REV1 Promotes PCNA Monoubiquitylation Through

RESEARCH ARTICLE REV1 promotes PCNA monoubiquitylation through interacting with ubiquitylated RAD18 Zhifeng Wang1, Min Huang1, Xiaolu Ma1, Huiming Li1, Tieshan Tang2,* and Caixia Guo1,*

ABSTRACT by providing a scaffold to facilitate polymerase switching at Translesion DNA synthesis (TLS) is a mode of DNA damage lesion sites (Guo et al., 2009). tolerance which plays an important role in genome mutagenesis Proliferating cell nuclear antigen (PCNA) is a replicative and chromatin integrity maintenance. Proliferating cell nuclear polymerase clamp, which becomes monoubiquitylated at Lys164 antigen (PCNA) monoubiquitylation is one of the key factors for in mammalian cells following various DNA damage treatments that TLS pathway choice. So far, it remains unclear how the TLS pathway cause stalling of the replication fork (Kannouche et al., 2004). – is elaborately regulated. Here, we report that TLS polymerase REV1 Monoubiquitylated PCNA (PCNA mUb) exhibits an enhanced can promote PCNA monoubiquitylation after UV radiation. Further interaction with Y-family polymerases (Guo et al., 2006b, 2008; studies revealed that this stimulatory effect is mediated through the Parker et al., 2007; Waters et al., 2009), and thus regulates their enhanced interaction between REV1 and ubiquitylated RAD18, access to the replicative ensemble stalled at a lesion to execute their – which facilitates the release of nonubiquitylated RAD18 from roles in lesion bypass. Given that PCNA mUb promotes the TLS ubiquitylated RAD18 trapping, after which RAD18 is recruited to pathway (Hoege et al., 2002; Moldovan et al., 2007; Chen et al., chromatin for its TLS function. Furthermore, we found that this 2011), many studies have been performed to understand how this in vivo stimulatory effect could also be detected after exposure to modification happens (Hedglin and Benkovic, 2015). In hydroxyurea or mitomycin C, but not methyl methanesulfonate addition to the major E3 ubiquitin ligase RAD18, several other E3 cdt2 (MMS), which is in line with the fact that ubiquitylated RAD18 could ligases, like RNF8 (Zhang et al., 2008) and CRL (Terai et al., – not be detected after exposure to MMS. 2010), have been reported to regulate PCNA mUb. Additionally, many factors, including apoptosis regulatory protein Siva (SIVA1) KEY WORDS: REV1, PCNA, RAD18, Ubiquitylation, Translesion DNA (Han et al., 2014), Spartan/C1orf124 [protein with sprT-like domain synthesis, UV at the N-terminus, also known as DNA damage protein targeting VCP (DVC1)] (Centore et al., 2012), MutS protein homolog 2 INTRODUCTION (MSH2) (Zlatanou et al., 2011; Lv et al., 2013), breast cancer 1 Cellular DNA is at risk of damage from a range of endogenous (BRCA1) (Tian et al., 2013), have also been found to regulate the and exogenous substances, which can result in genome instability RAD18-dependent PCNA–mUb. Ubiquitin-specific protease 1 and eventually lead to cancer or cell death. When DNA damage (USP1) also participates in the regulation of PCNA–mUb as a key occurs during replication, it will stall the replication fork, deubiquitylase (DUB) for deubiquitylating PCNA–mUb (Huang ultimately causing fork collapse and genome rearrangements et al., 2006). Recently, it was reported that monoubiquitylated (Jackson and Bartek, 2009; Ciccia and Elledge, 2010). To avoid RAD18 (RAD18–Ub) also regulates PCNA–mUb and TLS activity this, cells have evolved a translesion DNA synthesis (TLS) system (Zeman et al., 2014). RAD18–Ub not only releases itself from to replicate damaged DNA templates (Friedberg et al., 2005). chromatin (Zeman et al., 2014), but also sequesters nonubiquitylated Various specialized DNA polymerases, which include Polκ,Polη RAD18, preventing it from recruiting to chromatin. and REV1, are utilized in the TLS pathway (Ohmori et al., 2001; During studying the function(s) of REV1 in TLS, we accidentally Friedberg, 2005; Sale et al., 2012). After UV radiation, REV1 can observed that REV1 affects PCNA–mUb. We found that REV1 can be recruited to chromatin through the unique N-terminal BRCA1 promote the accumulation of RAD18 at chromatin and PCNA–mUb C terminus (BRCT) domain and its ubiquitin-binding motifs after UV radiation. Further studies indicated that this stimulatory (UBMs) (Guo et al., 2006a,b). Although the dCMP transferase effect is mediated through an enhanced interaction between REV1 activity of REV1 is conserved throughout eukaryotic evolution and RAD18–Ub, which facilitates the release of nonubiquitylated (Nelson et al., 1996; Zhang et al., 2002), this activity does not RAD18 from RAD18–Ub trapping followed by further recruitment account for its role in UV-induced mutagenesis. REV1 is found of RAD18 to chromatin for its TLS function. Interestingly, this to interact with other Y-family polymerases, including Polκ,Polη stimulatory effect could also be detected after treatments with and Polι, through its C-terminal polymerase interacting region hydroxyurea or mitomycin C (MMC), but not with methyl (PIR) (Guo et al., 2003). Therefore, it is likely that REV1 can methanesulfonate (MMS) which leads to the loss of RAD18–Ub. coordinate the activity of specialized DNA polymerases, possibly RESULTS

1 REV1 promotes PCNA monoubiquitylation Key Laboratory of Genomic and Precision Medicine, China Gastrointestinal – Cancer Research Center, Beijing Institute of Genomics, Chinese Academy of As PCNA mUb has been shown to interact with REV1 and mediate Sciences, Beijing 100101, China. 2State Key Laboratory of Membrane Biology, REV1 accumulation at UV-induced stalled replication sites, we Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China. wondered whether REV1 also affects UV-induced PCNA *Authors for correspondence ([email protected]; [email protected]) monoubiquitylation. To answer this question, we transfected 293T cells with siRNA directed against human REV1 (siREV1) and

Received 20 August 2015; Accepted 18 January 2016 examined the level of PCNA–mUb in the Triton-X-100-insoluble Journal of Cell Science

1223 RESEARCH ARTICLE Journal of Cell Science (2016) 129, 1223-1233 doi:10.1242/jcs.179408 fractions. We found that depletion of REV1 decreased the level of because PCNA–mUb does not seem to be necessary for its focus PCNA–mUb in the presence and absence of UV radiation (Fig. 1A). formation in cells either at S-phase or after damage treatments Conversely, we found that overexpression of GFP–REV1 in 293T (Essers et al., 2005). cells could increase the level of PCNA–mUb in the presence and absence of UV radiation (Fig. 1B). Interestingly, we found that the REV1 promotes PCNA–mUb independent of Polη and USP1 stimulatory effect of REV1 on PCNA–mUb is closely related to the Previous studies have shown that REV1 interacts with Polη (Guo level of REV1 expression; higher amounts of REV1 induced more et al., 2003) and Polη regulates PCNA–mUb (Durando et al., 2013), PCNA to be monoubiquitylated (Fig. 1C). These data indicate that leading us to wonder whether the stimulatory effect of REV1 on REV1 promotes basal and UV-induced PCNA–mUb, which is PCNA–mUb is mediated by Polη. We transfected GFP–REV1 into closely correlated to the level of REV1 expression. Additionally, we XP30RO–Polη cells and examined the level of PCNA–mUb in the performed PCNA immunofluorescence and detected no obvious presence and absence of Polη, and found that overexpression of change in PCNA focus formation in cells either depleted of or REV1 still promoted PCNA–mUb in the absence of Polη (Fig. 2A, overexpressing REV1 (Fig. S1). This result is to be expected lanes 1 and 2). In addition, although UV-induced PCNA–mUb was remarkably increased in XPRO30–Polη cells after adding doxycycline (Dox) to induce Polη expression (Fig. 2A, lanes 1 and 3), which is in line with the previous report (Durando et al., 2013), overexpression of REV1 in the Polη-expressing XPRO30–Polη cells further increased the level of PCNA–mUb after UV damage (Fig. 2A, lanes 3 and 4). These data indicate that the stimulatory effect of REV1 on PCNA–mUb is Polη-independent. Given that the level of PCNA–mUb is negatively regulated by the USP1 deubiquitylase (Huang et al., 2006), we wondered whether REV1 reduces the expression of USP1. We compared the level of USP1 in REV1-depleted and control 293T cells in the presence and absence of UV radiation. REV1 depletion did not cause appreciable alterations in USP1 expression (Fig. 2B). Moreover, overexpression of REV1 could also not reduce USP1 expression (Fig. 2C). Additionally, we found that overexpression of REV1 still significantly promoted PCNA–mUb in the USP1-depleted cells (Fig. 2D). These results indicate that the stimulatory effect of REV1 on PCNA–mUb is USP1-independent.

