Research Paper ITS2: an Ideal DNA Barcode for the Arid Medicinal Plant

Research Paper

ITS2: An ideal DNA barcode for the arid medicinal plant Rhazya stricta

Accepted 23rd July, 2018

ABSTRACT

Rhazya stricta is a widely used folkloric plant in Saudi Arabia, due to its considerable therapeutic properties. In herbal markets, it is sold in a dried powdered form and the absence of clear phenotypic traits can make its authenticity questionable. Potential misidentification can threaten consumers’ health. With DNA barcoding, this plant can be accurately identified regardless of its physical state. However, barcoding possesses challenges pertaining to marker locus variation. In this study, we assessed seven barcode markers from the chloroplast (psbA-trnH, matK, rbcL, rpoB, and rpoC1) and nuclear region (ITS1 and ITS2) to investigate the taxonomic accuracy of R. stricta. We compared DNA sequences of R. stricta from 50 fresh locally collected and 10 dried ground samples from the herbal market with the database sequences of R. stricta, R. orientalis and eight other related species. Three methods (BLAST, nearest distance, and neighborjoining tree) were used for the analysis. Apart from the intergenic spacer psbA-trnH, most of the chloroplast markers (matK, rbcL, rpoB, and rpoC1) showed S. A. Khan1*, M.N. Baeshen2, H. A. Ramadan3 and N. A.Baeshen1 high similarity with other taxa. Although psbA-trnH was variable for R. stricta, it showed indistinct alignment, which discouraged its use as a single locus barcode. 1Biological Sciences, King Abdulaziz In contrast, nuclear ITS2 distinguished between R. stricta, R. orientalis and other University, Jeddah, Saudi Arabia. related species, emerging as an ideal barcode for the genus Rhazya. A two-locus 2Biological Sciences, University of Jeddah, Jeddah, Saudi Arabia. marker of ITS1+ITS2 sequences also showed promising results. To safeguard 3Marine Sciences, King Abdulaziz consumers’ health, our study indicates the use of ITS2 as a cost-effective barcoding University, Jeddah, Saudi Arabia. marker for checking the authenticity of R. stricta.

*Corresponding author. E-mail: [email protected]. Tel: +966- Key words: DNA barcoding, medicinal plant, Rhazya stricta, ITS1, ITS2, psbA-trnH 500206743. regions.

INTRODUCTION

Rhazya stricta Decne is a medicinal plant that thrives in the Generally, R. stricta is acquired from markets under the arid regions of Saudi Arabia (Mandaville, 2011), other parts vernacular name “Hermal,” but accurate identification can of the Arabian Peninsula, and the Indian sub-continent be challenging due to the absence of distinct morphological (Zahran, 2010). Due to the valuable therapeutic properties traits in the dried or powdered state. The validation of of genus Rhazya (Apocynaceae), this plant species exhibits authenticity for pharmacological products is highly abundant medicinal properties (Elkady et al., 2014; Ahmed recommended (Veldman et al., 2014) to ensure et al., 2015), including anticancer (Baeshen et al., 2012; effectiveness, but contamination and adulteration are Elkady, 2013), antifungal (Emad and Gamal, 2013), and common in herbal markets which have led to some diseases antidiabetic (Baeshen et al., 2010) effects. Its sole sister and deaths (Vassou et al., 2015). Thus, to ascertain the species, Rhazya orientalis (syn. Amsonia orientalis) (Marwat authenticity of a medicinal plant for consumers’ safety, et al., 2012; Aksoy et al., 2013) is distributed throughout there is a strong need to perform identification at the northwest Turkey and northeast Greece (Acemi̇ et al., molecular level, in addition to traditional taxonomic and 2016). biochemical examinations (DeSalle, 2006).

