sign in sign up
<<
Home , NeXtProt, Semisynthesis, SUMO enzymes

AP Biology: B McGraw Hill AP Biology 2014-15 Contents

1 Carbohydrate 1 1.1 Structure ...... 1 1.2 Monosaccharides ...... 2 1.2.1 Classification of monosaccharides ...... 2 1.2.2 Ring-straight chain isomerism ...... 3 1.2.3 Use in living ...... 3 1.3 Disaccharides ...... 3 1.4 ...... 4 1.4.1 Classification ...... 5 1.5 ...... 5 1.5.1 ...... 5 1.6 ...... 5 1.7 See also ...... 6 1.8 References ...... 6 1.9 External links ...... 7

2 Lipid 8 2.1 Categories of lipids ...... 8 2.1.1 Fatty acids ...... 8 2.1.2 Glycerolipids ...... 9 2.1.3 Glycerophospholipids ...... 9 2.1.4 ...... 9 2.1.5 Sterol lipids ...... 10 2.1.6 Prenol lipids ...... 10 2.1.7 Saccharolipids ...... 10 2.1.8 Polyketides ...... 10 2.2 Biological functions ...... 11 2.2.1 Membranes ...... 11 2.2.2 Energy storage ...... 11 2.2.3 Signaling ...... 12

i ii CONTENTS

2.2.4 Other functions ...... 12 2.3 Metabolism ...... 12 2.3.1 ...... 12 2.3.2 Degradation ...... 13 2.4 Nutrition and health ...... 13 2.5 See also ...... 13 2.6 References ...... 13 2.6.1 Bibliography ...... 17 2.7 External links ...... 17

3 19 3.1 ...... 20 3.2 Synthesis ...... 20 3.2.1 Biosynthesis ...... 20 3.2.2 ...... 21 3.3 Structure ...... 21 3.3.1 Structure determination ...... 22 3.4 Cellular functions ...... 23 3.4.1 ...... 23 3.4.2 Cell signaling and ligand binding ...... 24 3.4.3 Structural ...... 24 3.5 Methods of study ...... 24 3.5.1 Protein purification ...... 25 3.5.2 Cellular localization ...... 25 3.5.3 ...... 26 3.5.4 ...... 26 3.6 Nutrition ...... 27 3.7 History and etymology ...... 27 3.8 See also ...... 28 3.9 Footnotes ...... 28 3.10 References ...... 31 3.11 External links ...... 31 3.11.1 Databases and projects ...... 31 3.11.2 Tutorials and educational websites ...... 32

4 33 4.1 Etymology and history ...... 33 4.2 Structures and mechanisms ...... 34 4.2.1 Specificity ...... 35 CONTENTS iii

4.2.2 Mechanisms ...... 36 4.2.3 Allosteric modulation ...... 36 4.3 Cofactors and coenzymes ...... 37 4.3.1 Cofactors ...... 37 4.3.2 Coenzymes ...... 37 4.4 Thermodynamics ...... 37 4.5 Kinetics ...... 38 4.6 Inhibition ...... 39 4.7 Biological function ...... 41 4.8 Control of activity ...... 41 4.9 Involvement in disease ...... 42 4.10 Naming conventions ...... 42 4.11 Industrial applications ...... 43 4.12 See also ...... 43 4.13 References ...... 43 4.14 Further reading ...... 48 4.15 External links ...... 48

5 PH 49 5.1 History ...... 49 5.2 Definition and measurement ...... 49 5.2.1 pH ...... 49 5.2.2 p[H] ...... 50 5.2.3 pH indicators ...... 51 5.2.4 pOH ...... 51 5.2.5 Extremes of pH ...... 51 5.2.6 Non-aqueous solutions ...... 51 5.3 Applications ...... 52 5.3.1 pH in nature ...... 52 5.3.2 Seawater ...... 52 5.3.3 Living systems ...... 53 5.4 Calculations of pH ...... 53 5.4.1 Strong acids and bases ...... 54 5.4.2 Weak acids and bases ...... 54 5.4.3 General method ...... 55 5.5 References ...... 55 5.6 External links ...... 56

6 57 iv CONTENTS

6.1 History ...... 57 6.2 Equations ...... 58 6.3 Elementary reactions ...... 59 6.4 Chemical equilibrium ...... 59 6.5 Thermodynamics ...... 60 6.6 Kinetics ...... 60 6.7 Reaction types ...... 61 6.7.1 Four basic types ...... 61 6.7.2 Oxidation and reduction ...... 62 6.7.3 Complexation ...... 63 6.7.4 Acid-base reactions ...... 63 6.7.5 Precipitation ...... 63 6.7.6 Solid-state reactions ...... 64 6.7.7 Reactions at the solid|gas interface ...... 64 6.7.8 Photochemical reactions ...... 64 6.8 ...... 64 6.9 Reactions in ...... 65 6.9.1 Substitution ...... 65 6.9.2 Addition and elimination ...... 66 6.9.3 Other mechanisms ...... 67 6.10 Biochemical reactions ...... 68 6.11 Applications ...... 68 6.12 Monitoring ...... 68 6.13 See also ...... 68 6.14 References ...... 69 6.15 Bibliography ...... 70 6.16 Text and image sources, contributors, and licenses ...... 71 6.16.1 Text ...... 71 6.16.2 Images ...... 76 6.16.3 Content license ...... 80 Chapter 1

Carbohydrate

in and chitin in arthropods). The 5-carbon monosac- OH HO OH charide ribose is an important component of coenzymes (e.g., ATP, FAD, and NAD) and the backbone of the ge- O netic known as RNA. The related deoxyribose O O HO OH is a component of DNA. Saccharides and their deriva- OH HO tives include many other important biomolecules that play OH key roles in the immune system, fertilization, preventing pathogenesis, blood clotting, and development.[7] Lactose is a disaccharide found in milk. It consists of a molecule In food science and in many informal contexts, the term of D-galactose and a molecule of D-glucose bonded by beta-1-4 carbohydrate often means any food that is particularly rich glycosidic linkage. It has a formula of C12H22O11. in the complex carbohydrate starch (such as cereals, bread, and pasta) or simple carbohydrates, such as sugar (found in candy, jams, and desserts). A carbohydrate is a large biological molecule, or macromolecule, consisting of carbon (C), hydrogen (H), and oxygen (O) , usually with a hydrogen:oxygen ratio of 2:1 (as in water); in other words, with 1.1 Structure the empirical formula Cm(H2O)n (where m could be dif- ferent from n).[1] Some exceptions exist; for example, Formerly the name “carbohydrate” was used in chemistry [2] deoxyribose, a sugar component of DNA, has the em- for any compound with the formula Cm (H2O) n. Follow- [3] pirical formula C5H10O4. Carbohydrates are technically ing this definition, some considered formaldehyde [4] [8] hydrates of carbon; structurally it is more accurate to view (CH2O) to be the simplest carbohydrate, while others them as polyhydroxy aldehydes and ketones.[5] claimed that title for glycolaldehyde.[9] Today the term is generally understood in the biochemistry sense, which ex- The term is most common in biochemistry, where it is a synonym of saccharide. The carbohydrates (saccharides) cludes compounds with only one or two carbons. are divided into four chemical groups: monosaccharides, Natural saccharides are generally built of simple car- disaccharides, oligosaccharides, and polysaccharides. In bohydrates called monosaccharides with general formula general, the monosaccharides and disaccharides, which are (CH2O)n where n is three or more. A typical monosac- smaller (lower molecular weight) carbohydrates, are com- charide has the structure H-(CHOH)x(C=O)-(CHOH)y- monly referred to as sugars.[6] The word saccharide comes H, that is, an aldehyde or ketone with many hydroxyl from the Greek word σάκχαρον (sákkharon), meaning groups added, usually one on each carbon atom that is "sugar.” While the scientific nomenclature of carbohydrates not part of the aldehyde or ketone . Ex- is complex, the names of the monosaccharides and disac- amples of monosaccharides are glucose, fructose, and charides very often end in the suffix -ose. For example, glyceraldehydes. However, some biological substances grape sugar is the monosaccharide glucose, cane sugar is commonly called “monosaccharides” do not conform to the disaccharide sucrose, and milk sugar is the disaccharide this formula (e.g., uronic acids and deoxy-sugars such as lactose (see illustration). fucose), and there are many chemicals that do conform to this formula but are not considered to be monosaccharides Carbohydrates perform numerous roles in living organisms. [10] Polysaccharides serve for the storage of energy (e.g., starch (e.g., formaldehyde CH2O and inositol (CH2O)6). and glycogen), and as structural components (e.g., cellulose The open-chain form of a monosaccharide often coexists

1 2 CHAPTER 1. CARBOHYDRATE

with a closed ring form where the aldehyde/ketone carbonyl group carbon (C=O) and hydroxyl group (-OH) react form- ing a hemiacetal with a new C-O-C bridge. Monosaccharides can be linked together into what are called polysaccharides (or oligosaccharides) in a large va- riety of ways. Many carbohydrates contain one or more modified monosaccharide units that have had one or more groups replaced or removed. For example, deoxyribose, a component of DNA, is a modified version of ribose; chitin is composed of repeating units of N-acetyl glucosamine, a nitrogen-containing form of glucose.

1.2 Monosaccharides

Main article: Monosaccharide Monosaccharides are the simplest carbohydrates in that they cannot be hydrolyzed to smaller carbohydrates. They are aldehydes or ketones with two or more hydroxyl groups. The general chemical formula of an unmodified monosac- charide is (C•H2O), literally a “carbon hydrate.” Monosac- charides are important fuel as well as build- ing blocks for nucleic acids. The smallest monosaccha- rides, for which n=3, are dihydroxyacetone and D- and L- glyceraldehydes.

1.2.1 Classification of monosaccharides

D-glucose is an aldohexose with the formula (C·H2O)6. The red atoms highlight the aldehyde group, and the blue atoms highlight the asymmetric center furthest from the aldehyde; because this -OH is on the right of the Fischer projection, this is a D sugar.

charide is an aldose; if the carbonyl group is a ketone, the monosaccharide is a ketose. Monosaccharides with three carbon atoms are called trioses, those with four are called tetroses, five are called pentoses, six are hexoses, and so on.[12] These two systems of classification are often com- bined. For example, glucose is an aldohexose (a six-carbon aldehyde), ribose is an aldopentose (a five-carbon alde- The α and β anomers of glucose. Note the position of the hyde), and fructose is a ketohexose (a six-carbon ketone). hydroxyl group (red or green) on the anomeric carbon rel- Each carbon atom bearing a hydroxyl group (-OH), with ative to the CH2OH group bound to carbon 5: they either the exception of the first and last carbons, are asymmetric, have identical absolute configurations (R,R or S,S) (α), or [11] making them stereo centers with two possible configura- opposite absolute configurations (R,S or S,R) (β). tions each (R or S). Because of this asymmetry, a num- Monosaccharides are classified according to three differ- ber of isomers may exist for any given monosaccharide for- ent characteristics: the placement of its carbonyl group, the mula. Using Le Bel-van't Hoff rule, the aldohexose D- number of carbon atoms it contains, and its chiral handed- glucose, for example, has the formula (C·H2O) 6, of which ness. If the carbonyl group is an aldehyde, the monosac- four of its six carbons atoms are stereogenic, making D- 1.3. DISACCHARIDES 3

glucose one of 24=16 possible stereoisomers. In the case the β anomer. of glyceraldehydes, an aldotriose, there is one pair of pos- sible stereoisomers, which are enantiomers and epimers. 1, 3-dihydroxyacetone, the ketose corresponding to the aldose 1.2.3 Use in living organisms glyceraldehydes, is a symmetric molecule with no stereo centers. The assignment of D or L is made according to Monosaccharides are the major source of fuel for the orientation of the asymmetric carbon furthest from the metabolism, being used both as an energy source (glucose carbonyl group: in a standard Fischer projection if the hy- being the most important in nature) and in biosynthesis. droxyl group is on the right the molecule is a D sugar, oth- When monosaccharides are not immediately needed by erwise it is an L sugar. The “D-" and “L-" prefixes should many cells they are often converted to more space-efficient not be confused with “d-" or “l-", which indicate the direc- forms, often polysaccharides. In many , including tion that the sugar rotates plane polarized light. This us- , this storage form is glycogen, especially in liver age of “d-" and “l-" is no longer followed in carbohydrate and muscle cells. In plants, starch is used for the same pur- chemistry.[13] pose. The most abundant carbohydrate, cellulose, is a struc- tural component of the cell wall of plants and many forms of algae. Ribose is a component of RNA. Deoxyribose is a 1.2.2 Ring-straight chain isomerism component of DNA. Lyxose is a component of lyxoflavin found in heart.[15] Ribulose and xylulose occurs in the pentose phosphate pathway. Galactose, a component of milk sugar lactose, is found in galactolipids in cell membranes and in glycoproteins in many tissues. Mannose occurs in human metabolism, especially in the of certain proteins. Fructose, or fruit sugar, is found in many plants and in humans, it is metabolized in the liver, absorbed directly into the intestines during digestion, and found in semen. Trehalose, a major sugar of insects, is rapidly hydrolyzed into two glucose molecules to support continuous flight.

1.3 Disaccharides

Glucose can exist in both a straight-chain and ring form.

The aldehyde or ketone group of a straight-chain monosac- charide will react reversibly with a hydroxyl group on a different carbon atom to form a hemiacetal or hemiketal, forming a heterocyclic ring with an oxygen bridge between two carbon atoms. Rings with five and six atoms are called furanose and pyranose forms, respectively, and exist in equilibrium with the straight-chain form.[14] Sucrose, also known as table sugar, is a common disaccharide. It is composed of two monosaccharides: D-glucose (left) and D- During the conversion from straight-chain form to the cyclic fructose (right). form, the carbon atom containing the carbonyl oxygen, called the anomeric carbon, becomes a stereogenic cen- ter with two possible configurations: The oxygen atom Main article: Disaccharide may take a position either above or below the plane of the ring. The resulting possible pair of stereoisomers is called Two joined monosaccharides are called a disaccharide and anomers. In the α anomer, the -OH substituent on the these are the simplest polysaccharides. Examples include anomeric carbon rests on the opposite side (trans) of the sucrose and lactose. They are composed of two monosac- ring from the CH2OH side branch. The alternative form, in charide units bound together by a covalent bond known as which the CH2OH substituent and the anomeric hydroxyl a glycosidic linkage formed via a dehydration reaction, re- are on the same side (cis) of the plane of the ring, is called sulting in the loss of a hydrogen atom from one monosac- 4 CHAPTER 1. CARBOHYDRATE

charide and a hydroxyl group from the other. The formula of unmodified disaccharides is C12H22O11. Although there are numerous kinds of disaccharides, a handful of disaccha- rides are particularly notable. Sucrose, pictured to the right, is the most abundant disaccharide, and the main form in which carbohy- drates are transported in plants. It is composed of one D-glucose molecule and one D-fructose molecule. The systematic name for sucrose, O-α-D-glucopyranosyl- (1→2)-D-fructofuranoside, indicates four things:

• Its monosaccharides: glucose and fructose

• Their ring types: glucose is a pyranose, and fructose is a furanose

• How they are linked together: the oxygen on carbon number 1 (C1) of α-D-glucose is linked to the C2 of D-fructose.

• The -oside suffix indicates that the anomeric carbon of both monosaccharides participates in the glycosidic bond.

Lactose, a disaccharide composed of one D-galactose molecule and one D-glucose molecule, occurs naturally in Grain products: rich sources of carbohydrates mammalian milk. The systematic name for lactose is O- β-D-galactopyranosyl-(1→4)-D-glucopyranose. Other no- table disaccharides include maltose (two D-glucoses linked in humans.[19] Humans are able to obtain most of their en- α−1,4) and cellulobiose (two D-glucoses linked β−1,4). ergy requirement from protein and fats, though the poten- Disaccharides can be classified into two types.They are re- tial for some negative health effects of extreme carbohy- ducing and non-reducing disaccharides. If the functional drate restriction remains, as the issue has not been studied group is present in bonding with another sugar unit, it is extensively so far.[19] However, in the case of dietary fiber called a reducing disaccharide or biose. – indigestible carbohydrates which are not a source of en- ergy – inadequate intake can lead to significant increases in mortality.[20] 1.4 Nutrition Following a diet consisting of very low amounts of daily carbohydrate for several days will usually result in higher Carbohydrate consumed in food yields 3.87 calories of en- levels of blood ketone bodies than an isocaloric diet with ergy per gram for simple sugars,[16] and 3.57 to 4.12 calories similar protein content.[21] This relatively high level of ke- per gram for complex carbohydrate in most other foods.[17] tone bodies is commonly known as and is very often High levels of carbohydrate are often associated with highly confused with the potentially fatal condition often seen in processed foods or refined foods made from plants, in- type 1 diabetics known as diabetic ketoacidosis. Somebody cluding sweets, cookies and candy, table sugar, honey, soft suffering ketoacidosis will have much higher levels of blood drinks, breads and crackers, jams and fruit products, pastas ketone bodies along with high blood sugar, dehydration and and breakfast cereals. Lower amounts of carbohydrate are electrolyte imbalance. usually associated with unrefined foods, including beans, tu- [18] Long-chain fatty acids cannot cross the blood–brain bar- bers, rice, and unrefined fruit. Foods from car- rier, but the liver can break these down to produce ketones. cass have the lowest carbohydrate, but milk does contain However the medium-chain fatty acids octanoic and hep- lactose. tanoic acids can cross the barrier and be used by the brain, Carbohydrates are a common source of energy in living or- which normally relies upon glucose for its energy.[22][23][24] ganisms; however, no carbohydrate is an essential nutrient allows humans to synthesize some glucose 1.5. METABOLISM 5 from specific amino acids: from the glycerol backbone in In any case, the simple vs. complex chemical distinc- triglycerides and in some cases from fatty acids. tion has little value for determining the nutritional qual- [30] Organisms typically cannot metabolize all types of car- ity of carbohydrates. Some simple carbohydrates (e.g. bohydrate to yield energy. Glucose is a nearly univer- fructose) raise blood glucose slowly, while some com- sal and accessible source of energy. Many organisms plex carbohydrates (starches), especially if processed, raise also have the ability to metabolize other monosaccharides blood sugar rapidly. The speed of digestion is determined and disaccharides but glucose is often metabolized first. by a variety of factors including which other nutrients are In Escherichia coli, for example, the lac operon will ex- consumed with the carbohydrate, how the food is prepared, individual differences in metabolism, and the chemistry of press enzymes for the digestion of lactose when it is [31] present, but if both lactose and glucose are present the the carbohydrate. lac operon is repressed, resulting in the glucose being The USDA’s Dietary Guidelines for Americans 2010 call for used first (see: Diauxie). Polysaccharides are also com- moderate- to high-carbohydrate consumption from a bal- mon sources of energy. Many organisms can easily break anced diet that includes six one-ounce servings of grain down starches into glucose, however, most organisms can- foods each day, at least half from whole grain sources and not metabolize cellulose or other polysaccharides like chitin the rest from enriched.[32] and arabinoxylans. These carbohydrate types can be me- The glycemic index (GI) and glycemic load concepts have tabolized by some and protists. Ruminants and been developed to characterize food behavior during hu- termites, for example, use microorganisms to process cel- man digestion. They rank carbohydrate-rich foods based lulose. Even though these complex carbohydrates are not on the rapidity and magnitude of their effect on blood glu- very digestible, they represent an important dietary element cose levels. Glycemic index is a measure of how quickly for humans, called dietary fiber. Fiber enhances digestion, [25] food glucose is absorbed, while glycemic load is a measure among other benefits. of the total absorbable glucose in foods. The insulin index Based on the effects on risk of heart disease and obesity,[26] is a similar, more recent classification method that ranks the Institute of Medicine recommends that American and foods based on their effects on blood insulin levels, which Canadian adults get between 45–65% of dietary energy are caused by glucose (or starch) and some amino acids in from carbohydrates.[27] The Food and Agriculture Organi- food. zation and World Health Organization jointly recommend that national dietary guidelines set a goal of 55–75% of to- tal energy from carbohydrates, but only 10% directly from 1.5 Metabolism sugars (their term for simple carbohydrates).[28] Main article: 1.4.1 Classification

Nutritionists often refer to carbohydrates as either simple 1.5.1 Catabolism or complex. However, the exact distinction between these groups can be ambiguous. The term complex is the metabolic reaction which cells undergo to was first used in the U.S. Senate Select Committee on Nu- extract energy. There are two major metabolic pathways of trition and Human Needs publication Dietary Goals for the monosaccharide catabolism: and the citric acid United States (1977) where it was intended to distinguish cycle. sugars from other carbohydrates (which were perceived to [29] In glycolysis, oligo/polysaccharides are cleaved first to be nutritionally superior). However, the report put “fruit, smaller monosaccharides by enzymes called glycoside hy- vegetables and whole-grains” in the complex carbohydrate drolases. The monosaccharide units can then enter into column, despite the fact that these may contain sugars as monosaccharide catabolism. In some cases, as with hu- well as polysaccharides. This confusion persists as today mans, not all carbohydrate types are usable as the digestive some nutritionists use the term complex carbohydrate to and metabolic enzymes necessary are not present. refer to any sort of digestible saccharide present in a whole food, where fiber, vitamins and minerals are also found (as opposed to processed carbohydrates, which provide energy but few other nutrients). The standard usage, however, is to 1.6 Carbohydrate chemistry classify carbohydrates chemically: simple if they are sugars (monosaccharides and disaccharides) and complex if they Carbohydrate chemistry is a large and economically impor- are polysaccharides (or oligosaccharides).[30] tant branch of organic chemistry. Some of the main organic 6 CHAPTER 1. CARBOHYDRATE reactions that involve carbohydrates are: [3] National Institute of Standards and Technology (2011). “Material Measurement Library D-erythro-Pentose, 2- deoxy-". nist.gov. • Carbohydrate acetalisation [4] Long Island University (May 29, 2013). “The Chemistry of • Cyanohydrin reaction Carbohydrates”. brooklyn.liu.edu.

• Lobry-de Bruyn-van Ekenstein transformation [5] Purdue University (May 29, 2013). “Carbohydrates: The Monosaccharides”. purdue.edu. • Amadori rearrangement [6] Flitsch, Sabine L.; Ulijn, Rein V (2003). “Sugars tied to the • Nef reaction spot”. Nature 421 (6920): 219–20. doi:10.1038/421219a. PMID 12529622. • Wohl degradation [7] Maton, Anthea; Jean Hopkins; Charles William McLaugh- • Koenigs–Knorr reaction lin; Susan Johnson; Maryanna Quon Warner; David LaHart; Jill D. Wright (1993). and Health. Engle- • Carbohydrate digestion wood Cliffs, New Jersey, USA: Prentice Hall. pp. 52–59. ISBN 0-13-981176-1.

[8] John Merle Coulter, Charler Reid Barnes, Henry Chandler 1.7 See also Cowles (1930), A Textbook of for Colleges and Uni- versities" • Bioplastic [9] Carl A. Burtis, Edward R. Ashwood, Norbert W. Tietz • (2000), Tietz fundamentals of • [10] Matthews, C. E.; K. E. Van Holde; K. G. Ahern (1999) Gluconeogenesis Biochemistry. 3rd edition. Benjamin Cummings. ISBN 0- • Glycoinformatics 8053-3066-6 [11] http://www.ncbi.nlm.nih.gov/books/NBK1955/#_ch2_s4_ • Glycolipid [12] Campbell, Neil A.; Brad Williamson; Robin J. Heyden • Glycoprotein (2006). Biology: Exploring Life. Boston, Massachusetts: Pearson Prentice Hall. ISBN 0-13-250882-6. • Low-carbohydrate diet [13] Pigman, Ward; Horton, D. (1972). “Chapter 1: Stereo- • Macromolecule chemistry of the Monosaccharides”. In Pigman and Hor- ton. The Carbohydrates: Chemistry and Biochemistry Vol • No-carbohydrate diet 1A (2nd ed.). San Diego: Academic Press. pp. 1–67.

• Nutrition [14] Pigman, Ward; Anet, E.F.L.J. (1972). “Chapter 4: Mutaro- tations and Actions of Acids and Bases”. In Pigman and Hor- • Pentose phosphate pathway ton. The Carbohydrates: Chemistry and Biochemistry Vol 1A (2nd ed.). San Diego: Academic Press. pp. 165–194. • [15] “lyxoflavin”. Merriam-Webster. • Saccharic acid [16] http://ndb.nal.usda.gov/ndb/foods/show/6202 • Sugar [17] http://www.fao.org/docrep/006/y5022e/y5022e04.htm • Carbohydrate NMR [18] http://www.diabetes.org.uk/upload/How%20we%20help/ catalogue/carb-reference-list-0511.pdf

[19] Westman, EC (2002). “Is dietary carbohydrate essential for 1.8 References human nutrition?". The American journal of clinical nutri- tion 75 (5): 951–3; author reply 953–4. PMID 11976176. [1] Western Kentucky University (May 29, 2013). “WKU BIO 113 Carbohydrates”. wku.edu. [20] Park, Y; Subar, AF; Hollenbeck, A; Schatzkin, A (2011). “Dietary fiber intake and mortality in the NIH-AARP diet [2] Eldra Pearl Solomon, Linda R. Berg, Diana W. Martin; and health study”. Archives of Internal Medicine 171 Cengage Learning (2004). Biology. google.books.com. p. (12): 1061–8. doi:10.1001/archinternmed.2011.18. PMC 52. ISBN 978-0534278281. 3513325. PMID 21321288. 1.9. EXTERNAL LINKS 7

[21] http://ajcn.nutrition.org/content/83/5/1055.full.pdf+html • Functional Glycomics Gateway, a collaboration be- tween the Consortium for Functional Glycomics and [22] http://www.jneurosci.org/content/23/13/5928.full Nature Publishing Group

[23] http://www.nature.com/jcbfm/journal/v33/n2/abs/ • Carbohydrate: Biochemistry Course jcbfm2012151a.html

[24] MedBio.info > Integration of Metabolism Professor em. Robert S. Horn, Oslo, Norway. Retrieved on May 1, 2010.

[25] Pichon, L; Huneau, JF; Fromentin, G; Tomé, D (2006). “A high-protein, high-fat, carbohydrate-free diet reduces energy intake, hepatic , and adiposity in rats”. The Jour- nal of nutrition 136 (5): 1256–60. PMID 16614413.

[26] Tighe, P; Duthie, G; Vaughan, N; Brittenden, J; Simpson, WG; Duthie, S; Mutch, W; Wahle, K; Horgan, G; Thies, F. (2010). “Effect of increased consumption of whole- grain foods on blood pressure and other cardiovascular risk markers in healthy middle-aged persons: a randomized, controlled trial”. The American journal of clinical nutri- tion 92 (4): 733–40. doi:10.3945/ajcn.2010.29417. PMID 20685951.

[27] Food and Nutrition Board (2002/2005). Dietary Reference Intakes for Energy, Carbohydrate, Fiber, Fat, Fatty Acids, Cholesterol, Protein, and Amino Acids. Washington, D.C.: The National Academies Press. Page 769. ISBN 0-309- 08537-3.

[28] Joint WHO/FAO expert consultation (2003). (PDF). Geneva: World Health Organization. pp. 55–56. ISBN 92- 4-120916-X.

[29] Joint WHO/FAO expert consultation (1998), Carbohydrates in human nutrition, chapter 1. ISBN 92-5-104114-8.

[30] “Carbohydrates”. The Nutrition Source. Harvard School of Public Health. Retrieved 3 April 2013.

[31] Jenkins, David; Alexandra L. Jenkins, Thomas M.S. Woleve, Lilian H. Thompson and A. Venkat Rao (Febru- ary 1986). “Simple and Complex Carbohydrates”. Nutrition Reviews 44 (2).

[32] DHHS and USDA, Dietary Guidelines for Americans 2010.

1.9 External links

• Carbohydrates, including interactive models and ani- mations (Requires MDL Chime)

• IUPAC-IUBMB Joint Commission on Biochemical Nomenclature (JCBN): Carbohydrate Nomenclature

• Carbohydrates detailed

• Carbohydrates and Glycosylation – The Virtual Li- brary of Biochemistry and Chapter 2

Lipid

Using this approach, lipids may be divided into eight categories: fatty acids, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, and polyketides (derived from condensation of ketoacyl subunits); and sterol lipids and prenol lipids (derived from condensation of isoprene subunits).[4] Although the term lipid is sometimes used as a synonym for fats, fats are a subgroup of lipids called triglycerides. Lipids also encompass molecules such as fatty acids and their derivatives (including tri-, di-, monoglycerides, and phospholipids), as well as other sterol-containing metabolites such as cholesterol.[7] Although humans and other mammals use various biosynthetic pathways to both break down and synthesize lipids, some essential lipids can- not be made this way and must be obtained from the diet. The chemical formation of pre-biological lipids and their formation into protocells are considered key steps in models of , the origin of life. Structures of some common lipids. At the top are cholesterol[1] and oleic acid.[2] The middle structure is a triglyceride com- posed of oleoyl, stearoyl, and palmitoyl chains attached to a glycerol backbone. At the bottom is the common phospholipid, 2.1 Categories of lipids phosphatidylcholine.[3] 2.1.1 Fatty acids

Lipids are a group of naturally occurring molecules that Fatty acids, or fatty acid residues when they form part of include fats, waxes, sterols, fat-soluble vitamins (such as a lipid, are a diverse group of molecules synthesized by vitamins A, D, E, and K), monoglycerides, diglycerides, chain-elongation of an acetyl-CoA primer with malonyl- triglycerides, phospholipids, and others. The main biolog- CoA or methylmalonyl-CoA groups in a process called ical functions of lipids include storing energy, signaling, [8][9] [4][5] . They are made of a hydrocarbon and acting as structural components of cell membranes. chain that terminates with a carboxylic acid group; this ar- Lipids have applications in the cosmetic and food industries [6] rangement confers the molecule with a polar, hydrophilic as well as in nanotechnology. end, and a nonpolar, hydrophobic end that is insoluble Lipids may be broadly defined as hydrophobic or in water. The fatty acid structure is one of the most amphiphilic small molecules; the amphiphilic nature of fundamental categories of biological lipids, and is com- some lipids allows them to form structures such as vesicles, monly used as a building-block of more structurally com- multilamellar/unilamellar liposomes, or membranes in an plex lipids.[10] The carbon chain, typically between four and aqueous environment. Biological lipids originate entirely 24 carbons long,[11] may be saturated or unsaturated, and or in part from two distinct types of biochemical subunits may be attached to functional groups containing oxygen, or “building-blocks": ketoacyl and isoprene groups.[4] halogens, nitrogen, and sulfur. If a fatty acid contains

8 2.1. CATEGORIES OF LIPIDS 9

a double bond, there is the possibility of either a cis or bilayer of cells,[22] as well as being involved in metabolism trans geometric isomerism, which significantly affects the and cell signaling.[23] Neural tissue (including the brain) molecule’s configuration. Cis-double bonds cause the fatty contains relatively high amounts of glycerophospholipids, acid chain to bend, an effect that is compounded with more and alterations in their composition has been implicated double bonds in the chain. Three double bonds in 18- in various neurological disorders.[24] Glycerophospholipids carbon linolenic acid, the most abundant fatty-acyl chains of may be subdivided into distinct classes, based on the nature plant thylakoid membranes, render these membranes highly of the polar headgroup at the sn−3 position of the glycerol fluid despite environmental low-temperatures,[12] and also backbone in eukaryotes and eubacteria, or the sn−1 posi- makes linolenic acid give dominating sharp peaks in high tion in the case of archaebacteria.[25] resolution 13-C NMR spectra of chlorplasts. This in turn plays an important role in the structure and function of cell membranes.[13] Most naturally occurring fatty acids are of the cis configuration, although the trans form does exist in some natural and partially hydrogenated fats and oils.[14] Examples of biologically important fatty acids include the , derived primarily from arachidonic acid and eicosapentaenoic acid, that include prostaglandins, leukotrienes, and thromboxanes. Docosahexaenoic acid is also important in biological systems, particularly with re- Phosphatidylethanolamine[3] spect to sight.[15][16] Other major lipid classes in the fatty acid category are the fatty esters and fatty . Fatty es- ters include important biochemical intermediates such as Examples of glycerophospholipids found in biological wax esters, fatty acid thioester coenzyme A derivatives, membranes are phosphatidylcholine (also known as PC, fatty acid thioester ACP derivatives and fatty acid car- GPCho or lecithin), phosphatidylethanolamine (PE or nitines. The fatty amides include N-acyl ethanolamines, GPEtn) and phosphatidylserine (PS or GPSer). In addi- such as the cannabinoid neurotransmitter anandamide.[17] tion to serving as a primary component of cellular mem- branes and binding sites for intra- and intercellular pro- teins, some glycerophospholipids in eukaryotic cells, such 2.1.2 Glycerolipids as phosphatidylinositols and phosphatidic acids are either precursors of or, themselves, membrane-derived second Glycerolipids are composed of mono-, di-, and tri- messengers.[26] Typically, one or both of these hydroxyl substituted glycerols,[18] the most well-known being the groups are acylated with long-chain fatty acids, but there fatty acid triesters of glycerol, called triglycerides. The are also alkyl-linked and 1Z-alkenyl-linked (plasmalogen) word “triacylglycerol” is sometimes used synonymously glycerophospholipids, as well as dialkylether variants in with “triglyceride”. In these compounds, the three hydroxyl archaebacteria.[27] groups of glycerol are each esterified, typically by different fatty acids. Because they function as an energy store, these lipids comprise the bulk of storage fat in animal tissues. The 2.1.4 Sphingolipids hydrolysis of the ester bonds of triglycerides and the release [28] of glycerol and fatty acids from adipose tissue are the initial Sphingolipids are a complicated family of compounds steps in metabolising fat.[19] that share a common structural feature, a sphingoid base backbone that is synthesized de novo from the Additional subclasses of glycerolipids are represented by and a long-chain fatty acyl CoA, then converted into glycosylglycerols, which are characterized by the presence ceramides, phosphosphingolipids, glycosphingolipids and of one or more sugar residues attached to glycerol via a other compounds. The major sphingoid base of mam- glycosidic linkage. Examples of structures in this cat- mals is commonly referred to as sphingosine. Ceramides egory are the digalactosyldiacylglycerols found in plant (N-acyl-sphingoid bases) are a major subclass of sphin- [20] membranes and seminolipid from mammalian sperm goid base derivatives with an -linked fatty acid. The [21] cells. fatty acids are typically saturated or mono-unsaturated with chain lengths from 16 to 26 carbon atoms.[29] 2.1.3 Glycerophospholipids The major phosphosphingolipids of mammals are sphingomyelins (ceramide phosphocholines),[30] whereas Glycerophospholipids, usually referred to as phospholipids, insects contain mainly ceramide phosphoethanolamines[31] are ubiquitous in nature and are key components of the lipid and fungi have phytoceramide phosphoinositols and 10 CHAPTER 2. LIPID

tached to a quinonoid core of non-isoprenoid origin.[41] Vitamin E and vitamin K, as well as the ubiquinones, are examples of this class. Prokaryotes synthesize polyprenols (called bactoprenols) in which the terminal isoprenoid unit attached to oxygen remains unsaturated, whereas in an- imal polyprenols (dolichols) the terminal isoprenoid is Sphingomyelin[3] reduced.[42]

2.1.7 Saccharolipids mannose-containing headgroups.[32] The glycosphin- golipids are a diverse family of molecules composed of one or more sugar residues linked via a glycosidic bond to the sphingoid base. Examples of these are the simple and complex glycosphingolipids such as cerebrosides and gangliosides.

2.1.5 Sterol lipids

Sterol lipids, such as cholesterol and its derivatives, are an important component of membrane lipids,[33] along with the glycerophospholipids and sphingomyelins. The , all derived from the same fused four-ring core structure, have different biological roles as hormones and signaling molecules. The eighteen-carbon (C18) steroids include the estrogen family whereas the C19 steroids comprise the androgens such as testosterone and

androsterone. The C21 subclass includes the progestogens [43] [34] Structure of the saccharolipid Kdo2-Lipid A. Glucosamine as well as the glucocorticoids and mineralocorticoids. residues in blue, Kdo residues in red, acyl chains in black and The secosteroids, comprising various forms of vitamin D, phosphate groups in green. are characterized by cleavage of the B ring of the core structure.[35] Other examples of sterols are the bile acids and Saccharolipids describe compounds in which fatty acids their conjugates,[36] which in mammals are oxidized deriva- are linked directly to a sugar backbone, forming struc- tives of cholesterol and are synthesized in the liver. The tures that are compatible with membrane bilayers. In the plant equivalents are the phytosterols, such as β-sitosterol, saccharolipids, a monosaccharide substitutes for the glyc- stigmasterol, and brassicasterol; the latter compound is also erol backbone present in glycerolipids and glycerophos- used as a biomarker for algal growth.[37] The predominant pholipids. The most familiar saccharolipids are the acy- sterol in fungal cell membranes is ergosterol.[38] lated glucosamine precursors of the Lipid A component of the lipopolysaccharides in Gram-negative bacteria. Typical lipid A molecules are disaccharides of glucosamine, which 2.1.6 Prenol lipids are derivatized with as many as seven fatty-acyl chains. The minimal lipopolysaccharide required for growth in E. coli is Prenol lipids are synthesized from the five-carbon-unit pre- Kdo2-Lipid A, a hexa-acylated disaccharide of glucosamine cursors isopentenyl diphosphate and dimethylallyl diphos- that is glycosylated with two 3-deoxy-D-manno-octulosonic phate that are produced mainly via the mevalonic acid acid (Kdo) residues.[43] (MVA) pathway.[39] The simple isoprenoids (linear alco- hols, diphosphates, etc.) are formed by the successive ad- dition of C5 units, and are classified according to number 2.1.8 Polyketides of these terpene units. Structures containing greater than 40 carbons are known as polyterpenes. Carotenoids are Polyketides are synthesized by polymerization of acetyl and important simple isoprenoids that function as antioxidants propionyl subunits by classic enzymes as well as iterative and as precursors of vitamin A.[40] Another biologically im- and multimodular enzymes that share mechanistic features portant class of molecules is exemplified by the quinones with the fatty acid synthases. They comprise a large num- and hydroquinones, which contain an isoprenoid tail at- ber of secondary metabolites and natural products from an- 2.2. BIOLOGICAL FUNCTIONS 11

imal, plant, bacterial, fungal and marine sources, and have great structural diversity.[44][45] Many polyketides are cyclic molecules whose backbones are often further modified by glycosylation, , , oxidation, and/or other processes. Many commonly used anti-microbial, anti-parasitic, and anti-cancer agents are polyketides or polyketide derivatives, such as erythromycins, , avermectins, and antitumor epothilones.[46]

2.2 Biological functions

2.2.1 Membranes

Eukaryotic cells are compartmentalized into membrane- bound organelles that carry out different biological func- tions. The glycerophospholipids are the main structural component of biological membranes, such as the cellu- lar plasma membrane and the intracellular membranes of organelles; in animal cells the plasma membrane phys- ically separates the intracellular components from the extracellular environment. The glycerophospholipids are amphipathic molecules (containing both hydrophobic and Self-organization of phospholipids: a spherical liposome, a micelle, hydrophilic regions) that contain a glycerol core linked to and a lipid bilayer. two fatty acid-derived “tails” by ester linkages and to one “head” group by a phosphate ester linkage. While glyc- erophospholipids are the major component of biological ous environment, while the hydrophobic tails minimize membranes, other non-glyceride lipid components such as their contact with water and tend to cluster together, form- sphingomyelin and sterols (mainly cholesterol in animal cell ing a vesicle; depending on the concentration of the lipid, membranes) are also found in biological membranes.[47] this biophysical interaction may result in the formation of In plants and algae, the galactosyldiacylglycerols,[48] and micelles, liposomes, or lipid bilayers. Other aggregations sulfoquinovosyldiacylglycerol,[20] which lack a phosphate are also observed and form part of the polymorphism of group, are important components of membranes of chloro- amphiphile (lipid) behavior. Phase behavior is an area of plasts and related organelles and are the most abundant study within and is the subject of current aca- lipids in photosynthetic tissues, including those of higher demic research.[51][52] Micelles and bilayers form in the plants, algae and certain bacteria. polar medium by a process known as the hydrophobic ef- fect.[53] When dissolving a lipophilic or amphiphilic sub- Plant thylakoid membranes have the largest lipid compo- stance in a polar environment, the polar molecules (i.e., nent of a non-bilayer forming monogalactosyl diglyceride water in an aqueous solution) become more ordered around (MGDG), and little phospholipids; despite this unique lipid the dissolved lipophilic substance, since the polar molecules composition, chloroplast thylakoid membranes have been cannot form hydrogen bonds to the lipophilic areas of the shown to contain a dynamic lipid-bilayer matrix as revealed [49] amphiphile. So in an aqueous environment, the water by magnetic resonance and electron microscope studies. molecules form an ordered "clathrate" cage around the dis- Bilayers have been found to exhibit high levels of solved lipophilic molecule.[54] birefringence, which can be used to probe the degree of or- The formation of lipids into protocell membranes is a key der (or disruption) within the bilayer using techniques such step in models of abiogenesis, the origin of life. as dual polarization interferometry and Circular dichroism. A biological membrane is a form of lamellar phase lipid bilayer. The formation of lipid bilayers is an energeti- 2.2.2 Energy storage cally preferred process when the glycerophospholipids de- scribed above are in an aqueous environment.[50] This is Triglycerides, stored in adipose tissue, are a major form of known as the hydrophobic effect. In an aqueous system, energy storage both in animals and plants. The adipocyte, the polar heads of lipids align towards the polar, aque- or fat cell, is designed for continuous synthesis and break- 12 CHAPTER 2. LIPID

down of triglycerides in animals, with breakdown con- teria), and in eukaryotic protein N-glycosylation.[66][67] trolled mainly by the activation of hormone-sensitive en- Cardiolipins are a subclass of glycerophospholipids con- zyme lipase.[55] The complete oxidation of fatty acids pro- taining four acyl chains and three glycerol groups that vides high caloric content, about 9 kcal/g, compared with are particularly abundant in the inner mitochondrial 4 kcal/g for the breakdown of carbohydrates and proteins. membrane.[68][69][70] They are believed to activate enzymes Migratory birds that must fly long distances without eating involved with oxidative .[71] Lipids also use stored energy of triglycerides to fuel their flights.[56] form the basis of hormones.[72]

2.2.3 Signaling 2.3 Metabolism In recent years, evidence has emerged showing that lipid signaling is a vital part of the cell signaling.[57][58] Lipid The major dietary lipids for humans and other animals are signaling may occur via activation of G protein-coupled animal and plant triglycerides, sterols, and membrane phos- or nuclear receptors, and members of several different pholipids. The process of synthesizes and lipid categories have been identified as signaling molecules degrades the lipid stores and produces the structural and and cellular messengers.[59] These include sphingosine- functional lipids characteristic of individual tissues. 1-phosphate, a derived from ceramide that is a potent messenger molecule involved in regulating calcium mobilization,[60] cell growth, and apoptosis;[61] 2.3.1 Biosynthesis diacylglycerol (DAG) and the phosphatidylinositol phos- phates (PIPs), involved in calcium-mediated activation of In animals, when there is an oversupply of dietary carbohy- protein kinase C;[62] the prostaglandins, which are one type drate, the excess carbohydrate is converted to triglycerides. of fatty-acid derived involved in inflammation This involves the synthesis of fatty acids from acetyl-CoA and immunity;[63] the steroid hormones such as estrogen, and the esterification of fatty acids in the production of testosterone and cortisol, which modulate a host of func- triglycerides, a process called lipogenesis.[73] Fatty acids are tions such as reproduction, metabolism and blood pressure; made by fatty acid synthases that polymerize and then re- and the oxysterols such as 25-hydroxy-cholesterol that are duce acetyl-CoA units. The acyl chains in the fatty acids are liver X receptor agonists.[64] Phosphatidylserine lipids are extended by a cycle of reactions that add the acetyl group, known to be involved in signaling for the phagocytosis of reduce it to an alcohol, dehydrate it to an group and apoptotic cells and/or pieces of cells. They accomplish this then reduce it again to an group. The enzymes of by being exposed to the extracellular face of the cell mem- fatty acid biosynthesis are divided into two groups, in an- brane after the inactivation of flippases which place them imals and fungi all these fatty acid synthase reactions are exclusively on the cytosolic side and the activation of scram- carried out by a single multifunctional protein,[74] while in blases, which scramble the orientation of the phospholipids. plant plastids and bacteria separate enzymes perform each After this occurs, other cells recognize the phosphatidylser- step in the pathway.[75][76] The fatty acids may be sub- ines and phagocytosize the cells or cell fragments exposing sequently converted to triglycerides that are packaged in them. lipoproteins and secreted from the liver. The synthesis of unsaturated fatty acids involves a desaturation reaction, whereby a double bond is introduced 2.2.4 Other functions into the fatty acyl chain. For example, in humans, the de- saturation of stearic acid by stearoyl-CoA desaturase-1 pro- The “fat-soluble” vitamins (A, D, E and K) – which are duces oleic acid. The doubly unsaturated fatty acid linoleic isoprene-based lipids – are essential nutrients stored in acid as well as the triply unsaturated α-linolenic acid can- the liver and fatty tissues, with a diverse range of func- not be synthesized in mammalian tissues, and are therefore tions. Acyl-carnitines are involved in the transport and essential fatty acids and must be obtained from the diet.[77] metabolism of fatty acids in and out of mitochondria, where they undergo .[65] Polyprenols and their Triglyceride synthesis takes place in the endoplasmic retic- phosphorylated derivatives also play important transport ulum by metabolic pathways in which acyl groups in fatty acyl-CoAs are transferred to the hydroxyl groups of roles, in this case the transport of oligosaccharides across [78] membranes. Polyprenol phosphate sugars and polyprenol glycerol-3-phosphate and diacylglycerol. diphosphate sugars function in extra-cytoplasmic glyco- Terpenes and isoprenoids, including the carotenoids, are sylation reactions, in extracellular polysaccharide biosyn- made by the assembly and modification of isoprene units thesis (for instance, peptidoglycan polymerization in bac- donated from the reactive precursors isopentenyl pyrophos- 2.5. SEE ALSO 13

phate and dimethylallyl pyrophosphate.[79] These precur- ies have shown positive health benefits associated with con- sors can be made in different ways. In animals and archaea, sumption of omega-3 fatty acids on infant development, the mevalonate pathway produces these compounds from cancer, cardiovascular diseases, and various mental ill- acetyl-CoA,[80] while in plants and bacteria the non- nesses, such as depression, attention-deficit hyperactivity mevalonate pathway uses pyruvate and glyceraldehyde 3- disorder, and dementia.[88][89] In contrast, it is now well- phosphate as substrates.[79][81] One important reaction that established that consumption of trans fats, such as those uses these activated isoprene donors is steroid biosynthe- present in partially hydrogenated vegetable oils, are a risk sis. Here, the isoprene units are joined together to make factor for cardiovascular disease.[90][91][92] squalene and then folded up and formed into a set of rings to [82] A few studies have suggested that total dietary fat in- make lanosterol. Lanosterol can then be converted into take is linked to an increased risk of obesity[93][94] and other steroids such as cholesterol and ergosterol.[82][83] diabetes.[95][96] However, a number of very large studies, including the Women’s Health Initiative Dietary Modifica- 2.3.2 Degradation tion Trial, an eight-year study of 49,000 women, the Nurses’ Health Study and the Health Professionals Follow-up Study, revealed no such links.[97][98][99] None of these studies sug- Beta oxidation is the metabolic process by which fatty acids gested any connection between percentage of calories from are broken down in the mitochondria and/or in peroxisomes fat and risk of cancer, heart disease, or weight gain. The to generate acetyl-CoA. For the most part, fatty acids are Nutrition Source, a website maintained by the Department oxidized by a mechanism that is similar to, but not identical of Nutrition at the Harvard School of Public Health, sum- with, a reversal of the process of fatty acid synthesis. That marizes the current evidence on the impact of dietary fat: is, two-carbon fragments are removed sequentially from the “Detailed research—much of it done at Harvard—shows carboxyl end of the acid after steps of dehydrogenation, that the total amount of fat in the diet isn't really linked hydration, and oxidation to form a beta-keto acid, which with weight or disease.”[100] is split by thiolysis. The acetyl-CoA is then ultimately con- verted into ATP, CO2, and H2O using the and the . Hence the Krebs Cycle can start at acetyl-CoA when fat is 2.5 See also being broken down for energy if there is little or no glucose available. • Emulsion test

The energy yield of the complete oxidation of the fatty acid • Essential fatty acid palmitate is 106 ATP.[84] Unsaturated and odd-chain fatty acids require additional enzymatic steps for degradation. • Lipid microdomain

• Lipid signaling 2.4 Nutrition and health • Lipidomics

Most of the fat found in food is in the form of triglycerides, • Lipoprotein cholesterol, and phospholipids. Some dietary fat is neces- sary to facilitate absorption of fat-soluble vitamins (A, D, • Protein-lipid interaction E, and K) and carotenoids.[85] Humans and other mammals have a dietary requirement for certain essential fatty acids, • Phenolic lipids, a class of natural products composed such as linoleic acid (an omega-6 fatty acid) and alpha- of long aliphatic chains and phenolic rings that occur linolenic acid (an omega-3 fatty acid) because they can- in plants, fungi and bacteria not be synthesized from simple precursors in the diet.[77] Both of these fatty acids are 18-carbon polyunsaturated fatty acids differing in the number and position of the dou- 2.6 References ble bonds. Most vegetable oils are rich in linoleic acid (safflower, sunflower, and corn oils). Alpha-linolenic acid [1] Maitland, Jr Jones (1998). Organic Chemistry. W W Norton is found in the green leaves of plants, and in selected seeds, & Co Inc (Np). p. 139. ISBN 0-393-97378-6. nuts, and legumes (in particular flax, rapeseed, walnut, [86] and soy). Fish oils are particularly rich in the longer- [2] Stryer et al., p. 328. chain omega-3 fatty acids eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA).[87] A large number of stud- [3] Stryer et al., p. 330. 14 CHAPTER 2. LIPID

[4] Fahy E, Subramaniam S, Murphy R, Nishijima M, Raetz C, [18] Coleman RA, Lee DP (2004). “Enzymes of triglyceride syn- Shimizu T, Spener F, Van Meer G, Wakelam M and Dennis thesis and their regulation”. Progress in Lipid Research 43 E.A (2009). “Update of the LIPID MAPS comprehensive (2): 134–76. doi:10.1016/S0163-7827(03)00051-1. PMID classification system for lipids”. Journal of Lipid Research 14654091. 50 (Supplement): S9–S14. doi:10.1194/jlr.R800095- JLR200. PMC 2674711. PMID 19098281. [19] van Holde and Mathews, p. 630–31.