REV1 promotes PCNA–mUb via a RAD18-dependent manner It is well-established that the level of PCNA–mUb is positively regulated by the RAD6–RAD18 ubiquitin ligase complex (Hoege et al., 2002; Kannouche et al., 2004; Ulrich, 2009; Hedglin and Benkovic, 2015). We wondered whether REV1 promotes PCNA– mUb in a RAD18-dependent fashion. We first transfected GFP- REV1 into control or RAD18 stable knockdown U2OS cells (Zhang et al., 2013). We found that depletion of RAD18 significantly inhibited the stimulatory effect of REV1 on UV-induced PCNA– mUb (Fig. 2E). However, considering that the RAD18 stable knockdown cells showed an appreciable level of REV1-promoted PCNA–mUb, it was necessary to determine whether REV1 might also stimulate PCNA–mUb in a RAD18-independent manner. We then established a RAD18 knockout 293T cell line based on Fig. 1. REV1 promotes PCNA–mUb. (A) 293T cells were transfected with TALEN technology. We found that the stimulatory effect of REV1 REV1-targeted siRNA (siREV1) or negative control siRNA (siNC). At 48 h post- on UV-induced PCNA–mUb was completely abrogated in RAD18 transfection REV1 expression in whole-cell extracts (WCE) was determined knockout cells (Fig. 2F). These results indicate that RAD18 using anti-REV1 antibodies. The REV1-depleted cells were exposed to mediates the REV1-promoted monoubiquitylation of PCNA in the 2 15 J/m UVC radiation (UV) or control (Con), the Triton-X-100- insoluble absence and presence of UV damage. fractions (CF) were extracted and the level of PCNA or PCNA–mUb was analyzed by western blotting using anti-PCNA antibodies. Tubulin: REV1 facilitates RAD18, but not RPA32, accumulation on loading control. (B) 293T cells were transfected with GFP–REV1 or GFP vector. At 30 h post-transfection, cells were treated with UVC as in A. The chromatin Triton-X-100- insoluble fractions were extracted and the levels of GFP–REV1, We then determined how RAD18 mediates REV1-promoted PCNA or PCNA–mUb were detected with anti-GFP or anti-PCNA antibodies, PCNA–mUb. We first compared the level of RAD18 in the respectively. (C) The stimulatory effect of REV1 on PCNA–mUb is closely control and REV1-depleted cells and found that REV1 depletion related to the level of REV1 expression. 293T cells were transfected with 1 μg does not affect RAD18 expression (Fig. 3A). However, depletion of μ – μ (lane 2) or 2 g (lane 3) of GFP REV1-expressing construct or 2 g of GFP REV1 resulted in a decreased chromatin association of RAD18 vector (lane 1). At 30 h post-transfection, cells were treated as in A. The levels of GFP–REV1 in WCE were analyzed with anti-GFP antibodies. The level of (Fig. 3B). To avoid the off-target effect of siRNA, we repeated the PCNA or PCNA–mUb was analyzed by western blotting using anti-PCNA experiment with another individual siRNA (siREV1-2) and antibodies. Tubulin: loading control. SE, short exposure; LE, long exposure. obtained similar results (Fig. 3C). Additionally, depletion of Journal of Cell Science

1224 RESEARCH ARTICLE Journal of Cell Science (2016) 129, 1223-1233 doi:10.1242/jcs.179408

Fig. 2. REV1 promotes PCNA–mUb in RAD18-dependent fashion, but not dependent on Polη and USP1. (A) REV1 promotes PCNA–mUb independent of Polη. XP30RO-Polη cells were transfected with GFP–REV1 or GFP vector. At 12 h post-transfection, the cells were incubated with media containing DMSO or 1 μg/ml doxycycline (Dox) for 12 h followed by 15 J/m2 UVC radiation. After a further 4 h, the insoluble fractions (CF) were harvested and the levels of PCNA and PCNA–mUb were analyzed by western blotting. Expression levels of GFP–REV1 and SFB–Polη were determined in whole-cell extracts (WCE). (B) Depletion of REV1 does not affect the level of USP1 in whole-cell extracts. 293T cells were transfected with REV1-targeted siRNA (siREV1) or negative control siRNA (siNC). After 48 h, the cells were exposed to 15 J/m2 UVC radiation (UV) or control (Con). After a further 4 h, the whole-cell extracts (WCE) were harvested and the expression levels of REV1 and USP1 were determined. Tubulin, loading control. (C) Overexpression of REV1 does not affect the level of USP1 in whole-cell extracts. 293T cells were transfected with GFP–REV1 or GFP vector. After 36 h, the whole-cell extracts (WCE) were harvested and the expression levels of GFP–REV1 and USP1 were determined. Tubulin, loading control. (D) REV1 promotes PCNA–mUb independent of USP1. USP1-depleted (siUSP1) 293T cells were transfected with GFP–REV1 or GFP vector. The CF and WCE were harvested and analyzed through western blotting. Expression of USP1 was determined in WCE. Tubulin: loading control. (E) RAD18 knockdown (shRAD18) and negative control (shNC) cells were transfected with GFP–REV1 or GFP vector. At 30 h post-transfection, cells were treated with 15 J/m2 UVC radiation. The Triton-X-100-insoluble fractions were harvested and analyzed by western blotting as in Fig. 1C. The expression of RAD18 was determined by anti-RAD18 antibodies. (F) RAD18 wild-type (WT) and knockout (KO) 293T cells were transfected with GFP–REV1 (lanes 2, 4, 6, 8) or GFP (lanes 1, 3, 5, 7). The cells were treated and analyzed as in A. Tubulin: loading control. GR: GFP–REV1; SE, short exposure; LE, long exposure.

REV1 did not produce an obvious difference in the distribution of knockdown of REV1 led to a clear reduction in RAD18 focus RAD18–mUb/RAD18 in the soluble fraction (Fig. 3C). formation after UV damage (Fig. 3D,E), although depletion of Considering that only a small fraction of total RAD18 associated REV1 had no obvious effect on RAD18 global nuclear staining with chromatin even after UV radiation in our system (Fig. S2A), we (Fig. S2B). Considering that RAD18 is recruited to stalled speculated that the amount of RAD18 released from the chromatin replication forks by virtue of its affinity for single-stranded DNA upon REV1 knockdown might be not enough to produce an obvious (ssDNA) coated with replication protein A (RPA) (Davies et al., difference in the distribution of RAD18–mUb/RAD18 in the 2008; Huttner and Ulrich, 2008), we therefore measured the level of soluble fraction. Thus, we examined whether REV1 regulates UV- chromatin-bound RPA in REV1-depleted cells and observed no induced RAD18 focus formation. We transfected U2OS cells with appreciable reduction compared with that in siNC-transfected cells two independent siRNAs (siREV1-1 and siREV1-2) and found that (Fig. 3B). We also examined the proportion of RPA-positive cells in Journal of Cell Science

