Microsatellite Loci in the Crested Newt (Triturus Cristatus) and Their Utility in Other Newt Taxa
Total Page：16
File Type：pdf, Size：1020Kb
Conservation Genetics 3: 87–89, 2002. 87 © 2002 Kluwer Academic Publishers. Printed in the Netherlands. Microsatellite loci in the crested newt (Triturus cristatus) and their utility in other newt taxa A.P. Krupa1,R.Jehle1,D.A.Dawson1, L.K. Gentle1, M. Gibbs1, J.W. Arntzen2 &T.Burke1,∗ 1Department of Animal and Plant Sciences, University of Sheffield, Sheffield, S10 2TN, UK; 2National Museum of Natural History, P.O. Box 9517, 2300 RA Leiden, The Netherlands, and Universidade do Porto, Unidade de G´enetica Animal e Conservação, Campus Agr´ario de Vairão, Rua de Monte, Crasto, 4480 Vila do Conde, Portugal (∗Corresponding author: E-mail: T.A.Burke@sheffield.ac.uk) Received 15 June 2001; accepted 17 July 2001 Key words: microsatellites, newts, polymorphism, Triturus Amphibians that breed in ponds are particularly deme- studied here (Arntzen et al. 1999). A hybridisation structured organisms, comprising populations that selection protocol was used to create two genomic can represent unique genetic entities despite their libraries, enriched for tetranucleotides [(CTAA)n and geographical proximity (Waldmann and Tocher 1997). (GATA)n] and dinucleotides [(CA)n and (GA)n], They are therefore highly suitable for addressing respectively, using the protocol of Armour et al. conservation genetic issues, but are as yet relatively (1994) as modified by Gibbs et al. (1997). For underrepresented in this research area (Jehle and PCR analysis, T. cristatus DNA was extracted using Arntzen, in press). The otherwise prominently debated standard phenol/chloroform procedures (Bruford et al. global population decline of amphibians (e.g., Alford 1998). PCR reactions were carried out in 10-µl reac- and Richards 1999), for example, has been little tion volumes containing 10 ng genomic DNA, 1 µM studied from a genetic point of view. of each primer, 0.2 mM of each dNTP, 0.25 units DNA The crested newt, Triturus cristatus, one of polymerase (Thermoprime Plus, Advanced Biotech- the five “large-bodied” species of the genus, is nologies), and between 0.625–1.5 mM MgCl2 in the distributed over large parts of central and northern manufacturer’s buffer (final concentrations 20 mM Europe, but is currently declining in large areas of (NH4)2SO4, 75 mM Tris-HCl pH 9.0, 0.01% (w/v) its original range (Corbett 1989; Beebee 1996). Trit- Tween). Reactions were overlaid with mineral oil and urus cristatus mostly inhabits agricultural landscapes, PCR amplifications were performed in Hybaid Touch- and the current fine-scale patterns of within-species Down thermal cyclers using the following profile: ◦ ◦ ◦ genetic diversity seem likely to reflect human altera- 94 C, 2 min, 1 cycle, then (94 C, 30 s, Tm C, 30 ◦ tions to natural habitats. To test this expectation, we s, 72 C, 30 s) for 39 cycles; Tm varied between 50– are using T. cristatus in western France as a model 56 ◦C depending on the locus. Touchdown PCRs were system to test if gene flow can be predicted from based on the above profile, except that the annealing landscape parameters, as quantified using Geographic temperature was dropped by two degrees from 64– Information System (GIS) technology (Arntzen et al. 56 ◦C after two cycles at each temperature, followed in preparation), so necessitating the development of a by 22 cycles at 55 ◦C. PCR products