DOCSLIB.ORG

For Molecular Biosystems

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
For Molecular Biosystems Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is © The Royal Society of Chemistry 2014 Table S1. The Expression of Genes Involved In HIP-55-knockdown A549 Cells Entrez Representative Gene Fold Gene Ontology Biological Gene Ontology Gene Ontology Gene Title Gene Public ID Symbol change Process Cellular Component Molecular Function intestinal cell (MAK- protein amino acid nucleus, membrane- nucleotide binding, 22858 NM_173041 ICK 0.10 like) kinase phosphorylation bounded organelle magnesium ion binding tandem C2 domains, 123036 NM_152332 TC2N 0.21 nucleus nuclear ATPase, H+ hydrogen ion ATP6V0D transporting, proton-transporting 245972 NM_152565 4.08 proton transport transmembrane transporter 2 lysosomal 38kDa, V0 domain activity subunit d2 SH2 domain 117157 BC022407 SH2D1B 8.03 protein binding containing 1B leucine zipper protein 7798 NM_033631 LUZP1 28.88 nucleus 1 multicellular organismal 25914 NM_173630 RTTN rotatin 4.51 development, determination of binding left/right symmetry F-box and leucine- ubiquitin-protein ligase 26223 NM_012159 FBXL21 4.28 protein ubiquitination ubiquitin ligase complex rich repeat protein 21 activity carboxypeptidase 130749 NM_173077 CPO carboxypeptidase O 0.17 proteolysis extracellular region activity,metallopeptidase activity,hydrolase activity beta-1,3-N- B3GALNT Golgi galactosyltransferase 148789 NM_152490 acetylgalactosaminylt 3.56 protein amino acid glycosylation 2 apparatus,membrane activity ransferase 2 carbohydrate metabolic glycerol kinase activity, glycerol kinase 5 256356 NM_152776 GK5 0.12 process,glycerol metabolic ATP binding ,transferase (putative) process activity, protein serine/threonine cell death,peptidyl-serine 146057 BC041876 TTBK2 tau tubulin kinase 2 33.39 intermediate filament kinase activity,ATP phosphorylation binding,transferase activity vacuolar protein phosphoserine 51699 BC032462 VPS29 sorting 29 homolog 0.29 protein transport cytoplasm,membrane phosphatase activity,zinc (S. cerevisiae) ion binding complement serine-type endopeptidase 717 BC029781 C2 0.10 proteolysis, immune response extracellular region component 2 activity,hydrolase activity zinc finger protein DNA binding,zinc ion 346157 BG722372 ZNF391 32.52 transcription nucleus 391 binding C-steroid hormone biosynthetic mitochondrion,endoplasmi steroid -alpha- 1586 AK094106 CYP17A1 0.04 process c reticulum monooxygenase activity Entrez Representative Gene Fold Gene Ontology Biological Gene Ontology Gene Ontology Gene Title Gene Public ID Symbol change Process Cellular Component Molecular Function visual perception,calcium- 149461 BC030524 CLDN19 claudin 19 0.21 tight junction magnesium ion binding independent cell-cell adhesion cytidine monophosphate-N- electron carrier acetylneuraminic activity,oxidoreductase acid hydroxylase 8418 BC022302 CMAH 0.11 oxidation reduction cytoplasm activity,CMP-N- (CMP-N- acetylneuraminate acetylneuraminate monooxygenase activity monooxygenase) pseudogene kelch-like 14 57565 BC021267 KLHL14 48.50 protein binding (Drosophila) prostaglandin- endoperoxide synthase 2 cell motion, regulation of blood nucleus,endoplasmic peroxidase activity,heme 5743 AY151286 PTGS2 0.32 (prostaglandin G/H pressure reticulum,microsome binding synthase and cyclooxygenase) WD repeat domain 144406 BC036233 WDR66 12.28 66 potassium voltage- phosphorelay,rtranscription,,sign 27133 BC043409 KCNH5 31.80 membrane potassium channel activity gated channel al transduction zinc finger protein nucleic acid binding,zinc 283933 BC036762 ZNF843 5.79 intracellular 843 ion binding prostaglandin F prostaglandin F receptor 5737 BC035694 PTGFR 3.59 parturition plasma membrane receptor (FP) activity acrosomal protein binding,hydrogen ATP6V0A lysosomal V0 subunit immune response, proton 23545 BC0223, 3.88 vesicle,endosome,plasma ion transmembrane 2 a2 transport membrane transporter activity WD repeat domain 57728 BC032578 WDR19 0.29 vesicle-mediated transport protein binding 19 chromatin structural cell cycle ,nuclear mRNA condensed chromosome binding,microtubule motor 8243 BC046147 SMC1A maintenance of 14.38 splicing,DNA repair kinetochore,cytoplasm, activity chromosomes 1A hypoxia inducible DNA binding,signal 64344 AK021881 HIF3A 0.30 regulation of transcription nucleus,cytoplasm factor 3 transducer activity Entrez Representative Gene Fold Gene Ontology Biological Gene Ontology Gene