Acta Sci. Pol. Hortorum Cultus, 19(3) 2020, 111–124 https://czasopisma.up.lublin.pl/index.php/asphc ISSN 1644-0692 e-ISSN 2545-1405 DOI: 10.24326/asphc.2020.3.10

ORIGINAL PAPER Accepted: 25.07.2019

MOLECULAR CLONING, BIOINFORMATION ANALYSIS AND EXPRESSION OF THE STRICTOSIDINE SYNTHASE IN Dendrobium officinale

Yan-Fang Zhu1,2 , Hong-Hong Fan2, Da-Hui Li2, Qing Jin2, Chuan-Ming Zhang2, Li-Qin Zhu2, Cheng Song2, Yong-Ping Cai2, Yi Lin2

1 Key Laboratory of Resource Plant Biology of Anhui Province, School of Life Sciences, Huaibei Normal University, Huaibei 235000, P.R. China 2 School of Life Sciences, Anhui Agricultural University, Hefei, 230036, P.R. China

Abstract The enzyme strictosidine synthase (STR, EC: 4.3.3.2) plays a key role in the biosynthetic pathway of terpenoid indole alkaloid (TIA). It catalyzes the condensation of the tryptamine and secologanin to form 3α(S)-stricto- sidine, which is the common precursor of all TIAs. In this paper, a STR gene designated as DoSTR (GenBank: KX068707) was first cloned and characterized fromDendrobium officinale with rapid amplified cDNA ends method (RACE). DoSTR has a length of 1380bp with 1179bp open reading frame encoding 392 amino acids. BlastP analyses showed that its amino acid sequence was classified into Str_synth superfamily. qRT-PCR showed that DoSTR was expressed in all tissues tested, with a significantly higher level in flower and the

lowest in stem. Four different treatments with MeJA, SA, ABA and AgNO3, respectively, could induce the DoSTR expression to a different extent. And the effect of MeJA was the most obvious and transcript level of DoSTR induced by MeJA was 20.7 times greater than that of control at 48 hours after treatment. Furthermore, it was found that DoSTR was localized in vacuole through transient expression in tobacco. The characteriza- tion and expression of DoSTR can help in further studying the role of DoSTR in the biosynthesis of TIAs in D. officinale. This study may throw light on the alkaloid biosynthesis pathway of D. officinale.

Key words: Dendrobium officinale, DoSTR, terpenoid indole alkaloid, tissue expression pattern, subcellular localization

Abbreviations: TIA – terpenoid indole alkaloid, RACE – rapid amplification of cDNA ends, ORF – open

reading fram, MeJA – methyljasmonate, SA – salicylic acid, ABA – absdcisic acid, AgNO3 – silver nitrate, STR – strictosidine synthase, CAT – camptothecin, qRT-PCR Real-time quantitative PCR

Introduction

Dendrobium officinale Kimura et Migo is a re- saccharides, alkaloids, phenols, coumarins, terpenes, nowned Dendrobium genus medicinal plant in tradi- flavonoids, amino acids, benzyl compounds, and some tional Chinese medicine. It has been widely used in trace mineral elements [Ng et al. 2012, Xu et al. 2013]. China owing to its diverse tonic components. The Due to these components, D. officinale possesses im- main active ingredients of D. officinale include poly- munomodulatory and hepatoprotective activities,

 [email protected]

© Copyright by Wydawnictwo Uniwersytetu Przyrodniczego w Lublinie Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10

antioxidant, anticancer, neuroprotective activities, fied by Professor Cai Yongping of Anhui Agricultural anti-cataract, and so on [Ng et al. 2012, Wei et al. University and used as the experimental materials 2016]. Among these medicinal ingredients, although which grew in wild environment and obtained from alkaloids are one of the most important components of Dabie Mountain Area in Huoshan county, Anhui prov- D. officinale, the biosynthesis pathway of these alka- ince, China. The current-year leaves were immediate- loids is still unclear. ly frozen in liquid nitrogen and stored at –80°C, which In a previous report, the alkaloids of Dendrobium were used to extract RNA for cloning DoSTR putative genus are mostly sesquiterpene alkaloids [Zhang et gene sequence. al. 2003]. Based on the D. officinale genome data and For further analysis DoSTR expression in different metabolic profiling, the pathway of D. officinale al- tissues (roots, stems, flowers and leaves), 0.5 grams of kaloid synthesis could be extended to generate a kind each tissue were collected from the above described of terpenoid indole alkaloid (TIA) [Yan et al. 2015, plants, quickly frozen and stored at –80°C, respectively. Jiao et al. 2018]. Moreover, according to the published Protocorms were induced from seeds on MS medium D. officinale transcriptome data, genes annotated as by the tissue culture. After cultured with temperature elements of D. officinale alkaloid biosynthetic path- 25/25°C (day/night) under darkness for 30 days. Then, ways were enriched in the TIA biosynthesis pathway it was transferred on MS medium supplemented with [Guo et al. 2013]. 1.0 mg L–1 6-BA, 0.1 mg L–1 NAA and 30 g L–1 sucrose. TIA is a large group of secondary metabolites By liquid suspension culture with temperature 25/25°C in plants with many pharmaceutical effects, such as (day/night) under darkness for 60 days, uniform size camptothecin, vinblastine and vincristine exhibiting protocorms were collected for RNA extraction. excellent anti-tumor activities [Mcknight et al. 1991, In order to analysis the DoSTR response to differ- Venditto et al. 2010], ajmalicine and serpentine be- ent stresses, some phytohormones were used to sim- ing used in the treatment of cardiac and circulatory ulated stresses. And protocorms were cultivated on [Pasquali et al. 1992], raubasine and reserpine treating MS medium supplemented with 100 μmol L–1 methyl- hypertension, high dosage of reserpine curing schizo- jasmonate (MeJA), 100 μmol L–1 salicylic acid (SA), phrenia [Ma 2006]. All of TIAs are derived from the 100 μmol L–1 absdcisic acid (ABA) and 30 μmol L–1 common precursor 3α (S) -strictosidine, which is cat- silver nitrate (AgNO3), respectively. The protocorms alyzed by strictosidine synthase (STR, EC: 4.3.3.2) treated by MeJA and SA were collected at 0, 2, 4, 8, 24, [Pasquali et al. 1992, Yamazaki et al. 2003]. Thus, the 48, 72 h and prepared for gene’s expression analysis,