1225 RESEARCH ARTICLE Journal of Cell Science (2016) 129, 1223-1233 doi:10.1242/jcs.179408

Fig. 3. REV1 promotes the recruitment of RAD18 to chromatin. (A) 293T cells were transfected with siNC or siREV1. At 48 h post-transfection, the cells were treated with 15 J/m2 UVC radiation or not (Con). The whole-cell extracts (WCE) were harvested. The expressions of RAD18 and REV1 were examined through western blotting using antibodies against RAD18 or REV1, respectively. Tubulin: loading control. (B) Depletion of REV1 inhibits the recruitment of RAD18 but not RPA32 to chromatin. The cells were treated as in A. The Triton-X-100-insoluble fractions were harvested and analyzed by western blotting for expression of RAD18, PCNA, PCNA–mUb and RPA32. (C) Depletion of REV1 inhibits the recruitment of RAD18 to chromatin. The cells were treated as in A and the levels of RAD18 in WCE, Triton-X-100-insoluble (CF) and soluble fractions were detected. LE, longer exposure; SE, short exposure. (D–F) REV1 is required for optimal RAD18 focus formation. U2OS cells were transfected with two independent siRNAs against REV1 (siREV1-1 and siREV1-2) or negative control siNC. At 48 h post-transfection, the cells were treated with 15 J/m2 UVC radiation or not. After a further 4 h, the cells were permeabilized, fixed and processed. (D) In cells processed for immunofluorescence, representative RAD18 foci are shown. (E) The proportion of cells with >50 RAD18 foci was quantified. Quantification results were the mean of three independent experiments and were presented as means±s.e.m. More than 100 cells were counted in each experiment. Depletion of REV1 significantly decreased UV-induced RAD18 focus formation as calculated using Student’s t-test, **P<0.01. (F) The level of REV1 in U2OS cells transfected with siREV1-1 and siREV1-2 was analyzed by western blotting using anti-REV1 antibodies. Tubulin: loading control.

UV-irradiated REV1-depleted cells. At 4 h after irradiation, the cells irradiated and the Triton-X-100-insoluble fractions were analyzed. were treated to remove soluble RPA and were processed for Like wild-type (WT) REV1, REV11-1123 (without the C-terminal PIR) immunofluorescence to reveal chromatin-bound RPA (Lv et al., could promote monoubiquitylation of PCNA and RAD18 recruitment 2013). As shown in Fig. S3, depletion of REV1 had no obvious to chromatin (Fig. 4C), indicating that REV1-facilitated PCNA–mUb effect on RPA focus formation. These data indicate that REV1 is independent of its PIR. This data is consistent with REV1 promoting promotes monoubiquitylation of PCNA by facilitating the binding PCNA–mUb in a Polη-independent fashion. Moreover, REV1653–1123 of RAD18, but not RPA, on chromatin. (without the BRCT, catalytic core and PIR) could also promote monoubiquitylation of PCNA and RAD18 recruitment to chromatin The UBM domains of REV1 are required for its stimulatory (Fig. 4C), suggesting that the BRCT and catalytic core of REV1 are effect on PCNA–mUb not necessary for REV1-facilitated PCNA–mUb. Notably, unlike WT To understand how REV1 facilitates RAD18 binding to chromatin, we REV1, UBM* REV1 could not promote monoubiquitylation of first examined the roles of essential REV1 domains in promoting PCNA and RAD18 recruitment to chromatin. Given that the UBMs RAD18 chromatin association and monoubiquitylation of PCNA. not only mediate the interaction of REV1 with other ubiquitylated

293T cells expressing a panel of REV1 peptides (Fig. 4A) were UV- proteins but also its monoubiquitylation (Guo et al., 2006b; Kim et al., Journal of Cell Science

1226 RESEARCH ARTICLE Journal of Cell Science (2016) 129, 1223-1233 doi:10.1242/jcs.179408

Fig. 4. The UBMs of REV1 promotes PCNA–mUb. (A) Schematic representation of mouse REV1 WT and mutants. PIR, polymerases interaction region; UBMs*: mutations in REV1 UBMs. (B) U2OS cells transfected with the indicated GFP–REV1 construct were irradiated with 15 J/m2 UVC and further incubated for 4 h. The cells were fixed and the proportion of GFP–REV1-expressing cells with >40 foci was determined. More than 300 cells were counted in each experiment. Quantification results were from three independent experiments and were presented as means±s.e.m. The *P values are respectively 0.0083, 0.007, 0.0042 and 0.003 from left to right. (C) 293T cells were transfected with the indicated GFP–REV1 constructs. The cells were treated and analyzed as in Fig. 1B. Expression levels of GFP–REV1 were determined in WCE. Tubulin: loading control. (D,E) REV1 peptides containing WT UBMs promote UV-induced RAD18 focus formation. U2OS cells were transfected with the indicated GFP–REV1 constructs by electroporation (Lonza; Amaxa Nucleofector with Cell Line Nucleofector Kit V: VCA- 1003 for U2OS cell line). At 24 h post-transfection, cells were UV-treated as in A. After a further 4 h, cells were Triton-X-100-pretreated followed by immunofluorescence labeling for RAD18. The proportion of cells positive for RAD18 foci in the total population was analyzed as in Fig. 3D,E. Representative RAD18 foci are shown in (D). (E) Quantification of RAD18-postive foci was performed as in B, but for cells with >50 foci. Results were the mean of three independent experiments and are presented as means±s.e.m. Overexpression of WT REV1, REV11-1123 or REV1653–1123 significantly increases UV-induced RAD18 focus formation as calculated using a Student’s t-test, *P<0.05. More than 100 cells were counted in each experiment.

2012), we analyzed whether monoubiquitylated REV1 could mUb might be mediated through its interaction with a ubiquitylated stimulate PCNA–mUb. Ubiquitin cDNA lacking the C-terminal protein. It is known that REV1 can interact with PCNA–mUb at the Gly-Gly codons was cloned into a pEGFP-C3-REV1 UBM* plasmid stalled replication sites, where REV1 exhibits focal distribution in the to make a full-length REV1-ubiquitin chimera (REV1–Ub; a mimic nucleus (Guo et al., 2009). We examined whether the REV1 peptides of monoubiquitylated REV1). We found that the REV1–Ub chimera which promote PCNA–mUb demonstrated increased REV1 focus failed to rescue the decreased PCNA–mUb resulting from expression formation after UV irradiation. Unlike WT REV1, REV11-1123 and of UBMs* (Fig. 4C). These data suggest that REV1 does not REV1653–1123 did not exhibit increased REV1 focus formation likely facilitate PCNA–mUb through its own monoubiquitylation. (Fig. 4B; Fig. S4). Moreover, we also noticed that, unlike WT REV1, Consistent with this result, overexpression of WT REV1, REV11-1123 REV11-1123 and REV1653–1123 did not display an appreciable and REV1653–1123, but not REV1 UBMs* and REV1–Ub, difference in the extent of their colocalization with PCNA after UV significantly increase UV-induced RAD18 focus formation treatment when compared with REV1 UBM* (Fig. S1C), suggesting (Fig. 4D,E). All the above results indicate that the UBMs of REV1 that the stimulatory effect of REV1 on PCNA–mUb is not likely are required for its stimulatory effect on PCNA–mUb and recruitment mediated by its interaction with PCNA–mUb at stalled replication of RAD18. Therefore, the stimulatory effect of REV1 on PCNA– sites. Collectively, these results hint at the possibility that another Journal of Cell Science

1227 RESEARCH ARTICLE Journal of Cell Science (2016) 129, 1223-1233 doi:10.1242/jcs.179408 ubiquitylated protein(s) other than PCNA–mUb might be involved in nonubiquitylated RAD18 and thus prevent the latter from being this process. recruited to damaged DNA (Zeman et al., 2014). We wondered whether REV1 interacts with RAD18–mUb and thus releases REV1 binds RAD18–Ub to release RAD18 from the RAD18–Ub/ RAD18 from the RAD18–mUb/RAD18 complex. To test this RAD18 complex hypothesis, we first examined the interaction between FLAG– RAD18 in cells exists in at least two different forms: an inactive, REV1 and GST–Ub–RAD18 or GST–RAD18. We found that monoubiquitylated form (RAD18–mUb) and an active, REV1 bound more strongly to GST–Ub–RAD18 than to GST– nonubiquitylated form (Miyase et al., 2005; Zeman et al., 2014). RAD18 (Fig. 5A). Additionally, mutation of UBMs in REV1 Recently, RAD18–mUb was reported to preferentially interact with significantly inhibited the binding of REV1 with GST–Ub–RAD18