The past two decades have seen advances in molecular MATERIALS AND METHODS techniques that could unambiguously identify medicinal plants (Uncu et al., 2015) in the absence of diagnostic Plant material sampling phenotypic characteristics. One such molecular technique is DNA barcoding, which provides swift identification, unlike We collected fifty (50) fresh leaf samples of R. stricta from traditional taxonomy (Mishra et al., 2016). With this five different locations in the Western province of Saudi technique, unidentified species are recognized using Arabia (at 21°21.042', 39°33.054'; 21°24.849', 39°44.044'; standardized DNA segments like universal product codes 21°29.622', 39°35.823'; 21°26.817', 39°31.109'; and and highly conserved DNA sequences are targeted where 21°26.423', 39°31.853'). Sampling was performed in the minor nucleotide variations have evolved (Ali et al., 2014). winter season when plants growth is active in the deserts. These nucleotide polymorphisms create a DNA barcode The identification of plant samples was carried out using that is unique to the species and can validate any type of morphological markers at King Abdul Aziz University. sample (Khan et al., 2012). Samples were frozen using liquid nitrogen and stored at - In animals, the mitochondrial cytochrome c oxidase 80°C until DNA extraction. Additionally, 10 dried and subunit 1 (COI) gene (Hebert et al., 2003) and other powered samples of R. stricta were collected from the local mitochondrial regions are used as universal DNA markers. herbal market. However, they are not an ideal choice for a barcode marker because these regions show slow evolution in plants (Palmer and Herbon, 1988). Complex evolutionary DNA extractions, amplification and sequencing phenomena in plants (for example, hybridization and polyploidy) complicate the definition of species boundaries DNA extraction and amplification from R. stricta samples (Fazekas et al., 2009). Hence, no single barcode region has was conducted in the Molecular Biology Laboratory at King yet been identified that can discriminate between all Fahad Research Center, Jeddah. The samples were 200,000 known plant species (Chen et al., 2010) and there thoroughly scraped and wiped with 75% ethanol to prevent is little possibility that a single universal plant DNA barcode fungal contamination. R. stricta is a poisonous plant with an marker exists (Pečnikar and Buzan, 2014). elevated level of alkaloids and flavonoids that can hinder Numerous coding and non-coding regions from the DNA extraction. To overcome this, we extracted genomic plastidial (rbcL, psbA-trnH, trnL-trnF, and matK) and DNA from young leaves (Fazekas et al., 2008) and utilized nuclear genomes (5S, 16S, 18S, and ITS) (Agarwal et al., the DNA easy plant mini kit (Qiagen, Germany) according to 2008) have been suggested for barcoding plants, including the manufacturer’s instructions with slight modifications medicinal species (Kress and Erickson, 2007; Lahaye et al., (elution buffer AE was heated to 65°C and elution times 2008; Mishra et al., 2016). Both coding (Mahadani et al., were increased by 30 min). These same modifications were 2013) and non-coding regions, like intergenic spacers used for extracting DNA from market samples. Total (psbK-psbI and atpF-atpH) (Khan et al., 2017) have yielded extracts were stored at −20°C until their use as templates positive results. However, the uniparental inheritance of for polymerase chain reaction (PCR). The extracted organellar DNA restricts the rate of information acquisition genomic DNA was also analyzed by electrophoresis on a 1% (Chase et al., 2005) as compared to that of biparentally agarose gel in 1× Tris/Borate/EDTA (TBE) buffer and inherited nuclear markers, like internal transcribed spacers stained with ethidium bromide (0.5 mg/ml). (nrITS) ITS1 and ITS2 (Chase and Fay, 2009). Additionally, Amplification of target loci sequences was performed in a mutation rates are higher in the nuclear genome (Wolfe et total volume of 30 μl, consisting of 15 μl of GoTaq green al., 1987). These attributes have led this region to be master mix (for final concentrations of 200 μM for each proposed as a DNA barcode for various flowering plants deoxynucleoside triphosphate and 1.5 mM MgCl2), 1 μm of (Hollingsworth et al., 2011), especially medicinal plants each forward and reverse primer, 25 to 250 ng of sample (Chen et al., 2010). genomic DNA, and deionized distilled water. Table 1 shows To enhance the discriminatory potential between closely the primers (Bioneer Corp., South Korea) and conditions related plant species, a multi-locus DNA barcode was used for amplifying chloroplast loci. Touchdown PCR was proposed by numerous taxonomists (Kane et al., 2012). A used to optimize thermocycling conditions for successful combination of 11 plastid and rDNA ITS2 sequence data amplification of the target regions (Table 1). were recommended for the study of Araucaria (Kranitz et The amplicons analysis was done on a 1.5% agarose gel al., 2014) and four markers (rbcL, matK, psbA-trnH, and using a 100-bp DNA ladder (Promega Corp., USA) as a ITS2) were tested in Sida (Vassou et al., 2015). Therefore, to molecular marker, as previously described for genomic improve the ability to identify the arid medicinal plant R. DNA analysis. A gel documentation system (Biospectrum stricta, we analyzed a multi-locus combination of seven 410; UVP) was used to analyze gel images. For bidirectional markers: ITS1 and ITS2 from the nuclear genome; and five sequencing, the PCR products were sent to Macrogen, Inc. other potential coding (rpoB, rpoC1, rbcL, matKand psbA- (Seoul, South Korea) using the same primers to resolve trnH) loci from the plastid genomes. ambiguities (Middendorf et al., 2001).

Table 1: Primers and amplification conditions for seven DNA barcoding loci.

Primer Nucleotide sequence (5′→3′) Thermocycling conditions matK_XF1 TAATTTACGATCAATTCATTC 94°C for 4 min, 40 cycles of 94°C for 50 s, 52°C for matK_MALP_R1 ACAAGAAAGTCGAAGTAT 1 min, and 72°C for 1 min, 72 ̊ C for 10 min

rbcLa F ATGTCACCACAAACAGAGACTAAAGC 94°C for 1 min, 30 cycles of 94°C for 45 s, 51°C for rbcLa R CTTCTGCTACAAATAAGAATCGATCTC 45 s, and 72°C for 5 s, 72°C for 5 min

rpoB F ATGCAACGTCAAGCAGTTCC 94°C for 4 min, 40 cycles or 30 s, 53°C for 40 s, and rpoB-3R GATCCCAGCATCACAATTCC 72°C for 40 s, 77°C for 7 min

rpoC1-1F GTGGATACACTTCTTGATAATGG 94°C for 4 min, 40 cycles of 94°C for 30 s, 53°C for rpoC1-3R TGAGAAAACATAAGTAAACGGGC 40 s, and 72°C for 40 s, 72°C for 7 min

psbA-trnH F GTTATGCATGAACGTAATGCTC 95°C for 2.30 min, 35 cycles of 95°C for 30 s, 58°C psbA-trnH R CGCGCATGGTGGATTCACAATCC for 40 s, and 64°C for 1 min, 72°C for 30 min