[5] Subramaniam S, Fahy E, Gupta S, Sud M, Byrnes [20] Hölzl G, Dörmann P (2007). “Structure and func- RW, Cotter D, Dinasarapu AR and Maurya MR tion of glycoglycerolipids in plants and bacte- (2011). “Bioinformatics and of the ria”. Progress in Lipid Research 46 (5): 225–43. Lipidome”. Chemical Reviews 111 (10): 6452–6490. doi:10.1016/j.plipres.2007.05.001. PMID 17599463. doi:10.1021/cr200295k. PMC 3383319. PMID 21939287. [21] Honke K, Zhang Y, Cheng X, Kotani N, Taniguchi N [6] Mashaghi S., Jadidi T., Koenderink G., Mashaghi A. (2013). (2004). “Biological roles of sulfoglycolipids and pathophys- “Lipid Nanotechnology”. Int. J. Mol. Sci. 2013 (14): 4242– iology of their deficiency”. Glycoconjugates Journal 21 (1– 4282. doi:10.3390/ijms14024242. 2): 59–62. doi:10.1023/B:GLYC.0000043749.06556.3d. PMID 15467400. [7] Michelle A, Hopkins J, McLaughlin CW, Johnson S, Warner [22] “The Structure of a Membrane”. The Lipid Chronicles. Re- MQ, LaHart D, Wright JD (1993). Human Biology and trieved 2011-12-31. Health. Englewood Cliffs, New Jersey, USA: Prentice Hall. ISBN 0-13-981176-1. OCLC 32308337. [23] Berridge MJ, Irvine RF (1989). “Inositol phosphates and cell signalling”. Nature Journal 341 (1): 197–205. [8] Vance JE, Vance DE (2002). Biochemistry of Lipids, doi:10.1038/341197a0. Lipoproteins and Membranes. Amsterdam: Elsevier. ISBN 0-444-51139-3. OCLC 51001207. [24] Farooqui AA, Horrocks LA, Farooqui T (2000). “Glyc- erophospholipids in brain: their metabolism, incorporation [9] Brown HA, ed. (2007). Lipodomics and Bioactive Lipids: into membranes, functions, and involvement in neurological Based Lipid Analysis, Volume 432 (Meth- disorders”. Chemistry and Physics of Lipids 106 (1): 1–29. ods in Enzymology). Boston: Academic Press. ISBN 0-12- doi:10.1016/S0009-3084(00)00128-6. PMID 10878232. 373895-4. OCLC 166624879. [25] Ivanova PT, Milne SB, Byrne MO, Xiang Y, Brown HA [10] Mandal, Ananya. “Types of Lipids”. news-medical.net. (2007). “Glycerophospholipid identification and quan- [11] Hunt SM, Groff JL, Gropper SAS (1995). Advanced Nutri- titation by electrospray ionization mass spectrometry”. tion and Human Metabolism. Belmont, CA: West Pub. Co. Methods in Enzymology. Methods in Enzymology 432: p. 98. ISBN 0-314-04467-1. 21–57. doi:10.1016/S0076-6879(07)32002-8. ISBN 9780123738950. PMID 17954212. [12] YashRoy R.C. (1987) 13-C NMR studies of lipid fatty [26] van Holde and Mathews, p. 844. acyl chains of chloroplast membranes. Indian Journal of Biochemistry and Biophysics, vol. 24(6), pp. 177- [27] Paltauf F (1994). “Ether lipids in biomembranes”. 178.https://www.researchgate.net/publication/230822408_ Chemistry and Physics of Lipids 74 (2): 101–39. 13-C_NMR_studies_of_lipid_fatty_acyl_chains_of_ doi:10.1016/0009-3084(94)90054-X. PMID 7859340. chloroplast_membranes?ev=prf_pub [28] Merrill AH, Sandhoff K. (2002). “Sphingolipids: [13] Devlin, pp. 193–95. metabolism and cell signaling”, Ch. 14 in New Compre- hensive Biochemistry: Biochemistry of Lipids, Lipoproteins, [14] Hunter JE (November 2006). “Dietary trans fatty acids: re- and Membranes, Vance, D.E. and Vance, J.E., eds. Elsevier view of recent human studies and food industry responses”. Science, NY, ISBN 0121822125. Lipids 41 (11): 967–92. doi:10.1007/s11745-006-5049-y. PMID 17263298. [29] Devlin, pp. 421–22.

[15] “A Long Lipid, a Long Name: Docosahexaenoic Acid”. The [30] Hori T, Sugita M (1993). “Sphingolipids in lower ani- Lipid Chronicles. Retrieved 2011-12-31. mals”. Prog. Lipid Res 32 (1): 25–45. doi:10.1016/0163- 7827(93)90003-F. PMID 8415797. [16] “DHA FOR OPTIMAL BRAIN AND VISUAL FUNC- TIONING”. DHA/EPA Omega-3 Institute. [31] Wiegandt H (1992). “Insect glycolipids”. Biochimica et Biophysica Acta 1123 (2): 117–26. doi:10.1016/0005- [17] Fezza F, De Simone C, Amadio D, Maccarrone M (2008). 2760(92)90101-Z. PMID 1739742. “Fatty acid amide hydrolase: a gate-keeper of the endo- cannabinoid system”. Subcellular Biochemistry. Subcellular [32] Guan X, Wenk MR (2008). “Biochemistry of inosi- Biochemistry 49: 101–32. doi:10.1007/978-1-4020-8831- tol lipids”. Frontiers in Bioscience 13 (13): 3239–51. 5_4. ISBN 978-1-4020-8830-8. PMID 18751909. doi:10.2741/2923. PMID 18508430. 2.6. REFERENCES 15

[33] Bach D, Wachtel E (2003). “Phospholipid/cholesterol generation of improved antifungal and antiparasitic agents”. model membranes: formation of cholesterol crystal- Current Topics in 8 (8): 639–53. lites”. Biochim Biophys Acta 1610 (2): 187–97. doi:10.2174/156802608784221479. PMID 18473889. Re- doi:10.1016/S0005-2736(03)00017-8. PMID 12648773. trieved 2009-04-12.

[34] Stryer et al., p. 749. [46] Minto RE, Blacklock BJ (2008). “Biosynthesis and function of polyacetylenes and allied natural prod- [35] Bouillon R, Verstuyf A, Mathieu C, Van Cromphaut ucts”. Progress in Lipid Research 47 (4): 233–306. S, Masuyama R, Dehaes P, Carmeliet G (2006). doi:10.1016/j.plipres.2008.02.002. PMC 2515280. PMID “Vitamin D resistance”. Best Practice & Research. 18387369. Clinical Endocrinology & Metabolism 20 (4): 627–45. doi:10.1016/j.beem.2006.09.008. PMID 17161336. [47] Stryer et al., pp. 329–331

[36] Russell DW (2003). “The enzymes, regula- [48] Heinz E.(1996). Plant glycolipids: structure, isolation and tion, and of bile acid synthesis”. An- analysis. in Advances in Lipid Methodology, Vol. 3 pp. nual Review of Biochemistry 72: 137–74. 211–332 (ed. W.W. Christie, Oily Press, Dundee) ISBN doi:10.1146/annurev.biochem.72.121801.161712. PMID 0951417169 12543708. [49] YashRoy R.C. (1990) Magnetic resonance studies [37] Villinski JC, Hayes JM, Brassell SC, Riggert VL, Dunbar of the dynamic organisation of lipids of chloroplast RB (2008). “Sedimentary sterols as biogeochemical indica- membranes. Journal of Biosciences, vol. 15(4), pp. 281- tors in the Southern Ocean”. Organic 39 (5): 288.https://www.researchgate.net/publication/225688482_ 567–88. doi:10.1016/j.orggeochem.2008.01.009. Magnetic_resonance_studies_of_dynamic_organisation_ of_lipids_in_chloroplast_membranes?ev=prf_pub [38] Deacon J (2005). Fungal Biology. Cambridge, MA: Black- well Publishers. p. 342. ISBN 1-4051-3066-0. [50] Stryer et al., pp. 333–34.

[39] Kuzuyama T, Seto H (2003). “Diversity of the biosynthesis [51] van Meer G, Voelker DR, Feigenson GW (2008). of the isoprene units”. Reports 20 (2): 171– “Membrane lipids: where they are and how they behave”. 83. doi:10.1039/b109860h. PMID 12735695. Nature Reviews Molecular Cell Biology 9 (2): 112–24. doi:10.1038/nrm2330. PMC 2642958. PMID 18216768. [40] Rao AV, Rao LG (2007). “Carotenoids and human health”. Pharmacological Research : the Official Jour- [52] Feigenson GW (2006). “Phase behavior of lipid mix- nal of the Italian Pharmacological Society 55 (3): 207–16. tures”. Nature 2 (11): 560–63. doi:10.1016/j.phrs.2007.01.012. PMID 17349800. doi:10.1038/nchembio1106-560. PMC 2685072. PMID 17051225. [41] Brunmark A, Cadenas E (1989). “Redox and addition chemistry of quinoid compounds and its biological impli- [53] Wiggins PM (1990). “Role of water in some biological pro- cations”. Free Radical Biology & Medicine 7 (4): 435–77. cesses”. Microbiological Reviews 54 (4): 432–49. PMC doi:10.1016/0891-5849(89)90126-3. PMID 2691341. 372788. PMID 2087221.

[42] Swiezewska E, Danikiewicz W (2005). “Polyisoprenoids: [54] Raschke TM, Levitt M (2005). “Nonpolar solutes en- structure, biosynthesis and function”. Progress in Lipid Re- hance water structure within hydration shells while reduc- search 44 (4): 235–58. doi:10.1016/j.plipres.2005.05.002. ing interactions between them”. Proceedings of the Na- PMID 16019076. tional Academy of Sciences of the United States of America 102 (19): 6777–82. doi:10.1073/pnas.0500225102. PMC [43] Raetz CR, Garrett TA, Reynolds CM, Shaw WA, Moore 1100774. PMID 15867152. JD, Smith DC Jr, Ribeiro AA, Murphy RC,Ulevitch RJ, Fearns C, Reichart D, Glass CK, Benner C, Subrama- [55] Brasaemle DL (December 2007). “Thematic review se- niam S, Harkewicz R, Bowers-Gentry RC, Buczynski MW, ries: adipocyte biology. The perilipin family of struc- Cooper JA, Deems RA, Dennis EA (2006). “Kdo2-Lipid tural lipid droplet proteins: stabilization of lipid droplets A of Escherichia coli, a defined endotoxin that activates and control of ”. J. Lipid Res 48 (12): 2547–59. macrophages via TLR-4”. Journal of Lipid Research 47 doi:10.1194/jlr.R700014-JLR200. PMID 17878492. (5): 1097–111. doi:10.1194/jlr.M600027-JLR200. PMID 16479018. [56] Stryer et al., p. 619.

[44] Walsh CT (2004). “Polyketide and nonribosomal peptide [57] Wang X (2004). “Lipid signaling”. Current Opinion in Plant : modularity and versatility”. Science 303 (5665): Biology 7 (3): 329–36. doi:10.1016/j.pbi.2004.03.012. 1805–10. doi:10.1126/science.1094318. PMID 15031493. PMID 15134755.

[45] Caffrey P, Aparicio JF, Malpartida F, Zotchev SB (2008). [58] Dinasarapu AR,Saunders B,Ozerlat I,Azam K, and Subra- “Biosynthetic engineering of polyene macrolides towards maniam S (2011). “Signaling gateway molecule pages—a 16 CHAPTER 2. LIPID

data model perspective”. Bioinformatics 27 (12): 1736– [70] Gohil VM, Greenberg ML (2009). “Mitochondrial mem- 1738. doi:10.1093/bioinformatics/btr190. PMC 3106186. brane biogenesis: phospholipids and proteins go hand PMID 21505029. in hand”. Journal of Cell Biology 184 (4): 469–72. doi:10.1083/jcb.200901127. PMC 2654137. PMID [59] Eyster KM (2007). “The membrane and lipids as integral 19237595. participants in signal transduction”. Advances in Education 31 (1): 5–16. doi:10.1152/advan.00088.2006. [71] Hoch FL (1992). “Cardiolipins and biomembrane func- PMID 17327576. tion”. Biochimica et Biophysica Acta 1113 (1): 71–133. doi:10.1016/0304-4157(92)90035-9. PMID 10206472. [60] Hinkovska-Galcheva V, VanWay SM, Shanley TP, Kunkel RG (2008). “The role of sphingosine-1-phosphate and [72] Steroids. Elmhurst.edu. Retrieved on 2013-10-10. ceramide-1-phosphate in calcium homeostasis”. Current [73] Stryer et al., p. 634. Opinion in Investigational Drugs 9 (11): 1192–205. PMID 18951299. [74] Chirala S, Wakil S (2004). “Structure and function of animal fatty acid synthase”. Lipids 39 (11): 1045–53. [61] Saddoughi SA, Song P, Ogretmen B (2008). “Roles of doi:10.1007/s11745-004-1329-9. PMID 15726818. bioactive sphingolipids in cancer biology and therapeu- tics”. Subcellular Biochemistry. Subcellular Biochemistry [75] White S, Zheng J, Zhang Y (2005). “The struc- 49: 413–40. doi:10.1007/978-1-4020-8831-5_16. ISBN tural biology of type II fatty acid biosynthesis”. 978-1-4020-8830-8. PMC 2636716. PMID 18751921. Annual Review of Biochemistry 74: 791–831. doi:10.1146/annurev.biochem.74.082803.133524. PMID [62] Klein C, Malviya AN (2008). “Mechanism of nuclear cal- 15952903. cium signaling by inositol 1,4,5-trisphosphate produced in the nucleus, nuclear located protein kinase C and cyclic [76] Ohlrogge J, Jaworski J (1997). “Regulation of fatty AMP-dependent protein kinase”. Frontiers in Bioscience 13 acid synthesis”. Annual Review of Plant Phys- (13): 1206–26. doi:10.2741/2756. PMID 17981624. iology and Plant 48: 109–136. doi:10.1146/annurev.arplant.48.1.109. PMID 15012259. [63] Boyce JA (2008). “Eicosanoids in asthma, allergic inflam- [77] Stryer et al., p. 643. mation, and host defense”. Current Molecular Medicine 8 (5): 335–49. doi:10.2174/156652408785160989. PMID [78] Stryer et al., pp. 733–39. 18691060. [79] Kuzuyama T, Seto H (2003). “Diversity of the biosynthesis [64] Bełtowski J (2008). “Liver X receptors (LXR) as therapeu- of the isoprene units”. Natural Product Reports 20 (2): 171– tic targets in dyslipidemia”. Cardiovascular Therapy 26 (4): 83. doi:10.1039/b109860h. PMID 12735695. 297–316. doi:10.1111/j.1755-5922.2008.00062.x. PMID 19035881. [80] Grochowski L, Xu H, White R (2006). "Methanocaldococcus jannaschii uses a modified [65] Indiveri C, Tonazzi A, Palmieri F (October 1991). “Char- mevalonate pathway for biosynthesis of isopentenyl acterization of the unidirectional transport of carnitine cat- diphosphate”. Journal of Bacteriology 188 (9): 3192–98. alyzed by the reconstituted carnitine carrier from rat liver doi:10.1128/JB.188.9.3192-3198.2006. PMC 1447442. mitochondria”. Biochim. Biophys. Acta 1069 (1): 110–6. PMID 16621811. doi:10.1016/0005-2736(91)90110-T. PMID 1932043. [81] Lichtenthaler H (1999). “The 1-Dideoxy-D-xylulose-5- [66] Parodi AJ, Leloir LF (April 1979). “The role of lipid phosphate pathway of isoprenoid biosynthesis in plants”. intermediates in the glycosylation of proteins in the eu- Annual Review of Plant Physiology and Plant Molecular caryotic cell”. Biochim. Biophys. Acta 559 (1): 1–37. Biology 50: 47–65. doi:10.1146/annurev.arplant.50.1.47. doi:10.1016/0304-4157(79)90006-6. PMID 375981. PMID 15012203.

[67] Helenius A, Aebi M (2001). “Intracellular functions [82] Schroepfer G (1981). “Sterol biosynthesis”. of N-linked glycans”. Science 291 (5512): 2364–69. Annual Review of Biochemistry 50: 585–621. doi:10.1126/science.291.5512.2364. PMID 11269317. doi:10.1146/annurev.bi.50.070181.003101. PMID 7023367. [68] Nowicki, M. and Frentzen, M. (2005). “Cardiolipin syn- [83] Lees N, Skaggs B, Kirsch D, Bard M (1995). “Cloning of thase of Arabidopsis thaliana”. FEBS Letters 579 (10): the late genes in the ergosterol biosynthetic pathway of Sac- 2161–2165. doi:10.1016/j.febslet.2005.03.007. PMID charomyces cerevisiae—a review”. Lipids 30 (3): 221–26. 15811335. doi:10.1007/BF02537824. PMID 7791529.

[69] Nowicki, M. (2006). “Characterization of the Cardiolipin [84] Stryer et al., pp. 625–26. Synthase from Arabidopsis thaliana”. Ph.D. thesis, RWTH- Aachen University. [85] Bhagavan, p. 903. 2.7. EXTERNAL LINKS 17

[86] Russo GL (2009). “Dietary n-6 and n-3 polyunsatu- of the American Medical Association 295 (6): 643–54. rated fatty acids: from biochemistry to clinical implications doi:10.1001/jama.295.6.643. PMID 16467233. in cardiovascular prevention”. Biochemical 77 (6): 937–46. doi:10.1016/j.bcp.2008.10.020. PMID [98] Howard BV, Manson JE, Stefanick ML, et al. (2006). 19022225. “Low-fat dietary pattern and weight change over 7 years: the Women’s Health Initiative Dietary Modification Trial”. [87] Bhagavan, p. 388. JAMA: the Journal of the American Medical Association 295 (1): 39–49. doi:10.1001/jama.295.1.39. PMID 16391215. [88] Riediger ND, Othman RA, Suh M, Moghadasian MH (2009). “A systemic review of the roles of n-3 fatty acids in [99] Howard BV, Van Horn L, Hsia J, et al. (2006). health and disease”. Journal of the American Dietetic Asso- “Low-fat dietary pattern and risk of cardiovascular dis- ciation 109 (4): 668–79. doi:10.1016/j.jada.2008.12.022. ease: the Women’s Health Initiative Randomized Con- PMID 19328262. trolled Dietary Modification Trial”. JAMA : the Journal of the American Medical Association 295 (6): 655–66. [89] Galli C, Risé P (2009). “Fish consumption, omega 3 fatty doi:10.1001/jama.295.6.655. PMID 16467234. acids and cardiovascular disease. The science and the clin- ical trials”. Nutrition and Health (Berkhamsted, Hertford- [100] “Fats and Cholesterol: Out with the Bad, In with the Good shire) 20 (1): 11–20. doi:10.1177/026010600902000102. — What Should You Eat? – The Nutrition Source — Har- PMID 19326716. vard School of Public Health”. Retrieved 2009-05-12. [90] Micha R, Mozaffarian D (2008). “Trans fatty acids: ef- fects on cardiometabolic health and implications for pol- icy”. Prostaglandins, Leukotrienes, and Essential Fatty Acids 2.6.1 Bibliography 79 (3–5): 147–52. doi:10.1016/j.plefa.2008.09.008. PMC • 2639783. PMID 18996687. Bhagavan NV (2002). Medical Biochemistry. San Diego: Harcourt/Academic Press. ISBN 0-12- [91] Dalainas I, Ioannou HP (2008). “The role of trans fatty 095440-0. acids in atherosclerosis, cardiovascular disease and infant development”. International Angiology: a Journal of the • Devlin TM (1997). Textbook of Biochemistry: With International Union of Angiology 27 (2): 146–56. PMID Clinical Correlations (4th ed.). Chichester: John Wi- 18427401. ley & Sons. ISBN 0-471-17053-4. [92] Mozaffarian D, Willett WC (2007). “Trans fatty acids • Stryer L, Berg JM, Tymoczko JL (2007). Biochemistry and cardiovascular risk: a unique cardiometabolic im- (6th ed.). San Francisco: W.H. Freeman. ISBN 0- print?". Current Atherosclerosis Reports 9 (6): 486–93. 7167-8724-5. doi:10.1007/s11883-007-0065-9. PMID 18377789. • [93] Astrup A, Dyerberg J, Selleck M, Stender S (2008). “Nutri- van Holde KE, Mathews CK (1996). Biochemistry tion transition and its relationship to the development of obe- (2nd ed.). Menlo Park, Calif: Benjamin/Cummings sity and related chronic diseases”. Obesity Review. 9 Suppl Pub. Co. ISBN 0-8053-3931-0. 1: 48–52. doi:10.1111/j.1467-789X.2007.00438.x. PMID 18307699.

[94] Astrup A (2005). “The role of dietary fat in obesity”. Sem- 2.7 External links inars in Vascular Medicine 5 (1): 40–47. doi:10.1055/s- 2005-871740. PMID 15968579. Introductory [95] Ma Y. et al; Olendzki, Barbara C.; Hafner, Andrea R.; Chiriboga, David E.; Culver, Annie L.; Andersen, Vic- • List of lipid-related web sites toria A.; Merriam, Philip A.; Pagoto, Sherry L. (2006). • “Low-carbohydrate and high-fat intake among adult patients Nature Lipidomics Gateway – Round-up and sum- with poorly controlled type 2 diabetes mellitus”. Nutrition maries of recent lipid research 22 (11–12): 1129–1136. doi:10.1016/j.nut.2006.08.006. • PMC 2039705. PMID 17027229. Lipid Library – General reference on lipid chemistry and biochemistry [96] Astrup A (2008). “Dietary management of obesity”. JPEN Journal of Parenteral and Enteral Nutrition 32 (5): 575–77. • Cyberlipid.org – Resources and history for lipids. doi:10.1177/0148607108321707. PMID 18753397. • Molecular Computer Simulations – Modeling of Lipid [97] Beresford SA, Johnson KC, Ritenbaugh C, et al. (2006). Membranes “Low-fat dietary pattern and risk of colorectal can- cer: the Women’s Health Initiative Randomized Con- • Lipids, Membranes and Vesicle Trafficking – The Vir- trolled Dietary Modification Trial”. JAMA: the Journal tual Library of Biochemistry and Cell Biology 18 CHAPTER 2. LIPID

Nomenclature

• IUPAC nomenclature of lipids

• IUPAC glossary entry for the lipid class of molecules

Databases

• LIPID MAPS – Comprehensive lipid and lipid- associated gene/protein databases.

• LipidBank – Japanese database of lipids and related properties, spectral data and references.

General

• ApolloLipids – Provides dyslipidemia and cardiovas- cular disease prevention and treatment information as well as continuing medical education programs • National Lipid Association – Professional medical ed- ucation organization for health care professionals who seek to prevent morbidity and mortality stemming from dyslipidemias and other cholesterol-related dis- orders. Chapter 3

Protein

This article is about a class of molecules. For protein as a A linear chain of amino acid residues is called a nutrient, see Protein (nutrient). For other uses, see Protein polypeptide. A protein contains at least one long polypep- (disambiguation). tide. Short polypeptides, containing less than about 20-30 Proteins (/ˈproʊˌtiːnz/ or /ˈproʊti.ɨnz/) are large biological residues, are rarely considered to be proteins and are com- monly called peptides, or sometimes oligopeptides. The in- dividual amino acid residues are bonded together by peptide bonds and adjacent amino acid residues. The sequence of amino acid residues in a protein is defined by the sequence of a gene, which is encoded in the genetic code. In gen- eral, the genetic code specifies 20 standard amino acids; however, in certain organisms the genetic code can in- clude selenocysteine and—in certain archaea—pyrrolysine. Shortly after or even during synthesis, the residues in a protein are often chemically modified by posttranslational modification, which alters the physical and chemical prop- erties, folding, stability, activity, and ultimately, the func- tion of the proteins. Sometimes proteins have non-peptide groups attached, which can be called prosthetic groups or cofactors. Proteins can also work together to achieve a particular function, and they often associate to form stable protein complexes. Once formed, proteins only exist for a certain period of time and are then degraded and recycled by the cell’s machinery through the process of protein turnover. A protein’s lifes- pan is measured in terms of its half-life and covers a wide A representation of the 3D structure of the protein myoglobin show- range. They can exist for minutes or years with an average ing turquoise alpha helices. This protein was the first to have its lifespan of 1–2 days in mammalian cells. Abnormal and or structure solved by X-ray . Towards the right-center misfolded proteins are degraded more rapidly either due to among the coils, a prosthetic group called a heme group (shown in gray) with a bound oxygen molecule (red). being targeted for destruction or due to being unstable. Like other biological macromolecules such as polysaccharides and nucleic acids, proteins are essen- molecules, or macromolecules, consisting of one or more tial parts of organisms and participate in virtually every long chains of amino acid residues. Proteins perform process within cells. Many proteins are enzymes that a vast array of functions within living organisms, in- catalyze biochemical reactions and are vital to metabolism. cluding catalyzing metabolic reactions, replicating DNA, Proteins also have structural or mechanical functions, responding to stimuli, and transporting molecules from one such as actin and myosin in muscle and the proteins in location to another. Proteins differ from one another pri- the cytoskeleton, which form a system of scaffolding that marily in their sequence of amino acids, which is dictated maintains cell shape. Other proteins are important in cell by the nucleotide sequence of their genes, and which usu- signaling, immune responses, cell adhesion, and the cell ally results in folding of the protein into a specific three- cycle. Proteins are also necessary in animals’ diets, since dimensional structure that determines its activity.

19 20 CHAPTER 3. PROTEIN

animals cannot synthesize all the amino acids they need and into a fixed conformation.[1] The side chains of the standard must obtain essential amino acids from food. Through the amino acids, detailed in the list of standard amino acids, process of digestion, animals break down ingested protein have a great variety of chemical structures and properties; into free amino acids that are then used in metabolism. it is the combined effect of all of the amino acid side chains in a protein that ultimately determines its three-dimensional Proteins may be purified from other cellular components [2] using a variety of techniques such as ultracentrifugation, structure and its chemical reactivity. The amino acids in a precipitation, electrophoresis, and ; the ad- polypeptide chain are linked by peptide bonds. Once linked vent of genetic engineering has made possible a num- in the protein chain, an individual amino acid is called a residue, and the linked series of carbon, nitrogen, and oxy- ber of methods to facilitate purification. Methods com- monly used to study protein structure and function in- gen atoms are known as the main chain or protein back- bone.[3] clude immunohistochemistry, site-directed mutagenesis, X-ray crystallography, nuclear magnetic resonance and The has two resonance forms that contribute mass spectrometry. some double-bond character and inhibit rotation around its axis, so that the alpha carbons are roughly coplanar. The other two dihedral angles in the peptide bond determine 3.1 Biochemistry the local shape assumed by the protein backbone.[4] The end of the protein with a free carboxyl group is known as the C-terminus or carboxy terminus, whereas the end with Main articles: Biochemistry, Amino acid and peptide bond a free amino group is known as the N-terminus or amino Most proteins consist of linear polymers built from series terminus. The words protein, polypeptide, and peptide are a little ambiguous and can overlap in meaning. Protein is generally used to refer to the complete biological molecule in a stable conformation, whereas peptide is generally re- served for a short amino acid oligomers often lacking a sta- ble three-dimensional structure. However, the boundary between the two is not well defined and usually lies near 20–30 residues.[5] Polypeptide can refer to any single linear chain of amino acids, usually regardless of length, but often implies an absence of a defined conformation.

3.2 Synthesis

3.2.1 Biosynthesis Chemical structure of the peptide bond (bottom) and the three- dimensional structure of a peptide bond between an alanine and Main article: an adjacent amino acid (top/inset) Proteins are assembled from amino acids using informa-

Resonance structures of the peptide bond that links individual amino acids to form a protein polymer

of up to 20 different L-α-amino acids. All proteinogenic amino acids possess common structural features, including an α-carbon to which an amino group, a carboxyl group, and a variable side chain are bonded. Only differs from this basic structure as it contains an unusual ring to the N- end amine group, which forces the CO–NH amide moiety A ribosome produces a protein using mRNA as template. 3.3. STRUCTURE 21

GTGCATCTGACTCCTGAGGAGAAG length of almost 27,000 amino acids.[8] CACGTAGACTGAGGACTCCTCTTC DNA (transcription)

GUGCAUCUGACUCCUGAGGAGAAG RNA 3.2.2 Chemical synthesis (translation) Short proteins can also be synthesized chemically by a V H L T P E E K protein family of methods known as , which rely on techniques such as chemical ligation The DNA sequence of a gene encodes the amino acid sequence of to produce peptides in high yield.[9] Chemical synthesis a protein. allows for the introduction of non-natural amino acids into polypeptide chains, such as attachment of fluorescent probes to amino acid side chains.[10] These methods are tion encoded in genes. Each protein has its own unique useful in laboratory biochemistry and cell biology, though amino acid sequence that is specified by the nucleotide se- generally not for commercial applications. Chemical syn- quence of the gene encoding this protein. The genetic code thesis is inefficient for polypeptides longer than about 300 is a set of three-nucleotide sets called codons and each amino acids, and the synthesized proteins may not read- three-nucleotide combination designates an amino acid, ily assume their native tertiary structure. Most chemical for example AUG (adenine-uracil-guanine) is the code for synthesis methods proceed from C-terminus to N-terminus, . Because DNA contains four nucleotides, the opposite the biological reaction.[11] total number of possible codons is 64; hence, there is some redundancy in the genetic code, with some amino acids specified by more than one codon.[6] Genes encoded 3.3 Structure in DNA are first transcribed into pre-messenger RNA (mRNA) by proteins such as RNA polymerase. Most or- ganisms then process the pre-mRNA (also known as a pri- Main article: Protein structure mary transcript) using various forms of Post-transcriptional Further information: Protein structure prediction modification to form the mature mRNA, which is then used Most proteins fold into unique 3-dimensional structures. as a template for protein synthesis by the ribosome. In prokaryotes the mRNA may either be used as soon as it is produced, or be bound by a ribosome after having moved away from the nucleoid. In contrast, eukaryotes make mRNA in the cell nucleus and then translocate it across the nuclear membrane into the cytoplasm, where protein synthesis then takes place. The rate of protein synthesis is higher in prokaryotes than eukaryotes and can reach up to 20 amino acids per second.[7] The process of synthesizing a protein from an mRNA tem- The crystal structure of the chaperonin. Chaperonins assist protein plate is known as translation. The mRNA is loaded onto the folding. ribosome and is read three nucleotides at a time by match- ing each codon to its base pairing anticodon located on a The shape into which a protein naturally folds is known as transfer RNA molecule, which carries the amino acid corre- its native conformation.[12] Although many proteins can fold sponding to the codon it recognizes. The enzyme aminoacyl unassisted, simply through the chemical properties of their tRNA synthetase “charges” the tRNA molecules with the amino acids, others require the aid of molecular chaperones correct amino acids. The growing polypeptide is often to fold into their native states.[13] Biochemists often refer to termed the nascent chain. Proteins are always biosynthe- four distinct aspects of a protein’s structure:[14] sized from N-terminus to C-terminus.[6] • Primary structure: the amino acid sequence. A protein The size of a synthesized protein can be measured by the is a polyamide. number of amino acids it contains and by its total molecular mass, which is normally reported in units of daltons (syn- • Secondary structure: regularly repeating local struc- onymous with atomic mass units), or the derivative unit tures stabilized by hydrogen bonds. The most com- kilodalton (kDa). Yeast proteins are on average 466 amino mon examples are the alpha helix, beta sheet and turns. acids long and 53 kDa in mass.[5] The largest known pro- Because secondary structures are local, many regions teins are the titins, a component of the muscle sarcomere, of different secondary structure can be present in the with a molecular mass of almost 3,000 kDa and a total same protein molecule. 22 CHAPTER 3. PROTEIN

Molecular surface of several proteins showing their comparative sizes. From left to right are: immunoglobulin G (IgG, an antibody), hemoglobin, insulin (a hormone), adenylate kinase (an enzyme), Three possible representations of the three-dimensional structure of and synthetase (an enzyme). the protein triose phosphate isomerase. Left: all-atom representa- tion colored by atom type. Middle: Simplified representation illus- trating the backbone conformation, colored by secondary structure. A special case of intramolecular hydrogen bonds within Right: Solvent-accessible surface representation colored by residue proteins, poorly shielded from water attack and hence pro- type (acidic residues red, basic residues blue, polar residues green, moting their own dehydration, are called dehydrons.[17] nonpolar residues white)

3.3.1 Structure determination • Tertiary structure: the overall shape of a single pro- tein molecule; the spatial relationship of the secondary Discovering the tertiary structure of a protein, or the quater- structures to one another. Tertiary structure is gen- nary structure of its complexes, can provide important clues erally stabilized by nonlocal interactions, most com- about how the protein performs its function. Common ex- monly the formation of a hydrophobic core, but also perimental methods of structure determination include X- through salt bridges, hydrogen bonds, disulfide bonds, ray crystallography and NMR , both of which and even posttranslational modifications. The term can produce information at atomic resolution. However, “tertiary structure” is often used as synonymous with NMR experiments are able to provide information from the term fold. The tertiary structure is what controls which a subset of distances between pairs of atoms can be the basic function of the protein. estimated, and the final possible conformations for a pro- tein are determined by solving a distance geometry prob- • Quaternary structure: the structure formed by several lem. Dual polarisation interferometry is a quantitative an- protein molecules (polypeptide chains), usually called alytical method for measuring the overall protein confor- protein subunits in this context, which function as a sin- mation and conformational changes due to interactions or gle protein complex. other stimulus. Circular dichroism is another laboratory technique for determining internal beta sheet/ helical com- Proteins are not entirely rigid molecules. In addition to position of proteins. Cryoelectron microscopy is used to these levels of structure, proteins may shift between sev- produce lower-resolution structural information about very eral related structures while they perform their functions. large protein complexes, including assembled viruses;[18] a In the context of these functional rearrangements, these variant known as electron crystallography can also produce tertiary or quaternary structures are usually referred to as high-resolution information in some cases, especially for "conformations", and transitions between them are called two-dimensional crystals of membrane proteins.[19] Solved conformational changes. Such changes are often induced structures are usually deposited in the Protein Data Bank by the binding of a substrate molecule to an enzyme’s active (PDB), a freely available resource from which structural site, or the physical region of the protein that participates in data about thousands of proteins can be obtained in the form chemical catalysis. In solution proteins also undergo varia- of Cartesian coordinates for each atom in the protein.[20] tion in structure through thermal vibration and the collision [15] Many more gene sequences are known than protein struc- with other molecules. tures. Further, the set of solved structures is biased toward Proteins can be informally divided into three main classes, proteins that can be easily subjected to the conditions re- which correlate with typical tertiary structures: globular quired in X-ray crystallography, one of the major structure proteins, fibrous proteins, and membrane proteins. Almost determination methods. In particular, globular proteins are all globular proteins are soluble and many are enzymes. Fi- comparatively easy to crystallize in preparation for X-ray brous proteins are often structural, such as collagen, the crystallography. Membrane proteins, by contrast, are diffi- major component of connective tissue, or keratin, the pro- cult to crystallize and are underrepresented in the PDB.[21] tein component of hair and nails. Membrane proteins often Structural initiatives have attempted to remedy serve as receptors or provide channels for polar or charged these deficiencies by systematically solving representative molecules to pass through the cell membrane.[16] structures of major fold classes. Protein structure predic- 3.4. CELLULAR FUNCTIONS 23

tion methods attempt to provide a means of generating a molecule substrates. When proteins bind specifically to plausible structure for proteins whose structures have not other copies of the same molecule, they can oligomerize been experimentally determined.[22] to form fibrils; this process occurs often in structural pro- teins that consist of globular monomers that self-associate to form rigid fibers. Protein–protein interactions also regu- 3.4 Cellular functions late enzymatic activity, control progression through the cell cycle, and allow the assembly of large protein complexes that carry out many closely related reactions with a com- Proteins are the chief actors within the cell, said to be car- mon biological function. Proteins can also bind to, or even rying out the duties specified by the information encoded be integrated into, cell membranes. The ability of bind- in genes.[5] With the exception of certain types of RNA, ing partners to induce conformational changes in proteins most other biological molecules are relatively inert elements allows the construction of enormously complex signaling upon which proteins act. Proteins make up half the dry networks.[25] Importantly, as interactions between proteins weight of an Escherichia coli cell, whereas other macro- are reversible, and depend heavily on the availability of dif- molecules such as DNA and RNA make up only 3% and ferent groups of partner proteins to form aggregates that 20%, respectively.[23] The set of proteins expressed in a par- are capable to carry out discrete sets of function, study of ticular cell or cell type is known as its proteome. the interactions between specific proteins is a key to under- stand important aspects of cellular function, and ultimately the properties that distinguish particular cell types.[26][27]

3.4.1 Enzymes

Main article: Enzyme

The best-known role of proteins in the cell is as enzymes, which catalyze chemical reactions. Enzymes are usually The enzyme hexokinase is shown as a conventional ball-and-stick highly specific and accelerate only one or a few chemical re- molecular model. To scale in the top right-hand corner are two of actions. Enzymes carry out most of the reactions involved its substrates, ATP and glucose. in metabolism, as well as manipulating DNA in processes The chief characteristic of proteins that also allows their di- such as DNA replication, DNA repair, and transcription. Some enzymes act on other proteins to add or remove chem- verse set of functions is their ability to bind other molecules specifically and tightly. The region of the protein responsi- ical groups in a process known as posttranslational modifi- cation. About 4,000 reactions are known to be catalyzed ble for binding another molecule is known as the binding by enzymes.[28] The rate acceleration conferred by enzy- site and is often a depression or “pocket” on the molec- 17 ular surface. This binding ability is mediated by the ter- matic catalysis is often enormous—as much as 10 -fold tiary structure of the protein, which defines the binding site increase in rate over the uncatalyzed reaction in the case of orotate decarboxylase (78 million years without the en- pocket, and by the chemical properties of the surrounding [29] amino acids’ side chains. Protein binding can be extraor- zyme, 18 milliseconds with the enzyme). dinarily tight and specific; for example, the ribonuclease The molecules bound and acted upon by enzymes are called inhibitor protein binds to human angiogenin with a sub- substrates. Although enzymes can consist of hundreds of femtomolar dissociation constant (<10−15 M) but does not amino acids, it is usually only a small fraction of the residues bind at all to its amphibian homolog onconase (>1 M). Ex- that come in contact with the substrate, and an even smaller tremely minor chemical changes such as the addition of a fraction—three to four residues on average—that are di- single methyl group to a binding partner can sometimes suf- rectly involved in catalysis.[30] The region of the enzyme fice to nearly eliminate binding; for example, the aminoacyl that binds the substrate and contains the catalytic residues tRNA synthetase specific to the amino acid valine discrim- is known as the active site. inates against the very similar side chain of the amino acid [24] Dirigent proteins are members of a class of proteins which isoleucine. dictate the of a compound synthesized by Proteins can bind to other proteins as well as to small- other enzymes. 24 CHAPTER 3. PROTEIN

3.4.2 Cell signaling and ligand binding body of a multicellular . These proteins must have a high binding affinity when their ligand is present in high concentrations, but must also release the ligand when it is present at low concentrations in the target tis- sues. The canonical example of a ligand-binding pro- tein is haemoglobin, which transports oxygen from the lungs to other organs and tissues in all vertebrates and has close homologs in every biological kingdom.[33] Lectins are sugar-binding proteins which are highly specific for their sugar moieties. Lectins typically play a role in biologi- cal recognition phenomena involving cells and proteins.[34] Receptors and hormones are highly specific binding pro- teins. Transmembrane proteins can also serve as ligand transport proteins that alter the permeability of the cell membrane to small molecules and . The membrane alone has a hydrophobic core through which polar or charged molecules cannot diffuse. Membrane proteins contain internal chan- nels that allow such molecules to enter and exit the cell. Many channel proteins are specialized to select for only a particular ion; for example, potassium and sodium chan- nels often discriminate for only one of the two ions.[35]

3.4.3 Structural proteins

Structural proteins confer stiffness and rigidity to Ribbon diagram of a mouse antibody against cholera that binds a otherwise-fluid biological components. Most struc- carbohydrate antigen tural proteins are fibrous proteins; for example, collagen and elastin are critical components of connective tissue Many proteins are involved in the process of cell signaling such as cartilage, and keratin is found in hard or filamen- and signal transduction. Some proteins, such as insulin, are tous structures such as hair, nails, feathers, hooves, and extracellular proteins that transmit a signal from the cell in some animal shells.[36] Some globular proteins can also which they were synthesized to other cells in distant tissues. play structural functions, for example, actin and tubulin Others are membrane proteins that act as receptors whose are globular and soluble as monomers, but polymerize to main function is to bind a signaling molecule and induce form long, stiff fibers that make up the cytoskeleton, which a biochemical response in the cell. Many receptors have allows the cell to maintain its shape and size. a binding site exposed on the cell surface and an effector Other proteins that serve structural functions are motor pro- domain within the cell, which may have enzymatic activity teins such as myosin, kinesin, and dynein, which are capable or may undergo a conformational change detected by other of generating mechanical forces. These proteins are cru- proteins within the cell.[31] cial for cellular motility of single celled organisms and the Antibodies are protein components of an adaptive immune sperm of many multicellular organisms which reproduce system whose main function is to bind antigens, or for- sexually. They also generate the forces exerted by contract- eign substances in the body, and target them for destruc- ing muscles[37] and play essential roles in intracellular trans- tion. Antibodies can be secreted into the extracellular en- port. vironment or anchored in the membranes of specialized B cells known as plasma cells. Whereas enzymes are limited in their binding affinity for their substrates by the neces- sity of conducting their reaction, antibodies have no such 3.5 Methods of study constraints. An antibody’s binding affinity to its target is extraordinarily high.[32] Main article: Protein methods Many ligand transport proteins bind particular small biomolecules and transport them to other locations in the The activities and structures of proteins may be examined 3.5. METHODS OF STUDY 25

in vitro, in vivo, and in silico. In vitro studies of purified proteins in controlled environments are useful for learning how a protein carries out its function: for example, enzyme kinetics studies explore the chemical mechanism of an en- zyme’s catalytic activity and its relative affinity for various possible substrate molecules. By contrast, in vivo experi- ments can provide information about the physiological role of a protein in the context of a cell or even a whole organism. In silico studies use computational methods to study pro- teins.

