JOURNAL OF NEMATOLOGY Article | DOI: 10.21307/jofnem-2020-128 e2020-128 | Vol. 52 Hemicycliophora ahvasiensis n. sp. (Nematoda: Hemicycliophoridae), and data on a known species, from Iran Sedighe Azimi1,*, Joaquín Abolafia2 3 and Majid Pedram Abstract 1Department of Plant Protection, Faculty of Agriculture, Shahid Hemicycliophora ahvasiensis n. sp., recovered from the rhizospheric Chamran University of Ahvaz, soil of date palm in Khuzestan province, southwest Iran, is described Ahvaz, Iran. and illustrated based upon morphological, morphometric and molecular data. The new species is characterized by its sheath, 2Departamento de Biología Animal, closely fitting most of the body, cuticle with or without numerous Biología Vegetal y Ecología, irregular lines, sometimes appearing as blocks in distal body Universidad de Jaén, Campus de region. Lateral field without discrete longitudinal lines, but often las Lagunillas, Avenida de Ben with continuous broken striae or anastomoses. Continuous lip Saprut s/n. 23071-Jaén, Spain. region with single annulus, slightly elevated labial disc, stylet with 3Department of Plant Pathology, posteriorly sloping knobs. Vulva with or without slightly modified lips, Faculty of Agriculture, Tarbiat spermatheca with sperm and tail conoid, symmetrically narrowing Modares University, Tehran, Iran. at distal region to form a narrow conical region. Morphologically, the new species looks similar to H. indica, H. labiata, H. siddiqii, *E-mail: [email protected] H. tenuistriata and H. typica. The latter species appears more similar This paper was edited by to the new species under light microscopy, but could be separated Thomas Powers. using the scanning electron microscopy and molecular data. The Received for publication new species was also compared with H. epicharoides and H. dulli, two species with close phylogenetic affinities to it. The phylogenetic August 24, 2020. relationships of the new species were reconstructed and discussed using partial sequences of the D2-D3 expansion segments of large subunit, and internal transcribed spacer regions (LSU D2-D3 and ITS rDNA). Hemicycliophora conida, the second studied species, was recovered from north Iran and characterized by morphological and molecular data. Keywords D2-D3-LSU, Hemicycliophora, H. conida, ITS, morphology, morphometrics, phylogeny, sheath nematode, taxonomy. In their excellent contribution to the systematics of Currently the genus contains 133 species (132 listed the superfamily Hemicycliophoroidea Skarbilovich, in Chitambar and Subbotin, 2014 and one in Maria 1959 (Siddiqi, 1980), Chitambar and Subbotin (2014) et al., 2018). reviewed the taxonomy of the genus Hemicycliophora There are 12 species of Hemicycliophora have (De Man, 1921) and updated data of the currently been reported from different provinces in Iran. They valid species. In the same year, Subbotin et al. (2014) are H. belemnis Germani & Luc, 1973, H. chilensis addressed aspects of the pathogenicity of Hemi­ Brzeski, 1974, H. conida Thorne, 1955, H. iranica Loof, cycliophora species on associated host plants, the 1984, H. lutosa Loof & Heyns, 1969, H. megalodiscus difficulties of morphological identifications due to Loof, 1984, H. poranga Monteiro & Lordello, 1978, H. morphological plasticity, and the lack of scanning ripa Van den Berg, 1981, H. sculpturata Loof, 1984, electron microscopic (SEM) and molecular data. H. spinituberculata Loof, 1984, H. sturhani Loof, © 2020 Authors. This is an Open Access article licensed under the Creative 1 Commons CC BY 4.0 license, https://creativecommons.org/licenses/by/4.0/ Hemicycliophora ahvasiensis n. sp. from Iran: Azimi et al. 1984 and H. vaccinii Reed & Jenkins, 1963. All of transferred to 3 μ l of TE buffer (10 mM Tris-Cl, 0.5 mM these species were characterized using traditional EDTA; pH 9.0) on a clean slide, and then crushed taxonomic methods (Eskandari, 2018). In an effort using a cover slip. The suspension was collected to document Hemicycliophora species occurring by adding 20 μ l TE buffer. One DNA sample for in Iran, two populations were recovered from soil the Gilan population and two DNA samples for samples obtained from different geographical lo- the Khuzestan population were prepared in this cations in northern and southern regions. The manner. The DNA samples were stored at –20°C preliminary morphological studies revealed the po- until used as a PCR template. Primers for LSU pulation recovered from south Iran resembled rDNA D2-D3 amplification were forward primer D2A H. typica de Man, 1921 under light microscope (5’–ACAAGTACCGTGAGGGAAAGT–3’) and reverse (LM), but further studies using SEM and molecular primer D3B (5’–TCGGAAGGAACCAGCTACTA–3’) data, and comparisons with all known species of (Nunn, 1992). Primers