DOCSLIB.ORG

JOURNAL of NEMATOLOGY Hemicycliophora

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
JOURNAL of NEMATOLOGY Hemicycliophora JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2020-128 e2020-128 | Vol. 52 Hemicycliophora ahvasiensis n. sp. (Nematoda: Hemicycliophoridae), and data on a known species, from Iran Sedighe Azimi1,*, Joaquín Abolafia2 3 and Majid Pedram Abstract 1Department of Plant Protection, Faculty of Agriculture, Shahid Hemicycliophora ahvasiensis n. sp., recovered from the rhizospheric Chamran University of Ahvaz, soil of date palm in Khuzestan province, southwest Iran, is described Ahvaz, Iran. and illustrated based upon morphological, morphometric and molecular data. The new species is characterized by its sheath, 2Departamento de Biología Animal, closely fitting most of the body, cuticle with or without numerous Biología Vegetal y Ecología, irregular lines, sometimes appearing as blocks in distal body Universidad de Jaén, Campus de region. Lateral field without discrete longitudinal lines, but often las Lagunillas, Avenida de Ben with continuous broken striae or anastomoses. Continuous lip Saprut s/n. 23071-Jaén, Spain. region with single annulus, slightly elevated labial disc, stylet with 3Department of Plant Pathology, posteriorly sloping knobs. Vulva with or without slightly modified lips, Faculty of Agriculture, Tarbiat spermatheca with sperm and tail conoid, symmetrically narrowing Modares University, Tehran, Iran. at distal region to form a narrow conical region. Morphologically, the new species looks similar to H. indica, H. labiata, H. siddiqii, *E-mail: [email protected] H. tenuistriata and H. typica. The latter species appears more similar This paper was edited by to the new species under light microscopy, but could be separated Thomas Powers. using the scanning electron microscopy and molecular data. The Received for publication new species was also compared with H. epicharoides and H. dulli, two species with close phylogenetic affinities to it. The phylogenetic August 24, 2020. relationships of the new species were reconstructed and discussed using partial sequences of the D2-D3 expansion segments of large subunit, and internal transcribed spacer regions (LSU D2-D3 and ITS rDNA). Hemicycliophora conida, the second studied species, was recovered from north Iran and characterized by morphological and molecular data. Keywords D2-D3-LSU, Hemicycliophora, H. conida, ITS, morphology, morphometrics, phylogeny, sheath nematode, taxonomy. In their excellent contribution to the systematics of Currently the genus contains 133 species (132 listed the superfamily Hemicycliophoroidea Skarbilovich, in Chitambar and Subbotin, 2014 and one in Maria 1959 (Siddiqi, 1980), Chitambar and Subbotin (2014) et al., 2018). reviewed the taxonomy of the genus Hemicycliophora There are 12 species of Hemicycliophora have (De Man, 1921) and updated data of the currently been reported from different provinces in Iran. They valid species. In the same year, Subbotin et al. (2014) are H. belemnis Germani & Luc, 1973, H. chilensis addressed aspects of the pathogenicity of Hemi­ Brzeski, 1974, H. conida Thorne, 1955, H. iranica Loof, cycliophora species on associated host plants, the 1984, H. lutosa Loof & Heyns, 1969, H. megalodiscus difficulties of morphological identifications due to Loof, 1984, H. poranga Monteiro & Lordello, 1978, H. morphological plasticity, and the lack of scanning ripa Van den Berg, 1981, H. sculpturata Loof, 1984, electron microscopic (SEM) and molecular data. H. spinituberculata Loof, 1984, H. sturhani Loof, © 2020 Authors. This is an Open Access article licensed under the Creative 1 Commons CC BY 4.0 license, https://creativecommons.org/licenses/by/4.0/ Hemicycliophora ahvasiensis n. sp. from Iran: Azimi et al. 1984 and H. vaccinii Reed & Jenkins, 1963. All of transferred to 3 μ l of TE buffer (10 mM Tris-Cl, 0.5 