Ontology Gene Title Gene Public ID Symbol change Process Cellular Component Molecular Function eukaryotic translation eukaryotic translation translation,interspecies translation initiation factor 1974 BC039344 EIF4A2 initiation factor 4A, 0.27 initiation factor 4F interaction between organisms activity,helicase activity isoform 2 complex transcription, anti- 5081 AI250939 PAX7 paired box 7 0.30 apoptosis,multicellular nucleus transcription factor activity organismal development Eukaryotic eukaryotic translation translation elongation factor 1915 BE622780 EEF1A1 translation elongation 4.67 translational elongation elongation factor 1 activity,GTPase activity factor 1 alpha 1 complex phospholipase D1, Ras protein signal Golgi 5337 AK091897 PLD1 phosphatidylcholine- 0.03 transduction,lipid catabolic phospholipase D activity membrane,cytoplasm specific process KIDINS22 kinase D-interacting 57498 AA992480 0.16 intracellular signaling cascade cytosol ,membrane kinase activity 0 substrate, 220kDa extracellular acute-phase response,cell region,fibrinogen collagen binding,peptidase 2335 W73431 FN1 fibronectin 1 3.50 adhesion complex,apical plasma activator activity membrane high mobility group regulation of transcription, DNA binding,protein 8091 AI990940 HMGA2 0.21 chromosome AT-hook 2 cell cycle, binding sensory perception of actin binding,receptor diaphanous homolog 1729 AL832054 DIAPH1 3.37 sound,actin cytoskeleton cytoskeleton binding,Rho GTPase 1 (Drosophila) organization binding Asparagine-linked glycosylation 5, dolichyl-phosphate protein glycosylation, endoplasmic reticulum oligosaccharyl transferase 29880 BG94,96 ALG5 beta- 0.30 determination of left/right membrane activity glucosyltransferase symmetry homolog (S. cerevisiae) solute carrier family 8 (sodium/calcium Heart contraction, regulation of plasma membraneT- calcium:sodium antiporter 6546 Y12885 SLC8A1 3.21 exchanger), member ion transport tubule,sarcolemma activity 1 Rho guanine ARHGEF regulation of Rho protein signal Rho guanyl-nucleotide 8874 AL831814 nucleotide exchange 4.18 nucleolus,cytosol 7 transduction exchange factor activity factor (GEF) 7 cyclic nucleotide nucleotide binding,ion ion transport,sensory perception 1262 BC040277 CNGA4 gated channel alpha 0.14 membrane channel activity,cAMP of smell 4 binding zinc finger protein DNA binding,zinc ion 163051 BI830259 ZNF709 4.92 transcription nucleus 709 binding Entrez Representative Gene Fold Gene Ontology Biological Gene Ontology Gene Ontology Gene Title Gene Public ID Symbol change Process Cellular Component Molecular Function olfactory receptor, 162998 AK095468 OR7D2 family 7, subfamily D, 5.79 sensory perception of smell plasma membrane olfactory receptor activity member 2 two-component sensor glucose metabolic pyruvate activity,protein histidine process,signal 5166 AL832708 PDK4 dehydrogenase 0.15 mitochondrial kinase activity,pyruvate transduction,peptidyl-histidine kinase, isozyme 4 dehydrogenase (acetyl- phosphorylation transferring) kinase activity ubiquitin specific ubiquitin-dependent protein ubiquitin thiolesterase 25862 AL049937 USP49 21.64 peptidase 49 catabolic process activity,zinc ion binding NADSYN nitrogen compound metabolic NAD+ synthase (glutamine- 55191 BF,1535 NAD synthetase 1 0.09 cytosol 1 process hydrolyzing) activity serpin peptidase inhibitor, clade E SERPINE chronological cell aging,blood extracellular serine-type endopeptidase 5054 BC020765 (nexin, plasminogen 4.46 1 coagulation,angiogenesis region,plasma membrane inhibitor activity activator inhibitor type 1), member 1 Mannosyl (alpha-1,3- )-glycoprotein beta- 1,4-N- carbohydrate metabolic extracellular region,Golgi 11320 BC031487 MGAT4A 3.07 transferring glycosyl groups acetylglucosaminyltr process,9N-glycan processing apparatus,membrane ansferase, isozyme A transcription factor 81931 BC020837 ZNF93 zinc finger protein 93 0.08 transcription nucleus activity,zinc ion binding nuclear receptor transcription factor 9970 BC030972 NR1I3 subfamily 1, group I, 9.67 transcription nucleus activity,steroid hormone member 3 receptor activity LIM and senescent plasma membrane,focal protein binding,zinc ion 3987 BC015843 LIMS1 cell antigen-like 15.36 cell aging adhesion binding domains 1 DNA binding,protein ataxia telangiectasia DNA repair,female gamete nucleus,nucleoplasm ,spi 472 BG623786 ATM 0.04 serine/threonine kinase mutated generation,brain development ndle,cytoplasmic vesicle activity arginine-glutamic transcription