for amplification of ITS the genus, revealed it to be an unknown species, rDNA were forward primer TW81 (5’–GTTTCCGTA described herein as H. ahvasiensis n. sp. The second GGTGAACCTGC–3’) and reverse primer AB28 (5’– species recovered from north Iran belonged to ATATGCTTAAGTTCAGCGGGT–3’) as described in H. conida Thorne, 1955. Vovlas et al. (2008). The 25 μ l PCR mixture contained 14.5 μ l of distilled water, 3 μ l of 10 × PCR buffer, 0.5 μ l Materials and methods of 10 mM dNTP mixture, 1.5 μ l of 50 mM MgCl2, 1 μ l of each primer (10 pmol/μ l), 0.5 μ l of Taq DNA polymerase Nematode extraction and morphological (Cinna Gen, Tehran, Iran, 5 U/μ l), and 3 μ l of DNA template. The thermal cycling program was as follows: observations denaturation at 95°C for 4 min, followed by 35 cycles Several soil samples were collected from date of denaturation at 94°C for 30 s, annealing at 52°C for palm and fruit tree gardens in Khuzestan and Gilan 40 s, and extension at 72°C for 80 s. A final extension provinces, Iran. The relevant information of the presently was performed at 72°C for 10 min. Amplification studied nematode populations, and those included in success was evaluated by electrophoresis on 1% phylogenetic analyses, are given in Table 1. Jenkins’ agarose gel (Aliramaji et al., 2018, 2020). The PCR method (Jenkins, 1964) was used to extract the products were purified using the QIAquick PCR ® nematodes from soil samples. The collected specimens purification kit (Qiagen ) following the manufacturer’s were killed in hot 4% formaldehyde solution and protocol and sequenced directly using the PCR transferred to anhydrous glycerin according to De primers with an ABI 3730XL sequencer (Bioneer Grisse (1969). Observations and measurements were Corporation, South Korea). The newly obtained se- conducted using a Leitz SM-LUX light microscope quences of the studied species were deposited into equipped with a drawing tube. Some of the the GenBank database (accession numbers LSU specimens were photographed using an Olympus D2-D3 MT901580/MT901581 and ITS rDNA MT901582 DP72 digital camera attached to an Olympus /MT901583 for the new species and MT901584 for ITS BX51 light microscope equipped with differential rDNA of H. conida, as indicated in Table 1). interference contrast (DIC). Phylogenetic analyses Scanning electron microscopy (SEM) The newly obtained sequences of the D2-D3 Specimens preserved in glycerin were selected for fragments of LSU rDNA of the both populations, observation according to Abolafia (2015). They were and the selected sequences from GenBank, were hydrated in distilled water, dehydrated in a graded aligned by Clustal X2 (http://www.clustal.org/) using mixture of ethanol-acetone series, critical point- the default parameters. The ITS dataset was aligned dried with liquid carbon dioxide, and coated with using MUSCLE as implemented in MEGA6 (Tamura gold. The mounts were examined with a Zeiss Merlin et al., 2013). The editing of both alignments was microscope (5 kV). performed manually. The outgroup taxa were chosen according to previous studies (Subbotin et al., 2014; DNA extraction, PCR and sequencing Van den Berg et al., 2018; Maria et al., 2018). The base substitution model was selected using MrModeltest For molecular analyses, single female specimens 2 (Nylander, 2004) based on the Akaike information were picked out, examined in a drop of distilled water criteria. A general time reversible model, including on a temporary slide under the light microscope, among-site rate heterogeneity and estimates of 2 JOURNAL OF NEMATOLOGY Table 1. Information of the species/populations of Hemicycliophora studied in present paper and those of ingroup and outgroup taxa used in phylogenetic analyses. GenBank accession numbers D2-D3 of Reference or Species Host Locality ITS LSU rDNA identifier H. ahvasiensis Phoenix Khuzestan province, MT901580, MT901582, Present study n. sp. dactylifera Iran MT901581 MT901583 H. californica Salix sp. Yolo County, CA, KF430518, KF430576 Subbotin et al. (2014) USA KF430519 H. conida Punica granatum Gilan province, Iran – MT901584 Present study H. conida Unknown plant Belgium FN433875 – I. Tandingan De Ley et al. (unpub.) H. conida Turf grasses Football pitch, KF430447 KF430580 P. Castillo; Subbotin Madrid, Spain et al. (2014) H. conida Unknown plant Clallam County, WA, KF430448 KF430579 Subbotin et al. (2014) USA H. dulli Peat South Africa MT329669, MT329671, M. Rashidifard MT329670 MT329672 (unpub.) H. epicharoides Ammophila Serranova, Brindisi, KF430512 – Subbotin et al. (2014) arenaria Italy H. epicharoides Ammophila S. Barrameda, – KF430608 Subbotin et al. (2014) arenaria Cádiz, Spain H. epicharoides Pragmites sp. Epiros, Greece – KF430606 Subbotin et al. (2014) H. floridensis Pinus elliotti