3.5.1 Protein purification

Main article: Protein purification

To perform in vitro analysis, a protein must be purified away from other cellular components. This process usu- ally begins with cell lysis, in which a cell’s membrane is disrupted and its internal contents released into a solution known as a crude lysate. The resulting mixture can be pu- rified using ultracentrifugation, which fractionates the var- Proteins in different cellular compartments and structures tagged ious cellular components into fractions containing soluble with green fluorescent protein (here, white) proteins; membrane lipids and proteins; cellular organelles, and nucleic acids. Precipitation by a method known as salting out can concentrate the proteins from this lysate. 3.5.2 Cellular localization Various types of chromatography are then used to isolate the protein or proteins of interest based on properties such The study of proteins in vivo is often concerned with the as molecular weight, net charge and binding affinity.[38] synthesis and localization of the protein within the cell. Al- The level of purification can be monitored using various though many intracellular proteins are synthesized in the types of gel electrophoresis if the desired protein’s molecu- cytoplasm and membrane-bound or secreted proteins in the lar weight and isoelectric point are known, by spectroscopy endoplasmic reticulum, the specifics of how proteins are if the protein has distinguishable spectroscopic features, or targeted to specific organelles or cellular structures is of- by enzyme assays if the protein has enzymatic activity. Ad- ten unclear. A useful technique for assessing cellular local- ditionally, proteins can be isolated according their charge ization uses genetic engineering to express in a cell a fusion using electrofocusing.[39] protein or chimera consisting of the natural protein of inter- For natural proteins, a series of purification steps may be est linked to a "reporter" such as green fluorescent protein (GFP).[41] The fused protein’s position within the cell can necessary to obtain protein sufficiently pure for laboratory [42] applications. To simplify this process, genetic engineering be cleanly and efficiently visualized using microscopy, is often used to add chemical features to proteins that make as shown in the figure opposite. them easier to purify without affecting their structure or Other methods for elucidating the cellular location of pro- activity. Here, a “tag” consisting of a specific amino acid teins requires the use of known compartmental markers for sequence, often a series of residues (a "His-tag"), regions such as the ER, the Golgi, lysosomes or vacuoles, is attached to one terminus of the protein. As a result, when mitochondria, chloroplasts, plasma membrane, etc. With the lysate is passed over a chromatography column contain- the use of fluorescently tagged versions of these markers ing nickel, the histidine residues ligate the nickel and at- or of antibodies to known markers, it becomes much sim- tach to the column while the untagged components of the pler to identify the localization of a protein of interest. For lysate pass unimpeded. A number of different tags have example, indirect immunofluorescence will allow for fluo- been developed to help researchers purify specific proteins rescence colocalization and demonstration of location. Flu- from complex mixtures.[40] orescent dyes are used to label cellular compartments for a 26 CHAPTER 3. PROTEIN

similar purpose.[43] 3.5.4 Bioinformatics Other possibilities exist, as well. For example, Main article: Bioinformatics immunohistochemistry usually utilizes an antibody to one or more proteins of interest that are conjugated to enzymes yielding either luminescent or chromogenic A vast array of computational methods have been developed signals that can be compared between samples, allowing to analyze the structure, function, and evolution of proteins. for localization information. Another applicable technique The development of such tools has been driven by the is cofractionation in sucrose (or other material) gradients [44] large amount of genomic and proteomic data available for using isopycnic centrifugation. While this technique a variety of organisms, including the human genome. It does not prove colocalization of a compartment of known is simply impossible to study all proteins experimentally, density and the protein of interest, it does increase the hence only a few are subjected to laboratory experiments likelihood, and is more amenable to large-scale studies. while computational tools are used to extrapolate to simi- Finally, the gold-standard method of cellular localization lar proteins. Such homologous proteins can be efficiently is immunoelectron microscopy. This technique also uses identified in distantly related organisms by sequence align- an antibody to the protein of interest, along with classical ment. Genome and gene sequences can be searched by a electron microscopy techniques. The sample is prepared for variety of tools for certain properties. Sequence profiling normal electron microscopic examination, and then treated tools can find restriction enzyme sites, open reading frames with an antibody to the protein of interest that is conjugated in nucleotide sequences, and predict secondary structures. to an extremely electro-dense material, usually gold. This Phylogenetic trees can be constructed and evolutionary hy- allows for the localization of both ultrastructural details as potheses developed using special software like ClustalW re- well as the protein of interest.[45] garding the ancestry of modern organisms and the genes they express. The field of bioinformatics is now indispens- Through another genetic engineering application known as able for the analysis of genes and proteins. site-directed mutagenesis, researchers can alter the protein sequence and hence its structure, cellular localization, and susceptibility to regulation. This technique even allows the Structure prediction and simulation incorporation of unnatural amino acids into proteins, using modified tRNAs,[46] and may allow the rational design of new proteins with novel properties.[47]

3.5.3 Proteomics

Main article: Proteomics

The total complement of proteins present at a time in a cell or cell type is known as its proteome, and the study of such large-scale data sets defines the field of proteomics, named by analogy to the related field of genomics. Key experimen- tal techniques in proteomics include 2D electrophoresis,[48] which allows the separation of a large number of proteins, mass spectrometry,[49] which allows rapid high-throughput identification of proteins and sequencing of peptides (most Constituent amino-acids can be analyzed to predict secondary, ter- often after in-gel digestion), protein microarrays,[50] which tiary and quaternary protein structure, in this case hemoglobin con- allow the detection of the relative levels of a large num- taining heme units. ber of proteins present in a cell, and two-hybrid screening, which allows the systematic exploration of protein–protein Main articles: Protein structure prediction and List of interactions.[51] The total complement of biologically pos- protein structure prediction software sible such interactions is known as the interactome.[52] A systematic attempt to determine the structures of proteins Complementary to the field of structural genomics, protein representing every possible fold is known as structural ge- structure prediction seeks to develop efficient ways to pro- nomics.[53] vide plausible models for proteins whose structures have not 3.7. HISTORY AND ETYMOLOGY 27

yet been determined experimentally.[54] The most success- thesis, while others are converted to glucose through ful type of structure prediction, known as homology mod- gluconeogenesis, or fed into the citric acid cycle. This use eling, relies on the existence of a “template” structure with of protein as a fuel is particularly important under starvation sequence similarity to the protein being modeled; struc- conditions as it allows the body’s own proteins to be used to tural genomics’ goal is to provide sufficient representation support life, particularly those found in muscle.[63] Amino in solved structures to model most of those that remain.[55] acids are also an important dietary source of nitrogen. Although producing accurate models remains a challenge when only distantly related template structures are avail- able, it has been suggested that sequence alignment is the 3.7 History and etymology bottleneck in this process, as quite accurate models can be produced if a “perfect” sequence alignment is known.[56] Many structure prediction methods have served to inform Further information: History of molecular biology the emerging field of protein engineering, in which novel protein folds have already been designed.[57] A more com- Proteins were recognized as a distinct class of biologi- plex computational problem is the prediction of intermolec- cal molecules in the eighteenth century by Antoine Four- ular interactions, such as in molecular docking and protein– croy and others, distinguished by the molecules’ ability protein interaction prediction.[58] to coagulate or flocculate under treatments with heat or [64] The processes of protein folding and binding can be simu- acid. Noted examples at the time included albumin from lated using such technique as molecular mechanics, in par- egg whites, blood serum albumin, fibrin, and wheat gluten. ticular, molecular dynamics and Monte Carlo, which in- Proteins were first described by the Dutch Gerardus creasingly take advantage of parallel and distributed com- Johannes Mulder and named by the Swedish chemist puting (Folding@home project;[59] molecular modeling on Jöns Jacob Berzelius in 1838.[65][66] Mulder carried out GPU). The folding of small alpha-helical protein domains elemental analysis of common proteins and found that such as the villin headpiece[60] and the HIV accessory nearly all proteins had the same empirical formula, [61] [67] protein have been successfully simulated in silico, and C400H620N100O120P1S1. He came to the erroneous hybrid methods that combine standard molecular dynamics conclusion that they might be composed of a single type of with calculations have allowed explo- (very large) molecule. The term “protein” to describe these ration of the electronic states of rhodopsins.[62] molecules was proposed by Mulder’s associate Berzelius; protein is derived from the Greek word πρώτειος (pro- teios), meaning “primary”,[68] “in the lead”, or “standing in front”.[69] Mulder went on to identify the products of pro- 3.6 Nutrition tein degradation such as the amino acid leucine for which he found a (nearly correct) molecular weight of 131 Da.[67] Further information: Protein (nutrient) Early nutritional scientists such as the German Carl von Voit believed that protein was the most important nutrient for Most microorganisms and plants can biosynthesize all 20 maintaining the structure of the body, because it was gen- standard amino acids, while animals (including humans) erally believed that “flesh makes flesh.”[70] Karl Heinrich must obtain some of the amino acids from the diet.[23] Ritthausen extended known protein forms with the identi- The amino acids that an organism cannot synthesize on its fication of . At the Connecticut Agricultural own are referred to as essential amino acids. Key enzymes Experiment Station a detailed review of the vegetable pro- that synthesize certain amino acids are not present in an- teins was compiled by Thomas Burr Osborne. Working imals — such as aspartokinase, which catalyzes the first with Lafayette Mendel and applying Liebig’s law of the min- step in the synthesis of , methionine, and imum in feeding laboratory rats, the nutritionally essential from aspartate. If amino acids are present in the environ- amino acids were established. The work was continued ment, microorganisms can conserve energy by taking up the and communicated by William Cumming Rose. The un- amino acids from their surroundings and downregulating derstanding of proteins as polypeptides came through the their biosynthetic pathways. work of Franz Hofmeister and Hermann Emil Fischer. The In animals, amino acids are obtained through the consump- central role of proteins as enzymes in living organisms was not fully appreciated until 1926, when James B. Sumner tion of foods containing protein. Ingested proteins are then [71] broken down into amino acids through digestion, which typ- showed that the enzyme urease was in fact a protein. ically involves denaturation of the protein through expo- The difficulty in purifying proteins in large quantities made sure to acid and hydrolysis by enzymes called proteases. them very difficult for early protein biochemists to study. Some ingested amino acids are used for protein biosyn- Hence, early studies focused on proteins that could be puri- 28 CHAPTER 3. PROTEIN

fied in large quantities, e.g., those of blood, egg white, vari- • Intein ous toxins, and digestive/metabolic enzymes obtained from • slaughterhouses. In the 1950s, the Armour Hot Dog Co. List of proteins purified 1 kg of pure bovine pancreatic ribonuclease A and • Protein design made it freely available to scientists; this gesture helped ri- bonuclease A become a major target for biochemical study • Proteopathy for the following decades.[67] • Proteopedia • • Intrinsically disordered proteins

3.9 Footnotes

[1] Nelson DL, Cox MM (2005). Lehninger’s Principles of Bio- chemistry (4th ed.). New York, New York: W. H. Freeman and Company.

[2] Gutteridge A, Thornton JM (2005). “Understanding na- ture’s catalytic toolkit”. Trends in Biochemical Sciences 30 (11): 622–29. doi:10.1016/j.tibs.2005.09.006. PMID John Kendrew with model of myoglobin in progress. 16214343.

Linus Pauling is credited with the successful predic- [3] Murray et al., p. 19. tion of regular protein secondary structures based on hydrogen bonding, an idea first put forth by William Ast- [4] Murray et al., p. 31. [72] bury in 1933. Later work by Walter Kauzmann on [5] Lodish H, Berk A, Matsudaira P, Kaiser CA, Krieger M, [73][74] denaturation, based partly on previous studies by Scott MP, Zipurksy SL, Darnell J (2004). Molecular Cell Kaj Linderstrøm-Lang,[75] contributed an understanding of Biology (5th ed.). New York, New York: WH Freeman and protein folding and structure mediated by hydrophobic in- Company. teractions. [6] van Holde and Mathews, pp. 1002–42. The first protein to be sequenced was insulin, by Frederick Sanger, in 1949. Sanger correctly determined the amino [7] Dobson CM (2000). “The nature and significance of protein acid sequence of insulin, thus conclusively demonstrating folding”. In Pain RH (ed.). Mechanisms of Protein Folding. Oxford, Oxfordshire: Oxford University Press. pp. 1–28. that proteins consisted of linear polymers of amino acids ISBN 0-19-963789-X. rather than branched chains, colloids, or cyclols.[76] He won the Nobel Prize for this achievement in 1958. [8] Fulton A, Isaacs W (1991). “Titin, a huge, elastic sarcom- eric protein with a probable role in morphogenesis”. BioEs- The first protein structures to be solved were hemoglobin says 13 (4): 157–61. doi:10.1002/bies.950130403. PMID and myoglobin, by Max Perutz and Sir John Cowdery 1859393. Kendrew, respectively, in 1958.[77][78] As of 2014, the Protein Data Bank has over 90,000 atomic-resolution struc- [9] Bruckdorfer T, Marder O, Albericio F (2004). “From tures of proteins.[79] In more recent times, cryo-electron production of peptides in milligram amounts for re- microscopy of large macromolecular assemblies[80] and search to multi-tons quantities for drugs of the fu- computational protein structure prediction of small protein ture”. Current Pharmaceutical 5 (1): 29–43. doi:10.2174/1389201043489620. PMID 14965208. domains[81] are two methods approaching atomic resolu- tion. [10] Schwarzer D, Cole P (2005). “Protein semisynthesis and expressed protein ligation: chasing a protein’s tail”. Current Opinion in Chemical Biology 9 (6): 561–69. 3.8 See also doi:10.1016/j.cbpa.2005.09.018. PMID 16226484. [11] Kent SB (2009). “Total chemical synthesis of pro- • DNA-binding protein teins”. Chemical Society Reviews 38 (2): 338–51. doi:10.1039/b700141j. PMID 19169452. • DNA, RNA and proteins: The three essential macro- molecules of life [12] Murray et al., p. 36. 3.9. FOOTNOTES 29

[13] Murray et al., p. 37. [28] Bairoch A (2000). “The ENZYME database in 2000”. Nucleic Acids Research 28 (1): 304–305. [14] Murray et al., pp. 30–34. doi:10.1093/nar/28.1.304. PMC 102465. PMID 10592255. [15] van Holde and Mathews, pp. 368–75. [29] Radzicka A, Wolfenden R (1995). “A proficient enzyme”. [16] van Holde and Mathews, pp. 165–85. Science 267 (5194): 90–93. Bibcode:1995Sci...267...90R. doi:10.1126/science.7809611. PMID 7809611. [17] Fernández A, Scott R (2003). “Dehydron: a struc- turally encoded signal for protein interaction”. Biophysical [30] EBI External Services (2010-01-20). “The Catalytic Site At- Journal 85 (3): 1914–28. Bibcode:2003BpJ....85.1914F. las at The European Bioinformatics Institute”. Ebi.ac.uk. doi:10.1016/S0006-3495(03)74619-0. PMC 1303363. Retrieved 2011-01-16. PMID 12944304. [31] Branden and Tooze, pp. 251–81. [18] Branden and Tooze, pp. 340–41. [32] van Holde and Mathews, pp. 247–50. [19] Gonen T, Cheng Y, Sliz P, Hiroaki Y, Fujiyoshi Y, Har- rison SC, Walz T (2005). “Lipid-protein interactions [33] van Holde and Mathews, pp. 220–29. in double-layered two-dimensional AQP0 crystals”. Na- ture 438 (7068): 633–38. Bibcode:2005Natur.438..633G. [34] Rüdiger H, Siebert HC, Solís D, Jiménez-Barbero J, Romero doi:10.1038/nature04321. PMC 1350984. PMID A, von der Lieth CW, Diaz-Mariño T, Gabius HJ (2000). 16319884. “Medicinal chemistry based on the sugar code: fundamen- tals of lectinology and experimental strategies with lectins [20] Standley DM, Kinjo AR, Kinoshita K, Nakamura H (2008). as targets”. Current Medicinal Chemistry 7 (4): 389–416. “Protein structure databases with new web services for struc- doi:10.2174/0929867003375164. PMID 10702616. tural biology and biomedical research”. Briefings in Bioin- formatics 9 (4): 276–85. doi:10.1093/bib/bbn015. PMID [35] Branden and Tooze, pp. 232–34. 18430752. [36] van Holde and Mathews, pp. 178–81.

[21] Walian P, Cross TA, Jap BK (2004). “Structural ge- [37] van Holde and Mathews, pp. 258–64; 272. nomics of membrane proteins”. Genome Biology 5 (4): 215. doi:10.1186/gb-2004-5-4-215. PMC 395774. PMID [38] Murray et al., pp. 21–24. 15059248. [39] Hey J, Posch A, Cohen A, Liu N, Harbers A (2008). “Frac- [22] Sleator RD. (2012). “Prediction of protein functions”. tionation of complex protein mixtures by liquid-phase iso- Methods in Molecular Biology. Methods in Molecular Bi- electric focusing”. Methods in Molecular Biology. Methods ology 815: 15–24. doi:10.1007/978-1-61779-424-7_2. in Molecular Biology™ 424: 225–39. doi:10.1007/978- ISBN 978-1-61779-423-0. PMID 22130980. 1-60327-064-9_19. ISBN 978-1-58829-722-8. PMID 18369866. [23] Voet D, Voet JG. (2004). Biochemistry Vol 1 3rd ed. Wiley: Hoboken, NJ. [40] Terpe K (2003). “Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial [24] Sankaranarayanan R, Moras D (2001). “The fidelity of the systems”. Applied and Biotechnology 60 translation of the genetic code”. Acta Biochimica Polonica (5): 523–33. doi:10.1007/s00253-002-1158-6. PMID 48 (2): 323–35. PMID 11732604. 12536251.

[25] van Holde and Mathews, pp. 830–49. [41] Stepanenko OV, Verkhusha VV, Kuznetsova IM, Uver- sky VN, Turoverov KK (2008). “Fluorescent proteins as [26] Copland JA, Sheffield-Moore M, Koldzic-Zivanovic biomarkers and biosensors: throwing color lights on molecu- N, Gentry S, Lamprou G, Tzortzatou-Stathopoulou F, lar and cellular processes”. Current Protein & Peptide Science Zoumpourlis V, Urban RJ, Vlahopoulos SA (2009). 9 (4): 338–69. doi:10.2174/138920308785132668. PMC “Sex steroid receptors in skeletal differentiation and 2904242. PMID 18691124. epithelial neoplasia: is tissue-specific intervention pos- sible?". BioEssays: news and reviews in molecular, [42] Yuste R (2005). “Fluorescence microscopy today”. Nature cellular and 31 (6): 629–41. Methods 2 (12): 902–904. doi:10.1038/nmeth1205-902. doi:10.1002/bies.200800138. PMID 19382224. PMID 16299474.

[27] Samarin S, Nusrat A (2009). “Regulation of epithelial apical [43] Margolin W (2000). “Green fluorescent protein as junctional complex by Rho family GTPases”. Frontiers in a reporter for macromolecular localization in bacterial bioscience: a journal and virtual library 14 (14): 1129–42. cells”. Methods (San Diego, Calif.) 20 (1): 62–72. doi:10.2741/3298. PMID 19273120. doi:10.1006/meth.1999.0906. PMID 10610805. 30 CHAPTER 3. PROTEIN

[44] Walker JH, Wilson K (2000). Principles and Techniques of U.S.A. 102 (4): 1029–34. Bibcode:2005PNAS..102.1029Z. Practical Biochemistry. Cambridge, UK: Cambridge Uni- doi:10.1073/pnas.0407152101. PMC 545829. PMID versity Press. pp. 287–89. ISBN 0-521-65873-X. 15653774.

[45] Mayhew TM, Lucocq JM (2008). “Developments in cell bi- [57] Kuhlman B, Dantas G, Ireton GC, Varani G, Stod- ology for quantitative immunoelectron microscopy based on dard BL, Baker D (2003). “Design of a novel glob- thin sections: a review”. Histochemistry and Cell Biology ular protein fold with atomic-level accuracy”. Science 130 (2): 299–313. doi:10.1007/s00418-008-0451-6. PMC 302 (5649): 1364–68. Bibcode:2003Sci...302.1364K. 2491712. PMID 18553098. doi:10.1126/science.1089427. PMID 14631033.

[46] Hohsaka T, Sisido M (2002). “Incorporation of non-natural [58] Ritchie DW (2008). “Recent progress and future directions amino acids into proteins”. Current Opinion in Chemical Bi- in protein–protein docking”. Current Protein and Peptide ology 6 (6): 809–15. doi:10.1016/S1367-5931(02)00376- Science 9 (1): 1–15. doi:10.2174/138920308783565741. 9. PMID 12470735. PMID 18336319.

[47] Cedrone F, Ménez A, Quéméneur E (2000). “Tailoring new [59] Scheraga HA, Khalili M, Liwo A (2007). “Protein- enzyme functions by rational redesign”. Current Opinion folding dynamics: overview of molecular simulation in 10 (4): 405–10. doi:10.1016/S0959- techniques”. Annual Review of Physical Chem- 440X(00)00106-8. PMID 10981626. istry 58: 57–83. Bibcode:2007ARPC...58...57S. doi:10.1146/annurev.physchem.58.032806.104614. [48] Görg A, Weiss W, Dunn MJ (2004). “Cur- PMID 17034338. rent two-dimensional electrophoresis technology for proteomics”. Proteomics 4 (12): 3665–85. [60] Zagrovic B, Snow CD, Shirts MR, Pande VS (2002). “Simu- doi:10.1002/pmic.200401031. PMID 15543535. lation of folding of a small alpha-helical protein in atomistic detail using worldwide-distributed computing”. Journal of [49] Conrotto P, Souchelnytskyi S (2008). “Proteomic ap- Molecular Biology 323 (5): 927–37. doi:10.1016/S0022- proaches in biological and medical sciences: principles 2836(02)00997-X. PMID 12417204. and applications”. Experimental Oncology 30 (3): 171–80. PMID 18806738. [61] Herges T, Wenzel W (2005). "In silico folding of a three [50] Joos T, Bachmann J (2009). “Protein microarrays: poten- helix protein and characterization of its free-energy land- tials and limitations”. Frontiers in Bioscience 14 (14): 4376– scape in an all-atom force field”. Physical Review Let- 85. doi:10.2741/3534. PMID 19273356. ters 94 (1): 018101. Bibcode:2005PhRvL..94a8101H. doi:10.1103/PhysRevLett.94.018101. PMID 15698135. [51] Koegl M, Uetz P (2007). “Improving yeast two-hybrid screening systems”. Briefings in Functional Genomics [62] Hoffmann M, Wanko M, Strodel P, König PH, Frauenheim & Proteomics 6 (4): 302–12. doi:10.1093/bfgp/elm035. T, Schulten K, Thiel W, Tajkhorshid E, Elstner M (2006). PMID 18218650. “Color tuning in rhodopsins: the mechanism for the spectral shift between bacteriorhodopsin and sensory rhodopsin II”. [52] Plewczyński D, Ginalski K (2009). “The interac- Journal of the American Chemical Society 128 (33): 10808– tome: predicting the protein–protein interactions in cells”. 18. doi:10.1021/ja062082i. PMID 16910676. Cellular & Molecular Biology Letters 14 (1): 1–22. doi:10.2478/s11658-008-0024-7. PMID 18839074. [63] Brosnan J (June 2003). “Interorgan amino acid transport and its regulation”. Journal of Nutrition 133 (6 Suppl 1): 2068S– [53] Zhang C, Kim SH (2003). “Overview of structural ge- 72S. PMID 12771367. nomics: from structure to function”. Current Opinion in Chemical Biology 7 (1): 28–32. doi:10.1016/S1367- [64] Thomas Burr Osborne (1909): The Vegetable Proteins, His- 5931(02)00015-7. PMID 12547423. tory pp 1 to 6, from archive.org

[54] Zhang Y (2008). “Progress and challenges in protein struc- [65] Bulletin des Sciences Physiques et Naturelles en Néer- ture prediction”. Current Opinion in Structural Biology lande (1838). pg 104. SUR LA COMPOSITION DE 18 (3): 342–48. doi:10.1016/j.sbi.2008.02.004. PMC QUELQUES SUBSTANCES ANIMALES 2680823. PMID 18436442. [66] Hartley, Harold. “Origin of the Word ‘Protein.’” Nature [55] Xiang Z (2006). “Advances in homology protein structure 168, no. 4267 (August 11, 1951): 244–244. doi:10.1038/ modeling”. Current Protein and Peptide Science 7 (3): 217– 168244a0. 27. doi:10.2174/138920306777452312. PMC 1839925. PMID 16787261. [67] Perrett D (2007). “From 'protein' to the beginnings of clin- ical proteomics”. Proteomics: Clinical Applications 1 (8): [56] Zhang Y, Skolnick J (2005). “The protein structure pre- 720–38. doi:10.1002/prca.200700525. PMID 21136729. diction problem could be solved using the current PDB li- brary”. Proceedings of the National Academy of Sciences [68] New Oxford Dictionary of English 3.10. REFERENCES 31

[69] Reynolds JA, Tanford C (2003). Nature’s Robots: A His- interaction networks”. Current Pharmaceutical Biotechnol- tory of Proteins (Oxford Paperbacks). New York, New York: ogy 9 (2): 67–76. doi:10.2174/138920108783955191. Oxford University Press. p. 15. ISBN 0-19-860694-X. PMID 18393863.

[70] Bischoff TLW, Voit, C (1860). Die Gesetze der Ernaehrung des Pflanzenfressers durch neue Untersuchungen festgestellt (in German). Leipzig, Heidelberg. 3.10 References

[71] Sumner JB (1926). “The isolation and crystallization of the • Branden C, Tooze J (1999). Introduction to Protein enzyme urease. Preliminary paper” (PDF). Journal of Bio- Structure. New York: Garland Pub. ISBN 0-8153- logical Chemistry 69 (2): 435–41. 2305-0. [72] Pauling L, Corey RB, Branson HR (1951). “The • structure of proteins: two hydrogen-bonded helical Murray RF, Harper HW, Granner DK, Mayes PA, configurations of the polypeptide chain” (PDF). Pro- Rodwell VW (2006). Harper’s Illustrated Biochem- ceedings of the National Academy of Sciences U.S.A. istry. New York: Lange Medical Books/McGraw- 37 (5): 235–40. Bibcode:1951PNAS...37..235P. Hill. ISBN 0-07-146197-3. doi:10.1073/pnas.37.5.235. PMC 1063348. PMID • 14834145. Van Holde KE, Mathews CK (1996). Biochemistry. Menlo Park, California: Benjamin/Cummings Pub. [73] Kauzmann W (1956). “Structural factors in protein denat- Co., Inc. ISBN 0-8053-3931-0. uration”. Journal of Cellular Physiology. Supplement 47 (Suppl 1): 113–31. doi:10.1002/jcp.1030470410. PMID 13332017. 3.11 External links [74] Kauzmann W (1959). “Some factors in the interpretation of protein denaturation”. Advances in Protein Chemistry. Ad- 3.11.1 Databases and projects vances in Protein Chemistry 14: 1–63. doi:10.1016/S0065- 3233(08)60608-7. ISBN 978-0-12-034214-3. PMID • The Protein Naming Utility 14404936. • [75] Kalman SM, Linderstrom-Lang K, Ottesen M, Richards Human Protein Atlas FM (1955). “Degradation of ribonuclease by subtil- • NCBI Entrez Protein database isin”. Biochimica et Biophysica Acta 16 (2): 297–99. doi:10.1016/0006-3002(55)90224-9. PMID 14363272. • NCBI Protein Structure database [76] Sanger F (1949). “The terminal peptides of insulin”. Bio- • Human Protein Reference Database chemical Journal 45 (5): 563–74. PMC 1275055. PMID 15396627. • Human Proteinpedia [77] Muirhead H, Perutz M (1963). “Structure of hemoglobin. • Folding@Home (Stanford University) A three-dimensional fourier synthesis of reduced hu- man hemoglobin at 5.5 Å resolution”. Nature 199 • Comparative Toxicogenomics Database cu- (4894): 633–38. Bibcode:1963Natur.199..633M. rates protein–chemical interactions, as well as doi:10.1038/199633a0. PMID 14074546. gene/protein–disease relationships and chemical- disease relationships. [78] Kendrew J, Bodo G, Dintzis H, Parrish R, Wyckoff H, Phillips D (1958). “A three-dimensional model of the • Bioinformatic Harvester A Meta search engine (29 myoglobin molecule obtained by X-ray analysis”. Na- databases) for gene and protein information. ture 181 (4610): 662–66. Bibcode:1958Natur.181..662K. doi:10.1038/181662a0. PMID 13517261. • Protein Databank in Europe (see also PDBeQuips, short articles and tutorials on interesting PDB struc- [79] “RCSB Protein Data Bank”. Retrieved 2014-04-05. tures) [80] Zhou ZH (2008). “Towards atomic resolution structural • determination by single-particle cryo-electron microscopy”. Research Collaboratory for Structural Bioinformatics Current Opinion in Structural Biology 18 (2): 218–28. (see also Molecule of the Month, presenting short ac- doi:10.1016/j.sbi.2008.03.004. PMC 2714865. PMID counts on selected proteins from the PDB) 18403197. • Proteopedia – Life in 3D: rotatable, zoomable 3D [81] Keskin O, Tuncbag N, Gursoy A (2008). “Characterization model with wiki annotations for every known protein and prediction of protein interfaces to infer protein-protein molecular structure. 32 CHAPTER 3. PROTEIN

• UniProt the Universal Protein Resource

• neXtProt – Exploring the universe of human proteins: human-centric protein knowledge resource

• Multi-Omics Profiling Expression Database: MOPED human and model organism protein/gene knowledge and expression data

3.11.2 Tutorials and educational websites

• “An Introduction to Proteins” from HOPES (Hunting- ton’s Disease Outreach Project for Education at Stan- ford)

• Proteins: Biogenesis to Degradation – The Virtual Li- brary of Biochemistry and Cell Biology Chapter 4

Enzyme

“Biocatalyst” redirects here. For the use of natural catalysts determines which metabolic pathways occur in that cell, tis- in organic chemistry, see Biocatalysis. sue and organ. Organelles are also differentially enriched Enzymes /ˈɛnzaɪmz/ are macromolecular biological in sets of enzymes to compartmentalise function within the cell. Like all catalysts, enzymes increase the rate of a reaction by lowering its activation energy (Eₐ‡). As a result, prod- ucts are formed faster and reactions reach their equilibrium state more rapidly. Most enzyme reaction rates are millions of times faster than those of comparable un-catalyzed re- actions and some are so fast that they are diffusion limited. As with all catalysts, enzymes are not consumed by the reac- tions they catalyze, nor do they alter the equilibrium of these reactions. However, enzymes do differ from most other cat- alysts in that they are highly specific for their substrates. Enzymes are known to catalyze about 4,000 biochemi- cal reactions.[3] A few RNA molecules called ribozymes also catalyze reactions, with an important example being some parts of the ribosome.[4][5] Synthetic molecules called artificial enzymes also display enzyme-like catalysis.[6] Enzyme activity can be affected by other molecules: de- Human glyoxalase I. Two zinc ions that are needed for the en- creased by inhibitors or increased by activators. Many zyme to catalyze its reaction are shown as purple spheres, and an drugs and poisons are enzyme inhibitors. Activity is also enzyme inhibitor called S-hexylglutathione is shown as a space- affected by temperature, pressure, chemical environment filling model, filling the two active sites. (e.g., pH), and the concentration of substrate. Some en- zymes are used commercially, for example, in the synthesis catalysts. They are responsible for thousands of metabolic of antibiotics. In addition, some household products use processes that sustain life.[1][2] Enzymes are highly selec- enzymes to speed up biochemical reactions (e.g., enzymes tive catalysts, greatly accelerating both the rate and speci- in biological washing powders break down protein or fat ficity of metabolic chemical reactions, from the digestion of stains on clothes; enzymes in meat tenderizers break down food to the synthesis of DNA. Most enzymes are proteins, proteins into smaller molecules, making the meat easier to although some catalytic RNA molecules have been identi- chew). The study of enzymes is called enzymology. fied. Enzymes adopt a specific three-dimensional structure, and may employ organic (e.g. biotin) and inorganic (e.g. magnesium ion) cofactors to assist in catalysis. Enzymes act by converting starting molecules (substrates) 4.1 Etymology and history into different molecules (products). Almost all chemical reactions in a biological cell need enzymes in order to oc- As early as the late 17th and early 18th centuries, the di- cur at rates sufficient for life. Since enzymes are selective gestion of meat by stomach secretions[7] and the conversion for their substrates and speed up only a few reactions from of starch to sugars by plant extracts and saliva were known. among many possibilities, the set of enzymes made in a cell However, the mechanism by which this occurred had not

33 34 CHAPTER 4. ENZYME

of cell-free fermentation”. Following Buchner’s example, enzymes are usually named according to the reaction they carry out. Typically, to generate the name of an enzyme, the suffix -ase is added to the name of its substrate (e.g., lactase is the enzyme that cleaves lactose) or the type of reaction (e.g., DNA polymerase forms DNA polymers).[14] Having shown that enzymes could function outside a liv- ing cell, the next step was to determine their biochemical nature. Many early workers noted that enzymatic activity was associated with proteins, but several scientists (such as Nobel laureate Richard Willstätter) argued that proteins were merely carriers for the true enzymes and that proteins per se were incapable of catalysis.[15] However, in 1926, James B. Sumner showed that the enzyme urease was a pure protein and crystallized it; Sumner did likewise for the enzyme catalase in 1937. The conclusion that pure pro- teins can be enzymes was definitively proved by Northrop and Stanley, who worked on the digestive enzymes pepsin (1930), trypsin and chymotrypsin. These three scientists were awarded the 1946 .[16] This discovery that enzymes could be crystallized eventu- ally allowed their structures to be solved by x-ray crystallog- raphy. This was first done for lysozyme, an enzyme found in tears, saliva and egg whites that digests the coating of some bacteria; the structure was solved by a group led by David Chilton Phillips and published in 1965.[17] This high- Eduard Buchner resolution structure of lysozyme marked the beginning of the field of structural biology and the effort to understand been identified.[8] how enzymes work at an atomic level of detail. In 1833, French chemist Anselme Payen discovered the first enzyme, diastase.[9] A few decades later, when studying the fermentation of sugar to alcohol by yeast, Louis Pas- 4.2 Structures and mechanisms teur came to the conclusion that this fermentation was cat- alyzed by a vital force contained within the yeast cells called See also: Enzyme catalysis "ferments", which were thought to function only within liv- Enzymes are in general globular proteins and range from ing organisms. He wrote that “alcoholic fermentation is an just 62 amino acid residues in size, for the monomer of act correlated with the life and organization of the yeast [18] [10] 4-oxalocrotonate tautomerase, to over 2,500 residues in cells, not with the death or putrefaction of the cells.” the animal fatty acid synthase.[19] A small number of RNA- In 1877, German physiologist Wilhelm Kühne (1837– based biological catalysts exist, with the most common be- 1900) first used the term enzyme, which comes from Greek ing the ribosome; these are referred to as either RNA- ἔνζυμον, “leavened”, to describe this process.[11] The word enzymes or ribozymes. The activities of enzymes are de- enzyme was used later to refer to nonliving substances such termined by their three-dimensional structure.[20] However, as pepsin, and the word ferment was used to refer to chem- although structure does determine function, predicting a ical activity produced by living organisms. novel enzyme’s activity just from its structure is a very dif- [21] In 1897, Eduard Buchner submitted his first paper on the ficult problem that has not yet been solved. ability of yeast extracts that lacked any living yeast cells to Most enzymes are much larger than the substrates they act ferment sugar. In a series of experiments at the University on, and only a small portion of the enzyme (around 2–4 of Berlin, he found that the sugar was fermented even when amino acids) is directly involved in catalysis.[22] The region there were no living yeast cells in the mixture.[12] He named that contains these catalytic residues, binds the substrate, the enzyme that brought about the fermentation of su- and then carries out the reaction is known as the active site. crose "zymase".[13] In 1907, he received the Nobel Prize in Enzymes can also contain sites that bind cofactors, which Chemistry “for his biochemical research and his discovery are needed for catalysis. Some enzymes also have binding 4.2. STRUCTURES AND MECHANISMS 35

anisms. Here, an enzyme such as DNA polymerase cat- alyzes a reaction in a first step and then checks that the product is correct in a second step.[24] This two-step process results in average error rates of less than 1 er- ror in 100 million reactions in high-fidelity mammalian polymerases.[25] Similar proofreading mechanisms are also found in RNA polymerase,[26] aminoacyl tRNA syn- thetases[27] and ribosomes.[28] Whereas some enzymes have broad-specificity, as they can act on a relatively broad range of different physiologically relevant substrates, many enzymes possess small side ac- tivities which arose fortuitously (i.e. neutrally), which may be the starting point for the evolutionary selection of a new function; this phenomenon is known as enzyme promiscu- ity.[29]

“Lock and key” model Ribbon diagram showing human carbonic anhydrase II. The grey sphere is the zinc cofactor in the active site. Diagram drawn from PDB 1MOO. Enzymes are very specific, and it was suggested by Emil Fis- cher in 1894 that this was because both the enzyme and the substrate possess specific complementary geometric shapes sites for small molecules, which are often direct or indirect that fit exactly into one another.[30] This is often referred to products or substrates of the reaction catalyzed. This bind- as “the lock and key” model. However, while this model ex- ing can serve to increase or decrease the enzyme’s activity, plains enzyme specificity, it fails to explain the stabilization providing a means for feedback regulation. of the transition state that enzymes achieve. Like all proteins, enzymes are long, linear chains of amino Enzyme changes shape Products acids that fold to produce a three-dimensional product. Substrate slightly as substrate binds Each unique amino acid sequence produces a specific struc- Active site ture, which has unique properties. Individual protein chains may sometimes group together to form a protein com- plex. Most enzymes can be denatured—that is, unfolded and inactivated—by heating or chemical denaturants, which Substrate entering Enzyme/substrate Enzyme/products Products leaving active site of enzyme complex complex active site of enzyme disrupt the three-dimensional structure of the protein. De- pending on the enzyme, denaturation may be reversible or irreversible. Diagrams to show the induced fit hypothesis of enzyme action Structures of enzymes with substrates or substrate analogs In 1958, Daniel Koshland suggested a modification to the during a reaction may be obtained using Time resolved lock and key model: since enzymes are rather flexible struc- crystallography methods. tures, the active site is continuously reshaped by interac- tions with the substrate as the substrate interacts with the enzyme.[31] As a result, the substrate does not simply bind 4.2.1 Specificity to a rigid active site; the amino acid side-chains that make up the active site are molded into the precise positions that Enzymes are usually very specific as to which reac- enable the enzyme to perform its catalytic function. In tions they catalyze and the substrates that are involved some cases, such as glycosidases, the substrate molecule in these reactions. Complementary shape, charge and also changes shape slightly as it enters the active site.[32] The hydrophilic/hydrophobic characteristics of enzymes and active site continues to change until the substrate is com- substrates are responsible for this specificity. En- pletely bound, at which point the final shape and charge zymes can also show impressive levels of stereospecificity, is determined.[33] Induced fit may enhance the fidelity of regioselectivity and chemoselectivity.[23] molecular recognition in the presence of competition and [34] Some of the enzymes showing the highest specificity and noise via the conformational proofreading mechanism. accuracy are involved in the copying and expression of Based on Fischer’s lock-and-key model and Koshland’s in- the genome. These enzymes have “proof-reading” mech- duced fit theory, the Chou’s distorted key theory for peptide 36 CHAPTER 4. ENZYME

drugs was proposed [35] to develop peptide drugs against Dynamics and function HIV/AIDS and SARS. [36] [37] [38] See also: Protein dynamics 4.2.2 Mechanisms The internal dynamics of enzymes has been suggested to [43][44][45] Enzymes can act in several ways, all of which lower ΔG‡ be linked with their mechanism of catalysis. In- (Gibbs energy):[39] ternal dynamics are the movement of parts of the en- zyme’s structure, such as individual amino acid residues, • Lowering the activation energy by creating an environ- a group of amino acids, or even an entire protein domain. ment in which the transition state is stabilized (e.g. These movements occur at various time-scales ranging from straining the shape of a substrate—by binding the femtoseconds to seconds. Networks of protein residues throughout an enzyme’s structure can contribute to catal- transition-state conformation of the substrate/product [46][47][48][49] molecules, the enzyme distorts the bound substrate(s) ysis through dynamic motions. This is simply into their transition state form, thereby reducing the seen in the kinetic scheme of the combined process, enzy- amount of energy required to complete the transition). matic activity and dynamics; this scheme can have several independent Michaelis-Menten-like reaction pathways that • Lowering the energy of the transition state, but with- are connected through fluctuation rates.[50][51][52] out distorting the substrate, by creating an environ- Protein motions are vital to many enzymes, but whether ment with the opposite charge distribution to that of small and fast vibrations, or larger and slower conforma- the transition state. tional movements are more important depends on the type • Providing an alternative pathway. For example, tem- of reaction involved. However, although these movements porarily reacting with the substrate to form an inter- are important in binding and releasing substrates and prod- mediate ES complex, which would be impossible in ucts, it is not clear if protein movements help to accelerate the absence of the enzyme. the chemical steps in enzymatic reactions.[53] These new in- sights also have implications in understanding allosteric ef- • Reducing the reaction entropy change by bringing sub- fects and developing new medicines. strates together in the correct orientation to react. Considering ΔH‡ alone overlooks this effect. 4.2.3 Allosteric modulation • Increases in temperatures speed up reactions. Thus, temperature increases help the enzyme function and develop the end product even faster. However, if heated too much, the enzyme’s shape deteriorates and the enzyme becomes denatured. Some enzymes like thermolabile enzymes work best at low temperatures. • The function of a protein is dependent on its structure so that if the structure is disrupted, so is its function.