mM these species were characterized using traditional EDTA; pH 9.0) on a clean slide, and then crushed taxonomic methods (Eskandari, 2018). In an effort using a cover slip. The suspension was collected to document Hemicycliophora species occurring by adding 20 μ l TE buffer. One DNA sample for in Iran, two populations were recovered from soil the Gilan population and two DNA samples for samples obtained from different geographical lo- the Khuzestan population were prepared in this cations in northern and southern regions. The manner. The DNA samples were stored at –20°C preliminary morphological studies revealed the po- until used as a PCR template. Primers for LSU pulation recovered from south Iran resembled rDNA D2-D3 amplification were forward primer D2A H. typica de Man, 1921 under light microscope (5’–ACAAGTACCGTGAGGGAAAGT–3’) and reverse (LM), but further studies using SEM and molecular primer D3B (5’–TCGGAAGGAACCAGCTACTA–3’) data, and comparisons with all known species of (Nunn, 1992). Primers for amplification of ITS the genus, revealed it to be an unknown species, rDNA were forward primer TW81 (5’–GTTTCCGTA described herein as H. ahvasiensis n. sp. The second GGTGAACCTGC–3’) and reverse primer AB28 (5’– species recovered from north Iran belonged to ATATGCTTAAGTTCAGCGGGT–3’) as described in H. conida Thorne, 1955. Vovlas et al. (2008). The 25 μ l PCR mixture contained 14.5 μ l of distilled water, 3 μ l of 10 × PCR buffer, 0.5 μ l Materials and methods of 10 mM dNTP mixture, 1.5 μ l of 50 mM MgCl2, 1 μ l of each primer (10 pmol/μ l), 0.5 μ l of Taq DNA polymerase Nematode extraction and morphological (Cinna Gen, Tehran, Iran, 5 U/μ l), and 3 μ l of DNA template. The thermal cycling program was as follows: observations denaturation at 95°C for 4 min, followed by 35 cycles Several soil samples were collected from date of denaturation at 94°C for 30 s, annealing at 52°C for palm and fruit tree gardens in Khuzestan and Gilan 40 s, and extension at 72°C for 80 s. A final extension provinces, Iran. The relevant information of the presently was performed at 72°C for 10 min. Amplification studied nematode populations, and those included in success was evaluated by electrophoresis on 1% phylogenetic analyses, are given in Table 1. Jenkins’ agarose gel (Aliramaji et al., 2018, 2020). The PCR method (Jenkins, 1964) was used to extract the products were purified using the QIAquick PCR ® nematodes from soil samples. The collected specimens purification kit (Qiagen ) following the manufacturer’s were killed in hot 4% formaldehyde solution and protocol and sequenced directly using the PCR transferred to anhydrous glycerin according to De primers with an ABI 3730XL sequencer (Bioneer Grisse (1969). Observations and measurements were Corporation, South Korea). The newly obtained se- conducted using a Leitz SM-LUX light microscope quences of the studied species were deposited into equipped with a drawing tube. Some of the the GenBank database (accession numbers LSU specimens were photographed using an Olympus D2-D3 MT901580/MT901581 and ITS rDNA MT901582 DP72 digital camera attached to an Olympus /MT901583 for the new species and MT901584 for ITS BX51 light microscope equipped with differential rDNA of H. conida, as indicated in Table 1). interference contrast (DIC). Phylogenetic analyses Scanning electron microscopy (SEM) The newly obtained sequences of the D2-D3 Specimens preserved in glycerin were selected for fragments of LSU rDNA of the both populations, observation according to Abolafia (2015). They were and the selected sequences from GenBank, were hydrated in distilled water, dehydrated in a graded aligned by Clustal X2 (http://www.clustal.org/) using mixture of ethanol-acetone series, critical point- the default parameters. The ITS dataset was aligned dried with liquid carbon dioxide, and coated with using MUSCLE as implemented in MEGA6 (Tamura gold. The