were run on 6% suitably powerful genetic marker system. In this paper polyacrylamide gels and visualised by staining with we report the development of eight PCR primer pairs silver (Promega). for polymorphic microsatellites in T. cristatus,and Primer pairs were developed for 45 loci, 31 of their cross-utility in other congeneric species. which produced a PCR product for eight tested indi- The small amount of tissue required for PCR-based viduals. Eight microsatellites were polymorphic for genotyping enabled the collection of minimal tissue T. cristatus in western France, and further tests using samples by tail-tip or toe clipping, a procedure that 168 individuals revealed between 3–9 alleles per locus has been shown to be relatively harmless in the species (Table 1). For two primers, Tcri43 and Tcri46, a 88 Table 1. Characterisation of eight polymorphic microsatellite loci for T. cristatus from western France. TD: Touchdown PCR profile, see text. n = 168 individuals analysed Locus Primer sequence (5 –3 ) Annealing temp. Repeat motif Size range of Number Ho He EMBL ◦ name ( C)/MgCl2 of cloned amplification of alleles accession conc. (mM) allele product Tcri13 F: GTGATGGTTGCCAAGC TD/1.5 (GT)36 114–130 4 0.196 0.223 AJ292500 R: GATCCAAGACACAGAATATTTAG Interrupted Tcri27 F: GATCCACTATAGTGAAAATAAATAATAAG 50/1.5 (GAAA)27 246–295 6 0.613 0.553 AJ292517 R: CAAGTTAGTATATGATATGCCTTTG Tcri29 F: CGAGTTGCCCAGACAAG TD/1.2 (TTTC)22 298–330 5 0.536 0.588 AJ292505 R: GATCACATGCCCATGGA (CA)11 Tcri32 F: GAAACTCGTAATCCAGCCCTAA TD/1.5 (TTTC)28 442–474 7 0.476 0.513 AJ292487 R: CAAGCCTCTTGCCTTTGAGT Interrputed Tcri35 F: CCAACTGGTATGGCATTG 55/1.5 (GAAA)32 185–229 5 0.571 0.552 AJ292490 R: GATCACAGAAACTCTGAATATAAGC Interrupted Tcri36 F: GATCATCTGAATCCCTCTG 55/1.5 (GAAA)36 266–282 3 0.470 0.463 AJ292491 R: ATACATTCATGACGTTTGG Interrupted Tcri43 F: CTTTTCACACCACTGGAGCA 50/1.5 (GAAA)30 262–298 9 0.655 0.684 AJ292511 R: GTTTCTATTAGTCTGGCATTGGCTGC Tcri46 F: CAAGTTTCCTCTGAAGCCAG 56/1.5 (TTTC)23 260–296 6 0.238 0.518 AJ292494 R: GTTTCTTGCCTGACAAAGTAATGCTTC Table 2. Cross-utility of the eight microsatellite loci in other newt species. When polymorphic, numbers of alleles are given; +/−: amplification but weak PCR product or polymorphism unresolved; −: no amplification. n = 11–15 for all Triturus species, n = 5 for Euproctus platycephalus Tcri13 Tcri27 Tcri29 Tcri32 Tcri35 Tcri36 Tcri43 Tcri46 T. karelinii 22534279 T. carnifex +/−+/−+/−+/− 6644 T. dobrogicus +/−+/−+/−+/− 4346 ∗ T. marmoratus +/− 6 +/− 66+/− 96 T. pygmaeus +/− 5 +/− 4425− T. alpestris +/−−−−+/−− − − T. vulgaris −−−−+/−− − +/− Euproctus platycephalus −−−−−−−− ∗For detailed data on polymorphism in T. marmoratus see Jehle et al. (2001). “pigtail” (having the sequence GTTTCT) was added to Cross-specific amplification tests revealed that the 5 end of one of each pair in order to achieve PCR most of the loci are usefully polymorphic in all large- products with minimal and consistent stutter bands bodied species of the genus, albeit often with lower (Brownstein et al. 1996). Tcri46 showed a significant variability (Table 2). However, only two loci showed deficiency in heterozygotes, which was probably due some, as yet not fully resolved, polymorphism for to the presence of null alleles (Jehle et al. 2001). the phylogenetically more distant T. alpestris and T. For routine typing, primers were labelled with vulgaris, and no amplification products were observed