DOCSLIB.ORG

2020, 111–124 Molecular Cloning, Bioinformation

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
2020, 111–124 Molecular Cloning, Bioinformation Acta Sci. Pol. Hortorum Cultus, 19(3) 2020, 111–124 https://czasopisma.up.lublin.pl/index.php/asphc ISSN 1644-0692 e-ISSN 2545-1405 DOI: 10.24326/asphc.2020.3.10 ORIGINAL PAPER Accepted: 25.07.2019 MOLECULAR CLONING, BIOINFORMATION ANALYSIS AND EXPRESSION OF THE STRICTOSIDINE SYNTHASE IN Dendrobium officinale Yan-Fang Zhu1,2 , Hong-Hong Fan2, Da-Hui Li2, Qing Jin2, Chuan-Ming Zhang2, Li-Qin Zhu2, Cheng Song2, Yong-Ping Cai2, Yi Lin2 1 Key Laboratory of Resource Plant Biology of Anhui Province, School of Life Sciences, Huaibei Normal University, Huaibei 235000, P.R. China 2 School of Life Sciences, Anhui Agricultural University, Hefei, 230036, P.R. China Abstract The enzyme strictosidine synthase (STR, EC: 4.3.3.2) plays a key role in the biosynthetic pathway of terpenoid indole alkaloid (TIA). It catalyzes the condensation of the tryptamine and secologanin to form 3α(S)-stricto- sidine, which is the common precursor of all TIAs. In this paper, a STR gene designated as DoSTR (GenBank: KX068707) was first cloned and characterized fromDendrobium officinale with rapid amplified cDNA ends method (RACE). DoSTR has a length of 1380bp with 1179bp open reading frame encoding 392 amino acids. BlastP analyses showed that its amino acid sequence was classified into Str_synth superfamily. qRT-PCR showed that DoSTR was expressed in all tissues tested, with a significantly higher level in flower and the lowest in stem. Four different treatments with MeJA, SA, ABA and AgNO3, respectively, could induce the DoSTR expression to a different extent. And the effect of MeJA was the most obvious and transcript level of DoSTR induced by MeJA was 20.7 times greater than that of control at 48 hours after treatment. Furthermore, it was found that DoSTR was localized in vacuole through transient expression in tobacco. The characteriza- tion and expression of DoSTR can help in further studying the role of DoSTR in the biosynthesis of TIAs in D. officinale. This study may throw light on the alkaloid biosynthesis pathway of D. officinale. Key words: Dendrobium officinale, DoSTR, terpenoid indole alkaloid, tissue expression pattern, subcellular localization Abbreviations: TIA – terpenoid indole alkaloid, RACE – rapid amplification of cDNA ends, ORF – open reading fram, MeJA – methyljasmonate, SA – salicylic acid, ABA – absdcisic acid, AgNO3 – silver nitrate, STR – strictosidine synthase, CAT – camptothecin, qRT-PCR Real-time quantitative PCR Introduction Dendrobium officinale Kimura et Migo is a re- saccharides, alkaloids, phenols, coumarins, terpenes, nowned Dendrobium genus medicinal plant in tradi- flavonoids, amino acids, benzyl compounds, and some tional Chinese medicine. It has been widely used in trace mineral elements [Ng et al. 2012, Xu et al. 2013]. China owing to its diverse tonic components. The Due to these components, D. officinale possesses im- main active ingredients of D. officinale include poly- munomodulatory and hepatoprotective activities, [email protected] © Copyright by Wydawnictwo Uniwersytetu Przyrodniczego w Lublinie Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10 antioxidant, anticancer, neuroprotective activities, fied by Professor Cai Yongping of Anhui Agricultural anti-cataract, and so on [Ng et al. 2012, Wei et al. University and used as the experimental materials 2016]. Among these medicinal ingredients, although which grew in wild environment and obtained from alkaloids are one of the most important components of Dabie Mountain Area in Huoshan county, Anhui prov- D. officinale, the biosynthesis pathway of these alka- ince, China. The current-year leaves were immediate- loids is still unclear. ly frozen in liquid nitrogen and stored at –80°C, which In a previous report, the