mounts were examined with a Zeiss Merlin et al., 2013). The editing of both alignments was microscope (5 kV). performed manually. The outgroup taxa were chosen according to previous studies (Subbotin et al., 2014; DNA extraction, PCR and sequencing Van den Berg et al., 2018; Maria et al., 2018). The base substitution model was selected using MrModeltest For molecular analyses, single female specimens 2 (Nylander, 2004) based on the Akaike information were picked out, examined in a drop of distilled water criteria. A general time reversible model, including on a temporary slide under the light microscope, among-site rate heterogeneity and estimates of 2 JOURNAL OF NEMATOLOGY Table 1. Information of the species/populations of Hemicycliophora studied in present paper and those of ingroup and outgroup taxa used in phylogenetic analyses. GenBank accession numbers D2-D3 of Reference or Species Host Locality ITS LSU rDNA identifier H. ahvasiensis Phoenix Khuzestan province, MT901580, MT901582, Present study n. sp. dactylifera Iran MT901581 MT901583 H. californica Salix sp. Yolo County, CA, KF430518, KF430576 Subbotin et al. (2014) USA KF430519 H. conida Punica granatum Gilan province, Iran – MT901584 Present study H. conida Unknown plant Belgium FN433875 – I. Tandingan De Ley et al. (unpub.) H. conida Turf grasses Football pitch, KF430447 KF430580 P. Castillo; Subbotin Madrid, Spain et al. (2014) H. conida Unknown plant Clallam County, WA, KF430448 KF430579 Subbotin et al. (2014) USA H. dulli Peat South Africa MT329669, MT329671, M. Rashidifard MT329670 MT329672 (unpub.) H. epicharoides Ammophila Serranova, Brindisi, KF430512 – Subbotin et al. (2014) arenaria Italy H. epicharoides Ammophila S. Barrameda, – KF430608 Subbotin et al. (2014) arenaria Cádiz, Spain H. epicharoides Pragmites sp. Epiros, Greece – KF430606 Subbotin et al. (2014) H. floridensis Pinus elliotti
Load more

Recommended publications
  • Are Introduced Rats (Rattus Rattus) Both Seed Predators and Dispersers In
    CHAPTER FOUR: ARE INTRODUCED RATS (RATTUS RATTUS) BOTH SEED PREDATORS AND DISPERSERS IN HAWAII? Aaron B. Shiels Department of Botany University of Hawaii at Manoa 3190 Maile Way Honolulu, HI. 96822 122 Abstract Invasive rodents are among the most ubiquitous and problematic species introduced to islands; more than 80% of the world‘s island groups have been invaded. Introduced rats (black rat, Rattus rattus; Norway rat, R. norvegicus; Pacific rat, R. exulans) are well known as seed predators but are often overlooked as potential seed dispersers despite their common habit of transporting fruits and seeds prior to consumption. The relative likelihood of seed predation and dispersal by the black rat, which is the most common rat in Hawaiian forest, was tested with field and laboratory experiments. In the field, fruits of eight native and four non-native common woody plant species were arranged individually on the forest floor in four treatments that excluded vertebrates of different sizes. Eleven species had a portion (3% to 100%) of their fruits removed from vertebrate-accessible treatments, and automated cameras photographed only black rats removing fruit. In the laboratory, black rats were offered fruits of all 12 species to assess consumption and seed fate. Seeds of two species (non-native Clidemia hirta and native Kadua affinis) passed intact through the digestive tracts of rats. Most of the remaining larger-seeded species had their seeds chewed and destroyed, but for several of these, some partly damaged or undamaged seeds survived rat exposure. The combined field and laboratory findings indicate that many interactions between black rats and seeds of native and non-native plants may result in dispersal.
    [Show full text]
  • Will Climate Change, Genetic and Demographic Variation Or Rat Predation Pose the Greatest Risk for Persistence of an Altitudinally Distributed Island Endemic?