factor transcription,multicellular 473 AI920976 RERE acid dipeptide (RE) 14.14 nucleus activity,protein binding,zinc organismal development repeats ion binding 3728 NM_021991 JUP junction plakoglobin 0.29 cell adhesion cytoplasm,cytoplasm cytoskeletal protein binding cadherin 1, type 1, E- cell adhesion,regulation of Golgi apparatus,plasma 999 NM_,4360 CDH1 0.27 calcium ion binding cadherin (epithelial) caspase activity membrane Entrez Representative Gene Fold Gene Ontology Biological Gene Ontology Gene Ontology Gene Title Gene Public ID Symbol change Process Cellular Component Molecular Function insulin-like growth cell adhesion,negative insulin-like growth factor 3490 NM_,1553 IGFBP7 factor binding protein
Load more

Recommended publications
  • Supplementary Information
    doi: 10.1038/nature08795 SUPPLEMENTARY INFORMATION Supplementary Discussion Population naming In some contexts, the indigenous hunter-gatherer and pastoralist peoples of southern Africa are referred to collectively as the Khoisan (Khoi-San) or more recently Khoesan (Khoe-San) people. This grouping is based on the unique linguistic use of click-consonants1. Many names, often country-specific, have been used by Bantu pastoralists and European settlers to describe the hunter-gatherers, including San, Saan, Sonqua, Soaqua, Souqua, Sanqua, Kwankhala, Basarwa, Batwa, Abathwa, Baroa, Bushmen, Bossiesmans, Bosjemans, or Bosquimanos. In addition, group-specific names such as !Kung and Khwe are often used for the broader population. The two most commonly used names, “San” and “Bushmen”, have both been associated with much controversy due to derogatory connotations2. “San” has become the more popular term used in Western literature, although “Bushmen” is arguably the more commonly recognized term within the communities. Since they have no collective name for themselves, the term Bushmen was selected for use in this paper as the term most familiar to the participants themselves. Regarding identification of individuals The five men identified in this study have all elected to have their identity made public knowledge. Thus we present two complete personal genomes (KB1 and ABT), a low-coverage personal genome (NB1), and personal exomes for all five men. On a scientific level, identification allows for current and future correlation of genetic data with demographic and medical histories. On a social level, identification allows for maximizing community benefit. For !Gubi, G/aq’o, D#kgao and !Aî, their name represents not only themselves, but importantly their extended family unit and a way of life severely under threat.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Sequence Overlap Between Autosomal and Sex-Linked Probes on the Illumina Humanmethylation27 Microarray
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Genomics 97 (2011) 214–222 Contents lists available at ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno Sequence overlap between autosomal and sex-linked probes on the Illumina HumanMethylation27 microarray Yi-an Chen a,b, Sanaa Choufani a, Jose Carlos Ferreira a,b, Daria Grafodatskaya a, Darci T. Butcher a, Rosanna Weksberg a,b,⁎ a Program in Genetics and Genome Biology, Hospital for Sick Children Research Institute, Toronto, Ontario, Canada b Institute of Medical Science, University of Toronto, Toronto, Ontario, Canada article info abstract Article history: The Illumina Infinium HumanMethylation27 BeadChip (Illumina 27k) microarray is a high-throughput Received 12 August 2010 platform capable of interrogating the human DNA methylome. In a search for autosomal sex-specific DNA Accepted 18 December 2010 methylation using this microarray, we discovered autosomal CpG loci showing significant methylation Available online 4 January 2011 differences between the sexes. However, we found that the majority of these probes cross-reacted with sequences from sex chromosomes. Moreover, we determined that 6–10% of the microarray probes are non- Keywords: specific and map to highly homologous genomic sequences. Using probes targeting different CpGs that are Illumina Infinium HumanMethylation 27 BeadChip exact duplicates of each other, we investigated the precision of these repeat measurements and concluded Non-specific cross-reactive probe that the overall precision of this microarray is excellent. In addition, we identified a small number of probes Sex-specific DNA methylation targeting CpGs that include single-nucleotide polymorphisms.