STR is considered as a key enzyme in TIA biosynthe- while those treated by ABA and AgNO3 were collected sis [Cui et al. 2015, Lu et al. 2009, Wungsintaweekul at 0, 1, 2, 3, 4, 7 d, respectively. Untreated protocorms et al. 2012]. were collected at different time as control. Although STR plays a key role in the TIAs biosyn- RNA extraction and cDNA synthesis. Total RNAs thesis, its sequence and characteristics in D. officina- from five different organs were isolated with RNAprep le are unknown. In this study, STR was cloned from Pure Plant Kit (Tiangen, China) using about 0.5 g tis- D. officinale for the first time. Its bioinformation, tis- sue grinded in liquid nitrogen. The quality and con- sue-specific expression, regulation by different phyto- centration of RNA were measured by NanoDrop 2000 hormones, subcellular localization were investigated. (Thermo). High quality RNA was used for the reverse These researches are important for the biosynthesis of transcription. The 3’- and 5’-RACE-Ready cDNA alkaloid in D. officinale. were reverse transcribed from the leaf total RNA using the SMARTer® RACE 5’/3’Kit (Clontech, US), ac- Materials and methods cording to the manufacturer’s instruction. First-strand cDNA for qRT-PCR was reverse transcribed from to- Plant materials. Two years old D. officinale wild tal RNAs using the PrimeScript RT Reagent Kit with plants which were grown in 20 cm height and 25 cm gDNA Eraser (DDR047A, Takara, China). inner dimeter round plastic pots filled with a sub- Cloning and sequencing the full-length cDNA of strate mix of small pine bark and sand, were identi- DoSTR. To obtain the full-length cDNA sequence of

112 https://czasopisma.up.lublin.pl/index.php/asphc Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10

DoSTR from D. officinale, 5’- and 3’-RACE experi- sources for proteomics [Artimo et al. 2012]. The pro- ments were carried out according to the SMARTer® tein subcellular localization and secondary structure RACE 5’/3’Kit user’s manual. The gene-specific prim- were predicted by PredictProtein and PredicProtein is ers EST-F and EST-R and the 3’RACE and 5’RACE an open resource for online prediction of protein struc- nested primers were shown in the Table 1. tural and functional features [https://www.predictpro- Amplified fragments of 5’- and 3’-RACE were pu- tein.org/, Yachdav et al. 2014]. N-signal peptides were rified and cloned into the pMD18-T vector (Takara, predicted using SignalP 5.0 which can predict the

Tab. 1. Names and sequences of primers

Primers name Sequences (5'–3')

STR-EST EST-F GCTTGAACTGCTGGAGGAT EST-R ACGGCTATGAATGACATTAAGACA 3'RACE 3'-OUT TTTCACTGCTGAGCCTTCTGGGA 3'-IN CAATGAAGGCAATCGTGGAAGG 5'RACE 5'-OUT GCCTTGTCACCTTTCAGCCAGTATC 5'-IN AAGGTCTCGCAAGAGGACAGTGGTT Full-length cDNA STR-F ATGGCACTCGCTGGGGCT STR-R TTACTCTAATGTAAATACGGCTATGAATGG 18SrRNA F GAGCGAACAGGATTAGATACCC R TCCTTTGAGTTTCGGTCTTGCG DoSRT subcellular localization F CGGGGTACCATGGCACTCGCTG R CGCGGATCCCTCTAATGTAAATACGGCTA

Sequences with underline are primers with restriction site

China), transformed into E. coli DH5α cells, and presence of signal peptides and the location of their then cultured in LB medium at 37°C in the dark for cleavage sites in protein from biology [http://www. sequencing. The complete sequence was assembled cbs.dtu.dk/services/SignalP/, Almagro Armenteros et using DNAMAN software into a full-length DoSTR al. 2019]. The structural model of DoSTR was built cDNA sequence. Primers to amply the full-length by homology modeling based on crystal structure of cDNA (Tab. 1) were designed based on the assembled homologous in SWISS-MODEL. The deduced amino core fragments of the 5’-and 3’-RACE sequences, and acid sequences were aligned with DNAMAN and used then to PCR and sequence. to construct a neighbor-joining tree in MEGA5 with Sequence analysis of DoSTR. The ORF of DoSTR default settings at least 1000 bootstrap replicates. was deduced using the online tool ORF Finder and ORF DoSTR relative expression analysis. To compare Finder is a widely used resource in National Center for tissue-specific expression profiles of DoSTR, tran- Biotechnology Information (NCBI) [http://www.ncbi. scripts of five organs were assayed. And for further nlm.nih.gov/orffinder/, Wheeler et al. 2007]. The theo- analysis of the response of DoSTR, MeJA, SA and retical isoelectric point (pI) and molecular mass for the ABA three plant growth substances and AgNO3 were protein were predicted by using the ExPASyProtParam used to treat protocorms, respectively. 0.5 grams pro- tool and ExPASy [http://www.expasy.org] has world- tocorms of different treatment time were collected and wide reputation as one of the main bioinformatics re- investigated. qRT-PCR was performed using a SYBR

https://czasopisma.up.lublin.pl/index.php/asphc 113 Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10