    Biology 2012, 1, 736-765; doi:10.3390/biology1030736 OPEN ACCESS biology ISSN 2079-7737 www.mdpi.com/journal/biology Article Will Climate Change, Genetic and Demographic Variation or Rat Predation Pose the Greatest Risk for Persistence of an Altitudinally Distributed Island Endemic? Catherine Laura Simmons 1, Tony D. Auld 2, Ian Hutton 3, William J. Baker 4 and Alison Shapcott 1,* 1 Faculty of Science Health, Education and Engineering, University of the Sunshine Coast, Maroochydore DC, QLD 4558, Australia; E-Mail: [email protected] 2 Office of Environment and Heritage (NSW), P.O. Box 1967 Hurstville, NSW 2220, Australia; E-Mail: [email protected] 3 P.O. Box 157, Lord Howe Island, NSW 2898, Australia; E-Mail: [email protected] 4 Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3AB, UK; E-Mail: [email protected] * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +61-7-5430-1211; Fax: +61-7-5430-2881. Received: 3 September 2012; in revised form: 29 October 2012 / Accepted: 16 November 2012 / Published: 23 November 2012 Abstract: Species endemic to mountains on oceanic islands are subject to a number of existing threats (in particular, invasive species) along with the impacts of a rapidly changing climate. The Lord Howe Island endemic palm Hedyscepe canterburyana is restricted to two mountains above 300 m altitude. Predation by the introduced Black Rat (Rattus rattus) is known to significantly reduce seedling recruitment. We examined the variation in Hedyscepe in terms of genetic variation, morphology, reproductive output and demographic structure, across an altitudinal gradient.
    [Show full text]
  • Nematodes and Agriculture in Continental Argentina
    Fundam. appl. NemalOl., 1997.20 (6), 521-539 Forum article NEMATODES AND AGRICULTURE IN CONTINENTAL ARGENTINA. AN OVERVIEW Marcelo E. DOUCET and Marîa M.A. DE DOUCET Laboratorio de Nematologia, Centra de Zoologia Aplicada, Fant/tad de Cien.cias Exactas, Fisicas y Naturales, Universidad Nacional de Cordoba, Casilla df Correo 122, 5000 C6rdoba, Argentina. Acceplecl for publication 5 November 1996. Summary - In Argentina, soil nematodes constitute a diverse group of invertebrates. This widely distributed group incJudes more than twO hundred currently valid species, among which the plant-parasitic and entomopathogenic nematodes are the most remarkable. The former includes species that cause damages to certain crops (mainly MeloicU:igyne spp, Nacobbus aberrans, Ditylenchus dipsaci, Tylenchulus semipenetrans, and Xiphinema index), the latter inc1udes various species of the Mermithidae family, and also the genera Steinernema and Helerorhabditis. There are few full-time nematologists in the country, and they work on taxonomy, distribution, host-parasite relationships, control, and different aspects of the biology of the major species. Due tO the importance of these organisms and the scarcity of information existing in Argentina about them, nematology can be considered a promising field for basic and applied research. Résumé - Les nématodes et l'agriculture en Argentine. Un aperçu général - Les nématodes du sol représentent en Argentine un groupe très diversifiè. Ayant une vaste répartition géographique, il comprend actuellement plus de deux cents espèces, celles parasitant les plantes et les insectes étant considèrées comme les plus importantes. Les espèces du genre Me/oi­ dogyne, ainsi que Nacobbus aberrans, Dùylenchus dipsaci, Tylenchulus semipenetrans et Xiphinema index représentent un réel danger pour certaines cultures.
    [Show full text]
  • Lepidorrhachis Mooreana (H
    Palm Conservation – Palm Specialist Group Lepidorrhachis mooreana (H. Wendl. & Drude) O. F. Cook Status: Not Evaluated in IUCN Red List. Vulnerable according to Dowe in Johnson (1996). Preliminary evaluation based on IUCN 2001 criteria: Endangered (EN B1a,bv) Common name Little Mountain Palm. Natural range Lepidorrhachis mooreana is restricted to the summits of Mt. Gower (875 m) and Mt. Lidgbird (777 m) on the remote Lord Howe Island. It occurs only above 750 m in dwarf mossy forest that dominates the summit plateau of Mt. Gower and the narrow summit ridge of Mt. Lidgbird. This forest is home to numerous remarkable endemic species including the pumpkin tree (Negria rhabdothamnoides), an arborescent member of the Gesneriaceae, and Dracophyllum fitzgeraldii (Ericaceae). It is also the primary nesting locality of the providence petrel (Pterodroma solandri) and is a stronghold for the woodhen (Tricholimnas sylvestris), an endemic member of the rail family that was recently rescued from the brink of extinction. However, less that 0.5 km2 of Lord Howe’s total surface area of 12 km2 is found above 750 m. The total area of suitable habitat available to Lepidorrhachis is thus extremely limited. Recognition characteristics Lepidorrhachis is very easily distinguished from the two other endemic palm genera on Lord Howe Island, Howea and Hedyscepe. It is a short solitary palm with a stem that rarely exceeds 2 m in height. It has stiff, arching leaves with short, deeply split leaf sheaths that do not form a distinct crownshaft. The sheaths are also covered with buff indumentum. Its bushy inflorescences are born below the leaves and are unisexual, both male and female inflorescences occurring on the same plant.