    [Show full text]
  • DNA Methylation Patterns from Peripheral Blood Separate Coronary Artery Disease Patients with and Without Heart Failure
    ESC HEART FAILURE ORIGINAL RESEARCH ARTICLE ESC Heart Failure 2020; 7: 2468–2478 Published online 2 July 2020 in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/ehf2.12810 DNA methylation patterns from peripheral blood separate coronary artery disease patients with and without heart failure Chris R. Bain1,2,3*†† , Mark Ziemann1,3,4,5††, Antony Kaspi1,3,4, Abdul Waheed Khan1, Rachael Taylor1, Hugh Trahair1, Ishant Khurana1,3,4, Harikrishnan Kaipananickal1,3,4,6, Sophie Wallace2,3, Assam El-Osta1,3,4,7,8, Paul S. Myles2,3 and Kiymet Bozaoglu1,9 1Baker IDI Heart and Diabetes Institute, Melbourne, VIC, Australia; 2Department of Anaesthesiology and Perioperative Medicine, The Alfred Hospital and Monash University, The Alfred Centre, Level 6, 99 Commercial Road, Melbourne, VIC 3004, Australia; 3Central Clinical School, Faculty of Medicine, Nursing and Health Sciences, Monash University, Melbourne, VIC, Australia; 4Epigenetics in Human Health and Disease Laboratory, Department of Diabetes, Central Clinical School, Monash University, Melbourne, VIC, Australia; 5School of Life and Environmental Sciences, Faculty of Science, Engineering and Built Environment, Deakin University, Melbourne, VIC, Australia; 6Department of Clinical Pathology, University of Melbourne, Melbourne, VIC, Australia; 7Hong Kong Institute of Diabetes and Obesity, The Chinese University of Hong Kong, Shatin, Hong Kong SAR; 8Faculty of Health, Department of Technology, Biomedical Laboratory Science, University College Copenhagen, Copenhagen, Denmark; 9Murdoch Children’s Research Institute and Department of Paediatrics, University of Melbourne, Melbourne, VIC, Australia Abstract Aims Natriuretic peptides are useful for diagnosis and prognostication of heart failure of any cause. Now, research aims to discover novel biomarkers that will more specifically define the heart failure phenotype.
    [Show full text]
  • Dual Proteome-Scale Networks Reveal Cell-Specific Remodeling of the Human Interactome
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Dual Proteome-scale Networks Reveal Cell-specific Remodeling of the Human Interactome Edward L. Huttlin1*, Raphael J. Bruckner1,3, Jose Navarrete-Perea1, Joe R. Cannon1,4, Kurt Baltier1,5, Fana Gebreab1, Melanie P. Gygi1, Alexandra Thornock1, Gabriela Zarraga1,6, Stanley Tam1,7, John Szpyt1, Alexandra Panov1, Hannah Parzen1,8, Sipei Fu1, Arvene Golbazi1, Eila Maenpaa1, Keegan Stricker1, Sanjukta Guha Thakurta1, Ramin Rad1, Joshua Pan2, David P. Nusinow1, Joao A. Paulo1, Devin K. Schweppe1, Laura Pontano Vaites1, J. Wade Harper1*, Steven P. Gygi1*# 1Department of Cell Biology, Harvard Medical School, Boston, MA, 02115, USA. 2Broad Institute, Cambridge, MA, 02142, USA. 3Present address: ICCB-Longwood Screening Facility, Harvard Medical School, Boston, MA, 02115, USA. 4Present address: Merck, West Point, PA, 19486, USA. 5Present address: IQ Proteomics, Cambridge, MA, 02139, USA. 6Present address: Vor Biopharma, Cambridge, MA, 02142, USA. 7Present address: Rubius Therapeutics, Cambridge, MA, 02139, USA. 8Present address: RPS North America, South Kingstown, RI, 02879, USA. *Correspondence: [email protected] (E.L.H.), [email protected] (J.W.H.), [email protected] (S.P.G.) #Lead Contact: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • RNA Epigenetics: Fine-Tuning Chromatin Plasticity and Transcriptional Regulation, and the Implications in Human Diseases