ITS1 F ACGAATTCATGGTCCGGTGAAGTGTTCG 95°C for 5 min, 38 cycles of 95°C for 1 min, 52°C ITS1 R TAGAATTCCCCGGTTCGCTCGCCGTTAC for 30 s, and 72°C for 1 min, 72°C for 10 min

GCGATACTTGGTGTGAAT 94°C for 5 min, 40 cycles of 94°C for 30 sec, 56°C ITS2 F GACGCTTCTCCAGACTACAAT for 30 s, and 72°C for 1 min, 72°C for 10 min

Data analysis Apocynaceae family from the GenBank database (Table 2). We studied eight other species from genera other than R. Forward and reverse sequences were analyzed and orientalis (syn. Amsonia orientalis), because Rhazya is a assembled using the highest quality setting in Geneious R11 ditypic genus and an extensive data was missing due to the software (Kearse et al., 2012). To evaluate the identification absence of psbA-trnH, matK rbcL, rpoB, and rpoC1 capabilities of the seven-barcode regions, we used three sequences for R. orientalis. We used MUSCLE plug-in identification methods: BLAST algorithm (Edgar, 2004) for editing and aligning the sequences and (http://blast.ncbi.nlm.nih.gov/blast.cgi), nearest distances, Geneious R11 software to analyze the percentage of and tree-based neighbor joining. Three scenarios were identical nucleotide sites and GC content. considered. First, when the BLAST hit of the query The tree-based phylogenetic analysis using the neighbor sequence was from the expected species, then it was joining method was used to study the discriminatory considered to be an accurate identification. Second, when abilities of different barcode markers. Utilizing the Kimura the BLAST hit was from several species that included the two-parameter model of nucleotide substitution, we expected species, then it was considered to be an assessed phylogenetic distances using MEGA 6.0 software ambiguous identification. Third, when the BLAST hit of the (Tamura et al., 2013). Node support was evaluated with a query sequence was from an unexpected species, it was 1000-replicate bootstrap. Along with the single locus considered to be an incorrect identification. For BLAST high barcode, concatenated ITS1+ITS2 sequences were also bit scores, the grades (a weighted score for the hit that analyzed. Intra-and inter-specific genetic distances were includes the E-value, pairwise identity, and coverage) and also calculated with this software. The recommended DNA E-value were taken into account. The nearest distance barcode (ITS2) was authenticated on 10 market samples of method depends on the smallest genetic distance and a R. stricta. Table 3 shows all sequences were deposited in correct identification confirms that the hit is from the same the GenBank nucleotide database. species as the query. In contrast, ambiguous identification indicates that many hits have the same small genetic distance in the query sequences. Incorrect identification RESULTS indicates that the hit is not from the query sequence. To improve the discriminatory efficiency of all seven proposed DNA isolation and amplification barcode regions, we downloaded the sequences for R. stricta and 10 highly similar species of related genera from We successfully extracted DNA from all the samples with

Table 2: Sequence sources for ITS1 and ITS2 markers from GenBank.

S/No. Species Accession number 1 Rhazya stricta KF815493 2 Amsonia orientalis KJ649326 3 Amsoniato mentosa MF963953 4 Carissa carandas HQ386688 5 Melodinus cochinchinensis HG004858 6 Nerium oleander HE602380 7 Rauvolfia verticillata FJ980307 8 Rauvolfia densiflora HQ386694 9 Neisosperma golmeratum AB331863 10 Neisosperma nakaianum AB331861

Table 3: Accession numbers for Rhazya stricta sequences submitted to GenBank.

Target region Accession number ITS1 KX602156 ITS2 KX602159 psbA-trnH KX602161 matK KX602160 rbcL KX602163 rpoB KX602164 rpoC1 KX602165

Table 4: Properties of seven DNA Barcoding candidate loci in R. stricta sequences.

Percentage (%) Sequence Mean Sequence Identical sites on length (bp) GC content Interspecific interspecific alignments Intraspecific distance distance ITS1 442 58.8 72.8 0.13 ± 0.1 10.26 ± 1.5 ITS2 229 62.9 68.6 0.03 ± 0.0 12.51 ± 2.4 ITS1 + ITS2 671 60.2 68.5 0.03 ± 0.0 10.95 ± 1.5

