale. This approach allowed 29 phosphoproteins in B. subtilis (Eymann et al., 2007; Levine et al., 2006) and 41 phosphoproteins from C. glutamicum (Bendt et al., 2003) were identified spotted at the protein level, no phosphorylation sites were identified at the time. The combination of phosphoprotein enrichment and 2D gel electrophoresis followed by mass spectrometry (MS) analysis allowed the identification of 58 phosphopeptides from 36 proteins, including 3 phosphotyrosine contining peptides, in C. jejuni (Voisin et al., 2007). Recently, this approach permitted identification of 16 phosphorylation sites from 63 phosphoproteins in M. pneumoniae (Schimidi et al., 2010) and 51 phosphoproteins from N. meningitidis (Bernardini et al., 2011).

One of the advantages of 2D gel based phosphoproteomics is that it is possible to analyze the phosphoproteome in different growth conditions. However, this technique has considerable

30 technical limitations. It has a low recovery of hydrophobic proteins such as membrane proteins, although this can be partially overcome by using special solubilization and analysis protocols (Eymann et al., 2004). Further, the wide range of occupation of phospho-sites (from less than 1% to more than 90%) complicates the detection, due to a limited dynamic range of the analysis. With this approach, it was by and large impossible to identifiy phosphorylation sites. Starting from 2007, gel-free approach coupled to high resolution MS allowed characterization of site-specific serine/threonine/tyrosine bacterial phosphoproteomes (Macek et al., 2007), and the approach has been applied for a number of bacterial species (Table 6). This approach involves the digestion of crude extracts with an endoprotease (trypsin or Lys-C) followed by phosphopeptide enrichment. The mixture is then separated by liquid chromatography (LC) that is coupled to a high resolution MS. In most studies, phosphopeptides were enriched by strong cation exchange and TiO2 chromatography (MaceK et al., 2008; Lin et al., 2009 and Soung et al., 2009). With this technique, phosphorylation sites could be detected in most identified phosphoproteins. This gel-free approach can also be used to analyze dynamics of the phosphoproteome in different growth conditions. A technique known as “stable isotope labeling by amino acids in the cell culture” (SILAC) allows comparison and relative quantification of protein phosphorylation in two different strains, or one strain cultured in two different growth conditions (Ong et al., 2002).

The recent site specific phosphoproteomes have greatly extended the numbers of known phosphoproteins and phosphorylation sites. Around 50 to 100 phosphorylation sites on average were identified in each published bacterial phosphoteome (Mijakovic et al., 2012), with the exception of M. tuberculosis in which more than 500 phosphorylation sites were detected, possible due to a larger kinome (Kobir et al., 2011). Table 6, represents a complete updated list of phosphorylation site-specific studies of different bacterial phosphoproteomes based on gel-free approach. An alternative to experimental identification of phosphorylation sites is in silico prediction. A widely used phosphorylation predictor NetPhos originally trained on eukaryotic data fell short in predicting bacterial phosphoproteins (Soufi et al., 2008a). This led to the development of bacteria specific version NetPhosBac (Miller et al., 2009) that competed with the eukaryotic predictors as well as bacteria specific version of the DISPHOS predictor (Kobir et al., 2011). NetPhosBac is currently dedicated to serine/threonine phosphorylation

31 due to having a limited number of tyrosine phosphorylation sites, but it is only a matter of time before enough data for a tyrosine specific version becomes valuable.

In terms of functional insights obtained from proteomics studies, an over-representation of phosphoproteins is found among enzymes of the central carbon metabolism (Soufi et al., 2008b; Macek et al., 2008) and house-keeping pathways as well as the virulence functions of bacterial pathogens (Jers et al., 2008). The physiological roles of a large part of those phosphorylation events are still unknown. It is now becoming clear that there is a very low conservation of phosphorylation sites. It is thought that this might reflect the adaptation of bacteria to different ecological niches (Soufi et al., 2008b).

Table 6.Site-specific phosphorylation studies of bacterial phosphoproteomes based on gel- free strategies (adapted from Mijakovic and Macek, 2012)

Organism No. of P-proteins No. of P-events References Bacillus subtilis 78 103 171 Escherichia coli 79 105 170 Lactococcus lactis 63 73 292 Halobacterium salinarum 69 81 3 Klebsiella pneumoniae 81 117 160 Pseudomonas aeruginosa 23 55 258 Pseudomonas putida 40 53 258 Streptomyces coelicolor 40 46 236 Mycobacterium tuberculosis 301 516 249 Streptococcus pneumoniae 84 163 303

The phosphoproteome studies generated long lists of phosphoproteins, and the next important steps will be to identify the kinases/ phosphatases that phosphorylate/dephosphorylate these proteins and the physiological roles of the phosphorylation events. First point should be possible to do by comparing phosphoproteins of wild type and kinase/phosphatase of knockout strains. We found this type of approach in M. pneumonia, with the identification of only 5 out of 63 phosphoproteins were targeted by

the two known kinases pointing toward the presence of novel classes of kinases (Schmidl et al., 2010). Secondly, the dynamics of the phosphorylation could be studied more profoundly, to see how phosphoproteomes change in response some physiological conditions, e.g. growth condition, growth phase etc. This can be done by an approach called SILAC and it was studied in global scale. In some cases, it also indicates the physiological roles of the phosphorylation event which is a stepping stone towards bacterial systems biology (Kobir et al., 2011). Finally, a daunting task will be to identify the physiological roles of the phosphorylation events, a task that this thesis work has been devoted to.

4. Bacillus subtilis is a model organism

Bacillus subtilis is a model organism for low-GC gram-positive bacteria (Kouwen et al., 2007). It is one of the best studied bacteria in terms of molecular biology and cell biology. It is a model organism in which studies have contributed to understand biological phenomena such as sporulation, natural competence, enzyme degradation, DNA repair and mutagenesis, SOS response regulation and carbon catabolite regulation ( Michael et al., 2003; Macek et al., 2007). In addition to this, it shows social behavior, in that the cells communicate with each other and form multicellular structures in the form of swarming cells and biofilms (Hamone et al., 2004; Murray et al., 2009). Various intra cellular regulatory systems are also studied in this organism such as two-component systems, Ser/Thr/Tyr phosphorylation, cascades of different sigma factors, regulatory RNAs etc. Of importance to the context of this work, protein Ser/Thr/tyr phosphorylation and several phosphorylation ‘modules’ such as partner switching in sporulation and stress response, are well characterized. B. subtilis possesses 7 characterized or putative kinases and 8 phosphatases. In phosphoproteomic studies more than 100 phosphoproteins have been identified in B. subtilis (Macek et al. (2007) and in most of the cases, the physiological roles of those phosphorylation events remain unknown. Its superb genetic amenability and relatively large size have provided the powerful tools required to investigate this bacterium from all possible aspects. From the biological standpoint it is a very important organism since it is used as cell factory for enzyme production. For example, it has been optimized for heterologous protein secretion for the production of active and stable enzymes (Brockmerier et al., 2006). Most strikingly, it has been found that many proteins have been specific sub cellular localization in bacterial cells that established a field of “bacterial cell biology,” and B. subtilis has been a model in this field. Now, we are beginning

33 to understand bacterial cell functions in terms of spatial organization, and even how bacteria can talk to each other or give their lives for the sake of the whole community.

I wrote a review paper dealing with protein phosphorylation in bacterial signal transduction that is related to all of my research projects

Biochimica et Biophysica Acta 1810 (2011) 989–994

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta

journal homepage: www.elsevier.com/locate/bbagen

Review Protein phosphorylation in bacterial signal transduction☆

Ahasanul Kobir a, Lei Shi a, Ana Boskovic a, Christophe Grangeasse b, Damjan Franjevic c, Ivan Mijakovic a,⁎ a Micalis, AgroParisTech-INRA UMR 1319, Domaine de Vilvert, 78352 Jouy en Josas, France b Institut de Biologie et Chimie des Protéines, CNRS-UCBL UMR 5086, 7 passage du Vercors, 69367 Lyon cedex 07, France c Division of Biology, Faculty of Science, Zagreb University, Rooseveltov Trg 6, 10000 Zagreb, Croatia article info a b s t r a c t

Article history: Background: Protein phosphorylation has emerged as one of the major post translational modifications in Received 8 October 2010 bacteria, involved in regulating a myriad of physiological processes. In a complex and dynamic system such as Received in revised form 15 December 2010 the bacterial cell, connectivity of its components accounts for a number of emergent properties. This article is Accepted 18 January 2011 part of a Special Issue entitled: Systems Biology of Microorganisms. Available online 22 January 2011 Scope of review: This review focuses on the implications of bacterial protein phosphorylation in cell signaling and regulation and highlights the connections and cross talk between various signaling pathways: bacterial Keywords: two-component systems and serine/threonine kinases, but also the interference between phosphorylation Protein phosphorylation fi Protein kinase and other post-translational modi cations (methylation and acetylation). Phosphoproteomics Major conclusions: Recent technical developments in high accuracy mass spectrometry have profoundly Phosphorylation predictor transformed proteomics, and today exhaustive site-specific phosphoproteomes are available for a number of Signal transduction bacterial species. Nevertheless, prediction of phosphorylation sites remains the main guide for many researchers, so we discuss the characteristics, limits and advantages of available phosphorylation predictors. General significance: The advent of quantitative phosphoproteomics has brought the field on the doorstep of systems biology, but a number of challenges remain before the bacterial phosphorylation networks can be efficiently modeled and their physiological role understood. This article is part of a Special Issue entitled: Systems Biology of Microorganisms. © 2011 Elsevier B.V. All rights reserved.

1. Introduction Phosphorylation is arguably the most extensively studied post- translational modification in bacteria [2–4], but other modifications, Post-translational modifications are a ubiquitous means of rapidly such as N-glycosylation and O-glycosylation [5], methylation [6] and and reversibly modifying the physico-chemical properties of a acetylation [6] are present as well, and should not be ignored. In fact, protein, triggering a number of possible consequences: change of bacteria employ a wider variety of monosaccharides than Eukarya to enzyme activity, oligomerization state, interaction with other pro- glycosylate their proteins [5]. To date, protein glycosylation has not teins, sub-cellular localization or half-life. Cells of multicellular been related to bacterial signal transduction, but is recognized as an organisms are known for their extensive networks of post-transla- important pathogenicity determinant. In Pseudomonas aeruginosa, tional modifications, in which different modification pathways flagellin glycosylation plays a major role in virulence [7], and in converge in signal integration [1]. By contrast, bacteria have often Streptococcus parasanguinis and Streptococcus gordonii O-glycosylation been erroneously considered as simple sacs of metabolites, optimized of serine-rich adhesion proteins modulates the attachment to host for fast growth and devoid of the regulatory network based on post- cells [8]. As exemplified by the case study of lysine acetylation in translational modifications. However, bacteria in their natural habitat Salmonella [9], bacteria can also acetylate key enzymes to tune often cope with the hostile environment, lack of nutrients and metabolic fluxes. A number of enzymes in the central metabolism (for constant biochemical warfare against other microbes (and eukaryal example enzymes controlling the glycolysis/gluconeogenesis switch hosts in case of pathogens), interspersed with very rare bursts of rapid and the glyoxylate shunt) are differentially acetylated in response to growth under favorable conditions. Therefore, it is not surprising that different carbon sources, accompanying changes in growth rate and bacteria also use an extensive network of post-translational modifica- metabolic fluxes. Similarly to numerous cases of cross-talk described tions to transmit signals and to coordinate cellular functions. in Eukarya, where different modifications occur on the same or neighboring residues in mutually exclusive fashion, a recent study on bacterial chemotaxis in Escherichia coli describes such interplay in the ☆ This article is part of a Special Issue entitled: Systems Biology of Microorganisms. case of the two-component response regulator CheY [10]. The output ⁎ Corresponding author at: Micalis, CBAI, AgroParisTech-INRA UMR 1319, 78850 Thiverval-Grignon, France. Tel.: +33 1 30 81 45 40; fax: +33 1 30 81 54 57. of the response regulator is coupled to environmental signals via a E-mail address: [email protected] (I. Mijakovic). rapid phosphorylation by the histidine kinase. On a much slower

0304-4165/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.bbagen.2011.01.006 990 A. Kobir et al. / Biochimica et Biophysica Acta 1810 (2011) 989–994 time-scale it responds to acetylation, which transmits the overall authors to conclude that two-component systems positively auto- energetic state of the cell since the acetate donors (acetate and acetyl- regulated at the transcription level exhibit “all or nothing” responses, CoA) and the synthesis of the acetylating enzymes are dependent on whereas those without a positive feedback loop exhibit graded and cellular metabolism [10]. The two signaling pathways, transmitting mixed mode responses. In the latter cases, the graded response information at very different speeds, thus converge on the same changes to mixed mode by an increase of the translation initiation rate regulator. Remaining with the example of chemotaxis, protein of the histidine kinase. There are exceptions to this rule, for example methylation also comes heavily into play, in a reciprocal regulation some positively autoregulated systems show graded behavior [20]. with phosphorylation. Signal terminating phosphatase CheC interacts This in fact demonstrates that two-component system overall design with a receptor-modifying deamidase CheD to terminate the signal by can allow the bacterium to choose between deterministic regulation receptor dephosphorylation, deamidation and methylation in Thermo- and stochastic switching using the same pathway architecture. The toga maritima and Bacillus subtilis [11]. Receptor methylation is level of cross-talk between two-component systems is either involved in chemotaxis in all bacteria studied so far [12], even though nonexistent or very low, and bacteria actively seek to minimize it a homologous system has not been found in E. coli. [21,22]. But when detected, is the cross talk just a noise, imperfect In this review we will focus on an overview of the recent advances insulation, or does it have biological consequences? B. subtilis two in the field of bacterial phosphorylation, highlighting the impact of component system WalRK (previously known as YycFG) coordinates protein phosphorylation on cellular physiology, connectivity of the the cell wall synthesis with the cell cycle [23], but it is not fully phosphorylation networks, recent methods in quantitative phospho- insulated. The normal trigger for the response regulator WalR is the proteomics and bioinformatic tools for prediction of bacterial septal localization of the kinase WalK. Under the specific conditions of phosphorylation sites. However, one should not forget that the phosphate limitation, the cell must go into induced stationary phase, bacteria use a plethora of post-translational modifications in their concomitant to activation of phosphate scavenging functions. There- signaling, that may yet prove to be as rich and as versatile as the one in fore, the phosphate starvation master regulator, the sensory kinase eukaryal cells. PhoR, bypasses the WalK input and phosphorylates directly WalR, thus relaying the signal to cease cell wall synthesis [24]. There is also 2. Histidine and aspartate kinases accumulating evidence of cross-talk between two-component systems and serine–threonine kinases. The two signaling pathways can When it comes to protein phosphorylation, Bacteria and Eukarya converge on the same transcription regulator, as exemplified by the modify the tyrosine, serine and threonine residues [2]. However, regulator MrpC in M. xanthus [25]. Alternatively, the serine/threonine bacteria (and some plants) also possess the two component systems, kinase can directly phosphorylate the response regulator eliciting a which rely on histidine autophosphorylation of the sensory kinases direct response. Such is the case of the response regulator CovR from (the first components) and aspartate phosphorylation of the response Streptococcus agalactiae [26], RitR from Streptococcus pneumoniae [27], regulators (the second components). The basic mechanism of two and DosR from Mycobacterium tuberculosis [28]. Besides the two component system action is the specific signal recognition by the component systems, bacteria possess a number of proteins of the sensory kinase, activation of its autokinase activity, phosphotransfer phosphoenol-pyruvate phosphotransferase system (PTS), which are to the cognate response regulator, which in turns triggers the cellular also transiently phosphorylated on histidine residues. The PTS response, most often by binding to DNA sequences regulating gene consists of a cascade of phosphotransferases that transmit the transcription. Besides this canonical mode of functioning, bacteria phosphate from phosphoenol pyruvate to the sugar that is being have evolved a number of variations, which have all been extensively imported. The level of histidine phosphorylation in the cascade reviewed recently [13]. One notable variation is the Pseudomonas depends on the flux of incoming sugars and participates actively in aeruginosa response regulator GacA that transmits the signal many facets of cellular regulation [29]. In the study of protein exclusively by directly controlling the expression of two small phosphorylation at the global level, modern tools of site-specific regulatory RNAs: rsmY and rsmZ. These sRNAs in turn affect the phosphoproteomics have become indispensable for detection of transcript stability of target genes, accounting for the entire GacA phosphorylated serines, threonines and tyrosines [30]. However, regulon [14]. In their role of sensing the immediate environment, two these methods do not allow the routine detection of phospho- component sensory kinases are often functionally coupled to the histidines and phospho-aspartates, due to their inherent instability transmembrane transporters that serve as co-sensors [15]. The key under acidic conditions used in the experimental pipeline. Neverthe- feature of two component systems is the high fidelity of recognition less, advanced transcriptomics tools, developments in FRET, immu- between the kinase and response regulator (almost no cross-talk with nodetection, bioinformatic analyses and other technologies hold other two-component systems) during phosphotransfer [16]. An promise of rapid advances in two-component systems research, as emerging feature in the field are the auxiliary regulators (distinct outlined in this methodological review [31]. from sensory kinases and response regulators), that interfere with these highly specific phosphotransfer reactions [17]. They act directly 3. Serine and threonine kinases on the sensory kinases, or the response regulators, and their purpose is to connect the given two-component system to other signaling For serine and threonine phosphorylation, Bacteria mostly use the pathways, i.e. accomplish signal integration. This notion of signal so-called Hanks type serine/threonine kinases, but also some atypical integration and connectivity has prompted some authors to use terms bi-functional kinases/phosphorylases. For example, the Hpr kinase/ such as “cognition” and “knowledge” in association with bacterial phosphorylase [32] that mediates the CcpA-dependent carbon signaling networks based on two-component systems [18], which catabolite regulation in Firmicutes phosphorylates the small regula- despite the obvious semantic arguments, does underline their tory protein HPr. In E. coli, the evolutionarily unrelated isocytrate complexity. The kinetics and feedback (signal extinction) of two dehydrogenase kinase/phosphatase [33] participates in regulating the component systems are far from fully understood. Some two glyoxylate shunt by phosphorylating the isocytrate dehydrogenase. component systems function like rheostats, others have adopted the Nevertheless, most bacterial serine/threonine kinases belong to “all or nothing” approach (with a threshold level for activation) and Hanks kinases [2], a protein family that seems to be deeply rooted some function in the so-called mixed mode [19]. An interesting recent in the tree of life, spanning all kingdoms. Despite the fact that Hanks study compared these output modes with the known kinetic kinases are present in eukaryal and bacterial genomes alike, parameters of the histidine kinases [19]. A stochastic kinetic model researchers often refer to the bacterial ones as “eukaryotic type of two component signaling, based on published data, allowed the kinases” [34]. This is probably due to historical reasons: Hanks kinases A. Kobir et al. / Biochimica et Biophysica Acta 1810 (2011) 989–994 991 were first discovered in Eukarya and later in Bacteria. Since it is very or inactivation, in case of phage integrases in E. coli [55]. BY-kinases unlikely that the genes encoding these kinases arrived to almost all are involved in pathogenicity functions via capsular polysaccharide bacterial genomes by horizontal transfer from Eukarya, we would like synthesis [56,57], but also figure prominently in house-keeping to argue here that the name “eukaryotic type kinases” is somewhat functions, such as cell cycle control [58] or heat shock response [59]. misleading. Hanks kinases have received ample attention in bacterial Interestingly, activity changes are not the only consequences of pathogens, where they were often shown to participate in virulence tyrosine phosphorylation: B. subtilis BY-kinase PtkA can alter the sub- functions [35]. Due to their homology to eukaryal kinases, bacterial cellular localization of its proteins targets [60]. For some substrates Hanks kinases (and associated phosphatases) are often employed in this was related to kinase–substrate co-localization, and for other the biochemical warfare, scrambling the host defenses via phosphor- substrates, the localization pattern was dependent on phosphoryla- ylation (or dephosphorylation) of host signaling proteins. Probably tion and not interaction with the kinase itself. Recent structural the best studied bacterial system in this respect is M. tuberculosis, studies gave important insights into oligomeric structures of where the structure/function relationship of Hanks kinases, and their transmembrane BY-kinases [61–63], suggesting autophosphorylation role as signal receptors has been probed extensively [36,37]. Apart as the mechanism for oligomer dissociation [62]. Dissociation of BY- from their involvement in virulence functions, bacterial Hanks kinases kinase oligomers upon autophosphorylation could arguably represent are also involved in housekeeping functions: threonine kinases have a step in signal transduction. However, the upstream part of the recently been shown to regulate bacterial protein secretion [38,39] cascade is still obscure. Despite having a large extracellular loop, to and a regulation of the cell shape via coordination of envelope this date no extracellular ligands have been assigned to BY-kinases, synthesis and cell division was described in Actinobacteria [40,41]. and this remains the weakest point in our knowledge concerning Despite a mountain of evidence on Hanks-kinase downstream actions, these enzymes. BY-kinases account for the vast majority of phos- phosphorylation of protein substrates and subsequent consequences phorylated tyrosine residues in bacteria, but there are a few for the bacterial physiology, we know precious little of the upstream exceptions (unusual tyrosine-phosphorylating sensory kinases [64], part of the cascade, the ligand binding. In B. subtilis, the Hanks kinase tyrosine-phosphorylating Hanks kinases [46,47]), most notable of PrkC has been shown to sense muropeptides of the cell wall and to which is the kinase McsB from B. subtilis, homologous to arginine- control spore germination [42]. A recent structural study of the M. phosphotransferases. This enzyme was found to tyrosine-phosphor- tuberculosis PrkC homolog, PknB prompted the authors to propose a ylate the repressor of heat-shock genes, CtsR [65]. However, in 2009, mechanism whereby muropeptides binding by the extracellular McsB had its status revised to that of an arginine kinase [66], and it is PASTA domains of the kinase leads to dimerization and subsequent presently not entirely clear whether the protein harbors both the activation of the enzyme [43]. Appealing as the hypothesis may be in activities, or just the latter one. Currently, the field of tyrosine kinases, its similarity to the activation of Hanks kinases in Eukarya, further which is the youngest one in bacteria, faces the challenge of assigning structure-functional analysis will be necessary to substantiate it. In the kinases to their physiological substrates. Unlike two-component parallel, first attempts at classifying bacterial Hanks kinases into sub- systems, where kinase and response regulator genes are often families are under way [44]. This is a particularly important task, adjacent on the chromosome, tyrosine kinase and substrate genes having in mind that such classification was precious in constructing rarely exhibit co-localization. Moreover, BY-kinases in general are sub-family-specific phosphorylation predictors for Eukarya, where the much more promiscuous than histidine kinases, phosphorylating up choice of substrates seems to be constrained within kinase sub- to a dozen cognate proteins, as shown in the case of B. subtilis BY- families. In parallel to global phosphoproteomic approaches (de- kinase PtkA [60]. Finally, this formidable task is greatly facilitated by scribed in Section 5), there are interesting alternative initiatives for advanced quantitative phosphoproteomics approaches, discussed in screening Hanks kinase substrates in vivo. Molle et al. [45] have Section 5. proposed a pipeline comprising of co-expression of kinase and substrate genes in E. coli, followed by identification of substrate 5. Phosphoproteomics phosphorylation by mass spectrometry. This approach for pair wise testing of kinase–substrate relations certainly has advantages over in Traditional phosphoproteomics, employed in bacteriology before vitro phosphorylation studies, and can be applied also for other types 2007, relied on 2D-gel separation of bacterial proteomes, 32P- of kinases. radiolabelling or immunodetection, and detection of phosphoproteins by low-resolution mass spectrometry, which precluded the identifi- 4. Tyrosine kinases cation of phosphorylation sites. These studies will not be reviewed here, since they offered little beyond the argument that many When it comes to protein-tyrosine phosphorylation, bacteria bacterial proteins are indeed phosphorylated. Starting from 2007, opted against using kinases of the Hanks family. Very few cases of high-resolution mass spectrometry coupled to gel-free analysis lead Hanks kinase phosphorylating tyrosines have been found in bacteria to the publication of site-specific serine/threonine/tyrosine bacterial [46,47]. Canonical bacterial protein–tyrosine kinases (BY-kinases) phosphoproteomes for a number of species: B. subtilis [67], E. coli [68], [48] are unique enzymes that exploit the ATP/GTP-binding Walker Lactococcus lactis [69], Klebsiella pneumoniae [70], Pseudomonas spp motif to catalyze phosphorylation of tyrosine residues. BY-kinases [71], S. pneumoniae [72], Mycoplasma pneumoniae [73], Streptomyces seem widespread, if not ubiquitous, in the bacterial kingdom [49], but coelicolor [74], and M. tuberculosis [75]. On average, in each bacterial are limited to only a few copies (typically one or two) per bacterial phosphoproteome around one hundred phosphorylation sites were genome. Initially, BY-kinases were considered to be only autopho- reported. A notable exception is S. coelicolor [76], where the site yield sphorylating enzymes, involved in exopolysaccharide production, was smaller (under 50 sites), probably due to a less powerful mass since they are usually encoded by genes in the large operons involved spectrometry analysis. In M. tuberculosis [75], the yield was signifi- in biosynthesis and export of sugar polymers [50]. In fact, interaction cantly higher (around 500 sites), possibly due to the fact that this of BY-kinases with the polysaccharide translocation machinery has bacterium has a very large serine/threonine kinase complement. The been clearly established in several species, and kinase autopho- phosphorylated proteins have versatile functions. The single largest sphorylation was seen to have an impact on the process [51]. sub-set of phosphorylated proteins is the enzymes involved in the However, it rapidly became apparent that BY-kinases can also central carbon metabolism. Other housekeeping proteins are also phosphorylate endogeneous substrates, leading to enzyme activation phosphorylated: helicases, chaperones, ribosomal proteins, amino- in the case of UDP-glucose dehydrogenases (in E. coli and B. subtilis) acyl tRNA-synthetases, etc. Proteins involved in signaling are over- [52,53] and single-stranded DNA-binding proteins (in B. subtilis) [54], represented in published phosphoproteomes, which also comprise a 992 A. Kobir et al. / Biochimica et Biophysica Acta 1810 (2011) 989–994 number of proteins of unknown function. The most striking feature of of bacterial phosphorylation networks, as a stepping stone towards the bacterial phosphoproteomes is the extremely low conservation of systems biology in this particular field. phosphorylation sites. Even in the proteins that were phosphorylated in most species, such as the enzymes of the central carbon 6. Phosphorylation predictors metabolism, conservation at the phosphorylation site level is nonexistent. Is serine/threonine/tyrosine phosphorylation so recent Despite the recent technological advances in phosphoproteomics, in bacteria, or does it evolve rapidly (with kinase relaxed specificities) a microbiologist working on a particular bacterial species whose to adapt to different environmental niches? Alternatively, are the phosphoproteome has not been published is not much closer to published phosphoproteomes incomplete, are we missing many low- having a list of phosphorylation sites in their organism of interest. The occupancy sites due to technical imperfections of our analysis? A mass spectrometry equipment involved in phosphoproteomics recent comprehensive analysis of phosphorylated proteins of E. coli analyses largely surpasses standard laboratory budgets, and data ribosomes showed that 24 ribosomal proteins are phosphorylated acquisition and analysis usually call for expert help. Therefore, many [77], whereas only a small number of them were detected in the E. coli bacteriologists are likely to use site-specific phosphorylation pre- phospho-proteome published only one year before [68]. Overall, the dictors, based on the growing phosphoproteomics datasets, to provide jury is still out, but a very simple experiment can show that the accurate predictions of phosphorylation events. Today, two major published phosphoproteomes are certainly incomplete. It suffices to phosphorylation predictors conceived to predict bacterial phosphor- change one parameter in the growth conditions, and in the same ylation sites are available on the WWW: NetPhosBac (http://www. bacterium new sites emerge, and some of the old ones are lost, as can cbs.dtu.dk/services/NetPhosBac-1.0/) [79] and Disphos (http://core. be seen by comparing the B. subtilis phosphoproteomes in [67] and ist.temple.edu/pred/pred.html) [80]. NetPhosBac is a neural network [76]. Alternatively, if a substrate is mixed with its cognate kinase in based predictor, trained on datasets of serine/threonine phosphory- vitro, in the presence of ATP, and subsequently analyzed by mass lation sites in E. coli and B. subtilis. Disphos is developed on around the spectrometry, many new phosphorylation sites will appear; for concept that looking for phosphorylation sites means looking for example compare tyrosine phosphorylation sites in the phosphopro- stretches of amino acids in proteins structures that are inherently teome [67] to an in vitro study [60]. The biological significance of disordered and accessible to solvent (i.e. kinases). It predicts serine, many low-occupancy phosphorylation sites is questioned by bacter- threonine and tyrosine, phosphorylation sites, and can be run in a iologists. Do they all have a biological role, or are they the bacterial-specific mode. Many readers will ask if these phosphoryla- consequence of relaxed kinase specificity, resulting in one major site tion predictors can be of any help, and since we are now in possession and several random secondary sites on every protein substrate? Even of over 1000 bacterial phosphorylation sites, we decided to bench- if they are secondary, what is the optimization criterion for the mark them. A predictor gives a probability value for a given residue to bacterial cell to maintain kinases with relaxed specificity? These are be phosphorylated, ranging from zero to one. Sites that score above important questions that we will have to tackle in order to understand 0.5 are likely to be phosphorylated and the ones scoring close to 1 are bacterial signaling based on protein phosphorylation. In any case, almost certain to be. We tested the performance of NetPhosBac and phosphorylation is undoubtedly a dynamic event, and experiments in Disphos on the published datasets of phosphorylated proteins from multiple conditions with quantitative comparisons of phosphoryla- four bacteria: P. putida [71], P. aeruginosa [71], K. pneumoniae [70] and tion site occupancy are the obvious next step in the field of L. lactis [69]. Phosphorylation sites scoring above 0.5 were retained as phosphoproteomics. For an extensive review of these techniques correct predictions, and the result is shown in Fig. 1. On average, see [78]. Feasibility of such approaches has been demonstrated NetPhosBac accurately predicted only 25% of the experimentally through the use of stable isotope labeling with amino acids in cell determined phosphorylation sites, whereas Disphos on average culture (SILAC) in a case study of B. subtilis [76], and we can soon predicted only under 5%. These results are certainly disappointing expect the publication of a new wave of site-specific and quantitative from the point of view of a bacteriologist who would use these bacterial phosphoproteomes (and proteomes in general). With this predictors to guide further experiments. The difference in utility of the new analytical tool, kinase and phosphatase knockouts can be two predictors is not as large when one takes into consideration that compared to wild type strains to infer connections between kinases/ many NetPhosBac predictions are just above the 0.5 cut-off, and phosphatases and their substrates. Once this work has been would therefore be of limited value. On the other hand, Disphos accomplished, we will be able to construct the first topology models predictions are much more discerning, the true positives always

Fig. 1. NetPhosBac and Disphos were used to predict phosphorylation sites on proteins from four bacterial specied: P. putida [71], P. aeruginosa [71], K. pneumoniae [70] and L. lactis [69], that were experimentally found to be phosphorylated. Experimentally determined phosphorylation sites scoring above 0.5 were retained as correct predictions, and the result for each predictor and each species is expressed as percentage of correct predictions in the entire dataset of phosphorylated proteins. A. Kobir et al. / Biochimica et Biophysica Acta 1810 (2011) 989–994 993 clustering around the value 1. The bottom line is that 75–95% of [21] E.S. Groban, E.J. Clarke, H.M. Salis, S.M. Miller, C.A. Voigt, Kinetic buffering of cross talk between bacterial two-component sensors, J. Mol. Biol. 390 (2009) 380–393. phosphorylated sites will not be picked up by the predictors, and in [22] A. Siryaporn, M. Goulian, Cross-talk suppression between the CpxA–CpxR and case of NetPhosBac there is also a real danger of false positives. In EnvZ–OmpR two-component systems in E. coli, Mol. Microbiol. 70 (2008) terms of further developments, neural network predictors must 494–506. [23] T. Fukushima, H. Szurmant, E.J. Kim, M. Perego, J.A. Hoch, A sensor histidine kinase decidedly take the same route as the predictors for Eukarya, i.e. co-ordinates cell wall architecture with cell division in Bacillus subtilis, Mol. species-specific, clade-specific, or kinase family-specific. Microbiol. 69 (2008) 621–632. [24] A. Howell, S. Dubrac, D. Noone, K.I. Varughese, K. Devine, Interactions between the YycFG and PhoPR two-component systems in Bacillus subtilis: the PhoR kinase 7. Concluding remarks phosphorylates the non-cognate YycF response regulator upon phosphate limitation, Mol. Microbiol. 59 (2006) 1199–1215. fi [25] H. Nariya, S.A. Inouye, Protein Ser/Thr kinase cascade negatively regulates the It is customary to nish off such review articles stating that the DNA-binding activity of MrpC, a smaller form of which may be necessary for the field is expanding exponentially (which it is) and the future is ripe Myxococcus xanthus development, Mol. Microbiol. 60 (2006) 1205–1217. with discoveries to come. However, steady exponential progress is [26] L. Rajagopal, A. Vo, A. Silvestroni, C.E. Rubens, Regulation of cytotoxin expression fi by converging eukaryotic-type and two-component signalling mechanisms in present in most elds of biology, and real excitement comes from Streptococcus agalactiae, Mol. Microbiol. 62 (2006) 941–957. quantum leaps. So let us instead express hope that new thinkers will [27] A.T. Ulijasz, S.P. Falk, B. Weisblum, Phosphorylation of the RitR DNA-binding be challenged by the many mysteries still hidden in the very simple domain by a Ser–Thr phosphokinase: implications for global gene regulation in – bacterial cell, and they will join our efforts to unravel some of them. the streptococci, Mol. Microbiol. 71 (2009) 382 390. [28] J.D. Chao, K.G. Papavinasasundaram, X. Zheng, A. Chávez-Steenbock, X. Wang, G.Q. Lee, Y. Av-Gay, Convergence of Ser/Thr and two-component signaling to coordinate expression of the dormancy regulon in Mycobacterium tuberculosis, J. Acknowledgements Biol. Chem. 285 (2010) 29239–29246. [29] J. Deutscher, C. Francke, P.W. Postma, How phosphotransferase system-related This work was supported by grants from the Institut National de protein phosphorylation regulates carbohydrate metabolism in bacteria, Micro- biol. Mol. Biol. Rev. 70 (2006) 939–1031. Recherche Agronomique (INRA) to IM and Agence Nationale de la [30] C. Jers, B. Soufi, C. Grangeasse, J. Deutscher, I. Mijakovic, Phosphoproteomics in Recheche (ANR) to IM and CG. bacteria: towards a systemic understanding of bacterial phosphorylation networks, Expert Rev. Proteomics 5 (2008) 619–627. [31] B.E. Scharf, Summary of useful methods for two-component system research, References Curr. Opin. Microbiol. 13 (2010) 246–252. [32] I. Mijakovic, S. Poncet, A. Galinier, V. Monedero, S. Fieulaine, J. Janin, S. Nessler, J.A. [1] Y.L. Deribe, T. Pawson, I. Dikic, Post-translational modifications in signal Marquez, K. Scheffzek, S. Hasenbein, W. Hengstenberg, J. Deutscher, Pyrophos- integration, Nat. Struct. Mol. Biol. 17 (2010) 666–672. phate-producing protein dephosphorylation by HPr kinase/phosphorylase: a relic [2] J. Deutscher, M.H. Saier, Ser/Thr/Tyr protein phosphorylation in bacteria — for of early life? Proc. Natl Acad. Sci. USA 99 (2002) 13442–13447. long time neglected, now well established, J. Mol. Microbiol. Biotechnol. 9 (2005) [33] J. Zheng, Z. Jia, Structure of the bifunctional isocitrate dehydrogenase kinase/ 125–131. phosphatase, Nature 465 (2010) 961–965. [3] M. Goulian, Two-component signaling circuit structure and properties, Curr. Opin. [34] J. Pérez, A. Castañeda-García, H. Jenke-Kodama, R. Müller, J. Muñoz-Dorado, Microbiol. 13 (2010) 184–189. Eukaryotic-like protein kinases in the prokaryotes and the myxobacterial kinome, [4] V. Molle, L. Kremer, Division and cell envelope regulation by Ser/Thr phosphor- Proc. Natl Acad. Sci. USA 105 (2008) 15950–15955. ylation: Mycobacterium shows the way, Mol. Microbiol. 75 (2010) 1064–1077. [35] A.J. Cozzone, Role of protein phosphorylation on serine/threonine and tyrosine in [5] M. Abu-Qarn, J. Eichler, N. Sharon, Not just for Eukarya anymore: protein the virulence of bacterial pathogens, J. Mol. Microbiol. Biotechnol. 9 (2005) glycosylation in Bacteria and Archaea, Curr. Opin. Struct. Biol. 18 (2008) 544–550. 198–213. [6] M.A. Lauber, W.E. Running, J.P. Reilly, B. subtilis ribosomal proteins: structural [36] T. Alber, Signaling mechanisms of the Mycobacterium tuberculosis receptor Ser/Thr homology and post-translational modifications, J. Proteome Res. 8 (2009) protein kinases, Curr. Opin. Struct. Biol. 19 (2009) 650–657. 4193–4206. [37] A.E. Greenstein, C. Grundner, N. Echols, L.M. Gay, T.N. Lombana, C.A. Miecskowski, [7] S.K. Arora, A.N. Neely, B. Blair, S. Lory, R. Ramphal, Role of motility and flagellin K.E. Pullen, P.Y. Sung, T. Alber, Structure/function studies of Ser/Thr and Tyr glycosylation in the pathogenesis of Pseudomonas aeruginosa burn wound protein phosphorylation in Mycobacterium tuberculosis, J. Mol. Microbiol. infections, Infect. Immun. 73 (2005) 4395–4398. Biotechnol. 9 (2005) 167–181. [8] M. Zhou, H. Wu, Glycosylation and biogenesis of a family of serine-rich bacterial [38] H.D. Kulasekara, S.I. Miller, Threonine phosphorylation times bacterial secretion, adhesins, Microbiology 155 (2009) 317–327. Nat. Cell Biol. 9 (2007) 734–736. [9] Q. Wang, Y. Zhang, C. Yang, H. Xiong, Y. Lin, J. Yao, H. Li, L. Xie, W. Zhao, Y. Yao, Z.B. [39] J.D. Mougous, C.A. Gifford, T.L. Ramsdell, J.J. Mekalanos, Threonine phosphoryla- Ning, R. Zeng, Y. Xiong, K.L. Guan, S. Zhao, G.P. Zhao, Acetylation of metabolic tion post-translationally regulates protein secretion in Pseudomonas aeruginosa, enzymes coordinates carbon source utilization and metabolic flux, Science 327 Nat. Cell Biol. 9 (2007) 797–803. (2010) 1004–1007. [40] M. Fiuza, M.J. Canova, I. Zanella-Cléon, M. Becchi, A.J. Cozzone, L.M. Mateos, L. [10] O. Liarzi, R. Barak, V. Bronner, M. Dines, Y. Sagi, A. Shainskaya, M. Eisenbach, Kremer, J.A. Gil, V. Molle, From the characterization of the four serine/threonine Acetylation represses the binding of CheY to its target proteins, Mol. Microbiol. 76 protein kinases (PknA/B/G/L) of Corynebacterium glutamicum toward the role of (2010) 932–943. PknA and PknB in cell division, J. Biol. Chem. 283 (2008) 18099–18112. [11] X. Chao, T.J. Muff, S.Y. Park, S. Zhang, A.M. Pollard, G.W. Ordal, A.M. Bilwes, B.R. [41] V. Molle, L. Kremer, Division and cell envelope regulation by Ser/Thr phosphor- Crane, A receptor-modifying deamidase in complex with a signaling phosphatase ylation: Mycobacterium shows the way, Mol. Microbiol. 75 (2010) 1064–1077. reveals reciprocal regulation, Cell 124 (2006) 561–571. [42] I.M. Shah, M.H. Laaberki, D.L. Popham, J. Dworkin, A eukaryotic-like Ser/Thr kinase [12] C.V. Rao, G.D. Glekas, G.W. Ordal, The three adaptation systems of Bacillus subtilis signals bacteria to exit dormancy in response to peptidoglycan fragments, Cell chemotaxis, Trends Microbiol. 16 (2008) 480–487. 135 (2008) 486–496. [13] R. Gao, A.M. Stock, Biological insights from structures of two-component proteins, [43] P. Barthe, G.V. Mukamolova, C. Roumestand, M. Cohen-Gonsaud, The structure of Annu. Rev. Microbiol. 63 (2009) 133–154. PknB extracellular PASTA domain from mycobacterium tuberculosis suggests a [14] A. Brencic, K.A. McFarland, H.R. McManus, S. Castang, I. Mogno, S.L. Dove, S. Lory, ligand-dependent kinase activation, Structure 18 (2010) 606–615. The GacS/GacA signal transduction system of Pseudomonas aeruginosa acts [44] N. Tyagi, K. Anamika, N. Srinivasan, A framework for classification of prokaryotic exclusively through its control over the transcription of the RsmY and RsmZ protein kinases, PLoS ONE 5 (2010) e10608. regulatory small RNAs, Mol. Microbiol. 73 (2009) 434–445. [45] V. Molle, J. Leiba, I. Zanella-Cléon, M. Becchi, L. Kremer, An improved method to [15] L. Tetsch, K. Jung, The regulatory interplay between membrane-integrated sensors unravel phosphoacceptors in Ser/Thr protein kinase-phosphorylated substrates, and transport proteins in bacteria, Mol. Microbiol. 73 (2009) 982–991. Proteomics 10 (2010) 3910–3915. [16] M.T. Laub, M. Goulian, Specificity in two-component signal transduction path- [46] B. Thomasson, J. Link, A.G. Stassinopoulos, N. Burke, L. Plamann, P.L. Hartzell, ways, Annu. Rev. Genet. 41 (2007) 121–145. MglA, a small GTPase, interacts with a tyrosine-kinase to control type IV pili- [17] D.R. Buelow, T.L. Raivio, Three (and more) component regulatory systems — mediated motility and development of Myxococcus xanthus, Mol. Microbiol. 46 auxiliary regulators of bacterial histidine kinases, Mol. Microbiol. 75 (2010) (2002) 1399–1413. 547–566. [47] X. Zhao, J.S. Lam, WaaP of Pseudomonas aeruginosa is a novel eukaryotic type [18] M.D. Baker, J.B. Stock, Signal transduction: networks and integrated circuits in protein–tyrosine-kinase as well as a sugar kinase essential for the biosynthesis of bacterial cognition, Curr. Biol. 17 (2007) R1021–R1024. core lipopolysaccharide, J. Biol. Chem. 277 (2002) 4722–4730. [19] A.M. Kierzek, L. Zhou, B.L. Wanner, Stochastic kinetic model of two component [48] C. Grangeasse, A.J. Cozzone, J. Deutscher, I. Mijakovic, Tyrosine phosphorylation: system signalling reveals all-or-none, graded and mixed mode stochastic an emerging regulatory device of bacterial physiology, Trends Biochem. Sci. 32 switching responses, Mol. Biosyst. 6 (2010) 531–542. (2007) 86–94. [20] T. Miyashiro, M. Goulian, High stimulus unmasks positive feedback in an [49] F. Jadeau, E. Bechet, A.J. Cozzone, G. Deléage, C. Grangeasse, C. Combet, autoregulated bacterial signaling circuit, Proc. Natl Acad. Sci. USA 105 (2008) Identification of the idiosyncratic bacterial protein tyrosine kinase (BY-kinase) 17457–17462. family signature, Bioinformatics 24 (2008) 2427–2430. 994 A. Kobir et al. / Biochimica et Biophysica Acta 1810 (2011) 989–994