Fig. 5. REV1 competes with RAD18 for binding to RAD18–Ub. (A,B) REV1 interacts with ubiquitylated RAD18 via its UBMs. Equal amounts of GST fusion – – – – – proteins (GST Ub RAD18 and GST RAD18) were incubated with cell lysates expressing FLAG-REV1 (WT or UBMs*) (A) or purified His REV1653–1123 or His REV1653–1123-UBMs* (B). The associated REV1 was detected by immunoblotting with antibodies against FLAG or His. (C,D) Immunoprecipitation reveals that an – – – L8A mutation in ubiquitin inhibits its association with His REV1653–1123. Equal amounts of GST fusion proteins GST Ub and GST Ub(L8A) were incubated with – – purified His REV1653–1123 (C). The same L8A mutation in ubiquitin also inhibits RAD18 Ub association with His-REV1653–1123. Equal amounts of GST fusion – – – – – – proteins GST Ub RAD18 and GST Ub(L8A) RAD18 were incubated with purified His REV1653–1123 (D). (E) HEK293T cells were transfected with FLAG REV1 WT and UBMs*. At 48 h post-transfection, the cells were treated with 1% formaldehyde for 15 min at room temperature to crosslink proteins. The Triton-X-100- soluble fractions were harvested and immunoprecipitated with anti-FLAG M2 beads. The bead-associated RAD18 and REV1 were detected with antibodies against RAD18 and FLAG, respectively. (F,G) REV1 inhibits the binding of RAD18 to RAD18–Ub through its UBMs. HEK293T cells were transfected with GFP– Ub–RAD18 and SFB–RAD18 or GFP–REV1. At 40 h post-transfection, the cell lysates were harvested. SFB–RAD18-associated GFP–Ub–RAD18 was coimmunoprecipitated using anti-FLAG M2 beads, then an equal amount of beads were further incubated with an increased amount of REV1-expressing lysates (F) or an equal amount of WT or UBM* REV1-expressing lysates (G). The immunoprecipitated GFP–Ub–RAD18 and SFB–RAD18 were detected with antibodies against GFP and FLAG, respectively. The amounts of GFP–REV1 used in the competitive binding systems were determined with anti-GFP antibody. (H,I) Purified – – – – His REV1653–1123 inhibits the binding of RAD18 and ubiquitylated RAD18 via its UBMs. GST Ub RAD18 proteins were incubated with equal amounts of His – − − − SUMO RAD18 and an increased amount of His REV1653–1123 (H) or equal amounts of His REV1653–1123 or His REV1653–1123-UBM* (I). The His fusion – – – – proteins His RAD18 and His REV1653–1123 pulled down by GST Ub RAD18 were detected with anti-His antibody. Ponceau staining in C,D,H,I shows that equal amounts of GST fusion proteins were used for the experiments. WT, wild type; U*, UBMs*. Journal of Cell Science

1228 RESEARCH ARTICLE Journal of Cell Science (2016) 129, 1223-1233 doi:10.1242/jcs.179408

(Fig. 5A). To further confirm this finding, we purified His-tagged after exposure to other damage agents causing replication fork REV1653–1123 and REV1653–1123-UBMs* and examined their stalling. Hydroxyurea, MMC and MMS are commonly used DNA interactions with either GST–Ub–RAD18 or GST–RAD18. Like damage agents to induce replication stress and PCNA–mUb (Lin REV1 protein, His–REV1653–1123 displayed much stronger binding et al., 2011; Mailand et al., 2013; Hedglin and Benkovic, 2015). with GST–Ub–RAD18 relative to its affinity to GST–RAD18 MMC is a potent DNA crosslinker, hydroxyurea stalls replication (Fig. 5B). Mutation of UBMs in His–REV1653–1123-UBMs* mostly through depletion of nucleotide pools without eliciting DNA eliminated the preferential binding of His–REV1653–1123 to GST– lesions, whereas MMS causes multiple DNA alkylation adducts that Ub–RAD18 (Fig. 5B). Considering that a L8A point mutation in cannot be bypassed by the replicative DNA polymerases (Friedberg, ubiquitin could disrupt its association with the UBMs in REV1 2006). We exposed 293T cells to hydroxyurea, MMC or MMS, and (Bienko et al., 2005; Bomar et al., 2010), we generated GST–Ub examined the effect of REV1 on PCNA–mUb. We found that (L8A) and GST–Ub(L8A)–RAD18 chimera to check their expression of REV1 still promoted PCNA–mUb after hydroxyurea interactions with REV1653–1123. Consistently, we found that and MMC treatments, whereas it failed to stimulate PCNA–mUb mutation of L8A in ubiquitin significantly inhibited the binding after exposure to MMS (Fig. 6A,B). Additionally, we noticed that between REV1653–1123 and ubiquitin or RAD18–Ub (Fig. 5C,D), RAD18–mUb could be detected after exposure to hydroxyurea and further confirming that the enhanced interaction between REV1 and MMC, but not MMS, which was recently reported to induce RAD18–Ub is mediated by the ubiquitin on RAD18–Ub and REV1 RAD18–mUb degradation (Zeman et al., 2014). These data further UBMs. Additionally, we transfected WT and UBMs* FLAG– support the conclusion that the stimulatory effect of REV1 on REV1 into 293T cells followed by crosslinking and PCNA–mUb is dependent on RAD18–mUb. immunoprecipitation using anti-FLAG M2 beads. Western blot analysis of the immunoprecipitated fractions showed that DISCUSSION unmodified RAD18 associated weakly with both WT and UBM* PCNA–mUb plays an important role in recruiting Y-family REV1. By contrast, substantially more RAD18–mUb was polymerases to stalled replication forks to facilitate the TLS coimmunoprecipitated with WT REV1 but not with the REV1 process. Given its key role in TLS and genome mutagenesis UBM* mutant (Fig. 5E), further supporting preferential association (Hoege et al., 2002; Moldovan et al., 2007; Chen et al., 2011), of REV1 with ubiquitylated RAD18 than nonubiquitylated RAD18. multiple studies have been performed to elucidate how the We then determined whether REV1 affects the interaction between monoubiquitylation of PCNA is regulated in vivo (Hedglin and RAD18–mUb and RAD18. We co-transfected SFB–RAD18 and Benkovic, 2015). So far, a number of factors have been identified GFP–Ub–RAD18 into 293T cells and immunoprecipitated SFB– which regulate PCNA–mUb, including the RAD6–RAD18 RAD18 with anti-FLAG M2 beads. Then the beads were aliquoted ubiquitin ligase complex (Hoege et al., 2002; Kannouche et al., and further incubated with an increased amount of expressed GFP– 2004), USP1 (Huang et al., 2006) and Polη (Durando et al., 2013). REV1. Finally, the bead-bound proteins were analyzed through In this study, we report that REV1 also modulates PCNA–mUb in western blotting. We noted that the levels of coimmunoprecipitated the absence of DNA damage, after exposure to UVC radiation, or GFP–Ub–RAD18 were negatively correlated with the amounts of treatment with hydroxyurea and MMC. supplemented GFP–REV1 (Fig. 5F), suggesting that REV1 inhibits Because REV1 interacts with Polη (Guo et al., 2003; Tissier et al., the interaction between RAD18 and RAD18–Ub. Furthermore, we 2004) and Polη regulates PCNA–mUb (Durando et al., 2013), we examined whether this inhibitory effect requires the UBMs of examined whether the stimulatory effect of REV1 on PCNA–mUb REV1. We performed the similar competitive binding experiment as was mediated by Polη. We found that overexpression of REV1 still above, by incubating the aliquoted beads with cell lysates promoted PCNA–mUb in the absence of Polη. In addition, we expressing WT or UBMs* REV1. We found that mutation of determined whether REV1 promoted PCNA–mUb through UBMs in REV1 abrogated its inhibitory effect on the interaction downregulation of USP1. We found that depletion of REV1 did between RAD18 and RAD18–Ub (Fig. 5G). To confirm these not affect USP1 expression. Additionally, REV1 still enhanced results, GST–Ub–RAD18 beads were aliquoted and incubated with PCNA–mUb in USP1-depleted cells. These data suggest that the an equal amount of purified His–SUMO–RAD18 and increased stimulatory effect of REV1 on PCNA–mUb is not mediated by Polη amount of purified His–REV1653–1123. In line with the result shown or USP1. in Fig. 5F, as more His–REV1653–1123 was supplemented, there was Interestingly, we found that the stimulatory effect of REV1 on an increase in His–REV1653–1123 binding and a decrease in His– PCNA–mUb after UV irradiation required its UBMs, indicating SUMO–RAD18 binding to GST–Ub–RAD18 (Fig. 5H). Compared that this process might be mediated by a ubiquitylated protein. with His–REV1653–1123, His–REV1653–1123-UBM* exhibited a Because the stimulatory effect of REV1 on PCNA–mUb is not weaker association with GST–Ub–RAD18, concomitantly with a correlated with increased REV1 focus formation or its lower inhibitory effect on the interaction between GST–Ub–RAD18 colocalization with PCNA upon UV irradiation, PCNA–mUb is and His–SUMO–RAD18 (Fig. 5I). These results demonstrate that, not a plausible candidate for this mediation. Intriguingly, we through its UBMs, REV1 competes with RAD18 for binding to detected reduced RAD18 but not RPA recruitment to chromatin in RAD18–mUb. As a corollary to this, nonubiquitylated RAD18 in Triton-X-100-insoluble fractions in REV1-depleted cells. It has RAD18–mUb/RAD18 complex is released, which allows more been reported that RAD18 can be monoubiquitylated in several RAD18 to be recruited to chromatin for monoubiquitylation of different mammalian cell lines (Miyase et al., 2005; Zeman et al., PCNA. 2014). Unlike nonubiquitylated RAD18, the ubiquitylated form of RAD18 does not bind SNF2 histone linker plant homeodomain REV1 does not promote PCNA–mUb after exposure to MMS RING helicase (SHPRH) or helicase-like transcription factor In addition to UV radiation, multiple DNA damage treatments can (HLTF), two downstream E3 ligases needed to carry out error- also induce PCNA–mUb at stalled replication forks in mammalian free bypass of DNA lesions (Lin et al., 2011; Zeman et al., 2014). cells (Kannouche et al., 2004; Niimi et al., 2008). We thus checked Instead, RAD18–mUb prefers to dimerize with nonubiquitylated whether the stimulatory effect of REV1 on PCNA–mUb still occurs RAD18 molecules, potentially inhibiting RAD18 function in trans Journal of Cell Science

