UCLA UCLA Electronic Theses and Dissertations
Title Dissecting the Regulatory Mechanism of the Mammalian Microtubule-Severing Protein Katanin in Mitosis
Permalink https://escholarship.org/uc/item/9zs774gv
Author Cheung, Chingnam
Publication Date 2016
Peer reviewed|Thesis/dissertation
eScholarship.org Powered by the California Digital Library University of California
UNIVERSITY OF CALIFORNIA
Los Angeles
Dissecting the Regulatory Mechanism of the Mammalian Microtubule-Severing
Protein Katanin in Mitosis
A Dissertation submitted in partial satisfaction of the requirements for the degree
Doctor of Philosophy
in Biochemistry and Molecular Biology
by
Chingnam Cheung
2016
© Copyright by
Chingnam Cheung
2016
ABSTRACT OF THE DISSERTATION
Dissecting the Regulatory Mechanism of the Mammalian Microtubule- Severing Protein Katanin in Mitosis
By
Chingnam Cheung
Doctor of Philosophy in Biochemistry and Molecular Biology
University of California, Los Angeles
Professor Jorge Torres, Chair
The Katanin family of microtubule-severing enzymes is critical for remodeling microtubule-based structures that influence cell division, motility, morphogenesis and signaling. Katanin is composed of a catalytic p60 subunit (A subunit, KATNA1) and a regulatory p80 subunit (B subunit, KATNB1). The mammalian genome also encodes two additional A-like subunits (KATNAL1 and KATNAL2) and one additional B-like subunit (KATNBL1) that have remained poorly characterized.
To better understand the human Katanins and more broadly the mechanisms controlling mammalian microtubule-severing, we first analyzed the human Katanin interactome (Katan-ome) through biochemical tandem affinity purifications and mass proteomic analyses. This revealed that all Katanin subunits could reciprocally co-purify with each other, with the exception of KATNAL2 that only purified with KATNA1. These interactions were verified by in vitro and in cell reciprocal co-immunoprecipitations, with
ii the exception of the KATNAL2-KATNA1 interaction. Analysis of the cell cycle subcellular localization of all Katanin subunits showed that KATNA1, KATNAL1 and
KATNB1 localized to the cytoplasm during interphase and to the spindle poles during mitosis. Surprisingly, KATNBL1 localized to the nucleus during interphase (dependent on an N-terminal nuclear localization signal) and to the spindle poles during mitosis. In cell microtubule-severing assays with each A subunit revealed that unlike KATNA1 and
KATNAL1, which showed microtubule-severing activity, KATNAL2 lacked detectable microtubule-severing activity. Interestingly, in vitro microtubule-severing assays showed that full-length KATNBL1 regulated KATNAL1 microtubule-severing activity in a concentration dependent manner. Furthermore, KATNB1 was able to compete the
KATNBL1-KATNA1 and KATNBL1-KATNAL1 interactions.
These results indicate that KATNBL1 is a regulator of microtubule-severing activity and that it cooperates/competes with KATNB1 for binding to KATNA1 and
KATNAL1 and that KATNB1 and KATNBL1 together regulate Katanin A subunit microtubule-severing activity.
iii The dissertation of Chingnam Cheung is approved.