[50] C. Whitfied, Biosynthesis and assembly of capsular polysaccharides in Escherichia [66] J. Fuhrmann, A. Schmidt, S. Spiess, A. Lehner, K. Turgay, K. Mechtler, E. coli, Annu. Rev. Biochem. 75 (2006) 39–68. Charpentier, T. Clausen, McsB is a protein arginine kinase that phosphorylates [51] B. Obadia, S. Lacour, P. Doublet, H. Baubichon-Cortay, A.J. Cozzone, C. Grangeasse, and inhibits the heat-shock regulator CtsR, Science 324 (2009) 1323–1327. Influence of tyrosine-kinase Wzc activity on colanic acid production in Escherichia [67] B. Macek, I. Mijakovic, J.V. Olsen, F. Gnad, C. Kumar, P.R. Jensen, M. Mann, The coli K12 cells, J. Mol. Biol. 367 (2007) 42–53. serine/threonine/tyrosine phosphoproteome of the model bacterium Bacillus [52] I. Mijakovic, S. Poncet, G. Boël, A. Mazé, S. Gillet, E. Jamet, P. Decottignies, C. subtilis, Mol. Cell. Proteomics 6 (2007) 697–707. Grangeasse, P. Doublet, P. Le Maréchal, J. Deutscher, Transmembrane modulator- [68] B. Macek, F. Gnad, B. Soufi, C. Kumar, J.V. Olsen, I. Mijakovic, I.M. Mann, dependent bacterial tyrosine kinase activates UDP-glucose dehydrogenases, Phosphoproteome analysis of E. coli reveals evolutionary conservation of bacterial EMBO J. 22 (2003) 4709–4718. Ser/Thr/Tyr phosphorylation, Mol. Cell. Proteomics 7 (2008) 299–307. [53] C. Grangeasse, B. Obadia, I. Mijakovic, J. Deutscher, A.J. Cozzone, P. Doublet, [69] B. Soufi, F. Gnad, P.R. Jensen, D. Petranovic, M. Mann, I. Mijakovic, B. Macek, The Autophosphorylation of the Escherichia coli protein kinase Wzc regulates tyrosine Ser/Thr/Tyr phosphoproteome of Lactococcus lactis IL1403 reveals multiply phosphorylation of Ugd, a UDP-glucose dehydrogenase, J. Biol. Chem. 278 (2003) phosphorylated proteins, Proteomics 8 (2008) 3486–3493. 39323–39329. [70] M.H. Lin, T.L. Hsu, S.Y. Lin, Y.J. Pan, J.T. Jan, J.T. Wang, K.H. Khoo, S.H. Wu, [54] I. Mijakovic, D. Petranovic, B. Macek, T. Cepo, M. Mann, J. Davies, P.R. Jensen, D. Phosphoproteomics of Klebsiella pneumonia NTUH-K2044 reveals a tight link Vujaklija, Bacterial single-stranded DNA-binding proteins are phosphorylated on between tyrosine phosphorylation and virulence, Mol. Cell. Proteomics 8 (2009) tyrosine, Nucleic Acids Res. 34 (2006) 1588–1596. 2613–2623. [55] M. Kolot, R. Gorovits, N. Silberstein, B. Fichtman, E. Yagil, Phosphorylation of the [71] A. Ravichandran, N. Sugiyama, M. Tomita, S. Swarup, Y. Ishihama, Ser/Thr/Tyr integrase protein of coliphage HK022, Virology 375 (2008) 383–390. phosphoproteome analysis of pathogenic and non-pathogenic Pseudomonas [56] C. Grangeasse, R. Terreux, S. Nessler, Bacterial tyrosine-kinases: structure- species, Proteomics 9 (2009) 2764–2775. function analysis and therapeutic potential, Biochim. Biophys. Acta 1804 (2010) [72] X. Sun, F. Ge, C.L. Xiao, X.F. Yin, R. Ge, L.H. Zhang, Q.Y. He, Phosphoproteomic 628–634. analysis reveals the multiple roles of phosphorylation in pathogenic bacterium [57] J.K. Morona, R. Morona, J.C. Paton, Attachment of capsular polysaccharide to the Streptococcus pneumoniae, J. Proteome Res. 9 (2010) 275–282. cell wall of Streptococcus pneumoniae type 2 is required for invasive disease, Proc. [73] S.R. Schmidl, K. Gronau, N. Pietack, M. Hecker, D. Becher, J. Stülke, The Natl Acad. Sci. USA 103 (2006) 8505–8510. phosphoproteome of the minimal bacterium Mycoplasma pneumoniae: analysis [58] D. Petranovic, O. Michelsen, K. Zahradka, C. Silva, M. Petranovic, P.R. Jensen, I. of the complete known Ser/ Thr kinome suggests the existence of novel kinases, Mijakovic, Bacillus subtilis strain deficient for the protein-tyrosine kinase PtkA Mol. Cell. Proteomics 9 (2010) 1228–1242. exhibits impaired DNA replication, Mol. Microbiol. 63 (2007) 1797–1805. [74] J.L. Parker, A.M. Jones, L. Serazetdinova, G. Saalbach, M.J. Bibb, M.J. Naldrett, [59] G. Klein, C. Dartigalongue, S. Raina, Phosphorylation-mediated regulation of heat Analysis of the phosphoproteome of the multicellular bacterium Streptomyces shock response in Escherichia coli, Mol. Microbiol. 48 (2003) 269–285. coelicolor A3(2) by protein/peptide fractionation, phosphopeptide enrichment [60] C. Jers, M.M. Pedersen, D.K. Paspaliari, W. Schütz, C. Johnsson, B. Soufi, B. Macek, P.R. and high-accuracy mass spectrometry, Proteomics 10 (2010) 2486–2497. Jensen, I. Mijakovic, Bacillus subtilis BY-kinase PtkA controls enzyme activity and [75] S. Prisic, S. Dankwa, D. Schwartz, M.F. Chou, J.W. Locasale, C.M. Kang, G. Bemis, localization of its protein substrates, Mol. Microbiol. 77 (2010) 287–299. G.M. Church, H. Steen, R.N. Husson, Extensive phosphorylation with over- [61] D.C. Lee, J. Zheng, Y.M. She, Z. Jia, Structure of Escherichia coli tyrosine kinase Etk lapping specificity by Mycobacterium tuberculosis serine/threonine protein reveals a novel activation mechanism, EMBO J. 27 (2008) 1758–1766. kinases, Proc. Natl Acad. Sci. USA 107 (2010) 7521–7526. [62] V. Olivares-Illana, P. Meyer, E. Bechet, V. Gueguen-Chaignon, D. Soulat, S. [76] B. Soufi, C. Kumar, F. Gnad, M. Mann, I. Mijakovic, B. Macek, Stable isotope labeling Lazereg-Riquier, I. Mijakovic, J. Deutscher, A.J. Cozzone, O. Laprévote, S. Morera, C. by amino acids in cell culture (SILAC) applied to quantitative proteomics of Grangeasse, S. Nessler, Structural basis for the regulation mechanism of the Bacillus subtilis, J. Proteome Res. 9 (2010) 3638–3646. tyrosine kinase CapB from Staphylococcus aureus, PLoS Biol. 6 (2008) e143. [77] G.Y. Soung, J.L. Miller, H. Koc, E.C. Koc, Comprehensive analysis of phosphorylated [63] E. Bechet, J. Gruszczyk, R. Terreux, V. Gueguen-Chaignon, A. Vigouroux, B. Obadia, proteins of Escherichia coli ribosomes, J. Proteome Res. 8 (2009) 3390–3402. A.J. Cozzone, S. Nessler, C. Grangeasse, Identification of structural and molecular [78] B. Macek, M. Mann, J.V. Olsen, Global and site-specific quantitative phosphopro- determinants of the tyrosine-kinase Wzc and implications in capsular polysac- teomics: principles and applications, Annu. Rev. Pharmacol. Toxicol. 49 (2009) charide export, Mol. Microbiol. 77 (2010) 1315–1325. 199–221. [64] J. Wu, N. Ohta, J.L. Zhao, A. Newton, A novel bacterial tyrosine kinase essential [79] M.L. Miller, B. Soufi, C. Jers, N. Blom, B. Macek, I. Mijakovic, NetPhosBac — a for cell division and differentiation, Proc. Natl Acad. Sci. USA 96 (1999) predictor for Ser/Thr phosphorylation sites in bacterial proteins, Proteomics 9 13068–13073. (2009) 116–125. [65] J. Kirstein, D. Zühlke, U. Gerth, K. Turgay, M. Hecker, A tyrosine kinase and its [80] L.M. Iakoucheva, P. Radivojac, C.J. Brown, T.R. O'Connor, J.G. Sikes, Z. Obradovic, activator control the activity of the CtsR heat shock repressor in B. subtilis, EMBO J. A.K. Dunker, Intrinsic disorder and protein phosphorylation, Nucleic Acids Res. 24 (2005) 3435–3445. 32 (2004) 1037–1049.

5. Outline of the thesis work The site-specific phosphoproteome of B. subtilis identified many new phosphoproteins and in most cases identified the phosphorylated residues. On the other hand, B. subtilis possess only a few Hanks type serine/threonine kinases, of which mostly remain uncharacterized with the exception of PrkC. This laid the foundation for the thesis work in which my first step was to choose interesting substrates and then identify specific serine/threonine kinases that phosphorylate them. In this thesis, I have focused on three phosphorylated proteins. The first study describes serine phosphorylation of the transition phase two-component systems sensory kinase DegS (Chapter 2), in the second, serine/threonine kinase YabT phosphorylates the recombinase RecA (Chapter 3) and in the third, phosphorylation of a global gene regulator AbrB modulates its DNA binding (chapter 4).

I also participated in writing of two review papers dealing with protein phosphorylation in bacterial signal transduction and BY kinases, respectively (Kobir et al., 2011 and Shi et al., 2010). The review describing protein phosphorylation in bacteria is directly related to my thesis work and for this reason I chose to include it in the introduction. For the BY-kinase review, my contribution was minimal and that is why the paper has been placed in the appendix.

DegS project Two-component systems, DegS/U is a complex global gene regulator in B. subtils.These signal transduction signaling systems are the kind of signalling proteins by which bacteria sense and respond to changes in the environment. This signal transduction system consist of two parts, a membrane-associated histidine kinase (DegS) and a cytoplasmic response regulator (DegU). In this system DegS receives signal or stress by which it is autophosphorylated and transfers phosphate to DegU. The phosphorylation level of response regulator DegU is fine-tuned and triggers gene expression of different subregulons at different levels (Mascher et al., 2006). Usually in two-component systems the sensory kinase is stimulated by ligad biding to its N-terminal sensing domain, but no such kind of signal has been reported before for DegS. In our phosphoproteomic study (Macek et al., 2007), DegS was found to be phosphorylated on serine 76 in the N-terminal sensing domain of DegS and we therefore hypothesized that phosphorylation of DegS could be an activated signal that might regulate the functions of DegU. DegU plays key roles in regulating the transition to

stationary phase phenomena such as competence (Dubnau et al., 1994; Kunst et al., 1994; Ogura & Tanaka,1996), motility (Amati et al.,2004; Kobayashi, 2007; Verhamme et al., 2007), complex colony formation, biofilm formation (Kobayashi et al., 2007 and Verhamme et al., 2007) as well as exoprotease production (Dahl et al., 1992;Msadek et al., 1990). So the aim of this study was to investigate the phosphorylation of DegS on serine 76 residue in vitro as well as to determine this phosphorylation effect on the DegS/U regulatory system in vivo.

RecA project RecA is well known as a general DNA recombinase that plays central roles in DNA repair (Smith et al., 1987 & 1989; Lusetti et al., 2002), homologous recombination (Mcentee et al., 1979; Shibata et al., 1979 & 2001; Chen et al., 2008), DNA metabolism (Cox et al., 2007), induction of SOS response (Fonville et al., 2010) and SOS-induced mutagenesis (Patel et al., 2010) in bacteria. When the bacterial cell is subjected to the harmful action of DNA damaging agents, it turns on SOS response. This process is triggered by damaged ssDNA that binds RecA which in turn serves as co-protease to cleave LexA transcriptional repressor. With LexA repressor is removed, the SOS regulon is activated. In addition, RecA protein also promotes homologous pairing and genetic DNA exchange that are important steps for homologous recombination and DNA repair (Michael et al., 2003, Harmon et al., 1996). RecA protein and its physiological role is well studied in E. coli (Roca et al.,1997) but there was no evidence of RecA phosphorylation in this organism (Michael et al., 2003). RecA eukaryotic homologous protein is Rad51 and its physiological role is well studied, and the phosphorylation of Rad51 is also well established. (Shimizu et al., 2009; Flott et al., 2011; Yata et al., 2012). On the other hand, in B. subtilis RecA has not been as extensively studied and phosphorylation of RecA has not been reported before. From phosphoproteomic study, we found RecA phosphorylated on serine 2 in its N-terminal domain (Soufi et al.,2010) and therefore we hypothesized that phosphorylation of RecA could be an activating signal that might regulate the participation of RecA in DNA damage repair during spore development.

The aim of this study was to investigate the phosphorylation capability of RecA on serine 2 and to determine the effect of this phosphorylation on its function to DNA repair during spore development.

AbrB project AbrB is a DNA binding global gene regulator protein of B. subtilis that is regulating over 100 genes that commence the expression during the transition phase at the end of vegetative growth and the onset of stationary phase (the nutrient limiting environments) and finally, the sporulation (Perego et al., 1991; Zuber et al., 1987; Schultz et al., 2009). In B. subtilis, AbrB plays diverse regulatory roles such as control of antibiotics production (Trowsdale et al., 1979; Marahiel et al., 1993; Phillips et al., 2002) development of competence to uptake DNA (Hahn et al., 1995; Schultz et al., 2009) the biofilm formation (Branda et al., 2001; Hamon et al., 2004; Chu et al., 2008) extracellular proteases production and degradative enzymes (Phillips et al., 2002) and control of expression of other stationary phase genes (Phillips et al., 2002). In the pathogenic bacteria, such as B. anthracis, it regulates expression of genes for the production of toxins (Saile et al., 2002). The transition phase regulator AbrB has several functions as an activator, a repressor and a preventer of expression of many genes in B. subtilis cellular metabolism (Mary et al., 1997). The regulation of AbrB is extremely complex and takes place both on transcriptional and protein level. Normally, AbrB has two oligomerization sites: one is C-terminal and another in the N-terminal domain for DNA binding (Vaughn et al.,2000). AbrB is also well known as a nonspecific DNA binding protein. AbrB has critical regulatory properties that are its ability to recognize and specifically bind a diverse subset of different base sequences located within the promoter regions of genes under its control (Strauch et al., 1989). In B. subtilis this protein is well studied but no phosphorylation of AbrB has been reported before. In the phosphoproteomic study, AbrB was found to be phosphorylated on serine 86 located close to its C-terminal oligomerization domain (Soufi et al.,2010) and we therefore hypothesized that AbrB phosphorylation could interfere DNA binding affinity of this ambiactive gene regulator during transition phase.

The aim of this study was to investigate the capability of AbrB phosphorylation on serine 86 and to determine the effect of this phosphorylation on its DNA binding efficiency and its physiological functions.

Chapter 2

Serine/threonine kinase YbdM (new name PrkD) phosphorylates two-component system kinase DegS

Bacillus subtilis Two-Component System Sensory Kinase DegS Is Regulated by Serine Phosphorylation in Its Input Domain

Carsten Jers1, Ahasanul Kobir2, Elsebeth Oline Søndergaard1, Peter Ruhdal Jensen1, Ivan Mijakovic2* 1 Center for Systems Microbiology, Technical University of Denmark, Lyngby, Denmark, 2 Micalis, AgroParisTech/Institut National de la Recherche Agronomique, Jouy en Josas, France

Abstract Bacillus subtilis two-component system DegS/U is well known for the complexity of its regulation. The cytosolic sensory kinase DegS does not receive a single predominant input signal like most two-component kinases, instead it integrates a wide array of metabolic inputs that modulate its activity. The phosphorylation state of the response regulator DegU also does not confer a straightforward ‘‘on/off’’ response; it is fine-tuned and at different levels triggers different sub-regulons. Here we describe serine phosphorylation of the DegS sensing domain, which stimulates its kinase activity. We demonstrate that DegS phosphorylation can be carried out by at least two B. subtilis Hanks-type kinases in vitro, and this stimulates the phosphate transfer towards DegU. The consequences of this process were studied in vivo, using phosphomimetic (Ser76Asp) and non-phosphorylatable (Ser76Ala) mutants of DegS. In a number of physiological assays focused on different processes regulated by DegU, DegS S76D phosphomimetic mutant behaved like a strain with intermediate levels of DegU phosphorylation, whereas DegS S76A behaved like a strain with lower levels of DegU phophorylation. These findings suggest a link between DegS phosphorylation at serine 76 and the level of DegU phosphorylation, establishing this post- translational modification as an additional trigger for this two-component system.

Citation: Jers C, Kobir A, Søndergaard EO, Jensen PR, Mijakovic I (2011) Bacillus subtilis Two-Component System Sensory Kinase DegS Is Regulated by Serine Phosphorylation in Its Input Domain. PLoS ONE 6(2): e14653. doi:10.1371/journal.pone.0014653 Editor: Katy C. Kao, Texas A&M University, United States of America Received July 13, 2010; Accepted January 10, 2011; Published February 3, 2011 Copyright: ß 2011 Jers et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was supported by grants from the Danish National Research Council (FNU) 272-07-0129, the Lundbeckfonden R17-A1535 and the Institut National de Recherche Agronomique (INRA) installation package to IM and a PhD stipend from the Technical University of Denmark (DTU) to CJ. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected]

Introduction teomic study in Bacillus subtilis, identified the two-component system histidine kinase DegS as being phosphorylated on the Two-component systems are a ubiquitous means of signal residue serine76, located in the signal sensing domain [8]. This transduction in bacteria [1]. The first, signal-receiving component implied the existence of a new type of crosstalk between two is a sensory histidine kinase that is triggered by a stimulus binding phosphorylation systems, namely one in which a presently or otherwise affecting its sensing domain. Upon activation, the unknown serine kinase would phosphorylate the two-component histidine kinase autophosphorylates on a histidine residue, and sensory histidine kinase. thereafter transfers the phosphate to a specific aspartate residue of Early mutational studies of the DegS/U two component system its cognate response regulator. Phosphorylation of the response established that the response regulator binds DNA sequences and regulator, in turn, triggers its regulatory role, which is in most regulates expression of specific genes both in its phosphorylated cases transcriptional regulation via binding of a specific DNA and unphosphorylated state. This was exemplified by reciprocal sequence. The histidine kinases of the two-component systems are effects of the two forms of DegU on exoprotease production and known to be highly specific, i.e. exhibiting low level of cross-talk competence [9]. The importance of DegS/U was further with non-cognate response regulators [2]. Another major group of underscored in two microarray experiments that independently bacterial kinases involved in signal transduction is the Hanks type demonstrated a total of 135 transcriptional units regulated either serine/threonine kinases [3,4]. Hanks type kinases and two- directly or indirectly by this two-component system [10,11]. Only component histidine kinases are sometimes found fusioned in a 22 transcriptional units were identified in the overlap between the single polypeptide in Cyanobacteria [5], however, very few cases of two studies, which could indicate an even larger regulon. Whereas crosstalk between these two protein families have been reported so the initial studies of DegS/U in the laboratory strain 168 mainly far. Two recent studies pointed out that serine/threonine kinases focused on competence and exoprotease production, more recent can phosphorylate two-component response regulators: StkP from studies using an undomesticated B. subtilis strain demonstrated that Streptococcus pneumoniae phosphorylates the orphan response regu- DegS/U also affects motility, complex colony and biofilm lator RitR [6] and serine-threonine kinase Stk1 phosphorylates formation. The regulation was shown to depend on the discrete and thereby abolishes the activity of the response regulator CovR levels of DegU phosphorylation, in a manner far more subtle than in Group B Streptococcus [7]. Interestingly, a recent phosphopro- a simple on/off switch [12,13]. It is now well established that

PLoS ONE | www.plosone.org 1 February 2011 | Volume 6 | Issue 2 | e14653 Serine-Phosphorylation of DegS

DegS/U system plays an important role in the transition growth Phosphorylation of DegS S76A by YbdM was completely phase where it receives many inputs which regulate degSU abolished, suggesting that it is the major phosphorylation site, transcription or modulate the activity of synthesized DegS/U and that the kinase YbdM is specific for this site (figure 1A). In proteins. The degSU genes are transcribed as an operon and degU is the same assay, phosphorylation of DegS S76A by YabT was as itself transcribed from two additional promoters: one activated by efficient as that of the wild type (figure 1B). This situation is not DegU,P and the other by nitrogen starvation [9,13–16]. The unprecedented [24], and residual phosphorylation in such case signal-sensing domain of DegS interacts with the SMC-ScpA- could be due to a presently unknown secondary site, or the lack of ScpB protein complex, involved in chromosome segregation, specificity exhibited by the kinase under in vitro conditions. Our which inhibits the kinase activity of DegS [17]. Similarly, the conclusion was that in vitro at least two different Hanks-type DNA-binding activity of DegU is inhibited by RapG and this kinases can phosphorylate DegS, of which YbdM is specific for inhibition is counteracted by PhrG in response to increased cell the residue serine 76. DegS is also known to exhibit phosphatase density [18]. DegS/U activity is further modulated by two small regulatory peptides, DegQ and DegR. DegQ enhances the phosphotransfer from DegS,P to DegU but does not protect DegU,P from dephosphorylation [13]. The latter is accomplished by DegR that stabilises DegU,P [19]. DegQ is synthesized in response to quorum sensing via ComPA and has been hypothesised to be a determinant for the transition from motile to sessile-growth state [13]. degR expression is SigD dependent and peaks in late exponential phase, but the physiological role remains elusive [20]. Despite the fact that the DegS/U two-component system is submitted to an elaborate control at both transcriptional and protein level, no specific DegS-activating signal has so far been proposed. Most two-component system histidine kinases are transmembrane proteins, presumably activated by extracellular signals via their N-terminal signal-sensing domains protruding from the cell surface [21]. By contrast, DegS is a cytosolic protein and hence responds to, and integrates several cytosolic signals, some of which have been listed above. In this study, we examined the possibility that phosphorylation of DegS on serine 76 residue could represent a novel input for this regulatory system. We demonstrated that the specific phosphorylation of this residue by the Hanks kinase YbdM stimulates phosphotransfer to DegU in vitro, and a phosphomimetic mutant of DegS leads to an increased DegU,P pool, and influences the transcription of key DegU- dependent promoters in vivo.

Results and Discussion DegS is phosphorylated in vitro by B. subtilis Hanks-type serine/threonine kinases In order to characterize the serine 76 phosphorylation of DegS, we first asked the question whether this phosphorylation is auto- catalyzed or it requires another kinase. To answer this question we carried out in vitro phosphorylation experiments with purified Figure 1. Phosphorylation of DegS by Hanks type kinases in DegS and 32P-c-ATP. Phospho-histidine and phospho-serine can vitro. Autoradiography of SDS-Polyacrylamide gels with proteins that 32 be easily distinguished, the latter being stable in acidic conditions had been incubated with P-c-ATP. Gels were treated by boiling in acid and resistant to heat. Since the entire radioactive label present on to remove phospho-histidine signals (A) Phosphorylation of DegS by the kinase YbdM. Lanes 1 and 2 are controls, with DegS alone and autophosphorylated DegS was removed by acid and heat YbdM alone, respectively. Lanes 3–5 show phosphorylation of DegS by treatment (figure 1), we concluded that DegS was incapable of YbdM for 15, 30 and 60 min, respectively. Lanes 6–8 show phosphor- autophosphorylating on serine. There are a number of poorly ylation of DegS S76A by YbdM for 15, 30 and 60 min, respectively. Lane characterized serine/threonine kinases in B. subtilis, mainly 9 shows the equivalent of the reaction from lane 5, after desalting to belonging to the family of Hanks-type kinases [22]. The most remove the ATP and a 2 h incubation to test for phosphatase activity. extensively characterized of those is the kinase PrkC that has (B) Phosphorylation of DegS by the kinase YabT. Lanes 1 and 2 are controls, with DegS alone and YabT alone, respectively. Lanes 3–5 show recently been shown to participate in signalling underlying spore phosphorylation of DegS by YabT for 15, 30 and 60 min, respectively. germination [23]. We purified the three Hanks-type kinases Lanes 6–8 show phosphorylation of DegS S76A by YabT for 15, 30 and PrkC, YabT and YbdM, and a putative kinase PrkA to test their 60 min, respectively. Lane 9 shows the equivalent of the reaction from ability to phosphorylate DegS in vitro. PrkA (data not shown) and lane 5, after desalting to remove the ATP and a 2 h incubation to test PrkC were unable to phosphorylate DegS, whereas both YbdM for phosphatase activity. (C) Phosphorylation of DegS by the kinase and YabT tested positive for DegS phosphorylation (figure 1). In PrkC. Lanes 1 and 2 are controls, with DegS alone and PrkC alone, respectively. Lanes 3–5 contain the reactions where PrkC concentration order to verify whether serine 76 is indeed the residue has been varied (2, 4 and 10 nM, respectively), and in lanes 6–7 the pH phosphorylated by these kinases, we constructed a mutant has been varied (pH 7 and pH 8, respectively). protein with a non-phosphorylatable replacement DegS S76A. doi:10.1371/journal.pone.0014653.g001

PLoS ONE | www.plosone.org 2 February 2011 | Volume 6 | Issue 2 | e14653 Serine-Phosphorylation of DegS activity, so we tested whether serine phosphorylation of DegS Phosphomimetic mutant DegS S76D exhibits increased could be removed by the protein itself. For this, we removed the autophosphorylation and phosphotransfer to DegU in ATP from the phosphorylation reactions catalyzed by YbdM and vitro YabT, and allowed the dephosphorylation reaction to occur for Rarely more than several percent of the target protein is 2 h. The radiolabel on DegS remained stable, indicating the phosphorylated during in vitro kinase assays, unless a specific absence of phospho-serine phosphatase activity (figure 1A and kinase-activating signal is present [28]. In order to study the 1B, lanes 9). The B. subtilis serine/threonine kinase-encoding regulatory effects of phosphorylation in vivo, phosphomimetic genes yabT, ybdM and prkA have been reported to belong to the mutants, with the phosphorylatable residue replaced by a larger, sigma F, G and E regulon respectively [25,26] hence linking them negatively charged amino acid are often employed [29]. Since our to sporulation specific processes. However, a recent transcrip- data indicated that DegS can be phosphorylated by two Hanks- tomics study [27] identified yabT, ybdM and prkC as transcribed in type kinases, for which the specific effectors (or conditions) that the exponential growth phase, which makes it highly probable trigger their activity towards DegS are unknown, it seemed that these kinases are present in the transition phase when DegS particularly promising to study the effects of DegS phosphorylation activity is triggered. Since YbdM appeared to be the the most in vivo using a phosphomimetic mutant DegS S76D. Before using specific kinase for DegS serine 76, we tested the effect of YbdM- the mutant protein in vivo, we checked whether its behaviour dependent DegS phosphorylation on the efficiency of phospho- during an in vitro phosphorylation assay would corresponded to transfer from DegS to DegU. To this end, we first incubated that of wild type DegS which had been phosphorylated by YbdM DegS with non-labelled ATP, MgCl2 and YbdM for 3 hrs, and (as shown in figure 2). Purified DegS S76D showed an increase in we also prepared a control sample of DegS incubated for exactly DegU phosphorylation on aspartate (figure 3A) as well as an the same time with ATP and MgCl2, but without YbdM. The increase in autophosphorylation on histidine (figure 3B) compared DegS sample pre-incubated with YbdM was more efficient in to the wild type. The respective activites of DegS S76A were also phosphorylating DegU, especially in the first 60 s period which above the wild type level, but below that of DegS S76D (figure 3). corresponds to the theoretical reaction time of the two- Interestingly, DegS S76D maintained a considerable level of component system (figure 2). incorporated phosphate in the presence of DegU, whereas DegS

Figure 2. Phosphorylation of DegS by YbdM stimulates phosphotransfer to DegU in vitro. (A) Autoradiography of SDS-Polyacrylamide gels with proteins that had been incubated with 32P-c-ATP. Gels were not treated by boiling in acid, so the phospho-histidine and phospho-aspartate signals are preserved. Efficiency of phosphotransfer of wild-type DegS to DegU (gel on the left) is compared to that of DegS that had been preincubated with YbdM, 50 mM non-labelled ATP and 5 mM MgCl2 for 3 h (gel on the right). (B) Quantification of DegU phosphorylation signals on both gels. doi:10.1371/journal.pone.0014653.g002

PLoS ONE | www.plosone.org 3 February 2011 | Volume 6 | Issue 2 | e14653 Serine-Phosphorylation of DegS wild type and DegS S76A retained much less phosphate under behave as the non-phosphorylatable degS S76A. All kinase mutants these conditions. DegS/U exerts a very complex regulation of had competence level identical or superior to wild-type, which is in several physiological processes, some of which are affected by high agreement with our hypothesis, but of limited evidential value, and others by low levels of DegU phosphorylation. We thus since degS S76A was itself non-distinguishable from the wild type. hypothesized that strains where wild type DegS would be replaced Competence in B. subtilis is a bistability phenomenon that occurs in by DegS S76D should be unable to activate processes that are a sub-population of cells which become transiently competent normally stimulated by non-phosphorylated DegU, and probably during a certain window of time in the transition growth phase overly stimulate processes that require phosphorylated DegU. We [32]. We thus asked the question whether the effect of degS S76D therefore decided to focus on several functions that exemplify these on competence could be due to a temporal shift in the window of contrasting situations to examine the regulatory role of DegS competence or an overall decrease in DegU-dependent comK phosphorylation on serine 76. expression. In order to determine this, lacZ encoding b- galactosidase was placed under the control of the comK promoter DegS S76D negatively affects competence development and introduced in the amyE locus of wild type and mutant strains. Competence development is a complex process regulated partly Activity of the comK promoter was assayed in the two-step by DegS/U via the transcriptional activation of comK exerted by competence media. Expression of comK was similar in the wild type unphosphorylated DegU [30]. To test the effect of phosphoryla- and degS S76A cells, peaking out as expected in the early transition tion of DegS serine 76 on this process, strains were constructed in phase. In the degS S76D mutant, expression of comK was 5-fold which the chromosomal version of degS was replaced by copies lower, and not induced at all in the transition phase (figure 4C). encoding either DegS S76D or DegS S76A. Competence of the When we overexpressed ybdM from an IPTG-dependent promoter resulting strains was initially compared to the wild type by using a in the wild type strain, comK was still induced, but less efficiently two-step transformation protocol [31]. The competence was than in the wild type. Since comK expression is known to be quantified as the number of colonies per mg of plasmid used for activated by unphosphorylated DegU, the conclusion we reached transformation, and normalized for the wild type (100+/212%). based on the presented data was that the degS S76D mutation , The strain degS S76A (155+/27%) was about 50% more indeed leads to an increase in the DegU P pool in vivo, in competent than the wild type, while the degS S76D mutant accordance to our phosphorylation data obtained in vitro. exhibited an approximately 5-fold reduction in competence (18+/ 20%), concurring with our working hypothesis. Next, competence DegS S76D affects complex colony formation and development on single cell level was assayed by introducing GFP swarming under control of the comK promoter. In this system we further After confirming the effect of the phosphomimetic mutation assayed the effects of inactivating individual serine/threonine S76D on the pool of DegU,P using the comK promoter, activated kinase-encoding genes prkC, ybdM and yabT (figure 4). Our by unphosphorylated DegU, we set out to confirm this finding hypothesis was confirmed, with an approximate 5-fold competence from the opposite angle. We next examined the yvcA promoter, reduction in degS S76D, while in this set up no difference between recently shown to be activated by intermediate levels of DegU,P wild type and the degS S76A strain was observed. In this setup, a [12]. We used the same experimental setup with promoter-lacZ mutant of the kinase phosphorylating DegS would be expected to fusions introduced ectopically, and the promoter activities were

Figure 3. DegS mutations affect autophosphorylation and DegU phosphorylation in vitro. Autoradiography of SDS-Polyacrylamide gels with proteins that had been incubated with 32P-c-ATP. Gels were not treated by boiling in acid, so the phospho-histidine and phospho-aspartate signals are preserved. Time periods are indicated for each lane, for DegU phosphorylation (A) and DegS autophosphorylation (B). doi:10.1371/journal.pone.0014653.g003

PLoS ONE | www.plosone.org 4 February 2011 | Volume 6 | Issue 2 | e14653 Serine-Phosphorylation of DegS

the dotted line (broken line indicates the dilution in the new medium). The results (with standard deviation bars) are the average from three technical replicas. doi:10.1371/journal.pone.0014653.g004

determined in cells grown in LB medium (figure 5). A significant increase in yvcA promoter activity was observed in the degS S76D strain and to a lesser extent in the strain overexpressing ybdM, compared to the wild type and degS S76A strain. A gradual increase in expression from the yvcA promoter in the wild type B. subtilis compared to the degS S76A strain observed in the stationary phase might indicate a gradual increase in the level of DegS serine phosphorylation, which is completely abolished in degS S76A. These results further substantiate that the level of DegU,P is increased in the degS S76D mutant. The yvcA promoter has been reported to be inhibited at high levels of DegU,P, indicating that this mutation leads rather to intermediate than excessive amount of DegU,P. Further substantiating this, protease production, known to be activated by high levels of DegU,P, was not stimulated by the degS S76D mutant (data not shown). YvcA has been shown to play an important role in complex colony formation [12]. The effects on yvcA promoter activity prompted us to investigate the effects of the degS S76D mutation on this and the other social behavioural traits pellicle formation and swarming that are regulated by low levels of DegU,P. The laboratory strain B. subtilis 168 does not readily swarm due to defects in surfactin production and a frame shift mutation in swrA [33] and we therefore tested these traits in the undomesticated strain NCIB 3610. No effect was observed on pellicle formation (data not shown). Concerning complex colony formation, all strains exhibited some variability on the MSgg medium. However, there was a subtle difference in colony morphology: the wild type and degS S76A colonies were capable of producing larger and more complex aerial structures than the strain degS S76D (figure 6). A more apparent phenotype was observed in swarming (figure 7). The wild type and degS S76A swarming pattern and speed were similar, they swarmed in a linear manner until

Figure 4. Competence development is inhibited in degS S76D strain. (A) Single cell analysis of competence: a representative picture demonstrating the difference in fluorescence intensity observed between competent and non-competent cells. (B) Single cell analysis of competence: numerical data. Competence of wild type, degS Figure 5. degS S76D leads to increased yvcA promoter activity. mutants and Ser/Thr kinase mutants normalised with respect to the yvcA promoter activity in wild type, degS S76A, S76D and the strain wild type cells. The results (with standard deviation bars) are the overexpressing ybdM grown in LB medium. Wild type is shown in filled average of three independent experiments. (C) comK promoter activity circles, degS S76A strain in filled triangles, degS S76D in open triangles in wild type, degS S76A, degS S76D and a strain overexpressing ybdM and the strain overexpressing ybdM in open circles. Culture growth is grown in competence media. Wild type is shown in filled circles, degS indicated with the dotted line. The results (with standard deviation S76A in filled triangles, degS S76D in open triangles and the strain bars) are the average from three technical replicas. overexpressing ybdM in open circles. Culture growth is indicated with doi:10.1371/journal.pone.0014653.g005

PLoS ONE | www.plosone.org 5 February 2011 | Volume 6 | Issue 2 | e14653 Serine-Phosphorylation of DegS

the time of degS S76D consolidation (data not shown). Further, this phenotype does not seem to be related to either surfactin production or the swrA mutation since a lab strain cured for these mutations, DS155 [33], exhibited no phenotype on swarming (data not shown). Nevertheless, these data collectively support the idea that degS S76D mutation indeed leads to an increased DegU,P level. If this mutation can mimic the phosphorylated form of DegS in vivo, it would indicate that the serine phosphorylation event could have the potential to regulate social behaviours regulated at low DegU,P levels in B. subtilis.