fluorescent dyes and run on an ABI 377 auto- for a member of the phylogenetically close genus mated sequencer. Several of the loci presented here Euproctus. have already been used for the species assignment In accordance with the biogeographical history of of morphologically indistinguishable larvae of T. western Europe (Taberlet et al. 1998), we observed a cristatus and T. marmoratus (Jehle et al. 2000), and higher degree of polymorphism in T. cristatus samples to infer the effective sizes of T. cristatus and T. from southern and eastern Europe (unpublished marmoratus populations (Jehle et al. 2001). data). Therefore, some loci that displayed specific 89 but monomorphic PCR products for T. cristatus in Beebee TJC (1996) Ecology and Conservation of Amphibians. western France might be of use for other geograph- Chapman and Hall, London. ical regions. They can be accessed through EMBL Brownstein MJ, Carpten JD, Smith JR (1996) Modification of non-templated nucleotide addition by Taq DNA polymerase: accession numbers AJ292473, AJ292476, AJ292481, Primer modifications that facilitate genotyping. BioTechniques, AJ292482, AJ292497, AJ292503 and AJ292504. 20, 1004–1010. Bruford MW, Hanotte O, Brookfield JFY, Burke T (1998) Multi- locus and single-locus DNA fingerprinting. In: Molecular Genetic Analysis of Populations: A Practical Approach, 2nd edn Acknowledgements (ed. Hoelzel AR), pp. 287–336. IRL Press, Oxford. Corbett K. (1989) The Conservation of European Reptiles and This work was supported by the Natural Environ- Amphibians. Christopher Helm, London. Gibbs M, Dawson DA, McCamley C, Wardle AF, Armour JAL, mental Research Council. During the preparation Burke T (1997) Chicken microsatellite markers isolated from of the manuscript RJ was supported by a Marie libraries enriched for simple tandem repeats. Anim. Genet., 28, Curie fellowship of the EC. Samples from western 401–417. France were collected under the permit 97/204 of Jehle R, Bouma P, Sztatecsny M, Arntzen JW (2000) High aquatic niche overlap in the newts Triturus cristatus and T. marmoratus the Ministere de l’Environment, Paris. The E. platy- (Amphibia, Urodela). Hydrobiologia, 437, 149–155. cephalus samples were kindly provided by R. Lecis, Jehle R, Arntzen JW, Burke T, Krupa A, Hödl W (2001) The annual University of Reading. number of breeding adults and the effective population size of syntopic newts (Triturus cristatus, T. marmoratus). Mol. Ecol., 10, 839–850. Jehle R, Arntzen JW (2001) High variation molecular markers References in amphibian conservation biology. Atti del Terzo Convegno Salvaguardia Anfibi, Edizioni Cogecstre, in press. Alford RA, Richards SJ (1999) Global amphibian declines: a Taberlet P, Fumagalli L, Wust-Saucy A-G, Cosson J-F (1998) problem in applied ecology. Ann. Rev. Ecol. Syst., 30, 133–165. Comparative phylogeography and postglacial colonization routes Armour JAL, Neuman N, Gobert S, Jeffreys AJ (1994) Isolation of in Europe. Mol. Ecol., 7, 353–364. human simple sequence repeat loci by hybridisation selection. Waldman B, Tocher M (1997) Behavioural ecology, genetic Hum. Mol. Genet., 3, 599–605. diversity, and declining amphibian populations. In: Behavioural Arntzen JW, Smithson A, Oldham RS (1999) Marking and tissue Ecology and Conservation Biology (ed. Caro T), pp. 394–448. sampling effects on body condition and survival in the newt Oxford University Press, Oxford. Triturus cristatus. J. Herpetol., 33, 567–576.