Margot E. Quinlan
Kent L. Hill
Jorge Torres, Committee Chair
University of California, Los Angeles
2016
iv Contents
Abstract...... iii
List of Figures...... viii
List of Supplemental Figures and Tables...... viii
Abbreviations...... ix
Acknowledgements...... xi
Curriculum Vitae...... xii
Chapter 1. Background
1.1 Microtubules is essential in many cellular processes, especially in cell division...... 1
1.2 Molecular structures and properties of microtubules...... 1
1.3 Microtubule structures in cell division...... 4
1.4 Microtubule dynamic is regulated by the MAP proteins...... 5
1.5 Structures of microtubule-severing proteins...... 6
1.6 Katanin is a heterodimer consists of a catalytic subunit and a regulatory subunit...... 11
1.7 The functions of Katanin in cell division are species-specific...... 12
1.8 Katanin is subject to multiple models of regulations in cell division...... 13
Chapter 2. Introduction and Rationale...... 16
Chapter 3. Results
3.1 Defining the mammalian Katanin interactome (Katan-ome)...... 20
3.2 Validation of Katanin subunit interactions...... 23
3.3 KATNBL1 has dynamic cell cycle dependent subcellular localization.....26
3.4 Regulation of Katanin microtubule-severing activity by KATNBL1...... 28
v 3.5 Sequestration of KATNBL1 to the nucleus is dependent on a nuclear localization signal...... 30
3.6 KATNB1 completes with KATNBL1 for binding to KATNA1 and KATNAL1...... 33
Chapter 4 – Discussion and Conclusions...... 35
Chapter 5 – Future Directions...... 39
Chapter 6 – Materials and Methods
6.1 Cell culture and cell cycle synchronization...... 41
6.2 Plasmids, mutation and generation of LAP-tagged Katanin inducible stable cell lines...... 41
6.3 Immunoprecipitations...... 42
6.4 In vitro binding assays...... 43
6.5 Tandem affinity purification of Katanins...... 43
6.6 In gel protein digestions...... 44
6.7 Nano-liquid chromatography with tandem mass spectrometry (LC-MS/MS) analysis...... 45
6.8 Experimental design and statistical rational...... 45
6.9 Immunofluorescence microscopy ...... 46
6.10 Preparation of GOPTS-PEG-biotin functional coverslips ...... 47
6.11 Katanin microtubule-severing TIRF assays...... 48
6.12 Recombinant protein expression and purification...... 49
6.13 Antibodies ...... 50
Chapter 7 – Supplemental Figures and Tables ...... 51
6.1 References/Bibliography...... 72
vi List of Figures
Figure 1.1 – Molecular structures and properties of microtubules...... 3
Figure 1.2 - Structures and mechanisms of microtubule-severing proteins...... 9
Figure 3.1 - The mammalian Katanin interactome (Katan-ome)...... 22
Figure 3.2 - The Katanin-Katanin pairwise binding assays...... 25
Figure 3.3 - Katanin subunit cell cycle subcellular localization...... 27
Figure. 3.4 - KATNBL1 regulates Katanin microtubule-severing activity...... 29
Figure 3.5 - KATNBL1 localization to the nucleus during interphase requires an N- terminal nuclear localization sequence...... 32
Figure 3.6 - KATNB1 competes the KATNA1-KATNBL1 and KATNAL1- KATNBL1 interactions...... 34
List of Supplemental Figures and Tables
Figure S1 - Katanin subunit interactions...... 51
Figure S2 - KATNAL2 does not display microtubule-severing activity...... 52
Figure S3 - Quantification of time-lapse microtubule TIRF fluorescence signals in the presence (or absence) of various Katanin subunits...... 53
Figure S4 - KATNBL1 localization to the nucleus duringinterphase requires an N- terminal nuclear localization sequence...... 54
Table S1 - Summary of the Katanin interactome (Katan-ome) ...... 55
Table S2 - Spectra of one peptide IDs in the Katan-ome...... 60
Table S3 - List of primers used to mutate KATNBL1...... 71
vii Abbreviations