alkaloids of Dendrobium were used to extract RNA for cloning DoSTR putative genus are mostly sesquiterpene alkaloids [Zhang et gene sequence. al. 2003]. Based on the D. officinale genome data and For further analysis DoSTR expression in different metabolic profiling, the pathway of D. officinale al- tissues (roots, stems, flowers and leaves), 0.5 grams of kaloid synthesis could be extended to generate a kind each tissue were collected from the above described of terpenoid indole alkaloid (TIA) [Yan et al. 2015, plants, quickly frozen and stored at –80°C, respectively. Jiao et al. 2018]. Moreover, according to the published Protocorms were induced from seeds on MS medium D. officinale transcriptome data, genes annotated as by the tissue culture. After cultured with temperature elements of D. officinale alkaloid biosynthetic path- 25/25°C (day/night) under darkness for 30 days. Then, ways were enriched in the TIA biosynthesis pathway it was transferred on MS medium supplemented with [Guo et al. 2013]. 1.0 mg L–1 6-BA, 0.1 mg L–1 NAA and 30 g L–1 sucrose. TIA is a large group of secondary metabolites By liquid suspension culture with temperature 25/25°C in plants with many pharmaceutical effects, such as (day/night) under darkness for 60 days, uniform size camptothecin, vinblastine and vincristine exhibiting protocorms were collected for RNA extraction. excellent anti-tumor activities [Mcknight et al. 1991, In order to analysis the DoSTR response to differ- Venditto et al. 2010], ajmalicine and serpentine be- ent stresses, some phytohormones were used to sim- ing used in the treatment of cardiac and circulatory ulated stresses. And protocorms were cultivated on [Pasquali et al. 1992], raubasine and reserpine treating MS medium supplemented with 100 μmol L–1 methyl- hypertension, high dosage of reserpine curing schizo- jasmonate (MeJA), 100 μmol L–1 salicylic acid (SA), phrenia [Ma 2006]. All of TIAs are derived from the 100 μmol L–1 absdcisic acid (ABA) and 30 μmol L–1 common precursor 3α (S) -strictosidine, which is cat- silver nitrate (AgNO3), respectively. The protocorms alyzed by strictosidine synthase (STR, EC: 4.3.3.2) treated by MeJA and SA were collected at 0, 2, 4, 8, 24, [Pasquali et al. 1992, Yamazaki et al. 2003]. Thus, the 48, 72 h and prepared for gene’s expression analysis, STR is considered as a key enzyme in TIA biosynthe- while those treated by ABA and AgNO3 were collected sis [Cui et al. 2015, Lu et al. 2009, Wungsintaweekul at 0, 1, 2, 3, 4, 7 d, respectively. Untreated protocorms et al. 2012]. were collected at different time as control. Although STR plays a key role in the TIAs biosyn- RNA extraction and cDNA synthesis. Total RNAs thesis, its sequence and characteristics in D. officina- from five different organs were isolated with RNAprep le are unknown. In this study, STR was cloned from Pure Plant Kit (Tiangen, China) using about 0.5 g tis- D. officinale for the first time. Its bioinformation, tis- sue grinded in liquid nitrogen. The quality and con- sue-specific expression, regulation by different phyto- centration of RNA were measured by NanoDrop 2000 hormones, subcellular localization were investigated. (Thermo). High quality RNA was used for the reverse These researches are important for the biosynthesis of transcription. The 3’- and 5’-RACE-Ready cDNA alkaloid in D. officinale. were reverse transcribed from the leaf total RNA using the SMARTer® RACE 5’/3’Kit (Clontech, US), ac- Materials AND METHODS cording to the manufacturer’s instruction. First-strand cDNA for qRT-PCR was reverse transcribed from to- Plant materials. Two years old D. officinale wild tal RNAs using the PrimeScript RT Reagent Kit with plants which were grown in 20 cm height and 25 cm gDNA Eraser (DDR047A, Takara, China). inner dimeter round plastic pots filled with a sub- Cloning and sequencing the full-length cDNA of strate mix of small pine bark and sand, were identi- DoSTR. To obtain the full-length cDNA sequence of 112 https://czasopisma.up.lublin.pl/index.php/asphc Zhu, Y.