1229 RESEARCH ARTICLE Journal of Cell Science (2016) 129, 1223-1233 doi:10.1242/jcs.179408

Fig. 6. Rad18–mUb is required for the stimulatory effect of REV1 on PCNA–mUb. HEK293T cells were transfected with GFP–REV1 for 30 h, followed by treatment with the following DNA damage agents: UVC (15 J/m2, recovered for 4 h), hydroxyurea (5 mM for 4 h), MMC (2.5 mg/ml for 4 h), MMS (50 μg/ml for 4 h) or DMSO (Con). The whole-cell proteins (WCE) and triton insoluble fractions (CF) were extracted and analyzed. The expression levels of PCNA, PCNA–mUb, GFP–REV1 and ubiquitylated RAD18 were determined. (A) REV1-promoted PCNA–mUb in response to hydroxyurea and MMC. (B) REV1 did not promote PCNA–mUb in response to MMS. Tubulin: loading control. SE, short exposure; LE, long exposure. (C) Model of REV1-promoted recruitment of RAD18 to chromatin. In the nucleoplasm, REV1 and non-ubiquitylated RAD18 competitively bind to ubiquitylated RAD18, which facilitates the release of non-ubiquitylated RAD18 from ubiquitylated RAD18 trapping followed by further RAD18 recruited to chromatin for its TLS function.

(Zeman et al., 2014). Notably, unlike exposure to MMS, UV damage sites, its PIP boxes and its interaction with RAD18 radiation does not cause obvious RAD18 deubiquitylation (Zeman (Durando et al., 2013; Masuda et al., 2015). et al., 2014). Considering RAD18–mUb can sequester REV1-mediated TLS is known to play a crucial role in DNA- nonubiquitylated RAD18 from recruiting to chromatin and thus damage-induced nucleotide substitutions in eukaryotes (Jansen regulates PCNA–mUb (Zeman et al., 2014), we speculate that et al., 2015). In addition to functioning as a scaffold protein for RAD18–mUb might be the ubiquitylated protein which mediates polymerase switching at sites of lesions (Guo et al., 2003), our data the effect of REV1 on PCNA–mUb after UV radiation. We indicate that REV1 can promote PCNA–mUb in response to UV, demonstrate that REV1 displays an enhanced interaction with hydroxyurea and MMC, whose biological function(s) await further RAD18–Ub (a mimic of RAD18–mUb) compared with RAD18, studies. The multiple regulatory roles of REV1 in the error-prone whereas mutation of UBMs in REV1 significantly eliminated this TLS pathway make it a promising target for chemotherapy. In preferential binding. Furthermore, WT, but not UBMs* REV1, support of this, recent studies using mouse lymphoma and prostate competes with nonubiquitylated RAD18 for binding to RAD18– cancer models have shown that depletion of REV1 can remarkably Ub, suggesting that REV1 likely facilitates the release of RAD18 inhibit drug-induced mutagenesis and sensitize cancer cells to from RAD18–Ub sequestration and promotes RAD18 recruitment chemotherapy (Xie et al., 2010; Xu et al., 2013). to chromatin (Fig. 6C). Consistently, the stimulatory effect of REV1 on PCNA–mUb was detected in cells exposed to DNA MATERIALS AND METHODS – Plasmids and reagents damage agents which do not abrogate RAD18 mUb, but not in Rev1 cells exposed to MMS, an agent shown to remove RAD18–mUb Mouse cDNA was cloned into pEGFP-C3 (Clontech) or p3xFLAG- CMV (Sigma) to generate EGFP- or FLAG-tagged proteins (named GFP– (Zeman et al., 2014). Taken together, our data reveal a newly – – REV1 and FLAG REV1, respectively). A series of truncated mREV1 discovered role for REV1 in regulating PCNA mUb and the TLS mutants were PCR-amplified and cloned into pEGFP-C3. The constructs pathway after certain types of DNA damage. Notably, our with mutations in mREV1 UBM domains were generated as described – discovered mode of regulation of PCNA mUb by REV1 is previously (Guo et al., 2006b). Vectors expressing REV1653–1123-pET-16b distinctively different from that of Polη, which was recently and its UBM* modification were constructed through PCR amplification. reported to regulate PCNA–mUb depending on its recruitment to The plasmids of pSFB-RAD18 (FLAG–RAD18) and His–SUMO–RAD18 Journal of Cell Science