Premix Ex TaqTM II (Takara, China) and detected by Results a CFX96 Real-Time system (BIO RAD, US). The rel- ative expression value was calculated using the 2–ΔΔCt Cloning and characterization of DoSTR. Based method [Pfaffl 2001], with D. officinale 18SrRNA as on the previous transcriptome analysis of D. officina- an internal control. And reactions were performed in le, the expressed sequence tags (EST) of DoSTR was triplicate. obtained [Guo et al. 2013]. Using the special primers DoSTR transient expression and subcellular localiza- designed by the EST, 5’RACE and 3’RACE of DoSTR tion. To analyze DoSTR transient expression, we used a were performed (Fig. 1). Two cDNA fragments of 801 pCambia1301-eGFP expression vector. Primers with re- bp and 529 bp were sequenced. The full-length 1380 bp striction site were designed to amplify the DoSTR ORF cDNA sequence of DoSTR was finally obtained from region from cDNA (Tab. 1). The PCR products were D. officinale by RACE method. There were a 96-bp separated and purified. The purified DNA and empty ex- 5’-untranslanted region (UTR) and a 105-bp 3’-UTR. pression vector pCambia1301-eGFP were cleaved with BlastP analysis revealed that the sequence of this pro- KpnI and BamHI, respectively, and then separated and tein contained the conserved domain of strictosidine purified. The two purified products were fused and synthase and was classified into Str_synth superfami- linked by T4 ligase (Takara, China). Then the recombi- ly. The results indicate that the gene is a member of the nant vectors were transformed into E. coli DH5α, and STR superfamily. Therefore, this gene was designated individual clones were selected to obtain positive re- as DoSTR (GenBank accession number KX068707). combinants as confirmed by sequencing. The recombi- As show in Figure 2, DoSTR cDNA contained a 1179 nant vector was named as pCambia1301-DoSTR-eG- bp ORF encoding a 392-amino acid protein. The de- FP. The empty expression vector pCambia1301-eGFP duced protein had an isoelectric point (pI) of 7.64 and served as a negative control. Then the constructed vec- a calculated molecular mass of about 44.0 kD. tors were transformed into Agrobacterium tumefaciens Bioinformatics analysis of DoSTR.Both the subcel- EHA105 with electroporation. And the suspensions of lular localization and secondary structure of DoSTR A. tumefaciens EHA105 were injected into the leaves were predicted using the online tool PredictProtein of tobacco (N. tabacum). After culturing in the dark [https://www.predictprotein.org/, Yachdav et al. 2014]. 48 h, the leaves of tobacco were zoomed in a confocal The predicted results showed that DoSTR was local- laser scanning microscope (Olympus, Japan). ized in the vacuole, and its secondary structure was

Fig. 1. Agarose gel electrophoresis of PCR products. A: the product of 5’RACE, B: the product of 3’RACE, C: full length of DoSTR

114 https://czasopisma.up.lublin.pl/index.php/asphc Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10

Fig. 2. The full length of DoSTR and its amino acid sequence. The start codon (ATG) and stop codon (TAA) were marked with box; M: DL 2000 marker

https://czasopisma.up.lublin.pl/index.php/asphc 115 Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10

Fig. 3. The 3D structure of DoSTR and Nothapodytes nimmoniana STR established by ho- mology-based modeling using the crystal structure of Rauvolfia serpentina STR as template composed of 6.63% helix, 26.28% strand and 67.09% Apocynaceae were included in a small group. The cat- loop, indicating that DoSTR can be classified as alytic function of these STRs has been experimentally a mixed protein. proved [Chen et al. 2008, Kutchan 1989, Mcknight et According to N-signal peptide prediction, the ami- al. 1990]. Then two clades composed of STRs from no acid sequence of DoSTR had a N-signal peptide Rubiaceae and Apocynaceae were further clustered to- with 23 residues, suggesting that it should function as gether, both of which belong to the order Gentianales a type of secretory protein. that has a variety of TIA secondary metabolites and The 3-dimensional structure of DoSTR protein active STRs. The phylogenetic relationship of DoSTR was predicted by SWISS-MODEL based on crystal is in accordance with the traditional evolutionary clas- structure of homology, with the Rauvolfia serpentina sification of plants. STR protein structure as the template. The predict- Additionally, although Nothapodytes nimmoniana ed structural model of DoSTR (without its N-signal from family Icacinaceae and order Celastrales, con- peptide) was a kind of six-bladed β-propeller fold tains camptothecin, a kind of monoterpenoid indole (Fig. 3), very similar to the 3D structure of R. serpen- alkaloid component [Manjunatha et al. 2016], its STR tina STR [Ma 2006]. Their structural similarity sug- did not cluster with those of five species from order gests that they may share similar functions. Gentianales. The STR of N. nimmoniana was first- Multiple sequences alignment of DoSTR with ly clustered with that of Papaver somniferum, then other homologous STRs revealed that there existed with 3 species of monocotyledon plants D. officina- a comparatively higher conservation (over 51% of le, Z. mays and E. guineensis. The result showed that identity) among various species (Fig. 4). DoSTR was distant in evolution with the STRs from The constructed phylogenetic tree of multiple orders Gentianales, instead it was closely related with STRs from different plants showed that D. officinale that of N. nimmoniana. When the two STR protein STR was clustered together with STRs from Zea mays sequences of D. officinale and N. nimmoniana were and Elaeis guineensis, two monocotyledon plants aligned, it was found that they had a similarity value (Fig. 5). Ophiorrhiza pumila and Mitragyna speciose of 75% (Fig. 6). STRs from family Rubiaceae were clustered into one Expression pattern of DoSTR in different tissues. clade, while those of Catharanthus roseus, Rauvolfia To determine the tissue-specific expression of DoSTR verticillata and Rauvolfia serpentine from family patterns qRT-PCR experiment was performed. DoSTR