    [Show full text]
  • The Island Rule and Its Application to Multiple Plant Traits
    The island rule and its application to multiple plant traits Annemieke Lona Hedi Hendriks A thesis submitted to the Victoria University of Wellington in partial fulfilment of the requirements for the degree of Master of Science in Ecology and Biodiversity Victoria University of Wellington, New Zealand 2019 ii “The larger the island of knowledge, the longer the shoreline of wonder” Ralph W. Sockman. iii iv General Abstract Aim The Island Rule refers to a continuum of body size changes where large mainland species evolve to become smaller and small species evolve to become larger on islands. Previous work focuses almost solely on animals, with virtually no previous tests of its predictions on plants. I tested for (1) reduced floral size diversity on islands, a logical corollary of the island rule and (2) evidence of the Island Rule in plant stature, leaf size and petiole length. Location Small islands surrounding New Zealand; Antipodes, Auckland, Bounty, Campbell, Chatham, Kermadec, Lord Howe, Macquarie, Norfolk, Snares, Stewart and the Three Kings. Methods I compared the morphology of 65 island endemics and their closest ‘mainland’ relative. Species pairs were identified. Differences between archipelagos located at various latitudes were also assessed. Results Floral sizes were reduced on islands relative to the ‘mainland’, consistent with predictions of the Island Rule. Plant stature, leaf size and petiole length conformed to the Island Rule, with smaller plants increasing in size, and larger plants decreasing in size. Main conclusions Results indicate that the conceptual umbrella of the Island Rule can be expanded to plants, accelerating understanding of how plant traits evolve on isolated islands.
    [Show full text]
  • Wendland's Palms
    Wendland’s Palms Hermann Wendland (1825 – 1903) of Herrenhausen Gardens, Hannover: his contribution to the taxonomy and horticulture of the palms ( Arecaceae ) John Leslie Dowe Published by the Botanic Garden and Botanical Museum Berlin as Englera 36 Serial publication of the Botanic Garden and Botanical Museum Berlin November 2019 Englera is an international monographic series published at irregular intervals by the Botanic Garden and Botanical Museum Berlin (BGBM), Freie Universität Berlin. The scope of Englera is original peer-reviewed material from the entire fields of plant, algal and fungal taxonomy and systematics, also covering related fields such as floristics, plant geography and history of botany, provided that it is monographic in approach and of considerable volume. Editor: Nicholas J. Turland Production Editor: Michael Rodewald Printing and bookbinding: Laserline Druckzentrum Berlin KG Englera online access: Previous volumes at least three years old are available through JSTOR: https://www.jstor.org/journal/englera Englera homepage: https://www.bgbm.org/englera Submission of manuscripts: Before submitting a manuscript please contact Nicholas J. Turland, Editor of Englera, Botanic Garden and Botanical Museum Berlin, Freie Universität Berlin, Königin- Luise-Str. 6 – 8, 14195 Berlin, Germany; e-mail: [email protected] Subscription: Verlagsauslieferung Soyka, Goerzallee 299, 14167 Berlin, Germany; e-mail: kontakt@ soyka-berlin.de; https://shop.soyka-berlin.de/bgbm-press Exchange: BGBM Press, Botanic Garden and Botanical Museum Berlin, Freie Universität Berlin, Königin-Luise-Str. 6 – 8, 14195 Berlin, Germany; e-mail: [email protected] © 2019 Botanic Garden and Botanical Museum Berlin, Freie Universität Berlin All rights (including translations into other languages) reserved.