-F., Fan, H.-H., Li, D.-H., Jin, Q., Zhang, C.-M., Zhu, L.-Q., Song, C., Cai, Y.-P., Lin, Y. (2020). Molecular cloning, bioinformation analysis and ex- pression of the strictosidine synthase in Dendrobium officinale. Acta Sci. Pol. Hortorum Cultus, 19(3), 111–124. DOI: 10.24326/asphc.2020.3.10 DoSTR from D. officinale, 5’- and 3’-RACE experi- sources for proteomics [Artimo et al. 2012]. The pro- ments were carried out according to the SMARTer® tein subcellular localization and secondary structure RACE 5’/3’Kit user’s manual. The gene-specific prim- were predicted by PredictProtein and PredicProtein is ers EST-F and EST-R and the 3’RACE and 5’RACE an open resource for online prediction of protein struc- nested primers were shown in the Table 1. tural and functional features [https://www.predictpro- Amplified fragments of 5’- and 3’-RACE were pu- tein.org/, Yachdav et al. 2014]. N-signal peptides were rified and cloned into the pMD18-T vector (Takara, predicted using SignalP 5.0 which can predict the Tab. 1. Names and sequences of primers Primers name Sequences (5'–3') STR-EST EST-F GCTTGAACTGCTGGAGGAT EST-R ACGGCTATGAATGACATTAAGACA 3'RACE 3'-OUT TTTCACTGCTGAGCCTTCTGGGA 3'-IN CAATGAAGGCAATCGTGGAAGG 5'RACE 5'-OUT GCCTTGTCACCTTTCAGCCAGTATC 5'-IN AAGGTCTCGCAAGAGGACAGTGGTT Full-length cDNA STR-F ATGGCACTCGCTGGGGCT STR-R TTACTCTAATGTAAATACGGCTATGAATGG 18SrRNA F GAGCGAACAGGATTAGATACCC R TCCTTTGAGTTTCGGTCTTGCG DoSRT subcellular localization F CGGGGTACCATGGCACTCGCTG R CGCGGATCCCTCTAATGTAAATACGGCTA Sequences with underline are primers with restriction site China), transformed into E. coli DH5α cells, and presence of signal peptides and the location of their then cultured in LB medium at 37°C in the dark for cleavage sites in protein from biology [http://www. sequencing. The complete sequence was assembled cbs.dtu.dk/services/SignalP/, Almagro Armenteros et using DNAMAN software into a full-length DoSTR al.
Load more

Recommended publications
  • Biogeografia Do Gênero Rauvolfia L. (Apocynaceae, Rauvolfioideae)
    UNIVERSIDADE FEDERAL DE SÃO CARLOS – CAMPUS SOROCABA Biogeografia do gênero Rauvolfia L. (Apocynaceae, Rauvolfioideae) DISSERTAÇÃO DE MESTRADO JOÃO DE DEUS VIDAL JÚNIOR SOROCABA – SP 2014 Biogeografia do gênero Rauvolfia L. (Apocynaceae, Rauvolfioideae) JOÃO DE DEUS VIDAL JÚNIOR BIOGEOGRAFIA DO GÊNERO Rauvolfia L. (APOCYNACEAE, RAUVOLFIOIDEAE) Dissertação apresentada à Universidade Federal de São Carlos – Campus Sorocaba, como parte das exigências do Programa de Pós-Graduação em Diversidade Biológica e Conservação, área de concentração em Sistemática, Taxonomia e Biogeografia, para a obtenção do título de Mestre. Profa. Dra. Ingrid Koch Orientadora Prof. Dr. André Olmos Simões Co-orientador SOROCABA – SP 2014 Vidal Jr., João de Deus. V649b Biogeografia do gênero Rauvolfia L. / João de Deus Vidal Jr. – – 2014. 127 f. : 28 cm. Dissertação (mestrado)-Universidade Federal de São Carlos, Campus Sorocaba, Sorocaba, 2014 Orientador: Ingrid Koch Banca examinadora: George Mendes Taliaferro Mattox, Pedro Fiaschi Bibliografia 1. Rauvolfia L. – biogeografia. 2. Sementes – dispersão. 3. Filogenia. I. Título. II. Sorocaba-Universidade Federal de São Carlos. CDD 580.9 Ficha catalográfica elaborada pela Biblioteca do Campus de Sorocaba. “O conto é o mapa que é o território. Você precisa se lembrar disso.” (Neil Gaiman) AGRADECIMENTOS Este trabalho é dedicado a todas as pessoas que acreditaram em mim enquanto pesquisador e pessoa. Obrigado especialmente à professora Ingrid Koch pelo apoio ao longo destes quase quatro anos de trabalho juntos: espero um dia me tornar um pesquisador tão competente quanto você. Espero que ainda venham muitas conquistas como frutos desta nossa parceria. Agradeço também a todos os colegas e docentes que me auxiliaram tanto ao longo da minha vida na pós-graduação e aos professores que leram e criticaram de forma tão construtiva este trabalho, em especial os professores André Olmos Simões, Maria Virgínia Urso-Guimarães, Sílvio Nihei, Ana Paula Carmignotto e George Mattox, que tiveram notável contribuição no desenvolvimento deste trabalho.