ITS2 + ITS1 671 60.2 72.8 0.13 ± 0.1 10.26 ± 1.8 psbA-trnH 604 23.8 78.6 0.16 ± 0.1 9.98 ± 0.6 matK 831 34.4 91.3 0 2.93 ± 0.6 rbcL 599 44.4 97.1 0 1.06 ± 0.4 rpoB 338 39.5 91.4 0 2.69 ± 0.5 rpoC1 427 41.9 94.8 0 1.32 ± 0.6

the protocol earlier described. All nuclear and plastidial loci family (Table 5). The inter-specific divergence was very low were amplified with the thermocycling conditions provided (matK: 2.93%, rbcL: 1.06%, rpoB: 2.69%, and rpoC1: in Table 4. 1.32%). However, inter-specific variation for psbA-trnH, ITS1 and ITS2 sequences was high (9.98, 10.26 and 12.51%, respectively) and was 10.95% for concatenated ITS1+ITS2. BLAST analysis and multiple alignments Also, the identical sites percentage (assessed using Geneious R11) for these loci was (psbA-trnH) 78.6%, (ITS1) The seven barcode loci (ITS1, ITS2, psbA-trnH, matK, rbcL, 72.8%, (ITS2) 68.6%, and (ITS1+ITS2) 68.5% (Figures 1 and rpoB, and rpoC1) showed 100% identity and query cover in 2). The intra-specific divergence for all seven barcode loci BLAST analysis with the R. stricta sequences (GenBank no. showed zero to very low variation, validating the KF815493). The matK, rbcL, rpoB, and rpoC1 sequences conclusion that all were R. stricta samples. Of the seven loci, exhibited high similarity to other taxa of the Apocynaceae the ITS2 locus possessed the highest inter-specific

Table 5: Results of BLAST analysis for R. stricta ITS2 sample sequences, showing similarity with other neighboring species from the Apocynaceae family.

Percentage (%) Bit- Organism Accession Sequence Query Identical score E-value Grade GC length (bp) coverage sites Rhazya stricta KF815493 407.044 225 9.78e-110 100.0 100.0 99.9 63.1 Amsonia orientalis KJ649326 343.926 229 9.78e-91 100.0 93.9 96.9 61.2 Amsonia tomentosa MF963953 345.73 225 2.80e-91 98.25 94.7 96.5 61.9

Carissa carandas HQ386688 320.483 229 1.12e-83 100.0 91.7 95.9 65.2

Melodinus cochinchinensis HG004858 264.578 238 7.53e-67 100.0 85.7 92.9 71.6 Nerium oleander HE602380 250.151 211 1.66e-62 92.14 87.7 89.9 68.6 Rauvolfia verticillata FJ980307 223.101 227 2.30e-54 98.25 82.8 90.5 69.9 Rauvolfia densiflora HQ386694 221.297 231 8.05e-54 100.0 82.3 91.1 70.0 Neisosperma golmeratum AB331863 219.494 206 2.81e-53 88.21 84.0 86.1 67.3 Neisosperma nakaianum AB331861 219.494 206 2.81e-53 88.21 84.0 86.1 67.3

Figure 1: Multiple sequence alignment for ITS2 locus from R. stricta sample sequences highlighting variable informative sites.

variation, rather than intra-specific variation, thereby distinctly identified dried powered market samples of R. presenting a clear barcoding gap that was distinctive for R. stricta. stricta.

DISCUSSION Neighbor joining tree identification Presently, 80% of the world population (Choudhary et al., The neighbor joining tree analysis for the ITS2 and ITS1+ 2015) is witnessing a resurgence of interest towards ITS2 loci clustered all sample sequences of R. stricta (query medicinal plants. A similar inclination can be observed in sequences) with those of the GenBank R. stricta sequences the native Saudi population (Al-Essa et al., 1998) regarding into a highly supported single independent clade (Figures 3 medicinal species of the local flora. For instance, the and 4). Thus, these results indicate that the ITS2 locus could countless pharmacological properties of R. stricta has made successfully identify R. stricta samples using BLAST, nearest it become an important and sought after medicinal plant in distances, and tree-based methods without any ambiguous this region (Gilani et al., 2007). Although it is easily or incorrect identification. Also, the ITS1+ITS2 double locus accessible from its natural habitat, its authentication in the exhibited promising results for authenticating of R. stricta. herbal market is challenging due to lack of distinct These two proposed DNA barcodes (ITS1 and ITS1+ITS2) phenotypic traits, various storage conditions and product

Figure 2: Multiple sequence alignments for double locus ITS1+ITS2 from R. stricta sample sequences highlighting variable informative sites.

Figure 3: Neighbor joining tree of ITS2 sequences for R. stricta. The branch labels display percentage of replicate trees where associated taxa clustered together in the bootstrap test (1000 replicates).

Figure 4: Neighbor joining tree of ITS1+ITS2 sequences for R.stricta. The branch labels display percentage of replicate trees where associated taxa clustered together in the bootstrap test (1000).