116 https://czasopisma.up.lublin.pl/index.php/asphc Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10

The black and colour boxes indicate the completely identical residues and the conserved residues among the aligned sequences, respectively. The amino acids residues pointed by red arrow are Cys-89, Cys-101 and Glu-309, respectively. STR protein sequences including Z. mays (Zea mays STR, NP_001150008.1), A. thaliana (Arabidopsis thaliana STR, NP_177542.1), C. roseus (Catharanthus roseus STR, CAA43936.1), E. guineen- sis (Elaeis guineensis STR, XP_010932965.1), M. speciosa (Mitragyna speciosa STR, ADK91432.1), M. truncalula (Medicago truncatula STR, XP_003617474.1), O. pumila (Ophiorrhiza pumila STR, BAB47180.1), N. nimmoniana (Nothapodytes nimmoniana STR, AIL49060.1), R. mannii (Rauvolfia mannii STR, P68174.1), R. serpentine (Rauvolfia serpentine STR, 2FP8), R. verticillata (Rauvolfia verticillata STR, AAY81922.1) Fig. 4. Multiple sequence alignments of DoSTR with other known STR

https://czasopisma.up.lublin.pl/index.php/asphc 117 Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10

STR sequences from Z. mays ( NP_001150008.1), E. guineensis ( XP_010932965.1),A. thalia- na (NP_177542.1), C. roseus (CAA43936.1), M. notabilis (XP_010110081.1), M. truncatula (XP_003617474.1), O. pumila (BAB47180.1), P. dactylifera (XP_017701989.1), R. serpentine (2FP8), R. verticillata ( AAY81922.1), N. nimmoniana ( AIL49060.1), P. somniferum ( AJT49020.1), M. speciosa (ADK91432.1), and D. officinale (KX068707)

Fig. 5. Phylogenetic tree analysis of DoSTR with STR sequences

Fig. 6. Two sequences alignment of D. officinale STR with N. nimmoniana STR

118 https://czasopisma.up.lublin.pl/index.php/asphc Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10

Fig. 7. Gene expression profiles of DoSTR in five different tissues

Fig. 8. Relative expression analysis of DoSTR treated by three plant growth substances and AgNO3. A, B,

C, D are the relative expression analysis of DoSTR during MeJA, SA, ABA, AgNO3 treatment and the control for D. officinale protocorms, respectively

https://czasopisma.up.lublin.pl/index.php/asphc 119 Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10

expression was detected in all the measured organs, the stable low level at different time, while four differ- including root, stem, leaf, flower and protocorm, al- ent treatments could induce the expression of DoSTR though with different expression levels as shown in with distinct peaks at different treating time (Fig. 8). Figure 7. The relative expression levels of DoSTR Under MeJA treatment, the transcript level of DoSTR were the highest in flowers, whereas those were the was enhanced by 20.7 times compared to that of the lowest in stems. In flowers, the expression amounts control and reached the highest level at 48h, then de- of DoSTR were 10.6 times, 8.3 times, 6.1 times and creased at 72h. This expression tendency is accor- 4.4 times higher than those in stems, protocorms, dance with the expression of HpSTR [Flores-Sanchez leaves and roots, respectively. This result showed that et al. 2016], CrSTR [Goklany et al. 2013] and MsSTR DoSTR constitutively expressed in all the tested tis- [Wungsintaweekul et al. 2012] induced by MeJA or JA. sues at different levels, which was the highest in flow- SA treatment caused the similar effects on expressions er, moderate in leaf and root, lowest in stem. of DoSTR with MeJA, but the peak induced by SA was Relative expression analysis of DoSTR treated by 6.7 times higher than that of the control at 24h and sub-

MeJA, SA, ABA and AgNO3. To analyze the expression sequently was decreased slowly. From the A and B of characteristics of DoSTR in response to biotic and abi- Figure 8, thus it is possibly that the inducing effect on otic stimuli, three phytohormones, including MeJA, the DoSTR expression by SA was less than by MeJA.