Concluding remarks Here we describe, to the best of our knowledge, the first example of a bacterial two component sensory kinase that is regulated via serine phosphorylation of its input domain by a Hanks type Ser/Thr kinase. DegS was phosphorylated by Hanks type serine/threonine kinases YbdM and YabT in vitro. YbdM- dependent phosphorylation was specific for serine 76 and it led to increased efficiency of phosphotransfer to DegU. Moreover, ybdM overexpression led to a similar (albeit less pronounced) in vivo effect on some DegU-controlled promoters as the degS S76D phosphomimetic mutation. The degS S76D strain exhibited phenotypes corresponding to elevated levels of DegU,P in vivo. The use of point-mutations to mimic phosphorylated and non-phosphorylatable proteins is a common tool employed in protein phosphorylation research but it has a potential pitfall. The ensuing phenotypes may be caused by conformational changes caused by the mutations, which are entirely unrelated to phosphorylation. In case of the DegS S76D mutation, the protein behaves in a similar manner as wild type DegS phosphorylated by YbdM. The fact that the mutant protein exhibits a higher DegU kinase activity is expected since it would correspond to 100% phosphorylation of DegS, which is never achieved by incubating DegS with YbdM in vitro. The non-phosphorylatable mutant DegS S76A also exhibits an increased DegU kinase activity in vitro but this does not translate to an increased pool of DegU,P in vivo. Whether this could reflect a conformational change of the protein leading to increased kinase activity or maybe increased stability in vitro remains elusive. Knocking out the kinase YbdM did not provoke strong phenotypes, possibly due to complementation of its function by remaining Hanks kinases. The overproduction of the regulatory kinase YbdM, which possibly phosphorylates other proteins, could also lead to non-physiologically relevant phenotypes. The fact remains that there is an agreement between the observations with Figure 6. Complex colony formation. Complex colony formation of the phosphomimetic DegS S76D and overexpression of YbdM. If the wild type B. subtilis and mutant strains degS S76A and degS S76D DegS S76D indeed can mimick the serine 76-phosphorylated state grown on MSgg medium. Representative colonies are shown, together of DegS, it would suggest that phosphorylation of serine 76 of with a scale bar. DegS contributes to an already very complex process of regulating doi:10.1371/journal.pone.0014653.g006 the level of DegU phosphorylation in B. subtilis. The molecular mechanism by which serine phosphorylation activates DegS reaching the end of the plate in just over 300 min (figure 7A). The activity remains elusive. The fact that a phosphomimetic mutant degS S76D strain swarmed in two phases. After an initial lag DegS S76D behaved in a similar manner would preclude that (compared to the wild type) of about 60 min, it started swarming phospho-transfer from serine to either DegS histidine or DegU at the same speed as the wild type until reaching about one half- aspartate is involved. It would seem plausible that phosphorylation distance towards the end of the plate. Then it paused for about could induce a conformational change thereby stimulating kinase 120 min, seemingly consolidating. Finally, it continued swarming activity, but due to the lack of any structural data for DegS this is and went on to reach the end of the plate with about 180 min merely a speculation. The residue serine 76 of DegS was found to delay compared to the wild type. Due to this stop-and-go be phosphorylated in the late exponential growth phase [8], but behaviour, the degS S76D final swarm exhibited concentric layers that study was performed on this single growth condition, and at various stages of consolidation (figure 7B). It is difficult to hence the temporal window of DegS serine phosphorylation is not explain this altered swarming pattern in the strain degS S76D. It known. Despite YbdM arguably being the most specific of the has previously been reported that expression of the flagella operon three, the other two Hanks type kinases present in B. subtilis can is inhibited at high DegU,P levels [34], but we observed no possibly contribute to phosphorylating DegS serine 76 in vivo to difference in flagella amount or organisation in the three strains at some extent. These kinases are presently almost completely

PLoS ONE | www.plosone.org 6 February 2011 | Volume 6 | Issue 2 | e14653 Serine-Phosphorylation of DegS

Figure 7. Swarming is affected by degS S76D. Swarming of the wild type B. subtilis and mutant strains degS S76A and degS S76D, Swarming speed (A) was followed by measuring the radii of the swarming zones on plates at designated time intervals. Wild type is shown in filled circles, degS S76A strain in filled triangles and degS S76D in open triangles. Consolidation of swarms (B) was documented one hour after the swarming reached the end of plates (367 min for wild type, 374 min for degS S76A, and 502 min for degS S76D). One of three independent experiments (all yielding similar results) is shown. doi:10.1371/journal.pone.0014653.g007 uncharacterised (except PrkC) and more work will be needed to for complex colony experiments [36]. For E. coli ampicillin elucidate specific signals that trigger their expression, activity and (100 mg/mL), kanamycin (25 mg/mL), tetracycline (8 mg/mL) and substrate specificity. Our results indicate that DegS serine for B. subtilis erythromycin (5 mg/mL), neomycin (5 mg/mL) and phosphorylation influences DegU phosphorylation in vivo, pointing tetracycline (15 mg/mL) were added as appropriate. towards a possible role in regulating phenomena such as motility and complex colony formation. DNA manipulations and strain construction B. subtilis genes degS, degU, prkA, prkC (catalytic domain), yabT Materials and Methods (catalytic domain) and ybdM were PCR-amplified using genomic DNA from the strain 168 as template [37]. In order to improve Bacterial strains and growth conditions solubility of PrkC and YabT only the cytosolic part containing the E. coli NM522 was used for plasmid propagation in cloning active site was used. Point mutations degS S76A and S76D were experiments. The chaperone overproducing strain E. coli M15 obtained using two partially overlapping mutagenic primers carrying pREP4-GroESL [35] was used for protein synthesis. B. (table 2). The PCR products were inserted in the vector pQE30 subtilis strains used in this study are listed in table 1. E. coli and B. (Qiagen) using appropriate restriction sites. For promoter-lacZ subtilis cells were grown at 37uC with shaking in LB medium. In fusions the promoter regions were PCR-amplified from genomic addition, B. subtilis was grown in competence media for DNA and inserted between the EcoRI and BamHI sites of transformation experiments as described [31] and MSgg medium pDG268-neo [38]. For comK promoter-gfp fusion, pDG268neo-

PLoS ONE | www.plosone.org 7 February 2011 | Volume 6 | Issue 2 | e14653 Serine-Phosphorylation of DegS

+ Table 1. List of B. subtilis strains used in this study. mutated gene were inserted into pG host8 between the BamHI and Cfr9I sites. B. subtilis was transformed with the constructs, plated on tetracycline-containing plates and incubated at the non- u Strain Description Reference replicative temperature 37 C, which selects for integration of the vector on the chromosome by single crossing-over. The transfor- 168 [36] mants were further cultured in liquid LB for loss of plasmid by the 168-degS NS degS K9stop This work second crossing-over event and the chromosomal mutation was 168-PcomK amyE::PcomK-lacZ This work verified by sequencing. In our hands the second-crossing over 168-PcomK-gfp amyE::PcomK-gfp This work happened with a low frequency indicating that B. subtilis, contrary to Lactococcus lactis, was not severely affected by a chromosomal 168-PcomK-IND ybdM ybdM::pHT315 This work + amyE::PcomK-lacZ copy of pG host8 actively replicating. Point mutations in B. subtilis NCIB3610 were introduced by same method except that 168-PyvcA amyE::PyvcA-lacZ This work transformation with pG+Host8 was done by PEG treatment of 168-PyvcA-IND ybdM ybdM::pHT315 This work protoplasts [44]. amyE::PyvcA-lacZ 168-degS S76A degS S76A This work Protein synthesis and purification 168-S76A-PcomK degS S76A This work 6xHis-tagged proteins were synthesised in the chaperone- amyE::PcomK-lacZ overproducing strain E. coli M15 carrying pREP4-groESL. Cultures 168-S76A-PcomK-gfp degS S76A This work u were grown shaking at 37 C to OD600 0.5, induced with 1 mM amyE::PcomK-gfp IPTG and grown for an additional 3 hours. Cells were disrupted 168-S76A-PyvcA degS S76A This work by sonication and 6xHis-tagged proteins were purified on Ni-NTA amyE::PyvcA-lacZ columns (Qiagen) according to manufacturer’s instruction, desalt- 168-degS S76D degS S76D This work ed with PD-10 columns (GE-Healthcare) and stored in a buffer 168-S76D-PcomK degS S76D This work containing 50 mM Tris-Cl pH 7.5, 100 mM NaCl and 10% amyE::PcomK-lacZ glycerol. Protein concentrations were estimated using the Bradford 168-S76D-PcomK-gfp degS S76D This work assay (Bio-Rad) with BSA as standard. amyE::PcomK-gfp 168.S76D-PyvcA degS S76D This work In vitro phosphorylation assay amyE::PyvcA-lacZ Phosphorylation reactions were performed in a total volume of 168-DdegS PcomK-gfp DdegS::pMUTIN2 This work 30 ml, essentially as described [28], with 180 nM DegS, DegS amyE::PcomK-gfp S76A or DegS S76D and 15 mM DegU. For serine phosphory- 168-DprkC PcomK-gfp DprkC::pMUTIN2 This work lation of DegS, reactions contained 10 nM of either PrkA, PrkC amyE::PcomK-gfp (catalytic domain), YabT (catalytic domain) or YbdM (unless 168-DybdM PcomK-gfp DybdM::pMUTIN2 This work otherwise specified in the figure legend). Besides the proteins, the amyE::PcomK-gfp reaction mixture contained 50 mM 32P-c-ATP (20 mCi/mmol), 168-DyabT PcomK-gfp DyabT::pMUTIN2 This work 42.5 mM Tris-Cl (pH 7.5), 5 mM MgCl2, 85 mM NaCl and 8.5% amy comK-gfp E::P glycerol. For PrkC, we varied the pH value of the Tris-Cl buffer to 3610 sfp+ swrA+ Bacillus Genetic the additional pH values of 7.0, and 8.0. To measure the influence Stock Center of YbdM on DegS phosphotransfer to DegU, DegS was pre- 3610 degS S76A sfp+ swrA+ degS S76A This work incubated with YbdM for 3 h, in exactly the same conditions as 3610 degS S76D sfp+ swrA+ degS S76D This work described above, only with non-labelled ATP. Reactions were DS155 PY79 sfp+ swrA+ [33] started by addition of ATP, incubated at 37uC for 60 min (unless otherwise indicated in figure legends) and stopped by addition of doi:10.1371/journal.pone.0014653.t001 SDS-containing loading buffer. All gels shown in the same figure have the same exposure times. For dephosphorylation assays, after PcomK was restricted with BamHI and PciI to remove lacZ, gfp was the initial phosphorylation reaction described above, the DegS/ PCR-amplified using plasmid pFH2191 [39] as template, YbdM and DegS/YabT reaction mixtures were desalted on a PD- restricted and ligated with the vector. B. subtilis was transformed 10 column (to remove the ATP), lyophilized and resuspended in with the constructs yielding strains with promoter-lacZ or -gfp the identical reaction mixture as before, but without ATP, and fusions inserted in the amyE locus using a one-step transformation incubated 2 hours at 37uC. The proteins were separated by SDS- method [40]. A nonsense mutation of degS (K9stop) was PAGE (for separation of PrkC and DegS we used a Tris-tricine constructed using two partially overlapping mutagenic primers. gel). For detection of phospho-histidine and phospho-aspartate, The PCR product and pHT315 [41] were restricted with EcoRV the gels were rinsed with water and dried directly, whereas for and PvuII and the fragments ligated. The resulting vector was detection of phospho-serine they were additionally treated in devoid of the Gram-positive origin of replication. Upon transfor- boiling 0.5 M HCl for 10 min. Radioactive signals were visualised mation and integration on the chromosome, the mutation was using STORM phosphoimager and quantified using the Image- verified by sequencing. Inactivation of prkA, prkC, ybdM and yabT Quant software (GE-healthcare). was done using pMUTIN2 [42]. For IPTG-inducible overexpression, ybdM was inserted in pHT315 and introduced in B. subtilis b-galactosidase assay + strains bearing promoter-lacZ fusions. The vector pG host8 150 mL LB was inoculated with overnight culture to OD600 of containing a temperature sensitive origin of replication was used 0.02 and grown with shaking at 37uC. IPTG at a final concentration to introduce degS S76A and S76D point mutations in situ, replacing of 0.5 mM was added where appropriate. At time points indicated the chromosomal version of degS in B. subtilis 168 [43]. BamHI- in the figures, 2 mL samples were taken, spun down (10000 g, Cfr9I fragments from pQE30-degS S76A and S76D containing the 2 min) and cell pellets were stored at 220uC. The pellet was

PLoS ONE | www.plosone.org 8 February 2011 | Volume 6 | Issue 2 | e14653 Serine-Phosphorylation of DegS

Table 2. Primers used in this study. Restriction sites are underlined and changed codons are in bold.

Name Sequence1 Description

DegU fwd CGCCGCGGATCCATGACTAAAGTAAACATTGTTATT BamHI DegU rev CGCAATGGTACCTTATCTCATTTCTACCCAGCCATTTTT KpnI DegS fwd CGCCGCGGATCCATGAATAAAACAAAGATGGATTCC BamHI DegS rev CGCAATGGTACCTTAAAGAGATAACGGAACCTTAATCAT KpnI PrkC fwd GAAGATCTATGCTAATCGGCAAGCGGATCAGCGGGCG BglII PrkCtrunc rev AAAACTGCAGTTACAAAACCCACGGCCACTTTTTTCTTTTTGCCG PstI, amplification of aa 1–333 YabT fwd GAAGATCTATGATGAACGACGCTTTGACGAGTTTGGC BglII YabTtrunc rev AAAACTGCAGTTAGATAAGCGTTGTTTCAAATAACCCC PstI, amplification of aa 1–321 YbdM fwd CGGGATCCATGGCATTAAAACTTCTAAAAAAACTGC BamHI YbdM rev AAAACTGCAGTTATGTGACCGATTGAATGGCCCG PstI YbdM pHT fwd CGCGGATCCAAAGGAGGAAAACATATGGCATTAAAACTTCTAAAAAAACTGCTATTTGACC BamHI YbdM pHT rev AAAACTGCAGTTATGTGACCGATTGAATGGCCCGGTTTAGATCCTCG PstI PrkA fwd CGGGATCCATGGATATATTAAAGAAAATTGAAAAGTAC BamHI PrkA rev AAAACTGCAGTTATCGGTTCAGCAGGCTGCCG PstI RBS-gfp fwd CGGGATCCAAAGGAGGAAAACATATGTCTAAAGGTGAAGAACTG BamHI gfp rev CCATACATGTTTATTTATACAGCTCATGCATGC PciI degS NS1 fwd CGGATATCATCTCGTGTTCTCCCGCTTC EcoRV, anneals 263 bp upstream of degS degS NS2 rev GTCCAGCTGTTCATACTGCTGGCGTGACTGC PvuII, anneals 123 bp inside degS prkC_ MUT_fwd CCCAAGCTTAAAGATCCTTTTCATCGCTACG HindIII prkC_MUT_rev CGCCCGCGGGGTGACCGTGGCGCCTTCTTTGAC SacII yabT_MUT_fwd CCCAAGCTTATGCAATGGAATACATAAAAGGG HindIII yabT_MUT_rev CGCCCGCGGTTGAAGCAGCGGGTTTCCTTCG SacII ybdM_MUTfwd CCCAAGCTTGAATTCATCATAGACGGACAGG HindIII ybdM_MUTrev CGCCCGCGGCAGCAAGAATAACAGCGTTTCTCC SacII S76A fwd AAACCGTTTAGCCGAGGTCAGCCGTAATTTTCA S76A S76A rev GGCTGACCTCGGCTAAACGGTTTCTCGCATGGC S76A S76D fwd AAACCGTTTAGACGAGGTCAGCCGTAATTTTCA S76D S76D rev GGCTGACCTCGTCTAAACGGTTTCTCGCATGGC S76D degS NS1 rev AATCCAGCACTTAGGAATCCATCTTTGTTTTATTC K9Stop degS NS2 fwd GATGGATTCCTAAGTGCTGGATTCTATTTTGATG K9Stop PcomK fwd CGGAATTCTAAAGAATCCCCCCAATGCC EcoRI PcomK rev CGCGGATCCGTCTGTTTTCTGACTCATAT BamHI PyvcA fwd CGGAATTCGAACGCCAAGCGGAAATGCC EcoRI PyvcA rev CGCGGATCCCCTGTCAGGGCAAGTAATAAG BamHI

doi:10.1371/journal.pone.0014653.t002

? resuspended in 2 mL of Z-buffer (60 mM Na2HPO4 7H20, plating. The plasmid pDG268-neo [38] conferring neomycin ? 0.04 mM NaH2PO4 H20, 10 mM KCl, 1 mM MgSO4 and resistance was used as DNA for competence experiments. Results 50 mM b-mercaptoethanol, pH 7.0) and OD600 was measured. from three biological replicates are presented as % of competence 1 mL cell suspension was treated with 0.5 mg lysozyme for 5 min at in wild type and are average and standard deviation of three 30uC before adding 8 mL 10% Triton X-100 and incubating for transformations. For single cell analysis the cultures were additional 5 min. Reaction was started by addition of 100 mL of incubated for 105 min after dilution in GM2 at which time 4 mg/mL ONPG and stopped by addition of 1 mL of 0.5 M cultures were concentrated 10 fold and 5 mL were deposited on a Na2CO3. Miller units were calculated as described previously [45]. polylysine-coated glass slide (Thermo Scientific) and examined using a Xeiss Axioplan microscope equipped with a Kappa ACC 1 Competence assays condenser, a Zeiss Plan Neofluor 1006 objective and a Kappa To assess the competence of B. subtilis strains cells were DX2 HC-FW camera. Images were acquired using Kappa transformed according to the two-step protocol described by Imagebase Control 2.7.2 software. In the experiments 1600 to Yasbin et al. with the modification that 60 min after dilution in 9800 cells per strain were examined. For wild type cells about GM2 medium, 0.5 mL culture were transferred to three test tubes 5.4% were competent and values are given as % of wild type with containing 1 mg DNA and incubated an additional 90 min before standard deviation of two independent experiments.

PLoS ONE | www.plosone.org 9 February 2011 | Volume 6 | Issue 2 | e14653 Serine-Phosphorylation of DegS

Complex colony formation and incubated at 37uC. Swarm radii were measured at the times Cells were grown in LB shaking at 37uC to OD600 0.5 at which indicated in the figure. Plates were scanned about 1 hour after the point 5 mL culture was spotted on a dried MSgg plate (1.5% agar) swarm reached the edge of the plate using a standard HP office and incubated for 96 hours at 28uC. Colonies were measured and scanner. photographed using a SONY Cyber-shot DSC-T20 camera with close focus enabled. For each sample, a representative image from Acknowledgments 20 examined colonies is presented. We would like to thank Dan Kearns for providing the strain DS155. Swarming Author Contributions Cells were grown in LB to an OD600 of 0.5 at which time LB plates (0.7% agar) dried for 20 min in a fume hood (face up) where Conceived and designed the experiments: CJ IM. Performed the inoculated with 5 mL culture and dried an additional 10 minutes. experiments: CJ AK EOS IM. Analyzed the data: CJ AK EOS PRJ IM. Petri dishes were sealed with parafilm to avoid plates drying out Wrote the paper: CJ IM.

References 1. Hoch JA (2000) Two-component and phosphorelay signal transduction. Curr 23. Shah IM, Laaberki MH, Popham DL, Dworkin J (2008) A eukaryotic-like Ser/ Opin Microbiol 3: 165–170. Thr kinase signals bacteria to exit dormancy in response to peptidoglycan 2. Laub MT, Goulian M (2007) Specificity in two-component signal transduction fragments. Cell 135: 486–496. pathways. Annu Rev Genet 41: 121–145. 24. Petranovic D, Grangeasse C, Macek B, Abdillatef M, Gueguen-Chaignon V, et al. 3. Madec E, Stensballe A, Kjellstro¨m S, Cladie`re L, Obuchowski M, et al. (2003) (2009) Activation of Bacillus subtilis Ugd by the BY-Kinase PtkA Proceeds via Mass spectrometry and site-directed mutagenesis identify several autopho- Phosphorylation of Its Residue Tyrosine 70. J Mol Microbiol Biotechnol 17: 83–89. sphorylated residues required for the activity of PrkC, a Ser/Thr kinase from 25. Wang ST, Setlow B, Conlon EM, Lyon JL, Imamura D, et al. (2006) The Bacillus subtilis. J Mol Biol 330: 459–472. forespore line of gene expression in Bacillus subtilis. J Mol Biol 358: 16–37. 4. O’Hare HM, Durań R, Cervenãnsky C, Bellinzoni M, Wehenkel, et al. (2008) 26. Steil L, Serrano M, Henriques AO, Vo¨lker U (2005) Genome-wide analysis of Regulation of glutamate metabolism by protein kinases in mycobacteria. Mol temporally regulated and compartment-specific gene expression in sporulating Microbiol 70: 1408–1423. cells of Bacillus subtilis. Microbiology 151: 399–420. 5. Phalip V, Li JH, Zhang CC (2001) HstK, a cyanobacterial protein with both a 27. Rasmussen S, Nielsen HB, Jarmer H (2009) The transcriptionally active regions serine/threonine kinase domain and a histidine kinase domain: implication for in the genome of Bacillus subtilis. Mol Microbiol 73: 1043–1057. the mechanism of signal transduction. Biochem J 360: 639–644. 28. Mijakovic I, Poncet S, Boe¨l G, MazeÁ, Gillet S, et al. (2003) Transmembrane 6. Ulijasz AT, Falk SP, Weisblum B (2009) Phosphorylation of the RitR DNA- modulator-dependent bacterial tyrosine kinase activates UDP-glucose dehydro- binding domain by a Ser-Thr phosphokinase: implications for global gene genases. EMBO J 22: 4709–4718. regulation in the streptococci. Mol Microbiol 71: 382–90. 29. Wittekind M, Reizer J, Deutscher J, Saier MH, Klevit RE (1989) Common 7. Lin WJ, Walthers D, Connelly JE, Burnside K, Jewell KA, et al. (2009) structural changes accompany the functional inactivation of HPr by seryl Threonine phosphorylation prevents promoter DNA binding of the Group B phosphorylation or by serine to aspartate substitution. Biochemistry 28: Streptococcus response regulator CovR. Mol Microbiol 71: 1447–1795. 9908–9912. 8. Macek B, Mijakovic I, Olsen JV, Gnad F, Kumar C, et al. (2007) The serine/ 30. Hamoen LW, Venema G, Kuipers OP (2003) Controlling competence in Bacillus threonine/tyrosine phosphoproteome of the model bacterium Bacillus subtilis. subtilis: shared use of regulators. Microbiology 149: 9–17. Mol Cell Proteomics 6: 697–707. 31. Yasbin RE, Wilson GA, Young FE (1975) Transformation and transfection in 9. Msadek T, Kunst F, Henner D, Klier A, Rapoport G, et al. (1990) Signal lysogenic strains of Bacillus subtilis: evidence for selective induction of prophage transduction pathway controlling synthesis of a class of degradative enzymes in in competent cells. J Bacteriol 121: 296–304. Bacillus subtilis: expression of the regulatory genes and analysis of mutations in 32. Maamar H, Dubnau D (2005) Bistability in the Bacillus subtilis K-state (competence) degS and degU. J Bacteriol 172: 824–834. system requires a positive feedback loop. Mol Microbiol 56: 615–624. 33. Kearns DB, Chu F, Rudner R, Losick R (2004) Genes governing swarming in 10. Ogura M, Yamaguchi H, Yoshida K-I, Fujita Y, Tanaka T (2001) DNA Bacillus subtilis and evidence for a phase variation mechanism controlling surface microarray analysis of Bacillus subtilis DegU, ComA and PhoP regulons: an motility. Mol Microbiol 52: 357–369. approach to comprehensive analysis of B. subtilis two-component regulatory 34. Amati G, Bisicchia P, Galizzi A (2004) DegU-P represses expression of the systems. Nucleic acids res 29: 3804–3813. motility fla-che operon in Bacillus subtilis. J Bacteriol 186: 6003–6014. 11. Ma¨der U, Antelmann H, Buder T, Dahl MK, Hecker M, et al. (2002) Bacillus 35. Amrein KE, Takcs B, Stieger M, Molnos J, Flint NA, et al. (1995) Purification subtilis functional genomics: genome-wide analysis of the DegS-DegU regulon by and characterization of recombinant human p50csk protein-tyrosine kinase from transcriptomics and proteomics. Mol Genet Genomics 268: 455–467. an Escherichia coli expression system overproducing the bacterial chaperones 12. Verhamme DT, Kiley TB, Stanley-Wall NR (2007) DegU co-ordinates GroES and GroEL. Proc Natl Acad Sci U S A 92: 1048–1052. multicellular behaviour exhibited by Bacillus subtilis. Mol Microbiol 65: 554–568. 36. Branda SS, Gonza´lez-Pastor JE, Ben-Yehuda S, Losick R, Kolter R (2001) 13. Kobayashi K (2007) Gradual activation of the response regulator DegU controls Fruiting body formation by Bacillus subtilis. Proc Natl Acad Sci U S A 98: serial expression of genes for flagellum formation and biofilm formation in 11621–11626. Bacillus subtilis. Mol Microbiol 66: 395–409. 37. Kunst F, Ogasawara N, Moszer I, Albertini AM, Alloni G, et al. (1997) The 14. Ogura M, Tsukahara K (2010) Autoregulation of the Bacillus subtilis response complete genome sequence of the gram-positive bacterium Bacillus subtilis. regulator gene degU is coupled with the proteolysis of DegU-P by ClpCP. Mol Nature 390: 249–256. Microbiol 75: 1244–1259. 38. Christiansen LC, Schou S, Nygaard P, Saxild HH (1997) Xanthine Metabolism 15. Veening JW, Igoshin OA, Eijlander RT, Nijland R, Hamoen LW, et al. (2008) in Bacillus subtilis: Characterization of the xpt-pbuX Operon and Evidence for Transient heterogeneity in extracellular protease production by Bacillus subtilis. Purine- and Nitrogen-Controlled Expression of Genes Involved in Xanthine Mol Syst Biol 4: 184. Salvage and Catabolism. J Bacteriol 179: 2540–2550. 16. Yasumura A, Abe S, Tanaka T (2008) Involvement of Nitrogen Regulation in 39. Østergaard H, Henriksen A, Hansen FG, Winther JR (2001) Shedding light on Bacillus subtilis degU Expression. J Bacteriol 190: 5162–5171. disulfide bond formation: engineering a redox switch in green fluorescent 17. Dervyn E, Noirot-Gros M-F, Mervelet P, McGovern S, Ehrlich SD, et al. (2004) protein. EMBO J 20: 5853–5862. The bacterial condensin/cohesin-like protein complex acts in DNA repair and 40. Jarmer H, Berka R, Knudsen S, Saxild HH (2002) Transcriptome analysis regulation of gene expression. Mol Microbiol 51: 1629–1640. documents induced competence of Bacillus subtilis during nitrogen limiting 18. Ogura M, Shimane K, Asai K, Ogasawara N, Tanaka T (2003) Binding of response conditions. FEMS Microbiol Lett 206: 197–200. regulator DegU to the aprE promoter is inhibited by RapG, which is counteracted 41. Arantes O, Lereclus D (1991) Construction of cloning vectors for Bacillus by extracellular PhrG in Bacillus subtilis. Mol Microbiol 49: 1685–1697. thuringiensis. Gene 108: 115–119. 19. Mukai K, Kawata-Mukai M, Tanaka T (1992) Stabilization of Phosphorylated 42. Vagner V, Dervyn E, Ehrlich SD (1998) A vector for systematic gene Bacillus subtilis DegU by DegR. J Bacteriol 174: 7954–7962. inactivation in Bacillus subtilis. Microbiology 144: 3097–3104. 20. Ogura M, Tanaka T (1997) Bacillus subtilis ComK negatively regulates degR 43. Maguin E, Pre´vost H, Ehrlich SD, Gruss A (1996) Efficient insertional gene expression. Mol Gen Genet 254: 157–165. mutagenesis in lactococci and other gram-positive bacteria. J Bacteriol 178: 21. Stock AM, Robinson VL, Goudreau PN (2000) Two-component signal 931–935. transduction. Annu Rev Biochem 69: 183–215. 44. Chang S, Cohen SN (1979) High frequency transformation of Bacillus subtilis 22. Leonard CJ, Aravind L, Koonin EV (1998) Novel families of putative protein protoplasts by plasmid DNA. Mol Gen Genet 168: 111–115. kinases in bacteria and archaea: evolution of the ‘‘eukaryotic’’ protein kinase 45. Miller J (1972) Experiments in Molecular Genetics. Cold Spring HarborNY: superfamily. Genome Res 8: 1038–1047. Cold Spring Harbor Laboratory.

PLoS ONE | www.plosone.org 10 February 2011 | Volume 6 | Issue 2 | e14653

Chapter 3

Phosphorylation effect of serine/threonine kinase YabT on the recombinase RecA

1 Bacillus subtilis serine/threonines kinase YabT phosphorylates the recombinase RecA

2 Short title: Bacillus subtilis YabT phosphorylates RecA

1,¶ 1,¶ 1 1 1 4 Vladimir Bidnenko , Lei Shi , Ahasanul Kobir , Magali Ventroux , Nathalie Pigeonneau ,

5 Alain Trubuil2, Marie-Françoise Noirot-Gros1,* and Ivan Mijakovic1,*

7 1INRA, UMR1319, F-78350 Jouy-en-Josas, France

8 2INRA, Unité de recherche Mathématiques et Informatique Appliquées, FR-78350 Jouy-en-

9 Josas, France

10 ¶These authors contributed equally to this work.

12 *To whom correspondence should be addressed:

13 Prof. Ivan Mijakovic, PhD

14 MICALIS UMR 1319, INRA-AgroParisTech, CBAI

15 F-78850 Thiverval-Grignon, FRANCE

16 E-mail: [email protected], Tel: +33 1 30 81 45 40, Fax: +33 1 30 81 54 57

17 Marie-Françoise Noirot-Gros, PhD

18 MICALIS UMR 1319, INRA-AgroParisTech, Domaine de Vilvert

19 FR-78351 Jouy-en-Josas, FRANCE

20 E-mail: [email protected], Tel: +33 1 34 65 25 19, Fax: +33 1 34 65 72 44

23 ABSTRACT

24 At the onset of sporulation, Bacillus subtilis cells synthesize a serine/threonine kinase YabT

25 that belongs to the Hanks family of kinases. Our characterization of YabT revealed some

26 interesting idiosyncratic features. Namely, YabT exhibited a clear septal localization and it

27 was activated by binding DNA, via a novel DNA-binding motif juxtaposed to the kinase

28 domain. In vitro, YabT phosphorylated B. subtilis recombinase RecA, specifically at the

29 residue serine 2. YabT and RecA interacted in a two-hybrid assay. In vivo, phosphorylation of

30 RecA promoted the formation of RecA foci at the onset of spore development. Such RecA

31 foci have previously been shown to associate with DNA lesions and the replacement of RecA

32 by a non-phosphorylatable derivative, or inactivation of YabT, lead to a drop in viable spores

33 produced in the presence of exogenous DNA damage. This finding suggests that

34 developmental stage-dependent phosphorylation of B. subtilis RecA protein may play a

35 similar role to Rad51 phosphorylation, which leads to its recruitment to lesion sites in

36 Eukarya. The molecular mechanism by which RecA phosphorylation promotes focus

37 formation remains to be elucidated.

39 INTRODUCTION

40 Protein phosphorylation is a wide-spread modification that allows rapid and reversible

41 regulation of protein activity [1]. It is involved in signal transduction both in Eukarya [2] and

42 Bacteria [3]. The average abundance of phosphate attached to bacterial proteins is estimated

43 to be 80-times lower compared to Eukarya [4], which partly accounts for the fact that

44 phosphorylation of bacterial proteins is often documented much later than that of their

45 eukaryal counterparts. Bacteria and Eukarya share the same super-family of Hanks-type

46 protein kinases capable of phosphorylating proteins on serine/threonine and tyrosine in

47 Eukarya [5], and on serine/threonine in Bacteria [6]. In addition, bacteria possess BY-kinases

48 for tyrosine phosphorylation [7], and two-component kinases for histidine/aspartate

49 phosphorylation [8]. In Eukarya, phosphorylation often participates in regulating the function

50 of proteins involved in DNA damage repair [9]. In mammals, the activity of the DNA

51 recombinase Rad51 [10] is known to be regulated by tyrosine phosphorylation, catalyzed by

52 kinases that are activated in response to DNA damage [11,12]. DNA recombinases participate

53 in homologous recombination and recombinational repair of DNA double-strand breaks in all

54 living forms [13]. In Bacteria, Rad51 homologues are known as RecA [14]. Proteins

55 belonging to the RecA family are single-stranded (ss) DNA-binding ATPases that promote

56 homologous DNA strand exchange through formation of a dynamic nucleoprotein filament

57 [15]. Participation of RecA and Rad51 in damage repair phenomena has been extensively

58 studied in exponentially growing cells. Upon DNA damage, RecA and Rad51 localize as

59 multiple foci or threads, assembled at the lesion sites [16,17]. However, while eukaryal Rad51

60 can be activated via phosphorylation in response to DNA damage, in Bacteria the activation

61 of DNA damage repair processes occurs essentially at the transcriptional level. This process

62 depends on RecA co-protease activity towards LexA repressor, controlling cellular SOS

63 response to DNA damage [18]. Reports of phosphorylation of bacterial proteins involved in

64 DNA metabolism are very scarce. Interestingly, phosphorylation of a bacterial RecA on the

65 residues serine 2 was for the first time detected in our recent proteomic study on B. subtilis

66 [19].

67 In the present study, we wanted to identify the B. subtilis kinase(s) responsible for

68 RecA phosphorylation. Since the phosphorylation takes place on a serine residue, we turned

69 to the characterized B. subtilis Hanks-type kinases (PrkC, PrkD and YabT) [20]. These

70 kinases are all known to be expressed during transition and stationary phase [21]. When

71 exposed to lack of nutrients, the ultimate stationary phase response of B. subtilis is the

72 morphological differentiation of a highly resistant life form called the spore. The spore

73 preserves the chromosome in a resistant dormant cell, which germinates into a vegetative

74 bacterium once the favorable growth conditions return [22]. Spore development is ensured by

75 a spatio-temporal program which coordinates the sequential activation of hundreds of specific

76 genes. Entry into sporulation is controlled by the master gene regulator Spo0A, which is

77 triggered by a complex protein phosphorelay [23]. Among the B. subtilis Hanks-kinases, the

78 best characterized is the PrkC, which participates in spore germination [24]. PrkD (YbdM)

79 has recently been shown to phosphorylate and thus activate the histidine kinase DegS,

80 contributing to increased levels of DegU~P [23]. YabT could also phosphorylate DegS in

81 vitro, albeit weekly and non-specifically [25], which left it as the sole B. subtilis Hanks kinase

82 without a known physiological substrate. Here we demonstrate that YabT phosphorylates the

83 B. subtilis RecA specifically at the residue serine 2. Moreover, we demonstrate a novel DNA-

84 binding motif juxtaposed to the YabT kinase domain, which allows this kinase to be activated

85 by DNA binding. Since YabT is synthesized at the onset of sporulation, we examined the

86 behavior of non-phosphorylatable and phospho-mimetic mutants of RecA during the window

87 of yabT expression. Behavior of these mutants lead us to suspect that phosphorylation affects

88 the participation of RecA in DNA lesion repair during spore development.

91 RESULTS AND DISCUSSION

93 YabT is a DNA-activated kinase that phosphorylates RecA in vitro

94 Phosphorylation of B. subtilis RecA at the residue serine 2 reported recently [19] opened up

95 the possibility that this recombinase might also be controlled by phosphorylation, like the

96 eukaryal Rad51. To identify the kinase that phosphorylates RecA, we purified 6xHis-tagged

97 RecA and the three B. subtilis Hanks-type kinases mentioned above: PrkC, PrkD and YabT

98 [24,25]. We used these proteins to perform an in vitro phosphorylation assay with 32P-γ-ATP.

99 YabT was the only kinase that efficiently phosphorylated RecA in vitro. The intensity of the

100 RecA phosphorylation signal (incorporation of 32P) was comparable to that of

101 autophosphorylated YabT and increased over time (Figure 1A, left panel). YabT-dependent

102 phosphorylation was specific for the RecA residue serine 2, since it was abolished by

103 replacing this residue with non-phosphorylatable alanine in the point-mutated RecA S2A

104 (Figure 1A, right panel). PrkC was unable to phosphorylate RecA in vitro, whereas PrkD

105 exhibited weak RecA phosphorylation that was not specific for serine 2 (data not shown).

106 Such non-specific phosphorylation has been reported for other substrates of Hanks-type

107 kinases [25], and this sort of substrate promiscuity is a generally acknowledged feature of this

108 kinase family [6]. Nevertheless, the in vitro phosphorylation data clearly established YabT as

109 the main kinase of RecA, specific for its residue serine 2. The strict in vivo confirmation for

110 the kinase-substrate relationships requires an exhaustive study by quantitative and site-

111 specific mass spectrometry phosphoproteomics, performed on different kinase knockouts.

112 Such a study is underway in our group, but is not within the scope of this paper.

113 The structure of YabT is unusual for a Hanks-type kinase. Proteins of this family

114 usually comprise a membrane-spanning helix, connecting the extracellular sensing domain to

115 the intracellular catalytic domain (Figure 1B). Ligand binding by the sensing domains usually

116 leads to kinase activation by cross-phosphorylation of kinase subunits [6]. Interestingly, YabT

117 possesses the transmembrane helix but lacks the external sensing domain. This suggests that

118 the activating signal for YabT might come from the cytosol. In the cytosolic part of YabT,

119 next to the catalytic domain, there is a region rich in lysine and arginine residues (putative

120 DNA binding site), absent in its homologues (Figure 1B). We therefore tested the ability of

121 YabT to bind DNA in vitro. Unlike any other characterized bacterial Hanks kinase, YabT was

122 capable of binding ssDNA and double stranded (ds) DNA (Figure 1C). This binding was not

123 sequence specific, and could be achieved with DNA fragments varying from ten to several

124 hundred bases (data not shown). Interestingly, the presence of both dsDNA and ssDNA

125 enhanced the phosphorylation activity of YabT in vitro (Figure 1D). To pin-point the putative

126 DNA-binding region we made two deletions, retaining residues 1-284 in YabTΔ1, and

127 residues 1-230 in YabTΔ2 (Figure 1B). YabTΔ1 preserves essentially the entire kinase

128 domain, and misses only the positively-charged residues downstream, whereas YabTΔ2

129 deletes the entire region of positively charged residues, thus inevitably eliminating a part of

130 the kinase domain. Both YabTΔ1 and YabTΔ2 have almost completely lost the ability to bind

131 DNA (Figure 1E). YabTΔ2 has lost all kinase activity, irrespective of presence of DNA

132 (Figure 1F). However, YabTΔ1 retained wild-type level of kinase activity in the absence of

133 DNA, but lost the ability to be activated by DNA (Figure 1F). This result suggests that the

134 lysine/arginine rich region of YabT between residues 284-315 is sufficient to bind DNA and

135 activate the kinase function.

136

137 YabT is expressed during sporulation, interacts with RecA in vivo and localizes to the

138 septum

139 YabT is a transmemembrane protein kinase, activated by binding DNA. In vitro, the

140 activating effect can be achieved with ss- and dsDNA. It would be tempting to speculate that

141 in vivo YabT might be activated by stretches of ssDNA at the lesion sites, like its eukaryal

142 counterpart, but for now this remains only a speculation. In order to explore when and where

143 YabT encounters DNA in the cell we shifted our attention to in vivo assays. YabT gene was

144 previously reported to be expressed in a SigF-dependent manner [26]. The transcription of

145 yabT peaks out 3 hours after the onset of sporulation (designated as T0), while the expression

146 of RecA slowly declines during this period (Figure 2A) [21]. We also checked the recA and

147 yabT expression by Western blot during the same period, (Figure 2B), and found similar

148 results. The YabT protein was not detectable at the initiation of sporulation, but appeared 2

149 hours later (at T2) and kept accumulating towards T5. RecA levels were constant during the

150 entire period (T0-T5). Next we wanted to verify that YabT can interact with its substrate

151 RecA in vivo, so we performed a yeast-based two hybrid assay. The growth on selective

152 medium was detected only when RecA fusion to the activation domain of Gal4 and YabT

153 fusion to the DNA binding domain of Gal4 were both present in the cell, clearly confirming

154 the interaction (Figure 2C). This interaction requires the integrity of RecA, since it was

155 abolished by deletion of either N- or C-terminal domains of RecA, as well as by point

156 mutations at serine 2. Finally, to pin-point the sub-cellular localization of YabT, we fused it

157 with the green fluorescent protein. Between T2-T3, which is the expression peak of yabT, the

158 GFP-YabT exhibited a clear septal localization (Figure 2D). These data suggest that the

159 kinase YabT is synthesized specifically at the onset of sporulation, and localizes to the

160 septum, probably anchored to the membrane via its transmembrane helix. There it is

161 positioned to encounter the DNA which is entering the spore, and this encounter would be

162 expected to activate the kinase, as demonstrated above (Figure 1D). Thereupon, YabT can

163 interact with RecA and phosphorylate it at the residue serine 2.

164

165 RecA phosphorylation has no influence on recombination and repair during vegetative

166 growth

167 To probe for consequences of RecA phosphorylation, we constructed a ΔyabT mutant, and as

168 additional controls, the two RecA point-mutant strains: recA S2A (non-phosphorylatable) and

169 recA S2D (phospho-mimetic). Phospho-mimetic mutants have been successfully used in the

170 past [27], and their use remains justified especially in bacteria where occupancy of the

171 phosphorylation sites is extremely low [4]. However, before making any conclusions based on

172 such mutants, it is essential to rule out artifacts due to potential destabilization of the mutated

173 protein. Using an anti-RecA antibody, we have established that RecA levels remain the same

174 and comparable to wild type in all the strains we used: ΔyabT, recA S2A and recA S2D

175 (Figure 3A). Furthermore, the RecA derivative proteins mutated at Serine 2 retained their

176 ability to self-interact in a yeast two hybrid assay, suggesting that they can potentially form

177 multimer assemblies (Figure 2C). Before focusing on spore development (the expression peak

178 of yabT) we wanted to check whether recA S2A and recA S2D mutations would have any

179 effect on the major known roles of RecA: the homologous recombination and DNA repair.

180 During vegetative growth all strains exhibited the same resistance to DNA damage as the wild

181 type, and their homologous recombination was fully functional (Figure S1).

182

183 RecA phosphorylation is important for spore formation under DNA-damaging

184 conditions

185 Next we turned to sporulation. Inactivation of recA has been shown to reduce sporulation

186 efficiency of B. subtilis, and it provoked a defect in prespore nucleoid condensation [28].

187 About 17% of all ΔrecA cells have been reported to exhibit elongated nucleotides. These have

188 been argued to have arisen due to accumulated mutations stalling the replication forks [28].

189 RecA is known to assemble in foci at stalled replication forks [29], where it presumably

190 assists in repair and restart of replication. Our strains ΔyabT, recA S2A and recA S2D retained

191 the total counts of heat resistant spores comparable to the wild type 20 hours after the onset of

192 sporulation (data not shown). This indicated that in the absence of exogenous DNA damaging

193 agents, phosphorylation of RecA does not play a major role in spore formation.

194 In order to better understand the role of RecA during spore development, we decided

195 to follow its localization using a GFP-RecA fusion. Several GFP-RecA fusions optimized for

196 B. subtilis have been reported previously [16, 29, 30], and none of them are entirely free of

197 artifacts. We thus tested a chimeric RecA-GFP C-terminally fused to an engineered

198 monomeric variant of the GFP and reported to be proficient for DNA repair [29] as well as a

199 N-terminal GFP-RecA fusion [30]. In both cases, cells expressing these fusions as the sole

200 source of RecA remained affected for survival under severe DNA damaging conditions during

201 vegetative growth [29, 30]. However, this problem can be circumvented when the recA

202 fusions to the gfp are co-expressed with a wild type genomic copy of recA [29, 30] (Figure S2

203 A). Such cells are proficient in recA-mediated recombination and repair during vegetative

204 growth and are not affected in their ability to enter sporulation upon starvation. In such

205 background, we induced the gfp-recA fusion at the onset sporulation as a means of monitoring

206 its sub-cellular localization at this specific stage of the development. However, when induced

207 concomitant to sporulation, the C-terminal RecA-GFP fusion produced aggregates in most

208 cells (data not shown). By contrast, the N-terminal GFP-RecA fusion gave rise to discrete foci

209 in a subset of cells and we decided to continue with this strain. It should be pointed out again

210 that this strain retains wild-type levers of survival under severe DNA damage (Figure S2 A).

211 The constitutive genomic recA allele is present in the cell, and the gfp-recA inducible fusion is

212 co-expressed from the amyE locus (recA+ amyE::Pxyl::gfp-recA). The induced GFP-RecA

213 has intracellular levels similar to the wild type RecA expressed from the endogenous recA

214 allele (Figure S2B). This construct has been transferred in the ΔyabT strain. The non-

215 phosphorylatable S2A and phosphomimetic S2D mutations were also inserted in the gfp-recA

216 fusion strain and co-expressed together with their cognate recA S2A and recA S2D genomic

217 copies. Next we compared the localization of RecA in mutant derivatives and ΔyabT

218 background to wild type RecA in sporulating cells. We found that cell and nucleotide sizes

219 were normal in all samples, which was expected, since the sporulation efficiency was at the

220 wild type levels in all strains. GFP-RecA foci were present in a subset of cells (Figure 3B). In

221 the wild type strain, these foci were present in about 15-20% cells. Interestingly, the the sub-

222 population of wild type cells that present RecA foci in absence of exogenous DNA damage is

223 about the same size as the sub-population of cells presenting elongated nucleotides in the

224 ΔrecA strain (17%) [28]. It would be tempting to speculate that this is the sub-population with

225 stalled replication forks, resulting in aborted sporulation in ΔrecA strain, and being repaired in

226 the wild type. However, without further evidence this remains only a speculation.

227 Surprisingly, the number of foci was slightly reduced in ΔyabT and recA S2A, and

228 was almost tripled with respect to the wild type in the phospho-mimetic recA S2D strain

229 (Figure 3C). In the absence of exogenous DNA damaging agents, and given that the overall

230 rate of DNA damage is the same in all strains, this could only mean that RecA

231 phosphorylation increases the RecA propensity to form foci, which have been previously

232 shown to occur at lesion sites [16,17]. Under the normal sporulation conditions, this feature

233 did not affect spore survival, so next we assessed the viability of spores in our mutant strains

234 that were treated with mitomycin at the onset of spore development. Spore survival was

235 expressed as the ratio of heat-resistant spore counts from mitomycin-treated and non-treated

236 culture (Figure 4A). The recA S2D spores exhibited similar viability to the wild type, but recA

237 S2A and ΔyabT spores exhibited about 50% less survival. Thus the strains that cannot

238 produce RecA phosphorylated at serine 2 also exhibited a drop in spore viability when

239 exogenous DNA damage was present. The morphology of foci changed upon inducing

240 exogenous DNA damage, shifting from clearly defined spots to thread-like structures,

241 probably reflecting recruitment of RecA to multiple lesion sites (Figure 4B). The

242 transformation of RecA foci under severe DNA damage further supports the notion that these

243 assemblies are indeed a result of interaction between RecA and DNA lesions.

244 Given the YabT specificity for phosphorylating RecA in vitro, the yabT expression

245 profile, its septal-like localization and ability to be activated by DNA, we propose that YabT

246 is the primary kinase responsible for phosphorylating RecA and promoting formation of its

247 foci at the lesion sites during spore development. The activation mode of YabT is reminiscent

248 of the eukaryal C-Abl kinase which phosphorylates Rad51 and is activated by associating

249 with DNA [31]. Another DNA damage-responsive kinase, Mec1, phosphorylates Rad51 at

250 serine 192, directly affecting its ATPase function, and subsequently its role in damage repair

251 [32].