+TIPs Plus-end tracking proteins 2D-LC Two-dimensional liquid chromatography AAA ATPase associated with various cellular activities AD-HSP Autosomal dominant hereditary spastic paraplegia CC Coiled-coil CDK1 Cyclin-dependent kinase 1 CDK2 Cyclin-dependent kinase 2 CDK5RAP2 Cyclin-dependent kinase 5 regulatory subunit associated protein 2 CEP295 Centrosomal protein 295 CEP97 Centrosomal protein 97 CIN Chromosome instability CLIP-170 Cytoplasmic linker protein-170 Con80 p80 C-terminal domain Cryo-EM Cryo-electron microscopy Ctb9 Cullin three binding protein 9 Ctrl Control Cul-3 Cullin-3 DDB1 Damage-specific DNA binding protein 1 Dm-Kat60 Drosophila KATNA1 DYRK2 Dual specificity tyrosine-phosphorylation-regulated kinase 2 EB1 End binding 1 EDD E3 identified by differential display EDVP E3 ligase complex containing EDD, DDB1 and VPRBP proteins EGFP Enhanced green fluorescent protein ESCRT-III Endosomal sorting complex required for transport-III GAPDH Glyceraldehyde 3-phosphate dehydrogenase GDP Guanosine diphosphate GFP Green fluorescent protein GST Glutathione S-transferase GTP Guanosine triphosphate HBD Four-helix bundle domain KATNA1 Katanin A1 KATNAL1 Katanin A-like 1 KATNAL2 Katanin A-like 2 KATNB1 Katanin B1 KATNBL1 Katanin B-like 1 KLHDC5 Kelch domain containing 5 LAP Localization and affinity purification LAPSER1 Leucine (L), alanine (A), proline (P), serine (S), glutamate (E) and arginine (R)-rich protein LZTS2 Leucine zipper putative tumor suppressor 2 MAP Microtubule-associated protein MCAK Mitotic centromere-associated kinesin MEI-1 Meiotic spindle formation protein-1
viii MEI-2 Meiotic spindle formation protein-2 MIM MIT interacting motifs MIT Microtubule-interacting and trafficking MS/MS Tandem mass spectrometry MTOC Microtubule-organizing center NBD Nucleotide-binding domain NDEL1 Nuclear distribution E-like 1 NLS Nuclear localization signal P-loop Phosphate-binding loop P60 KATNA1 P80 KATNB1 PCM Pericentriolar material PCM1 Pericentriolar material 1 PLK2 Polo-like kinase 2 PPFP-1 PAX8-PPARγ fusion protein Pro-rich Proline-rich SAXS Small-angle X-ray scattering SDS-PAGE Sodium dodecyl sulfate-polyacrylamide gel electrophoresis STARD9-MD StAR-related lipid transfer domain containing 9-motor domain TIRFM Total internal reflection fluorescence microscopy VPRBP Viral protein R binding protein VPS4 Vacuolar protein sorting-associated protein 4 VPS4_C VPS4 C-terminal domain WB Western blotted WD40 Beta-transducin repeats WDR62 WD repeat domain 62 XMAP230 Xenopus microtubule-associated protein 230
ix Acknowledgements
I would like to express my deepest gratitude to my advisor Dr. Jorge Torres for his guidance, patient and full support throughout my graduate career. I would also like to thank Dr. Steven Clarke, Dr. Margot Quinlan, Dr. Alexander van der Bliek and Dr. Kent Hill for serving on my committee.
I am thankful to be working with every past and current members of the Torres lab: Ankur Gholkar, Silvia Senese, Ivan Ramirez, Xiayu Xia, Melissa Charvez, Franklin Yang and Ben Lo. You all provided tremendous help to my graduate works. Also big thanks to the amazing undergraduates who have assisted me in my graduate work: Janice Kuang, Ing Ongpipattanakul, Karen Wong and Ngoc Bui.
I express my appreciation to the Quinlan lab. Supports from Quinlan lab have played a big part in my graduate work. I especially want to thank Christina Vizcarra and Elizabeth Roth-Johnson for their assistance in TIRF microscopy. In addition, I am grateful for the opportunities to collaborate with the Whitelegge lab in mass spectrometry. Joseph Capri and Whitaker Cohn have been a joy to work with and they make everything look easy. Finally, I want to thank Dr. Catherine Clarke and every member in the Clarke’s lab for being the best neighbor in UCLA.
I express my appreciation to Whitcome training grant for awarding me the pre- doctoral fellowships. The funding helps me tremendously in my graduate career.
I am thankful for Chris Kampmeyer and Michelle Bradley’s generous help in editing my thesis.
Sean Shen, thank you for being my roommate and keeping it 100.
Most importantly, I am truly grateful to have my grandma, my dad, my mom, Molly and Hotpot being there for me. My life would be very much less without the unconditional supports from my family.
I have many good memories of graduate school, thanks to every single one of you.