age (Khan et al., 2017). Thus, in an attempt to ensure Chinese medicinal plants, including 6600 plant samples of consumers’ health, we explored the technique of DNA 4800 species from 753 genera (Chen et al., 2010), and in barcoding for identification of R. stricta at the molecular Mediterranean legumes (Madesis et al., 2012). level, regardless of its physical state. Additionally, efficient sequencing results were observed DNA barcoding can be regarded as a “renaissance of in 222 species that represent the four sub-genera of taxonomy” (Miller, 2007). The past two decades have seen Passiflora (Giudicelli et al., 2015). The tractability of the an emergence of this molecular technique for effective nrITS region aids in its amplification, even from poor species discrimination (Pečnikar and Buzan , 2014). The quality DNA (Kress et al., 2005) like our dried powered targets of barcoding are highly conserved stretches of DNA, market samples. However, amplification and sequencing of either coding or non-coding regions, which contain minor matK, which is also observed in the temperate flora that polymorphisms (Ali et al., 2014). Various studies have also includes 436 species of land plants (Burgess et al., 2011) demonstrated its competency in defining species and medicinal Uncaria species (Zhang et al., 2015) was boundaries and flagging new species (Hebert et al., 2003, initially difficult. 2004). This simple and quick technique has been In our study, the sequences of plastidial markers matK, extensively used to identify medicinal plants (Li et al., 2014; rbcL, rpoC1, and rpoB were not variable enough to Zheng et al., 2015; Ganie et al., 2015). In the future, it is also discriminate between species. Similar results were expected to play an important role in the validation of plant observed for matK (Group et al., 2009), rbcL (Asahina et al., products (Han et al., 2016). 2010), rpoC1 (Starr et al., 2009) and rpoB (Yu et al., 2014). An ideal DNA barcode (i) should have conserved flanking In contrast, the intergenic spacer psbA-trnH region was regions for easy amplification and sequencing; (ii) should distinct for R. stricta. This region is thought to rapidly not exceed 1 kb for easy DNA extraction and amplification; evolve and have high rates of insertion/deletion (Kress and (iii) should possess higher inter-specific than intra-specific Erickson, 2007). However, this locus showed tremendous variation for species level resolution, and (iv) can be indistinct alignment with other taxa due to considerable efficiently handled with bioinformatic tools and analysis variations in length. Earlier studies (Yao et al., 2009) (Kress et al., 2005; Kress and Erickson, 2008; Wong et al., support these findings and Whitlock et al. (2010) related 2013). We chose seven DNA barcoding loci that had the this phenomenon to recurrent inversions that lead to an aforementioned criteria. The ITS1, ITS2, psbA-trnH, rbcL, overestimation of genetic divergence and inappropriate rpoB, and rpoC1 were easily amplified and sequenced. The phylogenetic assignment. Consequently, it can be used in nuclear-derived nrITS region can be amplified from two-loci or three-loci barcodes for adequate resolution medicinal plants and from plant species that have lost their (Kress et al., 2005; Chase et al., 2007). plastid genomes (Molina et al., 2014; Smith and Lee, 2014). The nuclear ribosomal intergenic spacers had the highest This characteristic of easy amplification is also seen in barcoding success rate of the seven markers investigated in

our study (ITS2 followed by ITS1). These markersresolved and Technology (KACST) under the grant GSP-34-119 for R. stricta from its sisterspecies R. orientalis support rendered in the course of this study. (Amsoniaorientalis).This high-resolution power in differentiating closely related species is credited to its increased evolution rate (Kress et al., 2005; Sass et al., REFERENCES 2007; Liu et al., 2011). ITS2 also differentiates between Acemi̇ A , Türker-Kaya S, Özen F (2016). FT-IR Spectroscopy Based congeneric species of Dendrobium (Singh et al., 2012), Evaluation of Changes in Primary Metabolites of Amsonia Orientalis citrus species (Sun et al., 2015), Physalis species (Feng et al., after In Vitro 6-Benzylaminopurine Treatment. Not. Bot. Horti Agrobo. 2016) and samples of herbal medicinal products (Michel et 44(1):209-214. al., 2016). In our study, the ITS2 spacer and concatenated Agarwal M, Shrivastava N, Padh H (2008). Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Rep. ITS1+ITS2 marker possessed higher inter-specific (12.51 27(4):617-631 and 10.95%, respectively) than intra-specific (0.03 and Ahmed A, Asad MJ, Ahmad MS, Qureshi R, Shah SI, Gul H, Gulfraz M (2015). 0.03%, respectively) variation for distinctly resolving R. Antidiabetic and Hypolipidemic Potential of Rhazya Stricta Decne Ex- stricta. Minor nucleotide variation in nrITS sequences was tract and Its Fractions. Int. Curr. Pharm. J. 4(2): 353-361 Aksoy Ö, Erbulucu T, Özen F, Deveci A (2013). Genetic variation in not restricted to one population. critically endangered plant Amsonia orientalis Decne. J. Biodivers. DNA barcoding utilizes polymorphisms, which leads to Environ. Sci. 3(1): 44-53. gaps in sequences. Distinct polymorphisms in the ITS2 and Al-Essa MA, Al-Mehaidib A, Al-Gain S (1998). Parental awareness of liver ITS1+ITS2 regions were seen as gaps during alignment, disease among Children in Saudi Arabia. Ann. Saudi Med. 18: 79-81. Ali MA, Gyulai G, Hidvegi N, Kerti B, Al Hemaid FM, Pandey AK, Lee J which could be used for barcoding R. stricta. Additionally, (2014). The changing epitome of species identification - DNA barcoding. the ITS2 and concatenated ITS1+ITS2 sequences displayed Saudi J. Biol. Sci. 21(3): 204-231 only 68.6 and 68.5% nucleotide similarity to the other Ali MA,Gyulai G, Hidvegi N, Kerti B, AlHemaid FM,Pandey AK, Lee J (2014). species sequences, whereas the psbA-trnH sequences The changing epitome of Species Identification -DNA barcoding. Saudi J. Biol. Sci. 21: 204-231. displayed 78.6% nucleotide similarity with other taxa, Asahina H, Shinozaki J, Masuda K, Morimitsu Y, Satake M (2010). which was much higher than the nrITS region. In addition, Identification of medicinal dendrobium species by phylogenetic our neighbor joining tree analysis showed 100% analyses using matK and rbcL sequences. J. Nat. Med. 64: 133-138. monophyletic differentiation for the single locus ITS2 and Baeshen N, Lari S, Al Doghaither HA, Ramadan HA (2010). Effect of Rhazya stricta Extract on Rat Adiponectin Gene and Insulin Resistance. J. Am. the double locus ITS1+ITS2. Also, we successfully validated Sci. 6(12): 1237-1245. R. stricta market samples using ITS2 and ITS1+ITS2 loci. Baeshen NA, Elkady AI, Abuzinadah OA, Mutwakil MH (2012). Potential Thus, we support the proposal of Chen et al. (2010) to use anticancer activity of the medicinal herb, Rhazya stricta, against human ITS2 as a standard barcode to identify medicinal plants and breast cancer. Afr. J. Biotechnol. 11(37): 8960-8972 Burgess KS, Fazekas AJ, Kesanakurti PR, Graham SW, Husband BC, New- their products. master, S.G., et al. (2011). Discriminating Plant Species in a Local Temperate Flora Using the rbcL+matK DNA Barcode. Methods Ecol. Evol. 2(4): 333- 340. Conclusion Chase MW, Cowan RS, Hollingsworth PM, van den Berg C, Madriñán S, Petersen G, Seberg O, Jørgsensen T, Cameron KM, Carine M, Pedersen N