    [Show full text]
  • Traditional Medicinal Plants in Ben En National Park, Vietnam
    BLUMEA 53: 569–601 Published on 31 December 2008 http://dx.doi.org/10.3767/000651908X607521 TRADITIONAL MEDICINAL PLANTS IN BEN EN NATIONAL PARK, VIETNAM HOANG VAN SAM1,2, PIETER BAAS2 & PAUL J.A. KEßLER3 SUMMARY This paper surveys the medicinal plants and their traditional use by local people in Ben En National Park, Vietnam. A total of 230 medicinal plant species (belonging to 200 genera and 84 families) is used by local people for treatment of 68 different diseases. These include species that are collected in the wild (65%) as well as species grown in home gardens. Leaves, stems and roots are most commonly used either fresh or dried or by decocting the dried parts in water. Women are mainly responsible for health care, they have better knowledge of medicinal plants than men, and also collect them more than men at almost every age level. The indigenous knowledge of traditional medicinal plants may be rapidly lost because 43% of the young generation do not know or do not want to learn about medicinal plants, and the remainder knows little about them. Moreover, nowadays local people tend to use western medicine. Eighteen medicinal plant species are commercialized and contribute on average 11% to the income of the households. The majority of medicinal species are used by less than half of the households and 68% of the medicinal plant species have use indices lower than 0.25. Only 6 of the medicinal species of Ben En are listed in the Red data list of Vietnam, but locally 18 medicinal species are endangered because of overharvesting.
    [Show full text]
  • The Relationship Between Ecosystem Services and Urban Phytodiversity Is Be- G.M
    Open Journal of Ecology, 2020, 10, 788-821 https://www.scirp.org/journal/oje ISSN Online: 2162-1993 ISSN Print: 2162-1985 Relationship between Urban Floristic Diversity and Ecosystem Services in the Moukonzi-Ngouaka Neighbourhood in Brazzaville, Congo Victor Kimpouni1,2* , Josérald Chaîph Mamboueni2, Ghislain Bileri-Bakala2, Charmes Maïdet Massamba-Makanda2, Guy Médard Koussibila-Dibansa1, Denis Makaya1 1École Normale Supérieure, Université Marien Ngouabi, Brazzaville, Congo 2Institut National de Recherche Forestière, Brazzaville, Congo How to cite this paper: Kimpouni, V., Abstract Mamboueni, J.C., Bileri-Bakala, G., Mas- samba-Makanda, C.M., Koussibila-Dibansa, The relationship between ecosystem services and urban phytodiversity is be- G.M. and Makaya, D. (2020) Relationship ing studied in the Moukonzi-Ngouaka district of Brazzaville. Urban forestry, between Urban Floristic Diversity and Eco- a source of well-being for the inhabitants, is associated with socio-cultural system Services in the Moukonzi-Ngouaka Neighbourhood in Brazzaville, Congo. Open foundations. The surveys concern flora, ethnobotany, socio-economics and Journal of Ecology, 10, 788-821. personal interviews. The 60.30% naturalized flora is heterogeneous and https://doi.org/10.4236/oje.2020.1012049 closely correlated with traditional knowledge. The Guineo-Congolese en- demic element groups are 39.27% of the taxa, of which 3.27% are native to Received: September 16, 2020 Accepted: December 7, 2020 Brazzaville. Ethnobotany recognizes 48.36% ornamental taxa; 28.36% food Published: December 10, 2020 taxa; and 35.27% medicinal taxa. Some multiple-use plants are involved in more than one field. The supply service, a food and phytotherapeutic source, Copyright © 2020 by author(s) and provides the vegetative and generative organs.