x Curriculum Vitae
Chingnam Cheung
Education
University of California, San Diego M.S. in Biochemistry, June 2010 University of California, San Diego B.S. in Biochemistry, June 2008
Research Experience
Dr. Susan Taylor’s Lab, UCSD August 2009 – June 2010 Undergraduate Researcher Project: Role of phosphorylation on Protein Kinase A (PKA) • Characterized mutants of the PKA regulatory subunit • Purified recombinant PKA subunits using a combination of chromatography techniques • Determined activities of mutant regulatory subunits by coupled activation assays and inhibition assays • Performed initial crystallization condition screening of PKA holoenzyme using an automated system • Identified potential agonists and antagonists of the PKA regulatory subunit utilizing a screening assay
Dr. Elizabeth Komives’ Lab, UCSD March 2007 – July 2009 Undergraduate Researcher Project: Mechanism of IkBα-mediated Nuclear factor-kappa B (NF-kB) regulation • Purified regulatory protein nuclear factor-kappa B (NF-kB) and its inhibitor IkBα • Analyzed protein binding efficiency using Electrophoretic Mobility Shift Assay (EMSA) • Measured relative Protein-DNA interaction using a fluorescent quenching approach • Performed and analyzed trypsin-digested IkBα using mass spectrometry
Nanogen Inc., San Diego, CA November 2006 – December 2007 Research Associate Project: Optimization of user protocol for genomic-based electronic microarray diagnosis system • Evaluated several automated sample purification methods • Identified and detected target DNA from clinical samples using electronic microarray
xi Teaching experiences
Undergraduate Mentor UCLA Biochemistry & Molecular Biology (Los Angeles, CA) March 2011 – Present
Teaching Assistant University of California, Los Angeles, Department of Biochemistry & Molecular Biology • CHEM 153L – Introduction to Protein Science Laboratory University of California, San Diego, Department of Biochemistry & Chemistry • CHEM 143B – Organic Chemistry Laboratory
Fellowships and Conferences
• University Fellowship, UCLA 2010 • Philip Whitcome Pre-doctoral Fellowship, UCLA July 2011– July 2014 • 2016 ASBMB conference poster presentation (San Diego, CA) • 2014 EMBO conference: Microtubules: structure, regulation and functions poster presentation (Heidelberg, Germany) • 2014 UCLA Molecular Biology Institute annual retreat poster presentation • 2013 ASBMB conference poster presentation (Boston, MA) • 2013 UCLA Molecular Biology Institute annual retreat poster presentation • 2012 UCLA Molecular Biology Institute annual retreat poster presentation • 2008 UCSD Undergraduate Student Research Conference poster presentation
Publications
• Cheung K., Senese S., Kuang J., Bui N., Ongpipattanakul C., Gholkar A., Cohn W., Capri J., Whitelegge J.P., and Torres J.Z. “Proteomic Analysis of the Mammalian Katanin Family of Microtubule-severing Enzymes Defines Katanin p80 subunit B-like 1 (KATNBL1) as a Regulator of Mammalian Katanin Microtubule-severing”, Molecular & Cellular Proteomics 2016 May;15(5):1658-69.
• Senese, S., Cheung, K., Lo, Y. C., Gholkar, A. A., Xia, X., Wohlschlegel, J. A., & Torres, J. Z. (2015). A unique insertion in STARD9's motor domain regulates its stability. Molecular biology of the cell, 26(3), 440-452.
Under Review
• Gholkar A.A., Cheung K., Hamideh S.A., Nnebe C., Khuu C., Lo Y.C., and Torres J.Z. “Fatostatin Exhibits a Dual Mode of Action Against Cancer Cell Proliferation by Affecting Both Lipid Metabolism and Cell Division”, 2016
• Bradley M., Ramirez I., Cheung K., Gholkar A.A., and Torres J.Z. “Inducible LAP-tagged Stable Cell Lines for Investigating Protein Function, Spatiotemporal Localization and Protein Interaction Networks”, 2016
xii Chapter 1 - Background
1.1 Microtubules are essential in many cellular processes, especially in cell division
Microtubules are dynamic, biopolymers that serve as an essential component of the cytoskeleton network. The cytoskeleton provides mechanical support for maintaining internal organization and cell shape in eukaryotic cells. The inherent dynamics of microtubules allow them to rapidly rearrange into functional structures that adapt to various cellular processes, such as intracellular transport, motility, neurogenesis, ciliogenesis and cell proliferation (1-3). During cell division, microtubules reorganize into an anti-parallel bipolar structure called the mitotic spindle. The integrity of the mitotic spindle is critical for ensuring faithful segregation of daughter chromosomes. Defects in mitotic spindles often lead to chromosome missegregation and result in aneuploidy.
Aneuploidy could subsequently lead to increased rates of chromosome missegregation, termed chromosomal instability (CIN), a hallmark of cancers (4,5).
1.2 Molecular structures and properties of microtubules
Microtubules are 25-nm-diameter, non-covalent biopolymers consisting of the 55-kDa
GTPases called tubulin (6,7) (Figure 1.1). Two tubulin isoforms, α-tubulins and β- tubulins, spontaneously interact to form heterodimers, which are the basic building blocks of microtubules. Tubulin heterodimers join head-to-tail to form protofilaments, which organize into the spiral and hollow cylindrical-structures of microtubules (6). The number of protofilaments in individual microtubules varies across organisms. In mammalian cells, microtubules are composed of 13 protofilaments and may range
1 between 10-15 protofilaments in other organisms (8). The opposite ends of microtubules have different properties. The β-tubulin-exposed plus-end grows more rapidly, while the α-tubulin-exposed minus-end grows at a much slower rate (9). All protofilaments within an individual microtubule point to the same end, giving it a distinct direction and polarity. The microtubule ends have high affinity toward GTP-bound tubulin heterodimers and this property drives polymerization. GTP hydrolysis occurs shortly after tubulins are added to microtubules and the unstable GDP-bound tubulin heterodimers spontaneously dissociate from microtubule ends (Figure 1.1) (10). Thus, microtubules are constantly undergoing polymerization and depolymerization, known as dynamic instability (1). Whether a microtubule grows or shrinks depends on the rate of
GTP hydrolysis and the rate of tubulin addition. When the rate of tubulin addition is faster than GTP hydrolysis, the microtubule ends maintain GTP-caps and continue to grow, termed “rescue” (11). When the rate of GTP hydrolysis is faster than tubulin addition, GDP-bound tubulin heterodimers start to dissociate from microtubule ends and the microtubule undergoes rapid depolymerization, termed “catastrophe” (11).