(2007). A proposal for a standardised protocol to barcode all land This study reveals that sequences from the plastidial coding plants. Taxon. 56(2): 295-299. markers matK, rbcL, rpoB, and rpoC1 were similar to Chase MW, Fay MF (2009). Barcoding of Plants and Fungi. Science. sequences from other taxa; thus, they are not suitable 325(5941): 682-683. regions for barcoding of R. stricta. In contrast, the Chase MW, Salamin N, Wilkinson M, Dunwell JM, Kesanakurthi RP, Haidar N, Savolainen V (2005). Land Plants and DNA Barcodes: Short-Term and intergenic spacer psbA-trnH had enough variation; although Long-Term Goals. Philos. Trans. R Soc. Lond. B. Biol. Sci. 360(1462): its indistinct alignment makes it suitable only for use as a 1889-1895. two-loci or three-loci barcode. By contrast, the nuclear ITS2 Chen S, Yao H, Han J, Liu C, Song J, Shi L, et al. (2010). Validation of the ITS2 sequences and the concatenated ITS1+ITS2 sequences were Region as a Novel DNA Barcode for Identifying Medicinal Plant Species. PLoS One. 5(1): e8613. distinctly variable for R. stricta. Therefore, our study Choudhary M, Kumar V, Malhotra H, Singh S (2015). Medicinal Plants with strongly suggests that the ITS2 region can serve as a gold potential anti-arthritic activity. J. Intercult. Ethnopharmacol. 4(2): 147- standard barcode for taxonomic validation of the medicinal 179. plant R. stricta. Because the ITS2 DNA barcode is cheap, DeSalle ROB (2006). Species discovery versus species identification in DNA barcoding efforts: response to Rubinoff. Conserv. Biol. 20(5): 1545- easily amplified and accurate, it can be used by regulatory 1547. agencies for market supervision of economically important Edgar RC (2004). MUSCLE: Multiple Sequence Alignment with High plants and their products. This work represents a step Accuracy and High Throughput. Nucleic Acids Res. 32: 1792-1797. towards generating a data bank of barcode markers for Elkady AI (2013) Crude Alkaloid Extract of Rhazya Stricta Inhibits Cell Growth and Sensitizes Human Lung Cancer Cells to Cisplatin through economically important flora of this region. Induction of Apoptosis. Genet. Mol. Biol. 36(1):12-21 Elkady AI, Hussein RAEH, Abu-Zinadah OA (2014). Differential Control of Growth, Apoptotic Activity and Gene Expression in Human Colon Cancer ACKNOWLEDGEMENT Cells by Extracts Derived from Medicinal Herbs, Rhazya stricta and Zingiber officinale and their Combination. World J. Gastroenterol. 20(41):15275-15288. The authors are grateful to King Abdullah City of Science Emad AM, Gamal EGE (2013). Screening for Antimicrobial Activity of Some