    [Show full text]
  • Cunninghamia Date of Publication: April 2020 a Journal of Plant Ecology for Eastern Australia
    Cunninghamia Date of Publication: April 2020 A journal of plant ecology for eastern Australia ISSN 0727- 9620 (print) • ISSN 2200 - 405X (Online) A Systematic Flora Survey, Floristic Classification and High-Resolution Vegetation Map of Lord Howe Island Paul Sheringham 1*, Peter Richards2, Phil Gilmour3, Jill Smith1 and Ernst Kemmerer 4 1 Department of Planning, Industry and Environment, Locked Bag 914 COFFS HARBOUR NSW 2450 2 17 Coronation Avenue, SAWTELL NSW 2452 3 523 Roses Rd, GLENIFFER, NSW 2454 4 Cradle Coast NRM, PO Box 338, BURNIE TAS 7320 * Author for correspondence: [email protected] Abstract: The present study took advantage of the availability of high resolution ADS40 digital imagery to 1) systematically resample the vegetation of the Lord Howe Island Group (LHIG, excluding Ball’s Pyramid); 2) conduct a numerical analysis of the floristic data; 3) map vegetation extent and the distribution of vegetation communities and 4) compare the resultant classification and mapping with those of Pickard (1983). In July 2013, a total of 86 full floristic and 105 rapid floristic sites were sampled across the island, based on a stratified random sampling design. A hierarchical agglomerative clustering strategy (Flexible UPGMA) and Bray-Curtis dissimilarity coefficient with default beta, along with nearest neighbour analysis to identify anomalous site allocations, was used to analyze the floristic data. In total 33 vegetation communities were delineated and mapped: 19 mapping units from the full floristic analysis; 7 variants identified within five of the above 19 groups; 3 mapping units from analysis of canopy- only floristic data; and 4 mapping units recognised in previous studies that are mapped but were not sampled in this survey.
    [Show full text]
  • (Arecaceae): Évolution Du Système Sexuel Et Du Nombre D'étamines
    Etude de l’appareil reproducteur des palmiers (Arecaceae) : évolution du système sexuel et du nombre d’étamines Elodie Alapetite To cite this version: Elodie Alapetite. Etude de l’appareil reproducteur des palmiers (Arecaceae) : évolution du système sexuel et du nombre d’étamines. Sciences agricoles. Université Paris Sud - Paris XI, 2013. Français. NNT : 2013PA112063. tel-01017166 HAL Id: tel-01017166 https://tel.archives-ouvertes.fr/tel-01017166 Submitted on 2 Jul 2014 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITE PARIS-SUD ÉCOLE DOCTORALE : Sciences du Végétal (ED 45) Laboratoire d'Ecologie, Systématique et E,olution (ESE) DISCIPLINE : -iologie THÈSE DE DOCTORAT SUR TRAVAUX soutenue le ./05/10 2 par Elodie ALAPETITE ETUDE DE L'APPAREIL REPRODUCTEUR DES PAL4IERS (ARECACEAE) : EVOLUTION DU S5STE4E SE6UEL ET DU NO4-RE D'ETA4INES Directeur de thèse : Sophie NADOT Professeur (Uni,ersité Paris-Sud Orsay) Com osition du jury : Rapporteurs : 9ean-5,es DU-UISSON Professeur (Uni,ersité Pierre et 4arie Curie : Paris VI) Porter P. LOWR5 Professeur (4issouri -otanical Garden USA et 4uséum National d'Histoire Naturelle Paris) Examinateurs : Anders S. -ARFOD Professeur (Aarhus Uni,ersity Danemark) Isabelle DA9OA Professeur (Uni,ersité Paris Diderot : Paris VII) 4ichel DRON Professeur (Uni,ersité Paris-Sud Orsay) 3 4 Résumé Les palmiers constituent une famille emblématique de monocotylédones, comprenant 183 genres et environ 2500 espèces distribuées sur tous les continents dans les zones tropicales et subtropicales.