It is interesting that this entropic effect involves destabiliza- tion of the ground state,[40] and its contribution to catalysis is relatively small.[41] Allosteric transition of an enzyme between R and T states, stabilized by an agonist, an inhibitor and a substrate (the MWC model) Transition state stabilization

The understanding of the origin of the reduction of ΔG‡ re- Main article: Allosteric regulation quires one to find out how the enzymes can stabilize its tran- sition state more than the transition state of the uncatalyzed Allosteric sites are sites on the enzyme that bind to reaction. It seems that the most effective way for reach- molecules in the cellular environment. The sites form weak, ing large stabilization is the use of electrostatic effects, in noncovalent bonds with these molecules, causing a change particular, when having a relatively fixed polar environment in the conformation of the enzyme. This change in confor- that is oriented toward the charge distribution of the tran- mation translates to the active site, which then affects the sition state.[42] Such an environment does not exist in the reaction rate of the enzyme.[54] Allosteric interactions can uncatalyzed reaction in water. both inhibit and activate enzymes and are a common way 4.4. THERMODYNAMICS 37

that enzymes are controlled in the body.[55]

4.3 Cofactors and coenzymes

Main articles: Cofactor (biochemistry) and Coenzyme

4.3.1 Cofactors

Some enzymes do not need any additional components to show full activity. However, others require non-protein molecules called cofactors to be bound for activity.[56] Co- factors can be either inorganic (e.g., metal ions and iron- sulfur clusters) or organic compounds (e.g., flavin and heme). Organic cofactors can be either prosthetic groups, which are tightly bound to an enzyme, or coenzymes, which are released from the enzyme’s active site during the reac- tion. Coenzymes include NADH, NADPH and adenosine triphosphate. These molecules transfer chemical groups be- tween enzymes.[57] Space-filling model of the coenzyme NADH An example of an enzyme that contains a cofactor is carbonic anhydrase, and is shown in the ribbon diagram formyl, methenyl or methyl groups carried by folic acid and above with a zinc cofactor bound as part of its active site.[58] the methyl group carried by S-adenosylmethionine. These tightly bound molecules are usually found in the ac- Since coenzymes are chemically changed as a consequence tive site and are involved in catalysis. For example, flavin of enzyme action, it is useful to consider coenzymes to be a and heme cofactors are often involved in redox reactions. special class of substrates, or second substrates, which are Enzymes that require a cofactor but do not have one bound common to many different enzymes. For example, about are called apoenzymes or apoproteins. An apoenzyme to- 700 enzymes are known to use the coenzyme NADH.[60] gether with its cofactor(s) is called a holoenzyme (this is the Coenzymes are usually continuously regenerated and their active form). Most cofactors are not covalently attached to concentrations maintained at a steady level inside the an enzyme, but are very tightly bound. However, organic cell: for example, NADPH is regenerated through the prosthetic groups can be covalently bound (e.g., biotin in pentose phosphate pathway and S-adenosylmethionine by the enzyme pyruvate carboxylase). The term “holoenzyme” methionine adenosyltransferase. This continuous regenera- can also be applied to enzymes that contain multiple protein tion means that even small amounts of coenzymes are used subunits, such as the DNA polymerases; here the holoen- very intensively. For example, the human body turns over zyme is the complete complex containing all the subunits its own weight in ATP each day.[61] needed for activity.

4.3.2 Coenzymes 4.4 Thermodynamics

Coenzymes are small organic molecules that can be loosely or tightly bound to an enzyme. Tightly bound coenzymes Main articles: Activation energy, Thermodynamic equilib- can be called prosthetic groups. Coenzymes transport rium and Chemical equilibrium chemical groups from one enzyme to another.[59] Some of these chemicals such as riboflavin, thiamine and folic acid As all catalysts, enzymes do not alter the position of the are vitamins (compounds that cannot be synthesized by the chemical equilibrium of the reaction. Usually, in the pres- body and must be acquired from the diet). The chemi- ence of an enzyme, the reaction runs in the same direc- cal groups carried include the hydride ion (H-) carried by tion as it would without the enzyme, just more quickly. NAD or NADP+, the phosphate group carried by adenosine However, in the absence of the enzyme, other possible un- triphosphate, the acetyl group carried by coenzyme A, catalyzed, “spontaneous” reactions might lead to different 38 CHAPTER 4. ENZYME

Catalytic step

without enzyme

activation E + S ES E + P energy without enzyme with enzyme activation energy with Substrate binding enzyme

reactants overall energy Energy e.g. 2 +2 OHCO released during Mechanism for a single substrate enzyme catalyzed reaction. The reaction enzyme (E) binds a substrate (S) and produces a product (P). products

H2CO3

says, where since the 90s, the dynamics of many enzymes Reaction coordinate are studied on the level of individual molecules. In 1902 Victor Henri proposed a quantitative theory of en- The energies of the stages of a chemical reaction. Substrates need a zyme kinetics,[63] but his experimental data were not useful lot of potential energy to reach a transition state, which then decays because the significance of the hydrogen ion concentration into products. The enzyme stabilizes the transition state, reducing was not yet appreciated. After Peter Lauritz Sørensen had the energy needed to form products. defined the logarithmic pH-scale and introduced the con- cept of buffering in 1909[64] the German chemist Leonor products, because in those conditions this different product Michaelis and his Canadian postdoc Maud Leonora Menten is formed faster. repeated Henri’s experiments and confirmed his equation, which is referred to as Henri-Michaelis-Menten kinetics Furthermore, enzymes can couple two or more reactions, (termed also Michaelis-Menten kinetics).[65] Their work so that a thermodynamically favorable reaction can be used was further developed by G. E. Briggs and J. B. S. Haldane, to “drive” a thermodynamically unfavorable one. For ex- who derived kinetic equations that are still widely consid- ample, the hydrolysis of ATP is often used to drive other ered today a starting point in solving enzymatic activity.[66] chemical reactions.[62] The major contribution of Henri was to think of enzyme Enzymes catalyze the forward and backward reactions reactions in two stages. In the first, the substrate binds re- equally. They do not alter the equilibrium itself, but only versibly to the enzyme, forming the enzyme-substrate com- the speed at which it is reached. For example, carbonic an- plex. This is sometimes called the Michaelis complex. The hydrase catalyzes its reaction in either direction depending enzyme then catalyzes the chemical step in the reaction on the concentration of its reactants. and releases the product. Note that the simple Michaelis Menten mechanism for the enzymatic activity is consid- Carbonic anhydrase CO2 + H2O−−−−−−−−−−−−−→H2CO3 (in ered today a basic idea, where many examples show that tissues; high CO2 concentration) the enzymatic activity involves structural dynamics. This Carbonic anhydrase is incorporated in the enzymatic mechanism while intro- H CO −−−−−−−−−−−−−→CO + H O (in 2 3 2 2 ducing several Michaelis Menten pathways that are con- lungs; low CO concentration) 2 nected with fluctuating rates.[50][51][52] Nevertheless, there is a mathematical relation connecting the behavior obtained Nevertheless, if the equilibrium is greatly displaced in one from the basic Michaelis Menten mechanism (that was in- direction, that is, in a very exergonic reaction, the reaction deed proved correct in many experiments) with the gener- is in effect irreversible. Under these conditions, the enzyme alized Michaelis Menten mechanisms involving dynamics will, in fact, catalyze the reaction only in the thermodynam- and activity; [67] this means that the measured activity of ically allowed direction. enzymes on the level of many enzymes may be explained with the simple Michaelis-Menten equation, yet, the actual activity of enzymes is richer and involves structural dynam- 4.5 Kinetics ics. Enzymes can catalyze up to several million reactions per Main article: Enzyme kinetics second. For example, the uncatalyzed decarboxylation of Enzyme kinetics is the investigation of how enzymes bind orotidine 5'-monophosphate has a half life of 78 million substrates and turn them into products. The rate data used years. However, when the enzyme orotidine 5'-phosphate in kinetic analyses are commonly obtained from enzyme as- decarboxylase is added, the same process takes just 25 4.6. INHIBITION 39

0.35 property are called catalytically perfect or kinetically per-

0.30 fect. Example of such enzymes are triose-phosphate iso- Vmax merase, carbonic anhydrase, acetylcholinesterase, catalase, 0.25 ½Vmax fumarase, β-lactamase, and superoxide dismutase. 0.20 Michaelis-Menten kinetics relies on the law of mass ac-

0.15 tion, which is derived from the assumptions of free diffusion and thermodynamically driven random colli- Reaction rate 0.10 sion. However, many biochemical or cellular processes Km 0.05 deviate significantly from these conditions, because of macromolecular crowding, phase-separation of the en- 0.00 0 1000 2000 3000 4000 zyme/substrate/product, or one or two-dimensional molec- Substrate concentration ular movement.[69] In these situations, a fractal Michaelis- Menten kinetics may be applied.[70][71][72][73] Saturation curve for an enzyme reaction showing the relation be- Some enzymes operate with kinetics, which are faster than tween the substrate concentration (S) and rate (v) diffusion rates, which would seem to be impossible. Sev- eral mechanisms have been invoked to explain this phe- nomenon. Some proteins are believed to accelerate catal- milliseconds.[68] Enzyme rates depend on solution condi- ysis by drawing their substrate in and pre-orienting them tions and substrate concentration. Conditions that denature by using dipolar electric fields. Other models invoke a the protein abolish enzyme activity, such as high tempera- quantum-mechanical tunneling explanation, whereby a pro- tures, extremes of pH or high salt concentrations, while rais- ton or an electron can tunnel through activation barriers, ing substrate concentration tends to increase activity when although for proton tunneling this model remains some- [S] is low. To find the maximum speed of an enzymatic re- what controversial.[74][75] Quantum tunneling for protons action, the substrate concentration is increased until a con- has been observed in tryptamine.[76] This suggests that en- stant rate of product formation is seen. This is shown in the zyme catalysis may be more accurately characterized as saturation curve on the right. Saturation happens because, “through the barrier” rather than the traditional model, as substrate concentration increases, more and more of the which requires substrates to go “over” a lowered energy bar- free enzyme is converted into the substrate-bound ES form. rier. At the maximum reaction rate (Vₐₓ) of the enzyme, all the enzyme active sites are bound to substrate, and the amount of ES complex is the same as the total amount of enzyme. 4.6 Inhibition However, Vₐₓ is only one kinetic constant of enzymes. The amount of substrate needed to achieve a given rate of re- action is also important. This is given by the Michaelis- (a) Reaction Menten constant (K), which is the substrate concentration Substrate

required for an enzyme to reach one-half its maximum re- Active action rate; generally, each enzyme has a characteristic K site for a given substrate. Another useful constant is kₐ, which Enzyme

is the rate of product formation handled by one active site Enzyme binds substrate Enzyme releases products and is generally given in units of inverse seconds. (b) Inhibition Inhibitor The efficiency of an enzyme can be expressed in terms Active of kₐ/K. This is also called the specificity constant and site incorporates the rate constants for all steps in the reac- Enzyme tion up to and including the first irreversible step. Be- Enzyme binds inhibitor Inhibitor competes cause the specificity constant reflects both affinity and with substrate catalytic ability, it is useful for comparing different en- zymes against each other, or the same enzyme with dif- Competitive inhibitors bind reversibly to the enzyme, preventing the ferent substrates. The theoretical maximum for the speci- binding of substrate. On the other hand, binding of substrate pre- ficity constant is called the diffusion limit and is about vents binding of the inhibitor. Substrate and inhibitor compete for 108 to 109 (M−1 s−1). At this point every collision of the enzyme. the enzyme with its substrate will result in catalysis, and the rate of product formation is not limited by the reac- Main article: Enzyme inhibitor tion rate but by the diffusion rate. Enzymes with this 40 CHAPTER 4. ENZYME

S parent K. kcat

E ES E + P competitive inhibition I Ks Uncompetitive inhibition Ki EI In uncompetitive inhibition, the inhibitor cannot bind to the S free enzyme, only to the ES-complex. The EIS-complex kcat E ES E + P uncompetitive inhibition thus formed is enzymatically inactive. This type of inhibi- Ks I tion is rare, but may occur in multimeric enzymes. Kii

EIS Non-competitive inhibition S kcat E ES E + P non-competitive inhibition Non-competitive inhibitors can bind to the enzyme at the I Ks I binding site at the same time as the substrate,but not to the Ki Kii Kss active site. Both the EI and EIS complexes are enzymati- EI EIS cally inactive. Because the inhibitor can not be driven from S the enzyme by higher substrate concentration (in contrast to competitive inhibition), the apparent Vₐₓ changes. But S kcat because the substrate can still bind to the enzyme, the K E ES E + P mixed inhibition stays the same. I Ks I Ki Kii Kss ko EI EIS EI + P Mixed inhibition S This type of inhibition resembles the non-competitive, ex- cept that the EIS-complex has residual enzymatic activ- Types of inhibition. This classification was introduced by W.W. ity.This type of inhibitor does not follow Michaelis-Menten Cleland.[77] equation. In many organisms, inhibitors may act as part of a feedback Enzyme reaction rates can be decreased by various types of mechanism. If an enzyme produces too much of one sub- enzyme inhibitors. stance in the organism, that substance may act as an in- hibitor for the enzyme at the beginning of the pathway that Competitive inhibition produces it, causing production of the substance to slow down or stop when there is sufficient amount. This is a form In competitive inhibition, the inhibitor and substrate com- of negative feedback. Enzymes that are subject to this form pete for the enzyme (i.e., they can not bind at the of regulation are often multimeric and have allosteric bind- same time).[78] Often competitive inhibitors strongly re- ing sites for regulatory substances. Their substrate/velocity semble the real substrate of the enzyme. For example, plots are not hyperbolar, but sigmoidal (S-shaped). methotrexate is a competitive inhibitor of the enzyme dihydrofolate reductase, which catalyzes the reduction of dihydrofolate to tetrahydrofolate. The similarity between the structures of folic acid and this drug are shown in the figure to the right bottom. In some cases, the inhibitor can bind to a site other than the binding-site of the usual substrate and exert an allosteric effect to change the shape of the usual binding-site. For example, strychnine acts as The coenzyme folic acid (left) and the anti-cancer drug methotrex- an allosteric inhibitor of the receptor in the mam- ate (right) are very similar in structure. As a result, methotrexate is malian spinal cord and brain stem. Glycine is a major post- a competitive inhibitor of many enzymes that use folates. synaptic inhibitory neurotransmitter with a specific recep- tor site. Strychnine binds to an alternate site that reduces Irreversible inhibitors react with the enzyme and form a the affinity of the glycine receptor for glycine, resulting in covalent adduct with the protein. The inactivation is irre- convulsions due to lessened inhibition by the glycine.[79] versible. These compounds include eflornithine a drug used In competitive inhibition the maximal rate of the reaction to treat the parasitic disease sleeping sickness.[80] Penicillin is not changed, but higher substrate concentrations are re- and Aspirin also act in this manner. With these drugs, the quired to reach a given maximum rate, increasing the ap- compound is bound in the active site and the enzyme then 4.8. CONTROL OF ACTIVITY 41

converts the inhibitor into an activated form that reacts ir-

Pyruvate Hexokinase Mg++ reversibly with one or more amino acid residues. Pyruvate kinase Phosphoglucose ++ isomerase ATP Mg Glucose ATP ADP ADP Glucose 6-phosphate + Enolase H Mg++ Fructose 6-phosphate Phosphofructokinase ×2 Mg++

Phosphoenolpyruvate H2 O H O ATP Uses of inhibitors 2 2-phosphoglycerate Phosphoglycerate ADP mutase Fructose 1,6-biphosphate Legend Phosphoglycerate Fructose bisphosphate aldolase Hydrogen 3-phosphoglycerate kinase Adenosine Glyceraldehyde 3-phosphate Mg++ Carbon ATP triphosphate Glyceraldehyde phosphate Oxygen Since inhibitors modulate the function of enzymes they are dehydrogenase Adenosine Phosphate group ADP Mg++ diphosphate ATP Triosephosphate isomerase

H2 PO 4 Inorganic phosphate Irreversible reaction (highly exergonic) ADP Mg++ Magnesium ion (cofactor) often used as drugs. A common example of an inhibitor + + + Reversible reaction NADH, H NAD NAD Nicotinamide adenine H PO dinucleotide 1,3-biphosphoglycerate 2 4 that is used as a drug is aspirin, which inhibits the COX-1 Hexokinase Enzyme Dihydroxyacetone phosphate and COX-2 enzymes that produce the inflammation mes- senger prostaglandin, thus suppressing pain and inflamma- Glycolytic enzymes and their functions in the of glycolysis tion. However, other enzyme inhibitors are poisons. For example, the poison cyanide is an irreversible enzyme in- hibitor that combines with the copper and iron in the active Enzymes determine what steps occur in these pathways. site of the enzyme cytochrome c oxidase and blocks cellular Without enzymes, metabolism would neither progress respiration.[81] through the same steps nor be fast enough to serve the needs of the cell. Indeed, a metabolic pathway such as glycolysis could not exist independently of enzymes. Glu- 4.7 Biological function cose, for example, can react directly with ATP to become phosphorylated at one or more of its carbons. In the ab- sence of enzymes, this occurs so slowly as to be insignifi- Enzymes serve a wide variety of functions inside living or- cant. However, if hexokinase is added, these slow reactions ganisms. They are indispensable for signal transduction and [82] continue to take place except that phosphorylation at carbon cell regulation, often via kinases and phosphatases. They 6 occurs so rapidly that, if the mixture is tested a short time also generate movement, with myosin hydrolyzing ATP to later, glucose-6-phosphate is found to be the only signifi- generate muscle contraction and also moving cargo around [83] cant product. As a consequence, the network of metabolic the cell as part of the cytoskeleton. Other ATPases in pathways within each cell depends on the set of functional the cell membrane are ion pumps involved in active trans- enzymes that are present. port. Enzymes are also involved in more exotic functions, such as luciferase generating light in fireflies.[84] Viruses can also contain enzymes for infecting cells, such as the HIV in- tegrase and reverse transcriptase, or for viral release from 4.8 Control of activity cells, like the influenza virus neuraminidase. There are five main ways that enzyme activity is controlled An important function of enzymes is in the digestive sys- in the cell. tems of animals. Enzymes such as amylases and proteases break down large molecules (starch or proteins, respec- tively) into smaller ones, so they can be absorbed by the 1. Enzyme production (transcription and translation of intestines. Starch molecules, for example, are too large to enzyme genes) can be enhanced or diminished by a be absorbed from the intestine, but enzymes hydrolyze the cell in response to changes in the cell’s environment. starch chains into smaller molecules such as maltose and This form of gene regulation is called enzyme induc- eventually glucose, which can then be absorbed. Differ- tion and inhibition. For example, bacteria may be- ent enzymes digest different food substances. In ruminants, come resistant to antibiotics such as penicillin because which have herbivorous diets, microorganisms in the gut enzymes called beta-lactamases are induced that hy- produce another enzyme, cellulase, to break down the cel- drolyze the crucial beta-lactam ring within the peni- lulose cell walls of plant fiber.[85] cillin molecule. Another example are enzymes in the liver called cytochrome P450 oxidases, which are im- Several enzymes can work together in a specific order, cre- portant in drug metabolism. Induction or inhibition of ating metabolic pathways. In a metabolic pathway, one en- these enzymes can cause drug interactions. zyme takes the product of another enzyme as a substrate. After the catalytic reaction, the product is then passed on 2. Enzymes can be compartmentalized, with differ- to another enzyme. Sometimes more than one enzyme can ent metabolic pathways occurring in different cellular catalyze the same reaction in parallel; this can allow more compartments. These patterns can be investigated by complex regulation: with, for example, a low constant ac- enzyme localization studies. For example, fatty acids tivity provided by one enzyme but an inducible high activity are synthesized by one set of enzymes in the cytosol, from a second enzyme. endoplasmic reticulum and the Golgi apparatus and 42 CHAPTER 4. ENZYME

used by a different set of enzymes as a source of en- ergy in the mitochondrion, through β-oxidation.[86] 3. Enzymes can be regulated by inhibitors and ac- tivators. For example, the end product(s) of a metabolic pathway are often inhibitors for one of the first enzymes of the pathway (usually the first irre- versible step, called committed step), thus regulating the amount of end product made by the pathways. Such a regulatory mechanism is called a negative feed- back mechanism, because the amount of the end prod- uct produced is regulated by its own concentration. Negative feedback mechanisms can effectively adjust the rate of synthesis of intermediate metabolites ac- cording to the demands of the cells. This helps allo- cate materials and energy economically, and prevents the manufacture of excess end products. The control of enzymatic action helps to maintain a stable internal environment in living organisms. 4. Enzymes can be regulated through covalent modula- tion. This can include phosphorylation, Phenylalanine hydroxylase. Created from PDB 1KW0 and glycosylation. For example, in the response to insulin, the phosphorylation of multiple enzymes, in- One example of enzyme deficiency is the most common cluding glycogen synthase, helps control the synthe- type of phenylketonuria. A mutation of a single amino sis or degradation of glycogen and allows the cell to acid in the enzyme phenylalanine hydroxylase, which cat- respond to changes in blood sugar.[87] Another ex- alyzes the first step in the degradation of phenylalanine, ample of post-translational modification is the cleav- results in build-up of phenylalanine and related products. age of the polypeptide chain. Chymotrypsin, a di- This can lead to intellectual disability if the disease is gestive protease, is produced in inactive form as untreated.[89] Another example is pseudocholinesterase de- chymotrypsinogen in the pancreas and transported in ficiency, in which the body’s ability to break down choline this form to the duodenum where it is activated. This ester drugs is impaired.[90] stops the enzyme from digesting the pancreas or other tissues before it enters the gut. This type of inactive A further example is when germline mutations in genes cod- precursor to an enzyme is known as a zymogen. ing for DNA repair enzymes cause hereditary cancer syn- dromes such as xeroderma pigmentosum. Defects in these 5. Some enzymes may become activated when local- enzymes cause cancer since the body is less able to repair ized to a different environment (e.g., from a re- mutations in the genome. This causes a slow accumulation ducing (cytoplasm) to an oxidizing (periplasm) en- of mutations and results in the development of many types vironment, high pH to low pH, etc.). For example, of cancer in the sufferer. hemagglutinin in the influenza virus is activated by a conformational change caused by the acidic condi- Oral administration of enzymes can be used to treat sev- tions, these occur when it is taken up inside its host eral diseases (e.g. pancreatic insufficiency and lactose in- cell and enters the lysosome.[88] tolerance). Since enzymes are proteins themselves they are potentially subject to inactivation and digestion in the gas- trointestinal environment. Therefore a non-invasive imag- 4.9 Involvement in disease ing assay was developed to monitor gastrointestinal activity of exogenous enzymes (prolyl endopeptidase as potential adjuvant therapy for celiac disease) in vivo.[91] Since the tight control of enzyme activity is essential for homeostasis, any malfunction (mutation, overproduction, underproduction or deletion) of a single critical enzyme can lead to a genetic disease. The importance of enzymes is 4.10 Naming conventions shown by the fact that a lethal illness can be caused by the malfunction of just one type of enzyme out of the thousands An enzyme’s name is often derived from its substrate or of types present in our bodies. the chemical reaction it catalyzes, with the word ending 4.12. SEE ALSO 43

in -ase. Examples are lactase, alcohol dehydrogenase and enzymes with novel properties, either through rational de- DNA polymerase. This may result in different enzymes, sign or in vitro evolution.[97][98] These efforts have begun to called isozymes, with the same function having the same ba- be successful, and a few enzymes have now been designed sic name. Isoenzymes have a different amino acid sequence “from scratch” to catalyze reactions that do not occur in and might be distinguished by their optimal pH, kinetic nature.[99] properties or immunologically. Isoenzyme and isozyme are homologous proteins. Furthermore, the normal physiolog- ical reaction an enzyme catalyzes may not be the same as 4.12 See also under artificial conditions. This can result in the same en- zyme being identified with two different names. For exam- • ple, glucose isomerase, which is used industrially to convert Catalytic triad glucose into the sweetener fructose, is a xylose isomerase in • Diffusion limited enzyme vivo (within the body). The International Union of Biochemistry and Molecular Bi- • Enzyme substrate (biology) ology have developed a nomenclature for enzymes, the EC • Immobilized enzyme numbers; each enzyme is described by a sequence of four numbers preceded by “EC”. The first number broadly clas- • Ki Database sifies the enzyme based on its mechanism. • The top-level classification is[92] List of enzymes • Proteomics • EC 1 Oxidoreductases: catalyze oxidation/reduction reactions • Protein family • EC 2 Transferases: transfer a functional group (e.g. a • Protein superfamily methyl or phosphate group) • SUMO enzymes • EC 3 Hydrolases: catalyze the hydrolysis of various bonds • The Proteolysis Map • EC 4 Lyases: cleave various bonds by means other than hydrolysis and oxidation • EC 5 Isomerases: catalyze isomerization changes 4.13 References within a single molecule [1] Smith AL (Ed) (1997). Oxford dictionary of biochemistry • EC 6 Ligases: join two molecules with covalent bonds. and molecular biology. Oxford [Oxfordshire]: Oxford Uni- versity Press. ISBN 0-19-854768-4. According to the naming conventions, enzymes are gener- ally classified into six main family classes and many sub- [2] Grisham, Charles M.; Reginald H. Garrett (1999). Biochem- istry. Philadelphia: Saunders College Pub. pp. 426–7. family classes. Some web-servers, e.g., EzyPred [93] and ISBN 0-03-022318-0. bioinformatics tools have been developed to predict which [94] [95] [96] main family class and sub-family class an enzyme [3] Bairoch A. (2000). “The ENZYME database in molecule belongs to according to its sequence information 2000” (PDF). Nucleic Acids Res 28 (1): 304–5. alone via the pseudo amino acid composition. doi:10.1093/nar/28.1.304. PMC 102465. PMID 10592255.

[4] Lilley D (2005). “Structure, folding and mechanisms of 4.11 Industrial applications ribozymes”. Current Opinion in Structural Biology 15 (3): 313–23. doi:10.1016/j.sbi.2005.05.002. PMID 15919196. Enzymes are used in the chemical industry and other in- dustrial applications when extremely specific catalysts are [5] Cech T (2000). “Structural biology. The ribo- some is a ribozyme”. Science 289 (5481): 878–9. required. However, enzymes in general are limited in the doi:10.1126/science.289.5481.878. PMID 10960319. number of reactions they have evolved to catalyze and also by their lack of stability in organic solvents and at high tem- [6] Groves JT (1997). “Artificial enzymes. The impor- peratures. As a consequence, protein engineering is an ac- tance of being selective”. Nature 389 (6649): 329–30. tive area of research and involves attempts to create new doi:10.1038/38602. PMID 9311771. 44 CHAPTER 4. ENZYME

[7] de Réaumur, RAF (1752). “Observations sur la digestion [17] Blake CC, Koenig DF, Mair GA, North AC, Phillips DC, des oiseaux”. Histoire de l'academie royale des sciences Sarma VR.; Koenig; Mair; North; Phillips; Sarma (1965). 1752: 266, 461. “Structure of hen egg-white lysozyme. A three-dimensional Fourier synthesis at 2 Angstrom resolution”. Nature 206 [8] Williams, H. S. (1904) A History of Science: in Five Vol- (4986): 757–61. doi:10.1038/206757a0. PMID 5891407. umes. Volume IV: Modern Development of the Chemical and Biological Sciences Harper and Brothers (New York) [18] Chen LH, Kenyon GL, Curtin F, Harayama S, Bem- Accessed 4 April 2007 benek ME, Hajipour G, Whitman CP; Kenyon; Curtin; Harayama; Bembenek; Hajipour; Whitman (1992). “4- [9] Payen, A. et J.-F. Persoz (1833) “Mémoire sur la diastase, les Oxalocrotonate tautomerase, an enzyme composed of 62 principaux produits de ses réactions et leurs applications aux amino acid residues per monomer”. J. Biol. Chem. 267 arts industriels” (Memoir on diastase, the principal products (25): 17716–21. PMID 1339435. of its reactions and their applications to the industrial arts), Annales de chimie et de physique, 2nd series, 53 : 73–92. [19] Smith S (1 December 1994). “The animal fatty acid syn- thase: one gene, one polypeptide, seven enzymes”. FASEB [10] Dubos J. (1951). “Louis Pasteur: Free Lance of Sci- J. 8 (15): 1248–59. PMID 8001737. ence, Gollancz. Quoted in Manchester K. L. (1995) Louis Pasteur (1822–1895)—chance and the prepared mind”. [20] Anfinsen C.B. (1973). “Principles that Govern the Fold- Trends Biotechnol 13 (12): 511–5. doi:10.1016/S0167- ing of Protein Chains”. Science 181 (4096): 223–30. 7799(00)89014-9. PMID 8595136. doi:10.1126/science.181.4096.223. PMID 4124164.

[11] Kühne coined the word “enzyme” in: W. Kühne (1877) [21] Dunaway-Mariano D (2008). “Enzyme func- "Über das Verhalten verschiedener organisirter und sog. tion discovery”. Structure 16 (11): 1599–600. ungeformter Fermente" (On the behavior of various orga- doi:10.1016/j.str.2008.10.001. PMID 19000810. nized and so-called unformed ferments), Verhandlungen des naturhistorisch-medicinischen Vereins zu Heidelberg, new se- [22] The Catalytic Site Atlas at The European Bioinformatics In- ries, vol. 1, no. 3, pages 190–193. The relevant passage oc- stitute. Retrieved 4 April 2007. curs on page 190: “Um Missverständnissen vorzubeugen und [23] Jaeger KE, Eggert T.; Eggert (2004). “Enantiose- lästige Umschreibungen zu vermeiden schlägt Vortragender lective biocatalysis optimized by directed evolution”. vor, die ungeformten oder nicht organisirten Fermente, deren Current Opinion in Biotechnology 15 (4): 305–13. Wirkung ohne Anwesenheit von Organismen und ausserhalb doi:10.1016/j.copbio.2004.06.007. PMID 15358000. derselben erfolgen kann, als Enzyme zu bezeichnen.” (Trans- lation: In order to obviate misunderstandings and avoid cum- [24] Shevelev IV, Hubscher U.; Hübscher (2002). “The 3' 5' ex- bersome periphrases, [the author, a university lecturer] sug- onucleases”. Nature Reviews Molecular Cell Biology 3 (5): gests designating as “enzymes” the unformed or not orga- 364–76. doi:10.1038/nrm804. PMID 11988770. nized ferments, whose action can occur without the presence of organisms and outside of the same.) [25] Tymoczko, John L.; Stryer Berg Tymoczko; Stryer, Lubert; Berg, Jeremy Mark (2002). Biochemistry. San Francisco: [12] Nobel Laureate Biography of Eduard Buchner at http:// W.H. Freeman. ISBN 0-7167-4955-6. nobelprize.org. Retrieved 4 April 2007. [26] Zenkin N, Yuzenkova Y, Severinov K.; Yuzenkova; [13] Text of Eduard Buchner’s 1907 Nobel lecture at http:// Severinov (2006). “Transcript-assisted transcrip- nobelprize.org. Retrieved 4 April 2007. tional proofreading”. Science. 313 (5786): 518–20. doi:10.1126/science.1127422. PMID 16873663. [14] The naming of enzymes by adding the suffix "-ase” to the substrate on which the enzyme acts, has been traced to [27] Ibba M, Soll D.; Soll (2000). “Aminoacyl-tRNA French scientist Émile Duclaux (1840–1904), who intended synthesis”. Annu Rev Biochem. 69: 617–50. to honor the discoverers of diastase – the first enzyme to be doi:10.1146/annurev.biochem.69.1.617. PMID 10966471. isolated – by introducing this practice in his book Traité de Microbiologie, vol. 2 (Paris, France: Masson and Co., 1899). [28] Rodnina MV, Wintermeyer W.; Wintermeyer (2001). “Fi- See Chapter 1, especially page 9. delity of aminoacyl-tRNA selection on the ribosome: ki- netic and structural mechanisms”. Annu Rev Biochem. 70: [15] Willstätter, R. (1927). Problems and Methods in Enzyme 415–35. doi:10.1146/annurev.biochem.70.1.415. PMID Research. Cornell University Press, Ithaca. quoted in Blow, 11395413. David (2000). “So do we understand how enzymes work?" (pdf). Structure 8 (4): R77–R81. doi:10.1016/S0969- [29] Tawfik, O. K. A. D. S.; Tawfik, D. S. (2010). “Enzyme 2126(00)00125-8. PMID 10801479. Promiscuity: A Mechanistic and Evolutionary Perspec- tive”. Annual Review of Biochemistry 79: 471–505. [16] 1946 Nobel prize for Chemistry laureates at http:// doi:10.1146/annurev-biochem-030409-143718. PMID nobelprize.org. Retrieved 4 April 2007. 20235827. 4.13. REFERENCES 45

[30] Fischer E. (1894). “Einfluss der Configuration auf [41] Villa J, Strajbl M, Glennon TM, Sham YY, Chu ZT, die Wirkung der Enzyme” [Influence of configuration Warshel A; Strajbl; Glennon; Sham; Chu; Warshel (2000). on the action of enzymes]. Berichte der Deutschen “How important are entropic contributions to enzyme catal- chemischen Gesellschaft zu Berlin 27 (3): 2985–93. ysis?". Proc. Natl. Acad. Sci. U.S.A. 97 (22): 11899– doi:10.1002/cber.18940270364. From page 2992: “Um ein 904. doi:10.1073/pnas.97.22.11899. PMC 17266. PMID Bild zu gebrauchen, will ich sagen, dass Enzym und Glucosid 11050223. wie Schloss und Schlüssel zu einander passen müssen, um eine chemische Wirkung auf einander ausüben zu können.” (To [42] Warshel A, Sharma PK, Kato M, Xiang Y, Liu H, Olsson use an image, I will say that an enzyme and a glucoside [i.e., MH; Sharma; Kato; Xiang; Liu; Olsson (2006). “Electro- glucose derivative] must fit like a lock and key, in order to static basis for enzyme catalysis”. Chem. Rev. 106 (8): be able to exert a chemical effect on each other.) 3210–35. doi:10.1021/cr0503106. PMID 16895325.

[31] Koshland D. E. (1958). “Application of a Theory of Enzyme [43] Eisenmesser EZ, Bosco DA, Akke M, Kern D; Bosco; Akke; Specificity to Protein Synthesis”. Proc. Natl. Acad. Sci. Kern (2002). “Enzyme dynamics during catalysis”. Science 44 (2): 98–104. doi:10.1073/pnas.44.2.98. PMC 335371. 295 (5559): 1520–3. doi:10.1126/science.1066176. PMID PMID 16590179. 11859194.

[32] Vasella A, Davies GJ, Bohm M.; Davies; Böhm (2002). [44] Agarwal PK (2005). “Role of protein dynamics in re- “Glycosidase mechanisms”. Current Opinion in Chemical Bi- action rate enhancement by enzymes”. J. Am. Chem. ology 6 (5): 619–29. doi:10.1016/S1367-5931(02)00380- Soc. 127 (43): 15248–56. doi:10.1021/ja055251s. PMID 0. PMID 12413546. 16248667.

[33] Boyer, Rodney (2002) [2002]. “6”. Concepts in Biochem- [45] Eisenmesser EZ, Millet O, Labeikovsky W; Millet; istry (2nd ed.). New York, Chichester, Weinheim, Brisbane, Labeikovsky; Korzhnev; Wolf-Watz; Bosco; Skalicky; Singapore, Toronto.: John Wiley & Sons, Inc. pp. 137–8. Kay; Kern (2005). “Intrinsic dynamics of an enzyme ISBN 0-470-00379-0. OCLC 51720783. underlies catalysis”. Nature 438 (7064): 117–21. doi:10.1038/nature04105. PMID 16267559. [34] Savir Y & Tlusty T; Tlusty (2007). Scalas, Enrico, ed. “Conformational proofreading: the impact of conforma- [46] Yang LW, Bahar I; Bahar (5 June 2005). “Coupling be- tional changes on the specificity of molecular recognition”. tween catalytic site and collective dynamics: A requirement PLoS ONE 2 (5): e468. doi:10.1371/journal.pone.0000468. for mechanochemical activity of enzymes”. Structure 13 (6): PMC 1868595. PMID 17520027. 893–904. doi:10.1016/j.str.2005.03.015. PMC 1489920. PMID 15939021. [35] Chou K.C. (1996). “Review: Prediction of human immunodeficiency virus protease cleavage sites in [47] Agarwal PK, Billeter SR, Rajagopalan PT, Benkovic SJ, proteins”. Analytical Biochemistry 233 (1): 1–14. Hammes-Schiffer S.; Billeter; Rajagopalan; Benkovic; doi:10.1006/abio.1996.0001. PMID 8789141. Hammes-Schiffer (5 March 2002). “Network of coupled promoting motions in enzyme catalysis”. Proc Natl Acad Sci [36] Gan, Y. R., Huang, H., Huang, Y. D., Rao, C. M., Zhao, USA. 99 (5): 2794–9. doi:10.1073/pnas.052005999. PMC Y., Liu, J. S., Wu, L. & Wei, D. Q.; Huang; Huang; 122427. PMID 11867722. Rao; Zhao; Liu; Wu; Wei (April 2006). “Synthesis and activity of an octapeptide inhibitor designed for SARS [48] Agarwal PK, Geist A, Gorin A; Geist; Gorin (2004). coronavirus main proteinase”. Peptides 27 (4): 622–625. “Protein dynamics and enzymatic catalysis: investigat- doi:10.1016/j.peptides.2005.09.006. PMID 16242214. ing the peptidyl-prolyl cis-trans isomerization activity of cyclophilin A”. Biochemistry 43 (33): 10605–18. [37] Du, Q. S., Wang, S., Wei, D. Q., Sirois, S. & Chou, K. C.; doi:10.1021/bi0495228. PMID 15311922. Wang; Wei; Sirois; Chou (2005). “Molecular modelling and chemical modification for finding peptide inhibitor against [49] Tousignant A, Pelletier JN.; Pelletier (2004). “Protein mo- SARS CoV Mpro”. Analytical Biochemistry 337 (2): 262– tions promote catalysis”. Chem Biol. 11 (8): 1037–42. 270. doi:10.1016/j.ab.2004.10.003. PMID 15691506. doi:10.1016/j.chembiol.2004.06.007. PMID 15324804.

[38] Du, Q. S., Sun, H. & Chou, K. C.; Sun; Chou (2007). “In- [50] Flomenbom O, Velonia K, Loos D et al. (2005). hibitor design for SARS coronavirus main protease based “Stretched exponential decay and correlations in the cat- on “distorted key theory"". Medicinal Chemistry 3 (1): 1–6. alytic activity of fluctuating single lipase molecules”. Proc. doi:10.2174/157340607779317616. PMID 17266617. Natl. Acad. Sci. U.S.A. 102 (7): 2368–2372. doi:10.1073/pnas.0409039102. PMC 548972. PMID [39] Fersht, Alan (1985). Enzyme structure and mechanism. San 15695587. Francisco: W.H. Freeman. pp. 50–2. ISBN 0-7167-1615- 1. [51] English BP, Min W, van Oijen AM et al. (2006). “Ever- fluctuating single enzyme molecules: Michaelis-Menten [40] Jencks, William P. (1987). Catalysis in chemistry and enzy- equation revisited”. Nature Chemical Biology 2 (2): 87–94. mology. Mineola, N.Y: Dover. ISBN 0-486-65460-5. doi:10.1038/nchembio759. PMID 16415859. 46 CHAPTER 4. ENZYME

[52] Lu H, Xun L, Xie X S; Xun; Xie (1998). “Single-molecule [66] Briggs G. E., Haldane J. B. S.; Haldane (1925). “A note on enzymatic dynamics”. Science 282 (5395): 1877–1882. the kinetics of enzyme action”. Biochem. J. 19 (2): 339– doi:10.1126/science.282.5395.1877. PMID 9836635. 339. PMC 1259181. PMID 16743508.