1230 RESEARCH ARTICLE Journal of Cell Science (2016) 129, 1223-1233 doi:10.1242/jcs.179408

(His–RAD18) were gifts from Dr Jun Huang (Zhejiang University, Immunofluorescence Hangzhou, China). The cDNA of human RAD18 was cloned into pEGFP- U2OS cells were UV-irradiated and processed for immunofluorescence C3 (Clontech) to generate the construct for expressing GFP-tagged RAD18 as described previously (Lv et al., 2013). Briefly, before fixing in 4% protein (GFP–RAD18). The ubiquitin cDNA lacking the C-terminal Gly- paraformaldehyde, the cells were treated with 0.5% Triton X-100 for 10 to Gly codons was cloned into either pEGFP-C3-REV1 UBM* plasmid for 30 min. Then the cells were blocked with 5% donkey serum (for RAD18 expression of GFP–REV1–Ub chimera or pEGFP-C3-RAD18 plasmid staining) or 5% BSA and 2% goat serum (for RPA32 staining) for 30 min. for expression of GFP–Ub–RAD18 as previously described (Bienko et al., After the blocking, cells were incubated with anti-RAD18 or anti-RPA32 2005; Zeman et al., 2014). The PCR products of RAD18 and Ub–RAD18 antibodies for 45 min. Then the samples were washed three times with were also subcloned into pGEX-4T-2 (GE Healthcare) for expression PBST (0.2% Tween 20 in PBS) and incubated with the appropriate Alexa- of GST–RAD18 and GST–Ub–RAD18 in E.coli. The mutant of Fluor-conjugated secondary antibody (Invitrogen – Molecular Probes) for GST–Ub(L8A)–RAD18 was prepared from GST–Ub–RAD18 by site- 30 min. The cells were further counterstained with DAPI to visualize directed mutagenesis. nuclear DNA. Images were taken with equal exposure time. The Anti-FLAG M2 agarose affinity gel (A2220) and mouse monoclonal immunofluorescence studies for PCNA were done as described previously antibody against FLAG (M2) (F3165; 1:1000) were purchased from Sigma- (Kannouche et al., 2001). Aldrich. Antibody against USP1 (D37B4; 1:1000) was from Cell Signaling For quantitative analysis of UV-induced REV1 focus formation, U2OS Technology. Antibodies against PCNA (PC10) (sc-56; 1:1000), His (H3) cells transfected with GFP–REV1 were treated with UVC (15 J/m2) and (sc-8036; 1:1000) and GFP (FL) (sc-8334; 1:500) were from Santa Cruz fixed with 4% paraformaldehyde 4 h later as described previously (Guo Biotechnology. Antibodies against RAD18 (ab57447; 1:1000) for western et al., 2006a). Cells with more than 40 REV1 foci were counted. blotting and RPA32 (9H8) (ab2175; 1:1000) were from Abcam. Antibody against RAD18 (A301-340A; 1:3000) for immunofluoresence was Preparation of triton-insoluble fractions for western blotting purchased from Bethyl Laboratories (Montgomery, TX). Antibody against Triton-X-100-insoluble fractions were prepared as described previously β-tubulin (abM59005-37B-PU; 1:4000) was from Beijing Protein (Kannouche et al., 2004) with modifications. Briefly, harvested cells were Innovation (Beijing, China). Alexa-Fluor-488-labeled goat anti-mouse- incubated with CSK100 buffer (100 mM NaCl, 300 mM sucrose, 3 mM IgG (A-11001; 1:1000) and Alexa-Fluor-555-labeled donkey anti-rabbit- MgCl2, 10 mM PIPES pH 6.8, 1 mM EGTA, 0.2% Triton X-100) IgG (A-31572; 1:1000) antibodies were from Invitrogen– Molecular Probes. containing a cocktail of protease inhibitors for 20 min at 4°C. The pellets Rabbit polyclonal antiserum against REV1872-1150 was made by Covance were lysed with buffer 1 (50 mM HEPES pH 7.5, 50 mM NaCl, 0.05% SDS, (Yang et al., 2015). 2 mM MgCl2, 10% glycerol, 0.1% Triton X-100, 10 units of RNase-free DNase I) containing a cocktail of protease inhibitors overnight. The Cell culture and reagents supernatants were harvested followed by western blotting. Human U2OS and HEK293T cells were obtained from the American Type Culture Collection (Rockville, MD). The XP30RO-Polη cell line, which is a Proteins expression and purification in E. coli Polη-deficient XP30RO cell line engineered to express SFB-tagged Polη GST fusion proteins (GST–RAD18, GST–Ub–RAD18 and GST–Ub under the control of a tetracycline-inducible promoter (Han et al., 2014), was (L8A)–RAD18) were expressed and purified as described previously a gift from Dr Jun Huang (Zhejiang University, Hangzhou, China). RAD18 (Zeman et al., 2014). His–SUMO–RAD18 was expressed and purified as stable knockdown U2OS cells were prepared as described (Zhang et al., described previously (Han et al., 2014). His–REV1653–1123 and His– 2013). All cell lines were grown in DMEM medium supplemented with E. coli REV1653–1123-UBM* were expressed in BL21 at 16°C overnight. 10% fetal bovine serum at 37°C in the presence of 5% CO2. For transient Bacterial pellets were incubated with lysis buffer (50 mM Tris pH 6.8, transfection experiments, cells were transfected with indicated constructs, 300 mM NaCl, 1% Triton X-100, 10 mM imidazole, 1 mM PMSF, and using VigoFect (Vigorous Biotechnology Beijing Co., Ltd, China) or 1 mM DTT) containing 1 mg/ml lysozyme (Sigma-Aldrich) for 1 h. After Lipofectamin 2000 (Invitrogen) following the manufacturer’s protocols. sonication, the lysates were clarified by centrifugation (12,000 g, 4°C, 30 min). The supernatant was incubated with Ni-NTA Agarose (Qiagen) for RNA interference 2.5 h at 4°C. After washing with buffer (50 mM Tris pH 6.8, 1 M NaCl, 1% The introduction of small interfering RNA (siRNA) into cells was carried Triton X-100, 10 mM imidazole), the proteins were eluted with buffer out with RNAiMAX (Invitrogen). siRNAs directed against human REV1 (50 mM Tris pH 6.8, 300 mM NaCl, 1% Triton X-100, 250 mM imidazole and USP1 were obtained from GenePharma (Shanghai, China). The gene- and 1 mM DTT) and frozen at −80°C. specific target sequences were as follows: REV1-1 (GAACAGUGACGC- AGGAAUA) (Akagi et al., 2009), REV1-2 (AAGCAUCAAAGCUGGA- Coimmunoprecipitation and western blotting CGACU) (Hicks et al., 2010), USP1 (GAAAUACACAGCCAAGUAAUU) HEK293T cells transfected with WT and UBMs* FLAG–REV1 were (Han et al., 2014). The negative control siNC sequence (UUCUCCGAA- incubated with 1% formaldehyde for 15 min at room temperature to CGUGUCACGU) was obtained from GenePharma. crosslink proteins. The reaction was stopped by a 5-min incubation with 0.1 M glycine. After two washes with PBS, the cells were harvested and Establishment of RAD18 knockout cell lines lysed with CSK100 buffer for 30 min at 4°C. After centrifugation at The RAD18 knockout cells (RAD18KO) were established using TALEN 21,000 g the supernatants were incubated with anti-FLAG M2 beads as described previously (Sanjana et al., 2012) with some modifications. overnight. The bead-associated proteins were separated by SDS-PAGE Briefly, the paired RAD18 TALEN arms were designed to target exon 1 followed by immunoblotting with either anti-FLAG or anti-RAD18 of RAD18. The sequences targeting RAD18 (L: ggactccctggccga; antibodies. R: caccttcatgactgccag) were constructed into the backbone of pTALEN-L and pTALEN-R, respectively, by one-step ligation using the Fast TALE™ GST pull-down assay TALEN Assembly kit (SIDANSAI Biotechnology, China). To get RAD18- For interaction between REV1 and GST–RAD18, REV1-expressing cells deficient clones, HEK293T cells were transfected with a mixture of were lysed with HEPES buffer (50 mM HEPES pH 7.4, 150 mM NaCl, plasmids containing pTALEN-Rad18-L, pTALEN-Rad18-R, and pEGFP- 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 10% glycerol, 10 μM ZnCl, C3 at a ratio of 9:9:2 in a 6 cm dish. One day later, the cells were incubated in 25 mM NaF) for 1 h at 4°C and then clarified by centrifugation at 21,000 g. media containing puromycin (1.2 μg/ml) for 3 days. Individual clones were The supernatants were incubated with the indicated GST fusion proteins for isolated by limiting dilution and screened for RAD18 expression through 2.5 h at 4°C. For GST pull-down with purified proteins, the purified proteins western blot. Genomic DNA isolated from the RAD18KO cells was PCR were diluted in HEPES buffer and then incubated with the indicated GST amplified and the targeted exon of RAD18 was confirmed through proteins for 2.5 h at 4°C. After washing, the bound proteins were separated

sequencing. by SDS-PAGE and analyzed by western blot with indicated antibodies. Journal of Cell Science