    [Show full text]
  • Nematoda: Criconematidae) from Hangzhou, China
    JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2020-006 e2020-06 | Vol. 52 A new rare nematode Nothocriconemoides hangzhouensis n. sp. (Nematoda: Criconematidae) from Hangzhou, China Munawar Maria1, Wentao Miao1, Ruihang Cai1, Pablo Castillo2 and Jingwu Zheng1, 3,* Abstract The Family Criconematidae is commonly referred as ring nematodes 1Laboratory of Plant Nematology, that include some members with economic importance as plant para- Institute of Biotechnology, College sites. During a recent nematode inventory survey at Zhejiang Province, of Agriculture & Biotechnology, China, a new species of genus Nothocriconemoides was detected in Zhejiang University, Hangzhou the rhizosphere of elm tree. Nothocriconemoides hangzhouensis n. 310058, Zhejiang, P.R. China. sp. can be characterized by the female body having annuli with fine 2Institute for Sustainable Agriculture longitudinal striations and 2 to 3 anastomoses at the posterior half of (IAS), Spanish National Research the body. The first cephalic annulus is rounded and expanded enclos- Council (CSIC), Campus de Excel- ing the lip region, and the second annulus is narrow, offset, collar like. encia Internacional Agroalimentario, En face view shows a central elevated labial disk bearing four distinct ceiA3, Avenida Menéndez Pidal equal-sized submedian lobes and “I” shaped oral aperture. Excreto- s/n, 14004 Córdoba, Spain. ry pore is located 3–4 annuli posterior to esophageal bulb. Vagina is straight and vulva closed. The ventral side of postvulval annuli is invert- 3Ministry of Agriculture Key Lab ed, in majority of individuals. Anus is indistinct and located on the next of Molecular Biology of Crop annuli posterior to vulva. Tail is short, conoid, with forked or branched Pathogens and Insects, Hangzhou terminus.
    [Show full text]
  • Species Discovery and Diversity in Lobocriconema (Criconematidae: Nematoda) and Related Plant-Parasitic Nematodes from North American Ecoregions
    Zootaxa 4085 (3): 301–344 ISSN 1175-5326 (print edition) http://www.mapress.com/j/zt/ Article ZOOTAXA Copyright © 2016 Magnolia Press ISSN 1175-5334 (online edition) http://doi.org/10.11646/zootaxa.4085.3.1 http://zoobank.org/urn:lsid:zoobank.org:pub:434DE1BF-55C9-45A4-B25A-AE5E54280172 Species discovery and diversity in Lobocriconema (Criconematidae: Nematoda) and related plant-parasitic nematodes from North American ecoregions T.O. POWERS 1,4, E.C. BERNARD2, T. HARRIS1, R. HIGGINS1, M. OLSON1, S. OLSON3, M. LODEMA1, J. MATCZYSZYN1, P. MULLIN1, L. SUTTON1 & K.S. POWERS1 1Department of Plant Pathology, University of Nebraska-Lincoln, Lincoln, NE 68583-0722, USA. E-mail: [email protected] 2Entomology & Plant Pathology, University of Tennessee, 2505 E.J. Chapman Drive, 370 Plant Biotechnology, Knoxville, TN, USA, 37996-4560. E-mail: [email protected] 3Department of Statistics, University of Nebraska-Lincoln, Lincoln, NE 68583-0963 4Corresponding author Abstract There are many nematode species that, following formal description, are seldom mentioned again in the scientific litera- ture. Lobocriconema thornei and L. incrassatum are two such species, described from North American forests, respective- ly 37 and 49 years ago. In the course of a 3-year nematode biodiversity survey of North American ecoregions, specimens resembling Lobocriconema species appeared in soil samples from both grassland and forested sites. Using a combination of molecular and morphological analyses, together with a set of species delimitation approaches, we have expanded the known range of these species, added to the species descriptions, and discovered a related group of species that form a monophyletic group with the two described species.