    [Show full text]
  • Chemotaxonomic Investigation of Apocynaceae for Retronecine-Type Pyrrolizidine 2 Alkaloids Using HPLC-MS/MS 3 4 Lea A
    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.23.260091; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Chemotaxonomic Investigation of Apocynaceae for Retronecine-Type Pyrrolizidine 2 Alkaloids Using HPLC-MS/MS 3 4 Lea A. Barny1, Julia A. Tasca1,2, Hugo A. Sanchez1, Chelsea R. Smith3, Suzanne Koptur4, Tatyana 5 Livshultz3,5,*, Kevin P. C. Minbiole1,* 6 1Department of Chemistry, Villanova University, Villanova, PA 19085, USA 7 2Department of Biochemistry and Molecular Biophysics, Perelman School of Medicine at the 8 University of Pennsylvania, 3400 Civic Center Blvd, Philadelphia, PA 19104, USA 9 3Department of Biodiversity Earth and Environmental Sciences, Drexel University, PA 19104, 10 USA 11 4Department of Biology, Florida International University, 11200 SW 8th St, Miami, FL 33199 12 5Department of Botany, Academy of Natural Sciences of Drexel University, 1900 Benjamin 13 Franklin Parkway, Philadelphia PA, 19103, USA 14 Email addresses: 15 LAB: [email protected] 16 JAT: [email protected] 17 HAS: [email protected] 18 CRS: [email protected] 19 SK: [email protected] 20 TL: [email protected] 21 KPCM: [email protected] 22 * Authors for correspondence: [email protected] and [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.23.260091; this version posted August 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • A Preliminary Checklist of the Vascular Plants and a Key to Ficus of Goualougo Triangle, Nouabalé-Ndoki National Park, Republic of Congo
    A Preliminary checklist of the Vascular Plants and a key to Ficus of Goualougo Triangle, Nouabalé-Ndoki National Park, Republic of Congo. Sydney Thony Ndolo Ebika MSc Thesis Biodiversity and Taxonomy of Plants University of Edinburgh Royal Botanic Garden Edinburgh Submitted: August 2010 Cover illustration: Aptandra zenkeri, Olacaceae Specimen: Ndolo Ebika, S.T. 28 By Sydney Thony Ndolo Ebika Acknowledgments Acknowledgments The achievement of this MSc thesis in Biodiversity and Taxonomy of Plants is the result of advice, support, help and frank collaboration between different people and organizations and institutions. Without these people this thesis could not have been achieved. My deep grateful thanks go to both Dr. Moutsamboté, J.-M. ( Rural Development Institute, Marien Ngouabi University, Republic of Congo ) and Dr. Harris, D.J. (Royal Botanic Garden Edinburgh) who gave me a powerful boost in studying plants during the botanic training workshop titled Inventory and Identification they organized at Kabo, Republic of Congo, in August 2006. Especially I would like to thank Dr. Harris, because the collaboration he established with the Goualougo Triangle Ape Project, Nouabalé- Ndoki National Park (NNNP), project I was working for, and his continued support for me has been very important to my training as a botanist. The Goualougo Triangle Ape Project (GTAP) is the area where all of the specimens treated in this thesis were collected. The team of this project was always looking after me night and day from 2006 to 2009. I would like to thank both principal investigators of the Triangle both Dr. Morgan, D. and Dr. Sanz, C. for their support to me.