Plants from Saudi Folk Medicine. Glob. J. Res. Med. Plants Indig. Med. 2: 2548-2558. 189-197. Mahadani P, Sharma GD, Ghosh SK (2013). Identification of Fazekas AJ, Burgess KS, Kesanakurti PR, Graham SW, Newmaster SG, Ethnomedicinal Plants (Rauvolfioideae: Apocynaceae) through DNA Husband BC, Percy DM, Hajibabaei M, Barrett SC. (2008). Multiple Barcoding from North- east India. Pharmacogn. Mag. 9(35): 255-263. multilocus DNA barcodes from the plastid genome discriminate plant Mandaville JP (2011). Bedouin Ethnobotany: Plant Concepts and Uses in a species equally well. PLoS One. 3(7):e2802. Desert Pastoral World. University of Arizona. Fazekas AJ, Kesanakurti PR, Burgess KS., Percy, D.M., Graham, S.W., Barrett, Marwat SK, Usman K, Shah SS, Anwar N, Ullah I (2012). A review of S.C., et al. (2009). Are plant species inherently harder to discriminate phytochemistry, bioactivities and ethno medicinal uses of Rhazya stricta than animal species using DNA barcoding markers? Mol. Ecol. Resour. 9 Decsne (Apocynaceae). Afr. J. Microbiol. Res. 6(8): 1629-1641. Suppl s1:130-139. Michel CI, Meyer RS, Taveras Y, Molina J (2016). The nuclear internal Feng S, Jiang M, Shi Y, Jiao K, Shen C, Lu J, Ying Q, Wang H (2016). transcribed spacer (ITS2) as a practical plant DNA barcode for herbal Application of the ribosomal DNA ITS2 region of Physalis (Solanaceae): medicines. J. Appl. Res. Med. Aromat. Plants. 3(3): 94-100. DNA barcoding and phylogenetic study. Front. Plant Sci. 7:1047 Middendorf LR, Humphrey PG, Narayanan N, Roemer SC (2001). Ganie SH, Upadhyay P, Das S, Sharma MP (2015). Authentication of Sequencing Technology. 2nd Edition, Biotechnology Set. pp.193-226. Medicinal Plants by DNA Markers. Plant Gene. 4: 83-99. Miller SE (2007). DNA barcoding and the renaissance of taxonomy. Proc. Gilani SA, Kikuchi A, Shinwari ZK, Khattak ZI, Watanabe KN (2007). Natl. Acad. Sci. U. S. A. 104(12): 4775-4776 Phytochemical, pharmacological and ethnobotanical studies of Rhazya Mishra P, Kumar A, Nagireddy A, Mani DN, Shukla AK, Tiwari R, stricta Decne. Phytother. Res. 21(4): 301-307. Sundaresan V (2016). DNA barcoding: an efficient tool to overcome Giudicelli GC, Mäder G, Brandão de Freitas L (2015). Efficiency of ITS authentication challenges in the herbal market. Plant Biotechnol. J. sequences for DNA barcoding in Passiflora (Passifloraceae). Int. J. Mol. 14(1): 8-21. Sci. 16(4): 7289-7303. Molina J, Hazzouri KM, Nickrent D, Geisler M, Meyer RS, Pentony MM, Group CPW, Hollingsworth PM, Forrest LL, Spouge JL, Hajibabaei M, Flowers JM, Pelser P, Barcelona J, Inovejas SA, Uy I (2014). Possible loss Ratnasingham, S., et al. (2009). A DNA Barcode for Land Plants. Proc of the chloroplast genome in the parasitic flowering plant Natl Acad Sci U S A. 106(31):12794-12797 Rafflesialagascae (Rafflesiaceae). Mol. Biol. Evol. 31(4): 793-803. Han, J, Pang X, Liao B, Yao H, Song J, Chen S (2016). An authenticity survey Palmer JD, Herbon LA.(1988). Plant mitochondrial DNA evolves rapidly in of Herbal Medicines from markets in China using DNA barcoding. structure, but slowly in sequence. J. Mol. Evol. 28(1-2): 87-97. Scientific Reports. 6: Article No. 18723. Pečnikar Ž F , Buzan EV (2014). 20 years since the introduction of DNA Hebert PD, Cywinska A, Ball SL (2003). Biological Identifications through barcoding: from theory to application. J. Appl. Genet. 55(1): 43-52. DNA Barcodes. Proc. Biol. Sci. 270(1512): 313-321. Sass C, Little DP, Stevenson DW, Specht CD (2007). DNA barcoding in the Hebert PD, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004). Ten cycadales: testing the potential of proposed barcoding markers for Species in One: DNA Barcoding Reveals Cryptic Species in the Neo- species identification of cycads. PloS One. 2(11): e1154. tropical Skipper Butterfly Astraptesfulgerator. Proc. Natl. Acad. Sci. U S Singh, H. K., Parveen, I., Raghuvanshi, S., &Babbar, S. B. (2012). The loci A. 101(41): 14812-14817. recommended as universal barcodes for plants on the basis of floristic Hollingsworth PM, Graham SW, Little DP (2011). Choosing and using a studies may not work with congeneric species as exemplified by DNA plant DNA barcode. PloS One. 6(5): e19254. barcoding of Dendrobium species. BMC research notes, 5(1), 42. Kane N, Sveinsson S, Dempewolf H, Yang JY, Zhang D, Engels JM, Cronk Q Smith DR, Lee RW (2014). A plastid without a genome: evidence from the (2012). Ultra‐barcoding in cacao (Theobroma spp.; Malvaceae) using non-photosynthetic green algal genus Polytomella. Plant whole chloroplast genomes and nuclear ribosomal DNA. Am. J. Physiol. 