1231 RESEARCH ARTICLE Journal of Cell Science (2016) 129, 1223-1233 doi:10.1242/jcs.179408

Competitive protein binding assays Guo, C., Fischhaber, P. L., Luk-Paszyc, M. J., Masuda, Y., Zhou, J., Kamiya, K., To examine how REV1 affects the interaction between RAD18 and Kisker, C. and Friedberg, E. C. (2003). Mouse Rev1 protein interacts with ubiquitylated RAD18, we transfected GFP–REV1 or SFB–RAD18 and multiple DNA polymerases involved in translesion DNA synthesis. EMBO J. 22, – – – 6621-6630. GFP Ub RAD18 into 293T cells. The cell lysates were harvested. SFB Guo, C., Sonoda, E., Tang, T.-S., Parker, J. L., Bielen, A. B., Takeda, S., Ulrich, RAD18 and associated GFP–Ub–RAD18 were coimmunoprecipitated H. D. and Friedberg, E. C. (2006a). REV1 protein interacts with PCNA: using anti-FLAG M2 beads in HEPES buffer, then an equal amount of significance of the REV1 BRCT domain in vitro and in vivo. Mol. Cell 23, 265-271. beads were further incubated with different amount of REV1-expressing Guo, C., Tang, T.-S., Bienko, M., Parker, J. L., Bielen, A. B., Sonoda, E., Takeda, lysates. To directly determine how the REV1 C-terminus affects the S., Ulrich, H. D., Dikic, I. and Friedberg, E. C. (2006b). Ubiquitin-binding motifs interaction between RAD18 and ubiquitylated RAD18, an equal amount of in REV1 protein are required for its role in the tolerance of DNA damage. Mol. Cell. Biol. 26, 8892-8900. GST–Ub–RAD18 protein was incubated with His–SUMO–RAD18 and – Guo, C., Tang, T.-S., Bienko, M., Dikic, I. and Friedberg, E. C. (2008). increasing amounts of His REV1653–1123. The bound proteins were Requirements for the interaction of mouse Polkappa with ubiquitin and its separated by SDS-PAGE followed by immunoblotting with indicated biological significance. J. Biol. Chem. 283, 4658-4664. antibodies. GST proteins were visualized by Ponceau S staining. Guo, C., Kosarek-Stancel, J. N., Tang, T.-S. and Friedberg, E. C. (2009). Y-family DNA polymerases in mammalian cells. Cell. Mol. Life Sci. 66, 2363-2381. Acknowledgements Han, J., Liu, T., Huen, M. S. Y., Hu, L., Chen, Z. and Huang, J. (2014). SIVA1 The authors thank Dr Jun Huang (Zhejiang University, Hangzhou, China) for directs the E3 ubiquitin ligase RAD18 for PCNA monoubiquitination. J. Cell Biol. 205, 811-827. reagents. Hedglin, M. and Benkovic, S. J. (2015). Regulation of Rad6/Rad18 activity during DNA damage tolerance. Annu. Rev. Biophys. 44, 207-228. Competing interests Hicks, J. K., Chute, C. L., Paulsen, M. T., Ragland, R. L., Howlett, N. G., The authors declare no competing or financial interests. Gueranger, Q., Glover, T. W. and Canman, C. E. (2010). Differential roles for DNA polymerases eta, zeta, and REV1 in lesion bypass of intrastrand versus Author contributions interstrand DNA cross-links. Mol. Cell. Biol. 30, 1217-1230. C.G. and T.T. conceived the study and designed experiments; Z.W. performed most Hoege, C., Pfander, B., Moldovan, G.-L., Pyrowolakis, G. and Jentsch, S. of the experiments. M.H and H.L. established the RAD18-knockout cell line. X.M. (2002). RAD6-dependent DNA repair is linked to modification of PCNA by constructed several expression vectors. Z.W., T.T. and C.G. analyzed the data and ubiquitin and SUMO. Nature 419, 135-141. wrote the manuscript. All authors read and approved the manuscript for publication. Huang, T. T., Nijman, S. M., Mirchandani, K. D., Galardy, P. J., Cohn, M. A., Haas, W., Gygi, S. P., Ploegh, H. L., Bernards, R. and D’Andrea, A. D. (2006). Funding Regulation of monoubiquitinated PCNA by DUB autocleavage. Nat. Cell Biol. 8, 339-347. This research was supported by the Chinese National 973 Project [2013CB945003 Huttner, D. and Ulrich, H. D. (2008). Cooperation of replication protein A with the to C.G., 2012CB944702 to T.T.]; the National Natural Science Foundation of China ubiquitin ligase Rad18 in DNA damage bypass. Cell Cycle 7, 3629-3633. [31471331, 31170730 to C.G., 31570816, 91519324, 81371415 to T.T.]; the Jackson, S. P. and Bartek, J. (2009). The DNA-damage response in human Strategic Priority Research Program of the CAS [XDB14030302]; CAS/SAFEA biology and disease. Nature 461, 1071-1078. International Partnership Program for Creative Research Teams; and the State Key Jansen, J. G., Tsaalbi-Shtylik, A. and de Wind, N. (2015). Roles of mutagenic Laboratory of Membrane Biology. translesion synthesis in mammalian genome stability, health and disease. DNA Repair 29, 56-64. Supplementary information Kannouche, P., Broughton, B. C., Volker, M., Hanaoka, F., Mullenders, L. H. and Supplementary information available online at Lehmann, A. R. (2001). Domain structure, localization, and function of DNA http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.179408/-/DC1 polymerase eta, defective in xeroderma pigmentosum variant cells. Genes Dev. 15, 158-172. References Kannouche, P. L., Wing, J. and Lehmann, A. R. (2004). Interaction of human DNA Akagi, J.-i., Masutani, C., Kataoka, Y., Kan, T., Ohashi, E., Mori, T., Ohmori, H. polymerase eta with monoubiquitinated PCNA: a possible mechanism for the and Hanaoka, F. (2009). Interaction with DNA polymerase eta is required for polymerase switch in response to DNA damage. Mol. Cell 14, 491-500. ’ nuclear accumulation of REV1 and suppression of spontaneous mutations in Kim, H., Yang, K., Dejsuphong, D. and D Andrea, A. D. (2012). Regulation of human cells. DNA Repair 8, 585-599. Rev1 by the Fanconi anemia core complex. Nat. Struct. Mol. Biol. 19, 164-170. Bienko, M., Green, C. M., Crosetto, N., Rudolf, F., Zapart, G., Coull, B., Lin, J.-R., Zeman, M. K., Chen, J.-Y., Yee, M.-C. and Cimprich, K. A. (2011). SHPRH and HLTF act in a damage-specific manner to coordinate different forms Kannouche, P., Wider, G., Peter, M., Lehmann, A. R. et al. (2005). Ubiquitin- of postreplication repair and prevent mutagenesis. Mol. Cell 42, 237-249. binding domains in Y-family polymerases regulate translesion synthesis. Science Lv, L., Wang, F., Ma, X., Yang, Y., Wang, Z., Liu, H., Li, X., Liu, Z., Zhang, T., 310, 1821-1824. Huang, M. et al. (2013). Mismatch repair protein MSH2 regulates translesion DNA Bomar, M. G., D’Souza, S., Bienko, M., Dikic, I., Walker, G. C. and Zhou, P. synthesis following exposure of cells to UV radiation. Nucleic Acids Res. 41, (2010). Unconventional ubiquitin recognition by the ubiquitin-binding motif within 10312-10322. the Y family DNA polymerases iota and Rev1. Mol. Cell 37, 408-417. Mailand, N., Gibbs-Seymour, I. and Bekker-Jensen, S. (2013). Regulation of Centore, R. C., Yazinski, S. A., Tse, A. and Zou, L. (2012). Spartan/C1orf124, a PCNA–protein interactions for genome stability. Nat. Rev. Mol. Cell Biol. 14, reader of PCNA ubiquitylation and a regulator of UV-induced DNA damage 269-282. response. Mol. Cell 46, 625-635. Masuda, Y., Kanao, R., Kaji, K., Ohmori, H., Hanaoka, F. and Masutani, C. Chen, J., Bozza, W. and Zhuang, Z. (2011). Ubiquitination of PCNA and its (2015). Different types of interaction between PCNA and PIP boxes contribute to essential role in eukaryotic translesion synthesis. Cell Biochem. Biophys. 60, distinct cellular functions of Y-family DNA polymerases. Nucleic Acids Res. 43, 47-60. 7898-7910.. Ciccia, A. and Elledge, S. J. (2010). The DNA damage response: making it safe to Miyase, S., Tateishi, S., Watanabe, K., Tomita, K., Suzuki, K., Inoue, H. and play with knives. Mol. Cell 40, 179-204. Yamaizumi, M. (2005). Differential regulation of Rad18 through Rad6-dependent Davies, A. A., Huttner, D., Daigaku, Y., Chen, S. and Ulrich, H. D. (2008). mono- and polyubiquitination. J. Biol. Chem. 280, 515-524. Activation of ubiquitin-dependent DNA damage bypass is mediated by replication Moldovan, G.-L., Pfander, B. and Jentsch, S. (2007). PCNA, the maestro of the protein A. Mol. Cell 29, 625-636. replication fork. Cell 129, 665-679. Durando, M., Tateishi, S. and Vaziri, C. (2013). A non-catalytic role of DNA Nelson, J. R., Lawrence, C. W. and Hinkle, D. C. (1996). Deoxycytidyl transferase polymerase eta in recruiting Rad18 and promoting PCNA monoubiquitination at activity of yeast REV1 protein. Nature 382, 729-731. stalled replication forks. Nucleic Acids Res. 41, 3079-3093. Niimi, A., Brown, S., Sabbioneda, S., Kannouche, P. L., Scott, A., Yasui, A., Essers, J., Theil, A. F., Baldeyron, C., van Cappellen, W. A., Houtsmuller, A. B., Green, C. M. and Lehmann, A. R. (2008). Regulation of proliferating cell nuclear Kanaar, R. and Vermeulen, W. (2005). Nuclear dynamics of PCNA in DNA antigen ubiquitination in mammalian cells. Proc. Natl. Acad. Sci. USA 105, replication and repair. Mol. Cell. Biol. 25, 9350-9359. 16125-16130. Friedberg, E. C. (2005). Suffering in silence: the tolerance of DNA damage. Nat. Ohmori, H., Friedberg, E. C., Fuchs, R. P. P., Goodman, M. F., Hanaoka, F., Rev. Mol. Cell Biol. 6, 943-953. Hinkle, D., Kunkel, T. A., Lawrence, C. W., Livneh, Z., Nohmi, T. et al. (2001). Friedberg, E. C. (2006). DNA Repair and Mutagenesis. Washington: ASM Press. The Y-family of DNA polymerases. Mol. Cell 8, 7-8. Friedberg, E. C., Lehmann, A. R. and Fuchs, R. P. P. (2005). Trading places: how Parker, J. L., Bielen, A. B., Dikic, I. and Ulrich, H. D. (2007). Contributions of do DNA polymerases switch during translesion DNA synthesis? Mol. Cell 18, ubiquitin- and PCNA-binding domains to the activity of Polymerase eta in