SA and ABA, together with AgNO3 (as one of the The response of DoSTR to ABA was relatively slow. ethylene inhibitors), were applied to treat D. offcinale Until the third day after treatment, the relative expres- protocorms, respectively. The results showed that the sion of DoSTR was only 2 times higher than that of the untreated control relative expression of DoSTR were in control. Subsequently the relative expression of DoSTR

Fig. 9. Subcellular localization analysis of DoSTR. The red arrows showed the site of the DoSTR in tobacco leaves

120 https://czasopisma.up.lublin.pl/index.php/asphc Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10

was sharply raised to 5.8 times compared to that of the [Ma 2006]. These results suggested that DoSTR might control at the fourth day, and decreased at 7d after treat- be an active STR. ment. Under AgNO3 treatment, the relative expression From the phylogenetic tree of STRs, STRs from level of DoSTR was elevated from 2d, and peaked at 4d Rubiaceae and Apocynaceae were clustered together, with the expression level 13 times higher than that of while STRs from monocotyledon plants Zea mays, the control, subsequently dropped at 7d. Elaeis guineensis and D. officinale were clustered Subcellular localization of DoSTR. To determine together. The phylogenetic relationship of STR is in DoSTR subcellular localization patterns, A. tume- accordance with the traditional evolutionary classifi- faciens EHA105 with the fusion expression vector cation of plants. As reported, CPT (a kind of TIA) was pCambia1301-DoSTR-eGFP was injected into the produced by many species belonged to some unrelat- leaves of tobacco (N. tabacum). Compared to the GFP ed orders within angiosperms [Lorence et al. 2004]. fluorescence which was mainly localized in the nuclei Lorence et al. [2004] supposed that the genes encoding and the cell membrane, the DoSTR-eGFP fluorescence enzymes involved in CPT biosynthesis were evolved was scatteredly distributed in the whole epidermal cell early during evolution, and these genes were not lost of tobacco leaf (Fig. 9). during evolution but might have been “switched off” during a period of time and “switched on” again at Discussion some later. This may explain why many unrelated plants could synthesize TIA. D. officinale is an important Chinese medicinal Tissue expression pattern showed that DoSTR con- herb and used widely in Asia, Europe and Australia stitutively expressed in all the tested tissues at different for its diverse tonic components. Among these com- levels, which was the highest in flower, moderate in ponents, alkaloids were rarely studied comparing with leaf and root, lowest in stem. This expression pattern other components for its low concentration, while of DoSTR is in line with that of O. japonica STR [Lu D. officinale produce high-quality alkaloids [Chen et et al. 2009], but is different from that ofR. verticillata al. 2006]. Therefore researches about alkaloids should STR [Chen et al. 2008]. Zhang et al. has just reported be enhanced. Based on the D. officinale genome data that the flowers ofD. officinale are rich in total phenol [Yan et al. 2015], transcriptome data [Guo et al. 2013] and flavonoid [Zhang et al. 2019]. Up to now, there and metabolic profiling [Jiao et al. 2018],D. officinale are no reports on the content of TIA in different tissue alkaloid biosynthetic pathways were enriched in the of D. officinale. From the tissue expression pattern of TIA biosynthesis pathway. Strictosidine synthase was DoSTR, we guess that the content of TIA is highest of the crucial enzyme in the biosynthetic pathway of TIA flower, secondly in leaf and root, lowest in stem. And [Cui et al. 2015], while the DoSTR was rarely known. the flowers ofD. officinaleare likely to have important In this study, DoSTR was first cloned and character- medicinal value. ized from D. officinale. At the same time, bioinfor- In this study, MeJA could dramatically induce mation analysis, tissue-specific expression, response the transcriptional level of DoSTR. It is accordance to different phytohormones and signal molecular and with the expression of HpSTR [Flores-Sanchez et subcellular localization were also tested. al. 2016], CrSTR [Goklany et al. 2013] and MsSTR DoSTR cDNA contained a 1179 bp ORF encoding [Wungsintaweekul et al. 2012] induced by MeJA or a 392-amino acid protein. BlastP analyses showed that JA. Because MeJA has been identified as a signaling its amino acid sequence was classified into Str_synth molecule that could induce gene expression and elicit superfamily. As shown in Figure 4, both Cys-89 and secondary metabolic pathways in plant cells [Pauwels

Cys-101 were highly conserved throughout the Str_ et al. 2008]. As one of the ethylene inhibitors, AgNO3 synth superfamily. The two Cys residues were consid- effects on the DoSTR expression were possibly asso- ered to be very important for maintaining the integri- ciated with repressing ethylene pathway. These results ty of the binding pocket of active STR proteins [Ma suggested that DoSTR was expressed at a lower level 2006]. At the same time, there was a Glu-309 at the ac- in untreated protocorms, but it could be induced in re- tive site in DoSTR protein in accordance with RsSTR sponse to biotic or abiotic stimuli.

https://czasopisma.up.lublin.pl/index.php/asphc 121 Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10