252

253 Persistent RecA foci coincide with absence of sporulation

254 The RecA foci are formed in about 15-20% of wild type cells at the onset of sporulation

255 (around T1-T2) and by the time the spore development completes around T6, they disappear

256 in most cells. However, a closer examination of B. subtilis cells with foci remaining at T6

257 revealed one interesting feature. None of the mother cells that have successfully produced a

258 spore contained the RecA focus. Foci that persist at T6 are found exclusively in the cells that

259 have not produced mature spores (Figure 5A). This suggested that persistent RecA foci and

260 accomplished spore development might be mutually exclusive. Persistent foci have been

261 previously described in exponentially growing cells as associated to replication forks stalled

262 at irreparable lesions [16,17,29]. It is therefore tempting to speculate that persistent RecA foci

263 correspond to stalled forks or otherwise irreparable lesion that prevent the completion of spore

264 development. If this is true, then exogenous DNA damage should lead to more persistent foci

265 at T6 and less spores. To test this hypothesis, we examined the T6 samples of cells that were

266 treated with mitomycin at T1 (Figure 5B). In the mitomycin-treated culture, the ratio of

267 mother cells with RecA foci to cells with mature spores at T6 inverted sharply. While the

268 spores and foci remained mutually exclusive, the majority of cells now contained RecA

269 assemblies and the fraction of mature spores diminished strongly (Figure 5C). This finding

270 suggests a link between RecA assemblies persistent at T6, irreparable DNA lesions and

271 failure to complete a mature spore. In this context, phosphorylation of RecA that increases the

272 propensity of foci formation could be seen as a contributory mechanism. More work will

273 clearly be required to elucidate the underlying mechanisms of this link.

274

275 Conclusions

276 In B. subtilis, the serine/threonine kinase YabT, devoid of extracellular sensing domain, is

277 expressed specifically during spore development and exhibits septal localization. Our in vitro

278 data show that YabT auto-activates upon binding DNA, and specifically phosphorylates RecA

279 at the residue serine 2. In vivo, RecA and YabT interact, and phosphorylation promotes the

280 formation of RecA foci. The exact mechanism of RecA recruitment to lesion sites, and the

281 formation and composition of RecA foci, are not well understood. The exact role of

282 phosphorylation in that process is far from clear, and we will devote our attention to

283 dissecting this mechanism in subsequent studies. Be it as it may, when RecA is replaced by a

284 non-phosphorylatable derivative, or when YabT is absent, the non phosphorylated form of

285 RecA is impaired in focus formation, leading to a drop in viable spores upon exogenous DNA

286 damage. If the RecA focus and the recruited recombinational/repair machinery are

287 unsuccessful in repairing the lesion and/or restarting the replication, the focus remains until

288 T6. A persistent RecA focus at T6 coincides with abolished sporulation.

289 The absence of a YabT orthologue and the RecA residue S2 in E. coli and other non-

290 sporulating bacteria (while both YabT and S2 of RecA are conserved in the majority of

291 Bacilli) corroborates the idea that this mechanism evolved for the specific task of ensuring

292 chromosome integrity during spore development in this genus. Parallels that can be drawn

293 between YabT on one hand and the eukaryal kinases C-Abl [31] and Mec1 [32] on the other

294 support the notion that the mechanisms governing bacterial development share similarities

295 with their counterparts in Eukarya, where protein phosphorylation is commonplace. Thus

296 RecA shares not only the functional similarity with its eukaryal homologue Rad51, but also

297 similarity of regulation via post-translational modifications.

298

299 MATERIALS AND METHODS

300

301 Strain construction and growth conditions

302 Cells were routinely grown in LB media containing, when needed, spectinomycin 60 µg/ml,

303 phleomycin 2 µg/ml, neomycin 5 µg/ml, chloramphenicol 7 µg/ml, erythromycin 0.5 µg/ml,

304 and ampicillin 100 µg/ml. E. coli TG1 was used for plasmids construction. B. subtilis strains

305 used in the study are TF8 derivatives [33] (Table 1). The primers used for recA mutagenesis

306 are listed in Table S1. The primers pairs mra1 + mra3R and mra2 + mra3F were used to

307 amplify the DNA fragments containing the parts of recAS2A gene and the flanking regions.

308 Mra1 + mra4R and mra2 + mra4F were used for recAS2D. Mra5 + mra7F and mra6 + mra7R

309 were used to obtain the fragments for yabT knockout. The primers uniGFP and mra8, mra9

310 and mra10, were used to obtain recA, recAS2A, and recAS2D, respectively. All recA versions

311 were cloned between EcoRI and BamHI sites in pSG1729 [34] to get N-terminal GFP fusions

312 proteins. Primers pyabTApa and pyabTSal were used to amplify the yabT gene, which was

313 cloned between ApaI and SalI sites in pSG1729 to obtain N-terminal yabT-GFP fusion at the

314 amyE locus. The fusion of yabT gene with SPA tag was obtained by amplification of the C-

315 terminal part of yabT with primers pyabTBam and pyabTNco and its cloning between BglII

316 and NcoI sites in pMUTIN-SPA [35]. The insertion cassette encoding the phleomycin-

317 resistance gene and a counter-selectable marker was flanked by the mutagenized recA

318 fragments in direct orientation and transformed into BS33 cells with selection at phleomycin.

319 Finally, the cells in which the cassette was lost due to recombination between the direct

320 repeats were isolated by counter-selection and loss of phleomycin resistance. The knock-out

321 yabT mutant was constructed in similar manner. The N-terminal fusions of RecA, RecAS2A,

322 RecAS2D and YabT proteins with GFP were constructed at the chromosomal amyE locus

323 using the plasmid pSG1729 [36]. For protein purification, RecA_wt forward, RecA_S2A

324 forward and RecA_S2D forward primers, were used with RecA reverse primer to obtain

325 respective recA versions, whereas kinase gene-specific primers were used for amplifying

326 kinase genes. All PCR fragments were cloned in pQE30 to get the 6xHis-tag fusion proteins.

327

328 Sporulation assay

329 Cells grown over-night on the solid DSM medium [37], were inoculated in the preheated

330 liquid DSM at OD600 0.1 and incubated at 37°C until OD600 1.5. From this point (taken as T0)

331 samples were grown for 20 h and plated in dilutions on LB. Half of the material was heated at

332 80°C (10 min) before plating. Colonies were counted after 36 hours of incubation at 37°C,

333 and the percentage of spores was calculated as the ratio of colonies forming units in heated

334 and unheated samples. The growth curves of outgrowing cultures were the same for all

335 strains. For mitomycin treatment, spores were grown as described previously [38]. At T1, 20

336 ng/ml mitomycin C (final concentration) was added to a half of the culture. At T7, both

337 treated and untreated cultures were analyzed for spore formation as above.

338

339 Synthesis and purification of affinity-tagged proteins and protein phosphorylation assay

340 All of the overexpressed genes: yabT (soluble cytosolic domain), yabTΔ1, yabTΔ2, prkD,

341 prkA, prkC (soluble cytosolic domain), recA and its point-mutated versions (mutagenic

342 forward primer) were cloned in the pQE-30 vector (Qiagen) (primers in Table S1) to

343 synthesize N-terminal His6 fusion proteins. Protein purification, phosphorylation assay and

344 signal visualization was performed as described [39]. Protein concentrations in assays are

345 specified in figure legends.

346

347 Electrophoretic mobility shift assays

348 The electrophoretic mobility shift assays were performed in the reactions containing 25 mM

349 Tris-HCl, pH 7.5, 50 mM NaCl, 5% glycerol, 1 mM DTT, 10 mM MgCl2, 50 µg/ml BSA, 1

350 mM ATP, 1.5 µM 140 nucleotide-long ssDNA and protein as indicated in the figure legend.

351 Reactions were incubated at 37 Ԩ for 30 min, and analyzed by gel electrophoresis in 0.8%

352 agarose with Ethidium Bromide staining.

353

354 Induction of the GFP- fusions studies during sporulation

355 Sporulation was initiated as described [40]. For each strain, an aliquot of 100 µl of

356 exponentially growing cells (LB at 37°C) was spread onto DSM plates, and grown over-night

357 at 30°C. Colonies were resuspended in liquid DSM supplemented with appropriate antibiotic

358 and OD600 adjusted to ~0.1. Cells were then grown at 37°C. When reaching stationary phase

359 0.5 % xylose was added to induce the expression of gfp-recA (time T0). Samples were taken

360 at time T3 and examined by fluorescence microscopy.

361

362 Fluorescence Microscopy

363 Cells were grown in DSM medium, rinsed in PBS and mounted on 1.2% agarose pads. When

364 required, cells were stained with DAPI to visualize the nucleoid, and with FM4–64

365 (Molecular Probes) to visualize the cell membrane. When required, 25 µg/ml of mitomycin

366 was added at T1. Fluorescence microscopy was performed on a Leica DMR2A using a 100

367 UplanAPO objective with an aperture of 1.35 and equipped with CoolSnap HQ camera

368 (Roper Scientific). System control and image processing were performed using MetaMorph

369 software. The indicated counts of cells were obtained from two to four independent

370 experiments performed on over 500 cells per strain.

371

372 Western blotting

373 The crude cell extracts were prepared as described [35], standardized using Bradford assay

374 and run on SDS-PAGE (12% polyacrylamide). RecA and GFP-RecA proteins were visualized

375 using the primary rabbit serum against the E. coli RecA (S. Marsin, CEA, France; working

376 dilution 1:5000) and the secondary goat peroxidise-coupled anti-rabbit IgG (Sigma; dilution

377 1:10000). The SPA-tagged YabT was visualized using the primary mouse ANTI-FLAG M2

378 monoclonal antibodies (Sigma; dilution 1:5000) and the secondary goat peroxidise-coupled

379 anti-mouse IgG antibodies (Sigma; dilution 1:20000).

380

381 Yeast two hybrid

382 The yeast two hybrid phenotypic assay for YabT-RecA interaction was performed as

383 described previously [41]. Briefly, the following gene fusions were produced: recA with the

384 activating domain of Gal4, and yabT with the DNA-binding domain of Gal4. Resulting

385 plasmids were inserted in yeast haploid cells and interacting phenotypes were screened for

386 ability to grow on the selective medium (-LUH).

387

388 ACKNOWLEDGEMENTS

389

390 We are grateful to Stéphanie Marsin (CEA, France) for the anti-RecA antiserum. We would

391 like to dedicate the paper to the memory of Mirjana Petranovic, for her contribution to the

392 field of bacterial DNA recombination.

393

394 REFERENCES

395

396 1. Cohen P (2000) The regulation of protein function by multisite phosphorylation--a 25

397 year update. Trends Biochem Sci 25: 596-601.

398 2. Deribe YL, Pawson T, Dikic I (2010) Post-translational modifications in signal

399 integration. Nat Struct Mol Biol 17: 666-672.

400 3. Kobir A, Shi L, Boskovic A, Grangeasse C, Franjevic D, Mijakovic I (2011) Protein

401 phosphorylation in bacterial signal transduction. Biochim Biophys Acta 1810: 989-994.

402 4. Kruger R, Kubler D, Pallisse R, Burkovski A, Lehmann WD (2006) Protein and

403 proteome phosphorylation stoichiometry analysis by element mass spectrometry. Anal

404 Chem 78: 1987-1994.

405 5. Leonard CJ, Aravind L, Koonin EV (1998) Novel families of putative protein kinases in

406 bacteria and archaea: evolution of the "eukaryotic" protein kinase superfamily. Genome

407 Res 8: 1038-1047.

408 6. Pereira SF, Goss L, Dworkin J (2011) Eukaryote-like serine/threonine kinases and

409 phosphatases in bacteria. Microbiol Mol Biol Rev 75: 192-212.

410 7. Grangeasse C, Cozzone AJ, Deutscher J, Mijakovic I (2007) Tyrosine phosphorylation:

411 an emerging regulatory device of bacterial physiology. Trends Biochem Sci 32: 86-94.

412 8. Goulian M (2010) Two-component signaling circuit structure and properties. Curr Opin

413 Microbiol 13: 184-189.

414 9. Herzberg K et al. (2006) Phosphorylation of Rad55 on serines 2, 8, and 14 is required for

415 efficient homologous recombination in the recovery of stalled replication forks. Mol Cell

416 Biol 26: 8396-8409.

417 10. Shinohara A, Shinohara M (2004) Roles of RecA homologues Rad51 and Dmc1 during

418 meiotic recombination. Cytogenet Genome Res 107: 201-207.

419 11. Yuan Z-M et al. (1998) Regulation of Rad51 Function by c-Abl in Response to DNA

420 Damage. J Biol Chem 273: 3799-3802.

421 12. Sørensen CS et al. (2005) The cell-cycle checkpoint kinase Chk1 is required for

422 mammalian homologous recombination repair. Nat Cell Biol 7: 195-201.

423 13. Kuzminov A (2001) DNA replication meets genetic exchange: chromosomal damage and

424 its repair by homologous recombination. Proc Natl Acad Sci USA 98: 8461-8468.

425 14. Lusetti SL, Cox MM (2002) The bacterial RecA protein and the recombinational DNA

426 repair of stalled replication forks. Annu Rev Biochem 71: 71-100.

427 15. Chen Z, Yang H, Pavletich NP (2008) Mechanism of homologous recombination from

428 the RecA-ssDNA/dsDNA structures. Nature 453: 489-494.

429 16. Kidane D, Graumann PL (2005) Dynamic formation of RecA filaments at DNA double

430 strand break repair centers in live cells. J Cell Biol 170: 357-366.

431 17. Haaf T, Golub EI, Reddy G, Radding CM, Ward DC (1995) Nuclear foci of mammalian

432 Rad51 recombination protein in somatic cells after DNA damage and its localization in

433 synaptonemal complexes. Proc Natl Acad Sci USA 92: 2298-2302.

434 18. Butala M, Zgur-Bertok D, Busby SJ (2009) The bacterial LexA transcriptional repressor.

435 Cell Mol Life Sci 66: 82-93.

436 19. Soufi B, Kumar C, Gnad F, Mann M, Mijakovic I, Macek B (2010) Stable isotope

437 labeling by amino acids in cell culture (SILAC) applied to quantitative proteomics of

438 Bacillus subtilis. J Proteome Res 9: 3638-3646.

439 20. Pietack N, Becher D, Schmidl SR, Saier MH, Hecker M, Commichau FM, Stülke J

440 (2010) In vitro phosphorylation of key metabolic enzymes from Bacillus subtilis: PrkC

441 phosphorylates enzymes from different branches of basic metabolism. J Mol Microbiol

442 Biotechnol 18: 129-140.

443 21. Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E,

444 Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O,

445 Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood

446 CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P,

447 Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B,

448 Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J,

449 Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P,

450 Noirot P (2012) Condition-dependent transcriptome reveals high-level regulatory

451 architecture in Bacillus subtilis. Science 335: 1103-1106.

452 22. Errington J (2003) Regulation of endospore formation in Bacillus subtilis. Nat Rev

453 Microbiol 1: 117-126.

454 23. Fujita M, Losick R (2005) Evidence that entry into sporulation in Bacillus subtilis is

455 governed by a gradual increase in the level and activity of the master regulator Spo0A.

456 Genes Dev 19: 2236-2244.

457 24. Shah IM, Laaberki MH, Popham DL, Dworkin J (2008) A eukaryotic-like Ser/Thr kinase

458 signals bacteria to exit dormancy in response to peptidoglycan fragments. Cell 135: 486–

459 496.

460 25. Jers C, Kobir A, Søndergaard EO, Jensen PR, Mijakovic I (2011) Bacillus subtilis two-

461 component system sensory kinase DegS is regulated by serine phosphorylation in its

462 input domain. PLoS One 6: e14653.

463 26. Wang et al. (2006) The forespore line of gene expression in Bacillus subtilis. J Mol Biol

464 358: 16-37.

465 27. Wittekind M, Reizer J, Deutscher J, Saier MH, Klevit RE (1989) Common structural

466 changes accompany the functional inactivation of HPr by seryl phosphorylation or by

467 serine to aspartate substitution. Biochemistry 28: 9908–9912.

468 28. Sciochetti SA, Blakely GW, Piggot PJ (2001) Growth phase variation in cell and nucleoid

469 morphology in a Bacillus subtilis recA mutant. J Bacteriol 183: 2963-2968.

470 29. Simmons LA, Grossman AD, Walker GC (2007) Replication is required for the RecA

471 localization response to DNA damage in Bacillus subtilis. Proc Natl Acad Sci USA 104:

472 1360-1365.

473 30. Meile JC, Wu LJ, Ehrlich SD, Errington J, Noirot P (2006) Systematic localization of

474 proteins fused to the green fluorescent protein in Bacillus subtilis: identification of new

475 proteins at the DNA replication factory. Proteomics 6: 2135-2146.

476 31. Shimizu H et al. (2009) c-ABL tyrosine kinase stabilizes Rad51 chromatin association.

477 Biochem. Biophys. Res Commun 382: 286-291.

478 32. Flott S et al. (2011) Regulation of Rad51 function by phosphorylation. EMBO Rep 12:

479 833-839.

480 33. Westers H et al. (2003) Genome engineering reveals large dispensable regions in Bacillus

481 subtilis. Mol Biol Evol 20: 2076-2090.

482 34. Fabret C, Ehrlich SD, Noirot P (2002) A new mutation delivery system for genome-scale

483 approaches in Bacillus subtilis. Mol Microbiol 46: 25-36.

484 35. Lecointe F, Sérèna C, Velten M, Costes A, McGovern S, Meile JC, Errington J, Ehrlich

485 SD, Noirot P, Polard P (2007) Anticipating chromosomal replication fork arrest: SSB

486 targets repair DNA helicases to active fork. EMBO J 26: 4239-4251.

487 36. Lewis PJ, Marston AL (1999) GFP vectors for controlled expression and dual labelling of

488 protein fusions in Bacillus subtilis. Gene 227: 101-110.

489 37. Schaeffer P, Millet J, Aubert J-P (1965) Catabolic repression of bacterial sporulation.

490 Proc Nat Acad Sci USA 54: 704-711.

491 38. Leighton TJ, Doi RH (1971) The stability of messenger ribonucleic acid during

492 sporulation in Bacillus subtilis. J Biol Chem 246: 3189-3195.

493 39. Mijakovic I, Poncet S, Boël G, Mazé A, Gillet S, Jamet E, Decottignies P, Grangeasse C,

494 Doublet P, Le Maréchal P, Deutscher J (2003) Transmembrane modulator-dependent

495 bacterial tyrosine kinase activates UDP-glucose dehydrogenases. EMBO J 22: 4709-

496 4718.

497 40. Nicholson WL, Setlow P (1990) in Molecular Biology Methods for Bacillus, eds

498 Harwood CL, Cutting SM (John Wiley & Sons Ldt, Chichester UK), pp. 432-450.

499 41. Noirot-Gros MF, Dervyn E, Wu LJ, Mervelet P, Errington J, Ehrlich SD, Noirot P (2002)

500 An expanded view of bacterial DNA replication. Proc Natl Acad Sci USA 99: 8342-8347.

501

502 FIGURE LEGENDS

503

504 Figure 1. YabT is activated by DNA binding and phosphorylates RecA. (A) Autoradiography

505 of SDS-polyacrylamide gels showing YabT-dependent phosphorylation of RecA wild type

32 506 and RecA S2A in the presence of P-γ-ATP and MgCl2. Incubation times are given above

507 each lane. Bands corresponding to autophosphorylated YabT and phosphorylated RecA are

508 indicated. (B) Schematized structure of YabT aligned to reference Hanks kinase PrkC,

509 showing the kinase domain (blue shading) and the transmembrane helix (grey). Truncated

510 versions YabTΔ1 and YabTΔ2 are shown, with the putative DNA-binding region (residues

511 230-315) highlighted in orange. (C) Binding of YabT to random sequence ssDNA (140 bases

512 fragment, 0.4 µM) and dsDNA (210 base pairs fragment, 0.25 µM). B. subtilis kinases YbdM

513 and PrkC were included (4.5 µM each) as controls in lane1 and 2, YabT concentrations are 0,

514 2.0, 3.0, 4.0, 5.0 µM (lanes 3-7) and 0, 1.5, 3.0, 4.5, 6.0 µM (lanes 8-12). (D)

515 Autoradiography of SDS-polyacrylamide gels showing the influence of DNA binding on

516 YabT autophosphorylation. 0.25 µM YabT was incubated for 2 h with 0, 3, 6, 12 nM of the

517 same ssDNA fragment (lanes 1-4), and with 0, 3, 6, 12 nM of the dsDNA fragment (lanes 5-

518 8). (E) Binding of YabTΔ1 and YabTΔ2 to 0.25 µM dsDNA fragment used above. Lane 1

519 contained no protein, and 3 µM of each protein (as indicated in the figure) were in lanes 2 to

520 4. (F) Autophosphorylation of YabT, YabTΔ1 and YabTΔ2 in the presence of 3 nM dsDNA

521 fragment DNA (lanes 2, 4 and 6), and in the absence of dsDNA fragment DNA (lane 1, 3 and

522 5).

523

524 Figure 2. YabT is overexpressed during sporulation, localizes to the septum and interacts

525 with RecA. (A) B. subtilis transcriptome data [21] presented as Log2 normalized expression

526 ratios shown for yabT (plain line) and recA (dotted line) during spore development (T0-T6).

527 (B) Western blot analysis during onset of sporulation. Non-modified RecA and SPA-tagged

528 YabT were expressed from the respective native promoters. The proteins were detected by

529 Western blot between T0-T5. (C) Two-hybrid phenotypic interaction assay with YabT and

530 RecA (wild type, truncated and mutant derivatives). Yeast haploid cells expressing the YabT

531 protein, the RecA full sized, or N and C-terminal domains (NTD and CTD respectively), as

532 well as the S2A and S2D mutant derivatives were fused with the binding domain of Gal4

533 (BD) and mated against compatible haploid cells expressing the matching RecA derivatives

534 fused with the activating domain (AD). The interacting phenotypes were monitored by the

535 ability of mating products to grow on the selective medium -LUH. (D) Fluorescence

536 microscopy of B. subtilis cells expressing a GFP-YabT fusion, images taken between T2-T3.

537 Green fluorescence indicates the position of GFP-YabT (left), stained membranes are in red

538 (middle), and they are also shown in overlay (right).

539

540 Figure 3. RecA foci observed during spore development. (A) RecA levels in different strains

541 were probed by Western blot using anti-RecA antibodies on crude extracts obtained at T3.

542 Strains are indicated above each lane. (B) GFP-RecA foci were analyzed by microscopy at

543 T3. The overlay picture represents membrane-staining (FM4-64) in red and GFP-RecA is

544 green. The GFP-RecA fusion was induced at T0. (C) Proportion of cells containing foci in

545 different mutant stains: ΔyabT, recA S2A and S2D, at T3. Foci detection was done with the

546 help of the fluorescent spot detector software (FluorSpotRecognition). Error bars represent

547 standard deviation from 3 independent experiments.

548

549 Figure 4. Phosphorylation of RecA is important for spore development in presence of

550 exogenous DNA damage. (A) Spore survival after mitomycin treatment at time-point T1 of

551 the sporulating cultures of B. subtilis strains recAS2A, recAS2D, ΔyabT and wild type. Spore

552 counts are expressed as number of spores in treated culture/number of spores in untreated

553 culture for each strain, normalized with respect to the wild type. Error bars represent standard

554 deviation from 5 biological replicates. (B) DNA damage transforms RecA foci into

555 filaments/threads. Wild type cells were observed with FITC/DAPI-staining overlap at T3.

556 Non treated cells are in the left panel and cells treated with mitomycin (25 µg/ml added at T1)

557 are in the right panel.

558

559 Figure 5. RecA foci persist at T6 when they encounter irreparable damage. (A) Sporulating

560 wild type cells observed at T6: FITC/brightfield overlap in the left panel and FITC/DAPI-

561 staining overlap in the right panel. (B) Sporulating wild type cells observed at T6, after

562 mitomycin treatment (25 µg/ml) at T0: FITC/brightfield overlap in the left panel and

563 FITC/DAPI-staining overlap in the right panel. (C) Cells with spores and cells with RecA

564 foci/threads counted in a sample of over 300 cells examined at T6. To the left is the ratio in

565 the untreated wild type cells, and to the right the ratio in wild type cells treated with

566 mitomycin.

567

568 Figure S1. RecA phosphorylation does not influence DNA damage repair or homologous

569 recombination in vegetative cells. (A) B. subtilis wild type and strains recA S2D and recA

570 S2A were plated on LB-agar containing different concentrations of mitomycin. The viability

571 is expressed as the ratio of the colony-forming units from the treated and non-treated cultures.

572 Standard deviations between the experiments did not exceed 15% of the mean values. (B) The

573 cells containing transcriptional fusion PdinR::lacZ were grown to early exponential phase

574 (OD600 0.03) and SOS response was induced by 40 ng/ml of mitomycin. β-galactosidase

575 activity was plotted agains time after induction. Open and filled symbols indicate the non-

576 induced and induced cultures, respectively, and vertical bars indicate standard deviations

577 obtained from five independent experiments. The differences in SOS induction between the

578 strains are not statistically significant. (C) The 5-µl drops from the sequential 10-fold

579 dilutions of the cultures as described above were placed at the LB-plates containing the DNA

580 alkylating agent methyl-methanesulfonate (MMS). The plates were incubated over-night at

581 37°C before scanning. (D) To test DNA recombination by single crossing-over the competent

582 B. subtilis wild type and the non-phosphorylatable recAS2A mutant cells were transformed by

583 the same amounts of the integrative plasmid pMUTIN2 containing different fragments of the

584 B. subtilis chromosome. To test DNA recombination by double crossing-over they were

585 transformed with B. subtilis genomic DNA containing inserted pMUTIN2 plasmid. The

586 efficiency of transformation was determined as the ratio of the erytromycine resistant colonies

587 to the number of viable cells in competent cultures. The analysis was performed twice and the

588 results of one representative experiment are shown.

589

590 Figure S2. GFP-RecA expressed in the recA+ background. (A) The expression of gfp-recA

591 from the xylose promoter in a recA+ background (BMR87) confers survival to increasing

592 amount of mitomycin C similar to that of the wild-type (BS33). Gfp-recA fusion was induced

593 by addition of 0.5% xylose, and cells were plated on LB-agar containing different

594 concentrations of mitomycin. Results were normalized with respect to 100% survival without

595 mitomycin. (B) RecA (39 kDa) and GFP-RecA (65 kDa) protein levels were checked in

596 protein extracts of wild type cells (BS33) and BMR87 (with and without the addition of

597 xylose). Western detection was performed with the anti-RecA antibodies.

598

599

600

601

602 Table 1. B. subtilis strains used in the study.

STRAINS Strain Relevant genotype Construction Origin

BS33 recA+ TF8a x BEST5907 (Pr ::Neo; this study NmR) BMR76 recAS2A See text for details this study BMR9 recAS2D See text for details this study BMR25 ΔyabT ::phleo See text for details; (PhlR) this study BMR87 recA+ BS33 x pSG1729recA (SpR) this study amyE::Pxyl::gfp-recA BMR81 recAS2A amyE::Pxyl::gfp- BMR76 x pSG1729recAS2A this study recS2A (SpR)

BMR16 recAS2D amyE::Pxyl::gfp- BMR9 x pSG1729recAS2D this study recS2D (SpR) BMR88 ΔyabT ::phleo BMR87 x BMR25 (SpR PhlR) this study amyE::Pxyl::gfp-recA R BMR32 amyE::Pxyl::gfp-yabT BS33 x pSG1729yabT (Sp ) this study

BMR6 recA+ amyE::PdinR::lacZ BS33 x JJS100 this study

BMR10 recAS2D BMR9 x JJS100 this study amyE::PdinR::lacZ BMR78 recAS2D BMR76 x JJS100 this study amyE::PdinR::lacZ

BMR96 yabT ::SPA BS33 x pMUTIN-SPAyabT this study

603

604

605

606

607

608 Figure 1

609

610 Figure 2

611

612

613 Figure 3

614

615

616

617

618

619

620

621

622

623 Figure 4

624

625

626

627

628

629

630 Figure 5

631

632

633

634

635

636

637

638 Figure S1

639

640

641

642

643

644

645

646

647 Figure S2

648 Table S1. PCR primers used in this study. For mra primers, the nucleotides creating Ser2 to

649 Ala2 mutation of the recA gene are bolded and underlined; the nucleotides complementary to

650 the extremities of the insertion cassette are in small characters; and complementary sequences

651 are marked in italics.

PRIMERS (5’-3’) mra1 AGTCGGTTCAGAGTTGCTGCTTGG cgacctgcaggcatgcaagctGCCTGACGATCCGCCATTCTATTTTTTCCTCCTTTATG mra3R TTACC mra2 TGTGTCTCTTCAGCTTGCTGCTG gagctcgaattcactggccgtcGTAACATAAAGGAGGAAAAAATAGAATGGCGGATCGT mra3F CAGGCAGCC gagctcgaattcactggccgtcGTAACATAAGGAGGAAAAAATAGAATGGATGATCGTC mra4F AGGCAGCC cgacctgcaggcatgcaagctGCCTGACGATCATCCATTCTATTTTTTCCTCCTTTATG mra4R TTACC mra5 CATTCCCATGTTCTTCAGGCG mra7F gagctcgaattcactggccgtcGTGATCAGTGTTTTAGCGC mra6 CGTATTCTCCAGGAGGAATG mra7R cgacctgcaggcatgcaagcTGGGAATATAGG CATCATCCG RecA_wt CGGGATCCATGAGTGATCGTCAGGCAGCCTTAGATATGGC (BamHI) forward RecA_S2 CGCGGATCCATGGCTGATCGTCAGGCAGCCTTAGATATGGCTCT (S2A, A forward BamHI) RecA_S2 CGCGGTCCATGGATGATCGTCAGGCAGCCTTAGATATGGCTCT (S2D, D forward BamHI) RecA AAAACTGCAGTTATTCTTCAAATTCGAGTTCTTCTTGTG (PstI) reverse YabTt_for GAAGATCTATGATGAACGACGCTTTGACGAGTTTGGC (BglII) ward YabTt_re AAAACTGCAGTTAGATAAGCGTTGTTTCAAATAACCCC (PstI) verse YabT Δ1 AAACTGCAGCCTAAGCTGTTCTTTGGGCTG (BglII) forward YabT Δ2 AAACTGCAGAGGCTGCGGTGATGCTTTTAT (BglII) forward YbdM_fo CGGGATCCATGGCATTAAAACTTCTAAAAAAACTGC (BamHI) rward YbdM_re AAAACTGCAGTTATGTGACCGATTGAATGGCCCG (PstI) verse PrkA CGGGATCCATGGATATATTAAAGAAAATTGAAAAGTAC (BamHI) forward PrkA AAAACTGCAGTTATCGGTTCAGCAGGCTGCCG (PstI) reverse PrkCt GAAGATCTATGCTAATCGGCAAGCGGATCAGCGGGCG (BglII) forward

PrkCt AAAACTGCAGTTACAAAACCCACGGCCACTTTTTTCTTTTTGCCG (PstI) reverse pyabTApa CTAGTGGGGCCCGTGTATTTGGCAGAAACATCAG (ApaI) pyabTSal ACGCGTCGACTCAGATAAAGAAAAAGATAATATAGGCG (SalI) Universal CGGAATTCTGCAGTTATTCTTCAAATTCGAGTTCTTCTTGTGTC precAwt TTGGATCCATATGAGTGATCGTCAGGCAGCC precAS2A TTGGATCCATATGGCTGATCGTCAGGCAGCC precAS2D TTTGGATCCATATGGATGATCGTCAGGCAGCC pdisAApa AACTTGGGCCCTTCAGTGATGTCTTGTCTG

pdisASal ATCGCGTCGACCAGTTGTCTGTCTAAATAATGCTTC

pyabTBa GCAAGGATCCGCTGCATTGATGTGG m pyabTNco AATTCCATGGGATTAAGAAAAAGATAATATAGGCG

652

Chapter 4

Hanks type ST kinase phosphorylation affects DNA binding properties of global gene regulator AbrB

Phosphorylation of Bacillus subtilis gene regulator AbrB modulates its DNA-binding

properties

Short title: Phosphorylation of Bacillus subtilis AbrB

Ahasanul Kobir1, Sandrine Poncet1, Vladimir Bidnenko1, Carsten Jers1, Samira Zouhir2,

Sylvie Nessler2, Marie-Françoise Noirot-Gros1 and Ivan Mijakovic1,*

1INRA-AgroParisTech, UMR-1319 Micalis, F-78350 Jouy-en-Josas, France

2 Laboratoire d’Enzymologie et Biochimie Structurales, CNRS, F-91198 Gif sur Yvette, France

*To whom correspondence should be addressed:

Prof. Ivan Mijakovic, PhD

MICALIS UMR 1319, INRA-AgroParisTech, CBAI

F-78850 Thiverval-Grignon, FRANCE

E-mail: [email protected], Tel: +33 1 30 81 45 40, Fax: +33 1 30 81 54 57

Total character count :

ABSTRACT

AbrB is a global gene regulator in Bacillus subtilis, involved in transition phase phenomena.

Here we report that AbrB can be phosphorylated by three B. subtilis serine/threonines kinases expressed during transition phase (PrkC, PrkD and YabT). Phospho-mimetic mutation S86D lead to reduced affinity of AbrB for its target DNA and abolished binding cooperativity in vitro. The same mutation led to a partial loss of AbrB control over the expression of several key target genes in vivo. We therefore propose that AbrB phosphorylation serves as an additional regulatory mechanism needed to switch off this ambiactive gene regulator during the transition phase.

INTRODUCTION

Phosphorylation of proteins on serines, threonines and tyrosines (S/T/Y) is the privileged means of signaling in Eukarya, where kinase cascades link signals from the cells surface to the control of gene expression via phosphorylation of transcription factors and other effectors

[1]. In Bacteria, a similar task is performed by the two-component systems, relying on histidine-aspartate phosphorylation [2]. Interestingly, recent phosphoproteomic analyses in bacteria revealed a number of transcription factors phosphorylated on S/T/Y residues [3-5].

There are very few studies that examine the consequences of S/T/Y phosphorylation of bacterial gene regulators. There are reports of two component response regulators phosphorylated by S/T kinases [6-8], and one described case where S/T kinases phosphorylate a histidine kinase [9]. However, with the exception of the anti-sigma factor RseA [10], S/T/Y phosphorylation of other classes of bacterial gene regulators has not been intensely studied.

Here we focused on S phosphorylation of a “non-two component” gene regulator: AbrB from

Bacillus subtilis, which was found to be phosphorylated at S86 [5].

AbrB is a DNA binding protein described as an ambiactive regulator [11]. AbrB binds

DNA specifically, but does not recognize a single consensus sequence. It binds a number of

DNA targets with the common denominator of being flexible, and undergoing a conformational change upon AbrB binding [12]. This allows AbrB to act as a global transcription regulator [13]. AbrB binding to DNA is cooperative, and often a single high affinity site is flanked by low affinity sites which allow binding of multiple AbrBs [11,14].

AbrB DNA binding domain comprises residues 1-53, and it has the capacity to dimerize [15].

The C-terminal region (residues 54-94) facilitates the second dimerization event, accounting for wild type AbrB appearing as a homo-tetramer in solution [15]. AbrB retains its tetrameric form when bound to DNA [12], but undergoes a conformational change leading to a decreased hydrodynamic radius [16].

The physiological role of AbrB has been initially described as repressing genes for stationary phase functions during exponential growth, and abrB expression is autoregulated

[17]. The abrB transcript was detectable only at the onset of exponential growth, and AbrB protein level diminished continuously towards the end of exponential phase [18]. Thus AbrB- mediated repression is progressively alleviated towards the transition phase, and the stationary phase functions emerge in a defined sequence of events (motility, degradative functions, competence, sporulation). AbrB is in fact a regulator that regulates other regulators, and is in turn regulated by other regulators in an extremely complex decision-making circuit [19].

In this study we speculated that AbrB might be regulated by phosphorylation on S86

[5]. Phenotypes of phospho-mimetic and non-phosphorylatable versions of AbrB in vivo and

DNA binding assays in vitro indicated that phopshorylation impedes AbrB DNA binding.

AbrB can be phosphorylated by three B. subtilis S/T kinases expressed during the transition phase (PrkC, PrkD and YabT) and we argue that this process contributes to fine-tuning of

AbrB activity.

RESULTS AND DISCUSSION

AbrB is phosphorylated by Hanks kinases that are active in the stationary phase

In our quantitative phosphoproteomic study on B. subtilis, we have detected phosphorylation of AbrB at the residue S86 [5]. We hypothesized that this transition phase regulator might be phosphorylated by Hanks-type kinases (PrkC, PrkD and YabT) that are expressed during B. subtilis transition and stationary phase [20]. Two of these kinases, PrkD and YabT have been found to phosphorylate and thus activate the histidine kinase DegS, and thereby contribute to accumulation of the DegU~P, which constitutes an important regulatory signal during transition phase [9]. PrkC does not phosphorylate DegS, but it contributes to B. subtilis spore germination via phosphorylation of several other substrates [21]. To test whether these kinases can phosphorylate AbrB, we performed an in vitro phosphorylation assay specific for

S/T/Y phosphorylation (Figure 1A). AbrB was clearly phosphorylated by all three kinases,

PrkD being the most efficient. Complete phosphorylation of proteins can rarely be achieved in vitro, in the absence of specific kinase activators [22], so for further studies we constructed point mutants abrB S86A and abrB S86D to mimic non-phosphorylatable and fully phosphorylated state of AbrB, respectively. Wild type and mutant AbrBs were detected in crude protein extracts using an AbrB specific antibody (courtesy of Ulf Gerth, Greifswald

UNI) and the same band intensities were obtained for all versions of AbrB, indicating that point mutations did not affect protein stability (Figure 1B).

AbrB phosphorylation interferes with its affinity for DNA and cooperativity of DNA binding

In order to test the consequence of phosphorylation on AbrB ability to bind DNA, we performed gel shift experiments with the oligonucleotide used by Vaughn et al. [15]. DNA concentration was kept constant and amount of AbrB was varied in the assays. Wild type

AbrB bound the DNA, and created high molecular weight complexes at higher protein concentration (Figure 1C). These “heavy” forms of AbrB-DNA complex arguably correspond to multiple AbrB tetramers fixed to the DNA, as proposed by Sullivan et al. [14]. AbrB S86A bound DNA with even more affinity than the wild type, and showed an increased propensity for forming “heavy” complexes. By contrast, the phosphomimetic AbrB S86D exhibited reduced affinity for DNA, and was unable to constitute high molecular weight complexes.

Next, we investigated tetramerization of AbrB in the absence of DNA. It has been indirectly shown by Fude & Strauch [23] that the AbrB residues essential for tetramerization are 48-55 and 88-94, and the phosphorylated residue S86 is not among them. Accordingly, when examined by gel filtration, AbrB wild type, S86A and S86D all formed tetramers in solution

(Figure 1D). This further confirmed that the two mutant proteins are properly folded, and excluded the possibility that phosphorylation of AbrB affects tetramer formation. This prompted us to conclude that AbrB phosphorylation reduces its affinity for DNA, and prevents multiple tetramers from binding AbrB target sequences.

Given the number and diversity of AbrB targets in the B. subtilis genome [13], we chose several key physiological processes where AbrB role has been described to investigate the consequences of AbrB phosphorylation in vivo. Our strategy was to examine the binding of AbrB and its mutant versions to each individual promoter of interest, establish the profile of expression from these promoters in abrB mutants, and seek phenotypes of abrB mutations related to relevant promoter activities.

AbrB phosphorylation stimulates exoprotease production

AbrB has been described as a repressor of the gene aprE, encoding the extracellular protease subtilisin [24]. We found that AbrB S86D binding to the aprE promoter was much weaker than that of wild type or ArbB S86S (Figure 2A). Consequently, expression from the aprE promoter in vivo started early in the mutant abrB S86D, and reached a higher level than in wild type and S86A strain (Figure 2B). We examined the secretion of the protease AprE by plating our strains on skimmed milk plates, and found that the abrB S86D strain produces much larger halos than wild type or abrB S86A (Figure 2C). This led us to conclude that

AbrB phosphorylation, with respect to aprE promoter, acts as a signal leading to alleviation of

AbrB-mediated repression.

AbrB phosphorylation antagonizes sporulation

AbrB is also known to repress the gene spo0E, encoding a phosphatase of Spo0A~P [25]. The

ΔabrB strain has been published to overexpress spo0E, and therefore exhibit a defect in sporulation due to depletion of Spo0A~P [25]. The binding of AbrB wild type, S86A and

S86D to the spo0E promoter region followed the familiar pattern, with S86D mutant binding weakly, and S86A mutant binding more strongly than the wild type (Figure 3A). Not surpsingly, the abrB S86A strain produced 3-5 times more spores that the wild type and sporulation in abrB S86D was slightly impaired (Figure 3B). Our conclusion was that AbrB phosphorylation alleviates the repression of spo0E, and antagonizes spore development.

AbrB phosphorylation affects the competence development

Natural competence of B. subtilis is regulated by the master regulator ComK. AbrB has a double effect on the expression of comK: it can bind (and repress) the comK promoter directly

[26], but it also represses roc, which encodes the main repressor of comK [27]. Thus, the competence develops in a window of opportunity limited on one side by too high levels of

AbrB (direct repression of comK) and on the other side too much Rok (repression of comK), as decreasing levels of AbrB allow for high expression of rok [19]. The binding of AbrB

S86D to the comK promoter was as impaired as seen with other promoters, and AbrB S86A exhibited higher affinity and more “heavy” complexes than the wild type AbrB (Figure 4A).

The profile of expression from the comK promoter was affected in AbrB mutants, with the

S86A causing premature expression compared to the wild type, presumably due to its inability to repress comK directly, and an earlier de-repression of roK (preliminary data not shown).

This was accompanied by a phenotyope of premature competence development of the mutant abrB S86D( Figure 4B),

Conclusions

Our results indicate that phosphorylation of AbrB takes place during the transition phase, when overall levels of AbrB are low. In vitro assays suggest that phosphorylation impedes binding of AbrB to its DNA targets. In vivo, we observed phenotypes of abrB S86D and abrB

S86A related to exoprotease production, competence and sporulation that can be explained as a direct consequence of this phenomenon. The next step in elucidating the overall importance of AbrB phosphorylation is an exhaustive transcriptome analysis of the abrB S86D and abrB

S86A strains, which is currently under way. Another interesting question is the identity of cellular signals that activate the promiscuous transition state kinases which phosphorylate

AbrB. Signals known to activate bacterial S/T/Y kinases are few and far in between, and identifying them remains one of the main challenges in the field.