    [Show full text]
  • Isolation and Structure Elucidation of Bioactive Compounds From
    ISOLATION AND STRUCTURE ELUCIDATION OF BIOACTIVE COMPOUNDS FROM RAUVOLFIA CAFFRA SOND BY BAFEDILE DORCAS TLHAPI, BSc(Hons) (11617811) Submitted in fulfilment of the requirements for the Degree of Master of Science (Chemistry) in the Department of Chemistry University of Venda Private Bag X 5050 Thohoyandou 0950 South Africa Supervisor: Prof. IDI. Ramaite Co-Supervisor: Prof. T. van Ree DECLARATION I, Bafedile Dorcas Tlhapi, hereby declare that the dissertation for the Master of Science (MSc) Degree in Chemistry, submitted at the University of Venda, is an original research document and has not been submitted previously for a degree at this or any other university, that it is my own work in design and in execution, and that all reference material contained therein has been duly acknowledged. ……………………..………………. ……………………………… (Signature of Candidate) Date i DEDICATIONS I would like to dedicate this dissertation to my mom (Maria Tlhapi), my dad (Molefe Moses Tlhapi) and my younger sister (Moleboheng Thabia Tlhapi), who have always been my source of inspiration through difficult times. I would also like to express my genuine gratitude to everyone who played a role in my upbringing, my undergraduate and postgraduate studies. Thank you all for your encouragement, patience and support. I hope that this research will justify that hard work, discipline, and perseverance yield good results. ii ACKNOWLEDGEMENTS First and foremost, I would like to thank God the most high for giving me the strength, health, and divine protection throughout this study. I would also like to convey my sincere gratitude to the following individuals and organizations: My supervisors, Prof. IDI. Ramaite and Prof.
    [Show full text]
  • Research Paper ITS2: an Ideal DNA Barcode for the Arid Medicinal Plant
    Academia Journal of Medicinal Plants 6(7): 000-000, July 2018 DOI: 10.15413/ajmp.2018.0136 ISSN 2315-7720 ©2018 Academia Publishing Research Paper ITS2: An ideal DNA barcode for the arid medicinal plant Rhazya stricta Accepted 23rd July, 2018 ABSTRACT Rhazya stricta is a widely used folkloric plant in Saudi Arabia, due to its considerable therapeutic properties. In herbal markets, it is sold in a dried powdered form and the absence of clear phenotypic traits can make its authenticity questionable. Potential misidentification can threaten consumers’ health. With DNA barcoding, this plant can be accurately identified regardless of its physical state. However, barcoding possesses challenges pertaining to marker locus variation. In this study, we assessed seven barcode markers from the chloroplast (psbA-trnH, matK, rbcL, rpoB, and rpoC1) and nuclear region (ITS1 and ITS2) to investigate the taxonomic accuracy of R. stricta. We compared DNA sequences of R. stricta from 50 fresh locally collected and 10 dried ground samples from the herbal market with the database sequences of R. stricta, R. orientalis and eight other related species. Three methods (BLAST, nearest distance, and neighborjoining tree) were used for the analysis. Apart from the intergenic spacer psbA-trnH, most of the chloroplast markers (matK, rbcL, rpoB, and rpoC1) showed S. A. Khan1*, M.N. Baeshen2, H. A. Ramadan3 and N. A.Baeshen1 high similarity with other taxa. Although psbA-trnH was variable for R. stricta, it showed indistinct alignment, which discouraged its use as a single locus barcode. 1Biological Sciences, King Abdulaziz In contrast, nuclear ITS2 distinguished between R. stricta, R.