The result of subcellular localization of DoSTR Center of Agri-forestry Industry in Dabieshan Area, showed that the DoSTR-eGFP fluorescence was scat- Anhui Agricultural University. teredly distributed in the whole epidermal cell of to- bacco leaf. The vacuole occupies almost whole epi- References dermal cell of tobacco leaf. So we guess the DoSTR is mainly localized in the vacuole of tobacco leaf. Almagro Armenteros, J.J., Tsirigos, K.D., Sønderby, C.K. It suggested that the DoSTR could be targeted mainly (2019). SignalP 5.0 improves signal peptide predictions to the vacuole, which is accordance with the predic- using deep neural networks. Nat. Biotechnol., 37, 420– tion described above and many other STRs [Mcknight 423. DOI: 10.1038/s41587-019-0036-z et al. 1991]. Artimo, P., Jonnalagedda, M., Arnold, K., Baratin, D., Strictosidine synthase-like proteins are widely Csardi, G., Castro, E. de, Duvaud, S., Flegel, V., existed in multicellular organisms, with the highly Fortier, A., Gasteiger, E., Grosdidier, A., Hernandez, diverse functions during the system evolution [Hicks C., Ioannidis, V., Kuznetsov, D., Liechti, R., Moretti, et al. 2011]. Strictosidine synthase-like proteins have S., Mostaguir, K., Redaschi, N., Rossier, G., Xenarios, been known for roles in animal immune response and I., Stockinger, H. (2012). ExPASy: SIB bioinformatics in plant defense mechanisms [Kibble et al. 2009]. The resource portal. Nucleic Acids Res., 40(W1), W597– bioinformation analysis, tissue-specific expression and W603. DOI: 10.1093/nar/gks400 subcellular localization of DoSTR, all these findings Benkert, P., Tosatto, S.C.E., Schomburg, D. (2008). QMEAN: A comprehensive scoring function for model showed that DoSTR were similar with other active quality assessment. Proteins Struct. Funct. Bioinf., 71, STRs and could be classified into Str_synth superfam- 261–277. DOI: 10.1002/prot.21715 ily. Meanwhile in the metabolic profiling of D. offici- Chen, R., Liao, Z.H., Chen, M., Wang, Q., Yang, C.X., nale, three kinds of TIAs, which are the downstream Yang, Y.J. (2008). Molecular cloning and characteriza- products of strictosidine, were detected by our group tion of the Strictosidine synthase Gene from Rauwolfia [Jiao et al. 2018]. That is to say there is active STR in verticillata. Russ. J. Plant. Physl., 55, 670–675. DOI: D. officinale. But strictosidine has not been detected 10.1134/s1021443708050117 with HPLC in D. officinale by our group. Combined Chen, X.M., Xiao, S.Y, Guo, S.X. (2006). Comparison of with all the results, we speculate that DoSTR may well chemical compositions between Dendrobium can- be an active gene and the synthesis of strictosidine is didum and Dendrobium nobile. Acta. Acad. Med. Sin., rapidly used to produce downstream products. Next 28(4), 524–529. DOI: 10.1360/aps040120 we will measure the activity of DoSTR through genet- Cui, L., Ni, X., Ji, Q., Teng, X., Yang, Y., Wu, C., Zekria, ic transformation and in vitro enzyme activity testing. D., Zhang, D., Kai, G. (2015). Co-overexpression of This study may throw light on the alkaloid biosynthe- geraniol-10-hydroxylase and strictosidine synthase im- sis pathway of D. officinale. We believe that with the proves anti-cancer drug camptothecin accumulation in further research, the TIA metabolic pathway of D. offi- Ophiorrhiza pumila. Sci. Rep., 5, 8227. DOI: 10.1038/ cinale will become more and more clear. srep08227 Flores-Sanchez, I.J., Paniagua-Vega, D., Vera-Reyes, I., AcknowleDgements Cerda-García-Rojas, C.M., Ramos-Valdivia, A.C. (2016). Alkaloid biosynthesis and metabolic profiling responses to jasmonic acid elicitation in Hamelia patens The present investigation is financially sup- plants by NMR-based metabolomics. Metabolomics, ported by Natural Science Foundation of China 12, 1–14. DOI: 10.1007/s11306-016-0999-4 (31501368, 81573518), Twelfth Five-Year Plan for Goklany, S., Rizvi, N.F., Loring, R.H., Cram, E.J., Lee- Science and Technology 19Support of Anhui Province Parsons, C.W.T. (2013). Jasmonate-dependent alkaloid (1301032139), Scientific Research Project of Anhui biosynthesis in Catharanthus roseus hairy root cultures Provincial Department of Education (KJ2015A005, is correlated with the relative expression of Orca and KJ2018B15, KJ2018A0403, KJ2016A644, Zct transcription factors. Biotechnol. Progr., 29, 1367– KJ2017A846) and The Biology Key Subject 1376. DOI: 10.1002/btpr.1801 Construction of Anhui, Collaborative Innovation Guo, X., Li, Y., Li, C., Luo, H., Wang, L., Qian, J., Luo, X.,

122 https://czasopisma.up.lublin.pl/index.php/asphc Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10