MATERIALS AND METHODS

Strain construction and growth conditions

E.coli NM 522 was used for cloning purposes, while the chaperone overexpressing strain E. coli

M15 containing pREP4-GroESL( 30) (confers kanamycin resistance and repression of IPTG-inducible promoter upstream of groES and groEL) was used for protein synthesis. Table:1 is representing the list of B. subtilis strains that were used in this study. All E.coli and B.subtilis strains were grown at 37°C with shaking in LB medium. In addition, B. subtilis was grown in Schaeffer sporulation medium (29) for sporulation experiments, competence medium (32) for transformation experiments and DS medium with supplement of 1.5% skimmed milk (31) for the exoprotease assay. Ampicline( 100µg/mL) and kanamycine(25µg/mL) were used for

E.coli and erythromycin( 5µg/mL) and neomycine (5 µg/mL) were used for B. subtilis selection, when appropriate. B. subtilis genes abrB, prkD, prkC (catalytic part), yabT

(catalytic part) were PCR amplified using genomic DNA from the strain 168 as template (35).

Point mutations abrB S86A and abrB S86D were obtained using two partially overlapping mutagenic primers (table 2). Plasmid pQE30 was used to insert all the PCR products for cloning. For promoter-lacZ fusions, 500-bp sequences downstream of promoters were PCR amplified from Bacillus subtilis 168 genomic DNA and inserted into plasmid pMUTIN2 using appropriate restriction sites. B. subtilis was transformed with the constructs yielding strains with lacZ gene under control of the promoter of interest (32). For in vivo construction of abrB S86A and abrB S86D mutations at the locus we used the improved mutation delivery

97 method (36 ). Briefly, the DNA fragments were amplified from the B. subtilis chromosome using primers mra28-mra32 and mra29-mra33 (for abrB S86A), and mra30-mra32 and mra31-mra33 (for abrB S86D). PCR with primers mra32 and mra33 was used to flank the appropriate pairs of fragments to the insertion cassette containing the phleomycin-resistance marker and the phage lambda cI repressor gene. The resulting PCR products were used to transform B. subtilis BS33 containing the neomycin-resistance gene under control of the lambda Pr promoter. The transformants were selected for acquisition of the phleomycin resistance and loss of the neomycin resistance, due to inhibition of Pr promoter by cI repressor. Finally, the insertion cassette was removed from the chromosome by counter selection of clones which restored the neomycin- and lost the phleomycin-resistance. All constructs were controlled by sequencing.

Synthesis and purification of affinity-tagged proteins and protein phosphorylation assay

Synthesis and purification of 6xHis-tagged proteins and in vitro phosphorylation assays were performed as described previously [9,22]. Protein concentrations in the in vitro assays and incubation times are indicated in the figure legends.

Western blot

Crude extracts were prepared from bacteria grown in SP medium. Aliquots were withdrawn at

T0(starting of exponential to stationary phase). It was calculated from different OD600 at different short time points. 10 mg of total proteins were separated by 12.5% SDS-PAGE.

After electrophoresis, proteins were transferred onto a nitrocellulose membrane which was treated with an anti-AbrB rabbit polyclonal antibodies diluted 1:5000-fold. Alkaline phosphatase-conjugate anti-rabbit antibodies at a 1:5000 dilution and the BCIP/NBT color

98 development substrate kit were used for the detection of AbrB bands, according to the manufacturer’s recommendations (Promega).

Electrophoretic mobility shift assays

The electrophoretic mobility shift assay were performed in the reaction containing 25mM

Tris-HCl, pH 7.5, 50 mM NaCl, 5% glycerol, 1 mM DTT, 10 mM MgCl2 and the concentration of protein and DNA as indicated in the figure legend. Known promoter regions( Table 2) were taken for DNA binding. Reactions mixture were then incubated at room temperature for 15 min and analyzed by gel electrophoresis in 0.8% agarose with

Ethidium bromide staining.

Gel filtration assay

The Superdex 200 10/300 GL column was equilibrated with 50mM Tris pH 7.4, 200 mM

NaCl, 1 mM EDTA and 1 mM DTT and calibrated with the following standards: thyroglobulin (669 kDa), ferritin (440 kDa), BSA (67 kDa), B-lactoglobulin (35 kDa), ribonuclease A (13.7 kDa), cytochrome C ( 13.6 kDa), aprotinin (6.5 kDa) and cobalamine

(1.4 kDa). 200 µl samples of purified proteins (0.1 µg/ml) AbrB wild type, AbrB S86D and

AbrB S86A were loaded individually and eluted at 0.5 ml/min. Protein content of the eluate was monitored constantly via A280.

Beta galactosidase assay

100 mL of medium (LB, Schaeffer sporulation medium or MGI) was inoculated with overnight culture to OD600 of 0.02 and grown with shaking at 37°C. At the time points indicated in the figures, 1 mL of sample was taken, spun down at 18 000 g for 2 min, washed twice with 0.5 ml of ice-cold 25 mM Tris-HCl, pH 7.4 and cell pellets were stored at -20°C.

At the same time 1 mL sample was collected to measure OD600. Cells were resuspended in 0.5 ml of Z buffer (60 mM Na2HPO4x7H2O, 0.04 mM NaH2PO4.H2O, 10 mM KCl, 1 mM

MgSO4 and 50 mM beta-mercaptoethanol, pH 7.0 ) supplemented with 8 µL solution of

Lysozyme 10 mg/ml and DNAse 1 mg/ml , vortexed and incubated at 37°C for 30 min.

Sample was spun down at 18 000 g for 5 min. Supernatant was collected (50 -500 µl depending on total protein concentration) and mixed with Z buffer (up to 800 µl). Reactions were started at 30°C by adding 0.2 ml of ONPG (4 mg/ml o-nitrophenyl-beta-D-Galactose) and stopped by 0.5 ml of 1M Na2C03. Miller units were calculated by reference protocol .(

33).

Protease production assay

Cells were grown overnight at 37°C on DS (0.8% nutrient broth, 0.1% KCl, 0.025%

MgSO4·7H2O, 1 mM Ca(NO3)2, 10 mM MnCl2, 1 mM FeSO4).. Colonies were inoculated in preheated DS medium at OD600 of 0.02 and grown to mid-late exponential phase. 2 µl

Samples were spotted onto DS agar plates (with 1.5% (w/v) skimmed milk). The plates were incubated for 15 hours at 37°C. The diameter of the hydrolytic halo surrounding the colony was measured to quantify extracellular protease productivity (31).

Competence assay

For competence assay B. subtilis strains cells were transformed according to the two-step protocol (32). Results from three biological replicates along with three technical replicates for each biological replicates, are presented as % of competence in the wild type. Mean values are shown with standard deviations from the total of nine transformations.

100

Sporulation assay

Cells were grown overnight in solid Schaeffer sporulation medium (SP), they were then inoculated in preheated liquid SP medium at OD600 0.1 and incubated at 37°C. Samples were grown for T6, T12, T18, T24 and T48 , diluted and plated on LB. One half of each samples was heated at 80°C for 15 min before plating, thus allowing to compare total counts to heat- resistant spores. Samples were incubated at 37°C and colonies were counted after 36 hours.

The percentage of spores was calculated as the ratio of CFU in heated and non-heated samples. (Schaeffer et al., 1965)

ACKNOWLEDGEMENTS

This research was supported by the grant from the Institut National de la Recherche

Agronomique to IM. We are grateful to Ulf Gerth for sharing his excellent anti-AbrB antibody.

101

REFERENCES

1. Cargnello M, Roux PP (2011) Activation and function of the MAPKs and their

substrates, the MAPK-activated protein kinases. Microbiol Mol Biol Rev 75: 50-83

2. Goulian M (2010) Two-component signaling circuit structure and properties. Curr Opin

Microbiol 13: 184-189

3. Macek B, Mijakovic I, Olsen JV, Gnad F, Kumar C, Jensen PR, Mann M (2007) The

serine/threonine/tyrosine phosphoproteome of the model bacterium Bacillus subtilis. Mol

Cell Proteomics 6: 697-707

4. Prisic S, Dankwa S, Schwartz D, Chou MF, Locasale JW, Kang CM, Bemis G, Church

GM, Steen H, Husson RN (2010) Extensive phosphorylation with overlapping specificity

by Mycobacterium tuberculosis serine/threonine protein kinases. Proc Natl Acad Sci USA

107: 7521-7526

5. Soufi B, Kumar C, Gnad F, Mann M, Mijakovic I, Macek B (2010) Stable isotope

labeling by amino acids in cell culture (SILAC) applied to quantitative proteomics of

Bacillus subtilis. J Proteome Res 9: 3638-3646

6. Kumar P, Kumar D, Parikh A, Rananaware D, Gupta M, Singh Y, Nandicoori VK (2009)

The Mycobacterium tuberculosis protein kinase K modulates activation of transcription

from the promoter of mycobacterial monooxygenase operon through phosphorylation of

the transcriptional regulator VirS. J Biol Chem 284: 11090-11099

7. Lin WJ, Walthers D, Connelly JE, Burnside K, Jewell KA, Kenney LJ, Rajagopal L

(2009) Threonine phosphorylation prevents promoter DNA binding of the Group B

Streptococcus response regulator CovR. Mol Microbiol 71: 1477-1495

8. Chao JD, Papavinasasundaram KG, Zheng X, Chávez-Steenbock A, Wang X, Lee GQ,

Av-Gay Y (2010) Convergence of Ser/Thr and two-component signaling to coordinate

102

expression of the dormancy regulon in Mycobacterium tuberculosis. J Biol Chem 285:

29239-29246.

9. Jers C, Kobir A, Søndergaard EO, Jensen PR, Mijakovic I (2011) Bacillus subtilis two-

component system sensory kinase DegS is regulated by serine phosphorylation in its

input domain. PLoS One 6: e14653

10. Barik S, Sureka K, Mukherjee P, Basu J, Kundu M (2010) RseA, the SigE specific anti-

sigma factor of Mycobacterium tuberculosis, is inactivated by phosphorylation-dependent

ClpC1P2 proteolysis. Mol Microbiol 75: 592-606

11. Strauch MA, Spiegelman GB, Merego M, Johnson WC, Burbulys D, Hoch JA (1989)

The transition state transcription regulator abrB of Bacillus subtilis is a DNA binding

protein. EMBO J 5: 1615-1621

12. Bobay BG, Benson L, Naylor S, Feeny B, Clark AC, Goshe MB, Strauch MA, Thompson

R, Cavanagh J (2004) Evaluation of the DNA binding tendencies of the transition state

regulator AbrB. Biochemistry 43: 16106-16118

13. Chumsakul O, Takahashi H, Oshima T, Hishimoto T, Kanaya S, Ogasawara N, Ishikawa

S (2011) Genome-wide binding profiles of the Bacillus subtilis transition state regulator

AbrB and its homolog Abh reveals their interactive role in transcriptional regulation.

Nucleic Acids Res 39: 414-428

14. Sullivan DM, Bobay BG, Kojetin DJ, Thompson RJ, Rance M, Strauch MA, Cavanagh J

(2008) Insights into the nature of DNA binding of AbrB-like transcription factors.

Structure 16: 1702-1713.

15. Vaughn JL, Feher V, Naylor S, Strauch MA, Cavanagh J (2000) Novel DNA binding

domain and genetic regulation model of Bacillus subtilis transition state regulator AbrB

Nat Struct Biol 12: 1139-1146

103

16. Cavanagh J, Thompson R, Bobay B, Benson LM, Naylor S (2002) Stoichiometries of

protein-protein/DNA binding and conformational changes for the transition-state

regulator AbrB measured by pseudo cell-size exclusion chromatography-mass

spectrometry. Biochemistry 41: 7859-7865

17. Strauch MA, Perego M, Burbulys D, Hoch JA (1989) The transition state transcription

regulator AbrB of Bacillus subtilis is autoregulated during vegetative growth. Mol

Microbiol 3: 1203-1209

18. O'Reilly M, Devine KM (1997) Expression of AbrB, a transition state regulator from

Bacillus subtilis, is growth phase dependent in a manner resembling that of Fis, the

nucleoid binding protein from Escherichia coli. J Bacteriol 179: 522-529

19. Shultz D, Wolynes PG, Jacob EB, Onuchic JN (2009) Deciding fate in adverse times:

sporulation and competence in Bacillus subtilis. Proc Natl Acad Sci USA 106: 21027-

21034

20. Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E,

Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O,

Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood

CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P,

Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B,

Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J,

Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P,

Noirot P (2012) Condition-dependent transcriptome reveals high-level regulatory

architecture in Bacillus subtilis. Science 335: 1103-1106

21. Shah IM, Laaberki MH, Popham DL, Dworkin J (2008) A eukaryotic-like Ser/Thr kinase

signals bacteria to exit dormancy in response to peptidoglycan fragments. Cell 135: 486–

496

104

22. Mijakovic I, Poncet S, Boël G, Mazé A, Gillet S, Jamet E, Decottignies P, Grangeasse C,

Doublet P, Le Maréchal P, Deutscher J (2003) Transmembrane modulator-dependent

bacterial tyrosine kinase activates UDP-glucose dehydrogenases. EMBO J 22: 4709-4718

23. Fude Y, Strauch MA (2005) Independent and interchangeable multimerization domains

of the AbrB, Abh, and SpoVT global regulatory proteins. J Bacteriol 187: 6354-6362

24. Ferrari E, Henner DJ, Perego M, Hoch JA (1988) Transcription of Bacillus subtilis

subtilisin and expression of subtilisin in sporulation mutants. J Bacteriol 170: 289-295

25. Shafikhani SH, Leighton T (2004) AbrB and Spo0E control the proper timing of

sporulation in Bacillus subtilis. Curr Microbiol 48: 262-269

26. Hamoen LW, Kausche D, Marahiel MA, van Sinderen D, Venema G, Serror P (2003)

The Bacillus subtilis transition state regulator AbrB binds to the -35 promoter region of

comK. FEMS Microbiol Lett 218: 299-304

27. Hoa TT, Tortosa P, Albano M, Dubnau D (2002) Rok (YkuW) regulates genetic

competence in Bacillus subtilis by directly repressing comK. Mol Microbiol 43: 15-26.

28. Christiansen LC, Schou S, Nygaard P, Saxild HH.(1997) Xanthine metabolism in

Bacillus subtilis: characterization of the xpt-pbuX operon and evidence for purine- and

nitrogen-controlled expression of genes involved in xanthine salvage and catabolism.J

Bacteriol.179(8):2540-50.

29. Schaeffer P, Millet J, Aubert JP. (1965). Catabolic repression of bacterial sporulation.

Proc Natl Acad Sci 54: 704–711

30. Amrein KE, Takcs B, Stieger M, Molnos J, Flint NA, et al. (1995) Purification and

characterization of recombinant human p50csk protein-tyrosine kinase from

an Escherichia coli expression system overproducing the bacterial chaperones GroES and

GroEL. Proc Natl Acad Sci U S A 92: 1048–1052.

105

31. Gao W, Dai S, Liu Q, Xu H, Qiao M. (2010) CitB mutation increases the alkaline

protease productivity in Bacillus subtilis J Gen Appl Microbiol.;56(5):403-7.

32. Yasbin RE, Wilson GA, Young FE. (1975) Transformation and transfection in lysogenic

strains of Bacillus subtilis: evidence for selective induction of prophage in competent

cells. J Bacteriol.;121(1):296-304.

33. Miller, J. (1972) Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold

Spring Harbor Laboratory.

34. M A Strauch, G B Spiegelman, M Perego, W C Johnson, D Burbulys, and J A Hoch (

1989)The transition state transcription regulator abrB of Bacillus subtilis is a DNA

binding protein.EMBO J.; 8(5): 1615–1621

35. Kunst, F., Ogasawara, N., Moszer, I., Albertini, A.M., Alloni, G., Azevedo, V. et al.

(1997) The complete genome sequence of the gram-positive bacterium Bacillus subtilis.

Nature 390:249-256.

36. Fabret C, Ehrlich SD, Noirot P.(2002)A new mutation delivery system for genome-scale

approaches in Bacillus subtilis.Mol Microbiol.46(1):25-36.

106

FIGURE LEGENDS

Figure 1. AbrB phosphorylation and its consequences, A) Autoradiography of SDS- polyacrylamide gels containing AbrB and Hanks type kinases YabT (truncated version), PrkC

32 (truncated version) and PrkD in the presence of P-γ-ATP and MgCl2. Reactions were incubated for 2 hours at 37°C. Lane 1, 2, 4 and 6 representing autophosphorylation of AbrB,

YabT, PrkC respectively and PrkD and lane 3,5,7 representing the phosphorylation of AbrB with YabT, PrkC and PrkD respectively.Bands corresponding to serine phosphorylation.

Concentration of proteinsof the kinases are 3.5µM of PrkC , 2.5 µM of YabT , 2.5 µM of

PrkD and substrates, 5µM of AbrB .B) AbrB levels in different strains were probed by

Western blot using an AbrB specific antibody (Crude extracts were obtained at T0 from strains indicated above each lane. C) Binding of AbrB and its mutant versions to a known target

DNA sequence (55 bases fragment) (15) using a gel shift assay. DNA concentration was 0.27

µM in each lane. Lane 1 is a control having no AbrB protein. AbrB concentrations were 5.7,

11.5, 23and 45 µM in lanes 2-5 for AbrB WT, lanes 6-9 for AbrB S86A and lanes 10-13 for

AbrB S86D respectively. D) Gel filtration of AbrB and its mutant versions. , Samples containing 0.1 µg/mL protein were injected on , The peaks eluted between 14.3 - 15 ml correspond to the theoretical M of as AbrB tetramer.

Figure 2. Exoprotease production is activated by AbrB phosphorylation. A) Binding of AbrB and its mutant versions to a known aprE promoter sequence (34) assayed by gel shift. 197 bp fragments was used with final DNA concentration of 0.18 µM. 30 µM of protein was used for

AbrB WT, AbrB S86A and AbrB S86D (proteins are indicated above each lane. B) aprE promoter activity in the wild type, abrB S86A, abrB S86D measured in LB medium. Wild type is shown in blue, abrB S86A in red, abrB S86D in green. The results with standard deviation bars are the average from two biological replicates, with two technical replicates for eachexperiment. C) exoprotease production of strains abrB WT, abrB S86A and abrB S86D

107 on DS medium. The extracellular protease productivity was measured by the diameter of the hydrolytic halo minus the diameter of the colony. The results shown here are a representative sample from three biological replicates.

Figure 3. AbrB phosphorylation affects sporulation A) Binding of AbrB and its mutant versions to a known spo0E promoter sequence (222 bases fragments) (34), using gel shift assay. DNA concentration was 0.7 µM in each lane. 20µM of protein was used for AbrB WT,

AbrB S86A and AbrB S86D, proteins are indicated above each lane. B) Spore survival after heat treatment at various time points after the initiation of sporulation (T0) for B.subtilis strains abrB S86A, abrB S86D and wild type. Spore counts are expressed as the number of spores in the heated culture divide by the number of spores in the non-heated culture. Error bars represent the standard deviation of 2 biological along with 2 technical replicates for each biological sample.

Figure 4. Phosphorylation of AbrB regulates the competence development.A) Binding of

AbrB and its mutant versions to the comK promoter sequence (475 bases fragments) analyzed by gel shift. DNA concentration was 0.5 µM in all lanes. 20µM of protein was used for AbrB

WT, AbrB S86A and AbrB S86D and the proteins are indicated above each lane. B)

Competence assay were performed using a standard B subtilis transformation protocol and the numerical data present the competence of wild type and abrB mutants. normalized with respect to the wild type cells. The results with standard deviation bars are the average from 3 biological replicates, with 3 technical for each.

108

Table 1: List of B. subtilis strains used in this study.

Strain Description Reference

168 WT abrB WT This work abrB S86A abrB S86A This work abrB S86D abrB S86D This work abrB WT aprE-lacZ abrB WT aprE::pMUTIN2 This work abrB S86A aprE-lacZ abrB S86A aprE::pMUTIN2 This work abrB S86D aprE-lacZ abrB S86D aprE::pMUTIN2 This work abrB WT comK-lacZ abrB WT comK::pMUTIN2 This work abrB S86A comK-lacZ abrB S86A comK::pMUTIN2 This work abrB S86D comK-lacZ abrB S86D comK::pMUTIN2 This work abrB WT spo0E-lacZ abrB WT spo0E::pMUTIN2 This work abrB S86A spo0E-lacZ abrB S86A spo0E::pMUTIN2 This work abrB S86D spo0E-lacZ abrB S86D spo0E::pMUTIN2 This work

Table 2: Primers used in this study. Restriction sites are underlined and changed cordons in mutagenic primers are in bold.

Name Sequence Restriction site

Gene amplification

AbrBfwd CGGGATCCATGTTTATGAAATCTACTGGTATTGTACG BamH I

AbrB rev AAAACTGCAGTTATTTAAGGTTTTGAAGCTGGTTTGG Pst I

PrkC fwd GAAGATCTATGCTAATCGGCAAGCGGATCAGCGGGCG Bgl II

PrkC trunk rev - AAAACTGCAGTTACAAAACCCACGGCCACTTTTTTCTTTTTGCCG Pst I

YabT fwd GAAGATCTATGATGAACGACGCTTTGACGAGTTTGGC Bgl II

YabT trunk rev- AAAACTGCAGTTAGATAAGCGTTGTTTCAAATAACCCC Pst I

109

PrkD fwd CGGGATCCATGGCATTAAAACTTCTAAAAAAACTGC BamH I

PrkD fwd AAAACTGCAGTTATGTGACCGATTGAATGGCCCG Pst I

AbrB-S86A rev AAAACTGCAGTTATTTAAGGTTTTGAAGCTGGTTTTGGATTTCGGCGATGATTTGCTCAGCGCCTT Pst I

AbrB-S86Drev AAAACTGCAGTTATTTAAGGTTTTGAAGCTGGTTTTGGATTTCGTCGATGATTTGCTCAGCGCCTT Pst I

PaprE_lacZ fwd CCGGAATTCATGGAAAAAGGCGGAAAGGTTCAAAAGCAATTTAAGTAT EcoRI

PaprE_lecz rev CGCGGATCCTTAACATCCATATTGTTGGAAATGGCCCACTCAATGCCGTTA BamHI

Pspo0E-lacz fwd CCGGAATTCATGGTTAATGATAGATGCCGCTAGAAAGCAGGGATTTACAGGG EcoR 1

Pspo0E-lacz rev CGCGGATCCTTATGTAAACACAGCGTGAGTGACGCCGAAAAAGAATATGC BamH1

Pcomk-lacz fwd ATAAGAATGCGGCCGCATGAGTGAACGGCGCAACAATTGCCGTGCTG Not I

PcomK-lacz rev CGCGGATCCTTAAATCATCTTCGTCCGCTCTTCTTTCGGGTACAG BamH I

Gshift assay

AbrB -5’ AGTCATAAACAGGAAGGTATTTCCATTTTTGGGGGTATAAGGATCCTGACGCATG AbrB-3’ CATGCGTCAGGATCCTTATACCCCCAAAAATGGAAATACCTTCCTGTTTATGACT-3’

AbrB-aprE-5’ GAAAATAGTTATTTCGAGTCTCTACGG

AbrB-aprE-3’ CACAATTTTTTGCTTCTCACTCTTTACCC

AbrB-comK-5’ CGGTTATACAAGGATTCATCGAGC

AbrB-comK-3’ CAATTGTTGCGCCGTTCACTTCAT

AbrB-spo0E-5’ CTTCATTGGGCATACCTCCTGCCTGG

AbrB-spo0E-3’ CAACAACCGCCCATTCACTTCACCC

In vivo mutant construction mra28 GAGCTCGAATTCACTGGCCGTCGGCGCTGAGCAAATCATCGCCGAAATCCAAAACCAGCTTC mra29 CGACCTGCAGGCATGCAAGCTGGTTTTGGATTTCGGCGATGATTTGCTCAGCGCCTTC mra30 GAGCTCGAATTCACTGGCCGTCGGCGCTGAGCAAATCATCGATGAAATCCAAAACCAGCTTC mra31 CGACCTGCAGGCATGCAAGCTGGTTTTGGATTTCATCGATGATTTGCTCAGCGCCTTC mra32 AAAGCGGAACAGCAAGGAGG mra33 TGCCGTTTTTCTGTCGTGCG

110

Figure 1

111

Figure 2

112

Figure 3

113

Figure 4

114

Chapter 5

Discussion

Discussion Protein phosphorylation plays a central role in signal transduction in bacteria. Upon sensing external stimuli, most kinases undergo autophosphorylation and proceed to transphosphorylate substrate proteins. In this manner, kinases often regulate physiological processes in the transition phase of bacterial growth. Phosphorylation on specific amino acid residues, such as serine, threonine, tyrosine, histidine, and aspartate, can control the activity of their target proteins either directly or indirectly. At least, three phosphorylation systems have been revealed in bacteria: two-component systems, PTS involved in sugar uptake and finally, serine/threonine and tyrosine phosphorylation. Although serine/threonine kinases are identified in many bacterial species, physiological roles of most of these kinases are unclear. With respect to serine/threonine phosphorylation, some regulatory roles of stationary phase function in B. subtilis are especially well studied, for example the the partner switching modules in sporulation and stress response (Gaidenko et al., 1999 & 2002; Madec et al., 2002). On the other hand, Bacillus subtilis possess only a few Hanks type serine/threonine kinases, most of which remain uncharacterized, with an exception of PrkC. In this work, I took advantage from the recently published B. subtilis phosphoproteome that identified a number of new phosphoproteins to study especially the effect of the serine phosphorylation of DegS (Macek et al., 2007), AbrB and RecA (Soufi et al.,2010) in the transition to stationary phase in B. subtilis.

Serine/threonine kinase YbdM phosphorylates two-component system kinase DegS Two-component systems are ubiquitous in signal transduction in bacteria. A well known two- component system DegS-DegU plays important roles during the transition from the exponential to the stationary growth phase of B. subtilis by regulating phenomena such as competence, swarming, motility, complex colony formation, biofilm formation and exoprotease production (Masdek et al., 1990; Kobayashi et al., 2007 and Verhamme et al., 2007). This system receives and integrates a number of different signals that trigger its regulatory roles in both transcriptional and post-transcriptional level. In this work, the role of the recently identified phosphorylation of DegS serine-76 located in the sensing domain was

115

studied (chapter 2) with the working hypothesis that serine phosphorylation by the Hanks type kinase could be an activating signal of DegS. Upon activation, the histidine kinase DegS autophosphorylates on a histidine residue but was not able to autophosphorylate on serine at 76 position. Instead, DegS turned out to be phosphorylated in vitro by Hanks type serine/threonine kinases. It seems unlikely that all Hanks type kinases present in B. subtilis equally contribute to phosphorylating DegS serine 76. However, these kinases are presently almost completely uncharacterized except PrkC. Of the three tested serine/threonine kinases, YbdM (new name is PrkD) and YabT were able to phosphorylate DegS, but out of the two only YbdM was specific for serine-76 and hence it is most likely to be the physiologically relevant kinase. DegS, therefore, became the first identified substrate for the Hanks type serine/threonine kinase YbdM. In order to study the regulatory effects of this phosphorylation, a non-phosphorylatable (S76A) and a phosphomimetic (S76D) version of DegS were taken for this study that representing 0% and 100% phosphorylation efficiency respectively. The emerging results supported our working hypothesis: the phosphomimetic mutation degS S76D led to an increased autophosphorylation and phosphate transfer towards DegU. From the early mutational studies of the two- component system DegS/U, it is well established that response regulator DegU binds DNA sequences in both unphosphorylated and phosphorylated state and regulates expression of specific genes assuming of a different level of DegU phosphorylation (Dahl et al., 1992; Murray et al., 2009). For example, unphosphorylated DegU activates the expression of genetic competence through the recruitment of ComK (Hamoen et al., 2000) while phosphorylated DegU is required to activate degradative enzyme synthesis and biofilm formation (Ogura et al., 2003; Verhamme et al., 2007). To confirm the regulatory function of the phosphorylation event, we introduced genes coding DegS S76A and S76D in place of the wild-type allele and tested the effect in different physiological assays. The results suggested an increase in a pool of DegU-P in degS S76D strain, which exhibited phenotypes in competence, swarming and complex colony formation. This result suggests that phosphorylation of serine 76 of DegS contributes to an already very complex process of regulating the level of DegU phosphorylation in B. subtilis. The above results point toward serine phosphorylation by Hanks type kinase being an activating signal for DegS, and phosphomimetic form of DegU results in intermediary levels of DegU phosphorylation in vivo. The fact that the interpretation of the physiological roles of DegS is based on its mutant analysis meant that more work will be needed to focus on confirming the kinase responsible

116

for the phosphorylation of DegS in vivo. In this study, we tried to do this by evaluating the consequence of inactivating individual kinases. Inactivated relevant kinase should confer a degS S76A phenotype. In our experimental set up, degS S76A strain behaved similar to the wild type, but degS S76D phenotype was easily distinguishable. Overexpression of the kinase YbdM has a similar phenoptype to that of degS S76D, confirming that YbdM is likely to be responsible for DegS phosphorylation in vivo. It is also crucial to figure out the identity of specific signals that trigger the activity and substrate specificity of YbdM. At present, it is not clear what cellular signal might control DegS serine phosphorylation. It is already indicated that the residue 76 is phosphorylated in late exponential growth phase (Macek et al., 2007) but further studies will be needed to address this question. In this study we established the first example of crosstalk between a Hanks-type kinase and a two-component kinase. Despite that fact that DegS/U system has been studied for more than 25 years; still new aspects of the stimulating system are discovered.

Phosphorylation effect of serine/threonine kinase YabT on the recombinase RecA

The RecA protein is known as a general DNA recombinase in bacteria. It is a prototype of family of recombinase protein that is ubiquitous in all types of living organisms (Vispé et al., 1997). It plays a central role in the DNA repair, homologous recombination, DNA metabolism, induction of SOS response and SOS-induced mutagenesis in bacteria (Michael et al., 2003). In this work, the role of the recently identified phosphorylation of RecA serine-2 located in the N-terminal domain was studied (chapter 3) with the working hypothesis that YabT dependent phosphorylation of RecA could be a signal to promote focus formation at the lesion sites during spore development. In this study first we examined if Hanks type kinases may phosphorylate RecA in vitro. Interestingly, RecA was phosphorylated by two Hanks type kinase YabT and YbdM but only YabT was specific for serine-2 and hence most likely to be the physiological relevant kinase. It is well known that PrkC participates in spore germination in B. subtilis (Shah et al., 2008).There is also evidence that YabT phosphorylated DegS, but this was not specific (Jers et al., 2011). Surprisingly, we found that YabT could bind ssDNA as well as dsDNA. This interesting result shifted our attention to characterize this unusual Hanks type kinase. When we look at its structure, we found a lack of external sensing domain. That means this kinase

117

does not get any signal from extracellular membrane. So we can speculate that the activating signal may come from cytosol. YabT contains a positively charged (Lys/Arg rich) region partially overlapping with the kinase domain. In order to test this, we constructed two mutants of YabT kinase by deleting the entire positively-charged region as well a part of the positively charged region downstream from the kinase domain (preserving the kinase domain intact). Finally we were able to conclude the YabT residues 284-315 constitute its DNA binding motif and DNA binding activates the YabT kinase function. From B. subtilis transcription analysis it was found that YabT is expressed during the onset of sporulation (Nicolas et al., 2012). We confirmed this by western blot analysis of yabT expression at the onset of sporulation stage. During the same period, the levels of RecA were relatively high and constant. We also confirmed the interaction between YabT and RecA by using a yeast two hybrid assay. Next important task was to identify the localization of YabT. By using over expressed GFP-YabT in fluorescence microscopy analysis we have shown that it locates to the septum. We speculated that YabT is anchored to the septal membrane via its transmembrane helix, and in that position, it can be activated by DNA entering the spore. So, we can interpret our results in this way: in vivo YabT might be activated by stretches of ssDNA at the lesion sites it and phosphorylates RecA. Phosphorylated RecA could then promote repair at lesion sites during spore development. Similar role was found in eukaryotes where Ser/thr kinases Mec1 and Tel1 were activated by DNA lesions and phosphorylate several proteins at DNA damage sites to promote cell survive and genome stability by various mechanisms (Traven & Heierhorst, 2005).

Next, our attention moved to the analysis of the effect of RecA phosphorylation on spore formation in the absence as well as in the presence of DNA damaging conditions. To investigate the consequence of RecA phosphorylation on spore development, a ΔyabT mutant, a ΔrecA mutant and two additional RecA point mutants recA S2A (non-phosphorylatable) and recA S2D (phospho-mimetic) were constructed whose theoretically phosphorylation efficiency were 0% and 100% respectively. In this study, we didn’t find that RecA phosphorylation influences spore formation significantly in the absence of exogenous DNA damage. However, even in the absence of exogenous damage, RecA formed foci in a sub- population of cells. Foci numbers increased 3-fold in the recA S2D strain, compared to the wild type. In the presence of exogenous DNA damaging agent, we found a diminished spore survival in ΔyabT mutant and non-phosphorylatable recA mutant compared to wild type. On the other hand, RecA foci formation was transient, as it was found at the onset of sporulation

118

around 1 to 2 hours after T0 but surprisingly, in the most cells, they disappeared around 6 hours after T0. In fact, T6 is the expected time when the spore development completes. Our results suggested that persistent RecA foci and complete spore development might be mutually exclusive. It was evidenced that in exponential phase persistent foci correspond to replication forks stalled at irreparable lesions (Haaf et al., 1995; Kidane et al., 2005; Simmons et al., 2007). In spore development, we can speculate that RecA persistent foci might also correspond to irreparable lesions and thereby prevent complete spore formation. Our results suggested a link among RecA foci at T6, irreparable DNA lesions and incomplete mature spores. We speculate a mechanism by which phosphorylated RecA recruitment to its DNA damage sites can increase focus formation during spore development. Similar evidence was also found in its eukaryatic counterpart Rad51 which is phosphorylated by its kinase PlK1 in response to DNA damage, that phosphorylation triggers another phosphorylation of Rad51 by its another kinase CK2, which in turn triggers to bind with Nbs1(Nijmegen breakage syndrome gene product) and promotes DNA repair by Homologous recombination. This mechanism facilates Rad51 recuritment to damage sites (Yata et al., 2012). So from our experiments, we can argue that RecA phosphorylation that increased focus formation could be a part of a similar mechanism. The exact mechanism for RecA recruitment to the lesion site as well as RecA foci composition and formation during spore development are not well understood. On the other hand, the exact role of phosphorylation in that process is far from clear, and more work will be needed in the future to elucidate these mechanisms. Future research should also focus on in vivo confirmation for the kinase-substrate interaction, that will need a complete study by quantative and site specific mass spectrometry based phosphoproteomics, which is under way in our group.

Concerning the above results, we can conclude that YabT is the main kinase responsible for RecA phosphorylation, and RecA phosphorylation, specifically at serine-2 promotes the RecA focus formation during spore development. Similar role was also observed in its eukaryotic counterpart Rad55 which is phosphorylated by its serine/threonine kinase Mec1 that is promoting homologous recombination (Bashkirov et al., 2006; Herzberg et al., 2006) and alsokinase Mec1 ( Flott et al., 2011) directing Rad51 role in damage repair. In this study, YabT appeared to have a similar mechanism as the eukaryotic counterpart kinases PlK1, Tel1 and Mec1 respectively (Yata et al., 2012; Traven & Heierhorst, 2005 and Flott et al., 2011).

119

Thus we can conclude that RecA has functional similarities with its eukaryal homologous RaD51 and Rad55 but is also similar in its regulation via post translational modifications.

Hanks type ST kinase phosphorylation affects DNA binding properties of global gene regulator AbrB

AbrB is a global gene regulator in B. subtilis, which is well known as a general repressor of stationary phase functions during the exponential growth. It is a DNA binding protein, which act as an ambiactive regulator (Strauch et al., 1989) but the DNA binding is not sequence specific for this gene regulator. More precisely, it can act either as an activator, or a repressor or a preventer of gene expression, controlling genes involved in antibiotic production, motility, genetic competence for uptake of DNA and degradative enzyme production during the transition state and the onset of stationary phase to sporulation (Perego et al., 1991; Zuber et al., 1987). Moreover, AbrB is a complex regulator who regulates other regulators as well as being regulated by other regulators in an extremely complex decision-making pathway (Shultz et al., 2009). In this work, we considered the possibility that AbrB might be regulated by phosphorylation on serine-86 during the transition phase. So in this study the working hypothesis was that AbrB phosphorylation could affect its DNA binding properties (chapter 4). AbrB is phosphorylated in vitro by three Hanks-type kinases (PrkC, YbdM and YabT) but none of them are found specific for the residue 86. Such non-specific phosphorylation has been reported for other substrates of Hanks type kinases in B. subtilis (Jers et al., 2011). Interestingly, all three kinases are expressed during transition and stationary phase in B. subtilis (Nicolas et al., 2012). In order to study the regulatory effects of this phosphorylation, we constructed point mutants abrB S86A (Non-phosphorylatable) and abrB S86 D (Phospho- mimetic) representing as 0% and 100% phosphorylation efficiency respectively. We tried to understand the effect of AbrB phosphorylation at serine-86 on its DNA binding capacity. In line with the working hypothesis, phospho-mimetic mutant of AbrB led to a decrease of DNA binding affinity observed in the gel-shift assay. If we look into the literature, it is reported that AbrB binding domain residues (1-53) in N-terminal and residues (54-94) in C-terminal can form dimers individually, and collectively, they form a tetramer in solution (Vaughn et al.,2000). Another study cites AbrB tetramerization residues as (48-55) in the N- terminal domain and (88-94) in the C-terminal domain (Fude et al., 2005). Our AbrB

120

phosphorylation site serine-86, is not directly included in the tetramerization region, but is not far away. We investigated tetramerization of AbrB and its mutants by gel filtration. WT AbrB, AbrB S86A and AbrB S86D appeared as tetramers in solution. Two conclusions could be drawn from these results: both mutants were folded properly, and AbrB phosphorylation state did not affect its tetramer formation. Therefore, the in vitro results suggest that phosphorylation of AbrB does not act on oligomerization, but affects DNA-binding affinity, despite the phosphorylated residue being in the oligomerization domain. To confirm the regulatory potential of this phosphorylation event in vivo, we introduced genes encoding abrB S86A and abrb S86D in the place of wild type allele and tested the effect in different physiological assays. In this in vivo study we chose some important reporter genes whose physiological roles have been established already. In line with the in vitro data, the results pointed toward the decreased affinity for DNA binding upon in the phospho-mimetic mutant strain (abrB S86D) which exhibited phenotypes in exoprotease production, competence and sporulation during the transition to stationary phase. These results pointed towards a link between AbrB phosphorylation on 86 and its activity in vivo.

For better understanding of AbrB phosphorylation on serine-86, many questions remain open. It is also evidenced that the AbrB protein from B. anthracis is highly homologous to B. subtilis (almost 80 out of 94 amino acids are identical except last 14 amino acids in the C- terminus). Despite their differing sequence in the C-terminus of AbrB protein from both B. subtilis and B. antharcis, there is no difference observed in their DNA binding eficiency. So these results established that in AbrB protein, N-terminal domain is conserved, and responsible for DNA binding specificity, whereas the C-terminal domain, involved in multimerization, is less conserved (Strauch et al., 2005b). It is also clear that differences in the AbrB protein in C-terminal domain did not interfere with the N-terminal domain DNA binding efficiency. In our study we focused on serine-86 phosphorylation and the impact on DNA binding. Normally, upon phosphorylation, conformational change appears in the protein. It is believed that AbrB-DNA binding interactions depend on the recognition of specific stretches of three- dimensional DNA helix configurations that are characterized by a subset of allowable structural parameters (e.g., minor groove width, degree of propeller twisting, etc.) (Strauch et al., 1995a; Bobay et al., 2004). So in line with these evidences, we can propose that C- terminal serine-86 phosphorylation of AbrB might change the confirmation in its C-terminal

121

part, and that might affect its DNA binding efficiency. It is also speculated that AbrB phosphorylation on serine-86 being non specific, maybe some other phosphorylation sites exist on AbrB, that we were not able to detect in our laboratory setup. It is also possible that AbrB serine-86 phosphorylation could alter a few or many transition to stationary phase associated genes’ expressions and could change their physiological functions. Future research should be focused on a complete transcriptome analysis of AbrB and its mutants, which is currently under way. So in line with this study, we can propose that AbrB phosphorylation on serine 86 could be an additional regulatory mechanism that is needed to switch off this ambiactive gene regulator during the transition phase.

122

References

1. Absalon, C., Obuchowski, M., Madec, E., Delattre, D., Holland, I.B., and Seror, S.J. (2009). CpgA, EF-Tu and the stressosome protein YezB are substrates of the Ser/Thr kinase/phosphatase couple, PrkC/PrpC, in Bacillus subtilis. Microbiology 155, 932- 943. 2. Adler, E., Donella-Deana, A., Arigoni, F., Pinna, L.A., and Stragler, P. (1997). Structural relationship between a bacterial developmental protein and eukaryotic PP2C protein phosphatases. Mol Microbiol 23, 57-62. 3. Aivaliotis, M., Macek, B., Gnad, F., Reichelt, P., Mann, M., and Oesterhelt, D. (2009). Ser/Thr/Tyr protein phosphorylation in the archaeon Halobacterium salinarum--a representative of the third domain of life. PLoS One 4, e4777. 4. Alber, T. (2009). Signaling mechanisms of the Mycobacterium tuberculosis receptor Ser/Thr protein kinases. Curr Opin Struct Biol 19, 650-657. 5. Alexander, C., Bilgin, N., Lindschau, C., Mesters, J.R., Kraal, B., Hilgenfeld, R., Erdmann, V.A., and Lippmann, C. (1995). Phosphorylation of elongation factor Tu prevents ternary complex formation. J Biol Chem 270, 14541-14547. 6. Alonso, A., Sasin, J., Bottini, N., Friedberg, I., Osterman, A., Godzik, A., Hunter, T., Dixon, J., and Mustelin, T. (2004). Protein tyrosine phosphatases in the human genome. Cell 117, 699-711. 7. Amati, G., Bisicchia, P., and Galizzi, A. (2004). DegU-P represses expression of the motility fla-che operon in Bacillus subtilis. J Bacteriol 186, 6003-6014. 8. Archambaud, C., Gouin, E., Pizarro-Cerda, J., Cossart, P., and Dussurget, O. (2005). Translation elongation factor EF-Tu is a target for Stp, a serine-threonine phosphatase involved in virulence of Listeria monocytogenes. Mol Microbiol 56, 383-396. 9. Arricau, N., Hermant, D., Waxin, H., and Popoff, M.Y. (1997). Molecular characterization of the Salmonella typhi StpA protein that is related to both Yersinia YopE cytotoxin and YopH tyrosine phosphatase. Res Microbiol 148, 21-26. 10. Bach, H., Wong, D., and Av-Gay, Y. (2009). Mycobacterium tuberculosis PtkA is a novel protein tyrosine kinase whose substrate is PtpA. Biochem J 420, 155-160. 11. Banu, L.D., Conrads, G., Rehrauer, H., Hussain, H., Allan, E., and van der Ploeg, J.R. (2010). The Streptococcus mutans serine/threonine kinase, PknB, regulates competence development, bacteriocin production, and cell wall metabolism. Infect Immun 78, 2209-2220. 12. Barthe, P., Mukamolova, G.V., Roumestand, C., and Cohen-Gonsaud, M. (2010). The structure of PknB extracellular PASTA domain from mycobacterium tuberculosis suggests a ligand-dependent kinase activation. Structure 18, 606-615. 13. Barthe, P., Roumestand, C., Canova, M.J., Kremer, L., Hurard, C., Molle, V., and Cohen-Gonsaud, M. (2009). Dynamic and structural characterization of a bacterial FHA protein reveals a new autoinhibition mechanism. Structure 17, 568-578. 14. Bashkirov, V.I., Herzberg, K., Haghnazari, E., Vlasenko, A.S., and Heyer, W.D. (2006). DNA damage-induced phosphorylation of Rad55 protein as a sentinel for DNA damage checkpoint activation in S. cerevisiae. Methods Enzymol 409, 166-182. 15. Battista, J.R., Cox, M.M., Daly, M.J., Narumi, I., Radman, M., and Sommer, S. (2003). The structure of D. radiodurans. Science 302, 567-568; author reply 567-568.