    [Show full text]
  • Diversity of Vascular Plants in Spring Water Swamp Areas of Thong Pha
    รายงานการวิจัยในโครงการ 128-145 ชุดโครงการทองผาภูมิตะวันตก Diversity of Vascular Plants in Spring Water Swamp Areas of Thong Pha Phum District, Kanchanaburi Province, Thailand Parinyanoot Darumas*, Chumpol Khunwasi and Tosak Seelanan Chulalongkorn University, Bangkok *[email protected] Abstract: A Taxonomic survey of vascular plants was carried out in three spring water swamp areas in Thong Pha Phum District namely Pong Phu Ron, Phu Poo Rachinee, and Phu Chumchon Ban Tha Maduea from December 2001 to November 2003. A total of 493 specimens were collected. They were identified into 273 species, 205 genera and 87 families. These can be categorized into pteridophytes and flowering plants. Among these, 24 species in 17 genera and 12 families are pteridophytes, of which Polypodiaceae is the richest family of 8 species. The remaining species were angiosperms which comprised 170 species of the dicots, and 79 species of the monocots. Among the flowering plants, Orchidaceae was the richest family with 56 species. The second was Labiatae with 11 species in 6 genera while the third was Leguminosae- Caesalpinioideae with 10 species in 5 genera. In addition, six endemic species to Thailand were recorded, i.e., Ardisia ficifolia K.Larsen & C.M.Hu, Ardisia confusa K.Larsen & C.M.Hu, Morinda scabrida Craib, Boesenbergia siamensis (Gagnep.) P.Sirirugsa, Aristolochia kerrii Craib and Magnolia siamensis, Dandy var. siamensis; the latter two species are very rare. The other 4 species, viz. Clematis smilacifolia Wall., Malleola penangiana (Hook.f.) J.J.Sm. & Schltr., Phalaenopsis parishii Rchb.f., and Renanthera coccinea Lour. were also rarely found in this natural habitat. Moreover, there are a number of species which are said to be threatened in Thailand.
    [Show full text]
  • BRINGING BACK the FORESTS Policies and Practices for Degraded Lands and Forests Proceedings of an International Conference 7–10 October 2002, Kuala Lumpur, Malaysia
    BRINGING BACK THE FORESTS Policies and Practices for Degraded Lands and Forests Proceedings of an International Conference 7–10 October 2002, Kuala Lumpur, Malaysia Food and Agriculture Organization of the United Nations Regional Office for Asia and the Pacific Bangkok, Thailand 2003 RAP PUBLICATION 2003/14 BRINGING BACK THE FORESTS Policies and Practices for Degraded Lands and Forests Proceedings of an International Conference 7–10 October 2002, Kuala Lumpur, Malaysia Editors: H.C. Sim, S. Appanah and P.B. Durst Organised by: Food and Agriculture Organization of the United Nations Regional Office for Asia and the Pacific Bangkok, Thailand 2003 The designations employed and the presentation of material in this publication do not imply the expression of any opinion whatsoever on the part of the Food and Agriculture Organization of the United Nations concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, without the permission of the copyright owner. Applications for such permission, with a statement of the purpose and extent of the reproduction, should be addressed to the Senior Forestry Officer, Food and Agridulture Organization of the United Nations, Regional Office for Asia and the Pacific, 39 Phra Atit Road, Bangkok, Thailand. @ FAO 2003 ISBN No: 974-7946-43-2 For copies of the report, write to: Patrick B. Durst Senior Forestry Officer FAO Regional Office for Asia and the Pacific 39 Phra Atit Road Bangkok 10200 Thailand Tel: (66-2) 697 4000 Fax: (66-2) 697 4445 Email: [email protected] FOREWORD Forests are important natural resources that fuel the continuous economic and social development of many countries.
    [Show full text]
  • Medicinal Plants for Women's and Children's Health in Urban and Rural
    Medicinal plants for women’s and children’s health in urban and rural areas of Gabon The harvest of wild and cultivated plants Esther van Vliet Major research project, master Environmental Biology, Utrecht University Supervisors: A.M. Towns MSc., Dr. T.R. van Andel Supervisors: A.M. Towns MSc., dr. T. van Andel Market saleswomen in Oyem, August 5th 2012, picture by Esther van Vliet Contents 1. Abstract ............................................................................................................................................... 4 2. Introduction ......................................................................................................................................... 5 2.1 Aim of this study ............................................................................................................................ 6 3. Methodology ....................................................................................................................................... 8 3.1 Field sites ....................................................................................................................................... 8 3.2 Data collection ............................................................................................................................... 8 3.3 Data analysis ................................................................................................................................ 12 3.4 Statistical analysis .......................................................................................................................