Xiang, L., Song, J., Sun, C., Xu, H., Yao, H., Chen, stress. Plant. J., 11, 1167–1175. DOI: 10.1046/j.1365- S. (2013). Analysis of the Dendrobium officinale 313X.1997.11061167.x transcriptome reveals putative alkaloid biosynthetic Lorence, A., Nessler, C.L. (2004). Camptothecin, over four genes and genetic markers. Gene, 527, 131–138. DOI: decades of surprising findings. Phytochemistry, 65, 10.1016/j.gene.2013.05.073 2735–2749. DOI: 10.1016/j.phytochem.2004.09.001 He, T., Huang, Y., Yang, L., Liu, T., Gong, W., Wang, X., Lu, H., McKnight, T.D. (1999). Tissue-specific expres- Sheng, J., Hu, J. (2016). Structural characterization and sion of the beta-subunit of tryptophan synthase in immunomodulating activity of polysaccharide from Camptotheca acuminata, an indole alkaloid-produc- Dendrobium officinale. Int. J. Biol. Macromol., 83, ing plant. Plant. Physiol., 120, 43–51. DOI: 10.1104/ 34–41. DOI: 10.1016/j.ijbiomac.2015.11.038 pp.120.1.43 Hicks, M.A., Barber, A.E., Giddings, L., Caldwell, J., Lu, Y., Wang, H., Wang, W., Qian, Z., Li, L., Wang, J., Zhou, O’Connor, S.E., Babbitt, P.C. (2011). The evolution G., Kai, G. (2009). Molecular characterization and ex- of function in strictosidine synthase-like proteins. pression analysis of a new cDNA encoding strictosidine Proteins Struct. Funct. Bioinf., 79, 3082–3098. DOI: synthase from Ophiorrhiza japonica. Mol. Biol. Rep., 10.1002/prot.23135 36, 1845–1852. DOI: 10.1007/s11033-008-9389-y Huang, K.W., Li, Y.R., Tao, S.C., Wei, G., Huang, Y., Chen, Luo, Q., Tang, Z., Zhang, X., Zhong, Y., Yao, S., Wang, D., Wu, C. (2016). Purification, characterization and bi- L., Lin, C., Luo, X. (2016). Chemical properties and ological activity of polysaccharides from Dendrobium antioxidant activity of a water-soluble polysaccharide officinale. Molecules, 21, 701. DOI: 10.3390/mole- from Dendrobium officinale. Int. J. Biol. Macromol., cules21060701 89, 219–227. DOI: 10.1016/j.ijbiomac.2016.04.067 Irmler, S., Schroder, G., St-Pierre, B., Crouch, N.P., Hotze, Ma, X. Panjikar, S., Koeke, J. (2006). The structure of M., Schmidt, J., Strack, D., Matern, U., Schroder, J. Rauvolfia serpentina strictosidine synthase is a novel (2000). Indole alkaloid biosynthesis in Catharanthus six-bladed β-propeller fold in plant proteins. Plant Cell, roseus: new enzyme activities and identification of 18, 907–920. DOI: 10.2307/20076650 cytochrome P450CYP72A1 as secologanin syn- Manjunatha, B.L., Singh, H.R., Ravikanth, G., Nataraja, thase. Plant. J., 24, 797–804. DOI: 10.1111/j.1365- K.N., Shankar, R., Kumar, S., Shaanker, R.U. (2016). 313X.2000.00922.x Transcriptome analysis of stem wood of Nothapodytes Jiao, C.Y., Song, C., Zheng, S.Y., Zhu, Y.P., Jin, Q., Cai, nimmoniana (Graham) Mabb. identifies genes associ- Y.P., Lin, Y. (2018). Metabolic Profiling ofDendrobium ated with biosynthesis of camptothecin, an anti-car- officinale in Response to Precursors and Methyl cinogenic molecule. J. Biosci., 41, 119–131. DOI: Jasmonate. Int. J. Mol. Sci., 19(3), 728–746. DOI: 10.1007/s12038-016-9591-3 10.3390/ijms19030728 Mariani, V., Kiefer, F., Schmidt, T., Haas, J., Schwede, T. http://www.cbs.dtu.dk/services/SignalP/ (2011). Assessment of template based protein structure http://www.expasy.org predictions in CASP9. Proteins Struct. Funct. Bioinf., http://www.ncbi.nlm.nih.gov/orffinder/ 79, 37–58. DOI: 10.1002/prot.23177 https://www.predictprotein.org/ Mcknight, T.D., Bergey, D.R., Burnett, R.J., Nessler, C.L. Kibble, N.A.J., Sohani, M.M., Shirley, N., Byrt, C., (1991). Expression of enzymatically active and cor- Roessner, U., Bacic, A., Schmidt, O., Schultz, C.J. rectly targeted strictosidine synthase in transgenic (2009). Phylogenetic analysis and functional char- tobacco plants. Planta, 185, 148–152. DOI: 10.1007/ acterisation of strictosidine synthase-like genes in BF00194055 Arabidopsis thaliana. Funct. Plant. Biol., 36, 1098– Mcknight, T.D., Roessner, C.A., Devagupta, R., Scott, A.I., 1109. DOI: 10.1071/FP09104 Nessler, C.L. (1990). Nucleotide-sequence of a cD- Kutchan, T.M. (1989). Expression of enzymatically active NA-encoding the vacuolar protein strictosidine syn- cloned stritosidine synthase from the higher-plant thase from Catharanthus roseus. Nucleic. Acids. Res., Rauvolfia serpentina in Escherichia coli. Febs. Lett., 18, 4939. DOI: 10.1093/nar/18.16.4939 257, 127–130. DOI: 10.1016/0014-5793(89)81802-2 Ng, T.B., Liu, J., Wong, J.H., Ye, X., Wing Sze, S.C., Tong, Y., LopezMeyer, M., Nessler, C.L. (1997). Tryptophan de- Zhang, K.Y. (2012). Review of research on Dendrobium, carboxylase is encoded by two autonomously reg- a prized folk medicine. Appl. Microbiol. Biot., 93, ulated genes in Camptotheca acuminata which are 1795–1803. DOI: 10.1007/s00253-011-3829-7 differentially expressed during development and Pasquali, G., Goddijn, O.J., De, W.A., Verpoorte, R.,

https://czasopisma.up.lublin.pl/index.php/asphc 123 Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10