499-505. Saccharomyces cerevisiae. Nucleic Acids Res. 35, 881-889. Journal of Cell Science

1232 RESEARCH ARTICLE Journal of Cell Science (2016) 129, 1223-1233 doi:10.1242/jcs.179408

Sale, J. E., Lehmann, A. R. and Woodgate, R. (2012). Y-family DNA polymerases Xu, X., Xie, K., Zhang, X.-Q., Pridgen, E. M., Park, G. Y., Cui, D. S., Shi, J., Wu, J., and their role in tolerance of cellular DNA damage. Nat. Rev. Mol. Cell Biol. 13, Kantoff, P. W., Lippard, S. J. et al. (2013). Enhancing tumor cell response to 141-152. chemotherapy through nanoparticle-mediated codelivery of siRNA and cisplatin Sanjana, N. E., Cong, L., Zhou, Y., Cunniff, M. M., Feng, G. and Zhang, F. (2012). prodrug. Proc. Natl. Acad. Sci. USA 110, 18638-18643. A transcription activator-like effector toolbox for genome engineering. Nat. Protoc. Yang, Y., Liu, Z., Wang, F., Temviriyanukul, P., Ma, X., Tu, Y., Lv, L., Lin, Y.-F., 7, 171-192. Huang, M., Zhang, T. et al. (2015). FANCD2 and REV1 cooperate in the Terai, K., Abbas, T., Jazaeri, A. A. and Dutta, A. (2010). CRL4(Cdt2) E3 ubiquitin protection of nascent DNA strands in response to replication stress. Nucleic Acids ligase monoubiquitinates PCNA to promote translesion DNA synthesis. Mol. Cell Res. 43, 8325-8339. 37, 143-149. Zeman, M. K., Lin, J.-R., Freire, R. and Cimprich, K. A. (2014). DNA damage- Tian, F., Sharma, S., Zou, J., Lin, S.-Y., Wang, B., Rezvani, K., Wang, H., Parvin, specific deubiquitination regulates Rad18 functions to suppress mutagenesis. J. D., Ludwig, T., Canman, C. E. et al. (2013). BRCA1 promotes the J. Cell Biol. 206, 183-197. ubiquitination of PCNA and recruitment of translesion polymerases in response Zhang, Y., Wu, X., Rechkoblit, O., Geacintov, N. E., Taylor, J. S. and Wang, Z. to replication blockade. Proc. Natl. Acad. Sci. USA 110, 13558-13563. (2002). Response of human REV1 to different DNA damage: preferential dCMP Tissier, A., Kannouche, P., Reck, M.-P., Lehmann, A. R., Fuchs, R. P. P. and insertion opposite the lesion. Nucleic Acids Res. 30, 1630-1638. Cordonnier, A. (2004). Co-localization in replication foci and interaction of human Zhang, S., Chea, J., Meng, X., Zhou, Y., Lee, E. Y. C. and Lee, M. Y. W. T. (2008). Y-family members, DNA polymerase pol eta and REVl protein. DNA Repair 3, 1503-1514. PCNA is ubiquitinated by RNF8. Cell Cycle 7, 3399-3404. Ulrich, H. D. (2009). Regulating post-translational modifications of the eukaryotic Zhang, X., Lv, L., Chen, Q., Yuan, F., Zhang, T., Yang, Y., Zhang, H., Wang, Y., replication clamp PCNA. DNA Repair 8, 461-469. Jia, Y., Qian, L. et al. (2013). Mouse DNA polymerase kappa has a functional role Waters, L. S., Minesinger, B. K., Wiltrout, M. E., D’Souza, S., Woodruff, R. V. and in the repair of DNA strand breaks. DNA Repair 12, 377-388. Walker, G. C. (2009). Eukaryotic translesion polymerases and their roles and Zlatanou, A., Despras, E., Braz-Petta, T., Boubakour-Azzouz, I., Pouvelle, C., regulation in DNA damage tolerance. Microbiol. Mol. Biol. Rev. 73, 134-154. Stewart, G. S., Nakajima, S., Yasui, A., Ishchenko, A. A. and Kannouche, P. L. Xie, K., Doles, J., Hemann, M. T. and Walker, G. C. (2010). Error-prone translesion (2011). The hMsh2-hMsh6 complex acts in concert with monoubiquitinated PCNA synthesis mediates acquired chemoresistance. Proc. Natl. Acad. Sci. USA 107, and Pol eta in response to oxidative DNA damage in human cells. Mol. Cell 43, 20792-20797. 649-662. Journal of Cell Science

1233