    G C A T T A C G G C A T genes Review RNA Epigenetics: Fine-Tuning Chromatin Plasticity and Transcriptional Regulation, and the Implications in Human Diseases Amber Willbanks, Shaun Wood and Jason X. Cheng * Department of Pathology, Hematopathology Section, University of Chicago, Chicago, IL 60637, USA; [email protected] (A.W.); [email protected] (S.W.) * Correspondence: [email protected] Abstract: Chromatin structure plays an essential role in eukaryotic gene expression and cell identity. Traditionally, DNA and histone modifications have been the focus of chromatin regulation; however, recent molecular and imaging studies have revealed an intimate connection between RNA epigenetics and chromatin structure. Accumulating evidence suggests that RNA serves as the interplay between chromatin and the transcription and splicing machineries within the cell. Additionally, epigenetic modifications of nascent RNAs fine-tune these interactions to regulate gene expression at the co- and post-transcriptional levels in normal cell development and human diseases. This review will provide an overview of recent advances in the emerging field of RNA epigenetics, specifically the role of RNA modifications and RNA modifying proteins in chromatin remodeling, transcription activation and RNA processing, as well as translational implications in human diseases. Keywords: 5’ cap (5’ cap); 7-methylguanosine (m7G); R-loops; N6-methyladenosine (m6A); RNA editing; A-to-I; C-to-U; 2’-O-methylation (Nm); 5-methylcytosine (m5C); NOL1/NOP2/sun domain Citation: Willbanks, A.; Wood, S.; (NSUN); MYC Cheng, J.X. RNA Epigenetics: Fine-Tuning Chromatin Plasticity and Transcriptional Regulation, and the Implications in Human Diseases. Genes 2021, 12, 627.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Multivariate Meta-Analysis of Differential Principal Components Underlying Human Primed and Naive-Like Pluripotent States
    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347666; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. October 20, 2020 To: bioRxiv Multivariate Meta-Analysis of Differential Principal Components underlying Human Primed and Naive-like Pluripotent States Kory R. Johnson1*, Barbara S. Mallon2, Yang C. Fann1, and Kevin G. Chen2*, 1Intramural IT and Bioinformatics Program, 2NIH Stem Cell Unit, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, Maryland 20892, USA Keywords: human pluripotent stem cells; naive pluripotency, meta-analysis, principal component analysis, t-SNE, consensus clustering *Correspondence to: Dr. Kory R. Johnson ([email protected]) Dr. Kevin G. Chen ([email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.20.347666; this version posted October 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. This article is a US Government work. It is not subject to copyright under 17 USC 105 and is also made available for use under a CC0 license. ABSTRACT The ground or naive pluripotent state of human pluripotent stem cells (hPSCs), which was initially established in mouse embryonic stem cells (mESCs), is an emerging and tentative concept. To verify this important concept in hPSCs, we performed a multivariate meta-analysis of major hPSC datasets via the combined analytic powers of percentile normalization, principal component analysis (PCA), t-distributed stochastic neighbor embedding (t-SNE), and SC3 consensus clustering.