123

16. Beltramini, A.M., Mukhopadhyay, C.D., and Pancholi, V. (2009). Modulation of cell wall structure and antimicrobial susceptibility by a Staphylococcus aureus eukaryote- like serine/threonine kinase and phosphatase. Infect Immun 77, 1406-1416. 17. Bendt, A.K., Burkovski, A., Schaffer, S., Bott, M., Farwick, M., and Hermann, T. (2003). Towards a phosphoproteome map of Corynebacterium glutamicum. Proteomics 3, 1637-1646. 18. Bernardini, G., Laschi, M., Serchi, T., Arena, S., D'Ambrosio, C., Braconi, D., Scaloni, A., and Santucci, A. (2011). Mapping phosphoproteins in Neisseria meningitidis serogroup A. Proteomics 11, 1351-1358. 19. Blanchard, K.C., Dearborn, E.H., Lasagna, L.C., and Buhle, E.L. (1952). The antidiuretic activity of some organic acids. Bull Johns Hopkins Hosp 91, 330-340. 20. Bliska, J.B. (2000). Yop effectors of Yersinia spp. and actin rearrangements. Trends Microbiol 8, 205-208. 21. Bobay, B.G., Benson, L., Naylor, S., Feeney, B., Clark, A.C., Goshe, M.B., Strauch, M.A., Thompson, R., and Cavanagh, J. (2004). Evaluation of the DNA binding tendencies of the transition state regulator AbrB. Biochemistry 43, 16106-16118. 22. Boitel, B., Ortiz-Lombardia, M., Duran, R., Pompeo, F., Cole, S.T., Cervenansky, C., and Alzari, P.M. (2003). PknB kinase activity is regulated by phosphorylation in two Thr residues and dephosphorylation by PstP, the cognate phospho-Ser/Thr phosphatase, in Mycobacterium tuberculosis. Mol Microbiol 49, 1493-1508. 23. Bork, P., Brown, N.P., Hegyi, H., and Schultz, J. (1996). The protein phosphatase 2C (PP2C) superfamily: detection of bacterial homologues. Protein Sci 5, 1421-1425. 24. Branda, S.S., Gonzalez-Pastor, J.E., Ben-Yehuda, S., Losick, R., and Kolter, R. (2001). Fruiting body formation by Bacillus subtilis. Proc Natl Acad Sci U S A 98, 11621-11626. 25. Bras, A.M., Chatterjee, S., Wren, B.W., Newell, D.G., and Ketley, J.M. (1999). A novel Campylobacter jejuni two-component regulatory system important for temperature-dependent growth and colonization. J Bacteriol 181, 3298-3302. 26. Brockmeier, U., Caspers, M., Freudl, R., Jockwer, A., Noll, T., and Eggert, T. (2006). Systematic screening of all signal peptides from Bacillus subtilis: a powerful strategy in optimizing heterologous protein secretion in Gram-positive bacteria. J Mol Biol 362, 393-402. 27. Bugert, P., and Geider, K. (1997). Characterization of the amsI gene product as a low molecular weight acid phosphatase controlling exopolysaccharide synthesis of Erwinia amylovora. FEBS Lett 400, 252-256. 28. Burbulys, D., Trach, K.A., and Hoch, J.A. (1991). Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell 64, 545-552. 29. Burnett, G., and Kennedy, E.P. (1954). The enzymatic phosphorylation of proteins. J Biol Chem 211, 969-980. 30. Calera, J.A., and Calderone, R. (1999). Flocculation of hyphae is associated with a deletion in the putative CaHK1 two-component histidine kinase gene from Candida albicans. Microbiology 145 ( Pt 6), 1431-1442.

124

31. Canova, M.J., Kremer, L., and Molle, V. (2009). The Mycobacterium tuberculosis GroEL1 chaperone is a substrate of Ser/Thr protein kinases. J Bacteriol 191, 2876- 2883. 32. Canova, M.J., Veyron-Churlet, R., Zanella-Cleon, I., Cohen-Gonsaud, M., Cozzone, A.J., Becchi, M., Kremer, L., and Molle, V. (2008). The Mycobacterium tuberculosis serine/threonine kinase PknL phosphorylates Rv2175c: mass spectrometric profiling of the activation loop phosphorylation sites and their role in the recruitment of Rv2175c. Proteomics 8, 521-533. 33. Chancey, S.T., Wood, D.W., and Pierson, L.S., 3rd (1999). Two-component transcriptional regulation of N-acyl-homoserine lactone production in Pseudomonas aureofaciens. Appl Environ Microbiol 65, 2294-2299. 34. Chang, C., Kwok, S.F., Bleecker, A.B., and Meyerowitz, E.M. (1993). Arabidopsis ethylene-response gene ETR1: similarity of product to two-component regulators. Science 262, 539-544. 35. Chao, J.D., Papavinasasundaram, K.G., Zheng, X., Chavez-Steenbock, A., Wang, X., Lee, G.Q., and Av-Gay, Y. (2010). Convergence of Ser/Thr and two-component signaling to coordinate expression of the dormancy regulon in Mycobacterium tuberculosis. J Biol Chem 285, 29239-29246. 36. Chen, Z., Yang, H., and Pavletich, N.P. (2008). Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structures. Nature 453, 489-484. 37. Chillemi, R., Simpore, J., Persichilli, S., Minucci, A., D'Agata, A., and Musumeci, S. (2005). Elevated levels of plasma homocysteine in postmenopausal women in Burkina Faso. Clin Chem Lab Med 43, 765-771. 38. Cho, K., and Zusman, D.R. (1999). Sporulation timing in Myxococcus xanthus is controlled by the espAB locus. Mol Microbiol 34, 714-725. 39. Chopra, P., Singh, B., Singh, R., Vohra, R., Koul, A., Meena, L.S., Koduri, H., Ghildiyal, M., Deol, P., Das, T.K., et al. (2003). Phosphoprotein phosphatase of Mycobacterium tuberculosis dephosphorylates serine-threonine kinases PknA and PknB. Biochem Biophys Res Commun 311, 112-120. 40. Chu, F., Kearns, D.B., McLoon, A., Chai, Y., Kolter, R., and Losick, R. (2008). A novel regulatory protein governing biofilm formation in Bacillus subtilis. Mol Microbiol 68, 1117-1127. 41. Cohen-Gonsaud, M., Barthe, P., Canova, M.J., Stagier-Simon, C., Kremer, L., Roumestand, C., and Molle, V. (2009). The Mycobacterium tuberculosis Ser/Thr kinase substrate Rv2175c is a DNA-binding protein regulated by phosphorylation. J Biol Chem 284, 19290-19300. 42. Cortay, J.C., Rieul, C., Duclos, B., and Cozzone, A.J. (1986). Characterization of the phosphoproteins of Escherichia coli cells by electrophoretic analysis. Eur J Biochem 159, 227-237. 43. Cotter, P.D., Emerson, N., Gahan, C.G., and Hill, C. (1999). Identification and disruption of lisRK, a genetic locus encoding a two-component signal transduction system involved in stress tolerance and virulence in Listeria monocytogenes. J Bacteriol 181, 6840-6843.

125

44. Cox, M.M. (2003). The bacterial RecA protein as a motor protein. Annu Rev Microbiol 57, 551-577. 45. Cox, M.M. (2003). Better chemistry for better survival, through regulation. Cell 112, 286-287. 46. Cox, M.M. (2007). Regulation of bacterial RecA protein function. Crit Rev Biochem Mol Biol 42, 41-63. 47. Cozzone, A.J. (1988a). Protein phosphorylation in prokaryotes. Annu Rev Microbiol 42, 97-125. 48. Cozzone, A.J. (1998b). Post-translational modification of proteins by reversible phosphorylation in prokaryotes. Biochimie 80, 43-48. 49. Cozzone, A.J. (2005). Role of protein phosphorylation on serine/threonine and tyrosine in the virulence of bacterial pathogens. J Mol Microbiol Biotechnol 9, 198- 213. 50. Cozzone, A.J., Grangeasse, C., Doublet, P., and Duclos, B. (2004). Protein phosphorylation on tyrosine in bacteria. Arch Microbiol 181, 171-181. 51. Cutler, J.L., and Labadie, R.F. (2008). Effects of ototopical antihistamine on otitis media in an allergic rat. Laryngoscope 118, 283-287. 52. Dadssi, M., and Cozzone, A.J. (1990). Evidence of protein-tyrosine kinase activity in the bacterium Acinetobacter calcoaceticus. J Biol Chem 265, 20996-20999. 53. Dahl, M.K., Msadek, T., Kunst, F., and Rapoport, G. (1992). The phosphorylation state of the DegU response regulator acts as a molecular switch allowing either degradative enzyme synthesis or expression of genetic competence in Bacillus subtilis. J Biol Chem 267, 14509-14514. 54. Dasgupta, A., Datta, P., Kundu, M., and Basu, J. (2006). The serine/threonine kinase PknB of Mycobacterium tuberculosis phosphorylates PBPA, a penicillin-binding protein required for cell division. Microbiology 152, 493-504. 55. Dean, A.M., and Koshland, D.E., Jr. (1990). Electrostatic and steric contributions to regulation at the active site of isocitrate dehydrogenase. Science 249, 1044-1046. 56. Dean, A.M., Lee, M.H., and Koshland, D.E., Jr. (1989). Phosphorylation inactivates Escherichia coli isocitrate dehydrogenase by preventing isocitrate binding. J Biol Chem 264, 20482-20486. 57. Delumeau, O., Dutta, S., Brigulla, M., Kuhnke, G., Hardwick, S.W., Volker, U., Yudkin, M.D., and Lewis, R.J. (2004). Functional and structural characterization of RsbU, a stress signaling protein phosphatase 2C. J Biol Chem 279, 40927-40937. 58. Deutscher, J., Herro, R., Bourand, A., Mijakovic, I., and Poncet, S. (2005b). P-Ser- HPr--a link between carbon metabolism and the virulence of some pathogenic bacteria. Biochim Biophys Acta 1754, 118-125. 59. Deutscher, J., and Saier, M.H., Jr. (2005a). Ser/Thr/Tyr protein phosphorylation in bacteria - for long time neglected, now well established. J Mol Microbiol Biotechnol 9, 125-131. 60. Didier, J.P., Cozzone, A.J., and Duclos, B. (2010). Phosphorylation of the virulence regulator SarA modulates its ability to bind DNA in Staphylococcus aureus. FEMS Microbiol Lett 306, 30-36.

126

61. Donat, S., Streker, K., Schirmeister, T., Rakette, S., Stehle, T., Liebeke, M., Lalk, M., and Ohlsen, K. (2009). Transcriptome and functional analysis of the eukaryotic-type serine/threonine kinase PknB in Staphylococcus aureus. J Bacteriol 191, 4056-4069. 62. Dorel, C., Vidal, O., Prigent-Combaret, C., Vallet, I., and Lejeune, P. (1999). Involvement of the Cpx signal transduction pathway of E. coli in biofilm formation. FEMS Microbiol Lett 178, 169-175. 63. Doublet, P., Grangeasse, C., Obadia, B., Vaganay, E., and Cozzone, A.J. (2002). Structural organization of the protein-tyrosine autokinase Wzc within Escherichia coli cells. J Biol Chem 277, 37339-37348. 64. Dubnau, D., Hahn, J., Roggiani, M., Piazza, F., and Weinrauch, Y. (1994). Two- component regulators and genetic competence in Bacillus subtilis. Res Microbiol 145, 403-411. 65. Duclos, B., Grangeasse, C., Vaganay, E., Riberty, M., and Cozzone, A.J. (1996). Autophosphorylation of a bacterial protein at tyrosine. J Mol Biol 259, 891-895. 66. Duncan, L., Alper, S., Arigoni, F., Losick, R., and Stragier, P. (1995). Activation of cell-specific transcription by a serine phosphatase at the site of asymmetric division. Science 270, 641-644. 67. Dutta, S., and Lewis, R.J. (2003). Crystallization and preliminary crystallographic analysis of the kinase-recruitment domain of the PP2C-type phosphatase RsbU. Acta Crystallogr D Biol Crystallogr 59, 191-193. 68. Eggler, A.L., Lusetti, S.L., and Cox, M.M. (2003). The C terminus of the Escherichia coli RecA protein modulates the DNA binding competition with single-stranded DNA-binding protein. J Biol Chem 278, 16389-16396. 69. Elsholz, A.K., Turgay, K., Michalik, S., Hessling, B., Gronau, K., Oertel, D., Mader, U., Bernhardt, J., Becher, D., Hecker, M., et al. (2012). Global impact of protein arginine phosphorylation on the physiology of Bacillus subtilis. Proc Natl Acad Sci U S A 109, 7451-7456. 70. Ernst, R.K., Guina, T., and Miller, S.I. (1999). How intracellular bacteria survive: surface modifications that promote resistance to host innate immune responses. J Infect Dis 179 Suppl 2, S326-330. 71. Eymann, C., Becher, D., Bernhardt, J., Gronau, K., Klutzny, A., and Hecker, M. (2007). Dynamics of protein phosphorylation on Ser/Thr/Tyr in Bacillus subtilis. Proteomics 7, 3509-3526. 72. Eymann, C., Dreisbach, A., Albrecht, D., Bernhardt, J., Becher, D., Gentner, S., Tam le, T., Buttner, K., Buurman, G., Scharf, C., et al. (2004). A comprehensive proteome map of growing Bacillus subtilis cells. Proteomics 4, 2849-2876. 73. Fabret, C., Feher, V.A., and Hoch, J.A. (1999). Two-component signal transduction in Bacillus subtilis: how one organism sees its world. J Bacteriol 181, 1975-1983. 74. Fabret, C., and Hoch, J.A. (1998). A two-component signal transduction system essential for growth of Bacillus subtilis: implications for anti-infective therapy. J Bacteriol 180, 6375-6383. 75. Federle, M.J., McIver, K.S., and Scott, J.R. (1999). A response regulator that represses transcription of several virulence operons in the group A streptococcus. J Bacteriol 181, 3649-3657.

127

76. Fischer, E.H., and Krebs, E.G. (1955). Conversion of phosphorylase b to phosphorylase a in muscle extracts. J Biol Chem 216, 121-132. 77. Fiuza, M., Canova, M.J., Patin, D., Letek, M., Zanella-Cleon, I., Becchi, M., Mateos, L.M., Mengin-Lecreulx, D., Molle, V., and Gil, J.A. (2008a). The MurC ligase essential for peptidoglycan biosynthesis is regulated by the serine/threonine protein kinase PknA in Corynebacterium glutamicum. J Biol Chem 283, 36553-36563. 78. Fiuza, M., Canova, M.J., Zanella-Cleon, I., Becchi, M., Cozzone, A.J., Mateos, L.M., Kremer, L., Gil, J.A., and Molle, V. (2008b). From the characterization of the four serine/threonine protein kinases (PknA/B/G/L) of Corynebacterium glutamicum toward the role of PknA and PknB in cell division. J Biol Chem 283, 18099-18112. 79. Flott, S., Kwon, Y., Pigli, Y.Z., Rice, P.A., Sung, P., and Jackson, S.P. (2011). Regulation of Rad51 function by phosphorylation. EMBO Rep 12, 833-839. 80. Fonville, N.C., Bates, D., Hastings, P.J., Hanawalt, P.C., and Rosenberg, S.M. (2010). Role of RecA and the SOS response in thymineless death in Escherichia coli. PLoS Genet 6, e1000865. 81. Freeman, J.A., and Bassler, B.L. (1999). A genetic analysis of the function of LuxO, a two-component response regulator involved in quorum sensing in Vibrio harveyi. Mol Microbiol 31, 665-677. 82. Fuhrmann, J., Schmidt, A., Spiess, S., Lehner, A., Turgay, K., Mechtler, K., Charpentier, E., and Clausen, T. (2009). McsB is a protein arginine kinase that phosphorylates and inhibits the heat-shock regulator CtsR. Science 324, 1323-1327. 83. Gaidenko, T.A., Kim, T.J., and Price, C.W. (2002). The PrpC serine-threonine phosphatase and PrkC kinase have opposing physiological roles in stationary-phase Bacillus subtilis cells. J Bacteriol 184, 6109-6114. 84. Gaidenko, T.A., Yang, X., Lee, Y.M., and Price, C.W. (1999). Threonine phosphorylation of modulator protein RsbR governs its ability to regulate a serine kinase in the environmental stress signaling pathway of Bacillus subtilis. J Mol Biol 288, 29-39. 85. Galperin, M.Y., Higdon, R., and Kolker, E. (2010). Interplay of heritage and habitat in the distribution of bacterial signal transduction systems. Mol Biosyst 6, 721-728. 86. Giefing, C., Jelencsics, K.E., Gelbmann, D., Senn, B.M., and Nagy, E. (2010). The pneumococcal eukaryotic-type serine/threonine protein kinase StkP co-localizes with the cell division apparatus and interacts with FtsZ in vitro. Microbiology 156, 1697- 1707. 87. Grangeasse, C., Cozzone, A.J., Deutscher, J., and Mijakovic, I. (2007). Tyrosine phosphorylation: an emerging regulatory device of bacterial physiology. Trends Biochem Sci 32, 86-94. 88. Grangeasse, C., Doublet, P., and Cozzone, A.J. (2002). Tyrosine phosphorylation of protein kinase Wzc from Escherichia coli K12 occurs through a two-step process. J Biol Chem 277, 7127-7135. 89. Grangeasse, C., Doublet, P., Vaganay, E., Vincent, C., Deleage, G., Duclos, B., and Cozzone, A.J. (1997). Characterization of a bacterial gene encoding an autophosphorylating protein tyrosine kinase. Gene 204, 259-265.

128

90. Grangeasse, C., Doublet, P., Vincent, C., Vaganay, E., Riberty, M., Duclos, B., and Cozzone, A.J. (1998). Functional characterization of the low-molecular-mass phosphotyrosine-protein phosphatase of Acinetobacter johnsonii. J Mol Biol 278, 339- 347. 91. Grangeasse, C., Obadia, B., Mijakovic, I., Deutscher, J., Cozzone, A.J., and Doublet, P. (2003). Autophosphorylation of the Escherichia coli protein kinase Wzc regulates tyrosine phosphorylation of Ugd, a UDP-glucose dehydrogenase. J Biol Chem 278, 39323-39329. 92. Greenstein, A.E., Echols, N., Lombana, T.N., King, D.S., and Alber, T. (2007a). Allosteric activation by dimerization of the PknD receptor Ser/Thr protein kinase from Mycobacterium tuberculosis. J Biol Chem 282, 11427-11435. 93. Greenstein, A.E., MacGurn, J.A., Baer, C.E., Falick, A.M., Cox, J.S., and Alber, T. (2007b). M. tuberculosis Ser/Thr protein kinase D phosphorylates an anti-anti-sigma factor homolog. PLoS Pathog 3, e49. 94. Grundner, C., Gay, L.M., and Alber, T. (2005). Mycobacterium tuberculosis serine/threonine kinases PknB, PknD, PknE, and PknF phosphorylate multiple FHA domains. Protein Sci 14, 1918-1921. 95. Gruszczyk, J., Fleurie, A., Olivares-Illana, V., Bechet, E., Zanella-Cleon, I., Morera, S., Meyer, P., Pompidor, G., Kahn, R., Grangeasse, C., et al. (2011). Structure analysis of the Staphylococcus aureus UDP-N-acetyl-mannosamine dehydrogenase Cap5O involved in capsular polysaccharide biosynthesis. J Biol Chem 286, 17112-17121. 96. Haaf, T., Golub, E.I., Reddy, G., Radding, C.M., and Ward, D.C. (1995). Nuclear foci of mammalian Rad51 recombination protein in somatic cells after DNA damage and its localization in synaptonemal complexes. Proc Natl Acad Sci U S A 92, 2298-2302. 97. Hagen, K.D., and Meeks, J.C. (1999). Biochemical and genetic evidence for participation of DevR in a phosphorelay signal transduction pathway essential for heterocyst maturation in Nostoc punctiforme ATCC 29133. J Bacteriol 181, 4430- 4434. 98. Hahn, J., Roggiani, M., and Dubnau, D. (1995). The major role of Spo0A in genetic competence is to downregulate abrB, an essential competence gene. J Bacteriol 177, 3601-3605. 99. Halbedel, S., Busse, J., Schmidl, S.R., and Stulke, J. (2006). Regulatory protein phosphorylation in Mycoplasma pneumoniae. A PP2C-type phosphatase serves to dephosphorylate HPr(Ser-P). J Biol Chem 281, 26253-26259. 100. Hamoen, L.W., Van Werkhoven, A.F., Venema, G., and Dubnau, D. (2000). The pleiotropic response regulator DegU functions as a priming protein in competence development in Bacillus subtilis. Proc Natl Acad Sci U S A 97, 9246-9251. 101. Hamon, M.A., Stanley, N.R., Britton, R.A., Grossman, A.D., and Lazazzera, B.A. (2004). Identification of AbrB-regulated genes involved in biofilm formation by Bacillus subtilis. Mol Microbiol 52, 847-860. 102. Hamon, M.A., Stanley, N.R., Britton, R.A., Grossman, A.D., and Lazazzera, B.A. (2004). Identification of AbrB-regulated genes involved in biofilm formation by Bacillus subtilis. Mol Microbiol 52, 847-860.

129

103. Hanks, S.K., and Hunter, T. (1995). Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J 9, 576-596. 104. Hanks, S.K., Quinn, A.M., and Hunter, T. (1988). The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 241, 42- 52. 105. Harmon, F.G., Rehrauer, W.M., and Kowalczykowski, S.C. (1996). Interaction of Escherichia coli RecA protein with LexA repressor. II. Inhibition of DNA strand exchange by the uncleavable LexA S119A repressor argues that recombination and SOS induction are competitive processes. J Biol Chem 271, 23874-23883. 106. Haruta, N., Yu, X., Yang, S., Egelman, E.H., and Cox, M.M. (2003). A DNA pairing-enhanced conformation of bacterial RecA proteins. J Biol Chem 278, 52710- 52723. 107. Hatakeyama, M., and Higashi, H. (2005). Helicobacter pylori CagA: a new paradigm for bacterial carcinogenesis. Cancer Sci 96, 835-843. 108. Herzberg, K., Bashkirov, V.I., Rolfsmeier, M., Haghnazari, E., McDonald, W.H., Anderson, S., Bashkirova, E.V., Yates, J.R., 3rd, and Heyer, W.D. (2006). Phosphorylation of Rad55 on serines 2, 8, and 14 is required for efficient homologous recombination in the recovery of stalled replication forks. Mol Cell Biol 26, 8396- 8409. 109. Hill, J., and Samuel, J.E. (2011). Coxiella burnetii acid phosphatase inhibits the release of reactive oxygen intermediates in polymorphonuclear leukocytes. Infect Immun 79, 414-420. 110. Hoch, J.A. (2000). Two-component and phosphorelay signal transduction. Curr Opin Microbiol 3, 165-170. 111. Hoch, J.A., and Varughese, K.I. (2001). Keeping signals straight in phosphorelay signal transduction. J Bacteriol 183, 4941-4949. 112. Hsu, F., Schwarz, S., and Mougous, J.D. (2009). TagR promotes PpkA- catalysed type VI secretion activation in Pseudomonas aeruginosa. Mol Microbiol 72, 1111-1125. 113. Huang, J., Carney, B.F., Denny, T.P., Weissinger, A.K., and Schell, M.A. (1995a). A complex network regulates expression of eps and other virulence genes of Pseudomonas solanacearum. J Bacteriol 177, 1259-1267. 114. Huang J, Schell M (1995b). Molecular characterization of the eps gene cluster of Pseudomonas solanacearum and its transcriptional regulation at a single promoter. Mol Microbiol; 16(5): 977–989.

115. Hunter, T. (1991). Protein kinase classification. Methods Enzymol 200, 3-37. 116. Hurley, J.H., Thorsness, P.E., Ramalingam, V., Helmers, N.H., Koshland, D.E., Jr., and Stroud, R.M. (1989). Structure of a bacterial enzyme regulated by phosphorylation, isocitrate dehydrogenase. Proc Natl Acad Sci U S A 86, 8635-8639.

130

117. Ilan, O., Bloch, Y., Frankel, G., Ullrich, H., Geider, K., and Rosenshine, I. (1999). Protein tyrosine kinases in bacterial pathogens are associated with virulence and production of exopolysaccharide. EMBO J 18, 3241-3248. 118. Imhof, L.A., Fudenberg, D., and Nowak, M.A. (2005). Evolutionary cycles of cooperation and defection. Proc Natl Acad Sci U S A 102, 10797-10800. 119. Iwanicki, A., Herman-Antosiewicz, A., Pierechod, M., Seror, S.J., and Obuchowski, M. (2002). PrpE, a PPP protein phosphatase from Bacillus subtilis with unusual substrate specificity. Biochem J 366, 929-936. 120. Jang, J., Stella, A., Boudou, F., Levillain, F., Darthuy, E., Vaubourgeix, J., Wang, C., Bardou, F., Puzo, G., Gilleron, M., et al. (2010). Functional characterization of the Mycobacterium tuberculosis serine/threonine kinase PknJ. Microbiology 156, 1619-1631. 121. Jault, J.M., Fieulaine, S., Nessler, S., Gonzalo, P., Di Pietro, A., Deutscher, J., and Galinier, A. (2000). The HPr kinase from Bacillus subtilis is a homo-oligomeric enzyme which exhibits strong positive cooperativity for nucleotide and fructose 1,6- bisphosphate binding. J Biol Chem 275, 1773-1780. 122. Jers, C., Kobir, A., Sondergaard, E.O., Jensen, P.R., and Mijakovic, I. (2011). Bacillus subtilis two-component system sensory kinase DegS is regulated by serine phosphorylation in its input domain. PLoS One 6, e14653. 123. Jers, C., Pedersen, M.M., Paspaliari, D.K., Schutz, W., Johnsson, C., Soufi, B., Macek, B., Jensen, P.R., and Mijakovic, I. (2010). Bacillus subtilis BY-kinase PtkA controls enzyme activity and localization of its protein substrates. Mol Microbiol 77, 287-299. 124. Jers, C., Soufi, B., Grangeasse, C., Deutscher, J., and Mijakovic, I. (2008). Phosphoproteomics in bacteria: towards a systemic understanding of bacterial phosphorylation networks. Expert Rev Proteomics 5, 619-627. 125. Jin, H., and Pancholi, V. (2006). Identification and biochemical characterization of a eukaryotic-type serine/threonine kinase and its cognate phosphatase in Streptococcus pyogenes: their biological functions and substrate identification. J Mol Biol 357, 1351-1372. 126. Jofre, E., and Becker, A. (2009). Production of succinoglycan polymer in Sinorhizobium meliloti is affected by SMb21506 and requires the N-terminal domain of ExoP. Mol Plant Microbe Interact 22, 1656-1668. 127. Johnson, L.N., and Lewis, R.J. (2001). Structural basis for control by phosphorylation. Chem Rev 101, 2209-2242. 128. Kang, C.M., Abbott, D.W., Park, S.T., Dascher, C.C., Cantley, L.C., and Husson, R.N. (2005). The Mycobacterium tuberculosis serine/threonine kinases PknA and PknB: substrate identification and regulation of cell shape. Genes Dev 19, 1692- 1704. 129. Kang, C.M., Vijay, K., and Price, C.W. (1998). Serine kinase activity of a Bacillus subtilis switch protein is required to transduce environmental stress signals but not to activate its target PP2C phosphatase. Mol Microbiol 30, 189-196.

131

130. Kang, S., La, J., Yoon, H., and Park, K. (2008). A synthetic heterodyne interferometer for small amplitude of vibration measurement. Rev Sci Instrum 79, 053106. 131. Kastner, R., Dussurget, O., Archambaud, C., Kernbauer, E., Soulat, D., Cossart, P., and Decker, T. (2011). LipA, a tyrosine and lipid phosphatase involved in the virulence of Listeria monocytogenes. Infect Immun 79, 2489-2498. 132. Kennelly, P.J. (2002). Protein kinases and protein phosphatases in prokaryotes: a genomic perspective. FEMS Microbiol Lett 206, 1-8. 133. Kidane, D., and Graumann, P.L. (2005). Dynamic formation of RecA filaments at DNA double strand break repair centers in live cells. J Cell Biol 170, 357-366. 134. Klein, G., Dartigalongue, C., and Raina, S. (2003). Phosphorylation-mediated regulation of heat shock response in Escherichia coli. Mol Microbiol 48, 269-285. 135. Klumpp, S., and Krieglstein, J. (2002). Phosphorylation and dephosphorylation of histidine residues in proteins. Eur J Biochem 269, 1067-1071. 136. Kobayashi, K. (2007). Gradual activation of the response regulator DegU controls serial expression of genes for flagellum formation and biofilm formation in Bacillus subtilis. Mol Microbiol 66, 395-409. 137. Kobir, A., Shi, L., Boskovic, A., Grangeasse, C., Franjevic, D., and Mijakovic, I. (2011). Protein phosphorylation in bacterial signal transduction. Biochim Biophys Acta 1810, 989-994. 138. Kolot, M., Gorovits, R., Silberstein, N., Fichtman, B., and Yagil, E. (2008). Phosphorylation of the integrase protein of coliphage HK022. Virology 375, 383-390. 139. Kondrashov, F.A., Koonin, E.V., Morgunov, I.G., Finogenova, T.V., and Kondrashova, M.N. (2006). Evolution of glyoxylate cycle enzymes in Metazoa: evidence of multiple horizontal transfer events and pseudogene formation. Biol Direct 1, 31. 140. Kornev, A.P., and Taylor, S.S. (2010). Defining the conserved internal architecture of a protein kinase. Biochim Biophys Acta 1804, 440-444. 141. Koul, A., Choidas, A., Treder, M., Tyagi, A.K., Drlica, K., Singh, Y., and Ullrich, A. (2000). Cloning and characterization of secretory tyrosine phosphatases of Mycobacterium tuberculosis. J Bacteriol 182, 5425-5432. 142. Kouwen, T.R., van der Goot, A., Dorenbos, R., Winter, T., Antelmann, H., Plaisier, M.C., Quax, W.J., van Dijl, J.M., and Dubois, J.Y. (2007). Thiol-disulphide oxidoreductase modules in the low-GC Gram-positive bacteria. Mol Microbiol 64, 984-999. 143. Kravanja, M., Engelmann, R., Dossonnet, V., Bluggel, M., Meyer, H.E., Frank, R., Galinier, A., Deutscher, J., Schnell, N., and Hengstenberg, W. (1999). The hprK gene of Enterococcus faecalis encodes a novel bifunctional enzyme: the HPr kinase/phosphatase. Mol Microbiol 31, 59-66. 144. Krupa, A., and Srinivasan, N. (2005). Diversity in domain architectures of Ser/Thr kinases and their homologues in prokaryotes. BMC Genomics 6, 129. 145. Kumagai, T., Kihara, H., Watanabe, W., Noda, M., Matoba, Y., and Sugiyama, M. (2009). A novel tyrosine-phosphorylated protein inhibiting the growth of Streptomyces cells. Biochem Biophys Res Commun 385, 534-538.

132

146. Kumar, P., Kumar, D., Parikh, A., Rananaware, D., Gupta, M., Singh, Y., and Nandicoori, V.K. (2009). The Mycobacterium tuberculosis protein kinase K modulates activation of transcription from the promoter of mycobacterial monooxygenase operon through phosphorylation of the transcriptional regulator VirS. J Biol Chem 284, 11090-11099. 147. Kunst, F., Msadek, T., Bignon, J., and Rapoport, G. (1994). The DegS/DegU and ComP/ComA two-component systems are part of a network controlling degradative enzyme synthesis and competence in Bacillus subtilis. Res Microbiol 145, 393-402. 148. Labadie, R.F., Noble, J.H., Dawant, B.M., Balachandran, R., Majdani, O., and Fitzpatrick, J.M. (2008). Clinical validation of percutaneous cochlear implant surgery: initial report. Laryngoscope 118, 1031-1039. 149. Lange, R., Wagner, C., de Saizieu, A., Flint, N., Molnos, J., Stieger, M., Caspers, P., Kamber, M., Keck, W., and Amrein, K.E. (1999). Domain organization and molecular characterization of 13 two-component systems identified by genome sequencing of Streptococcus pneumoniae. Gene 237, 223-234. 150. LaPorte, D.C. (1993). The isocitrate dehydrogenase phosphorylation cycle: regulation and enzymology. J Cell Biochem 51, 14-18. 151. LaPorte, D.C. (1993). The isocitrate dehydrogenase phosphorylation cycle: regulation and enzymology. J Cell Biochem 51, 14-18. 152. LaPorte, D.C., and Chung, T. (1985). A single gene codes for the kinase and phosphatase which regulate isocitrate dehydrogenase. J Biol Chem 260, 15291-15297. 153. Lee, D.C., Zheng, J., She, Y.M., and Jia, Z. (2008). Structure of Escherichia coli tyrosine kinase Etk reveals a novel activation mechanism. EMBO J 27, 1758- 1766. 154. Lee, D.H., Fudemberg, S.J., Davitt, B.V., and Cruz, O.A. (2005). Success of simple probing and irrigation in patients with nasolacrimal duct obstruction and otitis media. J AAPOS 9, 192-194. 155. Lee, Y., Kim, K., Suh, J.W., Rhee, S., and Lim, Y. (2007). Binding study of AfsK, a Ser/Thr kinase from Streptomyces coelicolor A3(2) and S-adenosyl-L- methionine. FEMS Microbiol Lett 266, 236-240. 156. Leonard, C.J., Aravind, L., and Koonin, E.V. (1998). Novel families of putative protein kinases in bacteria and archaea: evolution of the "eukaryotic" protein kinase superfamily. Genome Res 8, 1038-1047. 157. Levdikov, V.M., Blagova, E., Joseph, P., Sonenshein, A.L., and Wilkinson, A.J. (2006). The structure of CodY, a GTP- and isoleucine-responsive regulator of stationary phase and virulence in gram-positive bacteria. J Biol Chem 281, 11366- 11373. 158. Levine, A., Vannier, F., Absalon, C., Kuhn, L., Jackson, P., Scrivener, E., Labas, V., Vinh, J., Courtney, P., Garin, J., et al. (2006). Analysis of the dynamic Bacillus subtilis Ser/Thr/Tyr phosphoproteome implicated in a wide variety of cellular processes. Proteomics 6, 2157-2173.

133

159. Li, Y.P., Curley, G., Lopez, M., Chavez, M., Glew, R., Aragon, A., Kumar, H., and Baca, O.G. (1996). Protein-tyrosine phosphatase activity of Coxiella burnetii that inhibits human neutrophils. Acta Virol 40, 263-272. 160. Lin, M.H., Hsu, T.L., Lin, S.Y., Pan, Y.J., Jan, J.T., Wang, J.T., Khoo, K.H., and Wu, S.H. (2009). Phosphoproteomics of Klebsiella pneumoniae NTUH-K2044 reveals a tight link between tyrosine phosphorylation and virulence. Mol Cell Proteomics 8, 2613-2623. 161. Lin, W.J., Walthers, D., Connelly, J.E., Burnside, K., Jewell, K.A., Kenney, L.J., and Rajagopal, L. (2009). Threonine phosphorylation prevents promoter DNA binding of the Group B Streptococcus response regulator CovR. Mol Microbiol 71, 1477-1495. 162. Lippmann, J., Rothenburg, S., Deigendesch, N., Eitel, J., Meixenberger, K., van Laak, V., Slevogt, H., N'Guessan P, D., Hippenstiel, S., Chakraborty, T., et al. (2008). IFNbeta responses induced by intracellular bacteria or cytosolic DNA in different human cells do not require ZBP1 (DLM-1/DAI). Cell Microbiol 10, 2579- 2588. 163. Lomas-Lopez, R., Paracuellos, P., Riberty, M., Cozzone, A.J., and Duclos, B. (2007). Several enzymes of the central metabolism are phosphorylated in Staphylococcus aureus. FEMS Microbiol Lett 272, 35-42. 164. Lorenz, M.C., and Fink, G.R. (2002). Life and death in a macrophage: role of the glyoxylate cycle in virulence. Eukaryot Cell 1, 657-662. 165. Love, P.E., and Yasbin, R.E. (1986). Induction of the Bacillus subtilis SOS- like response by Escherichia coli RecA protein. Proc Natl Acad Sci U S A 83, 5204- 5208. 166. Lu, T., Tan, H., Lee, D., Chen, G., and Jia, Z. (2009). New insights into the activation of Escherichia coli tyrosine kinase revealed by molecular dynamics simulation and biochemical analysis. Biochemistry 48, 7986-7995. 167. Lusetti, S.L., and Cox, M.M. (2002). The bacterial RecA protein and the recombinational DNA repair of stalled replication forks. Annu Rev Biochem 71, 71- 100. 168. Lusetti, S.L., Shaw, J.J., and Cox, M.M. (2003). Magnesium ion-dependent activation of the RecA protein involves the C terminus. J Biol Chem 278, 16381- 16388. 169. Lusetti, S.L., Wood, E.A., Fleming, C.D., Modica, M.J., Korth, J., Abbott, L., Dwyer, D.W., Roca, A.I., Inman, R.B., and Cox, M.M. (2003). C-terminal deletions of the Escherichia coli RecA protein. Characterization of in vivo and in vitro effects. J Biol Chem 278, 16372-16380. 170. Macek, B., Gnad, F., Soufi, B., Kumar, C., Olsen, J.V., Mijakovic, I., and Mann, M. (2008). Phosphoproteome analysis of E. coli reveals evolutionary conservation of bacterial Ser/Thr/Tyr phosphorylation. Mol Cell Proteomics 7, 299- 307. 171. Macek, B., Mijakovic, I., Olsen, J.V., Gnad, F., Kumar, C., Jensen, P.R., and Mann, M. (2007). The serine/threonine/tyrosine phosphoproteome of the model bacterium Bacillus subtilis. Mol Cell Proteomics 6, 697-707.

134

172. Madec, E., Laszkiewicz, A., Iwanicki, A., Obuchowski, M., and Seror, S. (2002). Characterization of a membrane-linked Ser/Thr protein kinase in Bacillus subtilis, implicated in developmental processes. Mol Microbiol 46, 571-586. 173. Maeda, K., Tribble, G.D., Tucker, C.M., Anaya, C., Shizukuishi, S., Lewis, J.P., Demuth, D.R., and Lamont, R.J. (2008). A Porphyromonas gingivalis tyrosine phosphatase is a multifunctional regulator of virulence attributes. Mol Microbiol 69, 1153-1164. 174. Maeda, T., Wurgler-Murphy, S.M., and Saito, H. (1994). A two-component system that regulates an osmosensing MAP kinase cascade in yeast. Nature 369, 242- 245. 175. Manai, M., and Cozzone, A.J. (1979). Analysis of the protein-kinase activity of Escherichia coli cells. Biochem Biophys Res Commun 91, 819-826. 176. Manai, M., and Cozzone, A.J. (1982). Endogenous protein phosphorylation in Escherichia coli extracts. Biochem Biophys Res Commun 107, 981-988. 177. Manning, G., Whyte, D.B., Martinez, R., Hunter, T., and Sudarsanam, S. (2002). The protein kinase complement of the human genome. Science 298, 1912- 1934. 178. Marahiel, M.A., Nakano, M.M., and Zuber, P. (1993). Regulation of peptide antibiotic production in Bacillus. Mol Microbiol 7, 631-636. 179. Mascher, T., Helmann, J.D., and Unden, G. (2006). Stimulus perception in bacterial signal-transducing histidine kinases. Microbiol Mol Biol Rev 70, 910-938. 180. Matsumoto, A., Hong, S.K., Ishizuka, H., Horinouchi, S., and Beppu, T. (1994). Phosphorylation of the AfsR protein involved in secondary metabolism in Streptomyces species by a eukaryotic-type protein kinase. Gene 146, 47-56. 181. Matsumoto, A., Hong, S.K., Ishizuka, H., Horinouchi, S., and Beppu, T. (1994). Phosphorylation of the AfsR protein involved in secondary metabolism in Streptomyces species by a eukaryotic-type protein kinase. Gene 146, 47-56. 182. McEntee, K., Weinstock, G.M., and Lehman, I.R. (1979). Initiation of general recombination catalyzed in vitro by the recA protein of Escherichia coli. Proc Natl Acad Sci U S A 76, 2615-2619. 183. Michael M. Cox (2003) The bacterial protein as a motor protein;Annu. Rev. Microbiol.57:551–77

184. Mieczkowski, C., Iavarone, A.T., and Alber, T. (2008). Auto-activation mechanism of the Mycobacterium tuberculosis PknB receptor Ser/Thr kinase. EMBO J 27, 3186-3197. 185. Mijakovic, I., and Macek, B. (2012). Impact of phosphoproteomics on studies of bacterial physiology. FEMS Microbiol Rev 36, 877-892. 186. Mijakovic, I., Petranovic, D., Bottini, N., Deutscher, J., and Ruhdal Jensen, P. (2005). Protein-tyrosine phosphorylation in Bacillus subtilis. J Mol Microbiol Biotechnol 9, 189-197. 187. Mijakovic, I., Petranovic, D., Macek, B., Cepo, T., Mann, M., Davies, J., Jensen, P.R., and Vujaklija, D. (2006). Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine. Nucleic Acids Res 34, 1588-1596. 135

188. Mijakovic, I., Poncet, S., Boel, G., Maze, A., Gillet, S., Jamet, E., Decottignies, P., Grangeasse, C., Doublet, P., Le Marechal, P., et al. (2003). Transmembrane modulator-dependent bacterial tyrosine kinase activates UDP-glucose dehydrogenases. EMBO J 22, 4709-4718. 189. Mijakovic, I., Poncet, S., Galinier, A., Monedero, V., Fieulaine, S., Janin, J., Nessler, S., Marquez, J.A., Scheffzek, K., Hasenbein, S., et al. (2002). Pyrophosphate- producing protein dephosphorylation by HPr kinase/phosphorylase: a relic of early life? Proc Natl Acad Sci U S A 99, 13442-13447. 190. Mijakovic. I(2010) Protein Phosphorylation in Bacteria. Microbe. Volume 5, Number 1

191. Miller, M.L., Soufi, B., Jers, C., Blom, N., Macek, B., and Mijakovic, I. (2009). NetPhosBac - a predictor for Ser/Thr phosphorylation sites in bacterial proteins. Proteomics 9, 116-125. 192. Miller, M., et al. 2010. Staphylococcal PknB as the first prokaryotic representative of the proline-directed kinases. PLoS One 5:e9057.