[53] Olsson, MH; Parson, WW; Warshel, A (2006). “Dynam- [67] Xue X, Liu F, Ou-Yang ZC; Liu; Ou-Yang (2006). ical Contributions to Enzyme Catalysis: Critical Tests of “Single molecule Michaelis-Menten equation beyond qua- A Popular Hypothesis”. Chem. Rev. 106 (5): 1737–56. sistatic disorder”. Phys. Rev. E 74 (3): 030902. doi:10.1021/cr040427e. PMID 16683752. doi:10.1103/PhysRevE.74.030902. PMID 17025584. [68] Radzicka A, Wolfenden R.; Wolfenden (1995). “A [54] Neet KE (1995). “Cooperativity in enzyme function: equi- proficient enzyme”. Science 267 (5194): 90–931. librium and kinetic aspects”. Meth. Enzymol. Meth- doi:10.1126/science.7809611. PMID 7809611. ods in Enzymology 249: 519–67. doi:10.1016/0076- 6879(95)49048-5. ISBN 978-0-12-182150-0. PMID [69] Ellis RJ (2001). “Macromolecular crowding: obvious but 7791626. underappreciated”. Trends Biochem. Sci. 26 (10): 597–604. doi:10.1016/S0968-0004(01)01938-7. PMID 11590012. [55] Changeux JP, Edelstein SJ; Edelstein (2005). “Allosteric mechanisms of signal transduction”. Science 308 (5727): [70] Kopelman R (1988). “Fractal Reaction Ki- 1424–8. doi:10.1126/science.1108595. PMID 15933191. netics”. Science 241 (4873): 1620–26. doi:10.1126/science.241.4873.1620. PMID 17820893. [56] de Bolster, M.W.G. (1997). “Glossary of Terms Used in : Cofactor”. International Union of [71] Savageau MA (1995). “Michaelis-Menten mechanism re- Pure and Applied Chemistry. Retrieved 30 October 2007. considered: implications of fractal kinetics”. J. Theor. Biol. 176 (1): 115–24. doi:10.1006/jtbi.1995.0181. PMID [57] de Bolster, M.W.G. (1997). “Glossary of Terms Used in 7475096. Bioinorganic Chemistry: Coenzyme”. International Union of Pure and Applied Chemistry. Retrieved 30 October [72] Schnell S, Turner TE; Turner (2004). “Reaction kinetics 2007. in intracellular environments with macromolecular crowd- ing: simulations and rate laws”. Prog. Biophys. Mol. Biol. [58] Fisher Z, Hernandez Prada JA, Tu C, Duda D, Yoshioka 85 (2–3): 235–60. doi:10.1016/j.pbiomolbio.2004.01.012. C, An H, Govindasamy L, Silverman DN and McKenna R. PMID 15142746. (2005). “Structural and kinetic characterization of active- [73] Xu F, Ding H; Ding (2007). “A new kinetic model for site histidine as a proton shuttle in catalysis by human car- heterogeneous (or spatially confined) enzymatic catalysis: bonic anhydrase II”. Biochemistry. 44 (4): 1097–115. Contributions from the fractal and jamming (overcrowd- doi:10.1021/bi0480279. PMID 15667203. ing) effects”. Appl. Catal. A: Gen. 317 (1): 70–81. doi:10.1016/j.apcata.2006.10.014. [59] Wagner, Arthur L. (1975). Vitamins and Coenzymes. Krieger Pub Co. ISBN 0-88275-258-8. [74] Garcia-Viloca M., Gao J., Karplus M., Truhlar D. G.; Gao; Karplus; Truhlar (2004). “How enzymes work: analysis [60] BRENDA The Comprehensive Enzyme Information Sys- by modern rate theory and computer simulations”. Science tem. Retrieved 4 April 2007. 303 (5655): 186–95. doi:10.1126/science.1088172. PMID 14716003. [61] Törnroth-Horsefield S, Neutze R; Neutze (2008). “Opening and closing the metabolite gate”. Proc. Natl. Acad. Sci. [75] Olsson M. H., Siegbahn P. E., Warshel A.; Siegbahn; U.S.A. 105 (50): 19565–6. doi:10.1073/pnas.0810654106. Warshel (2004). “Simulations of the large kinetic isotope ef- PMC 2604989. PMID 19073922. fect and the temperature dependence of the hydrogen atom transfer in lipoxygenase”. J. Am. Chem. Soc. 126 (9): [62] Ferguson, S. J.; Nicholls, David; Ferguson, Stuart (2002). 2820–8. doi:10.1021/ja037233l. PMID 14995199. Bioenergetics 3 (3rd ed.). San Diego: Academic. ISBN 0- 12-518121-3. [76] Masgrau L., Roujeinikova A., Johannissen L. O., Hothi P., Basran J., Ranaghan K. E., Mulholland A. J., Sutcliffe M. J., [63] Henri, V. (1902). “Theorie generale de l'action de quelques Scrutton N. S., Leys D.; Roujeinikova; Johannissen; Hothi; diastases”. Compt. Rend. Hebd. Acad. Sci. Paris 135: 916– Basran; Ranaghan; Mulholland; Sutcliffe; Scrutton; Leys 9. (2006). “Atomic Description of an Enzyme Reaction Dom- inated by Proton Tunneling”. Science 312 (5771): 237–41. [64] Sørensen,P.L. (1909). “Enzymstudien {II}. Über die Mes- doi:10.1126/science.1126002. PMID 16614214. sung und Bedeutung der Wasserstoffionenkonzentration bei enzymatischen Prozessen”. Biochem. Z. 21: 131–304. [77] Cleland, W.W. (1963). “The Kinetics of Enzyme-catalyzed Reactions with two or more Substrates or Products 2. [65] Michaelis L., Menten M. (1913). “Die Kinetik der Invert- {I}nhibition: Nomenclature and Theory”. Biochim. Bio- inwirkung”. Biochem. Z. 49: 333–369. English translation. phys. Acta 67: 173–87. doi:10.1016/0926-6569(63)90226- Retrieved 6 April 2007. 8. PMID 14021668. 4.13. REFERENCES 47

[78] Price, NC. (1979). “What is meant by 'competitive inhi- [91] Fuhrmann G, Leroux JC; Leroux (2011). “In vivo bition'?". Trends in Biochemical Sciences 4 (11): pN272. fluorescence imaging of exogenous enzyme activity in doi:10.1016/0968-0004(79)90205-6. the gastrointestinal tract”. Proceedings of the Na- tional Academy of Sciences 108 (22): 9032–9037. [79] Dick, Ronald M. (2011). “Chapter 2. Pharmacodynamics: doi:10.1073/pnas.1100285108. PMC 3107327. PMID The Study of Drug Action”. In Ouellette, Richard G.; Joyce, 21576491. Joseph A. Pharmacology for Nurse Anesthesiology. Jones & Bartlett Learning. ISBN 978-0-7637-8607-6. [92] The complete nomenclature can be browsed at Enzyme Nomenclature. Recommendations of the Nomenclature [80] R Poulin; Lu, L; Ackermann, B; Bey, P; Pegg, AE Committee of the International Union of Biochemistry and (5 January 1992). “Mechanism of the irreversible in- Molecular Biology on the Nomenclature and Classification activation of mouse ornithine decarboxylase by alpha- of Enzymes by the Reactions they Catalyse. Nomenclature difluoromethylornithine. Characterization of sequences at Committee of the International Union of Biochemistry and the inhibitor and coenzyme binding sites”. Journal of Bio- Molecular Biology (NC-IUBMB) logical Chemistry 267 (1): 150–8. PMID 1730582. [93] Shen, HB; Chou, KC (2007). “EzyPred: A top-down ap- [81] Yoshikawa S and Caughey WS. (15 May 1990). “Infrared proach for predicting enzyme functional classes and sub- evidence of cyanide binding to iron and copper sites in classes”. Biochemical and Biophysical Research Commu- bovine heart cytochrome c oxidase. Implications regarding nications 364 (1): 53–9. doi:10.1016/j.bbrc.2007.09.098. oxygen reduction”. J Biol Chem. 265 (14): 7945–58. PMID PMID 17931599. 2159465. [94] Qiu, JD; Huang, JH; Shi, SP; Liang, RP (2010). “Us- [82] Hunter T. (1995). “Protein kinases and phosphatases: the ing the concept of Chou’s pseudo amino acid compo- yin and yang of protein phosphorylation and signaling”. sition to predict enzyme family classes: An approach Cell. 80 (2): 225–36. doi:10.1016/0092-8674(95)90405- with support vector machine based on discrete wavelet 0. PMID 7834742. transform”. Protein and peptide letters 17 (6): 715–22. doi:10.2174/092986610791190372. PMID 19961429. [83] Berg JS, Powell BC, Cheney RE; Powell; Cheney (1 April 2001). “A millennial myosin census”. Mol. Biol. Cell 12 (4): [95] Zhou, X. B., Chen, C., Li, Z. C. & Zou, X. Y.; Chen; Li; 780–94. doi:10.1091/mbc.12.4.780. PMC 32266. PMID Zou (2007). “Using Chou’s amphiphilic pseudo-amino acid 11294886. composition and support vector machine for prediction of enzyme subfamily classes”. Journal of Theoretical Biology [84] Meighen EA (1 March 1991). “Molecular biology of bac- 248 (3): 546–551. doi:10.1016/j.jtbi.2007.06.001. PMID terial bioluminescence”. Microbiol. Rev. 55 (1): 123–42. 17628605. PMC 372803. PMID 2030669. [96] Chou, K. C. (2005). “Using amphiphilic pseudo amino acid [85] Mackie RI, White BA; White (1 October 1990). “Re- composition to predict enzyme subfamily classes”. Bioinfor- cent advances in rumen microbial and metabolism: matics 21 (1): 10–19. doi:10.1093/bioinformatics/bth466. potential impact on nutrient output”. J. Dairy Sci. 73 PMID 15308540. (10): 2971–95. doi:10.3168/jds.S0022-0302(90)78986-2. PMID 2178174. [97] Renugopalakrishnan V, Garduno-Juarez R, Narasimhan G, Verma CS, Wei X, Li P.; Garduño-Juárez; Narasimhan; [86] Faergeman NJ, Knudsen J; Knudsen (1997). “Role of long- Verma; Wei; Li (2005). “Rational design of thermally stable chain fatty acyl-CoA esters in the regulation of metabolism proteins: relevance to bionanotechnology”. J Nanosci Nan- and in cell signalling”. Biochem. J. 323 (Pt 1): 1–12. PMC otechnol. 5 (11): 1759–1767. doi:10.1166/jnn.2005.441. 1218279. PMID 9173866. PMID 16433409.

[87] Doble B. W., Woodgett J. R.; Woodgett (2003). “GSK- [98] Hult K, Berglund P.; Berglund (2003). “Engineered en- 3: tricks of the trade for a multi-tasking kinase”. J. Cell. zymes for improved organic synthesis”. Current Opinion Sci. 116 (Pt 7): 1175–86. doi:10.1242/jcs.00384. PMC in Biotechnology 14 (4): 395–400. doi:10.1016/S0958- 3006448. PMID 12615961. 1669(03)00095-8. PMID 12943848.

[88] Carr C. M., Kim P. S.; Kim (2003). “A spring-loaded [99] Jiang L, Althoff EA, Clemente FR; Althoff; Clemente; mechanism for the conformational change of influenza Doyle; Röthlisberger; Zanghellini; Gallaher; Betker; hemagglutinin”. Cell 73 (4): 823–32. doi:10.1016/0092- Tanaka; Barbas Cf; Hilvert; Houk, KN; Stoddard, BL; 8674(93)90260-W. PMID 8500173. Baker, D (2008). “De novo computational design of retro-aldol enzymes”. Science 319 (5868): 1387–91. [89] Phenylketonuria: NCBI Genes and Disease. Retrieved 4 doi:10.1126/science.1152692. PMC 3431203. PMID April 2007. 18323453.

[90] “Pseudocholinesterase deficiency”. U.S. National Library of [100] Guzmán-Maldonado H, Paredes-López O; Paredes-López Medicine. Retrieved 5 September 2013. (1995). “Amylolytic enzymes and products derived from 48 CHAPTER 4. ENZYME

starch: a review”. Critical reviews in food science and nu- trition 35 (5): 373–403. doi:10.1080/10408399509527706. PMID 8573280.

[101] Dulieu C, Moll M, Boudrant J, Poncelet D; Moll; Boudrant; Poncelet (2000). “Improved performances and control of beer fermentation using encapsulated alpha-acetolactate de- carboxylase and modeling”. Biotechnology progress 16 (6): 958–65. doi:10.1021/bp000128k. PMID 11101321.

4.14 Further reading

4.15 External links Chapter 5

PH

For other uses, see PH (disambiguation). the measure of the hydronium ion concentration.[2]

5.1 History

The concept of p[H] was first introduced by Danish chemist Søren Peder Lauritz Sørensen at the Carlsberg Laboratory in 1909[3] and revised to the modern pH in 1924 to accom- modate definitions and measurements in terms of electro- chemical cells. In the first papers, the notation had the “H” as a subscript to the lowercase “p”, as so: pH. The exact meaning of the “p” in “pH” is disputed, but ac- cording to the Carlsberg Foundation pH stands for "power of hydrogen”.[4] It has also been suggested that the “p” stands for the German Potenz (meaning “power”), others re- fer to French puissance (also meaning “power”, based on the The sour taste of lemon juice is a result of it being composed of fact that the Carlsberg Laboratory was French-speaking). about 5% to 6% citric acid, an acid with a pH of roughly 2.2. Another suggestion is that the “p” stands for the Latin terms pondus hydrogenii, potentia hydrogenii, or potential hydro- In chemistry, pH (/piːeɪtʃ/ or /piːheɪtʃ/) is a measure of the gen. It is also suggested that Sørensen used the letters “p” acidity or basicity of an aqueous solution. Solutions with a and “q” (commonly paired letters in mathematics) simply to [5] pH less than 7 are said to be acidic and solutions with a pH label the test solution (p) and the reference solution (q). greater than 7 are basic or alkaline. Pure water has a pH Current usage in chemistry is that p stands for “decimal very close to 7. cologarithm of”, as also in the term pKₐ, used for acid dis- sociation constants.[6] The pH scale is traceable to a set of standard solutions whose pH is established by international agreement.[1] Primary pH standard values are determined using a concentration cell with transference, by measuring the po- 5.2 Definition and measurement tential difference between a hydrogen electrode and a stan- dard electrode such as the silver chloride electrode. Mea- 5.2.1 pH surement of pH for aqueous solutions can be done with a glass electrode and a pH meter, or using indicators. pH is defined as the decimal logarithm of the reciprocal of the hydrogen ion activity, aH+, in a solution.[1] pH measurements are important in medicine, biology, chemistry, agriculture, forestry, food science, environmental science, oceanography, civil engineer- ( ) 1 ing, chemical engineering, nutrition, water treatment & − pH = log10(aH+ ) = log10 water purification, and many other applications. aH+ Mathematically, pH is the negative logarithm of the activity This definition was adopted because ion-selective elec- of the (solvated) hydronium ion, more often expressed as trodes, which are used to measure pH, respond to activity.

49 50 CHAPTER 5. PH

Ideally, electrode potential, E, follows the Nernst equation, with respect to standard buffer values. Commercial stan- which, for the hydrogen ion can be written as dard buffer solutions usually come with information on the value at 25 °C and a correction factor to be applied for other temperatures. 0 RT 0 2.303RT E = E + ln(aH+ ) = E − pH The pH scale is logarithmic and therefore pH is a F F dimensionless quantity. where E is a measured potential, E0 is the standard elec- trode potential, R is the gas constant, T is the temperature in kelvin, F is the Faraday constant. For H+ number of elec- trons transferred is one. It follows that electrode potential 5.2.2 p[H] is proportional to pH when pH is defined in terms of ac- tivity. Precise measurement of pH is presented in Interna- [4] tional Standard ISO 31-8 as follows:[7] A galvanic cell is set This was the original definition of Sørensen, which was up to measure the electromotive force (e.m.f.) between a superseded in favor of pH in 1924. However, it is possi- reference electrode and an electrode sensitive to the hydro- ble to measure the concentration of hydrogen ions directly, gen ion activity when they are both immersed in the same if the electrode is calibrated in terms of hydrogen ion con- aqueous solution. The reference electrode may be a silver centrations. One way to do this, which has been used ex- chloride electrode or a calomel electrode. The hydrogen- tensively, is to titrate a solution of known concentration of a ion selective electrode is a standard hydrogen electrode. strong acid with a solution of known concentration of strong alkali in the presence of a relatively high concentration of background electrolyte. Since the concentrations of acid Reference electrode | concentrated solution of and alkali are known, it is easy to calculate the concentra- KCl || test solution | H2 | Pt tion of hydrogen ions so that the measured potential can be correlated with concentrations. The calibration is usu- Firstly, the cell is filled with a solution of known hydrogen ally carried out using a Gran plot.[8] The calibration yields ion activity and the emf, ES, is measured. Then the emf, a value for the standard electrode potential, E0, and a slope EX, of the same cell containing the solution of unknown factor, f, so that the Nernst equation in the form pH is measured.

E − E 2.303RT pH(X) = pH(S) + S X E = E0 + f log[H+] z F The difference between the two measured emf values is proportional to pH. This method of calibration avoids the can be used to derive hydrogen ion concentrations from ex- need to know the standard electrode potential. The pro- perimental measurements of E. The slope factor, f, is usu- portionality constant, 1/z is ideally equal to 1 the ally slightly less than one. A slope factor of less than 0.95 2.303RT /F indicates that the electrode is not functioning correctly. The “Nernstian slope”. presence of background electrolyte ensures that the hydro- To apply this process in practice, a glass electrode is used gen ion activity coefficient is effectively constant during the rather than the cumbersome hydrogen electrode. A com- . As it is constant, its value can be set to one by bined glass electrode has an in-built reference electrode. It defining the standard state as being the solution containing is calibrated against buffer solutions of known hydrogen ion the background electrolyte. Thus, the effect of using this activity. IUPAC has proposed the use of a set of buffer procedure is to make activity equal to the numerical value solutions of known H+ activity.[1] Two or more buffer so- of concentration. lutions are used in order to accommodate the fact that the “slope” may differ slightly from ideal. To implement this The glass electrode (and other ion selective electrodes) approach to calibration, the electrode is first immersed in a should be calibrated in a medium similar to the one being standard solution and the reading on a pH meter is adjusted investigated. For instance, if one wishes to measure the pH to be equal to the standard buffer’s value. The reading from of a seawater sample, the electrode should be calibrated in a second standard buffer solution is then adjusted, using the a solution resembling seawater in its chemical composition, “slope” control, to be equal to the pH for that solution. Fur- as detailed below. ther details, are given in the IUPAC recommendations.[1] The difference between p[H] and pH is quite small. It has When more than two buffer solutions are used the electrode been stated[9] that pH = p[H] + 0.04. It is common practice is calibrated by fitting observed pH values to a straight line to use the term “pH” for both types of measurement. 5.2. DEFINITION AND MEASUREMENT 51

5.2.3 pH indicators K Main article: pH indicator − W [OH ] = + Indicators may be used to measure pH, by making use of [H ] where KW is the self-ionisation constant of water. Taking logarithms

pOH = pKW − pH

So, at room temperature pOH ≈ 14 − pH. However this relationship is not strictly valid in other circumstances, such as in measurements of soil alkalinity.

5.2.5 Extremes of pH

Measurement of pH below about 2.5 (ca. 0.003 mol dm−3 acid) and above about 10.5 (ca. 0.0003 mol dm−3 al- kali) requires special procedures because, when using the glass electrode, the Nernst law breaks down under those Chart showing the variation of color of universal indicator paper conditions. Various factors contribute to this. It cannot with pH be assumed that liquid junction potentials are independent of pH.[10] Also, extreme pH implies that the solution is the fact that their color changes with pH. Visual compar- concentrated, so electrode potentials are affected by ionic ison of the color of a test solution with a standard color strength variation. At high pH the glass electrode may be chart provides a means to measure pH accurate to the near- affected by “alkaline error”, because the electrode becomes est whole number. More precise measurements are possi- sensitive to the concentration of cations such as Na+ and ble if the color is measured spectrophotometrically, using a K+ in the solution.[11] Specially constructed electrodes are colorimeter of spectrophotometer. Universal indicator con- available which partly overcome these problems. sists of a mixture of indicators such that there is a contin- Runoff from mines or mine tailings can produce some very uous color change from about pH 2 to pH 10. Universal low pH values.[12] indicator paper is made from absorbent paper that has been impregnated with universal indicator. 5.2.6 Non-aqueous solutions

5.2.4 pOH Hydrogen ion concentrations (activities) can be measured in non-aqueous solvents. pH values based on these measure-

pOH 14 13 12 11 10 9 8 7 6 5 4 3 2 1 0 ments belong to a different scale from aqueous pH values, because activities relate to different standard states. Hydro- gen ion activity, aH+, can be defined[13][14] as:

( ) pH 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 − ⊖ µH+ µH+ aH+ = exp Relation between p[OH] and p[H] (red = acid region, blue = basic RT region) where μH+ is the chemical potential of the hydrogen ion, pOH is sometimes used as a measure of the concentration of μoH₊ is its chemical potential in the chosen standard state, hydroxide ions, OH−, or alkalinity. pOH values are derived R is the gas constant and T is the thermodynamic tempera- from pH measurements. The concentration of hydroxide ture. Therefore pH values on the different scales cannot be ions in water is related to the concentration of hydrogen ions compared directly, requiring an intersolvent scale which in- by volves the transfer activity coefficient of hydrolyonium ion. 52 CHAPTER 5. PH pH is an example of an acidity function. Other acidity is dissolved in water, the pH will be less than that of pure functions can be defined. For example, the Hammett acid- water. When a base, or alkali, is dissolved in water, the ity function, H0, has been developed in connection with pH will be greater than that of pure water. A solution of superacids. a strong acid, such as hydrochloric acid, at concentration 1 mol dm−3 has a pH of 0. A solution of a strong alkali, such The concept of “Unified pH scale” has been developed on −3 the basis of the absolute chemical potential of the proton. as sodium hydroxide, at concentration 1 mol dm , has a This scale applies to liquids, gases and even solids.[15] pH of 14. Thus, measured pH values will lie mostly in the range 0 to 14, though negative pH values and values above 14 are entirely possible. Since pH is a logarithmic scale, a difference of one pH unit is equivalent to a tenfold differ- 5.3 Applications ence in hydrogen ion concentration. The pH of an aqueous solution of a salt such as sodium chloride is slightly differ- ent from that of pure water, even though the salt is neither acidic nor basic. This is because the hydrogen and hydrox- ide ions’ activity is dependent on ionic strength, so K varies with ionic strength. The pH of pure water decreases with increasing temper- atures. For example, the pH of pure water at 50 °C is 6.55. Note, however, that water that has been exposed to air is mildly acidic. This is because water absorbs carbon dioxide from the air, which is then slowly con- verted into bicarbonate and hydrogen ions (essentially cre- ating carbonic acid).

⇌ − + CO2 + H2O HCO3 + H

5.3.1 pH in nature

pH-dependent plant pigments that can be used as pH in- dicators occur in many plants, including hibiscus, red cab- bage (anthocyanin) and red wine. The juice of citrus fruits is acidic mainly because it contains citric acid. Other carboxylic acids occur in many living systems. For exam- ple, lactic acid is produced by muscle activity. The state of protonation of phosphate derivatives, such as ATP, is pH-dependent. The functioning of the oxygen-transport en- zyme hemoglobin is affected by pH in a process known as the Root effect.

5.3.2 Seawater

The pH of seawater plays an important role in the ocean’s carbon cycle, and there is evidence of ongoing ocean acid- ification caused by carbon dioxide emissions.[16] However, pH measurement is complicated by the chemical properties of seawater, and several distinct pH scales exist in chemical oceanography.[17] pH values of some common substances As part of its operational definition of the pH scale, the IUPAC defines a series of buffer solutions across a range Water has a pH of pK/2, so the pH of pure water is about 7 of pH values (often denoted with NBS or NIST designa- at 25 °C; this value varies with temperature. When an acid tion). These solutions have a relatively low ionic strength 5.4. CALCULATIONS OF PH 53

(~0.1) compared to that of seawater (~0.7), and, as a conse- In practical terms, the three seawater pH scales differ in quence, are not recommended for use in characterizing the their values by up to 0.12 pH units, differences that are pH of seawater, since the ionic strength differences cause much larger than the accuracy of pH measurements typ- changes in electrode potential. To resolve this problem, an ically required, in particular, in relation to the ocean’s alternative series of buffers based on artificial seawater was carbonate system.[17] Since it omits consideration of sul- developed.[18] This new series resolves the problem of ionic fate and fluoride ions, the free scale is significantly different strength differences between samples and the buffers, and from both the total and seawater scales. Because of the rela- the new pH scale is referred to as the total scale, often de- tive unimportance of the fluoride ion, the total and seawater noted as pHT. scales differ only very slightly. The total scale was defined using a medium containing sulfate ions. These ions experience protonation,H+ + 2− − 5.3.3 Living systems SO4 HSO4 , such that the total scale includes the effect of both protons (free hydrogen ions) and hydrogen sulfate ions:

+ + − The pH of different cellular compartments, body fluids, [H ]T = [H ]F + [HSO4 ] and organs is usually tightly regulated in a process called acid-base homeostasis. The most common disorder in acid- An alternative scale, the free scale, often denoted pHF, + base homeostasis is acidosis, which means an acid overload omits this consideration and focuses solely on [H ]F, in in the body, generally defined by pH falling below 7.35.* principle making it a simpler representation of hydrogen ion Alkalosis is the opposite condition, with blood pH being concentration. Only [H+]T can be determined,[19] therefore + 2− excessively high. [H ]F must be estimated using the [SO4 ] and the stability − * constant of HSO4 ,KS : The pH of blood is usually slightly basic with a value of pH 7.365. This value is often referred to as physiological pH in biology and medicine. Plaque can create a local acidic [H+]F = [H+]T − [HSO −] = [H+]T ( 1 + [SO 2−] 4 4 environment that can result in tooth decay by demineral- /KS* )−1 ization. Enzymes and other proteins have an optimum pH range and can become inactivated or denatured outside this However, it is difficult to estimate KS* in seawater, limiting range. the utility of the otherwise more straightforward free scale. Another scale, known as the seawater scale, often denoted pHSWS, takes account of a further protonation relationship 5.4 Calculations of pH between hydrogen ions and fluoride ions, H+ + F− ⇌ HF. Resulting in the following expression for [H+]SWS: The calculation of the pH of a solution containing acids and/or bases is an example of a chemical speciation calcu- + + − [H ]SWS = [H ]F + [HSO4 ] + [HF] lation, that is, a mathematical procedure for calculating the concentrations of all chemical species that are present in the However, the advantage of considering this additional com- solution. The complexity of the procedure depends on the plexity is dependent upon the abundance of fluoride in the nature of the solution. For strong acids and bases no calcu- medium. In seawater, for instance, sulfate ions occur at lations are necessary except in extreme situations. The pH much greater concentrations (> 400 times) than those of of a solution containing a weak acid requires the solution fluoride. As a consequence, for most practical purposes, of a quadratic equation. The pH of a solution containing the difference between the total and seawater scales is very a weak base may require the solution of a cubic equation. small. The general case requires the solution of a set of non-linear simultaneous equations. The following three equations summaries the three scales of pH: A complicating factor is that water itself is a weak acid and a weak base. It dissociates according to the equilibrium pHF = − log [H+]F + − + pHT = − log ( [H ]F + [HSO4 ] ) = − log [H ]T + − 2H2O ⇌ H3O (aq) + OH (aq) + − pHSWS = − log ( [H ]F + [HSO4 ] + [HF] ) = − log [H+]SWS with a dissociation constant,K defined as 54 CHAPTER 5. PH

and its value is assumed to have been determined by ex- periment. This being so, there are three unknown concen- + − Kw = [H ][OH ] trations, [HA], [H+] and [A-] to determine by calculation. Two additional equations are needed. One way to provide + where [H ] stands for the concentration of the aquated them is to apply the law of mass conservation in terms of - hydronium ion and [OH ] represents the concentration of the two “” H and A. the hydroxide ion.K has a value of about 10−14 at 25 °C, so pure water has a pH of about 7. This equilibrium needs to be taken into account at high pH and when the solute concentration is extremely low. CA = [A] + [HA]

5.4.1 Strong acids and bases CH = [H] + [HA]

Strong acids and bases are compounds that, for practical C stands for analytical concentration. In some texts one purposes, are completely dissociated in water. Under nor- mass balance equation is replaced by an equation of charge mal circumstances this means that the concentration of hy- balance. This is satisfactory for simple cases like this one, drogen ions in acidic solution can be taken to be equal to but is more difficult to apply to more complicated cases as the concentration of the acid. The pH is then equal to minus those below. Together with the equation defining Kₐ, there the logarithm of the concentration value. Hydrochloric acid are now three equations in three unknowns. When an acid (HCl) is an example of a strong acid. The pH of a 0.01M is dissolved in water CA = CH = Cₐ, the concentration of the acid, so [A] = [H]. After some further algebraic manip- solution of HCl is equal to −log10(0.01), that is, pH = 2. Sodium hydroxide, NaOH, is an example of a strong base. ulation an equation in the hydrogen ion concentration may The p[OH] value of a 0.01M solution of NaOH is equal to be obtained. −log10(0.01), that is, p[OH] = 2. From the definition of p[OH] above, this means that the pH is equal to about 12. 2 For solutions of sodium hydroxide at higher concentrations [H] + Ka[H] − KaCa = 0 the self-ionization equilibrium must be taken into account. Self-ionization must also be considered when concentra- Solution of this quadratic equation gives the hydrogen ion tions are extremely low. Consider, for example, a solution concentration and hence p[H] or, more loosely, pH. This of hydrochloric acid at a concentration of 5×10−8M. The procedure is illustrated in an ICE table which can also be simple procedure given above would suggest that it has a used to calculate the pH when some additional (strong) acid pH of 7.3. This is clearly wrong as an acid solution should or alkali has been added to the system, that is, when CA ≠ have a pH of less than 7. Treating the system as a mixture CH. of hydrochloric acid and the amphoteric substance water, a For example, what is the pH of a 0.01M solution of benzoic [21] pH of 6.89 results. acid, pKₐ = 4.19? −4.19 −5 Step 1: Ka = 10 = 6.46 × 10 5.4.2 Weak acids and bases Step 2: Set up the quadratic equation. [H]2 + 6.46 × 10−5[H] − 6.46 × 10−7 = 0 A weak acid or the conjugate acid of a weak base can be + × −4 treated using the same formalism. Step 3: Solve the quadratic equation. [H ] = 7.74 10 ; pH = 3.11 For alkaline solutions an additional term is added to the HA ⇌ H+ + A− mass-balance equation for hydrogen. Since addition of hy- droxide reduces the hydrogen ion concentration, and the HA+ ⇌ H+ + A hydroxide ion concentration is constrained by the self- ionization equilibrium to be equal to Kw First, an acid dissociation constant is defined as follows. [H+] Electrical charges are omitted from subsequent equations for the sake of generality [H] + [HA] − K C = w H [H] [H][A] K = a [HA] In this case the resulting equation in [H] is a cubic equation. 5.5. REFERENCES 55

5.4.3 General method [4] “Carlsberg Group Company History Page”. Carls- berggroup.com. Retrieved 7 May 2013. Some systems, such as with polyprotic acids, are amenable [5] Myers, Rollie J. (2010). “One-Hundred Years to spreadsheet calculations.[22] With three or more reagents of pH”. Journal of Chemical Education 87: 30. or when many complexes are formed with general formulae Bibcode:2010JChEd..87...30M. doi:10.1021/ed800002c. such as ABHᵣ the following general method can be used to calculate the pH of a solution. For example, with three [6] Nørby, Jens (2000). “The origin and the meaning of the little reagents, each equilibrium is characterized by and equilib- p in pH”. Trends in the Biochemical Sciences 25 (1): 36–37. rium constant, β. doi:10.1016/S0968-0004(99)01517-0. PMID 10637613. [7] Quantities and units – Part 8: and molec- ular physics, Annex C (normative): pH. International Orga- p q r [ApBqHr] = βpqr[A] [B] [H] nization for Standardization, 1992.

Next, write down the mass-balance equations for each [8] Rossotti, F.J.C.; Rossotti, H. (1965). “Potentiometric titra- tions using Gran plots: A textbook omission”. J. Chem. Ed. 42 (7): 375–378. Bibcode:1965JChEd..42..375R. doi:10.1021/ed042p375.

p q r CA = [A] + pβpqr[A] [B] [H] [9] Mendham, J.; Denney, R. C.; Barnes, J. D.; Thomas, M. J. K. (2000), Vogel’s Quantitative Chemical Analysis (6th ed.), p q r New York: Prentice Hall, ISBN 0-582-22628-7, Section CB = [B] + qβpqr[A] [B] [H] 13.23, “Determination of pH” p q r −1 CH = [H] + rβpqr[A] [B] [H] − Kw[H] [10] Feldman, Isaac (1956). “Use and Abuse of pH mea- Note that there are no approximations involved in these surements”. 28 (12): 1859. equations, except that each stability constant is defined as a doi:10.1021/ac60120a014. quotient of concentrations, not activities. Much more com- [11] Mendham, J.; Denney, R. C.; Barnes, J. D.; Thomas, M. J. plicated expressions are required if activities are to be used. K. (2000), Vogel’s Quantitative Chemical Analysis (6th ed.), There are 3 non-linear simultaneous equations in the three New York: Prentice Hall, ISBN 0-582-22628-7, Section unknowns, [A], [B] and [H]. Because the equations are non- 13.19 The glass electrode linear, and because concentrations may range over many [12] Nordstrom, D. Kirk; Alpers, Charles N. (March 1999). powers of 10, the solution of these equations is not straight- “Negative pH, efflorescent mineralogy, and consequences forward. However, many computer programs are available for environmental restoration at the Iron Mountain Su- which can be used to perform these calculations; for details perfund site, California”. Proceedings of the National see chemical equilibrium#Computer programs. There may Academy of Sciences of the United States of America be more than three reagents. The calculation of hydrogen (PNAS) 96 (7): 3455–62. Bibcode:1999PNAS...96.3455N. ion concentrations, using this formalism, is a key element doi:10.1073/pnas.96.7.3455. PMC 34288. PMID in the determination of equilibrium constants by potentio- 10097057. metric titration. [13] IUPAC, Compendium of Chemical Terminology, 2nd ed. (the “Gold Book”) (1997). Online corrected version: (2006–) "activity (relative activity), a". 5.5 References [14] International Union of Pure and Applied Chemistry (1993). Quantities, Units and Symbols in Physical Chemistry, 2nd edi- [1] Covington, A. K.; Bates, R. G.; Durst, R. A. (1985). tion, Oxford: Blackwell Science. ISBN 0-632-03583-8. pp. “Definitions of pH scales, standard reference values, mea- 49–50. Electronic version. surement of pH, and related terminology”. Pure Appl. Chem. 57 (3): 531–542. doi:10.1351/pac198557030531. [15] Himmel, D.; Goll, S. K.; Leito, I.; Krossing, I. “A Unified pH Scale for all Phases” Angew. Chem. Int. Ed. 2010, 49, [2] Bates, Roger G. Determination of pH: theory and practice. 6885–6888. doi:10.1002/anie.201000252 Wiley, 1973. [16] Royal Society (2005). Ocean acidification due to increasing [3] Sorensen, S. P. L., Enzymstudien. II, Über die Messung und atmospheric carbon dioxide. ISBN 0-85403-617-2. die Bedeutung der Wasserstoffionenkonzentration bei enzy- matischen Prozessen, Biochem. Zeitschr., 1909, vol. 21, pp. [17] Zeebe, R. E. and Wolf-Gladrow, D. (2001) CO2 in seawater: 131–304. Two other publications appeared in 1909 one in equilibrium, kinetics, isotopes, Elsevier Science B.V., Ams- French and one in Danisch terdam, Netherlands ISBN 0-444-50946-1 56 CHAPTER 5. PH

[18] Hansson, I. (1973). “A new set of pH-scales and standard buffers for seawater”. Deep Sea Research 20 (5): 479–491. doi:10.1016/0011-7471(73)90101-0.

[19] Dickson, A. G. (1984). “pH scales and proton- transfer reactions in saline media such as sea water”. Geochim. Cosmochim. Acta 48 (11): 2299–2308. Bibcode:1984GeCoA..48.2299D. doi:10.1016/0016- 7037(84)90225-4.

[20] Boron, Walter, F.; Boulpaep, E.L. (2004). Medical Phys- iology: A Cellular And Molecular Approaoch. Else- vier/Saunders. ISBN 1-4160-2328-3.

[21] Maloney, Chris. “pH calculation of a very small concentra- tion of a strong acid.”. Retrieved 13 March 2011.

[22] Billo, E.J. (2011). EXCEL for Chemists (3rd ed.). Wiley- VCH. ISBN 978-0-470-38123-6.

5.6 External links

• The pH Scale

• Chem1 Virtual Textbook, Acid-base Equilibria and Calculations

• Red Cabbage pH Indicator

• Food and Foodstuff – pH Values • Online pH Calculator for about 100 inorganic Acids, Bases, and Salts Chapter 6

Chemical reaction

tion is part of the reaction mechanism. Chemical reactions are described with chemical equations, which graphically present the starting materials, end products, and sometimes intermediate products and reaction conditions. Chemical reactions happen at a characteristic reaction rate at a given temperature and chemical concentration, and rapid reactions are often described as spontaneous, requir- ing no input of extra energy other than thermal energy. Non-spontaneous reactions run so slowly that they are con- sidered to require the input of some type of additional en- ergy (such as extra heat, light or electricity) in order to pro- ceed to completion (chemical equilibrium) at human time scales. Different chemical reactions are used in combinations dur- ing chemical synthesis in order to obtain a desired product. In biochemistry, a similar series of chemical reactions form metabolic pathways. These reactions are often catalyzed by protein enzymes. These enzymes increase the rates of biochemical reactions, so that metabolic syntheses and de- compositions impossible under ordinary conditions may be A thermite reaction using iron(III) oxide. The sparks flying out- performed at the temperatures and concentrations present wards are globules of molten iron trailing smoke in their wake. within a cell. The general concept of a chemical reaction has been ex- A chemical reaction is a process that leads to the transfor- tended to reactions between entities smaller than atoms, in- [1] mation of one set of chemical substances to another. Clas- cluding nuclear reactions, radioactive decays, and reactions sically, chemical reactions encompass changes that only in- between elementary particles as described by quantum field volve the positions of electrons in the forming and breaking theory. of chemical bonds between atoms, with no change to the nuclei (no change to the elements present), and can often be described by a chemical equation. is a sub-discipline of chemistry that involves the chemical 6.1 History reactions of unstable and radioactive elements where both electronic and nuclear changes may occur. Chemical reactions such as combustion in the fire, The substance (or substances) initially involved in a chem- fermentation and the reduction of ores to metals were ical reaction are called reactants or reagents. Chemical re- known since antiquity. Initial theories of transformation of actions are usually characterized by a chemical change, and materials were developed by Greek philosophers, such as they yield one or more products, which usually have proper- the Four-Element Theory of Empedocles stating that any ties different from the reactants. Reactions often consist of substance is composed of the four basic elements – fire, a sequence of individual sub-steps, the so-called elementary water, air and earth. In the Middle Ages, chemical trans- reactions, and the information on the precise course of ac- formations were studied by Alchemists. They attempted, in

57 58 CHAPTER 6. CHEMICAL REACTION

fire-like element called “phlogiston”, which was contained within combustible bodies and released during combustion. This proved to be false in 1785 by Antoine Lavoisier who found the correct explanation of the combustion as reaction with oxygen from the air.[5] Joseph Louis Gay-Lussac recognized in 1808 that gases al- ways react in a certain relationship with each other. Based on this idea and the atomic theory of John Dalton, Joseph Proust had developed the law of definite proportions, which later resulted in the concepts of stoichiometry and chemical equations.[6] Regarding the organic chemistry, it was long believed that compounds obtained from living organisms were too com- plex to be obtained synthetically. According to the concept of vitalism, organic matter was endowed with a “vital force” and distinguished from inorganic materials. This separation was ended however by the synthesis of urea from inorganic precursors by Friedrich Wöhler in 1828. Other chemists who brought major contributions to organic chemistry in- clude Alexander William Williamson with his synthesis of ethers and Christopher Kelk Ingold, who, among many dis- coveries, established the mechanisms of substitution reac- tions.

6.2 Equations Antoine Lavoisier developed the theory of combustion as a chemical reaction with oxygen

particular, to convert lead into gold, for which purpose they used reactions of lead and lead-copper alloys with sulfur.[2] The production of chemical substances that do not normally occur in nature has long been tried, such as the synthesis of sulfuric and nitric acids attributed to the controversial al- chemist Jābir ibn Hayyān. The process involved heating of sulfate and nitrate minerals such as copper sulfate, alum As seen from the equation CH and saltpeter. In the 17th century, Johann Rudolph Glauber 4 + 2 O produced hydrochloric acid and sodium sulfate by reacting 2 → CO sulfuric acid and sodium chloride. With the development of 2 + 2 H the lead chamber process in 1746 and the Leblanc process, 2O, a coefficient of 2 must be placed before the oxygen gas on the allowing large-scale production of sulfuric acid and sodium reactants side and before the water on the products side in order carbonate, respectively, chemical reactions became imple- for, as per the law of conservation of mass, the quantity of each mented into the industry. Further optimization of sulfuric element does not change during the reaction acid technology resulted in the contact process in 1880s,[3] and the Haber process was developed in 1909–1910 for Main article: Chemical equation ammonia synthesis.[4] From the 16th century, researchers including Jan Baptist Chemical equations are used to graphically illustrate chem- van Helmont, Robert Boyle and Isaac Newton tried to estab- ical reactions. They consist of chemical or structural for- lish theories of the experimentally observed chemical trans- mulas of the reactants on the left and those of the products formations. The phlogiston theory was proposed in 1667 on the right. They are separated by an arrow (→) which in- by Johann Joachim Becher. It postulated the existence of a dicates the direction and type of the reaction; the arrow is 6.4. CHEMICAL EQUILIBRIUM 59

read as the word “yields”.[7] The tip of the arrow points in the direction in which the reaction proceeds. A double ar- row () pointing in opposite directions is used for equilibrium reactions. Equations should be balanced according to the stoichiometry, the number of atoms of each species should be the same on both sides of the equation. This is achieved by scaling the number of involved molecules (A, B, C and D in a schematic example below) by the appropriate integers a, b, c and d.[8] Isomerization of azobenzene, induced by light (hν) or heat (Δ)

a A + b B −→ c C + d D In a typical dissociation reaction, a bond in a molecule splits (ruptures) resulting in two molecular fragments. The split- More elaborate reactions are represented by reaction ting can be homolytic or heterolytic. In the first case, the schemes, which in addition to starting materials and prod- bond is divided so that each product retains an electron and ucts show important intermediates or transition states. becomes a neutral radical. In the second case, both elec- Also, some relatively minor additions to the reaction can be trons of the remain with one of the products, indicated above the reaction arrow; examples of such addi- resulting in charged ions. Dissociation plays an important tions are water, heat, illumination, a catalyst, etc. Similarly, role in triggering chain reactions, such as hydrogen–oxygen some minor products can be placed below the arrow, often or polymerization reactions. with a minus sign. AB −→ A + B Dissociation of a molecule AB into fragments A and B An example of organic reaction: oxidation of ketones to esters with a peroxycarboxylic acid For bimolecular reactions, two molecules collide and react with each other. Their merger is called chemical synthesis can be applied to design a complex or an addition reaction. synthesis reaction. Here the analysis starts from the prod- ucts, for example by splitting selected chemical bonds, to arrive at plausible initial reagents. A special arrow (⇒) is −→ used in retro reactions.[9] A + B AB Another possibility is that only a portion of one molecule is transferred to the other molecule. This type of reac- 6.3 Elementary reactions tion occurs, for example, in redox and acid-base reactions. In redox reactions, the transferred particle is an electron, The elementary reaction is the smallest division into which whereas in acid-base reactions it is a proton. This type of a chemical reaction can be decomposed to, it has no inter- reaction is also called metathesis. mediate products.[10] Most experimentally observed reac- tions are built up from many elementary reactions that oc- cur in parallel or sequentially. The actual sequence of the HA + B −→ A + HB individual elementary reactions is known as reaction mech- anism. An elementary reaction involves a few molecules, for example usually one or two, because of the low probability for sev- eral molecules to meet at a certain time.[11] The most important elementary reactions are unimolecular NaCl(aq) + AgNO3(aq) −→ NaNO3(aq) + AgCl(s) and bimolecular reactions. Only one molecule is involved in a unimolecular reaction; it is transformed by an isomer- ization or a dissociation into one or more other molecules. Such reactions require the addition of energy in the form 6.4 Chemical equilibrium of heat or light. A typical example of a unimolecular reac- tion is the cis–trans isomerization, in which the cis-form of Main article: Chemical equilibrium a compound converts to the trans-form or vice versa.[12] 60 CHAPTER 6. CHEMICAL REACTION

Most chemical reactions are reversible, that is they can and This reaction to form carbon dioxide and molybdenum is do run in both directions. The forward and reverse reac- endothermic at low temperatures, becoming less so with in- tions are competing with each other and differ in reaction creasing temperature.[15] ΔH° is zero at 1,855 K, and the rates. These rates depend on the concentration and there- reaction becomes exothermic above that temperature. fore change with time of the reaction: the reverse rate grad- Changes in temperature can also reverse the direction ten- ually increases and becomes equal to the rate of the forward dency of a reaction. For example, the water gas shift reac- reaction, establishing the so-called chemical equilibrium. tion The time to reach equilibrium depends on such parameters as temperature, pressure and the materials involved, and is determined by the minimum free energy. In equilibrium, CO + H O ⇌ CO + H the Gibbs free energy must be zero. The pressure depen- (g) 2 (v) 2(g) 2(g) dence can be explained with the Le Chatelier’s principle. is favored by low temperatures, but its reverse is favored by For example, an increase in pressure due to decreasing vol- high temperature. The shift in reaction direction tendency ume causes the reaction to shift to the side with the fewer occurs at 1,100 K.[15] [13] moles of gas. Reactions can also be characterized by the internal energy The reaction yield stabilizes at equilibrium, but can be in- which takes into account changes in the entropy, volume creased by removing the product from the reaction mixture and chemical potential. The latter depends, among other or changed by increasing the temperature or pressure. A things, on the activities of the involved substances.[16] change in the concentrations of the reactants does not af- fect the equilibrium constant, but does affect the equilib- dU = T dS − p dV + µ dn rium position. U: internal energy, S: entropy, p: pressure, μ: chemi- cal potential, n: number of molecules, d: small change sign 6.5 Thermodynamics

Chemical reactions are determined by the laws of 6.6 Kinetics thermodynamics. Reactions can proceed by themselves if they are exergonic, that is if they release energy. The asso- The speed at which a reactions takes place is studied by ciated free energy of the reaction is composed of two dif- reaction kinetics. The rate depends on various parameters, [14] ferent thermodynamic quantities, enthalpy and entropy: such as:

G = H − T · S. • Reactant concentrations, which usually make the reac- G: free energy, H: enthalpy, T: temperature, S: en- tion happen at a faster rate if raised through increased tropy, Δ: difference(change between original and collisions per unit time. Some reactions, however, product) have rates that are independent of reactant concentra- tions. These are called zero order reactions. Reactions can be exothermic, where ΔH is negative and en- • Surface area available for contact between the reac- ergy is released. Typical examples of exothermic reactions tants, in particular solid ones in heterogeneous sys- are precipitation and crystallization, in which ordered solids tems. Larger surface areas lead to higher reaction are formed from disordered gaseous or liquid phases. In rates. contrast, in endothermic reactions, heat is consumed from the environment. This can occur by increasing the entropy • Pressure – increasing the pressure decreases the vol- of the system, often through the formation of gaseous reac- ume between molecules and therefore increases the tion products, which have high entropy. Since the entropy frequency of collisions between the molecules. increases with temperature, many endothermic reactions • Activation energy, which is defined as the amount of preferably take place at high temperatures. On the contrary, energy required to make the reaction start and carry on many exothermic reactions such as crystallization occur at spontaneously. Higher activation energy implies that low temperatures. Changes in temperature can sometimes the reactants need more energy to start than a reaction reverse the sign of the enthalpy of a reaction, as for the with a lower activation energy. carbon monoxide reduction of molybdenum dioxide: • Temperature, which hastens reactions if raised, since higher temperature increases the energy of the o 2CO(g)+MoO2(s) −→ 2CO2(g)+Mo(s); H = +21.86 kJ at 298molecules, K creating more collisions per unit time, 6.7. REACTION TYPES 61

• The presence or absence of a catalyst. Catalysts are substances which change the pathway (mechanism) of A + B A B a reaction which in turn increases the speed of a reac- tion by lowering the activation energy needed for the A B A + B reaction to take place. A catalyst is not destroyed or changed during a reaction, so it can be used again. A B + C A C + B • For some reactions, the presence of electromagnetic A B + C D A C + B D radiation, most notably ultraviolet light, is needed to promote the breaking of bonds to start the reac- tion. This is particularly true for reactions involving Representation of four basic chemical reactions types: synthesis, radicals. decomposition, single replacement and double replacement. Several theories allow calculating the reaction rates at the molecular level. This field is referred to as reaction dynam- In a synthesis reaction, two or more simple substances com- ics. The rate v of a first-order reaction, which could be dis- bine to form a more complex substance. These reactions are integration of a substance A, is given by: in the general form:

d[A] v = − = k · [A]. A + B −→ AB dt Its integration yields: Two or more reactants yielding one product is another way to identify a synthesis reaction. One example of a synthe- sis reaction is the combination of iron and sulfur to form · −k·t iron(II) sulfide: [A](t) = [A]0 e . Here k is first-order rate constant having dimension 1/time, [A](t) is concentration at a time t and [A]0 is the initial 8F e + S8 −→ 8F eS concentration. The rate of a first-order reaction depends only on the concentration and the properties of the involved Another example is simple hydrogen gas combined with substance, and the reaction itself can be described with simple oxygen gas to produce a more complex substance, the characteristic half-life. More than one time constant such as water.[18] is needed when describing reactions of higher order. The temperature dependence of the rate constant usually follows Decomposition the Arrhenius equation: Main article: Decomposition reaction

−Ea/kB T k = k0e A decomposition reaction is the opposite of a synthesis re- where Eₐ is the activation energy and kB is the Boltzmann action, where a more complex substance breaks down into constant. One of the simplest models of reaction rate is its more simple parts. These reactions are in the general the collision theory. More realistic models are tailored to form:[18][19] a specific problem and include the transition state theory, the calculation of the potential energy surface, the Marcus theory and the Rice–Ramsperger–Kassel–Marcus (RRKM) AB −→ A + B theory.[17] One example of a decomposition reaction is the electrolysis of water to make oxygen and hydrogen gas: 6.7 Reaction types

2H O −→ 2H + O 6.7.1 Four basic types 2 2 2

Synthesis Single replacement

Main article: Synthesis reaction In a single replacement reaction, a single uncombined el- ement replaces another in a compound; in other words, 62 CHAPTER 6. CHEMICAL REACTION

one element trades places with another element in a compound[18] These reactions come in the general form of:

A + BC −→ AC + B

One example of a single displacement reaction is when magnesium replaces hydrogen in water to make magnesium hydroxide and hydrogen gas:

Mg + 2H2O −→ Mg(OH)2 + H2

Sodium chloride is formed through the redox reaction of sodium Double replacement metal and chlorine gas

In a double replacement reaction, the anions and cations of two compounds switch places and form two entirely dif- Oxidation is better defined as an increase in oxidation state, ferent compounds.[18] These reactions are in the general and reduction as a decrease in oxidation state. In practice, form:[19] the transfer of electrons will always change the oxidation state, but there are many reactions that are classed as “re- dox” even though no electron transfer occurs (such as those [20][21] AB + CD −→ AD + CB involving covalent bonds). In the following redox reaction, hazardous sodium metal For example, when barium chloride (BaCl2) and reacts with toxic chlorine gas to form the ionic compound 2- magnesium sulfate (MgSO4) react, the SO4 anion sodium chloride, or common table salt: switches places with the 2Cl- anion, giving the compounds BaSO4 and MgCl2.