    [Show full text]
  • Structural Basis for Disruption of Claudin Assembly in Tight Junctions
    www.nature.com/scientificreports OPEN Structural basis for disruption of claudin assembly in tight junctions by an enterotoxin Received: 11 May 2016 Takehiro Shinoda1,2, Naoko Shinya1,2, Kaori Ito1,2, Noboru Ohsawa1,2, Takaho Terada1,3, Accepted: 01 September 2016 Kunio Hirata4, Yoshiaki Kawano4, Masaki Yamamoto4, Tomomi Kimura-Someya1,2, Published: 20 September 2016 Shigeyuki Yokoyama1,3 & Mikako Shirouzu1,2 The food-poisoning bacterium Clostridium perfringens produces an enterotoxin (~35 kDa) that specifically targets human claudin-4, among the 26 human claudin proteins, and causes diarrhea by fluid accumulation in the intestinal cavity. The C-terminal domain of the Clostridium perfringens enterotoxin (C-CPE, ~15 kDa) binds tightly to claudin-4, and disrupts the intestinal tight junction barriers. In this study, we determined the 3.5-Å resolution crystal structure of the cell-free synthesized human claudin- 4•C-CPE complex, which is significantly different from the structure of the off-target complex of an engineered C-CPE with mouse claudin-19. The claudin-4•C-CPE complex structure demonstrated the mechanism underlying claudin assembly disruption. A comparison of the present C-CPE-bound structure of claudin-4 with the enterotoxin-free claudin-15 structure revealed sophisticated C-CPE- induced conformation changes of the extracellular segments, induced on the foundation of the rigid four-transmembrane-helix bundle structure. These conformation changes provide a mechanistic model for the disruption of the lateral assembly of claudin molecules. Furthermore, the present novel structural mechanism for selecting a specific member of the claudin family can be used as the foundation to develop novel medically important technologies to selectively regulate the tight junctions formed by claudin family members in different organs.
    [Show full text]
  • Glucose-Induced Changes in Gene Expression in Human Pancreatic Islets: Causes Or Consequences of Chronic Hyperglycemia
    Diabetes Volume 66, December 2017 3013 Glucose-Induced Changes in Gene Expression in Human Pancreatic Islets: Causes or Consequences of Chronic Hyperglycemia Emilia Ottosson-Laakso,1 Ulrika Krus,1 Petter Storm,1 Rashmi B. Prasad,1 Nikolay Oskolkov,1 Emma Ahlqvist,1 João Fadista,2 Ola Hansson,1 Leif Groop,1,3 and Petter Vikman1 Diabetes 2017;66:3013–3028 | https://doi.org/10.2337/db17-0311 Dysregulation of gene expression in islets from patients In patients with type 2 diabetes (T2D), islet function de- with type 2 diabetes (T2D) might be causally involved clines progressively. Although the initial pathogenic trigger in the development of hyperglycemia, or it could develop of impaired b-cell function is still unknown, elevated glu- as a consequence of hyperglycemia (i.e., glucotoxicity). cose levels are known to further aggravate b-cell function, a To separate the genes that could be causally involved condition referred to as glucotoxicity, which can stimulate in pathogenesis from those likely to be secondary to hy- apoptosis and lead to reduced b-cell mass (1–5). Prolonged perglycemia, we exposed islets from human donors to exposure to hyperglycemia also can induce endoplasmic re- ISLET STUDIES normal or high glucose concentrations for 24 h and ana- ticulum (ER) stress and production of reactive oxygen spe- fi lyzed gene expression. We compared these ndings with cies (6), which can further impair islet function and thereby gene expression in islets from donors with normal glucose the ability of islets to secrete the insulin needed to meet the tolerance and hyperglycemia (including T2D). The genes increased demands imposed by insulin resistance and obe- whose expression changed in the same direction after sity (7).
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Essential Genes and Their Role in Autism Spectrum Disorder
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2017 Essential Genes And Their Role In Autism Spectrum Disorder Xiao Ji University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Bioinformatics Commons, and the Genetics Commons Recommended Citation Ji, Xiao, "Essential Genes And Their Role In Autism Spectrum Disorder" (2017). Publicly Accessible Penn Dissertations. 2369. https://repository.upenn.edu/edissertations/2369 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2369 For more information, please contact [email protected]. Essential Genes And Their Role In Autism Spectrum Disorder Abstract Essential genes (EGs) play central roles in fundamental cellular processes and are required for the survival of an organism. EGs are enriched for human disease genes and are under strong purifying selection. This intolerance to deleterious mutations, commonly observed haploinsufficiency and the importance of EGs in pre- and postnatal development suggests a possible cumulative effect of deleterious variants in EGs on complex neurodevelopmental disorders. Autism spectrum disorder (ASD) is a heterogeneous, highly heritable neurodevelopmental syndrome characterized by impaired social interaction, communication and repetitive behavior. More and more genetic evidence points to a polygenic model of ASD and it is estimated that hundreds of genes contribute to ASD. The central question addressed in this dissertation is whether genes with a strong effect on survival and fitness (i.e. EGs) play a specific oler in ASD risk. I compiled a comprehensive catalog of 3,915 mammalian EGs by combining human orthologs of lethal genes in knockout mice and genes responsible for cell-based essentiality.
    [Show full text]