    [Show full text]
  • <I>Mesocriconema Ericaceum</I>
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Papers in Plant Pathology Plant Pathology Department 6-15-2016 Description of Mesocriconema ericaceum n. sp. (Nematoda: Criconematidae) and notes on other nematode species discovered in an ericaceous heath bald community in Great Smoky Mountains National Park, USA Thomas O. Powers University of Nebraska-Lincoln, [email protected] Peter Mullin University of Nebraska-Lincoln, [email protected] Rebecca Higgins University of Nebraska-Lincoln, [email protected] Timothy Harris University of Nebraska-Lincoln, [email protected] KirsFollotewn thiS. Pso awendrs additional works at: http://digitalcommons.unl.edu/plantpathpapers UnivPerasitrty ofof NtheebrasBiodka-Livinecorsitln, ykpo Cwommoners1@unls,.eEducology and Evolutionary Biology Commons, Genetics and Genomics Commons, Other Plant Sciences Commons, Plant Biology Commons, Plant Pathology Commons, and the Zoology Commons Powers, Thomas O.; Mullin, Peter; Higgins, Rebecca; Harris, Timothy; and Powers, Kirsten S., "Description of Mesocriconema ericaceum n. sp. (Nematoda: Criconematidae) and notes on other nematode species discovered in an ericaceous heath bald community in Great Smoky Mountains National Park, USA" (2016). Papers in Plant Pathology. 438. http://digitalcommons.unl.edu/plantpathpapers/438 This Article is brought to you for free and open access by the Plant Pathology Department at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Papers in Plant Pathology by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Published in Nematology 18:8 (2016), pp. 879-903. DOI 10.1163/15685411-00003001 Copyright © Koninklijke Brill NV, Leiden, 2016. Used by permission . Submitted 24 March 2016; revised 31 May 2016; accepted 31 May 2016; published online 15 June 2016.
    [Show full text]
  • 1 §4-71-6.5 List of Restricted Animals [ ] Part A: For
    §4-71-6.5 LIST OF RESTRICTED ANIMALS [ ] PART A: FOR RESEARCH AND EXHIBITION SCIENTIFIC NAME COMMON NAME INVERTEBRATES PHYLUM Annelida CLASS Hirudinea ORDER Gnathobdellida FAMILY Hirudinidae Hirudo medicinalis leech, medicinal ORDER Rhynchobdellae FAMILY Glossiphoniidae Helobdella triserialis leech, small snail CLASS Oligochaeta ORDER Haplotaxida FAMILY Euchytraeidae Enchytraeidae (all species in worm, white family) FAMILY Eudrilidae Helodrilus foetidus earthworm FAMILY Lumbricidae Lumbricus terrestris earthworm Allophora (all species in genus) earthworm CLASS Polychaeta ORDER Phyllodocida FAMILY Nereidae Nereis japonica lugworm PHYLUM Arthropoda CLASS Arachnida ORDER Acari FAMILY Phytoseiidae 1 RESTRICTED ANIMAL LIST (Part A) §4-71-6.5 SCIENTIFIC NAME COMMON NAME Iphiseius degenerans predator, spider mite Mesoseiulus longipes predator, spider mite Mesoseiulus macropilis predator, spider mite Neoseiulus californicus predator, spider mite Neoseiulus longispinosus predator, spider mite Typhlodromus occidentalis mite, western predatory FAMILY Tetranychidae Tetranychus lintearius biocontrol agent, gorse CLASS Crustacea ORDER Amphipoda FAMILY Hyalidae Parhyale hawaiensis amphipod, marine ORDER Anomura FAMILY Porcellanidae Petrolisthes cabrolloi crab, porcelain Petrolisthes cinctipes crab, porcelain Petrolisthes elongatus crab, porcelain Petrolisthes eriomerus crab, porcelain Petrolisthes gracilis crab, porcelain Petrolisthes granulosus crab, porcelain Petrolisthes japonicus crab, porcelain Petrolisthes laevigatus crab, porcelain Petrolisthes
    [Show full text]