Another example of a double displacement reaction is the 2Na(s) + Cl2(g) −→ 2NaCl(s) reaction of lead(II) nitrate with potassium iodide to form lead(II) iodide and potassium nitrate: In the reaction, sodium metal goes from an oxidation state of 0 (as it is a pure element) to +1: in other words, the sodium lost one electron and is said to have been oxidized. On the other hand, the chlorine gas goes from an oxidation P b(NO3)2 + 2KI −→ P bI2 + 2KNO3 of 0 (it is also a pure element) to −1: the chlorine gains one electron and is said to have been reduced. Because the 6.7.2 Oxidation and reduction chlorine is the one reduced, it is considered the electron ac- ceptor, or in other words, induces oxidation in the sodium - thus the chlorine gas is considered the oxidizing agent. Conversely, the sodium is oxidized or is the electron donor, and thus induces reduction in the other species and is con- sidered the reducing agent. Which of the involved reactants would be reducing or oxi- dizing agent can be predicted from the electronegativity of their elements. Elements with low electronegativity, such as most metals, easily donate electrons and oxidize – they are reducing agents. On the contrary, many ions with high Illustration of a redox reaction oxidation numbers, such as H 2O Redox reactions can be understood in terms of transfer of 2, MnO− electrons from one involved species (reducing agent) to an- 4, CrO other (oxidizing agent). In this process, the former species 3, Cr is oxidized and the latter is reduced. Though sufficient for 2O2− many purposes, these descriptions are not precisely correct. 7, OsO 6.7. REACTION TYPES 63

4 can gain one or two extra electrons and are strong oxidiz- plex can be predicted with the crystal field theory and ligand ing agents. field theory. Complexation reactions also include ligand ex- The number of electrons donated or accepted in a redox change, in which one or more ligands are replaced by an- other, and redox processes which change the oxidation state reaction can be predicted from the electron configuration [24] of the reactant element. Elements try to reach the low- of the central metal atom. energy noble gas configuration, and therefore alkali metals and halogens will donate and accept one electron respec- 6.7.4 Acid-base reactions tively. Noble gases themselves are chemically inactive.[22] An important class of redox reactions are the In the Brønsted–Lowry acid–base theory, an acid-base re- electrochemical reactions, where electrons from the action involves a transfer of protons (H+) from one species power supply are used as the reducing agent. These (the acid) to another (the base). When a proton is removed reactions are particularly important for the production of from an acid, the resulting species is termed that acid’s chemical elements, such as chlorine[23] or aluminium. The conjugate base. When the proton is accepted by a base, the reverse process in which electrons are released in redox resulting species is termed that base’s conjugate acid.[25] In reactions and can be used as electrical energy is possible other words, acids act as proton donors and bases act as pro- and used in batteries. ton acceptors according to the following equation:

HA + B ⇌ A− + HB+ 6.7.3 Complexation HA: acid, B: Base, A−: conjugated base, HB+: conju- gated acid

The reverse reaction is possible, and thus the acid/base and conjugated base/acid are always in equilibrium. The equi- librium is determined by the acid and base dissociation con- stants (Kₐ and K) of the involved substances. A special case of the acid-base reaction is the neutralization where an acid and a base, taken at exactly same amounts, form a neutral salt. Acid-base reactions can have different definitions depend- ing on the acid-base concept employed. Some of the most common are:

• Arrhenius definition: Acids dissociate in water releas- + – ing H3O ions; bases dissociate in water releasing OH ions. • Brønsted-Lowry definition: Acids are proton (H+) donors, bases are proton acceptors; this includes the Arrhenius definition. • Lewis definition: Acids are electron-pair accep- Ferrocene – an iron atom sandwiched between two C5H5 ligands tors, bases are electron-pair donors; this includes the Brønsted-Lowry definition. In complexation reactions, several ligands react with a metal atom to form a . This is achieved by providing lone pairs of the ligand into empty orbitals of 6.7.5 Precipitation the metal atom and forming dipolar bonds. The ligands are Lewis bases, they can be both ions and neutral molecules, Precipitation is the formation of a solid in a solution or in- such as carbon monoxide, ammonia or water. The num- side another solid during a chemical reaction. It usually ber of ligands that react with a central metal atom can be takes place when the concentration of dissolved ions ex- found using the 18-electron rule, saying that the valence ceeds the solubility limit[26] and forms an insoluble salt. shells of a transition metal will collectively accommodate This process can be assisted by adding a precipitating agent 18 electrons, whereas the symmetry of the resulting com- or by removal of the solvent. Rapid precipitation results in 64 CHAPTER 6. CHEMICAL REACTION

Solution Supernate

In this Paterno–Büchi reaction, a photoexcited carbonyl group is added to an unexcited olefin, yielding an oxetane.

Many important processes involve . The premier example is photosynthesis, in which most plants use solar energy to convert carbon dioxide and water into glucose, disposing of oxygen as a side-product. Hu- mans rely on photochemistry for the formation of vita- min D, and vision is initiated by a photochemical reaction Suspension Precipitate of rhodopsin.[12] In fireflies, an enzyme in the abdomen catalyzes a reaction that results in bioluminescence.[32] Many significant photochemical reactions, such as ozone Precipitation formation, occur in the Earth atmosphere and constitute . an amorphous or microcrystalline residue and slow process can yield single crystals. The latter can also be obtained by recrystallization from microcrystalline salts.[27] 6.8 Catalysis

6.7.6 Solid-state reactions Further information: Reaction Progress Kinetic Analysis In catalysis, the reaction does not proceed directly, but

Reactions can take place between two solids. However, be- Reaction without catalyst cause of the relatively small diffusion rates in solids, the cor- responding chemical reactions are very slow in comparison Reaction with catalyst to liquid and gas phase reactions. They are accelerated by increasing the reaction temperature and finely dividing the reactant to increase the contacting surface area.[28] Ea (Y→X) Ea (X→Y)

6.7.7 Reactions at the solid|gas interface Y Energy Reaction can take place at the solid|gas interface, surfaces at ∆H very low pressure such as ultra-high vacuum. Via scanning X tunneling microscopy, it is possible to observe reactions at the solid|gas interface in real space, if the time scale of [29][30] the reaction is in the correct range. Reactions at the Reaction path solid|gas interface are in some cases related to catalysis. Schematic potential energy diagram showing the effect of a catalyst in an endothermic chemical reaction. The presence of a catalyst 6.7.8 Photochemical reactions opens a different reaction pathway (in red) with a lower activation energy. The final result and the overall thermodynamics are the In photochemical reactions, atoms and molecules absorb same. energy (photons) of the illumination light and convert into an excited state. They can then release this energy by through a third substance known as catalyst. Unlike other breaking chemical bonds, thereby producing radicals. Pho- reagents that participate in the chemical reaction, a cat- tochemical reactions include hydrogen–oxygen reactions, alyst is not consumed by the reaction itself; however, it radical polymerization, chain reactions and rearrangement can be inhibited, deactivated or destroyed by secondary reactions.[31] processes. Catalysts can be used in a different phase 6.9. REACTIONS IN ORGANIC CHEMISTRY 65

6.9.1 Substitution

In a substitution reaction, a functional group in a particular is replaced by another group.[36] These reactions can be distinguished by the type of substituting species into a nucleophilic, electrophilic or radical substitu- tion.

Solid heterogeneous catalysts are plated on meshes in ceramic catalytic converters in order to maximize their surface area. This exhaust converter is from a Peugeot 106 S2 1100

(heterogeneous) or in the same phase (homogeneous) as SN1 mechanism the reactants. In heterogeneous catalysis, typical secondary processes include coking where the catalyst becomes cov- ered by polymeric side products. Additionally, heteroge- neous catalysts can dissolve into the solution in a solid– liquid system or evaporate in a solid–gas system. Catalysts SN2 mechanism can only speed up the reaction – chemicals that slow down the reaction are called inhibitors.[33][34] Substances that in- In the first type, a nucleophile, an atom or molecule with crease the activity of catalysts are called promoters, and an excess of electrons and thus a negative charge or partial substances that deactivate catalysts are called catalytic poi- charge, replaces another atom or part of the “substrate” sons. With a catalyst, a reaction which is kinetically inhib- molecule. The electron pair from the nucleophile attacks ited by a high activation energy can take place in circum- the substrate forming a new bond, while the leaving group vention of this activation energy. departs with an electron pair. The nucleophile may be Heterogeneous catalysts are usually solids, powdered in or- electrically neutral or negatively charged, whereas the sub- der to maximize their surface area. Of particular impor- strate is typically neutral or positively charged. Examples tance in heterogeneous catalysis are the platinum group of nucleophiles are hydroxide ion, alkoxides, amines and metals and other transition metals, which are used in halides. This type of reaction is found mainly in aliphatic hydrogenations, catalytic reforming and in the synthesis of hydrocarbons, and rarely in aromatic hydrocarbon. The lat- commodity chemicals such as nitric acid and ammonia. ter have high electron density and enter nucleophilic aro- Acids are an example of a homogeneous catalyst, they in- matic substitution only with very strong electron withdraw- crease the nucleophilicity of carbonyls, allowing a reaction ing groups. Nucleophilic substitution can take place by two that would not otherwise proceed with electrophiles. The different mechanisms, SN1 and SN2. In their names, S advantage of homogeneous catalysts is the ease of mixing stands for substitution, N for nucleophilic, and the number them with the reactants, but they may also be difficult to represents the kinetic order of the reaction, unimolecular [37] separate from the products. Therefore, heterogeneous cat- or bimolecular. alysts are preferred in many industrial processes.[35]

6.9 Reactions in organic chemistry

In organic chemistry, in addition to oxidation, reduction or acid-base reactions, a number of other reactions can take place which involve covalent bonds between carbon atoms or carbon and heteroatoms (such as oxygen, nitrogen, halogens, etc.). Many specific reactions in organic chem- istry are name reactions designated after their discoverers. 66 CHAPTER 6. CHEMICAL REACTION

The three steps of an SN2 reaction. The nucleophile is X· + R−H −→ X−H + R· green and the leaving group is red R· + X2 −→ R−X + X· Reactions during the chain reaction of radical substi- tution

SN2 reaction causes stereo inversion (Walden inversion) 6.9.2 Addition and elimination

The SN1 reaction proceeds in two steps. First, the leaving The addition and its counterpart, the elimination, are reac- group is eliminated creating a carbocation. This is followed tions which change the number of substitutents on the car- by a rapid reaction with the nucleophile.[38] bon atom, and form or cleave multiple bonds. Double and In the SN2 mechanism, the nucleophile forms a transition triple bonds can be produced by eliminating a suitable leav- state with the attacked molecule, and only then the leav- ing group. Similar to the nucleophilic substitution, there are ing group is cleaved. These two mechanisms differ in the several possible reaction mechanisms which are named af- stereochemistry of the products. SN1 leads to the non- ter the respective reaction order. In the E1 mechanism, the stereospecific addition and does not result in a chiral center, leaving group is ejected first, forming a carbocation. The but rather in a set of geometric isomers (cis/trans). In con- next step, formation of the double bond, takes place with trast, a reversal (Walden inversion) of the previously exist- elimination of a proton (deprotonation). The leaving or- ing stereochemistry is observed in the SN2 mechanism.[39] der is reversed in the E1cb mechanism, that is the proton is split off first. This mechanism requires participation of a Electrophilic substitution is the counterpart of the nucle- base.[42] Because of the similar conditions, both reactions ophilic substitution in that the attacking atom or molecule, in the E1 or E1cb elimination always compete with the SN1 an electrophile, has low electron density and thus a pos- substitution.[43] itive charge. Typical electrophiles are the carbon atom of carbonyl groups, carbocations or sulfur or nitronium cations. This reaction takes place almost exclusively in aro- matic hydrocarbons, where it is called electrophilic aro- matic substitution. The electrophile attack results in the so- called σ-complex, a transition state in which the aromatic system is abolished. Then, the leaving group, usually a pro- ton, is split off and the aromaticity is restored. An alterna- tive to aromatic substitution is electrophilic aliphatic substi- tution. It is similar to the nucleophilic aliphatic substitution and also has two major types, SE1 and SE2[40] E2 elimination

The E2 mechanism also requires a base, but there the at- tack of the base and the elimination of the leaving group proceed simultaneously and produce no ionic intermediate. In contrast to the E1 eliminations, different stereochemi- cal configurations are possible for the reaction product in the E2 mechanism, because the attack of the base prefer- entially occurs in the anti-position with respect to the leav- ing group. Because of the similar conditions and reagents, the E2 elimination is always in competition with the SN2- [44] Mechanism of electrophilic aromatic substitution substitution.

In the third type of substitution reaction, radical substi- tution, the attacking particle is a radical.[36] This process usually takes the form of a chain reaction, for example in the reaction of with halogens. In the first step, Electrophilic addition of hydrogen bromide light or heat disintegrates the halogen-containing molecules producing the radicals. Then the reaction proceeds as an The counterpart of elimination is the addition where dou- avalanche until two radicals meet and recombine.[41] ble or triple bonds are converted into single bonds. Simi- 6.9. REACTIONS IN ORGANIC CHEMISTRY 67

lar to the substitution reactions, there are several types of dition proceeds as a chain reaction, and such reactions are additions distinguished by the type of the attacking parti- the basis of the free-radical polymerization.[52] cle. For example, in the electrophilic addition of hydrogen bromide, an electrophile (proton) attacks the double bond forming a carbocation, which then reacts with the nucle- 6.9.3 Other organic reaction mechanisms ophile (bromine). The carbocation can be formed on ei- ther side of the double bond depending on the groups at- tached to its ends, and the preferred configuration can be predicted with the Markovnikov’s rule.[45] This rule states that “In the heterolytic addition of a polar molecule to an alkene or , the more electronegative (nucleophilic) atom (or part) of the polar molecule becomes attached to The Cope rearrangement of 3-methyl-1,5-hexadiene the carbon atom bearing the smaller number of hydrogen atoms.”[46] If the addition of a functional group takes place at the less substituted carbon atom of the double bond, then the elec- + trophilic substitution with acids is not possible. In this case, one has to use the hydroboration–oxidation reaction, where in the first step, the boron atom acts as electrophile and adds Mechanism of a Diels-Alder reaction to the less substituted carbon atom. At the second step, the nucleophilic hydroperoxide or halogen anion attacks the boron atom.[47] While the addition to the electron-rich and is mainly electrophilic, the nucleophilic addition plays an important role for the carbon-heteroatom multiple bonds, and especially its most important representative, the car- bonyl group. This process is often associated with an elim- ination, so that after the reaction the carbonyl group is present again. It is therefore called addition-elimination re- Orbital overlap in a Diels-Alder reaction action and may occur in carboxylic acid derivatives such as chlorides, esters or anhydrides. This reaction is often catalyzed by acids or bases, where the acids increase by the In a rearrangement reaction, the carbon skeleton of a electrophilicity of the carbonyl group by binding to the oxy- molecule is rearranged to give a structural isomer of the gen atom, whereas the bases enhance the nucleophilicity of original molecule. These include hydride shift reactions the attacking nucleophile.[48] such as the Wagner-Meerwein rearrangement, where a hydrogen, alkyl or aryl group migrates from one carbon to a neighboring carbon. Most rearrangements are associ- ated with the breaking and formation of new carbon-carbon bonds. Other examples are sigmatropic reaction such as the Cope rearrangement.[53] Cyclic rearrangements include cycloadditions and, more generally, pericyclic reactions, wherein two or more dou- Acid-catalyzed addition-elimination mechanism ble bond-containing molecules form a cyclic molecule. An important example of cycloaddition reaction is the Diels– Nucleophilic addition of a carbanion or another nucleophile Alder reaction (the so-called [4+2] cycloaddition) between to the double bond of an alpha, beta unsaturated carbonyl a conjugated diene and a substituted alkene to form a sub- compound can proceed via the Michael reaction, which be- stituted cyclohexene system.[54] longs to the larger class of conjugate additions. This is one Whether or not a certain cycloaddition would proceed de- of the most useful methods for the mild formation of C–C [49][50][51] pends on the electronic orbitals of the participating species, bonds. as only orbitals with the same sign of wave function will Some additions which can not be executed with nucle- overlap and interact constructively to form new bonds. Cy- ophiles and electrophiles, can be succeeded with free rad- cloaddition is usually assisted by light or heat. These per- icals. As with the free-radical substitution, the radical ad- turbations result in different arrangement of electrons in the 68 CHAPTER 6. CHEMICAL REACTION

excited state of the involved molecules and therefore in dif- ferent effects. For example, the [4+2] Diels-Alder reac- tions can be assisted by heat whereas the [2+2] cycloaddi- tion is selectively induced by light.[55] Because of the or- bital character, the potential for developing stereoisomeric products upon cycloaddition is limited, as described by the Woodward–Hoffmann rules.[56]

6.10 Biochemical reactions

Enzyme changes shape Products Substrate slightly as substrate binds Active site

Thermite reaction proceeding in railway welding. Shortly after this, the liquid iron flows into the mould around the rail gap

Substrate entering Enzyme/substrate Enzyme/products Products leaving active site of enzyme complex complex active site of enzyme sible, maximizing the yield and minimizing the amount of reagents, energy inputs and waste. Catalysts are especially Illustration of the induced fit model of enzyme activity helpful for reducing the energy required for the reaction and increasing its reaction rate.[59][60] Biochemical reactions are mainly controlled by enzymes. Some specific reactions have their niche applications. For These proteins can specifically catalyze a single reaction, example, the thermite reaction is used to generate light and so that reactions can be controlled very precisely. The re- heat in pyrotechnics and welding. Although it is less con- action takes place in the active site, a small part of the en- trollable than the more conventional oxy-fuel welding, arc zyme which is usually found in a cleft or pocket lined by welding and flash welding, it requires much less equipment amino acid residues, and the rest of the enzyme is used and is still used to mend rails, especially in remote areas.[61] mainly for stabilization. The catalytic action of enzymes re- lies on several mechanisms including the molecular shape (“induced fit”), bond strain, proximity and orientation of molecules relative to the enzyme, proton donation or with- 6.12 Monitoring drawal (acid/base catalysis), electrostatic interactions and many others.[57] Mechanisms of monitoring chemical reactions depend strongly on the reaction rate. Relatively slow processes The biochemical reactions that occur in living organisms can be analyzed in situ for the concentrations and identi- are collectively known as metabolism. Among the most ties of the individual ingredients. Important tools of real important of its mechanisms is the , in which time analysis are the measurement of pH and analysis of different DNA and enzyme-controlled processes result in optical absorption (color) and emission spectra. A less ac- the production of large molecules such as proteins and [58] cessible but rather efficient method is introduction of a ra- carbohydrates from smaller units. Bioenergetics studies dioactive isotope into the reaction and monitoring how it the sources of energy for such reactions. An important en- changes over time and where it moves to; this method is of- ergy source is glucose, which can be produced by plants ten used to analyze redistribution of substances in the hu- via photosynthesis or assimilated from food. All organisms man body. Faster reactions are usually studied with ultrafast use this energy to produce adenosine triphosphate (ATP), laser spectroscopy where utilization of femtosecond lasers which can then be used to energize other reactions. allows short-lived transition states to be monitored at time scaled down to a few femtoseconds.[62] 6.11 Applications 6.13 See also Chemical reactions are central to chemical engineering where they are used for the synthesis of new compounds • Chemist from natural raw materials such as petroleum and mineral ores. It is essential to make the reaction as efficient as pos- • Chemistry 6.14. REFERENCES 69

• List of organic reactions [16] Atkins, p. 150

• Organic reaction [17] Atkins, p. 963

• Reaction progress kinetic analysis [18] To react or not to react?. Utah State Office of Education. Retrieved 4 June 2011. • Combustion [19] Six Types of Chemical Reactions – MrGuch ChemFiesta. • Mass balance [20] Jenny P. Glusker (1991). “Structural Aspects of Metal Lig- anding to Functional Groups in Proteins”. In Christian B. Anfinsen. Advances in Protein Chemistry 42. San Diego: 6.14 References Academic Press. p. 7. ISBN 0-12-034242-1. [21] Liang-Hong Guo; H. Allen; O. Hill (1991). “Direct Elec- [1] IUPAC, Compendium of Chemical Terminology, 2nd ed. trochemistry of Proteins and Enzymes”. In A. G. Sykes. (the “Gold Book”) (1997). Online corrected version: Advances in 36. San Diego: Academic (2006–) "chemical reaction". Press. p. 359. ISBN 0-12-023636-2.

[2] Jost Weyer (1973). “Neuere Interpretationsmöglichkeiten [22] Wiberg, pp. 289–290 der Alchemie”. Chemie in unserer Zeit (in German) 7 (6): 177. doi:10.1002/ciuz.19730070604. [23] Wiberg, p. 409

[3] Leonard J. Friedman; Samantha J. Friedman (2008). [24] Wiberg, pp. 1180–1205 “American Institute of Chemical Engineers Clearwater [25] IUPAC, Compendium of Chemical Terminology, 2nd ed. Convention”. Boca Raton, Florida: Acid Engineering & (the “Gold Book”) (1997). Online corrected version: Consulting, Inc. |chapter= ignored (help) (2006–) "conjugate acid–base pair".

[4] Anthony N. Stranges (2000). “Germany’s synthetic fuel in- [26] IUPAC, Compendium of Chemical Terminology, 2nd ed. dustry, 1935–1940”. In John E. Lesch. The German Chem- (the “Gold Book”) (1997). Online corrected version: ical Industry in the Twentieth Century. Kluwer Academic (2006–) "precipitation". Publishers. p. 170. ISBN 0-7923-6487-2. [27] Jörg Wingender; Stefanie Ortanderl (July 2009). “Ausfäl- [5] Brock, pp. 34–55 lung”. Römpp Chemie-Lexikon. Thieme.

[6] Brock, pp. 104–107 [28] H. Jürgen Meyer (2007). “Festkörperchemie”. In Erwin Riedel. Modern Inorganic Chemistry (in German) (3rd ed.). [7] Richard Myers (2009). The Basics of Chemistry. de Gruyter. p. 171. ISBN 978-3-11-019060-1. Greenwood Publishing Group. p. 55. ISBN 0313316643. [29] J. Wintterlin,S. Völkening,T. V. W. Janssens,T. Zam- [8] IUPAC, Compendium of Chemical Terminology, 2nd ed. belli,G. Ertl (1997): Atomic and Macroscopic Reaction (the “Gold Book”) (1997). Online corrected version: Rates of a Surface-Catalyzed Reaction In: Science 278:1931 (2006–) "chemical reaction equation". doi:10.1126/science.278.5345.1931

[9] E. J. Corey (1988). “Robert Robinson Lecture. Retrosyn- [30] T. Waldmann et al. (2012): Oxidation of an Organic Ad- thetic thinking—essentials and examples”. Chemical Society layer: A Bird’s Eye View In: Journal of the American Chem- Reviews 17: 111. doi:10.1039/CS9881700111. ical Society 134:8817 doi:10.1021/ja302593v

[10] IUPAC, Compendium of Chemical Terminology, 2nd ed. [31] Atkins, pp. 937–950 (the “Gold Book”) (1997). Online corrected version: (2006–) "elementary reaction". [32] David Stanley Saunders (2002). Insect clocks (Third ed.). Amsterdam: Elsevier. p. 179. ISBN 0-444-50407-9. [11] Gernot Frenking (2006). “Elementarreaktionen”. Römpp Chemie-Lexikon. Thieme. [33] IUPAC, Compendium of Chemical Terminology, 2nd ed. (the “Gold Book”) (1997). Online corrected version: [12] Hideki Kandori (2006). “Retinal Binding Proteins”. In (2006–) "catalyst". Christophe Dugave. Cis-trans Isomerization in Biochemistry. Wiley-VCH. p. 56. ISBN 3-527-31304-4. [34] IUPAC, Compendium of Chemical Terminology, 2nd ed. (the “Gold Book”) (1997). Online corrected version: [13] Atkins, p. 114. (2006–) "inhibitor".

[14] Atkins, pp. 106–108 [35] Christoph Elschenbroich (2008). Organometallchemie (6th ed.). Wiesbaden: Vieweg+Teubner Verlag. p. 263. ISBN [15] Reaction Web 978-3-8351-0167-8. 70 CHAPTER 6. CHEMICAL REACTION

[36] March, Jerry (1985), Advanced Organic Chemistry: Reac- [56] R. B. Woodward; Roald Hoffmann (1965). Jour- tions, Mechanisms, and Structure (3rd ed.), New York: Wi- nal of the American Chemical Society 87 (2): 395. ley, ISBN 0-471-85472-7 doi:10.1021/ja01080a054.

[37] S. R. Hartshorn (1973). Aliphatic Nucleophilic Substitution. [57] Peter Karlson; Detlef Doenecke; Georg Fuchs; Wolfgang London: Cambridge University Press. p. 1. ISBN 0-521- Gerok (2005). Karlson Biochemistry and Pathobiochemistry 09801-7. (in German) (16th ed.). Thieme. pp. 55–56. ISBN 978-3- 13-357815-8. [38] Leslie C. Bateman; Mervyn G. Church; Edward D. Hughes; Christopher K. Ingold; Nazeer Ahmed Taher (1940). [58] IUPAC, Compendium of Chemical Terminology, 2nd ed. “188. Mechanism of substitution at a saturated carbon (the “Gold Book”) (1997). Online corrected version: atom. Part XXIII. A kinetic demonstration of the uni- (2006–) "anabolism". molecular solvolysis of alkyl halides. (Section E) a gen- [59] Gerhard Emig; Elias Klemm (2005). Technical Chemistry eral discussion”. Journal of the Chemical Society: 979. (in German) (5th ed.). Springer. pp. 33–34. ISBN 978-3- doi:10.1039/JR9400000979. 540-23452-4.

[39] Brückner, pp. 63–77 [60] B. Trost (1991). “The atom economy—a search for synthetic efficiency”. Science 254 [40] Brückner, pp. 203–206 (5037): 1471–7. Bibcode:1991Sci...254.1471T. [41] Brückner, p. 16 doi:10.1126/science.1962206. PMID 1962206. [61] Guy E Weismantel (1999). John J. McKetta, ed. [42] Brückner, p. 192 Encyclopedia of Chemical Processing and Design: Volume [43] Brückner, p. 183 67 – Water and Wastewater Treatment: Protective Coating Systems to Zeolite 67. CRC Press. p. 109. ISBN 0-8247- [44] Brückner, p. 172 2618-9.

[45] Wiberg, pp. 950, 1602 [62] Atkins, p. 987

[46] IUPAC, Compendium of Chemical Terminology, 2nd ed. (the “Gold Book”) (1997). Online corrected version: 6.15 Bibliography (2006–) "Markownikoff rule".

[47] Brückner, p. 125 • Atkins, Peter W. and Julio de Paula (2006). Physical Chemistry, 4th Edition. Weinheim: Wiley-VCH. ISBN [48] Hans Peter Latscha; Uli Kazmaier; Helmut Alfons Klein 978-3-527-31546-8. (2008). Organische Chemie: Chemie-basiswissen II (in Ger- man) 2 (6th ed.). Springer. p. 273. ISBN 978-3-540- • Brock, William H. (1997). Viewegs Geschichte der 77106-7. Chemie (in German). Braunschweig: Vieweg. ISBN 3-540-67033-5. [49] “Organic Reactions”. 2004. doi:10.1002/0471264180. ISBN 0-471-26418-0. • Brückner, Reinhard (2004). Reaktionsmechanis- men (in German) (3rd ed.). München: Spektrum [50] Ian Hunt. “Chapter 18: Enols and Enolates — The Michael Akademischer Verlag. ISBN 3-8274-1579-9. Addition reaction”. University of Calgary. • Wiberg, Egon, Wiberg, Nils and Holleman, Arnold [51] Brückner, p. 580 Frederick (2001). Inorganic chemistry. Academic [52] Manfred Lechner; Klaus Gehrke; Eckhard Nordmeier Press. ISBN 0-12-352651-5. (2003). Macromolecular Chemistry (3rd ed.). Basel: Birkhäuser. pp. 53–65. ISBN 3-7643-6952-3.

[53] Marye Anne Fox; James K. Whitesell (2004). Organic chemistry (Third ed.). Jones & Bartlett. p. 699. ISBN 0- 7637-2197-2.

[54] Otto Diels; Kurt Alder (1928). “Synthesen in der hydroaro- matischen Reihe”. Justus Liebig’s Annalen der Chemie 460: 98. doi:10.1002/jlac.19284600106.

[55] Brückner, pp. 637–647 6.16. TEXT AND IMAGE SOURCES, CONTRIBUTORS, AND LICENSES 71

6.16 Text and image sources, contributors, and licenses

6.16.1 Text

• Carbohydrate Source: http://en.wikipedia.org/wiki/Carbohydrate?oldid=638575918 Contributors: Magnus Manske, Marj Tiefert, Sodium, Bryan Derksen, Zundark, Tarquin, Taw, Josh Grosse, Youssefsan, Toby Bartels, Anthere, Robert Foley, Heron, DennisDaniels, Ubiquity, Lir, Wshun, Booyabazooka, Ixfd64, Sheldon Rampton, Cyde, GTBacchus, Tregoweth, Looxix, Ellywa, Ahoerstemeier, Mac, Jebba, Ojs, Julesd, Ugen64, Glenn, Tristanb, Palfrey, Evercat, Jedidan747, Mxn, Hashar, Charles Matthews, Ww, Steinsky, Tero, Carbuncle, Donarreiskof- fer, Gentgeen, Robbot, Josh Cherry, Tomchiukc, Mayooranathan, Stewartadcock, Pingveno, Academic Challenger, AaronS, HaeB, Tobias Bergemann, Centrx, Giftlite, DocWatson42, Lupin, Everyking, Dratman, Bensaccount, Digital infinity, Jfdwolff, Guanaco, Jorge Stolfi, Ee- quor, SWAdair, Kandar, Christopherlin, Decoy, Knutux, Sonjaaa, Antandrus, Onco p53, OverlordQ, G3pro, Jossi, H Padleckas, Neutrality, Imjustmatthew, Chmod007, Generic Player, Mike Rosoft, Kingal86, Shipmaster, Discospinster, Cacycle, Vsmith, Kennnesbitt, Mani1, Mart- pol, Aardark, Bender235, ESkog, Geoking66, Hritcu, MisterSheik, Joanjoc, Kwamikagami, Mwanner, Shanes, Matteh, Adambro, Causa sui, Bobo192, Dungodung, Arcadian, Jag123, Avitek, Shambler1, La goutte de pluie, Sasquatch, Cjb88, XDarklytez, Krellis, Jjron, Mareino, Lu- nigma, Jumbuck, Alansohn, Gary, Elpincha, Patrick Bernier, Arthena, Bart133, Melaen, Bucephalus, ClockworkSoul, Evil Monkey, Shoefly, Bsadowski1, Redvers, Bookandcoffee, Antifamilymang, BadSeed, Kenyon, OwenX, Lkjhgfdsa, Macaddct1984, GraemeLeggett, Christopher Thomas, Slgrandson, GFP, Graham87, V8rik, FreplySpang, BorisTM, RxS, Tabercil, Rjwilmsi, Coemgenus, Bfigura, Fish and karate, Redecke, FlaBot, RobertG, Mishuletz, Nihiltres, Who, DuckLionDog, Karrmann, McDogm, Chobot, DVdm, Wasted Time R, Elfguy, YurikBot, Wave- length, Muchness, Kirill Lokshin, Stephenb, Bill52270, Pseudomonas, NawlinWiki, Wiki alf, Grafen, Erielhonan, Deskana, RazorICE, Thiseye, Ezberry, Boobytrapped, Irishguy, Raven4x4x, Khooly59, Nick C, DeadEyeArrow, Tetracube, Silverchemist, Kriskhaira, 21655, Zzuuzz, Theda, Closedmouth, Jwissick, GraemeL, CWenger, WILLY-MART, Afn, HereToHelp, Katieh5584, Diablo Rojo, GrinBot, DVD R W, Kf4bdy, Tir- ronan, That Guy, From That Show!, Sardanaphalus, Vanka5, Veinor, Crystallina, SmackBot, Skaijo, MattieTK, Terrancommander, Saravask, ThreeDee912, JK23, Hydrogen Iodide, Blue520, Bomac, KocjoBot, Anastrophe, Delldot, Zephyris, Gilliam, Ohnoitsjamie, Skizzik, Chao- joker, ERcheck, Tyciol, Kurykh, Persian Poet Gal, Jprg1966, MalafayaBot, Deli nk, Nbarth, DHN-bot, Gruzd, Philip Howard, Darth Panda, Brinerustle, CharonM72, Can't sleep, clown will eat me, Frap, TheKMan, Addshore, Flubbit, Stevenmitchell, Richard001, Drphilharmonic, DMacks, Where, Kuzaar, DJIndica, SashatoBot, Lasindi, Dbtfz, Soap, Kuru, Vaterlo, Kipala, DrNixon, Gobonobo, Perfectblue97, Aleenf1, IronGargoyle, Mr. Vernon, A. Parrot, Hootforum, Mr Stephen, Ryulong, MTSbot, Hetar, BranStark, Iridescent, Az1568, Tawkerbot2, Curt- mack, Google20, AlbertChesterMan, Daedalus969, JForget, Cacahueten, Andrew nixon, Deon, Ale jrb, Robotsintrouble, Scohoust, The Font, JohnCD, WillowW, SyntaxError55, Gogo Dodo, Anthonyhcole, Pascal.Tesson, Tawkerbot4, Christian75, DumbBOT, Chrislk02, Omicronper- sei8, Robert.Allen, Grant M, Gimmetrow, JamesAM, Thijs!bot, Epbr123, Pstanton, Following specific instructions whispered by a mysterious cat, N5iln, Mojo Hand, Marek69, WVhybrid, Mbrutus, Hermioneelovesron, Leon7, Miller17CU94, Eleuther, LachlanA, David D., AntiVandalBot, Swac, Gioto, Settersr, Seaphoto, Opelio, QuiteUnusual, TimVickers, Smartse, Danger, MECU, Spencer, DarthShrine, Eleos, Gökhan, Yancyfry jr, JAnDbot, Deflective, Husond, MER-C, Mcorazao, Sanchom, Xeno, Hut 8.5, Makron1n, Kirrages, Geniac, Connormah, Bongwarrior, VoABot II, Plusik, Densan98, Equinexus, JamesBWatson, CTF83!, Bubba hotep, Srice13, 28421u2232nfenfcenc, Lilmisshawna, NicD, Cpl Syx, Just James, DerHexer, Esanchez7587, TheRanger, Yobol, MartinBot, STBot, CliffC, EyeSerene, Spencerw, Bushwacker1, Arjun01, Kiore, Clien- tele, Killakiwi, R'n'B, Ash, J.delanoy, Pharaoh of the Wizards, Trusilver, Bogey97, Herbythyme, Peter Chastain, Hans Dunkelberg, Yonidebot, Rod57, TheChrisD, Jeffrey Rollins, Xdamagedx, Coppertwig, HiLo48, Loperg, Belovedfreak, NewEnglandYankee, Jenrose, Touch Of Light, Jmcw37, Auuman Anubis, KylieTastic, Thygan, Jamesontai, Vanished user 39948282, Brvman, Microbrain, Black Kite, Aznskill101, Deor, VolkovBot, ABF, Jennavecia, VasilievVV, Wolfnix, Philip Trueman, TXiKiBoT, OverSS, Juniperusjosh, Qxz, Someguy1221, Littlealien182, Lradrama, Martin451, JhsBot, Buddhipriya, LeaveSleaves, Ffinder, Rjm at sleepers, Wingedsubmariner, RadiantRay, Lerdthenerd, Itzchink, Enviroboy, Vector Potential, Spinningspark, Newsaholic, Ronmore, AlleborgoBot, Logan, EmxBot, Boloneyboy is awsome, Joshua Rambajue, Quietbritishjim, SieBot, Lazarevski, BotMultichill, Krawi, Gerakibot, Rockstone35, Caltas, RJaguar3, Yintan, Xkfusionxk, Hxhbot, Nuttyco- conut, Recursiveblue, Tombomp, Drywontonmee, StaticGull, Leetuser, WikiLaurent, Pinkadelica, Ainlina, WikipedianMarlith, Loren.wilton, ClueBot, The Thing That Should Not Be, Arakunem, Reeceyyyy15, Drmies, Razimantv, The determinator, Healthynutrition, Paradox pioneer, Uncle Milty, Joao Xavier, Michaplot, ChandlerMapBot, Phenylalanine, VIC&EM, DragonBot, Excirial, Alexbot, Jusdafax, Pwgman14, Pix- elBot, OpinionPerson, CupOfRoses, NuclearWarfare, Peter.C, Tnxman307, Albla.rocks.u.251, BOTarate, La Pianista, Unmerklich, Thingg, Vegetator, Aitias, Versus22, DumZiBoT, Forgedbliss, InternetMeme, XLinkBot, Mjharrison, Spitfire, Little Mountain 5, Avoided, SilvonenBot, NellieBly, PL290, Frood, Thatguyflint, Benjaminruggill, Addbot, Willking1979, Some jerk on the Internet, Thomas888b, Ronhjones, Tutter- Mouse, Fieldday-sunday, GD 6041, Jasonbholden, CanadianLinuxUser, Fluffernutter, Diptanshu.D, NjardarBot, Morning277, EconoPhysicist, Glane23, Energie energie, Favonian, Tide rolls, Verbal, Czar Brodie, Teles, Alamgir, Swarm, Legobot, Luckas-bot, Yobot, Tohd8BohaithuGh1, Berkay0652, II MusLiM HyBRiD II, Nallimbot, IW.HG, Beavs, Backslash Forwardslash, AnomieBOT, Rubinbot, 1exec1, Jim1138, Pyrrhus16, AdjustShift, Caca21he, Materialscientist, Kasper90, Citation bot, Erlendaakre, Vuerqex, Steven10000bca, Frankenpuppy, Nifky?, Xqbot, Tin- ucherianBot II, Addihockey10, Gigemag76, Nasnema, XZeroBot, Tad Lincoln, D2earth, Biggieyankfan, GrouchoBot, Abce2, Frankie0607, RibotBOT, Amaury, Glycoform, 78.26, Shadowjams, Dr. Klim, Jotade11, Thomas Hoglund, FrescoBot, Vinithehat, Oldlaptop321, 24ten, Theowoo, HJ Mitchell, Iqinn, Biker Biker, Pinethicket, I dream of horses, Trvb, Triplestop, A8UDI, Impala2009, SpaceFlight89, Mikespedia, ,Yunshui, ItsZippy, Sumone10154 ,کاشف عقیل ,Mary Ann N. Magallen, MrTobias, Bgpaulus, Jauhienij, Sultan11, Cancerquest, TobeBot Callanecc, Vrenator, Clarkcj12, Diannaa, Suffusion of Yellow, Sirkablaam, Reach Out to the Truth, Minimac, Skmacksler, Marie Poise, An- drea105, Mean as custard, Toliseju, RjwilmsiBot, Vokes1, Jakebedard, DASHBot, EmausBot, Acather96, WikitanvirBot, Immunize, Ajraddatz, Broflowsky, Razor2988, RaoInWiki, Ben salvatori, Tommy2010, Winner 42, Ingridcool1193, Wikipelli, K6ka, Shadowhunter177, Kriskbunch, Hbuschman, Melissa1995, Cjbe2, AvicBot, JSquish, Barfonyourface, Fæ, Julius00007, ThecarterV, Wayne Slam, Tolly4bolly, Erianna, Mayur, Donner60, Kriders54, Carmichael, ChuispastonBot, Peter Karlsen, Leoj83, TYelliot, DASHBotAV, Dakilla55, Will Beback Auto, ClueBot NG, AznBurger, MelbourneStar, This lousy T-shirt, NTTGermania, Escapepea, O.Koslowski, Castncoot, Widr, Gelainest, HMSSolent, Calabe1992, WNYY98, Gamye387, Lowercase sigmabot, NZLS11, Catherine garnsey, MusikAnimal, AvocatoBot, Metricopolus, Now Look What You've Done, Mark Arsten, D Namtar, 96smidge, TheBrandon1099, 4001001A, Jeuce6, Jackie0711, Zujua, Keturys, Swyilk, Davos1423, 4Jays1034, Johnmichaeloliver, Biosthmors, Riley Huntley, Pratyya Ghosh, Boboshowme, W.D., T0M80Y, ChrisGualtieri, Mediran, AlchemistOfJoy, JY- Bot, Dexbot, Webclient101, Islander007, Lugia2453, Hair, Penguin112, Little green rosetta, Sowlos, Whynotlamacha, Jumpingwhiskers, ZX95, Legalus452, Nhathuyenle, Mbeavers13, Kimberly.zimmel, Epicgenius, Nicevilleangel, Puffin2012, Iztwoz, Eyesnore, UnluckyJohnThomas, Js- 72 CHAPTER 6. CHEMICAL REACTION

tacy1, EvergreenFir, Фил Тоукач, DavidLeighEllis, Zenibus, Stefangv123, Iwantfreebooks, Miscellaneous131, Addishamsi, Donjoe, Manul, Tkyles1009, Abineish, Meteor sandwich yum, Crazy131, Monkbot, TheBigtobia, Scarlettail, Trackteur, Badenoch13, Shiva Kant Gautam, Mr.Nukem, Bicepeddie, Y-S.Ko, Jonathan is dumb, Papasotevergotas42, Jerry09baddog, Cflynnbraves and Anonymous: 1175