193. Min, K.T., Hilditch, C.M., Diederich, B., Errington, J., and Yudkin, M.D. (1993). Sigma F, the first compartment-specific transcription factor of B. subtilis, is regulated by an anti-sigma factor that is also a protein kinase. Cell 74, 735-742. 194. Minic, Z., Marie, C., Delorme, C., Faurie, J.M., Mercier, G., Ehrlich, D., and Renault, P. (2007). Control of EpsE, the phosphoglycosyltransferase initiating exopolysaccharide synthesis in Streptococcus thermophilus, by EpsD tyrosine kinase. J Bacteriol 189, 1351-1357. 195. Mizuno, T. (1997). Compilation of all genes encoding two-component phosphotransfer signal transducers in the genome of Escherichia coli. DNA Res 4, 161-168. 196. Mizuno, T., Kaneko, T., and Tabata, S. (1996). Compilation of all genes encoding bacterial two-component signal transducers in the genome of the cyanobacterium, Synechocystis sp. strain PCC 6803. DNA Res 3, 407-414. 197. Molle, V., Brown, A.K., Besra, G.S., Cozzone, A.J., and Kremer, L. (2006). The condensing activities of the Mycobacterium tuberculosis type II fatty acid synthase are differentially regulated by phosphorylation. J Biol Chem 281, 30094- 30103. 198. Molle, V., Kremer, L., Girard-Blanc, C., Besra, G.S., Cozzone, A.J., and Prost, J.F. (2003). An FHA phosphoprotein recognition domain mediates protein EmbR phosphorylation by PknH, a Ser/Thr protein kinase from Mycobacterium tuberculosis. Biochemistry 42, 15300-15309. 199. Molle, V., Soulat, D., Jault, J.M., Grangeasse, C., Cozzone, A.J., and Prost, J.F. (2004). Two FHA domains on an ABC transporter, Rv1747, mediate its phosphorylation by PknF, a Ser/Thr protein kinase from Mycobacterium tuberculosis. FEMS Microbiol Lett 234, 215-223.

136

200. Morona, J.K., Morona, R., Miller, D.C., and Paton, J.C. (2002). Streptococcus pneumoniae capsule biosynthesis protein CpsB is a novel manganese-dependent phosphotyrosine-protein phosphatase. J Bacteriol 184, 577-583. 201. Morona, J.K., Morona, R., Miller, D.C., and Paton, J.C. (2003). Mutational analysis of the carboxy-terminal (YGX)4 repeat domain of CpsD, an autophosphorylating tyrosine kinase required for capsule biosynthesis in Streptococcus pneumoniae. J Bacteriol 185, 3009-3019. 202. Morona, J.K., Paton, J.C., Miller, D.C., and Morona, R. (2000). Tyrosine phosphorylation of CpsD negatively regulates capsular polysaccharide biosynthesis in streptococcus pneumoniae. Mol Microbiol 35, 1431-1442. 203. Mougous, J.D., Gifford, C.A., Ramsdell, T.L., and Mekalanos, J.J. (2007). Threonine phosphorylation post-translationally regulates protein secretion in Pseudomonas aeruginosa. Nat Cell Biol 9, 797-803. 204. Msadek, T., Kunst, F., Henner, D., Klier, A., Rapoport, G., and Dedonder, R. (1990). Signal transduction pathway controlling synthesis of a class of degradative enzymes in Bacillus subtilis: expression of the regulatory genes and analysis of mutations in degS and degU. J Bacteriol 172, 824-834. 205. Mukhopadhyay, A., and Kennelly, P.J. (2011). A low molecular weight protein tyrosine phosphatase from Synechocystis sp. strain PCC 6803: enzymatic characterization and identification of its potential substrates. J Biochem 149, 551-562. 206. Munoz-Dorado, J., Inouye, S., and Inouye, M. (1991). A gene encoding a protein serine/threonine kinase is required for normal development of M. xanthus, a gram-negative bacterium. Cell 67, 995-1006. 207. Murli, S., Watson, R.O., and Galan, J.E. (2001). Role of tyrosine kinases and the tyrosine phosphatase SptP in the interaction of Salmonella with host cells. Cell Microbiol 3, 795-810. 208. Murray, E.J., Kiley, T.B., and Stanley-Wall, N.R. (2009). A pivotal role for the response regulator DegU in controlling multicellular behaviour. Microbiology 155, 1- 8. 209. Musumeci, L., Bongiorni, C., Tautz, L., Edwards, R.A., Osterman, A., Perego, M., Mustelin, T., and Bottini, N. (2005). Low-molecular-weight protein tyrosine phosphatases of Bacillus subtilis. J Bacteriol 187, 4945-4956. 210. Nakar, D., and Gutnick, D.L. (2003). Involvement of a protein tyrosine kinase in production of the polymeric bioemulsifier emulsan from the oil-degrading strain Acinetobacter lwoffii RAG-1. J Bacteriol 185, 1001-1009. 211. Nariya, H., and Inouye, S. (2002). Activation of 6-phosphofructokinase via phosphorylation by Pkn4, a protein Ser/Thr kinase of Myxococcus xanthus. Mol Microbiol 46, 1353-1366. 212. Nariya, H., and Inouye, S. (2005a). Factors that modulate the Pkn4 kinase cascade in Myxococcus xanthus. J Mol Microbiol Biotechnol 9, 147-153. 213. Nariya, H., and Inouye, S. (2005b). Identification of a protein Ser/Thr kinase cascade that regulates essential transcriptional activators in Myxococcus xanthus development. Mol Microbiol 58, 367-379.

137

214. Nariya, H., and Inouye, S. (2006). A protein Ser/Thr kinase cascade negatively regulates the DNA-binding activity of MrpC, a smaller form of which may be necessary for the Myxococcus xanthus development. Mol Microbiol 60, 1205-1217. 215. Nicolas, P., Mader, U., Dervyn, E., Rochat, T., Leduc, A., Pigeonneau, N., Bidnenko, E., Marchadier, E., Hoebeke, M., Aymerich, S., et al. (2012). Condition- dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science 335, 1103-1106. 216. Niebisch, A., Kabus, A., Schultz, C., Weil, B., and Bott, M. (2006). Corynebacterial protein kinase G controls 2-oxoglutarate dehydrogenase activity via the phosphorylation status of the OdhI protein. J Biol Chem 281, 12300-12307. 217. Nixon, B.T., Ronson, C.W., and Ausubel, F.M. (1986). Two-component regulatory systems responsive to environmental stimuli share strongly conserved domains with the nitrogen assimilation regulatory genes ntrB and ntrC. Proc Natl Acad Sci U S A 83, 7850-7854. 218. Noble, J.H., Warren, F.M., Labadie, R.F., and Dawant, B.M. (2008). Automatic segmentation of the facial nerve and chorda tympani in CT images using spatially dependent feature values. Med Phys 35, 5375-5384. 219. Novakova, L., Bezouskova, S., Pompach, P., Spidlova, P., Saskova, L., Weiser, J., and Branny, P. (2010). Identification of multiple substrates of the StkP Ser/Thr protein kinase in Streptococcus pneumoniae. J Bacteriol 192, 3629-3638. 220. Novakova, L., Saskova, L., Pallova, P., Janecek, J., Novotna, J., Ulrych, A., Echenique, J., Trombe, M.C., and Branny, P. (2005). Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates. FEBS J 272, 1243-1254. 221. Obuchowski, M. (2005). [Serine-threonine protein phosphatases from Bacillus subtilis]. Postepy Biochem 51, 95-104. 222. Obuchowski, M., Madec, E., Delattre, D., Boel, G., Iwanicki, A., Foulger, D., and Seror, S.J. (2000). Characterization of PrpC from Bacillus subtilis, a member of the PPM phosphatase family. J Bacteriol 182, 5634-5638. 223. Ogura, M., Shimane, K., Asai, K., Ogasawara, N., and Tanaka, T. (2003). Binding of response regulator DegU to the aprE promoter is inhibited by RapG, which is counteracted by extracellular PhrG in Bacillus subtilis. Mol Microbiol 49, 1685- 1697. 224. Ogura, M., and Tanaka, T. (1996). Bacillus subtilis DegU acts as a positive regulator for comK expression. FEBS Lett 397, 173-176. 225. O'Hare, H.M., Duran, R., Cervenansky, C., Bellinzoni, M., Wehenkel, A.M., Pritsch, O., Obal, G., Baumgartner, J., Vialaret, J., Johnsson, K., et al. (2008). Regulation of glutamate metabolism by protein kinases in mycobacteria. Mol Microbiol 70, 1408-1423. 226. Ohlsen, K., and Donat, S. (2010). The impact of serine/threonine phosphorylation in Staphylococcus aureus. Int J Med Microbiol 300, 137-141. 227. Olivares-Illana, V., Meyer, P., Bechet, E., Gueguen-Chaignon, V., Soulat, D., Lazereg-Riquier, S., Mijakovic, I., Deutscher, J., Cozzone, A.J., Laprevote, O., et al.

138

(2008). Structural basis for the regulation mechanism of the tyrosine kinase CapB from Staphylococcus aureus. PLoS Biol 6, e143. 228. Ong, S.-E. (2002) Stable Isotope Labeling by Amino Acids in Cell Culture, SILAC, as a Simple and Accurate Approach to Expression Proteomics. Molecular & Cellular Proteomics 1, 376-386 229. Ortiz-Lombardia, M., Pompeo, F., Boitel, B., and Alzari, P.M. (2003). Crystal structure of the catalytic domain of the PknB serine/threonine kinase from Mycobacterium tuberculosis. J Biol Chem 278, 13094-13100. 230. Osaki, M., Arcondeguy, T., Bastide, A., Touriol, C., Prats, H., and Trombe, M.C. (2009). The StkP/PhpP signaling couple in Streptococcus pneumoniae: cellular organization and physiological characterization. J Bacteriol 191, 4943-4950. 231. Ostrovsky, P.C., and Maloy, S. (1995). Protein phosphorylation on serine, threonine, and tyrosine residues modulates membrane-protein interactions and transcriptional regulation in Salmonella typhimurium. Genes Dev 9, 2034-2041. 232. Paiment, A., Hocking, J., and Whitfield, C. (2002). Impact of phosphorylation of specific residues in the tyrosine autokinase, Wzc, on its activity in assembly of group 1 capsules in Escherichia coli. J Bacteriol 184, 6437-6447. 233. Paracuellos, P., Ballandras, A., Robert, X., Kahn, R., Herve, M., Mengin- Lecreulx, D., Cozzone, A.J., Duclos, B., and Gouet, P. (2010). The extended conformation of the 2.9-A crystal structure of the three-PASTA domain of a Ser/Thr kinase from the human pathogen Staphylococcus aureus. J Mol Biol 404, 847-858. 234. Parikh, A., Verma, S.K., Khan, S., Prakash, B., and Nandicoori, V.K. (2009). PknB-mediated phosphorylation of a novel substrate, N-acetylglucosamine-1- phosphate uridyltransferase, modulates its acetyltransferase activity. J Mol Biol 386, 451-464. 235. Park, S.T., Kang, C.M., and Husson, R.N. (2008). Regulation of the SigH stress response regulon by an essential protein kinase in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 105, 13105-13110. 236. Parker, J.L., Jones, A.M., Serazetdinova, L., Saalbach, G., Bibb, M.J., and Naldrett, M.J. (2010). Analysis of the phosphoproteome of the multicellular bacterium Streptomyces coelicolor A3(2) by protein/peptide fractionation, phosphopeptide enrichment and high-accuracy mass spectrometry. Proteomics 10, 2486-2497. 237. Patel, M., Jiang, Q., Woodgate, R., Cox, M.M., and Goodman, M.F. (2010). A new model for SOS-induced mutagenesis: how RecA protein activates DNA polymerase V. Crit Rev Biochem Mol Biol 45, 171-184. 238. Pawson, T., and Scott, J.D. (2005). Protein phosphorylation in signaling--50 years and counting. Trends Biochem Sci 30, 286-290. 239. Perego, M., and Hoch, J.A. (1991). Negative regulation of Bacillus subtilis sporulation by the spo0E gene product. J Bacteriol 173, 2514-2520. 240. Pereira, S.F., Goss, L., and Dworkin, J. (2011). Eukaryote-like serine/threonine kinases and phosphatases in bacteria. Microbiol Mol Biol Rev 75, 192-212. 241. Perez, J., Castaneda-Garcia, A., Jenke-Kodama, H., Muller, R., and Munoz- Dorado, J. (2008). Eukaryotic-like protein kinases in the prokaryotes and the myxobacterial kinome. Proc Natl Acad Sci U S A 105, 15950-15955.

139

242. Perez, J., Garcia, R., Bach, H., de Waard, J.H., Jacobs, W.R., Jr., Av-Gay, Y., Bubis, J., and Takiff, H.E. (2006). Mycobacterium tuberculosis transporter MmpL7 is a potential substrate for kinase PknD. Biochem Biophys Res Commun 348, 6-12. 243. Phillips, Z.E., and Strauch, M.A. (2002). Bacillus subtilis sporulation and stationary phase gene expression. Cell Mol Life Sci 59, 392-402. 244. Pietack, N., Becher, D., Schmidl, S.R., Saier, M.H., Hecker, M., Commichau, F.M., and Stulke, J. (2010). In vitro phosphorylation of key metabolic enzymes from Bacillus subtilis: PrkC phosphorylates enzymes from different branches of basic metabolism. J Mol Microbiol Biotechnol 18, 129-140. 245. Pietack, N., Becher, D., Schmidl, S.R., Saier, M.H., Hecker, M., Commichau, F.M., and Stulke, J. (2010). In vitro phosphorylation of key metabolic enzymes from Bacillus subtilis: PrkC phosphorylates enzymes from different branches of basic metabolism. J Mol Microbiol Biotechnol 18, 129-140. 246. Pingitore, A., Galli, E., Barison, A., Iervasi, A., Scarlattini, M., Nucci, D., L'Abbate, A., Mariotti, R., and Iervasi, G. (2008). Acute effects of triiodothyronine (T3) replacement therapy in patients with chronic heart failure and low-T3 syndrome: a randomized, placebo-controlled study. J Clin Endocrinol Metab 93, 1351-1358. 247. Poncet, S., Mijakovic, I., Nessler, S., Gueguen-Chaignon, V., Chaptal, V., Galinier, A., Boel, G., Maze, A., and Deutscher, J. (2004). HPr kinase/phosphorylase, a Walker motif A-containing bifunctional sensor enzyme controlling catabolite repression in Gram-positive bacteria. Biochim Biophys Acta 1697, 123-135. 248. Preneta, R., Jarraud, S., Vincent, C., Doublet, P., Duclos, B., Etienne, J., and Cozzone, A.J. (2002). Isolation and characterization of a protein-tyrosine kinase and a phosphotyrosine-protein phosphatase from Klebsiella pneumoniae. Comp Biochem Physiol B Biochem Mol Biol 131, 103-112. 249. Prisic, S., Dankwa, S., Schwartz, D., Chou, M.F., Locasale, J.W., Kang, C.M., Bemis, G., Church, G.M., Steen, H., and Husson, R.N. (2010). Extensive phosphorylation with overlapping specificity by Mycobacterium tuberculosis serine/threonine protein kinases. Proc Natl Acad Sci U S A 107, 7521-7526. 250. Ptacek, J., Devgan, G., Michaud, G., Zhu, H., Zhu, X., Fasolo, J., Guo, H., Jona, G., Breitkreutz, A., Sopko, R., et al. (2005). Global analysis of protein phosphorylation in yeast. Nature 438, 679-684. 251. Rahmsdorf, H.J., Herrlich, P., Pai, S.H., Schweiger, M., and Wittmann, H.G. (1973). Ribosomes after infection with bacteriophage T4 and T7. Mol Gen Genet 127, 259-271. 252. Rahmsdorf, H.J., Pai, S.H., Ponta, H., Herrlich, P., Roskoski, R., Jr., Schweiger, M., and Studier, F.W. (1974). Protein kinase induction in Escherichia coli by bacteriophage T7. Proc Natl Acad Sci U S A 71, 586-589. 253. Raivio, T.L., Popkin, D.L., and Silhavy, T.J. (1999). The Cpx envelope stress response is controlled by amplification and feedback inhibition. J Bacteriol 181, 5263- 5272. 254. Rajagopal, L., Clancy, A., and Rubens, C.E. (2003). A eukaryotic type serine/threonine kinase and phosphatase in Streptococcus agalactiae reversibly

140

phosphorylate an inorganic pyrophosphatase and affect growth, cell segregation, and virulence. J Biol Chem 278, 14429-14441. 255. Rajagopal, L., Vo, A., Silvestroni, A., and Rubens, C.E. (2005). Regulation of purine biosynthesis by a eukaryotic-type kinase in Streptococcus agalactiae. Mol Microbiol 56, 1329-1346. 256. Rajagopal, L., Vo, A., Silvestroni, A., and Rubens, C.E. (2006). Regulation of cytotoxin expression by converging eukaryotic-type and two-component signalling mechanisms in Streptococcus agalactiae. Mol Microbiol 62, 941-957. 257. Rantanen, M.K., Lehtio, L., Rajagopal, L., Rubens, C.E., and Goldman, A. (2007). Structure of Streptococcus agalactiae serine/threonine phosphatase. The subdomain conformation is coupled to the binding of a third metal ion. FEBS J 274, 3128-3137. 258. Ravichandran, A., Sugiyama, N., Tomita, M., Swarup, S., and Ishihama, Y. (2009). Ser/Thr/Tyr phosphoproteome analysis of pathogenic and non-pathogenic Pseudomonas species. Proteomics 9, 2764-2775. 259. Reid, A.N., and Whitfield, C. (2005). functional analysis of conserved gene products involved in assembly of Escherichia coli capsules and exopolysaccharides: evidence for molecular recognition between Wza and Wzc for colanic acid biosynthesis. J Bacteriol 187, 5470-5481. 260. Reiterer, V., Grossniklaus, L., Tschon, T., Kasper, C.A., Sorg, I., and Arrieumerlou, C. (2011). Shigella flexneri type III secreted effector OspF reveals new crosstalks of proinflammatory signaling pathways during bacterial infection. Cell Signal 23, 1188-1196. 261. Rimington, C. (1927). The Phosphorus of Caseinogen: Constitution of Phosphopeptone. Biochem J 21, 1187-1193. 262. Robinson, V.L., Buckler, D.R., and Stock, A.M. (2000). A tale of two components: a novel kinase and a regulatory switch. Nat Struct Biol 7, 626-633. 263. Robu, M.E., Inman, R.B., and Cox, M.M. (2004). Situational repair of replication forks: roles of RecG and RecA proteins. J Biol Chem 279, 10973-10981. 264. Roca, A.I., and Cox, M.M. (1997). RecA protein: structure, function, and role in recombinational DNA repair. Prog Nucleic Acid Res Mol Biol 56, 129-223. 265. Rubens, C.E., Heggen, L.M., Haft, R.F., and Wessels, M.R. (1993). Identification of cpsD, a gene essential for type III capsule expression in group B streptococci. Mol Microbiol 8, 843-855. 266. Saile, E., and Koehler, T.M. (2002). Control of anthrax toxin gene expression by the transition state regulator abrB. J Bacteriol 184, 370-380. 267. Schlicker, C., Fokina, O., Kloft, N., Grune, T., Becker, S., Sheldrick, G.M., and Forchhammer, K. (2008). Structural analysis of the PP2C phosphatase tPphA from Thermosynechococcus elongatus: a flexible flap subdomain controls access to the catalytic site. J Mol Biol 376, 570-581. 268. Schmidl, S.R., Gronau, K., Hames, C., Busse, J., Becher, D., Hecker, M., and Stulke, J. (2010a). The stability of cytadherence proteins in Mycoplasma pneumoniae requires activity of the protein kinase PrkC. Infect Immun 78, 184-192.

141

269. Schmidl, S.R., Gronau, K., Pietack, N., Hecker, M., Becher, D., and Stulke, J. (2010b). The phosphoproteome of the minimal bacterium Mycoplasma pneumoniae: analysis of the complete known Ser/Thr kinome suggests the existence of novel kinases. Mol Cell Proteomics 9, 1228-1242. 270. Schultz, C., Niebisch, A., Schwaiger, A., Viets, U., Metzger, S., Bramkamp, M., and Bott, M. (2009a). Genetic and biochemical analysis of the serine/threonine protein kinases PknA, PknB, PknG and PknL of Corynebacterium glutamicum: evidence for non-essentiality and for phosphorylation of OdhI and FtsZ by multiple kinases. Mol Microbiol 74, 724-741. 271. Schultz, D., Wolynes, P.G., Ben Jacob, E., and Onuchic, J.N. (2009b). Deciding fate in adverse times: sporulation and competence in Bacillus subtilis. Proc Natl Acad Sci U S A 106, 21027-21034. 272. Seibel, N.L., Steinherz, P.G., Sather, H.N., Nachman, J.B., Delaat, C., Ettinger, L.J., Freyer, D.R., Mattano, L.A., Jr., Hastings, C.A., Rubin, C.M., et al. (2008). Early postinduction intensification therapy improves survival for children and adolescents with high-risk acute lymphoblastic leukemia: a report from the Children's Oncology Group. Blood 111, 2548-2555. 273. Selbach, M., Moese, S., Hurwitz, R., Hauck, C.R., Meyer, T.F., and Backert, S. (2003). The Helicobacter pylori CagA protein induces cortactin dephosphorylation and actin rearrangement by c-Src inactivation. EMBO J 22, 515-528. 274. Shah, I.M., and Dworkin, J. (2010). Induction and regulation of a secreted peptidoglycan hydrolase by a membrane Ser/Thr kinase that detects muropeptides. Mol Microbiol 75, 1232-1243. 275. Shah, I.M., Laaberki, M.H., Popham, D.L., and Dworkin, J. (2008). A eukaryotic-like Ser/Thr kinase signals bacteria to exit dormancy in response to peptidoglycan fragments. Cell 135, 486-496. 276. Shakir, S.M., Bryant, K.M., Larabee, J.L., Hamm, E.E., Lovchik, J., Lyons, C.R., and Ballard, J.D. (2010). Regulatory interactions of a virulence-associated serine/threonine phosphatase-kinase pair in Bacillus anthracis. J Bacteriol 192, 400- 409. 277. Sharma, K., Gupta, M., Krupa, A., Srinivasan, N., and Singh, Y. (2006). EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine/threonine kinases and phosphatase in Mycobacterium tuberculosis. FEBS J 273, 2711-2721. 278. Shi L, Potts M, Kennelly PJ.(1998)The serine, threonine, and/or tyrosine- specific protein kinases and protein phosphatases of prokaryotic organisms: a family portrait.FEMS Microbiol;22(4):229-53.

279. Shi, L., Kobir, A., Jers, C. and Mijakovic, I. (2010) Bacterial protein-tyrosine kinases. Curr proteomics

280. Shi, Y. (2009). Serine/threonine phosphatases: mechanism through structure. Cell 139, 468-484.

142

281. Shibata, T., Cunningham, R.P., DasGupta, C., and Radding, C.M. (1979). Homologous pairing in genetic recombination: complexes of recA protein and DNA. Proc Natl Acad Sci U S A 76, 5100-5104. 282. Shibata, T., Nishinaka, T., Mikawa, T., Aihara, H., Kurumizaka, H., Yokoyama, S., and Ito, Y. (2001). Homologous genetic recombination as an intrinsic dynamic property of a DNA structure induced by RecA/Rad51-family proteins: a possible advantage of DNA over RNA as genomic material. Proc Natl Acad Sci U S A 98, 8425-8432. 283. Sickmann, A., and Meyer, H.E. (2001). Phosphoamino acid analysis. Proteomics 1, 200-206. 284. Simmons, L.A., Grossman, A.D., and Walker, G.C. (2007). Replication is required for the RecA localization response to DNA damage in Bacillus subtilis. Proc Natl Acad Sci U S A 104, 1360-1365. 285. Singh, B., Singh, G., Trajkovic, V., and Sharma, P. (2003). Intracellular expression of Mycobacterium tuberculosis-specific 10-kDa antigen down-regulates macrophage B7.1 expression and nitric oxide release. Clin Exp Immunol 134, 70-77. 286. Singh, K.D., Halbedel, S., Gorke, B., and Stulke, J. (2007). Control of the phosphorylation state of the HPr protein of the phosphotransferase system in Bacillus subtilis: implication of the protein phosphatase PrpC. J Mol Microbiol Biotechnol 13, 165-171. 287. Singh, S.K., Matsuno, K., LaPorte, D.C., and Banaszak, L.J. (2001). Crystal structure of Bacillus subtilis isocitrate dehydrogenase at 1.55 A. Insights into the nature of substrate specificity exhibited by Escherichia coli isocitrate dehydrogenase kinase/phosphatase. J Biol Chem 276, 26154-26163. 288. Smart, G. et al.(2010) Rollin Like a Tank Wzc’s Involvement in Polysaccharide Secretion and Gliding Motility in Flavobacterium johnsoniae. Infection.

289. Smith, K.C., and Wang, T.C. (1989). recA-dependent DNA repair processes. Bioessays 10, 12-16. 290. Smith, K.C., Wang, T.V., and Sharma, R.C. (1987). recA-dependent DNA repair in UV-irradiated Escherichia coli. J Photochem Photobiol B 1, 1-11. 291. Soufi, B., Gnad, F., Jensen, P.R., Petranovic, D., Mann, M., Mijakovic, I., and Macek, B. (2008a). The Ser/Thr/Tyr phosphoproteome of Lactococcus lactis IL1403 reveals multiply phosphorylated proteins. Proteomics 8, 3486-3493. 292. Soufi, B., Jers, C., Hansen, M.E., Petranovic, D., and Mijakovic, I. (2008b). Insights from site-specific phosphoproteomics in bacteria. Biochim Biophys Acta 1784, 186-192. 293. Soufi, B., Kumar, C., Gnad, F., Mann, M., Mijakovic, I., and Macek, B. (2010). Stable isotope labeling by amino acids in cell culture (SILAC) applied to quantitative proteomics of Bacillus subtilis. J Proteome Res 9, 3638-3646.

143

294. Soulat, D., Jault, J.M., Duclos, B., Geourjon, C., Cozzone, A.J., and Grangeasse, C. (2006). Staphylococcus aureus operates protein-tyrosine phosphorylation through a specific mechanism. J Biol Chem 281, 14048-14056. 295. Soung, G.Y., Miller, J.L., Koc, H., and Koc, E.C. (2009). Comprehensive analysis of phosphorylated proteins of Escherichia coli ribosomes. J Proteome Res 8, 3390-3402. 296. South, S.L., Nichols, R., and Montie, T.C. (1994). Tyrosine kinase activity in Pseudomonas aeruginosa. Mol Microbiol 12, 903-910. 297. Stingele, F., Neeser, J.R., and Mollet, B. (1996). Identification and characterization of the eps (Exopolysaccharide) gene cluster from Streptococcus thermophilus Sfi6. J Bacteriol 178, 1680-1690. 298. Stock, A.M., Robinson, V.L., and Goudreau, P.N. (2000). Two-component signal transduction. Annu Rev Biochem 69, 183-215. 299. Strauch, M.A. (1995). Delineation of AbrB-binding sites on the Bacillus subtilis spo0H, kinB, ftsAZ, and pbpE promoters and use of a derived homology to identify a previously unsuspected binding site in the bsuB1 methylase promote. J Bacteriol 177, 6999-7002. 300. Strauch, M.A., Ballar, P., Rowshan, A.J., and Zoller, K.L. (2005). The DNA- binding specificity of the Bacillus anthracis AbrB protein. Microbiology 151, 1751- 1759. 301. Strauch, M.A., Spiegelman, G.B., Perego, M., Johnson, W.C., Burbulys, D., and Hoch, J.A. (1989). The transition state transcription regulator abrB of Bacillus subtilis is a DNA binding protein. EMBO J 8, 1615-1621. 302. Stueland, C.S., Gorden, K., and LaPorte, D.C. (1988). The isocitrate dehydrogenase phosphorylation cycle. Identification of the primary rate-limiting step. J Biol Chem 263, 19475-19479. 303. Sun, X., Ge, F., Xiao, C.L., Yin, X.F., Ge, R., Zhang, L.H., and He, Q.Y. (2010). Phosphoproteomic analysis reveals the multiple roles of phosphorylation in pathogenic bacterium Streptococcus pneumoniae. J Proteome Res 9, 275-282. 304. Sureka, K., Hossain, T., Mukherjee, P., Chatterjee, P., Datta, P., Kundu, M., and Basu, J. (2010). Novel role of phosphorylation-dependent interaction between FtsZ and FipA in mycobacterial cell division. PLoS One 5, e8590. 305. Sutherland, E.W., Jr., and Wosilait, W.D. (1955). Inactivation and activation of liver phosphorylase. Nature 175, 169-170. 306. Thakur, M., and Chakraborti, P.K. (2006). GTPase activity of mycobacterial FtsZ is impaired due to its transphosphorylation by the eukaryotic-type Ser/Thr kinase, PknA. J Biol Chem 281, 40107-40113. 307. Thakur, M., and Chakraborti, P.K. (2008). Ability of PknA, a mycobacterial eukaryotic-type serine/threonine kinase, to transphosphorylate MurD, a ligase involved in the process of peptidoglycan biosynthesis. Biochem J 415, 27-33. 308. Thomason, P.A., Traynor, D., Stock, J.B., and Kay, R.R. (1999). The RdeA- RegA system, a eukaryotic phospho-relay controlling cAMP breakdown. J Biol Chem 274, 27379-27384.

144

309. Thomasson, B., Link, J., Stassinopoulos, A.G., Burke, N., Plamann, L., and Hartzell, P.L. (2002). MglA, a small GTPase, interacts with a tyrosine kinase to control type IV pili-mediated motility and development of Myxococcus xanthus. Mol Microbiol 46, 1399-1413. 310. Traven, A., and Heierhorst, J. (2005). SQ/TQ cluster domains: concentrated ATM/ATR kinase phosphorylation site regions in DNA-damage-response proteins. Bioessays 27, 397-407. 311. Treuner-Lange, A., Ward, M.J., and Zusman, D.R. (2001). Pph1 from Myxococcus xanthus is a protein phosphatase involved in vegetative growth and development. Mol Microbiol 40, 126-140. 312. Trowsdale, J., Chen, S.M., and Hoch, J.A. (1979). Genetic analysis of a class of polymyxin resistant partial revertants of stage O sporulation mutants of Bacillus subtilis: map of the chromosome region near the origin of replication. Mol Gen Genet 173, 61-70. 313. Truong-Bolduc, Q.C., Ding, Y., and Hooper, D.C. (2008). Posttranslational modification influences the effects of MgrA on norA expression in Staphylococcus aureus. J Bacteriol 190, 7375-7381. 314. Tyagi, N., Anamika, K., and Srinivasan, N. (2010). A framework for classification of prokaryotic protein kinases. PLoS One 5, e10608. 315. Udo, H., Lam, C.K., Mori, S., Inouye, M., and Inouye, S. (2000). Identification of a substrate for Pkn2, a protein Ser/Thr kinase from Myxococcus xanthus by a novel method for substrate identification. J Mol Microbiol Biotechnol 2, 557-563. 316. Udo, H., Munoz-Dorado, J., Inouye, M., and Inouye, S. (1995). Myxococcus xanthus, a gram-negative bacterium, contains a transmembrane protein serine/threonine kinase that blocks the secretion of beta-lactamase by phosphorylation. Genes Dev 9, 972-983. 317. Ueda, A., and Wood, T.K. (2009). Connecting quorum sensing, c-di-GMP, pel polysaccharide, and biofilm formation in Pseudomonas aeruginosa through tyrosine phosphatase TpbA (PA3885). PLoS Pathog 5, e1000483. 318. Ulijasz, A.T., Falk, S.P., and Weisblum, B. (2009). Phosphorylation of the RitR DNA-binding domain by a Ser-Thr phosphokinase: implications for global gene regulation in the streptococci. Mol Microbiol 71, 382-390. 319. Umeyama, T., Tanabe, Y., Aigle, B.D., and Horinouchi, S. (1996). Expression of the Streptomyces coelicolor A3(2) ptpA gene encoding a phosphotyrosine protein phosphatase leads to overproduction of secondary metabolites in S. lividans. FEMS Microbiol Lett 144, 177-184. 320. Vaughn, J.L., Feher, V., Naylor, S., Strauch, M.A., and Cavanagh, J. (2000). Novel DNA binding domain and genetic regulation model of Bacillus subtilis transition state regulator abrB. Nat Struct Biol 7, 1139-1146. 321. Verhamme, D.T., Kiley, T.B., and Stanley-Wall, N.R. (2007). DegU coordinates multicellular behaviour exhibited by Bacillus subtilis. Mol Microbiol 65, 554-568.

145

322. Verma, A., and Maurelli, A.T. (2003). Identification of two eukaryote-like serine/threonine kinases encoded by Chlamydia trachomatis serovar L2 and characterization of interacting partners of Pkn1. Infect Immun 71, 5772-5784. 323. Veyron-Churlet, R., Molle, V., Taylor, R.C., Brown, A.K., Besra, G.S., Zanella-Cleon, I., Futterer, K., and Kremer, L. (2009). The Mycobacterium tuberculosis beta-ketoacyl-acyl carrier protein synthase III activity is inhibited by phosphorylation on a single threonine residue. J Biol Chem 284, 6414-6424. 324. Veyron-Churlet, R., Zanella-Cleon, I., Cohen-Gonsaud, M., Molle, V., and Kremer, L. (2010). Phosphorylation of the Mycobacterium tuberculosis beta-ketoacyl- acyl carrier protein reductase MabA regulates mycolic acid biosynthesis. J Biol Chem 285, 12714-12725. 325. Villarino, A., Duran, R., Wehenkel, A., Fernandez, P., England, P., Brodin, P., Cole, S.T., Zimny-Arndt, U., Jungblut, P.R., Cervenansky, C., et al. (2005). Proteomic identification of M. tuberculosis protein kinase substrates: PknB recruits GarA, a FHA domain-containing protein, through activation loop-mediated interactions. J Mol Biol 350, 953-963. 326. Vincent, C., Doublet, P., Grangeasse, C., Vaganay, E., Cozzone, A.J., and Duclos, B. (1999). Cells of Escherichia coli contain a protein-tyrosine kinase, Wzc, and a phosphotyrosine-protein phosphatase, Wzb. J Bacteriol 181, 3472-3477. 327. Vincent, C., Duclos, B., Grangeasse, C., Vaganay, E., Riberty, M., Cozzone, A.J., and Doublet, P. (2000). Relationship between exopolysaccharide production and protein-tyrosine phosphorylation in gram-negative bacteria. J Mol Biol 304, 311-321. 328. Vispe, S., and Defais, M. (1997). Mammalian Rad51 protein: a RecA homologue with pleiotropic functions. Biochimie 79, 587-592. 329. Walker, J.E., Saraste, M., Runswick, M.J., and Gay, N.J. (1982). Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J 1, 945-951. 330. Wang, J.Y., and Koshland, D.E., Jr. (1978). Evidence for protein kinase activities in the prokaryote Salmonella typhimurium. J Biol Chem 253, 7605-7608. 331. Wehenkel, A., Bellinzoni, M., Schaeffer, F., Villarino, A., and Alzari, P.M. (2007). Structural and binding studies of the three-metal center in two mycobacterial PPM Ser/Thr protein phosphatases. J Mol Biol 374, 890-898. 332. Whitmore, S.E., and Lamont, R.J. (2012). Tyrosine phosphorylation and bacterial virulence. Int J Oral Sci 4, 1-6. 333. Wong, S.M., Carroll, P.A., Rahme, L.G., Ausubel, F.M., and Calderwood, S.B. (1998). Modulation of expression of the ToxR regulon in Vibrio cholerae by a member of the two-component family of response regulators. Infect Immun 66, 5854- 5861. 334. Wosten, M.M., and Groisman, E.A. (1999). Molecular characterization of the PmrA regulon. J Biol Chem 274, 27185-27190. 335. Wu, J., Ohta, N., Zhao, J.L., and Newton, A. (1999). A novel bacterial tyrosine kinase essential for cell division and differentiation. Proc Natl Acad Sci U S A 96, 13068-13073.

146

336. Wugeditsch, T., Paiment, A., Hocking, J., Drummelsmith, J., Forrester, C., and Whitfield, C. (2001). Phosphorylation of Wzc, a tyrosine autokinase, is essential for assembly of group 1 capsular polysaccharides in Escherichia coli. J Biol Chem 276, 2361-2371. 337. Yang, X., Kang, C.M., Brody, M.S., and Price, C.W. (1996). Opposing pairs of serine protein kinases and phosphatases transmit signals of environmental stress to activate a bacterial transcription factor. Genes Dev 10, 2265-2275. 338. Yao, F., and Strauch, M.A. (2005). Independent and interchangeable multimerization domains of the AbrB, Abh, and SpoVT global regulatory proteins. J Bacteriol 187, 6354-6362. 339. Zhang, C.C. (1996). Bacterial signalling involving eukaryotic-type protein kinases. Mol Microbiol 20, 9-15. 340. Zhang, W., and Shi, L. (2004). Evolution of the PPM-family protein phosphatases in Streptomyces: duplication of catalytic domain and lateral recruitment of additional sensory domains. Microbiology 150, 4189-4197. 341. Zhao, X., and Lam, J.S. (2002). WaaP of Pseudomonas aeruginosa is a novel eukaryotic type protein-tyrosine kinase as well as a sugar kinase essential for the biosynthesis of core lipopolysaccharide. J Biol Chem 277, 4722-4730. 342. Zheng, X., Papavinasasundaram, K.G., and Av-Gay, Y. (2007). Novel substrates of Mycobacterium tuberculosis PknH Ser/Thr kinase. Biochem Biophys Res Commun 355, 162-168. 343. Zuber, P., and Losick, R. (1987). Role of AbrB in Spo0A- and Spo0B- dependent utilization of a sporulation promoter in Bacillus subtilis. J Bacteriol 169, 2223-2230.

147

Chapter 6

List of appendices

Current Proteomics, 2010, 7, 000-000 1 Bacterial Protein-Tyrosine Kinases

Lei Shi1, Ahasanul Kobir1, Carsten Jers2 and Ivan Mijakovic*,1

1Micalis UMR 1319, AgroParisTech-INRA, Domaine de Vilvert, 78352 Jouy-en-Josas, France France; 2Center for Sys- tems Microbiology, Technical University of Denmark, DK-2800 Lyngby, Denmark

Abstract: Bacteria and Eukarya share essentially the same family of protein-serine/threonine kinases, also known as the Hanks-type kinases. However, when it comes to protein-tyrosine phosphorylation, bacteria seem to have gone their own way. Bacterial protein-tyrosine kinases (BY-kinases) are bacterial enzymes that are unique in exploiting the ATP/GTP- binding Walker motif to catalyze phosphorylation of protein tyrosine residues. Characterized for the first time only a decade ago, BY-kinases have now come to the fore. Important regulatory roles have been linked with these enzymes, via their involvement in exopolysaccharide production, virulence, DNA metabolism, stress response and other key functions of the bacterial cell. BY-kinases act through autophosphorylation (mainly in exopolysaccharide production) and phosphorylation of other proteins, which have in most cases been shown to be activated by tyrosine phosphorylation. Protein-tyrosine phosphorylation in bacteria is particular with respect to very low occupancy of phosphorylation sites in vivo; this has represented a major challenge for detection techniques. Only the recent breakthroughs in gel-free high resolution mass spectrometry allowed the systematic detection of phosphorylated tyrosines by phosphoprotomics studies in bacteria. Other pioneering studies conducted in recent years, such as the first structures of BY-kinases and biochemical and phyiological studies of new BY-kinase substrates significantly furthered our understanding of these enzymes and highlighted their importance in bacterial physiology. Having no orthologues in Eukarya, BY-kinases are receiving a growing attention from the biomedical field, since they represent a particularly promising target for anti-bacterial drug design.