Schilperoort, R.A. (1992). Coordinated regula- Xu, J., Han, Q., Li, S., Chen, X., Wang, X., Zhao, Z., Chen, tion of two indole alkaloid biosynthetic genes from H. (2013). Chemistry, bioactivity and quality control of Catharanthus roseus by auxin and elicitors. Plant. Mol. Dendrobium, a commonly used tonic herb in tradition- Biol., 18, 1121–1131. DOI: 10.1007/BF00047715 al Chinese medicine. Phytochem. Rev., 12, 341–367. Pauwels, L., Morreel, K., De Witte, E., Lammertyn, F., DOI: 10.1007/s11101-013-9310-8 Van Montagu, M., Boerjan, W., Inzé, D., Goossens, Yachdav, G., Kloppmann, E., Kajan, L., Hecht, M., Goldberg, A. (2008). Mapping methyl jasmonate-mediated tran- T., Hamp, T., Hönigschmid, P., Schafferhans, A., scriptional reprogramming of metabolism and cell cy- Roos, M., Bernhofer, M., Richter, L., Ashkenazy, H., cle progression in cultured Arabidopsis cells. PNAS, Punta, M., Schlessinger, A., Bromberg, Y., Schneider, 105(4), 1380–1385. DOI: 10.1073/pnas.0711203105 R., Vriend, G., Sander, Ch., Ben-Tal, N., Rost, B. Pfaffl, M.W. (2001). A new mathematical model for relative (2014). PredictProtein – an open resource for online quantification in real-time RT-PCR. Nucleic. Acids. prediction of protein structural and functional features. Res., 29, 2002–2009. DOI: 10.1093/nar/29.9.e45 Nucleic Acids Res., 42(Web Server issue), W337– Stevens, L.H., Giroud, C., Pennings, E., Verpoorte, R. W343. DOI: 10.1093/nar/gku366 (1993). Purification and characterization of stric- Yamazaki, Y., Sudo, H., Yamazaki, M., Aimi, N., Saito, tosidine synthase from a suspension-culture of K. (2003). Camptothecin biosynthetic genes in hairy Cinchona robusta. Phytochemistry, 33, 99–106. DOI: roots of Ophiorrhiza pumila: cloning, characteriza- 10.1016/0031-9422(93)85403-E tion and differential expression in tissues and by stress Venditto, V.J., Simanek, E.E. (2010). Cancer therapies uti- compounds. Plant. Cell. Physiol., 44, 395–403. DOI: lizing the camptothecins: a review of the in vivo lit- 10.1093/pcp/pcg051 erature. Mol. Pharm., 7, 307–349. DOI: 10.1021/ Yan, L., Wang, X., Liu, H., Tian, Y., Lian, J., Yang, R., mp900243b Hao, S., Wang, X., Yang, S., Li, Q., Qi, S., Kui, L., Wang, C.T., Liu, H.T., Gao, X.S., Zhang, H. (2010). Okpekum, M., Ma, X., Zhang, J., Ding, Z., Zhang, G., Overexpression of G10H and ORCA3 in the hairy Wang, W., Dong, Y., Sheng, J. (2015). The Genome roots of Catharanthus roseus improves catharanthine of Dendrobium officinale Illuminates the Biology of production. Plant. Cell. Rep., 29, 887–894. DOI: the Important Traditional Chinese Orchid Herb. Mol. 10.1007/s00299-010-0874-0 Plant., 8, 922–934. DOI:10.1016/j.molp.2014.12.011 Wei, W., Feng, L., Bao, W.R., Ma, D.L., Leung, C.H., Nie, Zhang, X., Zhang, S., Gao, B., Qian, Z., Liu, J., Wu, S., S.P., Han, Q.B. (2016). Structure characterization and Si, J. (2019). Identification and quantitative analysis of immunomodulating effects of polysaccharides isolated phenolic glycosides with antioxidant activity in meth- from Dendrobium officinale. J. Agric. Food. Chem., anolic extract of Dendrobium catenatum flowers and 64(4), 881–889. DOI: 10.1021/acs.jafc.5b05180 selection of quality control herb-markers. Food Res. Wheeler, D.L., Barrett, T., Benson, D.A., Bryant, S.H., Int., 123, 732–745. Canese, K., Chetvernin, V. (2007). Database resourc- Zhu, N., Han, S., Yang, C., Qu, J., Sun, Z., Liu, W., Zhang, es of the national center for biotechnology informa- X. (2016). Element-tracing of mineral matters in tion. Nucleic Acids Res., 35(Database), D5–D12. DOI: Dendrobium officinale using ICP-MS and multivariate 10.1093/nar/gkl1031 analysis. SpringerPlus, 5, 1–9. DOI: 10.1186/s40064- Wungsintaweekul, J., Choo-malee, J., Charoonratana, T., 016-2618-2 Keawpradub N. (2012). Methyl jasmonate and yeast Xu, R.X., Cao, F.X., Peng, J.Q., Si, S.B. (2012). Cloning extract stimulate mitragynine production in Mitragyna and analysis of strictosidine synthase in Rauvolfia yun- speciosa (Roxb.) Korth. shoot culture. Biotechnol. Lett., nanensis. J. Cent. South. Univ. For Technol., 32, 128– 34, 1945–1950. DOI: 10.1007/s10529-012-0968-6 131. DOI: 10.1007/s11783-011-0280-z

124 https://czasopisma.up.lublin.pl/index.php/asphc