• Lipid Source: http://en.wikipedia.org/wiki/Lipid?oldid=639213234 Contributors: Magnus Manske, Marj Tiefert, Sodium, Mav, Stephen Gilbert, Ubiquity, Lir, Patrick, Ixfd64, Karada, 168..., Ellywa, Ahoerstemeier, Mac, JWSchmidt, Nikai, Jedidan747, Mxn, HolIgor, Dcoetzee, Tb, Saltine, Bevo, Lunchboxhero, Donarreiskoffer, Robbot, Mayooranathan, Stewartadcock, HaeB, Dina, DarkHorizon, Dave6, Marc Venot, Giftlite, Nunh-huh, Everyking, Michael Devore, Bensaccount, Jfdwolff, SWAdair, Edcolins, Kandar, Utcursch, Andycjp, Toytoy, Cckkab, Quadell, An- tandrus, Alteripse, Karol Langner, Neutrality, Mike Rosoft, Felix Wan, Rich Farmbrough, Mani1, Hapsiainen, Sten, Joanjoc, RoyBoy, Adambro, Stesmo, Orbst, Shenme, Arcadian, Giraffedata, Physicistjedi, Daf, Pschemp, Sam Korn, Haham hanuka, Pearle, Ranveig, Jumbuck, Alansohn, Etxrge, Arthena, Walkerma, Velella, ClockworkSoul, Cburnett, Garzo, Ceyockey, Cimex, Mivadar, Cruccone, Eleassar777, Fenteany, Schzmo, Plw, Marudubshinki, GFP, Graham87, V8rik, BorisTM, Sjakkalle, Rjwilmsi, JHMM13, Tangotango, MZMcBride, Crazynas, Yamamoto Ichiro, FlaBot, RobertG, Nivix, RexNL, Gurch, Jrtayloriv, Travis.Thurston, Chobot, Gwernol, The Rambling Man, YurikBot, Wavelength, Borgx, Ashleyisachild, Dannyhoffman, Matanya (renamed), Sceptre, Reo On, Shaddack, Pseudomonas, Gustavb, Wiki alf, ViperBite, AeonicOmega, Tjarrett, Bobak, Syrthiss, DeadEyeArrow, Bota47, Derek.cashman, Elkman, Nlu, FF2010, Zzuuzz, Lt-wiki-bot, DVD R W, Eog1916, Sar- danaphalus, Dybdahl, SmackBot, Ashill, TestPilot, Ikip, Bomac, Thunderboltz, Chairman S., S charette, Leptonsoup337, Edgar181, Zephyris, Gilliam, Quidam65, Bluebot, NCurse, Tree Biting Conspiracy, Lennert B, Octahedron80, DHN-bot, Darth Panda, Enigma55, Myrryam, Can't sleep, clown will eat me, Roadnottaken, VMS Mosaic, Addshore, Nakon, Richard001, Drphilharmonic, Doodle77, Where, Richard0612, Clicketyclack, Bioashok, Visium, Platonides, Mouse Nightshirt, Kuru, Andymc, Mgiganteus1, Mr. Lefty, Special-T, Spook`, ElBeeroMan, Sasata, Esoltas, Iridescent, Harvy2004, JoeBot, Kelly Katula, Courcelles, Daniel5127, CalebNoble, JForget, CmdrObot, Aherunar, Woudloper, Hardrada, Casper2k3, TheTito, Kupirijo, Reywas92, Rifleman 82, Wildnox, Tawkerbot4, Shirulashem, Christian75, Chrislk02, Narayanese, Krylonblue83, Epbr123, Redwullf, Headbomb, Miller17CU94, CharlotteWebb, AntiVandalBot, Why My Fleece?, KP Botany, Autocracy, TimVickers, Darklilac, Fireice, AubreyEllenShomo, Myanw, Dan4636, JAnDbot, Husond, MER-C, FaerieInGrey, Sangak, Pedro, Bongwar- rior, VoABot II, Kajasudhakarababu, Bulbeck, Lunkwill42, User A1, Gomm, DerHexer, WLU, Olegkolesnikov, MartinBot, NochnoiDozor, 52 Pickup, Anaxial, Mschel, Ryanreednro, TLF1981, Captain panda, Pharaoh of the Wizards, Trusilver, EscapingLife, Peter Chastain, Hodja Nasreddin, SubwayEater, Jadeogle, Squeezeweasel, TheUnionBlood, Mikael Häggström, Coppertwig, Pyrospirit, AntiSpamBot, Freiddie, Kyli- eTastic, ThePointblank, Idioma-bot, Deor, MEHMEHMEHMEH, EchoBravo, Quentonamos, Philip Trueman, TXiKiBoT, BuickCenturyDriver, Showjumpersam, Rei-bot, Qxz, Big Papa 13, JhsBot, LeaveSleaves, Vgranucci, King003, Jdude89, Madhero88, Chaffers, Burntsauce, Quant- pole, Sfmammamia, NHRHS2010, Steven Weston, D. Recorder, SieBot, Sakkura, Nathan, Keilana, Bentogoa, Flyer22, Qst, Oiws, Pradilla94, Maryrebecca, Hiei-Touya-icedemon, Mike2vil, SallyForth123, WikipedianMarlith, Vreezkid, Loren.wilton, ClueBot, Artichoker, Jvcallaway, The Thing That Should Not Be, Taroaldo, Compaddict11, MchRj2, Michaplot, WiseManOnTheMountain, Nikolaevna, Boosmith, Excirial, Eeekster, Vaz222, Rubylover234, Cenarium, Bergamo, Thingg, Aitias, Kruusamägi, Lmaps, Dakilla15, XLinkBot, Tullywinters, Knopfkind, Bagelboi, Actam, Avoided, NellieBly, Mifter, JinJian, Lemchesvej, Yelsaimery, Addbot, DOI bot, Wickey-nl, Ronhjones, Fieldday-sunday, Download, EconoPhysicist, Glane23, Tahmmo, DubaiTerminator, Tide rolls, Quantumobserver, Albert galiza, Javanbakht, आशीष भटनागर, Luckas-bot, Nlaeditor, Fraggle81, P1ayer, R500Mom, Tempodivalse, 61 88 131 149a, AnomieBOT, Choij, Hughesdavidw, Giants27, Materi- alscientist, Citation bot, Frankenpuppy, Muffinman123123, Carturo222, Xqbot, Hoops32, Addihockey10, JimVC3, Capricorn42, GrouchoBot, RibotBOT, Eboireau, Markacohen, Miyagawa, Bekus, Sphinxlipos, LucienBOT, 27 Juni, Curiousgeorgethemonkey, Madfalcon108, Citation bot 1, Niazac, Pinethicket, Boulaur, Jonesey95, Nanominori, AmphBot, A8UDI, OrcaMorgan, Ezhuttukari, SpaceFlight89, Pbsouthwood, Medicin- -Musselboy, JimBrownish, Katgabrielle, Tbhotch, Jesse V., Andrewx96, DARTH SID ,کاشف عقیل ,eMan555, Jauhienij, Tim1357, FoxBot IOUS 2, Mrsmosher, RjwilmsiBot, Sion55, Alice Davidson, Daniel Cliff, Immunize, Costas78, Dewritech, Primefac, Jax0527, Tommy2010, Wikipelli, We hope, SporkBot, Wayne Slam, Ocaasi, Rcsprinter123, NYMets2000, MonoAV, ChuispastonBot, DASHBotAV, ClueBot NG, Widr, CasualVisitor, Helpful Pixie Bot, Nothing98765432154, NotWith, Vanischenu, Shisha-Tom, Neulabs, Mitality, Prof. Squirrel, Khazar2, Illia Connell, BrightStarSky, TwoTwoHello, Logan.Phospholipid, Keroru, Epicgenius, Tentinator, Ginsuloft, AddWittyNameHere, Huscarlkarl, Anrnusna, Monkbot, BethNaught, Rakeshyashroy, Jonoallen22, Blazer32100, Gingee41100, Physicsmathftw, Davidparklee, Johnbender01 and Anonymous: 638

• Protein Source: http://en.wikipedia.org/wiki/Protein?oldid=639481548 Contributors: AxelBoldt, Magnus Manske, Marj Tiefert, Mav, Bryan Derksen, Tarquin, Taw, Malcolm Farmer, Andre Engels, Toby Bartels, PierreAbbat, Karen Johnson, Ben-Zin, Robert Foley, AdamRetchless, Netesq, Mbecker, DennisDaniels, Spiff, Dwmyers, Lir, Michael Hardy, Erik Zachte, Lexor, Ixfd64, Fruge, Cyde, 168..., Ams80, Ahoerste- meier, Mac, Snoyes, Msablic, JWSchmidt, Darkwind, Glenn, Whkoh, Aragorn2, Mxn, Zarius, Lfh, Ike9898, StAkAr Karnak, Tpbradbury, Taxman, Taoster, Samsara, Shizhao, Jecar, Bloodshedder, Carl Caputo, Jusjih, Donarreiskoffer, Robbot, Josh Cherry, Altenmann, Peak, Ro- manm, Arkuat, Stewartadcock, Merovingian, Sunray, Hadal, Isopropyl, Anthony, Holeung, Lupo, Dina, Mattwolf7, Centrx, Giftlite, Christopher Parham, Andries, Mikez, Wolfkeeper, Netoholic, Doctorcherokee, Peruvianllama, Everyking, Subsolar, Curps, Alison, Dmb000006, Bensac- count, Eequor, Alvestrand, Jackol, Delta G, Neilc, OldakQuill, Adenosine, ChicXulub, DocSigma, Jonathan Grynspan, Knutux, Antandrus, Onco p53, G3pro, PDH, Karol Langner, H Padleckas, Bumm13, Tsemii, JohnArmagh, Jh51681, I b pip, Jake11, Ivo, Adashiel, Corti, Sysy, Indosauros, A-giau, Johan Elisson, Diagonalfish, Discospinster, Rich Farmbrough, Guanabot, Cacycle, Wk muriithi, Bishonen, Bibble, Bender235, ESkog, Cyclopia, Kbh3rd, Richard Taylor, Eric Forste, MBisanz, El C, Rgdboer, Gilgamesh he, Susvolans, RoyBoy, Perfecto, RTucker, Bobo192, Ja- sonzhuocn, Cmdrjameson, R. S. Shaw, Polluks, Password, Arcadian, Joe Jarvis, Jerryseinfeld, Jojit fb, NickSchweitzer, Banks, BW52, Haham hanuka, Hangjian, Benbread, Espoo, Siim, Alansohn, JYolkowski, Chino, Tpikonen, Interiot, Andrewpmk, SlimVirgin, Kocio, Mailer diablo, ClockworkSoul, Super-Magician, Knowledge Seeker, Cburnett, LFaraone, Gene Nygaard, Redvers, Bookandcoffee, BadSeed, Kznf, RyanGer- bil10, Ron Ritzman, Megan1967, Roland2, Angr, Richard Arthur Norton (1958- ), Pekinensis, Woohookitty, TigerShark, Jpers36, Benbest, JeremyA, Miss Madeline, Sir Lewk, Fenteany, Steinbach, M412k, Wayward, Essjay, Turnstep, Dysepsion, Matturn, Magister Mathematicae, V8rik, BorisTM, RxS, Sjakkalle, Rjwilmsi, Tizio, Tawker, Yamamoto Ichiro, FuelWagon, Titoxd, FlaBot, Ageo020, Yanggers, RexNL, Gurch, Alexjohnc3, Fresheneesz, Alphachimp, Chobot, Moocha, Bornhj, Korg, Bubbachuck, The Rambling Man, YurikBot, Wavelength, Sceptre, Reo On, Jtkiefer, Zafiroblue05, Chuck Carroll, Splette, SpuriousQ, Rada, Derezo, CanadianCaesar, Stephenb, Gaius Cornelius, Cambridge- BayWeather, Yyy, Ihope127, Cryptic, Cpuwhiz11, Wimt, The Hokkaido Crow, Annabel, Sentausa, Shanel, NawlinWiki, Wiki alf, UCaetano, BigCow, Exir Kamalabadi, Dureo, Mccready, Irishguy, Shinmawa, Banes, Matticus78, Rmky87, Raven4x4x, Khooly59, Neil.steiner, Misza13, Tony1, Bucketsofg, Dbfirs, Aaron Schulz, BOT-Superzerocool, DeadEyeArrow, Bota47, Kkmurray, Brisvegas, Mr.Bip, Wknight94, Trigger hippie77, Astrojan, Tetracube, Holderca1, Phgao, Zzuuzz, Closedmouth, Dspradau, Pookythegreat, GraemeL, JoanneB, CWenger, Anclation, 6.16. TEXT AND IMAGE SOURCES, CONTRIBUTORS, AND LICENSES 73

Staxringold, Banus, AssistantX, GrinBot, 8472, DVD R W, CIreland, That Guy, From That Show!, Eog1916, Wikimercenary, AndrewWTaylor, Sardanaphalus, Twilight Realm, Crystallina, Scolaire, SmackBot, FocalPoint, Zenchu, Paranthaman, Slashme, TestPilot, Pgk, Bomac, Davewild, Delldot, AnOddName, RobotJcb, Edgar181, Zephyris, Xaosflux, Gilliam, Ppntori, Richfife, Malatesta, NickGarvey, ERcheck, JSpudeman, Ty- ciol, Bluebot, Dbarker348, Persian Poet Gal, Ben.c.roberts, Stubblyhead, Elagatis, MalafayaBot, Moshe Constantine Hassan Al-Silverburg, Deli nk, Rama’s Arrow, Zsinj, Can't sleep, clown will eat me, Keith Lehwald, DéRahier, Fjool, Onorem, Snowmanradio, Yidisheryid, EvelinaB, Rrburke, Mr.Z-man, SundarBot, NewtN, Nibuod, Nakon, Drdozer, MEJ119, Smokefoot, Drphilharmonic, Wisco, Wybot, DMacks, PandaDB, Jls043, Mikewall, Kukini, Clicketyclack, Derekwriter, EMan32x, Rockvee, Akubra, J. Finkelstein, Euchiasmus, Timdownie, Soumyasch, As- troChemist, Hemmingsen, Accurizer, Kyawtun, Mr. Lefty, IronGargoyle, The Man in Question, MarkSutton, Bhulsepga, Special-T, Munita Prasad, Beetstra, Muad, Rickert, Bendzh, Aarktica, Johnchiu, Shella, Sijo Ripa, Citicat, Jose77, Sasata, ShakingSpirit, BranStark, Iridescent, Electrified mocha chinchilla, Lakers, JoeBot, Wjejskenewr, Tawkerbot2, Dlohcierekim, Bioinformin, MightyWarrior, Jman5, Fvasconcellos, SkyWalker, JForget, GeneralIroh, Porterjoh, Ale jrb, Dread Specter, Insanephantom, Satyrium, Dycedarg, Scohoust, Makeemlighter, Pica- roon, KyraVixen, DSachan, CWY2190, Nadyes, THF, Outriggr, ONUnicorn, Icek, WillowW, MC10, Michaelas10, Gogo Dodo, Eric Martz, Ttiotsw, Chasingsol, Studerby, Tawkerbot4, Carstensen, Christian75, Narayanese, Btharper1221, Omicronpersei8, Nugneant, Gimmetrow, Thijs!bot, Epbr123, Barticus88, StuartF, Opabinia regalis, Sid 3050, Mojo Hand, Headbomb, Marek69, John254, Folantin, James086, Tellyad- dict, Miller17CU94, Dgies, Tim2027uk, Escarbot, Ileresolu, AntiVandalBot, Galilee12, Luna Santin, Settersr, BenJWoodcroft, AaronY, Jj137, TimVickers, Priscus, Sprite89, MECU, JAnDbot, Deflective, Husond, MER-C, Janejellyroll, Andonic, OllyG, Lawilkin, Acroterion, Magiola- ditis, Henning Blatt, Karlhahn, Bongwarrior, VoABot II, AuburnPilot, Hasek is the best, Think outside the box, Roadsoap, Srice13, Stelligent, Eldumpo, Mkdw, Emw, User A1, Lafw, Glen, Rajpaj, DerHexer, JaGa, Megalodon99, Khalid Mahmood, WLU, Wayne Miller, Squidonius, Seba5618, Hdt83, MartinBot, Kenshealth, Meduban, Dan Gagnon, R'n'B, Player 03, LedgendGamer, Paranomia, J.delanoy, Pharaoh of the Wizards, CFCF, Hans Dunkelberg, Boghog, Uncle Dick, Public Menace, Pipe34, WarthogDemon, Hodja Nasreddin, G. Campbell, Lantonov, Tylerhammond2, LordAnubisBOT, Ignatzmice, Dthzip, Coppertwig, Pyrospirit, Belovedfreak, GBoran, SJP, AA, Touch Of Light, Shoessss, Ju- liancolton, Bogdan, Burzmali, Jamesontai, Natl1, WinterSpw, Pdcook, Kalyandchakravarthy, Mlsquirrel, CardinalDan, Idioma-bot, Montchav, Carl jr., King Lopez, VolkovBot, IWhisky, Mstislavl, ABF, Ashdog137, Leebo, AlnoktaBOT, VasilievVV, Tiberti, Philip Trueman, TXiKi- BoT, Oshwah, Tameeria, JesseOjala, Sam1001, A4bot, Guillaume2303, Nitin77, Xavierschmit, Qxz, Clarince63, Melsaran, Martin451, Leafy- plant, LeaveSleaves, Mkv22, Seb az86556, Fitnesseducation, Mkubica, Sirsanjuro, Hannes Röst, Naturedude858, Spiral5800, Hedgehog33, Pierpunk, Amb sib, Synthebot, Wilbur2012, Falcon8765, Duckttape17, Enviroboy, Vector Potential, Kingjalis3, Brigand dog, Doc James, AlleborgoBot, Kehrbykid, Gangsta4lif, Frank 212121, Zoeiscow, EmxBot, ThinkerThoughts, Masterofsuspense3, Christoph.gille, SieBot, Gra- ham Beards, Moonriddengirl, Work permit, Sharpvisuals, Winchelsea, Caltas, Iwearsox21, Jipan, Triwbe, Manojdhawade, Yintan, Agesworth, Mfickes, Eganio, Keilana, Shura58, Radon210, Editore99, Oda Mari, Grimey109, Danizdeman, Paolo.dL, Thishumorcake, Jlaudiow713, Oxy- moron83, Nuttycoconut, Chenmengen, Poindexter Propellerhead, Lordfeepness, Fratrep, Maelgwnbot, N96, StaticGull, Mike2vil, Wuhwuzdat, Mygerardromance, Hamiltondaniel, Ascidian, Dabomb87, Superbeecat, Agilemolecule, Ayleuss, TwinnedChimera, AutoFire, Asher196, Las- corz, Tatterfly, Naturespace, Amotz, WikipedianMarlith, Seaniemaster, De728631, ClueBot, The Thing That Should Not Be, Rodhullandemu, Plankwalking, Arakunem, Mild Bill Hiccup, Coookeee crisp, CounterVandalismBot, Niceguyedc, Spritegenie, Peteruetz, ChandlerMapBot, NClement, Wardface, DragonBot, Douglasmtaylor, Alexbot, Jusdafax, Jordell 000, Mike713, OpinionPerson, CupOfRoses, NuclearWarfare, Cenarium, Lunchscale, Jotterbot, Achilles.g, Aitias, Versus22, NERIC-Security, Thinking Stone, ClanCC, Tprentice, XLinkBot, Ivan Akira, Rror, Capitana, Mifter, Samwebstah, Michael.J.Goydich, Noctibus, Jbeans, ZooFari, Frictionary, Sgpsaros, Doctor Knoooow, Champ0815, Lemchesvej, HexaChord, Addbot, Some jerk on the Internet, DOI bot, Landon1980, SunDragon34, Ronhjones, TutterMouse, Fieldday-sunday, Cuaxdon, Nick Van Ni, Cst17, Mentisock, CarsracBot, EconoPhysicist, Mai-tai-guy, Glane23, AndersBot, Omnipedian, Debresser, LinkFA- Bot, RoadieRich, Tassedethe, Numbo3-bot, OffsBlink, Tide rolls, James42.5, Gail, Ettrig, Swarm, Javanbakht, A K AnkushKumar, Luckas-bot, Yobot, II MusLiM HyBRiD II, Minorfixer, Eric-Wester, Tempodivalse, AnomieBOT, Itln boy, Xelixed, Galoubet, Piano non troppo, Adjust- Shift, VK3, Kingpin13, RandomAct, Sonic h, Materialscientist, Yurilinda, Citation bot, Knightdude99, Neurolysis, Aspenandgwen, LilHelpa, Xqbot, Timir2, Capricorn42, Bihco, Tchussle, Tad Lincoln, Flavonoid, P99am, Tennispro427, Almabot, 200itlove, GrouchoBot, Laxman12, Abce2, Aznnerd123, Omnipaedista, HernanQB, RibotBOT, Pravinhiwale, Altruistic Egotist, GhalyBot, Miyagawa, Captain-n00dle, FrescoBot, Tobby72, This doesnt help at all, Citation bot 1, Pinethicket, Bernarddb, HRoestBot, Katherine Folsom, Jstraining, Curehd, My very best wishes, Jauhienij, ActivExpression, Cnwilliams, Tim1357, Missellyah, FoxBot, TobeBot, Sweet xx, Lotje, Ndkartik, January, Max Janu, Duckyinc2, Specs112, Brian the Editor, Suffusion of Yellow, Tbhotch, Jesse V., Minimac, DARTH SIDIOUS 2, Usmanmyname, Ripchip Bot, Agent Smith (The Matrix), DASHBot, EmausBot, Cpeditorial, WikitanvirBot, Immunize, Snow storm in Eastern Asia, 021-adilk, JonReader, Clarker1, Scot- tyBerg, Joeywallace9, GoingBatty, Minimac’s Clone, RenamedUser01302013, Hous21, Wikipelli, Commanderigg, SRMN2, Meruem, JSquish, HiW-Bot, Traxs7, Heshamscience, Futureworldconqueror, Alpha Quadrant, John Mackenzie Burke, AvicAWB, Elektrik Shoos, Bamyers99, H3llBot, Zap Rowsdower, RODSHEL, Imnoteditinganything, Rajatgaur, Richardmnewton, Codahawk, Wstraub, Hylian Auree, Petrb, Teaktl17, ClueBot NG, Eastewart2010, Pisaadvocate, Helpful Pixie Bot, Bibcode Bot, BG19bot, Gautehuus, Edward Gordon Gey, Gupta.udatha, Protein Chemist, NotWith, Smettems, Prof. Squirrel, Fma69, Dexbot, Wimblecf, Joeinwiki, David P Minde, Prokaryotes, Kirtimaansyal, Anrnusna, Monkbot and Anonymous: 1184 • Enzyme Source: http://en.wikipedia.org/wiki/Enzyme?oldid=640389752 Contributors: AxelBoldt, Magnus Manske, Marj Tiefert, Derek Ross, Bryan Derksen, Taw, Malcolm Farmer, Andre Engels, Danny, Gianfranco, Tempel, Zoe, Graham, Netesq, Ewen, Olivier, Dwmyers, Lir, D, JohnOwens, Michael Hardy, GABaker, Lexor, DIG, Ixfd64, Qaz, 168..., Ahoerstemeier, Ronz, Elano, 5ko, Den fjättrade ankan, JWSchmidt, Glenn, Tristanb, TonyClarke, Rob Hooft, Hashar, Jengod, Gingekerr, Wikiborg, Stone, Ike9898, Wolfgang Kufner, Tpbradbury, John NRW, Taxman, Ed g2s, Mperkins, Shizhao, Exaton, Fvw, Pietrosperoni, Secretlondon, Jusjih, Lumos3, Gentgeen, Robbot, Chris 73, Yelyos, Romanm, Academic Challenger, Hadal, JesseW, Jpbrenna, Holeung, Lupo, Diberri, MilkMiruku, GreatWhiteNortherner, Giftlite, Christopher Parham, Fennec, Jyril, Nunh-huh, Ævar Arnfjörð Bjarmason, Doctorcherokee, Everyking, Chihowa, Michael Devore, Bensaccount, Maver1ck, Dun- charris, FrYGuY, Mboverload, Eequor, Jackol, Pne, Delta G, Wmahan, ChicXulub, Gzuckier, GeneMosher, Onco p53, OverlordQ, MisfitToys, G3pro, PDH, Vina, MacGyverMagic, Bumm13, PFHLai, Neutrality, Phpham31, Joyous!, Clemwang, Fabrício Kury, Zondor, Trevor MacIn- nis, DanielCD, Johan Elisson, Discospinster, Rich Farmbrough, Guanabot, Cacycle, Narsil, Mjpieters, Mani1, Bender235, ESkog, Kbh3rd, Kjoonlee, Danny B-), CanisRufus, Pt, Bookofjude, DavidRader, CDN99, Causa sui, Bobo192, Smalljim, Xevious, Arcadian, Guiltyspark, Giraffedata, Nk, TheProject, Samulili, Nhandler, Haham hanuka, Krellis, Jumbuck, Siim, Alansohn, Anthony Appleyard, PopUpPirate, Pe- temorris, Arthena, Atlant, Riana, Seans Potato Business, Walkerma, Ynhockey, Hu, Stillnotelf, Bart133, Theyeti, PaePae, Mcy jerry, Knowl- edge Seeker, Evil Monkey, Jobe6, Dirac1933, IMeowbot, Arakin, Ajpratt56, Ianblair23, Redvers, Drummstikk, Capecodeph, Instantnood, RyanGerbil10, Jwanderson, Woohookitty, Dalmoz, TigerShark, Tabletop, Dolfrog, SCEhardt, M412k, Wayward, MarcoTolo, JohnJohn, Pal- 74 CHAPTER 6. CHEMICAL REACTION

ica, Turnstep, Magister Mathematicae, BD2412, Chun-hian, Mendaliv, Josh Parris, Rjwilmsi, Tizio, Саша Стефановић, Quale, Dpark, Vary, Harry491, HappyCamper, Brighterorange, The wub, Bhadani, Sango123, DirkvdM, FlaBot, Ian Pitchford, SchuminWeb, RobertG, Shultzc, Jak123, Mister Matt, Nihiltres, Crazycomputers, Nivix, RexNL, Nige111, Takometer, Intgr, Stevenfruitsmaak, Daycd, BradBeattie, Smart- smith, Scimitar, Chobot, Jaraalbe, Jdhowens90, Bornhj, DVdm, Gwernol, The Rambling Man, YurikBot, Wavelength, Mdemian, Phantom- steve, John Quincy Adding Machine, Conscious, Bcebul, Captaindan, DanMS, Stephenb, Bill52270, Gaius Cornelius, K.C. Tang, NawlinWiki, Wiki alf, Msikma, Grafen, Icelight, Nutiketaiel, Aaron Brenneman, Xdenizen, Matticus78, Ruhrfisch, Hv, BOT-Superzerocool, DeadEyeAr- row, Bota47, Superiority, Brisvegas, Typer 525, Nlu, Nick123, Wknight94, Leptictidium, FF2010, Donbert, Zero1328, Albert109, Zzuuzz, Syd Midnight, Lt-wiki-bot, TimBarrel, Closedmouth, KGasso, Sean Whitton, BorgQueen, GraemeL, JoanneB, Amren, Anclation, F. Cosoleto, Tvd12110, Mejor Los Indios, DVD R W, ChemGardener, Sardanaphalus, Attilios, SmackBot, Michael%Sappir, Saravask, Jamesters, Knowled- geOfSelf, Chazz88, Unyoyega, David Shear, Blue520, WookieInHeat, EncycloPetey, Delldot, Jab843, Veesicle, Frymaster, Edgar181, Alsandro, Zephyris, Gaff, Aksi great, Gilliam, Hmains, Modulus86, Yaser al-Nabriss, SergeantBolt, MrDrBob, Geneb1955, RDBrown, NCurse, Fuz- zform, Hichris, MalafayaBot, Moshe Constantine Hassan Al-Silverburg, DHN-bot, Darth Panda, Oatmeal batman, Rlevse, Langbein Rise, Ro- yArnon, Tsca.bot, Can't sleep, clown will eat me, Vanished User 0001, NoahElhardt, Yaksha, JonHarder, EvelinaB, TKD, Addshore, SundarBot, Khukri, Decltype, Nakon, Savidan, Jiddisch, Richard001, Weregerbil, Iridescence, Drphilharmonic, Hammer1980, DMacks, Sturm br, Mion, Ck lostsword, Pilotguy, Kukini, Clicketyclack, Baoilleach, Dono, LtPowers, Harryboyles, Mouse Nightshirt, Kuru, J. Finkelstein, AmiDaniel, FrozenMan, Kipala, SilkTork, DrNixon, Minna Sora no Shita, Tlesher, IronGargoyle, Physis, Clone1, Mathel, Ben Moore, Knights who say ni, Beetstra, Serephine, Սահակ, SandyGeorgia, Dalstadt, Mets501, Dcflyer, Artman40, Jose77, Stuckonempty, Iridescent, Paul venter, JoeBot, Shoeofdeath, 10014derek, Blackprince, CapitalR, Blehfu, Tawkerbot2, Dlohcierekim, Daniel5127, TWUChemLS, Ioannes Pragensis, Fvascon- cellos, JForget, CmdrObot, Fedir, Van helsing, Robotsintrouble, John Riemann Soong, SupaStarGirl, Drinibot, MiShogun, THF, ShelfSkewed, WeggeBot, Casper2k3, WillowW, Steel, Mato, Michaelas10, Gogo Dodo, Lugnuts, Jedonnelley, Tawkerbot4, Carstensen, DumbBOT, Chrislk02, FastLizard4, Smellysam524, Kozuch, Omicronpersei8, Gourgeousladyy, Tunheim, Gimmetrow, Chris CII, Thijs!bot, Epbr123, Opabinia re- galis, Tomharris, N5iln, Young Pioneer, Sopranosmob781, Luigifan, Pjvpjv, Marek69, (3ucky(3all, Harlequin2134, West Brom 4ever, Elem3nt, James086, Miller17CU94, Dfrg.msc, CharlotteWebb, Wikidenizen, Tomos ANTIGUA Tomos, Northumbrian, Escarbot, Eleuther, David D., KrakatoaKatie, AntiVandalBot, Luna Santin, Aljasm, Prolog, Kheiron, Jj137, TimVickers, Gdo01, TJClark, JAnDbot, Deflective, MER-C, Correctist, Hello32020, Hut 8.5, NEUROtiker, FaerieInGrey, Magioladitis, Bongwarrior, VoABot II, Wikidudeman, JamesBWatson, Swpb, Think outside the box, Aerographer1981, Emhale, Twisted86, Pax deorum, Recurring dreams, WhatamIdoing, Fallschirmjäger, Catherine- maguire, Mikhail Garouznov, Economo, Dirac66, Emw, User A1, ArmadilloFromHell, Glen, DerHexer, JaGa, Wdflake, Lelkesa, Lenticel, Squidonius, Patstuart, Fishyfishy, DancingPenguin, Sinharaja2002, MartinBot, Arjun01, ChemNerd, Rettetast, Curiousgeorgie, Anaxial, Com- monsDelinker, Dr. St-Amant, Flannelgraf, CBSB, AmH2, Fondls, J.delanoy, Pharaoh of the Wizards, Jroenick2797, Timberman, Cyclosa, DrKiernan, Trusilver, Awg usc, Dreamm, Hans Dunkelberg, Shane wallmann, Cybercyclone3993, Jorwisgar, Hector kevin, Jstew87, Articles for analfuckbaggage-!, Sefog, Bot-Schafter, Katalaveno, Ghjfdhgdju, Victuallers, Jonnylyman, Rocket71048576, Chriswiki, AntiSpamBot, Flugs, Plasticup, LittleHow, NewEnglandYankee, Evan57, JohnnyRush10, Hellfire68, Cmichael, Suhail174, Benwd, RB972, Ichbintux, Pdcook, An- dreasJSbot, Useight, Matthiascarrigan, CardinalDan, Idioma-bot, Wikieditor06, PeaceNT, VolkovBot, Tkenna, Jeff G., Wolfnix, Philip True- man, DoorsAjar, TXiKiBoT, Zidonuke, Bob888, Pkarp11, Sk741, Qxz, Xxpsycho37xx, Indy 900, Tantal-ja, DennyColt, DocteurCosmos, Gre- gogil, Psyche825, Jitu jain, Scottiedog15, Katimawan2005, Iamstaurtmayle, Stuartmayle, Synthebot, Altermike, Falcon8765, CephasE, Sfmam- mamia, Kosigrim, Petergans, Hazel77, EmxBot, 01roshay, Cwhitt817, SieBot, Sonicology, Ttony21, Jauerback, Gerakibot, Viskonsas, Caltas, Matthew Yeager, Cwkmail, Yintan, Purbo T, Maphyche, Arbor to SJ, Monkeymox, Wmpearl, Oxymoron83, Kochipoik, Lightmouse, Poindexter Propellerhead, Mbols, Hobartimus, OKBot, Bobadillo, StaticGull, Cppgx, GiveItSomeThought, Hezzy140, Ebuxbaum, Pinkadelica, M2Ys4U, Denisarona, Buzybeez, Lascorz, Blabberfruit, Forluvoft, Webridge, Atif.t2, Elassint, ClueBot, PipepBot, Snigbrook, The Thing That Should Not Be, VsBot, Yikrazuul, Damonchicken, WDavis1911, Mild Bill Hiccup, Regibox, CounterVandalismBot, OccamzRazor, Blanchardb, Michał Sobkowski, LizardJr8, Liempt, Rose090, Timhewitt101, Mcrkramer, Moguls, DragonBot, Alexbot, Jusdafax, Vanisheduser12345, Pmm530, Idontknowmyname, Tyler, Arjayay, Jotterbot, Huntthetroll, Saebjorn, Aitias, Yasitha2, Dheenkumar, TAKEN00, Redeemer079, Qwfp, Jamess- cottbrown, Skunkboy74, XLinkBot, Jovianeye, Rror, Vojtěch Dostál, Little Mountain 5, Skarebo, NellieBly, Jeremyb650, WikiDao, ZooFari, MystBot, HexaChord, CalumH93, Addbot, Some jerk on the Internet, DOI bot, Jojhutton, Marxspiro, Ronhjones, PandaRepublican, Fieldday- sunday, Adrian 1001, Low-frequency internal, Cst17, MrOllie, LaaknorBot, EconoPhysicist, Bassbonerocks, Omnipedian, Debresser, Doniago, LinkFA-Bot, 84user, Numbo3-bot, Tide rolls, Alfie66, Luckas-bot, Yobot, Fraggle81, II MusLiM HyBRiD II, Yoilish, Mmxx, Beeswaxcandle, Chios1127, Naipicnirp, AnomieBOT, Haetmachine, 1exec1, Neptune5000, Barliman Butterbur, AdjustShift, Scuzzer, Kingpin13, Bluerasberry, Materialscientist, Kasper90, Citation bot, Videot43, Felyza, Frankenpuppy, Tekks, Xqbot, Timir2, Intelati, Apothecia, Jeffrey Mall, DSisyphBot, Rlmrace, Texasrocks, J04n, GrouchoBot, Popnose, ProtectionTaggingBot, Omnipaedista, Shirik, RibotBOT, The Wiki ghost, Moxy, GainLine, Shadowjams, AlimanRuna, Some standardized rigour, Timehigh, Captain-n00dle, GT5162, 10buttz, LucienBOT, HJ Mitchell, Simpler12, Km- douglass, Citation bot 1, Intelligentsium, AstaBOTh15, Pinethicket, I dream of horses, Elockid, HRoestBot, Edderso, MimisHandler, Calmer Waters, A8UDI, Killacoll123, Σ, KES47, Papapu, Shanmugamp7, Jauhienij, Mj455972007, K1lla abbas, FoxBot, TobeBot, Trappist the monk, -Barneycleo, Stefano Garibaldi, Vrenator, Mewilliams95, Shosh3333, Amkilpatrick, Justine Hill, Canuckian89, Yorubaspar ,کاشف عقیل tan, Suffusion of Yellow, Myplace345, Jynto, Tbhotch, Jrc2005, Reach Out to the Truth, EMacG, DARTH SIDIOUS 2, AXRL, Maaayowa, RjwilmsiBot, Q3w3e3, Beki Hellens, Mdznr, Androstachys, DASHBot, EmausBot, Cpeditorial, WikitanvirBot, Gfoley4, Snow storm in East- ern Asia, Talktomarie1, Gn96, Kerivoula, Matty616, Tommy2010, Ballboy070707, Wikipelli, 6AND5, Dspoel, Shuipzv3, SimBioUSA, John Mackenzie Burke, Michaeljwilson, Rcjohns1, H3llBot, EWikist, Jarodalien, Wayne Slam, U+003F, Sky380, Beastinbman, L Kensington, Lo- ganloganlogand, Donner60, Beta cafe, ChuispastonBot, Snehalshekatkar, ClueBot NG, Gareth Griffith-Jones, Apdang, MelbourneStar, His- toricPandaBear, Gilderien, Eltronio, Eseosala, Bjhiggins, Widr, Antiqueight, Flomenbom, Robertohaas, Timflutre, Bradley1545, Helpful Pixie Bot, Lalo1121, HMSSolent, Lowercase sigmabot, BG19bot, Maxwell754, Happylama101, The Banner Turbo, Dakarai99, 13shepht, Jacob- True, Gautehuus, Mark Arsten, Dhruvrajgohil, FutureTrillionaire, Dr. Krishna Prasad Nooralabettu, Mrspkapila, KhoousesWiki, BattyBot, Johnmichaeloliver, Studlaff, Miszatomic, A2-25, Pratyya Ghosh, Mrt3366, Dexbot, Webclient101, Dannyboy600, Lugia2453, Andrew Murkin, Joeinwiki, Mark viking, Epicgenius, Forever elementary school student, Bdoc13, Jakec, DavidLeighEllis, Evolution and evolvability, Ugog Niz- dast, Ginsuloft, Amr94, IsaacOcean, PierreFG5, Suderpie, SimonWombat8, Anrnusna, Ziahlao, Chloemthomson, EngScott, JohnGormleyJG, Monkbot, Rakeshyashroy and Anonymous: 1334 • PH Source: http://en.wikipedia.org/wiki/PH?oldid=640138868 Contributors: AxelBoldt, Magnus Manske, Sodium, Bryan Derksen, Jeronimo, Gareth Owen, Andre Engels, Kowloonese, Youssefsan, SJK, Space Cadet, SimonP, Peterlin, Heron, Ewen, Quercusrobur, Olivier, MimirZero, Bdesham, Patrick, D, Michael Hardy, Polimerek, DIG, Shellreef, Gabbe, Ixfd64, Karada, CesarB, Stan Shebs, WeißNix, Docu, Angela, Glenn, 6.16. TEXT AND IMAGE SOURCES, CONTRIBUTORS, AND LICENSES 75