164(4): 1812-1819. Bot. 99(2): 320-329. Starr JR, Naczi RF, Chouinard BN (2009). Plant DNA barcodes and species Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton resolution in sedges (Carex, Cyperaceae). Mol. Ecol. Resour. 9(Suppl s1): S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, 151-163. Drummond A (2012). Geneious Basic: an integrated and extendable Sun YL, Kang HM, Han SH, Park YC, Hong SK (2015). Taxonomy and desktop software platform for the organization and analysis of sequence phylogeny of the genus citrus based on the nuclear ribosomal DNA its data. Bioinformatics. 28(12):1647-1649. region sequence. Pakistan J. Bot. 47(1), 95-101. Khan S, Al-Qurainy F, Nadeem M, Tarroum M (2012). Development of Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013). MEGA6: genetic markers for Ochradenus arabicus (Resedaceae), an endemic Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. medicinal plant of Saudi Arabia. Genet. Mol. Res. 11(2): 1300-1308. 30(12): 2725-2729. Khan SA, Baeshen MN, Ramadan HA, Baeshen NA (2017). Emergence of Uncu AT, Frary A, Doganlar S (2015). Cultivar origin and admixture Plastidial Inter- genic Spacers as Sui. DNA Barcodes for Arid Medicinal detection in Turkish olive oils by SNP-based CAPS assays. J. Agric. Food Plant Rhazya stricta. Am. J. Plant Sci. 8(8): 1774-1789. Chem. 63(8):2284-2295 Kress WJ, Erickson DL (2007). A Two-Locus Global DNA Barcode for Land Vassou SL, Kusuma G, Parani M (2015). DNA barcoding for species Plants: The Coding rbcL Gene Complements the Non-Coding trnH-psbA identification from dried and powdered plant parts: a case study with Spacer Region. PLoS One. 2(6) e508. authentication of the raw drug market samples of Sida cordifolia. Gene. Kress WJ, Erickson DL (2008). DNA barcodes: genes, genomics, and 559(1): 86-93. bioinformatics. Proc. Natl. Acad. Sci. U.S.A. 105(8), 2761-2762. Veldman S, Otieno J, Gravendeel, B., van Andel T, de Boer H (2014). Kress WJ, Wurdack KJ, Zimmer EA, Weigt LA, Janzen DH (2005). Use of Conservation of Endangered Wild Harvested Medicinal Plants: Use of DNA barcodes to identify flowering plants. Proc. Natl. Acad. Sci. DNA Barcoding. In: Gurib-Fakim, A., Novel Plant Bio resources: U.S.A. 102(23): 8369-8374. Applications in Food, Medicine and Cosmetics, John Wiley & Sons, Ltd., Lahaye R, van der Bank M, Bogarin D, Warner J, Pupulin F, Gigot G, Maurin Chichester. pp. 81-88. O, Duthoit S, Barraclough TG, Savolainen V (2008). DNA Barcoding the Whitlock BA, Hale AM, Groff PA (2010). Intraspecific inversions pose a Floras of Biodiversity Hotspots. Proc. Natl. Acad. Sci. U. S. A. 105(8): challenge for the trnH-psbA plant DNA barcode. PloS one. 5(7):e11533 2923-2928. Wolfe KH, Li WH, Sharp PM (1987). Rates of nucleotide substitution vary Li M, Au KY, Lam H, Cheng L, But PPH, Shaw PC (2014). Molecular greatly among plant mitochondrial, chloroplast, and nuclear DNAs. Proc. Identification and Cytotoxicity Study of Herbal Medicinal Materials That Natl. Acad. Sci. U. S. A. 84(24): 9054-9058. Are Con- fused by Aristolochia Herbs. Food Chem. 147: 332-339. Wong KL, But PH, Shaw PC (2013). Evaluation of seven DNA barcodes for Liu J, Möller M, Gao LM, Zhang DQ, Li DZ. (2011). DNA barcoding for the differentiating closely related medicinal Gentiana species and their discrimination of Eurasian yews (Taxus L., Taxaceae) and the discovery adulterants. Chin. Med. 8(1):16. of cryptic species. Mol Ecol Resour. 11(1): 89-100. Yao H, Song JY, Ma XY, Liu C, Li Y, Xu HX, Han JP, Duan LS, Chen SL (2009). Madesis, P., Ganopoulos, I., Ralli, P., &Tsaftaris, A. (2012). Barcoding the Identification of Dendrobium species by a candidate DNA barcode major Mediterranean leguminous crops by combining universal sequence: the chloroplast psbA-trnH intergenic chloroplast and nuclear DNA sequence targets. Genet. Mol. Res. 11(3): region. Plantamedica. 75(06): 667-669.

Yu H, Wu K, Song J, Zhu Y, Yao H, Luo, K., et al. (2014). Expedient Zheng SH, Ren WG, Wang ZH, Huang LF (2015). Use of Chloroplast DNA identification of Magnoliaceae species by DNA barcoding. Plant Omics. Barcodes to Identify Osmunda japonica and Its Adulterants. Plant Syst. 7(1): 47-53. Evol. 301(7): 1843-1850. Zahran MA (2010). Climate-Vegetation: Afro-Asian Mediterranean and Red Sea Coastal Lands. Springer Science & Business Media. https://doi.org/10.1007/978-90-481-8595-5 Zhang JQ, Meng SY, Wen J, Rao GY (2015). DNA barcoding of Rhodiola (crassulaceae): a case study on a group of recently diversified medicinal plants from the Qinghai-Tibetan Plateau. 10(3):e0119921.