    [Show full text]
  • Q0LX° 3 Series of Revisions of Apocynaceae XLVII
    WAGENINGEN AGRICULTURAL UNIVERSITY PAPERS 98-3(1999 ) Series of Revisions of Apocynaceae XLVII The genus Cerbera L. by A.J.M. Leeuwenberg Department ofPlant Taxonomy Agricultural University P.O. Box 8010, 6700 ED Wageningen, the Netherlands Date of publication: 31Januar y 1999 Wageningen MM AgriculturalUniversit y The Netherlands 1999 Q0LX° 3 Series of Revisions of Apocynaceae XLVII. The genus Cerbera L. / A.J.M. Leeuwenberg ISBN 90-5782-019-6 NUGI 823 ISSN 0169-345X Distribution: Backhuys Publishers, P.O. Box 321,230 0 AH Leiden, The Netherlands. Telephone: +31-71-5170208 Fax:+31-71-5171856 E-mail: [email protected] All rights reserved Printed in The Netherlands WageningenAgricultural UniversityPapers 98-3(1999) BIBLIOTHEEK LANDBOUWUNIVERSITEIT WAGENINGEN Series of Revisions of Apocynaceae XLVII The genus Cerbera L. by A.J.M. Leeuwenberg Department of Plant Taxonomy, Wageningen Agricultural University, P.O. Box 8010, 6700 ED Wageningen, the Netherlands Abstract The genus Cerbera is monographed in this paper. It counts 6 species and can be found in Pemba, Tanzania, and Madagascar in the West to Pitcairn Island in the East, and from Okinawa Island, Japan, to Southern Queensland, Australia. C. laeta has been described as new to science, 3 names were reduced to synonymy and 30 binomials are listed as species or synonyms in other genera. Introduction The present publication is based on the study of herbarium material including the types of almost all names and synonyms, and living material of 2 of the 6 species maintained here. As it is not possible to recognize vegetative or fruiting material to the species, the author had to leave relatively many specimens unnamed, when more than one species is represented in a certain area.
    [Show full text]
  • 4.670.600 Bita
    All rights reserved. No part of this publication may be reproduced, distributed, or transmitted in any form or by any means, including photocopying, recording, or other electronic or mechanical methods, without the prior written permission of the publisher, except in the case of brief quotations embodied in critical reviews and certain other noncommercial uses permitted by copyright law. LIPI Press © 2017 Indonesian Institute of Sciences (LIPI) Bali Botanic Garden An Alphabetical List of Plant Species Cultivated in Bali Botanic Garden: Ida Bagus Ketut Arinasa, Bayu Adjie, and Dyan Meiningsasi Siswoyo Putri (Eds.). xiv + 422 hlm. ; 14,8 x 21 cm ISBN: 978-979-799-872-1 1. Plant species 2. Bali Botanic Garden 3. Catalogue 017.5 Copy editor : Tantrina Dwi Aprianita Proofreader : Martinus Helmiawan and Sarwendah Puspita Dewi Layouter : Nurhasanah Ridwan and Prapti Sasiwi Cover Designer : Dhevi E.I.R. Mahelingga Photographer : I Gede Wawan Setiadi First Edition : August 2017 Published by: LIPI Press, member of Ikapi Jln. Gondangdia Lama 39, Menteng, Jakarta 10350 Phone (021) 314 0228, 314 6942. Fax. (021) 314 4591 E-mail: [email protected] Website: lipipress.lipi.go.id LIPI press @lipi_press Contents Editorial Note ...................................................................................................... vii Abbreviations and Symbols ............................................................................... ix Foreword ..............................................................................................................
    [Show full text]