Whkoh, AugPi, Kimiko, Iorsh, Cherkash, Mulad, Trainspotter, Timwi, Ww, Stone, Ike9898, Dysprosia, DJ Clayworth, Tpbradbury, Omega- tron, Raul654, Secretlondon, Jusjih, PuzzletChung, Gromlakh, Donarreiskoffer, Gentgeen, Kaol, Hoskie, Jotomicron, Lowellian, Merovingian, Sverdrup, Flauto Dolce, Hadal, Jleedev, GreatWhiteNortherner, Giftlite, Jacoplane, Haeleth, Lupin, Alison, Markus Kuhn, Bensaccount, Dun- charris, Guanaco, Dmmaus, Mboverload, Siroxo, Sinclair44, Eequor, Gadfium, Knutux, LiDaobing, Slowking Man, Yath, Rdsmith4, Kevin B12, Icairns, Talrias, TreyHarris, NoPetrol, Austin Hair, Shadypalm88, SamuelScarano, Ratiocinate, PhotoBox, Kaverin, Discospinster, Rich Farmbrough, Cacycle, Vsmith, Mecanismo, Peak Freak, Paul August, Bender235, Ngchen, Mykhal, Rubicon, Kbh3rd, Sfahey, Edwinstearns, Hayabusa future, Evand, Edward Z. Yang, Shanes, Sietse Snel, Bobo192, Dragon76, DimaDorfman, Smalljim, Get It, Dungodung, Colonel Cow, Congruence, Oolong, Jumbuck, Danski14, Siim, Alansohn, Keenan Pepper, Plumbago, Benjah-bmm27, AzaToth, Katana, Mac Davis, Walkerma, Ynhockey, Pion, Rickyp, Velella, SidP, Cburnett, Suruena, Egg, TenOfAllTrades, Vuo, Gene Nygaard, Bsdlogical, Martian, Kazvor- pal, Kbolino, Lkinkade, Jeffrey O. Gustafson, Woohookitty, DavidK93, Benbest, Pol098, Amigadave, Hdante, Mangojuice, GregorB, Way- ward, Prashanthns, Marudubshinki, Emerson7, Graham87, V8rik, Chun-hian, Snafflekid, Rjwilmsi, Coemgenus, Nightscream, Adjusting, Ve- gaswikian, Tomtheman5, Klortho, Vuong Ngan Ha, Titoxd, FlaBot, Latka, SouthernNights, Piyrwq, RexNL, Gurch, Karelj, ApprenticeFan, Lmatt, Alphachimp, Supersaiyanplough, Physchim62, King of Hearts, Chobot, DVdm, John Dalton, 334a, Protarion, EamonnPKeane, Yurik- Bot, Hairy Dude, Markhoney, Taejo, Bhny, SluggoOne, Crumbsucker, Ansell, Stephenb, Russoc4, Manop, Archelon, Yyy, Wimt, Anomalocaris, NawlinWiki, Długosz, Djm1279, Sir48, Mulp, Shinmawa, Zwobot, Samir, Zephalis, DeadEyeArrow, Elkman, Haemo, Kkmurray, Arch o me- dian, Veatch, Phgao, Closedmouth, E Wing, JoanneB, Chriswaterguy, Vidarlo, ChemGardener, Itub, Xetrov znt, Doubleplusjeff, SmackBot, BAPhilp, InverseHypercube, Unyoyega, Bomac, KocjoBot, Ddcampayo, Jab843, Kintetsubuffalo, Edgar181, Nathan.tang, Gilliam, ERcheck, Hraefen, Persian Poet Gal, TheEndless, MalafayaBot, SchfiftyThree, Deli nk, Schlemazl, Octahedron80, Baronnet, A. B., Hgrosser, Scwlong, Can't sleep, clown will eat me, Mulder416, Frap, Oceanblast, VMS Mosaic, Addshore, Yosha, Flyguy649, Makemi, Nakon, Cubbi, RandomP, Drphilharmonic, BryanG, Mwtoews, Jitterro, Shushruth, Ziggle, Jóna Þórunn, Saippuakauppias, Kukini, Horiavulpe, Will Beback, Sashato- Bot, Kuru, J. Finkelstein, Scientizzle, WildLava, Kingfisherswift, Fophillips, Mgiganteus1, Olin, IronGargoyle, 041744, Carhas0, Jared W, Beetstra, George The Dragon, Bendzh, Fangfufu, MTSbot, Darry2385, Rickington, BranStark, Dangal, HisSpaceResearch, Colonel Warden, JoeBot, Skapur, Basicdesign, Shoeofdeath, Goalkeeper432, Oobug, Lenoxus, Thricecube, Tawkerbot2, Conrad.Irwin, Fvasconcellos, Friendly Neighbour, Cheer chick, Tinymonster4, Dycedarg, Chrumps, Galo1969X, JohnCD, Leevanjackson, GHe, Green caterpillar, Outriggr, Simply south, Cydebot, Kupirijo, Kanags, Mike Christie, Dadofsam, Zginder, TMaster, Rracecarr, Tkynerd, Tawkerbot4, Shirulashem, Christian75, Peppage, Shrish, Troy17, Omicronpersei8, Soadquake981, Thijs!bot, Poorleno, ManN, Jaypunkrawk, Mcoop06, Mojo Hand, Trevyn, Jojan, Marek69, Speedyboy, DmitTrix, Electron9, James086, Dfrg.msc, AgentPeppermint, Flarity, Nerdman01, Escarbot, AntiVandalBot, Tiagoma, Saimhe, Seaphoto, Jayron32, Jacchigua, Pwhitwor, Jj137, LibLord, Axxaer, Lperez2029, Spencer, Myanw, Joehall45, JesseG88, JAnDbot, Deflective, Husond, Anand wiki, Andonic, Vl'hurg, Kerotan, LittleOldMe, Steveprutz, Bencherlite, Merlin002, Canjth, Swikid, Bongwarrior, VoABot II, Wikidudeman, JNW, J.P.Lon, Arperry, Avicennasis, 28421u2232nfenfcenc, Ragimiri, Allstarecho, DerHexer, Philg88, GermanX, ExNoctem, Limtohhan, I B Wright, Mateuscb, G.A.S, S3000, MartinBot, Infrangible, Arjun01, NAHID, ChemNerd, Bfesser, Rettetast, The- Egyptian, R'n'B, Alexrussell101, Leyo, Fletcher12, Paranomia, J.delanoy, CFCF, Bogey97, Nbauman, Musicmojo, Piercetheorganist, Terrek, Arcette, Eliz81, DoC352, Katalaveno, Stan J Klimas, Mahewa, Mikael Häggström, Vorx, Hut 6.5, Polska Pierogi, Sd31415, SJP, Ukt-zero, Josh Tumath, Natl1, JavierMC, Max skill1, MikeLeeds, Sébastien Bruneau, CardinalDan, X!, Deor, 28bytes, VolkovBot, CWii, Thedjatclu- brock, Jennavecia, AlnoktaBOT, Soliloquial, Ryan032, Philip Trueman, DoorsAjar, TXiKiBoT, Caster23, Miranda, Rei-bot, Anonymous Dis- sident, AlexDenney, Ask123, Qxz, Sintaku, LeaveSleaves, DoktorDec, Mashimaroiscute, Cremepuff222, Sp1979, X-TECHNO-X, Maxim, Madhero88, Rogerdpack, Eubulides, R45, Superjustinbros., Lamro, Orange32, Macbeth11, Synthebot, Df747jet, Tapalmer99, Maethordaer, ColemanJ, Mar vin kaiser, Mrz1818, Cindamuse, AlleborgoBot, TheBendster, Lando5, PGWG, Petergans, Pengwen1800, BriEnBest, SieBot, Punk Rocka 07, Scarian, Caltas, Matthew Yeager, Ryanfrm, RJaguar3, Triwbe, Smsarmad, Calabraxthis, Happysailor, Audree, Oxymoron83, AnonGuy, Ks0stm, Hatster301, Abmcdonald, Wodickey, Denisarona, WakingLili, Elassint, ClueBot, Snigbrook, Foxj, Jorl17, Saddhiyama, Freebullets, Yamakiri, Ectomaniac, Xavexgoem, CounterVandalismBot, Xenon54, Blanchardb, Michał Sobkowski, Amiya Sarkar, Neverquick, Puchiko, DragonBot, Excirial, Shinkolobwe, Lartoven, Danmichaelo, Terra Xin, Jotterbot, Promethean, Dekisugi, Thehelpfulone, La Pianista, BBBBBRRRRAAAAPPPP, Thingg, Wnt, Party, DumZiBoT, Rvoorhees, Chimchar monferno, Darkicebot, XLinkBot, Katpjotr, Qae, Dee0789, Gonzonoir, Stickee, Drvestone, Ost316, DocEvers, Mccally, MystBot, Vqors, Chuender, Airplaneman, Freestyle-69, HexaChord, Lollipoopz, Addbot, Element16, Friginator, Mdawg123, Mr. Wheely Willy Guy, Fieldday-sunday, CanadianLinuxUser, Asphatasawhale, NjardarBot, MrOl- lie, Download, CUSENZA Mario, Professor carlos, Lukeduke404, Tide rolls, Lightbot, Yobot, Tohd8BohaithuGh1, Senator Palpatine, Heejinny, II MusLiM HyBRiD II, Washburnmav, THEN WHO WAS PHONE?, Nallimbot, Knownot, AnomieBOT, Fecor, 1exec1, Jim1138, Accuruss, Karthickbala, Healthtotem, Materialscientist, Limideen, RobertEves92, Jhmpub, The High Fin Sperm Whale, Citation bot, OllieFury, Carl- sotr, Maxis ftw, Cuzbff3, Clark89, Mavrisa, Xqbot, Jonathanmcguinness, Plumpurple, Melmann, Gigemag76, Samman600, Br77rino, Um8zcw, Hi878, RibotBOT, Smallman12q, Shadowjams, Jsorr, Ddroar, FrescoBot, Silence of the night, Craig Pemberton, Citation bot 1, Åkebråke, Re- drose64, Tintenfischlein, Pinethicket, I dream of horses, Elockid, HRoestBot, Alltat, Yahia.barie, V.narsikar, CHawc, Nepenthes9997, RedBot, Robvanvee, Pantjz, Vrenator, Jeffrd10, Tbhotch, Dcastorina, Elikrieg, DARTH SIDIOUS 2, Solzhenitsyn1, Updatehelper, Bento00, Friend of a friends, EmausBot, Cpeditorial, Immunize, Heracles31, ScottyBerg, Nurath224, GoingBatty, Minimac’s Clone, Slightsmile, The Mysterious El Willstro, Asheara, Wikipelli, K6ka, Auró, Drpepper469, Chricho, JSquish, Tickle me gusta, White Trillium, Josve05a, WebmasterPhion, Bfdhsjla, Dffgd, 0Shadru, Carlos D. Caridad, Wayne Slam, Rsrinath1995, L Kensington, Danball7, WaterCrane, One.Ouch.Zero, DASHBo- tAV, Phguy, Berberisb, Petrb, ClueBot NG, Satellizer, Tariq.aljarah, XXkatarmaXx, Baseball Watcher, DieSwartzPunkt, Cntras, Finniganawak- ens, Adwiii, Widr, Arrit, Lexipoo313, Helpful Pixie Bot, HMSSolent, Bibcode Bot, IkeMay708, Lowercase sigmabot, Msaunier, MusikAnimal, Xxxxn1l0xxxx, Mark Arsten, FutureTrillionaire, Dainomite, Joydeep, Bradzarb, Baller29, Grass123, Al22771, Zedshort, DD dev, Morning Sun- shine, Archit 22, Achowat, Sgrover924, Poopingpoop, W192, Jakebarrington, Pratyya Ghosh, Tazzy284834u83, Abdulwahabmalik, Mediran, Blegat, Webclient101, Lugia2453, Ozia22900, Paikrishnan, JakeWi, Jakec, HoboMcJoe, Monkbot, Bfoxx1919, Fun8001, HelloThereMinions, Boy Seeks Girl Tonight and Anonymous: 1043 • Chemical reaction Source: http://en.wikipedia.org/wiki/Chemical%20reaction?oldid=638268413 Contributors: Marj Tiefert, Mav, Bryan Derksen, Tarquin, Andre Engels, Toby Bartels, Rlee0001, Ewen, Dwmyers, Shellreef, Gabbe, Ixfd64, Pcb21, Ahoerstemeier, Schneelocke, Ec5618, Aion, 4lex, Phil Boswell, Gentgeen, Robbot, Cdang, Academic Challenger, Hadal, Wikibot, HaeB, Carnildo, Tobias Bergemann, Cen- trx, Giftlite, Tom harrison, Iridium77, Everyking, Bensaccount, Guanaco, Foobar, James Crippen, Antandrus, OverlordQ, Jossi, Rdsmith4, Tail, Sam Hocevar, Neutrality, Backdoor, Alperen, Grstain, Discospinster, Rich Farmbrough, Guanabot, Cacycle, Vsmith, HeikoEvermann, Suchire, Dave souza, Ivan Bajlo, Paul August, ESkog, CanisRufus, MBisanz, El C, Triona, ~K, Bobo192, Whosyourjudas, Apsmif101, Cmdr- jameson, Elipongo, Tomgally, La goutte de pluie, Jojit fb, Kjkolb, GChriss, MPerel, Kierano, Benbread, Danski14, Alansohn, Keenan Pepper, 76 CHAPTER 6. CHEMICAL REACTION

Iothiania, Riana, AzaToth, Walkerma, Malo, Snowolf, Wtmitchell, Shoefly, Vuo, Etherwings, Gene Nygaard, LukeSurl, Duplode, TigerShark, Camw, Kristaga, Wayward, Palica, A3r0, Mandarax, Tjbk tjb, Magister Mathematicae, V8rik, Galwhaa, MJSkia1, Ikh, Salix alba, Ekspi- ulo, Makaristos, S Schaffter, Bhadani, Yamamoto Ichiro, FlaBot, Nihiltres, RexNL, Gurch, Ayla, Takometer, Valermos, Physchim62, King of Hearts, Chobot, Hall Monitor, YurikBot, Angus Lepper, RobotE, Mukkakukaku, Aznph8playa, GLaDOS, Wavesmikey, Lar, Sbalaji1984, Stephenb, Rsrikanth05, NawlinWiki, Jaxl, Exir Kamalabadi, Excession, Bobbo, Wonglokking, RUL3R, Amcfreely, ICanAlwaysChangeThis- Later, Tony1, Syrthiss, Everyguy, Deville, Warfreak, Јованвб, Ybbor, Junglecat, Jonathan.s.kt, GrinBot, Airconswitch, ChemGardener, Itub, Crystallina, SmackBot, Tarret, KnowledgeOfSelf, David Shear, Blue520, Bomac, Jrockley, Delldot, Jab843, Edgar181, HeartofaDog, Srnec, Commander Keane bot, Hmains, Skizzik, Andy M. Wang, Hugo-cs, Chris the speller, TimBentley, RDBrown, Bduke, Dreg743, Miquonranger03, SchfiftyThree, Complexica, DHN-bot, Sbharris, Colonies Chris, Hallenrm, Darth Panda, Brinerustle, Audriusa, Can't sleep, clown will eat me, PoiZaN, Vulcanstar6, EvelinaB, Rrburke, SundarBot, Stevenmitchell, Richard001, RandomP, Weregerbil, DMacks, DDima, Sadi Carnot, Click- etyclack, Ugur Basak Bot, Ceoil, Cumbrowski, SashatoBot, Nishkid64, Mouse Nightshirt, Zahid Abdassabur, Kuru, John, Matthiasobermann, Gobonobo, Evenios, Mbeychok, DaRealFoo17, Goodnightmush, Minglex, IronGargoyle, Slakr, Beetstra, Martinp23, Mr Stephen, Funnybunny, Michael12345, EEPROM Eagle, MTSbot, Caiaffa, Levineps, Simon12, Iridescent, Joseph Solis in Australia, Walton One, Sam Li, Civil En- gineer III, Courcelles, Tawkerbot2, Dlohcierekim, Fvasconcellos, Top o My Class, JForget, Tanthalas39, Ale jrb, Benwildeboer, Moreschi, Neelix, Ispy1981, MrFish, Myasuda, Badseed, Sopoforic, Abeg92, A876, Mike Christie, Rifleman 82, Gogo Dodo, Anonymi, Tawkerbot4, Shirulashem, Christian75, Malleus Fatuorum, Thijs!bot, Epbr123, Daa89563, Marek69, John254, NorwegianBlue, Tellyaddict, Macaddict10, Escarbot, Mentifisto, AntiVandalBot, Luna Santin, Seaphoto, Opelio, QuiteUnusual, Smartse, Farosdaughter, Myanw, Res2216firestar, JAnD- bot, Leuko, CosineKitty, Hut 8.5, MSBOT, .anacondabot, Acroterion, Bongwarrior, VoABot II, Ronstew, Usien6, Lacort, Brusegadi, All- starecho, User A1, PoliticalJunkie, Chris G, DerHexer, Phalphalak, Calltech, Gjd001, MartinBot, Mythealias, BetBot, ChemNerd, Mschel, Mausy5043, Slash, J.delanoy, C Ronald, Bogey97, Joshua777, Eduemoni, Uncle Dick, Kemiv, Thermbal, Eliz81, Katalaveno, LordAnubisBOT, Danewlosed, Gurchzilla, AntiSpamBot, NewEnglandYankee, SJP, LeighvsOptimvsMaximvs, Mufka, MetsFan76, Widawski, Bob, Jamesontai, WarFox, Mihas-bot, Squids and Chips, Idioma-bot, Lights, Nikthestunned, VolkovBot, Morenooso, Jeff G., Nburden, AlnoktaBOT, TheOther- Jesse, Barneca, Philip Trueman, TXiKiBoT, Zidonuke, Technopat, Arnon Chaffin, Qxz, Someguy1221, Anna Lincoln, Sjr 14, KyleRGiggs, Jackfork, Cremepuff222, BotKung, Ilyushka88, Maxim, Shanata, Finngall, Wikiachanger, Teh roflmaoer, Carinemily, Enviroboy, Brianga, Fis- cher.sebastian, Logan, LuigiManiac, NHRHS2010, SieBot, Sonicology, Ttony21, Tresiden, BotMultichill, Meldor, Winchelsea, Dawn Bard, Yintan, Arda Xi, Keilana, Nicolaidisd, Tiptoety, Oda Mari, Yourmomsface, Bananastalktome, Oxymoron83, Techman224, Hobartimus, Samiel cadmium, C'est moi, StaticGull, Amanafu, Ainlina, MBK004, ClueBot, The Thing That Should Not Be, Rodhullandemu, RWardy, Cory vol- com, Boing! said Zebedee, CounterVandalismBot, Piledhigheranddeeper, Jusdafax, Erebus Morgaine, Flyingbox, Eeekster, NuclearWarfare, Promethean, DeltaQuad, BOTarate, Thingg, Aitias, Wuzur, Versus22, Burner0718, SoxBot III, Templarion, Darkicebot, Jmanigold, Connor- crazy15, XLinkBot, BodhisattvaBot, Jovianeye, Rror, Little Mountain 5, Avoided, Skarebo, ErkinBatu, Badgernet, Noctibus, Kaiwhakahaere, Klundarr, Addbot, Willking1979, Some jerk on the Internet, Captain-tucker, Friginator, Fieldday-sunday, Laurinavicius, Kman543210, Cana- dianLinuxUser, Ka Faraq Gatri, Morning277, Chamal N, EconoPhysicist, Jgmikulay, Bassbonerocks, West.andrew.g, Numbo3-bot, Tide rolls, David0811, Artichoke-Boy, Luckas-bot, Yobot, 2D, Cflm001, II MusLiM HyBRiD II, The Earwig, THEN WHO WAS PHONE?, Daniele Pugliesi, Jenny.tsukino, 9258fahsflkh917fas, Piano non troppo, Simon the Likable, Kingpin13, Sólyomszem, Materialscientist, Mike13409, The High Fin Sperm Whale, Citation bot, ROFLimeditinghistory, Tasha Cadd, GB fan, LilHelpa, Marshallsumter, Gsmgm, Vulcan Hephaestus, Brane.Blokar, Obersachsebot, Xqbot, Cureden, Canman512, 4twenty42o, What!?Why?Who?, Davidcallowhill, Mein2d, The Evil IP address, Maddie!, GrouchoBot, Gulgothal, Isym444, Earlypsychosis, RibotBOT, SassoBot, Mgtrevisan, GhalyBot, Lilac Purple, Phirefor1, Shadowjams, Kjrogers23, YusrSehl, Prari, FrescoBot, Tangent747, Josewu, Helloguy123, HJ Mitchell, HamburgerRadio, Citation bot 1, Amplitude101, Nir- mos, Redrose64, Pinethicket, I dream of horses, Meddlingwithfire, A8UDI, V.narsikar, Hariehkr, Phearson, Σ, Footwarrior, Nafile, Dac04, Jauhienij, TobeBot, Michelle Garratt, Rudy16, Reaper Eternal, Everyone Dies In the End, Specs112, Diannaa, Adi4094, Wikipidea123, Jen- Van, Tbhotch, Reach Out to the Truth, DARTH SIDIOUS 2, TjBot, Bhawani Gautam, Vishwarun.kannan, Jiggajason, CanadianPenguin, Or- phan Wiki, Immunize, Lolmastar, Heracles31, Racerx11, Koolabhinavr, Gr8bambam, Tommy2010, Mwkeller17, JSquish, HiW-Bot, ZéroBot, Splibubay, Wackywace, EWikist, SubZero..Vighu.., Puffin, R7000, Jcaraballo, E2w killer, L'ecrivant, Staticd, 28bot, ClueBot NG, Louisflakes, Ernie2506, Blazinpimp69, Fauzan, Amorgan103, Delusion23, Amberbrown842, Imbored32, Widr, NuclearEnergy, MandaMeow, Helpful Pixie Bot, Jamboy23, Magicfrisbeekid, Bibcode Bot, Lowercase sigmabot, Ienjoyanapple, TetraEleven, Hashem sfarim, Kndimov, PhnomPencil, Wiki13, Mark Arsten, Supra256, Jerin.wiki.jacob, Writ Keeper, NotWith, C.Rose.Kennedy.2, WeeJay10, Klilidiplomus, Shaun, Anbu121, NGC 2736, Testem, ChrisGualtieri, Albertshilling28, Belfurd, Balajigeneralknowledge, Sliikas, Cmrufo, Dexbot, Dunno47, Webclient101, Lu- gia2453, Frosty, SFK2, Paikrishnan, AntiguanAcademic, Ugog Nizdast, Zenibus, Brogan 117, Yka.yash, Y-S.Ko, Behshd, Tu A.Tordes and Anonymous: 1036

6.16.2 Images

• File:216_pH_Scale-01.jpg Source: http://upload.wikimedia.org/wikipedia/commons/2/23/216_pH_Scale-01.jpg License: CC BY 3.0 Con- tributors: & Physiology, Connexions Web site. http://cnx.org/content/col11496/1.6/, Jun 19, 2013. Original artist: OpenStax College • File:225_Peptide_Bond-01.jpg Source: http://upload.wikimedia.org/wikipedia/commons/2/26/225_Peptide_Bond-01.jpg License: CC BY 3.0 Contributors: Anatomy & Physiology, Connexions Web site. http://cnx.org/content/col11496/1.6/, Jun 19, 2013. Original artist: OpenStax College • File:3d_tRNA.png Source: http://upload.wikimedia.org/wikipedia/commons/f/f1/3d_tRNA.png License: CC BY-SA 3.0 Contributors: Own work Original artist: Vossman • File:Acetic-acid-dissociation-3D-balls.png Source: http://upload.wikimedia.org/wikipedia/commons/9/96/ Acetic-acid-dissociation-3D-balls.png License: Public domain Contributors: Own work Original artist: Ben Mills • File:Activation_energy.svg Source: http://upload.wikimedia.org/wikipedia/commons/2/24/Activation_energy.svg License: Copyrighted free use Contributors: ? Original artist: ? • File:Alpha-D-Glucopyranose.svg Source: http://upload.wikimedia.org/wikipedia/commons/c/c6/Alpha-D-Glucopyranose.svg License: Pub- lic domain Contributors: Own work Original artist: NEUROtiker 6.16. TEXT AND IMAGE SOURCES, CONTRIBUTORS, AND LICENSES 77

• File:Alpha-D-glucopyranose-2D-skeletal.png Source: http://upload.wikimedia.org/wikipedia/commons/4/48/ Alpha-D-glucopyranose-2D-skeletal.png License: Public domain Contributors: ? Original artist: ? • File:Amylose.svg Source: http://upload.wikimedia.org/wikipedia/commons/4/45/Amylose.svg License: CC-BY-SA-3.0 Contributors: ? Origi- nal artist: ? • File:Antoine_lavoisier_color.jpg Source: http://upload.wikimedia.org/wikipedia/commons/6/6c/Antoine_lavoisier_color.jpg License: Public domain Contributors: Courtesy of Chemical Achievers Original artist: Louis Jean Desire Delaistre, after Boilly • File:Azobenzene_isomerization_de.svg Source: http://upload.wikimedia.org/wikipedia/commons/2/22/Azobenzene_isomerization_de.svg License: Public domain Contributors: Own work Original artist: Yikrazuul • File:Baeyer-Villiger-Oxidation-V1.svg Source: http://upload.wikimedia.org/wikipedia/commons/3/3c/Baeyer-Villiger-Oxidation-V1.svg License: Public domain Contributors: Own work Original artist: Faynara • File:Beta-D-glucopyranose-2D-skeletal.png Source: http://upload.wikimedia.org/wikipedia/commons/6/60/ Beta-D-glucopyranose-2D-skeletal.png License: Public domain Contributors: ? Original artist: ? • File:Carbonic_anhydrase.png Source: http://upload.wikimedia.org/wikipedia/commons/4/40/Carbonic_anhydrase.png License: Public do- main Contributors: Own work Original artist: Labrador2 • File:Carbonic_anhydrase_reaction_in_tissue.svg Source: http://upload.wikimedia.org/wikipedia/commons/f/fe/Carbonic_anhydrase_ reaction_in_tissue.svg License: CC-BY-SA-3.0 Contributors: Image:Activation2 updated.svg Original artist: Fvasconcellos (talk · contribs) • File:Cellulose-Ibeta-from-xtal-2002-3D-balls.png Source: http://upload.wikimedia.org/wikipedia/commons/f/f9/ Cellulose-Ibeta-from-xtal-2002-3D-balls.png License: Public domain Contributors: Own work Original artist: Ben Mills • File:Chaperonin_1AON.png Source: http://upload.wikimedia.org/wikipedia/commons/6/6c/Chaperonin_1AON.png License: CC BY-SA 3.0 Contributors: Own work Original artist: Thomas Splettstoesser • File:Chemical_precipitation_diagram.svg Source: http://upload.wikimedia.org/wikipedia/commons/7/78/Chemical_precipitation_diagram. svg License: Public domain Contributors: Own work Original artist: Vectorized by ZooFari; raster by ZabMilenko • File:Chemical_reactions.svg Source: http://upload.wikimedia.org/wikipedia/commons/d/dc/Chemical_reactions.svg License: CC BY-SA 3.0 Contributors: Own work Original artist: Aushulz • File:Combustion_reaction_of_methane.jpg Source: http://upload.wikimedia.org/wikipedia/commons/7/7c/Combustion_reaction_of_ methane.jpg License: CC BY-SA 3.0 Contributors: • Methane-3D-space-filling.svg Original artist: • Jynto • File:Common-salt.jpg Source: http://upload.wikimedia.org/wikipedia/commons/4/4d/Common-salt.jpg License: CC BY-SA 3.0 Contributors: Own work Original artist: Edal Anton Lefterov • File:Common_lipids_lmaps.png Source: http://upload.wikimedia.org/wikipedia/commons/2/20/Common_lipids_lmaps.png License: CC- BY-SA-3.0 Contributors: Transferred from en.wikipedia; transfered to Commons by User:Frokor using CommonsHelper. Original artist: Eoin Fahy Original uploader was Lmaps at en.wikipedia • File:Commons-logo.svg Source: http://upload.wikimedia.org/wikipedia/en/4/4a/Commons-logo.svg License: ? Contributors: ? Original artist: ? • File:Competitive_inhibition.svg Source: http://upload.wikimedia.org/wikipedia/commons/f/fe/Competitive_inhibition.svg License: Public domain Contributors: Image:Competitive inhibition.png Original artist: Authored by Jerry Crimson Mann, modified by TimVickers, vectorized by Fvasconcellos • File:Cope_Rearrangement_Scheme.png Source: http://upload.wikimedia.org/wikipedia/commons/1/15/Cope_Rearrangement_Scheme.png License: CC-BY-SA-3.0 Contributors: ? Original artist: ? • File:Cscr-featured.svg Source: http://upload.wikimedia.org/wikipedia/en/e/e7/Cscr-featured.svg License: ? Contributors: ? Original artist: ? • File:D-glucose_color_coded.png Source: http://upload.wikimedia.org/wikipedia/commons/8/8d/D-glucose_color_coded.png License: Public domain Contributors: Transferred from en.wikipedia Original artist: Original uploader was ClockworkSoul at en.wikipedia • File:DNA123_rotated.png Source: http://upload.wikimedia.org/wikipedia/commons/d/d9/DNA123_rotated.png License: Public domain Con- tributors: http://www.dna.gov/ , en:DNA123_rotated.png Original artist: DNA • File:Diels_Alder_Mechanismus.svg Source: http://upload.wikimedia.org/wikipedia/commons/6/6a/Diels_Alder_Mechanismus.svg License: Public domain Contributors: Own work (Original text: Roland1952) Original artist: Roland1952 at German Wikipedia • File:Diels_Alder_Orbitale.svg Source: http://upload.wikimedia.org/wikipedia/commons/2/2b/Diels_Alder_Orbitale.svg License: CC BY-SA 3.0 Contributors: Transferred from de.wikipedia; transferred to Commons by User:Leyo using CommonsHelper. Original artist: Roland Mattern. Original uploader was Roland1952 at de.wikipedia • File:E1-mechanism.svg Source: http://upload.wikimedia.org/wikipedia/commons/7/76/E1-mechanism.svg License: Public domain Contribu- tors: Own work Original artist: Matthias M. • File:E1cb-mechanism.svg Source: http://upload.wikimedia.org/wikipedia/commons/3/34/E1cb-mechanism.svg License: Public domain Con- tributors: Own work Original artist: Matthias M. • File:E2-mechanism.svg Source: http://upload.wikimedia.org/wikipedia/commons/6/61/E2-mechanism.svg License: Public domain Contribu- tors: Own work Original artist: Matthias M. • File:Eduardbuchner.jpg Source: http://upload.wikimedia.org/wikipedia/commons/b/b2/Eduardbuchner.jpg License: Public domain Contrib- utors: Les Prix Nobel, 1907[1] Original artist: Nobel Foundation 78 CHAPTER 6. CHEMICAL REACTION

• File:Electrophilic_aromatic_substitution.svg Source: http://upload.wikimedia.org/wikipedia/commons/e/e1/Electrophilic_aromatic_ substitution.svg License: Public domain Contributors: Own work Original artist: Yikrazuul • File:Enzyme_allostery_en.svg Source: http://upload.wikimedia.org/wikipedia/commons/3/3b/Enzyme_allostery_en.svg License: CC BY-SA 3.0 Contributors: • File:Enzyme allostery es.svg Original artist: File:Enzyme allostery es.svg: File:Enzyme allostery es.png: File:Enzyme allostery.png: Allostery.png: Nicolas Le Novere (talk). • File:Ferrocene-from-xtal-3D-balls.png Source: http://upload.wikimedia.org/wikipedia/commons/7/7a/Ferrocene-from-xtal-3D-balls.png License: Public domain Contributors: Own work Original artist: Ben Mills • File:Folder_Hexagonal_Icon.svg Source: http://upload.wikimedia.org/wikipedia/en/4/48/Folder_Hexagonal_Icon.svg License: Cc-by-sa-3.0 Contributors: ? Original artist: ? • File:Foodlogo2.svg Source: http://upload.wikimedia.org/wikipedia/commons/d/d6/Foodlogo2.svg License: CC-BY-SA-3.0 Contributors: Original Original artist: Seahen • File:GLO1_Homo_sapiens_small_fast.gif Source: http://upload.wikimedia.org/wikipedia/commons/a/ae/GLO1_Homo_sapiens_small_ fast.gif License: GFDL Contributors: Own work Original artist: WillowW • File:Genetic_code.svg Source: http://upload.wikimedia.org/wikipedia/commons/3/37/Genetic_code.svg License: CC-BY-SA-3.0 Contribu- tors: Own work Original artist: Madprime • File:Glucose_Fisher_to_Haworth.gif Source: http://upload.wikimedia.org/wikipedia/commons/a/af/Glucose_Fisher_to_Haworth.gif Li- cense: CC-BY-SA-3.0 Contributors: Made by me with xdrawchem and gimp. Original artist: Wikimuzg • File:Glycolysis.svg Source: http://upload.wikimedia.org/wikipedia/commons/a/a0/Glycolysis.svg License: CC BY-SA 3.0 Contributors: Own work Original artist: This vector image was created with Inkscape • File:H-Add-El.Mechanismus.PNG Source: http://upload.wikimedia.org/wikipedia/commons/3/34/H-Add-El.Mechanismus.PNG License: Public domain Contributors: selbst erstellt mit ChemDraw 8.0 Original artist: Eschenmoser • File:HBr-Addition.png Source: http://upload.wikimedia.org/wikipedia/commons/a/a5/HBr-Addition.png License: Public domain Contribu- tors: selbst erstellt mit ChemDraw 8.0 Original artist: Eschenmoser • File:Helmet_logo_for_Underwater_Diving_portal.png Source: http://upload.wikimedia.org/wikipedia/commons/5/5e/Helmet_logo_ for_Underwater_Diving_portal.png License: ? Contributors: Kask-nurka.jpg Kask-nurka.jpg Original artist: Kask-nurka.jpg: User:Julo • File:Hexokinase_ball_and_stick_model,_with_substrates_to_scale_copy.png Source: http://upload.wikimedia.org/wikipedia/commons/ e/e7/Hexokinase_ball_and_stick_model%2C_with_substrates_to_scale_copy.png License: Public domain Contributors: Transferred from en.wikipedia; transferred to Commons by User:Leptictidium using CommonsHelper. Original artist: Original uploader was TimVickers at en.wikipedia • File:Induced_fit_diagram.svg Source: http://upload.wikimedia.org/wikipedia/commons/2/24/Induced_fit_diagram.svg License: Public do- main Contributors: Provided by TimVickers Original artist: Created by TimVickers, vectorized by Fvasconcellos • File:InternationalPaper6413.jpg Source: http://upload.wikimedia.org/wikipedia/commons/c/c5/InternationalPaper6413.jpg License: CC- BY-SA-3.0 Contributors: en:InternationalPaper6413.JPG Original artist: Pollinator • File:Issoria_lathonia.jpg Source: http://upload.wikimedia.org/wikipedia/commons/2/2d/Issoria_lathonia.jpg License: CC-BY-SA-3.0 Con- tributors: ? Original artist: ? • File:Kdo2-lipidA.png Source: http://upload.wikimedia.org/wikipedia/commons/3/3c/Kdo2-lipidA.png License: CC BY-SA 3.0 Contributors: Modified version of en:Image:Kdo2 lipidA.png Original artist: en:User:Lmaps and User:TimVickers • File:KendrewMyoglobin.jpg Source: http://upload.wikimedia.org/wikipedia/commons/e/ec/KendrewMyoglobin.jpg License: CC BY 2.5 Contributors: MRC Laboratory of Molecular Biology (Transferred from en.wikipedia by User:Mormegil). Original artist: © MRC Labora- tory of Molecular Biology, requests for higher resolution images should be sent to [email protected] (original uploader to the English Wikipedia was Dumarest) • File:Lactose.svg Source: http://upload.wikimedia.org/wikipedia/commons/0/04/Lactose.svg License: Public domain Contributors: Selfmade with ChemDraw. Original artist: Calvero. • File:Lemon.jpg Source: http://upload.wikimedia.org/wikipedia/commons/e/e4/Lemon.jpg License: CC BY-SA 2.5 Contributors: Own work Original artist: André Karwath aka Aka • File:Localisations02eng.jpg Source: http://upload.wikimedia.org/wikipedia/commons/6/6e/Localisations02eng.jpg License: CC BY-SA 2.5 Contributors: http://gfp-cdna.embl.de/ Original artist: Jeremy Simpson and Rainer Pepperkok • File:Methotrexate_and_folic_acid_compared.png Source: http://upload.wikimedia.org/wikipedia/commons/6/67/Methotrexate_and_ folic_acid_compared.png License: Public domain Contributors: en:Image:Methotrexate_and_folic_acid_compared.png Original artist: TimVickers • File:Michaelis-Menten_saturation_curve_of_an_enzyme_reaction.svg Source: http://upload.wikimedia.org/wikipedia/commons/9/99/ Michaelis-Menten_saturation_curve_of_an_enzyme_reaction.svg License: Public domain Contributors: http://en.wikipedia.org/wiki/Image: MM_curve_v3.png (PD) Original artist: fullofstars 6.16. TEXT AND IMAGE SOURCES, CONTRIBUTORS, AND LICENSES 79

• File:Mouse_cholera_antibody.png Source: http://upload.wikimedia.org/wikipedia/commons/a/a2/Mouse_cholera_antibody.png License: CC BY-SA 3.0 Contributors: Own work Original artist: Thomas Splettstoesser (www.scistyle.com) • File:Myoglobin.png Source: http://upload.wikimedia.org/wikipedia/commons/6/60/Myoglobin.png License: Public domain Contributors: self made based on PDB entry Original artist: →<ₐ ᵣₑ₌'//ₒₒ.ᵢᵢₑᵢₐ.ₒᵣ/ᵢᵢ/Uₑᵣ:AₐTₒ' ᵢₑ₌'Uₑᵣ:AₐTₒ'>Aₐ<ₐ ᵣₑ₌'//ₒₒ.ᵢᵢₑᵢₐ.ₒᵣ/ᵢᵢ/ Uₑᵣ_ₐ:AₐTₒ' ᵢₑ₌'Uₑᵣ ₐ:AₐTₒ'>Tₒ • File:NADH-3D-vdW.png Source: http://upload.wikimedia.org/wikipedia/commons/e/ed/NADH-3D-vdW.png License: Public domain Con- tributors: ? Original artist: ? • File:PHscalenolang.svg Source: http://upload.wikimedia.org/wikipedia/commons/b/bb/PHscalenolang.svg License: CC BY-SA 2.5 Contribu- tors: • PHscalenolang.png Original artist: PHscalenolang.png: myself, PatríciaR • File:Padlock-silver.svg Source: http://upload.wikimedia.org/wikipedia/commons/f/fc/Padlock-silver.svg License: CC0 Contributors: http:// openclipart.org/people/Anonymous/padlock_aj_ashton_01.svg Original artist: This image file was created by AJ Ashton. Uploaded from English WP by User:Eleassar. Converted by User:AzaToth to a silver color. • File:Paterno-Buchi_reaction.svg Source: http://upload.wikimedia.org/wikipedia/commons/2/24/Paterno-Buchi_reaction.svg License: Public domain Contributors: Own work Original artist: Su-no-G • File:People_icon.svg Source: http://upload.wikimedia.org/wikipedia/commons/3/37/People_icon.svg License: CC0 Contributors: OpenClipart Original artist: OpenClipart • File:Peptide-Figure-Revised.png Source: http://upload.wikimedia.org/wikipedia/commons/c/c9/Peptide-Figure-Revised.png License: CC BY-SA 3.0 Contributors: Own work Original artist: Chemistry-grad-student • File:Peptide_group_resonance.png Source: http://upload.wikimedia.org/wikipedia/commons/1/17/Peptide_group_resonance.png License: CC-BY-SA-3.0 Contributors: Transfered from en.wikipedia Original artist: Original uploader was WillowW at en.wikipedia • File:Phenylalanine_hydroxylase_brighter.jpg Source: http://upload.wikimedia.org/wikipedia/commons/9/97/Phenylalanine_hydroxylase_ brighter.jpg License: Public domain Contributors: en:Image:Phenylalanine_hydroxylase_brighter.jpg Original artist: TimVickers • File:Phosphatidyl-Ethanolamine.png Source: http://upload.wikimedia.org/wikipedia/commons/d/d2/Phosphatidyl-Ethanolamine.png Li- cense: Public domain Contributors: Originally from en.wikipedia; description page is/was here. See Stryer L, Berg JM, Tymoczko JL. (2007). Biochemistry. San Francisco: W.H. Freeman. ISBN 0-7167-8724-5. p. 330. Original artist: Original uploader was Jag123 at en.wikipedia • File:Phospholipids_aqueous_solution_structures.svg Source: http://upload.wikimedia.org/wikipedia/commons/c/c6/Phospholipids_ aqueous_solution_structures.svg License: Public domain Contributors: Own work Original artist: Mariana Ruiz Villarreal ,LadyofHats • File:Plastic_spoon_n_Laundry_detergent_n_Washing_powder_in_white.jpg Source: http://upload.wikimedia.org/wikipedia/commons/ 7/7a/Plastic_spoon_n_Laundry_detergent_n_Washing_powder_in_white.jpg License: CC BY-SA 3.0 Contributors: Own work Original artist: Lebacno • File:Portal-puzzle.svg Source: http://upload.wikimedia.org/wikipedia/en/f/fd/Portal-puzzle.svg License: Public domain Contributors: ? Orig- inal artist: ? • File:Pot_catalytique_vue_de_la_structure.jpg Source: http://upload.wikimedia.org/wikipedia/commons/b/b2/Pot_catalytique_vue_de_la_ structure.jpg License: GFDL Contributors: Own work Original artist: The RedBurn • File:Protein_composite.png Source: http://upload.wikimedia.org/wikipedia/commons/5/54/Protein_composite.png License: CC BY-SA 3.0 Contributors: Own work (rendered with Cinema 4D) Original artist: Thomas Splettstoesser (www.scistyle.com) • File:Proteinviews-1tim.png Source: http://upload.wikimedia.org/wikipedia/commons/6/6e/Proteinviews-1tim.png License: CC-BY-SA-3.0 Contributors: Self created from PDB entry 1TIM using the freely available visualization and analysis package VMD Original artist: Opabinia regalis • File:Redox_reaction.png Source: http://upload.wikimedia.org/wikipedia/commons/e/ee/Redox_reaction.png License: Public domain Contrib- utors: Transfered from en.wikipedia Original artist: Original uploader was Bensaccount at en.wikipedia • File:Ribosome_mRNA_translation_en.svg Source: http://upload.wikimedia.org/wikipedia/commons/b/b1/Ribosome_mRNA_translation_ en.svg License: Public domain Contributors: Own work based on:[1], [2], [3], [4], [5], [6], [7], and [8]. Original artist: LadyofHats • File:Roquefort_cheese.jpg Source: http://upload.wikimedia.org/wikipedia/commons/9/92/Roquefort_cheese.jpg License: CC-BY-SA-3.0 Contributors: ? Original artist: ? • File:SN1_reaction_mechanism.png Source: http://upload.wikimedia.org/wikipedia/commons/b/bb/SN1_reaction_mechanism.png License: Public domain Contributors: Selfmade with ChemDraw. Original artist: Calvero. • File:SN2-Walden-before-and-after-horizontal-3D-balls.png Source: http://upload.wikimedia.org/wikipedia/commons/4/46/ SN2-Walden-before-and-after-horizontal-3D-balls.png License: Public domain Contributors: Own work Original artist: Ben Mills • File:SN2_reaction_mechanism.png Source: http://upload.wikimedia.org/wikipedia/commons/3/39/SN2_reaction_mechanism.png License: Public domain Contributors: Selfmade with ChemDraw. Original artist: Calvero. • File:Simple_mechanism.svg Source: http://upload.wikimedia.org/wikipedia/commons/9/96/Simple_mechanism.svg License: Public domain Contributors: Own work (Original caption: “I am author TimVickers (talk)”) Original artist: TimVickers at en.wikipedia • File:Sjb_whiskey_malt.jpg Source: http://upload.wikimedia.org/wikipedia/commons/3/32/Sjb_whiskey_malt.jpg License: CC-BY-SA-3.0 Contributors: en:Image:Sjb_whiskey_malt.jpg Original artist: Finlay_McWalter's friend SJB 80 CHAPTER 6. CHEMICAL REACTION

• File:Sphingomyelin-horizontal-2D-skeletal.png Source: http://upload.wikimedia.org/wikipedia/commons/9/92/ Sphingomyelin-horizontal-2D-skeletal.png License: Public domain Contributors: ? Original artist: ? • File:SpongeDiver.jpg Source: http://upload.wikimedia.org/wikipedia/commons/8/81/SpongeDiver.jpg License: Public domain Contributors: Own work Original artist: Bryan Shrode • File:Starchy-foods..jpg Source: http://upload.wikimedia.org/wikipedia/commons/5/5c/Starchy-foods..jpg License: Public domain Contribu- tors: ? Original artist: ? • File:Sucrose_3Dprojection.png Source: http://upload.wikimedia.org/wikipedia/commons/5/56/Sucrose_3Dprojection.png License: Public domain Contributors: Own work Original artist: glycoform • File:Symbol_list_class.svg Source: http://upload.wikimedia.org/wikipedia/en/d/db/Symbol_list_class.svg License: Public domain Contribu- tors: ? Original artist: ? • File:Symbol_support_vote.svg Source: http://upload.wikimedia.org/wikipedia/en/9/94/Symbol_support_vote.svg License: Public domain Contributors: ? Original artist: ? • File:TPI1_structure.png Source: http://upload.wikimedia.org/wikipedia/commons/1/1c/TPI1_structure.png License: Public domain Contrib- utors: based on 1wyi (http://www.pdb.org/pdb/explore/explore.do?structureId=1WYI), made in pymol Original artist: →<ₐ ᵣₑ₌'//ₒₒ.ᵢᵢₑᵢₐ. ₒᵣ/ᵢᵢ/Uₑᵣ:AₐTₒ' ᵢₑ₌'Uₑᵣ:AₐTₒ'>Aₐ<ₐ ᵣₑ₌'//ₒₒ.ᵢᵢₑᵢₐ.ₒᵣ/ᵢᵢ/Uₑᵣ_ₐ:AₐTₒ' ᵢₑ₌'Uₑᵣ ₐ:AₐTₒ'>Tₒ • File:ThermiteReaction.jpg Source: http://upload.wikimedia.org/wikipedia/commons/5/5b/ThermiteReaction.jpg License: CC BY-SA 3.0 Contributors: Own work - also at Flickr Original artist: User:Nikthestunned (Wikipedia) • File:Types_of_inhibition_en.svg Source: http://upload.wikimedia.org/wikipedia/commons/7/72/Types_of_inhibition_en.svg License: Public domain Contributors: en:Image:Inhibition.png (PD) Original artist: fullofstars • File:Universal_indicator_paper.jpg Source: http://upload.wikimedia.org/wikipedia/commons/2/2c/Universal_indicator_paper.jpg License: CC0 Contributors: Own work Original artist: Bordercolliez • File:Velp-thermitewelding-1.jpg Source: http://upload.wikimedia.org/wikipedia/commons/8/82/Velp-thermitewelding-1.jpg License: Pub- lic domain Contributors: http://en.wikipedia.org/wiki/Image:Velp-thermitewelding-1.jpg Original artist: Skatebiker • File:Walden-inversion-3D-balls.png Source: http://upload.wikimedia.org/wikipedia/commons/b/bb/Walden-inversion-3D-balls.png Li- cense: Public domain Contributors: Own work Original artist: Ben Mills • File:Wiki_letter_w_cropped.svg Source: http://upload.wikimedia.org/wikipedia/commons/1/1c/Wiki_letter_w_cropped.svg License: CC- BY-SA-3.0 Contributors: • Wiki_letter_w.svg Original artist: Wiki_letter_w.svg: Jarkko Piiroinen • File:Wikiquote-logo.svg Source: http://upload.wikimedia.org/wikipedia/commons/f/fa/Wikiquote-logo.svg License: Public domain Contrib- utors: ? Original artist: ? • File:Wiktionary-logo-en.svg Source: http://upload.wikimedia.org/wikipedia/commons/f/f8/Wiktionary-logo-en.svg License: Public domain Contributors: Vector version of Image:Wiktionary-logo-en.png. Original artist: Vectorized by Fvasconcellos (talk · contribs), based on original logo tossed together by Brion Vibber

6.16.3 Content license

• Creative Commons Attribution-Share Alike 3.0