Keywords: Protein-tyrosine kinase / BY-kinase / bacteria / protein phosphorylation / phosphoproteome / signal transduction / cellular regulation

BY-KINASES IN BACTERIAL PHYSIOLOGY consists of an N-terminal transmembrane loop (of variable size), followed by a cytosolic catalytic domain that contains The literature in the research field of post-translational the ATP-binding site and a C-terminal tail of autophosphory- modifications of proteins abounds with statements that latable tyrosine residues [5]. A distinctive feature of these elaborate modifications found in Eukarya do not exist in enzymes is that they use a structural motif known as the P- Bacteria. On more than one occasion, this simply reflected loop (Walker motifs A and B) to constitute their active site. the fact that nobody had made a serious effort looking for This feature is shared by only a few bacterial protein-kinases them. Recent examples of “missing” modifications finally [8], whereas in Eukarya, Walker motifs are found in many found in bacteria are those of protein glycosylation [1], ace- ATP/GTPases [9], but not in protein kinases. In Firmicutes, tylation [2] and methylation [2]. In much the same spirit, the canonic BY-kinase gene has been split in two, encoding protein-tyrosine phosphorylation was considered non- separately the transmembrane domain and the cytosolic existant in bacteria, until the pioneering studies appeared in kinase, both of which maintain a tight functional interaction the mid nineties [3,4], identifying phosphorylated tyrosine despite being separated to independent polypeptide chains residues in bacterial proteins. These first studies reported (Fig. 1). The cause and functional consequences of this sepa- members of a new family of proteins that autophosphory- ration remain unclear, although some new leads have ap- lated on tyrosine, which were later named BY-kinases (for peared in recent studies and these will be discussed in the bacterial tyrosine kinases) [5], but are also known as poly- following chapter. saccharide copolymerases [6] due to multiple roles they play in the cellular physiology. BY-kinase-encoding genes have In the first phase of research on BY-kinases, since their since been identified in a majority of sequenced bacterial discovery in 1996 and up to 2003, these enzymes were con- genomes, and are thus considered widespread, if not ubiqui- sidered exclusively as autophosphorylating kinases. Initially, tous, in the bacterial kingdom [7]. BY-kinases account for BY-kinase autophosphorylation has been linked to the func- most tyrosine phosphorylation events identified in bacteria tional role of these enzymes in exopolysaccharide production so far, the exception being some unusual two-component in several bacterial systems that were studied, since they are systems that phosphorylate on tyrosine. A typical BY-kinase usually encoded by genes in the large operons involved in biosynthesis and export of sugar polymers [10]. One of the most exhaustively studied systems concerning BY-kinase *Address correspondence to this author at the Micalis UMR 1319, AgroP- implication in exopolysaccharide synthesis is the Proteobac- arisTech-INRA, F-78850 Thiverval-Grignon, FRANCE, Tel: +33(0)1 30 81 45 40, Fax: +33(0)1 30 81 54 57; teria model organism Escherichia coli. E. coli possesses two E-mail: [email protected] BY-kinases: Wzc encoded a gene in the operon which participates in the biosynthesis of polysaccharide polymers [11]

Fig. (1). Schematic representation of the two archetypal BY-kinase architectures. Proteobacteria have the two functional domains; transmembrane (green) and kinase (red) encoded by a single gene, and in Firmicutes these domains are independent proteins, encoded by separate genes. BY-kinases in both types of bacteria interact with the exopolysaccharide synthesis and translocation machinery (light blue), which is more complex in Proteobacteria where it has to traverse 2 membranes. The C-terminal end of the transmembrane domain that activates the kinase domain is represented in black. In Proteobacteria, this fragment is linked covalently to the kinase domain, and the active kinase domain is thus capable of phosphorylating the full set of its endogenous substrates (S1). In Firmicutes, the kinase is also activated by the C- terminal fragment of the transmembrane modulator, and can thus phosphorylate a set of physiological substrates (S1), as shown in case a). However, the kinase is free to dissociate from this modulator and meet other proteins that can accomplish this function (M2), and perhaps change its specificity towards another set of substrates (S2), as illustrated in case b). Finally, recent data indicate that the kinase can also co- localize with some of its substrates (S3), case c), although the physiological role of this co-localization is not clear at present. and Etk, encoded by a gene in the G4C operon which is re- [6]. A similar system has been described in Firmicutes, quired for formation of group 4 capsule (G4C) polysaccha- where the most extensively studied system with respect to ride [12]. It has been demonstrated that presence of Wzc and exopolysaccharide production is probably that of Streptococ- Etk is essential for synthesis of corresponding extracellular cus pneumoniae. The autophosphorylating BY-kinase CpsD polysaccharides. More to the point, the auto-phosphorylation is essential for capsular polysaccharide biosynthesis in S. of tyrosine residues in the C-termini of these BY-kinases is pneumoniae, where it regulates the amount of the synthe- the key feature in the assembly of capsular polysaccharides. sized capsular polysaccharide, which in turn affects the at- Both the phosphorylated and the non-phosphorylated forms tachment of the bacteria to the host cells and contributes to of Wzc are essential for polysaccharide polymer production the infection process [17,18]. Similar processes have been [13,14], and the current hypothesis is that the cycling be- described in a number of other bacteria [5]. An interesting tween phosphorylated and non-phosphorylated form of Wzc hypothesis has been put forward by Cuthbertson et al. [6] allows the polysaccharide polymer synthesis to proceed cor- who argue that co-polymerases may simply influence the rectly. Accordingly, Wzc and Etk have been classified as amount of produced polysaccharides by serving as molecular polysaccharide co-polymerases. In their co-polymerase ca- scaffolds for the other members of the translocon. The de- pacity, these BY-kinases have been shown to influence the tailed mechanism of the functional interaction between po- amount of polysaccharides as well as the length of the pro- lymerases and co-polymerases has not been entirely pin- duced polymer probably via an interaction with a polysac- pointed, but considerable efforts are currently directed at this charide polymerase Wzy [14-16]. An interesting observation question. from the evolutionary standpoint is that there are members of After the initial link between BY-kinase autophosphory- the polysaccharide co-polymerase family which contain the lation and exopolysaccharide production had been firmly transmembrane domain, but have no cytosolic kinase domain BY-Kinases Current Proteomics, 2010, Vol. 7, No. 3 3 established, this field took a new direction in the year 2003, UDP-acetyl-mannosamine dehydrogenase Cap5O [26], when several teams simultaneously published reports that whereas tyrosine-phosphorylation of Klebsiella pneumoniae BY-kinases can phosphorylate other endogenous proteins undecaprenolphosphate glycosyltransferase WcaJ has been substrates on tyrosine residues [19-21]. In each reported case reported as necessary for capsular polysaccharide synthesis the substrate activity was regulated by BY-kinase dependent [27]. The emergent phosphorylation networks based on BY- phosphorylation (Fig. 2). E. coli Etk was found to phos- kinases and their substrates hold promise of significant com- phorylate RpoH (an alternative heat shock sigma factor) and plexity. So far only one case of a single substrate phosphory- an anti-sigma factor RseA and thus participate in triggering lated by several kinases has been reported: E. coli Ugd phos- the heat shock response [19]. Its paralogue, Wzc [20], and a phorylated by Wzc and Etk [23]. However, the examples of BY-kinase orthologue from Bacillus subtilis, PtkA [21], one kinase phosphorylating several substrates are plenty: E. were found to phosphorylate UDP-glucose dehydrogenases coli Etk phosphorylates RpoH, RseA [19] and Ugd [23], and in their respective organisms. The molecular mechanism of B. subtilis PtkA phosphorylates UDP-glucose dehydro- activation of UDP-glucose dehydrogenases by BY-kinase genases Ugd and TuaD [21], as well as single-stranded dependent tyrosine phosphorylation has been studied in mo- DNA-binding proteins SsbA and SsbB [28]. Phosphorylation lecular detail [22-24], and in the process, Etk from E coli has of single-stranded DNA-binding proteins by BY-kinases, also been found to phosphorylate the cognate UDP-glucose which results in increased affinity for DNA, hinted at an dehydrogenases [23]. Although the mechanisms of UDP- interesting possibility that BY-kinases migh in fact be exten- glucose dehydrogenases activation are arguably not identical sively involved in regulating the DNA metabolism. B. sub- in E. coli [23] and B. subtilis [24], they both involve precise tilis cells devoid of PtkA exhibited a complex pleiotropic positioning of the phosphorylated tyrosine with respect to the phenotype with defects in the cell cycle, initiation of the bound substrate in the enzyme active site. Moreover, the DNA replication and chromosome distribution [29]. In addi- investigation of the activation mechanism in E. coli has shed tion to SsbA and SsbB, PtkA phosphorylates and regulates light on two parallel signal transduction pathways that inter- the activity of other proteins involved in B. subtilis single- sect at the level of UDP-glucose dehydrogenase phosphory- standed DNA metabolism, which may account for the com- lation; one involving Wzc and the colanic acid synthesis and plex phenotype of the !ptkA strain (Jers & Mijakovic, un- the other Etk and polymyxin resistance [23]. Examples of published results). In E. coli, the BY-kinase Wzc was found BY-kinases phosphorylating enzymes involved in the syn- to phosphorylate integrase proteins (Int) of coliphages thesis of sugar polymers have rapidly emerged in other bac- HK022 and ". Overexpression of Wzc in tyrosine- terial systems. S. thermophilus phosphoglycosyltransferase phosphatase deficient background resulted in a significantly EpsE is phosphorylated and activated by the cognate BY- reduced lysogenization, indicating that phosphorylation of kinase EpsD [25], Staphylococcus aureus BY-kinase Int down-regulates its activity [30]. Cap5B2 can phosphorylate and activate an endogenous

Fig. (2). Schematic representation of the physiological and regulatory roles of BY-kinases. BY-kinase autophosphorylation controls the involvement of these enzymes in the synthesis and translocation of sugar polymers. In addition, BY-kinases phosphorylate a number of intracellular substrates. Only well-studied cases are presented here, with clearly documented consequences for bacterial physiology. 4 Current Proteomics, 2010, Vol. 7, No. 3 Kobir et al.

Following the finding that heat shock response in E. coli the fact that the C-terminal part of the transmembrane modu- is modulated by the activity of the BY-kinase Etk [19], a link lator (protruding into the cytosol) stabilizes ATP binding by between tyrosine phosphorylation and heat shock was also hydrophobic sandwich interaction between the adenine ring published for B. subtilis. A protein with no homology to ca- and a phenylalanine residue of the modulator protein [36]. In nonical BY-kinases, McsB, was found to phosphorylate case of CapB, the non-phosphorylated kinase monomers, as CtsR, repressor of the heat-shock genes in the presence of a opposed to the case of Wzc, associated in an octameric ring modulator protein McsA [31]. By consequence, the tyrosine- structure, anchored to the membrane via interaction with the phosphorylated CtsR was reported to release its target DNA. transmembrane modulator CapA. Notably, one of the tyro- McsB was also found to act as a regulated adaptor protein sine residues in the C-terminal tyrosine cluster was found for ClpCP, the protease complex responsible for the degrada- bound to the active site of the neighbouring subunit, suggest- tion of CtsR [32]. The active, phosphorylated kinase McsB ing an inter-molecular phosphorylation mechanism. The fact interacts with both CtsR and ClpC, and targets CtsR to the that no tyrosine residue in the cluster is preferentially phos- ClpCP complex. Finally, in 2009 McsB seems to have been phorylated reflects a high degree of flexibility in that region. taken off the list of tyrosine kinases, and its status revised to An important conclusion from this study was that autophos- that of an arginine kinase [33]. It would be interesting to see phorylation of CapB is expected to induce dissociation of the whether this kinase has a dual specificity, or the discrepan- ring structure, by a conformational change that disrupts the cies between the two reports were due to different detection amino acid contacts at the interaction interface, while main- methods. This by no means diminished the importance of taining the interaction between individual CapB-CapA cou- previous findings that McsB functionally interacts with CtsR ples. The two BY-kinase structures also provided a rationale and ClpCP. At the same time, this new finding opened a new for the substrate specificity of Tyr vs Ser/Thr kinases and the chapter of bacterial protein phosphorylation at arginine resi- difference between BY-kinases and the structurally highly dues. similar ATPases such as MinD [40]. The resolved structures of BY-kinases have rekindled PROTEOBACTERIA VS. FIRMICUTES: DIFFERENT interest in a decade-old question, why are there distinct Pro- STRUCTURES FOR DIFFERENT REGULATORY teobacteria- and Firmicutes-type architectures; one with a STRATEGIES? single-polypeptide chain, and the other with two functional Important advances in the field of bacterial protein- domains (transmembrane and kinase) split in separate pro- tyrosine kinases were made recently in terms of structural teins (Fig. 1). BY-kinases in Proteobacteria have a large studies. The Walker motifs found in BY-kinases, and the extracellular (periplasmic) loop that allows them to interact overall sequence homology, had suggested that these pro- with the polysaccharide translocation machinery [6], and this teins might structurally resemble bacterial ATPases such as loop is significantly shorter in Firmicutes which lack the MinD and Soj [5]. The first structural insights came from the outer membrane and all corresponding structures. However, low resolution structure (14 Å) of E. coli BY-kinase Wzc in both types of BY-kinases are perfectly capable of phos- complex with the capsular polysaccharide translocon Wza phorylating various intra-cellular protein substrates, so this [34]. It revealed a Wzc tetramer that oligomerises via the particular activity (substrate phosphorylation and recognition periplasmic domains, and with its cytosolic kinase domains of multiple substrates) does not seem to be linked with any freely protruding into the cytosol (not interacting with each one of the two particular architectures. The structural study other). The functional insights derived from this structure on CapB indicated that upon octamer dissociation, each in- suggested that Wzc regulates export by triggering an dividual BY-kinase molecule remains in contact with its open/active conformation of the translocase Wza. More re- transmembrane modulator CapA, and were it ever to separate cently, two high resolution structures of BY-kinases were from it, it would become effectively inactive as a kinase, due published: Etk from E. coli [35] representing the Proteobac- to destabilization of the ATP-binding site [36]. And yet the teria-type BY-kinase architecture, and CapA/B from S. fact remains, BY-kinases in Firmicutes have evolved with an aureus [36] representing the Firmicutes-type BY-kinase ar- option to dissociate from their transmembrane modulators, chitecture. These structures provided insights into the func- which makes it rather difficult to imagine that they never do tional role of several conserved features. In a previous bio- so. Our group has recently performed localization studies on chemical study it was demonstrated that Etk homologue Wzc the BY-kinase PtkA in B. subtilis using fluorescent protein is activated through a two-step mechanism involving a con- fusions, and we were able to demonstrate that PtkA co- served tyrosine in the active site and the C-terminal tyrosine localizes with its transmembrane modulator TkmA under cluster [37]. The structure data combined with biochemical certain growth conditions, but we were equally able to iden- and in silico analysis revealed a novel mechanism by which tify growth conditions where PtkA dissociates from TkmA the first activation steps proceeds, showing that the con- and becomes prevalently cytosolic (Jers & Mijakovic, un- served tyrosine side chain points into the active site thereby published results). In some cases PtkA also co-localized with blocking activity. Upon autophosphorylation, the negatively some of its newly identified proteins substrates. We further charged phosphotyrosine rotates out of the active site and is demonstrated that PtkA can interact with other cytosolic pro- stabilized by interaction with an arginine residue [35,38]. In teins that are not its substrates but can modulate its kinase Firmicutes, where the kinase domain is separated in a dis- activity (Shi, Noirot-Gros & Mijakovic, unpublished results). tinct polypeptide chain, it has been shown that the interaction This incited us to speculate that BY-kinases in Firmicutes with the remaining transmembrane domain is necessary for might have a separated kinase domain in order to make it the kinase activity [21,39]. The structure of S. aureus CapB accessible to other modulators, and therefore participate in demonstrated that the activation proceeds, at least in part, by signaling pathways other than the principal one that starts at BY-Kinases Current Proteomics, 2010, Vol. 7, No. 3 5 the cell membrane, with the classical BY-kinase transmem- phosphoproteomics, stable isotope labeling of cell cultures brane domain. Arguments to support our hypothesis are ad- with amino acids (SILAC) provides reliable means of rela- mittedly not abundant at the moment, but we are confident tive quantification of phosphotyrosines [47]. However, SI- that further studies in this direction will bring about another LAC-based quantification imposes some limitations in terms important turning point in the story of BY-kinases. of choice of growth medium. Alternative approaches rely on labeling after the growth phase, thus not influencing the DETECTING PHOSPHO-TYROSINES: DEVELOP- growth conditions, such as for example the dimethylation of MENTS IN MASS SPECTROMETRY PHOSPHOPRO- peptides with stable isotopes [48]. In parallel to mass spec- TEOMICS trometry-based phosphoproteomics, unrelated approaches are being developed to study protein-tyrosine phosphorylation. In Eukarya, protein-tyrosine phosphorylation only accounts for approximately 0.05% of the total cellular protein They may lack the broadness of the global phosphoproteomic approaches, but may have other advantages in terms of phosphorylation, even though almost one fifth of the cellular time resolved detection of specific phosphorylation events. kinome encodes protein-tyrosine kinases [41]. Despite the For example, electrochemical biosensors have been devel- average scarcity in terms of occupancy of phosphorylation oped to monitor specific tyrosine kinase activities (and sites, protein-tyrosine phosphorylation plays key roles in screening of inhibitors) in vitro [49]. In this particular study, eukaryal signal transduction, cell differentiation and growth. In Bacteria, occupancy of protein-tyrosine phosphorylation the authors have used specific biotinylated substrate peptides immobilized on a streptavidin-coated indium-tin oxide elec- sites is also very low, to the extent that this type of phos- trode surface. The phosphorylation is detected using an ATP phorylation has not been identified at all by traditional pro- analogue adenosine gamma-thio triphosphate. After kinase- teomics approaches using 2D-gels and low-resolution mass catalysed thio-phosphorylation of the immobilized peptides, spectrometry [42]. Only recently, the advent of gel-free the electrode surface was exposed to gold nanoparticles and analysis coupled to high-resolution mass spectrometry enabled us to systematically detect phospho-tyrosines in bacte- the signals were thereafter detected by voltametry, using gold-chloride electrochemistry. This method seems particu- rial phosphoproteomes [27, 43-45]. In terms of the number larly promising for in vitro screening of specific tyrosine- of identified phosphorylation sites, phospho-tyrosines ac- kinase inhibitors, and other developments in nanotechnology count for 3-10% of published bacterial phosphoproteomes biosensors may hold a promise for applications allowing in and this is a considerable over-representation compared to vivo studies of signal transduction in microorganisms. the eukaryal systems. Nevertheless, in terms of actual site occupancy tyrosine phosphorylation remains very low, and PERSPECTIVES the signals of tyrosine-phosphorylated peptides during mass spectrometry analysis are as a rule difficult to detect due to Site-specific bacterial phosphoproteomes are being pub- ion suppression effects from a comparatively high back- lished at an increasing pace [27, 43-45], and with the high ground of non-phosphorylated peptides. Therefore, enrich- accuracy mass spectrometry becoming more accessible we ment techniques for phosphotyrosine-containing peptides may reasonably expect to identify large numbers of BY- preceding mass spectrometry analysis represent a promising kinase substrates in various bacterial organisms. At present, area for improvement. In all phosphoproteomic studies per- bioinformatic predictors of protein phosphorylation sites are formed in bacteria so far, phosphopeptides were enriched by available. Neural-network algorithms, such as NetPhosBac methods not distinguishing between various phosphoesters [50], trained with available datasets on experimentally iden- (phospho-serine, -threonine and -tyrosine), such as using tified phosphorylation sites, can predict serine/threonine strong cationic exchange, titanium-oxide or immobilized phosphorylation based on sequence homology and conserva- metal affinity chromatography. Anti-phosphoamino acid tion of sites. Alternative predictors are the ones based on antibodies against phospho-serine/threonine and to lesser local structural disorder, such as DISPHOS [51]. At present, extent against phospho-tyrosine are infamous for somewhat the number of identified sites of protein-tyrosine phosphory- relaxed specificity, due to the fact that antibodies recognize a lation in bacterial proteins is not sufficient to envisage the stretch of 10-11 amino acids and a single phosphoamino acid construction of homology-based predictors such as Net- is not an ideal epitope. While this may represent a challenge PhosBac, but approaches based on local structural disorder for specific detection by Western blots, in terms of phos- seem more promising. In particular, weak conservation of phopeptide enrichment from crude protein extracts antibod- bacterial phosphoproteomes on the phosphorylation site level ies can be a useful tool. In studies performed on eukaryal is an argument in favour of developing clade-specific predic- systems, the 4G10 and the PY100 antibodies were found to tors, rather than global bacterial predictors. Upon examina- be the most efficient for the immune-affinity enrichment of tion of published tyrosine phosphorylation sites assigned to a phosphotyrosine proteins and peptides, and a combined use specific kinase, as for example Ugd, TuaD, SsbA and SsbB of the two antibodies was recommended to obtain the best proteins phosphorylated by PtkA in B. subtilis [21,28], no result [46]. It seems therefore that a viable route towards clear kinase recognition motif has emerged in the immediate global tyrosine phosphorylation studies in bacteria might surroundings of the phosphorylated residues. It is therefore imply antibody based enrichment prior to mass spectrometry plausible to assume that BY-kinases, much like their cognate analysis. In terms of cellular signaling, protein-tyrosine phosphotyrosine-protein phosphatases [52], recognize struc- phosphorylation is a dynamic event and quantitative and tural motifs distant from the phosphorylated(able) residue on time resolved analytical approaches are prerequisite to un- which they act. One big remaining question concerning the derstanding its physiological role; even more so bearing in regulatory role of BY-kinases is the regulation of their mind the short generation time of bacteria. In quantitative kinase activity. BY-kinases described in recent structural 6 Current Proteomics, 2010, Vol. 7, No. 3 Kobir et al. studies offer a snapshot of a constitutively active kinase, but gene encoding an autophosphorylating protein tyrosine kinase. we cannot be certain that this is indeed the case in vivo. The Gene, 1997, 204, 259-265. [5] Grangeasse, C.; Cozzone, A.J.; Deutscher, J. and Mijakovic, I. presence of large extracellular loops, by analogy to eukaryal Tyrosine phosphorylation: an emerging regulatory device of bacte- systems, suggests the existence of extracellular signals that rial physiology. Trends Biochem. Sci., 2007, 32, 86-94. might trigger kinase activity. However, in Proteobacteria [6] Cuthbertson, L.; Mainprize, I.L.; Naismith, J.H. and Whitfield, C. these extracellular loops are heavily involved in interactions Pivotal roles of the outer membrane polysaccharide export and with polysaccharide translocation machinery, and it is ques- polysaccharide copolymerase protein families in export of extracellular polysaccharides in Gram-negative bacteria. Microbiol. tionable whether they may form a real signal acceptor site. In Mol. Biol. Rev., 2009, 73, 155-177. bacteria in general, our knowledge on extracellular signals [7] Jadeau, F.; Bechet, E.; Cozzone, A.J.; Deléage, G.; Grangeasse, C. that trigger the activity of cytosolic serine/threonine and ty- and Combet, C. Identification of the idiosyncratic bacterial protein rosine kinases is very limited [53], but this may simply re- tyrosine kinase (BY-kinase) family signature. Bioinformatics, 2008, 24, 2427-2430. flect our lack of investigative approaches concerning this [8] Mijakovic, I.; Poncet, S.; Galinier, A.; Monedero, V.; Fieulaine; S., part of the signaling cascade. The amount of data gathered Janin, J.; Nessler, S.; Marquez, H.-A.; Scheffzek, K.; Hasenbein, on BY-kinases is at present not extensive enough to allow in- S.; Hengstenberg, W. and Deutscher, J. Pyrophosphate-producing depth modeling of tyrosine-phosphorylation-based regula- protein dephosphorylation by HPr kinase/phosphorylase: a relic of tory networks. However, the available elements on specific early life? Proc. Natl. Acad. Sci. USA, 2002, 99, 13442-13347. [9] Patel, S. and Latterich, M. The AAA team: related ATPases with substrate activation should soon allow the construction of diverse functions. Trends Cell. Biol., 1998, 8, 65-71. simple Boolean-type models, integrating all known BY- [10] Whitfied, C. Biosynthesis and assembly of capsular polysaccha- kinase interactants. Since tyrosine phosphorylation is a dy- rides in Escherichia coli. Annu. Rev. Biochem., 2006, 75, 39-68. namic event; it may be justified to invest some efforts in [11] Vincent, C.; Doublet, P.; Grangeasse, C.; Vaganay, E.; Cozzone, A.J. and Duclos, B. Cells of Escherichia coli contain a protein- quantitative, time-resolved analysis of BY-kinase cellular tyrosine kinase, Wzc, and a phosphotyrosine-protein phosphatase, functions, and create dynamic models describing the behav- Wzb. J. Bacteriol., 1999, 181, 3472-3477. ior of these regulatory loops. These efforts may be particu- [12] Peleg, A.; Shifrin, Y.; Ilan, O.; Nadler-Yona, C.; Nov, S.; Koby, S.; larly well justified by the relatively high connectivity of BY- Baruch, K.; Altuvia, S.; Elgrably-Weiss, M.; Abe, C.M.; Knutton, kinases in Firmicutes, with a large number of substrates and S.; Saper, M.A. and Rosenshine, I. Identification of an Escherichia coli operon required for formation of the O-antigen capsule. J. Bac- alternative modulators. teriol., 2005, 187, 5259-5266. Recent reviews concerning BY-kinases and bacterial [13] Paiment, A.; Hocking, J. and Whitfield, C. Impact of phosphorylation of specific residues in the tyrosine autokinase, Wzc, on its ac- protein phosphorylation in general [54,55] point out the tivity in assembly of group 1 capsules in Escherichia coli. J. Bacte- promise they hold in terms of strategies for battling infective riol., 2002, 184, 6437-6447. diseases caused by bacterial pathogens. The main advantage [14] Obadia, B.; Lacour, S.; Doublet, P.; Baubichon-Cortay, H.; Coz- of BY-kinases in this respect is the fact that they have no zone, A.J. and Grangeasse, C. Influence of tyrosine-kinase Wzc activity on colanic acid production in Escherichia coli K12 cells. J. eukaryal homologues, so their specific inhibitors are less Mol. Biol., 2007, 367, 42-53. likely to affect the host than for example the inhibitors of [15] Tocilj, A.; Munger, C.; Proteau, A.; Morona, R.; Purins, L.; Hanks type serine/threonine kinases, which are present both Ajamian, E.; Wagner, J.; Papadopoulos, M.; Van Den Bosch, L.; in Bacteria and Eukarya. However, as discussed above, BY- Rubinstein, J.L.; Féthière, J.; Matte, A. and Cygler, M. Bacterial kinases seem to be quite promiscuous in terms of choosing polysaccharide co-polymerases share a common framework for control of polymer length. Nat. Struct. Mol. Biol., 2008, 15, 130- their substrates. Along these lines, Lin et al. [27] justifiably 138. argue that site-specific knowledge concerning the substrates [16] Whitfield, C. and Larue, K. Stop and go: regulation of chain length regulated by BY-kinases might provide more specific targets in the biosynthesis of bacterial polysaccharides. Nat. Struct. Mol. for inhibitory drugs. There is nevertheless an agreement in Biol., 2008, 15, 121-123. [17] Morona, J.K.; Morona, R. and Paton, J.C. Attachment of capsular the field that inhibiting bacterial tyrosine phosphorylation is polysaccharide to the cell wall of Streptococcus pneumoniae type 2 a promising venue in developing new therapeutics, and con- is required for invasive disease. Proc. Natl. Acad. Sci. USA, 2006, siderable efforts are already committed to this approach. 103, 8505-8510. [18] Morona, J.K.; Miller, D.C.; Morona, R. and Paton, J.C. The effect ACKNOWLEDGEMENTS that mutations in the conserved capsular polysaccharide biosynthesis genes cpsA, cpsB, and cpsD have on virulence of Streptococcus This work was supported by grants from the Lund- pneumoniae. J. Infect. Dis., 2004, 189, 1905-1913. beckfonden and the Institut National de Recherche [19] Klein, G.; Dartigalongue, C. and Raina, S. Phosphorylation- mediated regulation of heat shock response in Escherichia coli. Agronomique (INRA) to IM and a PhD stipend from the Mol. Microbiol., 2003, 48, 269-285. Technical University of Denmark (DTU) to CJ. [20] Grangeasse, C.; Obadia, B.; Mijakovic, I.; Deutscher, J.; Cozzone, A.J. and Doublet, P. Autophosphorylation of the Escherichia coli References protein kinase Wzc regulates tyrosine phosphorylation of Ugd, a UDP-glucose dehydrogenase. J. Biol. Chem., 2003, 278, 39323- 39329. [1] Abu-Qarn, M.; Eichler, J. and Sharon N. Not just for Eukarya any- [21] Mijakovic, I.; Poncet, S.; Boël, G.; Mazé, A.; Gillet, S.; Jamet, E.; more: protein glycosylation in Bacteria and Archaea. Curr. Opin. Decottignies, P.; Grangeasse, C.; Doublet, P.; Le Maréchal, P. and Struct. Biol., 2008, 18, 544-550. Deutscher, J. Transmembrane modulator-dependent bacterial tyro- [2] Lauber, M.A.; Running, W.E. and Reilly, J.P. B. subtilis ribosomal sine kinase activates UDP-glucose dehydrogenases. EMBO J., proteins: structural homology and post-translational modifications. 2003, 22, 4709-4718. J. Proteome Res., 2009, 8, 4193-4206. [22] Mijakovic, I.; Petranovic, D. and Deutscher, J. How tyrosine phos- [3] Duclos, B.; Grangeasse, C.; Vaganay, E.; Riberty, M. and Cozzone, phorylation affects the UDP-glucose dehydrogenase activity of Ba- A.J. Autophosphorylation of a bacterial protein at tyrosine. J. Mol. cillus subtilis YwqF. J. Mol. Microbiol. Biotechnol., 2004, 8, 19- Biol., 1996, 259, 891-895. 25. [4] Grangeasse, C.; Doublet, P.; Vaganay, E.; Vincent, C.; Deléage, [23] Lacour, S.; Bechet, E.; Cozzone, A.J.; Mijakovic, I. and G.; Duclos, B. and Cozzone, A.J. Characterization of a bacterial Grangeasse, C. Tyrosine phosphorylation of the UDP-glucose de- BY-Kinases Current Proteomics, 2010, Vol. 7, No. 3 7

hydrogenase of Escherichia coli is at the crossroads of colanic acid lar dynamics simulation and biochemical analysis. Biochemistry, synthesis and polymyxin resistance. PLoS One, 2008, 3, e3053. 2009, 48, 7986-7995. [24] Petranovic, D.; Grangeasse, C.; Macek, B.; Abdillatef, M.; [39] Soulat, D.; Jault, J.M.; Duclos, B.; Geourjon, C.: Cozzone, A.J.; Gueguen-Chaignon, V.; Nessler, S.; Deutscher, J. and Mijakovic, I. and Grangeasse, C. Staphylococcus aureus operates protein- Activation of Bacillus subtilis Ugd by the BY-kinase PtkA pro- tyrosine phosphorylation through a specific mechanism. J. Biol. ceeds via phosphorylation of its residue tyrosine 70. J. Mol. Micro- Chem., 2006, 281, 14048-14056. biol. Biotechnol., 2009, 17, 83-89. [40] Lee, D.C. and Jia, Z. Emerging structural insights into bacterial [25] Minic, Z.; Marie, C.; Delorme, C.; Faurie, J.M.; Mercier, G.; tyrosine kinases. Trends Biochem. Sci., 2009, 34, 351-357. Ehrlich, D. and Renault, P. Control of EpsE, the phosphoglycosyl- [41] Blume-Jensen. P. and Hunter, T. Oncogenic kinase signaling. Na- transferase initiating exopolysaccharide synthesis in Streptococcus ture, 2001, 411, 355-365. thermophilus, by EpsD tyrosine kinase. J. Bacteriol., 2007, 189, [42] Bendt, A.K.; Burkovski, A.; Schaffer, S.; Bott, M.; Farwick, M. 1351-1357. and Hermann, T. Towards a phosphoproteome map of Corynebac- [26] Soulat, D.; Grangeasse, C.; Vaganay, E.; Cozzone, A.J. and terium glutamicum. Proteomics, 2003, 3, 1637-1646. Duclos, B. UDP-acetyl-mannosamine dehydrogenase is an endoge- [43] Macek, B.; Mijakovic, I.; Olsen, J.V.; Gnad, F.; Kumar, C.; Jensen, nous protein substrate of Staphylococcus aureus protein-tyrosine P.R. and Mann, M. The serine/threonine/tyrosine phosphoproteome kinase activity. J. Mol. Microbiol. Biotechnol., 2007, 13, 45-54. of the model bacterium Bacillus subtilis. Mol. Cell. Proteom., [27] Lin, M.H.; Hsu, T.L.; Lin, S.Y.; Pan, Y.J.; Jan, J.T.; Wang, J.T.; 2007, 6, 697-707. Khoo, K.H. and Wu, S.H. Phosphoproteomics of Klebsiella pneu- [44] Macek, B.; Gnad, F.; Soufi, B.; Kumar, C.; Olsen, J.V.; Mijakovic, monia NTUH-K2044 reveals a tight link between tyrosine phos- I. and Mann, M. Phosphoproteome analysis of E. coli reveals evo- phorylation and virulence. Mol. Cell. Proteom., 2009, in press, lutionary conservation of bacterial Ser/Thr/Tyr phosphorylation. PMID: 19696081. Mol. Cell. Proteom., 2008, 7, 299-307. [28] Mijakovic, I.; Petranovic, D.; Macek, B.; Cepo, T.; Mann, M.; [45] Soufi, B.; Gnad, F.; Jensen, P.R.; Petranovic, D.; Mann, M.; Mi- Davies, J.; Jensen, P.R.; and Vujaklija, D. Bacterial single-stranded jakovic, I. and Macek, B. The Ser/Thr/Tyr phosphoproteome of DNA-binding proteins are phosphorylated on tyrosine. Nucleic Ac- Lactococcus lactis IL1403 reveals multiply phosphorylated pro- ids Res., 2006, 34, 1588-1596. teins. Proteomics, 2008, 8, 3486-3493. [29] Petranovic, D.; Michelsen, O.; Zahradka, K.; Silva, C.; Petranovic, [46] Lind, S.B.; Molin, M.; Savitski, M.M.; Emilsson, L.; Åström, J.; M.; Jensen, P.R. and Mijakovic, I. Bacillus subtilis strain deficient Hedberg, L., Adams, C.; Nielsen, M.L., Engström, A.; Elfineh, L.; for the protein-tyrosine kinase PtkA exhibits impaired DNA repli- Andersson, E.; Zubarev, R.A. and Pettersson, U. Immunoaffinity cation. Mol. Microbiol., 2007, 63, 1797-1805. enrichments followed by mass spectrometric detection for studying [30] Kolot, M.; Gorovits, R.; Silberstein, N.; Fichtman, B. and Yagil, E. global protein tyrosine phosphorylation. J. Prot. Res., 2008, 7, Phosphorylation of the integrase protein of coliphage HK022. Vi- 2897-2910. rology, 2008, 375, 383-390. [47] Bantscheff, M.; Schirle, M.; Sweetman, G.; Rick, J. and Kuster, B. [31] Kirstein, J.; Zühlke, D.; Gerth, U.; Turgay, K. and Hecker, M. A Quantitative mass spectrometry in proteomics: a critical review. tyrosine kinase and its activator control the activity of the CtsR Anal. Bioanal. Chem., 2007, 389, 1017-1031. heat shock repressor in B. subtilis. EMBO J., 2005, 24, 3435-3445. [48] Boersema, P.J.; Aye, T.T.; van Veen, T.A.; Heck, A.J. and Mo- [32] Kirstein, J.; Dougan, D.A.; Gerth, U.; Hecker, M. and Turgay, K. hammed, S. Triplex protein quantification based on stable isotope The tyrosine kinase McsB is a regulated adaptor protein for ClpCP. labeling by peptide dimethylation applied to cell and tissue lysates. EMBO J., 2007, 26, 2061-2070. Proteomics, 2008, 8, 4624-4632. [33] Fuhrmann, J.; Schmidt, A.; Spiess, S.; Lehner, A.; Turgay, K.; [49] Kerman, K. and Kraatz, H.B. Electrochemical detection of protein Mechtler, K.; Charpentier, E. and Clausen, T. McsB is a protein ar- tyrosine kinase-catalysed phosphorylation using gold nanoparticles. ginine kinase that phosphorylates and inhibits the heat-shock regu- Biosens. Bioelectron., 2009, 24, 1484-1489. lator CtsR. Science, 2009, 324, 1323-1327. [50] Miller, M.L.; Soufi, B.; Jers, C.; Blom, N.; Macek, B. and Mijak- [34] Collins, R.F.; Beis, K.; Dong, C.; Botting, C.H.; McDonnell, C.; ovic, I. NetPhosBac - a predictor for Ser/Thr phosphorylation sites Ford, R.C.; Clarke, B.R.; Whitfield, C. and Naismith, J.H. The 3D in bacterial proteins. Proteomics, 2009, 9, 116-125. structure of a periplasm-spanning platform required for assembly of [51] Iakoucheva, L.M.; Radivojac, P.; Brown, C.J.; O'Connor, T.R.; group 1 capsular polysaccharides in Escherichia coli. Proc. Natl. Sikes, J.G.; Obradovic, Z. and , Dunker, A.K. Intrinsic disorder and Acad. Sci. USA, 2007, 104, 2390-2395. protein phosphorylation. Nucleic Acids Res., 2004, 32, 1037-1049. [35] Lee, D.C.; Zheng, J.; She, Y.M. and Jia, Z. Structure of Es- [52] Mijakovic, I.; Musumeci, L.; Tautz, L.; Petranovic, D.; Edwards, cherichia coli tyrosine kinase Etk reveals a novel activation R.A.; Jensen, P.R.; Mustelin, T.; Deutscher, J. and Bottini N. In vi- mechanism. EMBO J., 2008, 27, 1758-1766. tro characterization of the Bacillus subtilis protein tyrosine phos- [36] Olivares-Illana, V.; Meyer, P.; Bechet, E.; Gueguen-Chaignon, V.; phatase YwqE. J. Bacteriol., 2005, 187, 3384-3390. Soulat, D.; Lazereg-Riquier, S.; Mijakovic, I.; Deutscher, J.; Coz- [53] Shah, I.M.; Laaberki, M.H.; Popham, D.L. and Dworkin, J. A eu- zone, A.J.; Laprévote, O.; Morera, S.; Grangeasse, C. and Nessler, karyotic-like Ser/Thr kinase signals bacteria to exit dormancy in re- S. Structural basis for the regulation mechanism of the tyrosine sponse to peptidoglycan fragments. Cell, 2008, 135, 486-496. kinase CapB from Staphylococcus aureus. PLoS Biol., 2008, 6, [54] Grangeasse, C.; Terreux, R. and Nessler, S. Bacterial tyrosine- e143. kinases: structure-function analysis and therapeutic potential. Bio- [37] Grangeasse, C.; Doublet, P. and Cozzone, A.J. Tyrosine phos- chim. Biophys. Acta, 2009, in press, doi: phorylation of protein kinase Wzc from Escherichia coli K12 oc- 10.1016/j.bbapap.2009.08.018 curs through a two-step process. J. Biol. Chem., 2002, 277, 7127- [55] Jers, C.; Soufi, B.; Grangeasse, C.; Deutscher, J. and Mijakovic, I. 7135. Phosphoproteomics in bacteria: towards a systemic understanding [38] Lu, T.; Tan, H.; Lee, D.; Chen, G. and Jia, Z. New insights into the of bacterial phosphorylation networks. Exp. Rev. Proteom., 2008, activation of Escherichia coli tyrosine kinase revealed by molecu- 5, 619-627.

Received: November 25, 2009 Revised: May 11, 2010 Accepted: May 14, 2010

I supervised one Master student, Paula Dobrinic, for her Master Thesis to University of Zegreb, Croatia. This is only a five months experimental works. Here I am presenting her project.

Introduction

In bacteria, signal transduction often occurs through phosphorylation of histidine and aspartate residues, as a part of relatively simple two-component systems (Pirrung, 1999). On the other hand, Ser/Thr or Tyr-specific kinases are usually involved in signal transduction within eukaryotic cells. The majority of eukaryotic kinases make up a large superfamily of homologous proteins, known as Hanks-type kinases, characterized by a conserved kinase (catalytic) domain (Hanks et al., 1988). Some of these kinases form phosphorylation cascades which regulate various cellular processes. The best-studied example of this type of signal transduction is the MAP kinase pathway (Seger and Krebs, 1995).

A significant number of Hanks-type Ser/Thr protein kinases has been found in bacteria, particularly in Actinobacteria (Pereira et al., 2011). Still, the ability of these kinases to interact and to form signalling cascades hasn’t been fully studied.

Hanks-type kinases of a model Gram-positive bacterium Bacillus subtilis were the subject of this research. Membrane kinase PrkC phosphorylates various known substrates and contributes to spore germination (Shah et al., 2008). From the structural analysis it is found that in PrkC the position of the invariant lysine 40 is indicated as an active site. So mutation of this residue inactivates the enzyme, since it is directly involved in the phosphotransfer reaction (Madec et al. (2003). The other two Ser/Thr-kinases, YabT and YbdM, are not so well characterized (Jers et al., 2011).

Hypothesis

We hypothesized that bacterial Hanks-type kinases transduce signals in a manner similar to their eukaryotic homologs.

The aim of this research was to find out whether Hanks-type kinases of B. subtilis constitute a phosphorylation cascade in vitro.

Materials and methods

To determine whether B. subtilis Hanks-type kinases form the phosphorylation cascade, it was first necessary to abolish their autophosphorylation activity. For that purpose, specific Lys residue in the catalytic domain that is essential for kinase activity, was replaced by site- directed mutagenesis. In order to improve solubility of PrkC and YabT, only the cytosolic part

155

containing the active site was used. Recombinant His-tagged proteins were expressed in E. coli and purified on Ni-NTA columns . Wild-type and mutant forms of different kinases were combined and phosphorylation assays were performed with 32P-γ-ATP as a phosphate donor.

Results

For this experiment we constructed some non-phosphorylating mutants.For PrkC, YabT and YbdM, the mutations resulting by replacing Lys(K) to Aspartate(D), Alanine(A) and serine(S) respectively were made. When specific mutations introduced into kinase domains of PrkC K40D and YbdM K54S, abolished their autophosphorylation activity in vitro.Phosphorylation assays showed that membrane-linked kinases PrkC and YabT phosphorylate YbdM (Fig. 9). Interestingly a strong radioactive signal obtained in a reaction between the wild-type and the mutant form of PrkC confirms transphosphorylation (intermolecular) activity of this receptor- like kinase (Fig. 9).

Fig 9: Schematic representation of the signal transduction cascade formed by B. subtilis Hanks-type kinases. Red arrows indicate phosphorylation events between the kinases

Conclusion

We have determined that two membrane-linked kinases, PrkC and YabT, phosphorylate the cytosolic kinase YbdM.

The intermolecular kinase activity of PrkC was confirmed.

156

The activation of receptor kinase PrkC is probably the first step of this newly characterized signal transduction cascade.

References

Hanks SK, Quinn AM, Hunter T (1988) The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 241, 42–52.

Jers C, Kobir A, Søndergaard EO, Jensen PR, Mijakovic I (2011) Bacillus subtilis two- component system sensory kinase DegS is regulated by serine phosphorylation in its input domain. PLoS ONE 6, e14653.

Madec E, Stensballe A, Kjellstrom S, Cladiere L, Obuchowski M, Jensen ON, Séror SJ (2003) Mass spectrometry and site-directed mutagenesis identify several autophosphorylated residues required for the activity of PrkC, a Ser/Thr kinase from Bacillus subtilis. J Mol Biol 330, 459–472.

Mijakovic I, Poncet S, Boel G, Maze A, Gillet S, Jamet E, Decottignies P, Grangeasse C, Doublet P, Le Marechal P, Deutscher J (2003) Transmembrane modulator-dependent bacterial tyrosine kinase activates UDP-glucose dehydrogenases. EMBO J 22, 4709-18.

Pereira SFF, Goss L, Dworkin J (2011) Eukaryote-like serine/threonine kinases and phosphatases in bacteria. Microbiol Mol Biol Rev 75, 192-212.

Pirrung MC (1999) Histidine kinases and two-component signal transduction systems. Chem Biol 6, 167-175.

Seger R, Krebs EG (1995) The MAPK signaling cascade. FASEB J 9, 726–735.

Shah IM, Laaberki MH, Popham DL, Dworkin J (2008) A eukaryotic-like Ser/Thr kinase signals bacteria to exit dormancy in response to peptidoglycan fragments. Cell 135, 486-497.

157