2
Figure 1.1 - Molecular structures and properties of microtubules.
Microtubules consist of α- (blue sphere) and β- (purple sphere) tubulin heterodimers. Mammalian microtubules consist of 13 protofilaments (between 10-15 protofilaments in other organisms) that arrange spirally into a cylindrical structure that is 25-nm in diameter. GTP-bound tubulin (dark purple sphere) heterodimers add to the fast-growing plus-end (points to the top) of microtubule. The newly added GTP-bound tubulin heterodimer is then hydrolyzed to GDP-bound tubulin (light purple sphere) heterodimer shortly after polymerization. At the microtubule-organizing center (MTOC), the slow- growing minus-end of the microtubule is stabilized by γ-tubulin (green spheres) and capping proteins. Microtubules undergo constant polymerization and depolymerization, termed “dynamic instability”. When new tubulin heterodimers are added to the microtubules faster than GTP hydrolysis, the microtubule maintains a stable “GTP-cap” and grows rapidly, a process termed “rescue”. When GTP hydrolysis occurs faster than the addition of new tubulin heterodimers, the microtubule loses the GTP-cap and spontaneously undergoes rapid depolymerization, a process termed “catastrophe”. (Figure modified from Cecilia Conde and Alfredo Cáceres, “Microtubule Assembly, Organization and Dynamics in Axons and Dendrites.,” Nature Reviews. Neuroscience 10, no. 5 (May 2009): 319–332, doi:10.1038/nrn2631.)
3 1.3 Microtubule structures in cell division
In eukaryotes, microtubules merge into a tubulin structure called the microtubule- organizing center (MTOC), or the centrosome. The centrosome nucleates microtubules and regulates microtubule arrays. In interphase, the centrosome controls the formation of microtubule-based cellular structures such as cilia and flagella, whereas in cell division, the centrosome mediates the formation of mitotic spindle. The centrosome consists of a pair of centrioles surrounded by a matrix of proteins called the pericentriolar material (PCM) (12). The centrioles are two cylindrical structures that are positioned perpendicularly to each other. Each centriole contains nine short microtubule-structures that are composed of three microtubules bundled to each other.
The pair of centrioles serves as an anchor for the mass of proteins that form the PCM including the γ-tubulin ring complex. The γ-tubulin ring complex consists of γ-tubulins and five other proteins, which are arranged into a 25-nm-wide open-ring structure (13).
The γ-tubulin ring complex serves as a microtubule minus-end cap and is responsible for microtubule nucleation.
During mitosis, each pair of the duplicated centrioles moves toward the opposite sides of the dividing cell and microtubules quickly reorganize to form the bipolar spindle.
Microtubules nucleate toward the opposite poles of the cell and form an antiparallel- array that defines the spindle. Microtubules that extend towards the cell cortex from the centrosomes are called astral microtubules and are responsible for spindle poles positioning. Spindle assembly and other cellular processes often require complete remodeling of microtubule structures. Rapid growth and shrinkage of microtubules
4 require precise spatial and temporal control of microtubule dynamics modulated by a broad class of proteins called microtubule-associated proteins (MAPs).
1.4 Microtubules dynamic are regulated by the MAP proteins
MAPs are classified as a broad class of proteins that co-purify with microtubules, which include proteins that promote microtubule polymerization, depolymerization or stabilization. For example, Tau is a classic MAP that promotes axonal outgrowth and maintains neuronal processes (14). The C-terminal repeats of Tau bind to the hydrophobic pockets in between tubulin heterodimers to stabilize microtubules, suppress catastrophe and promote rescue (15-17). EB1 and CLIP-170 are plus-end tracking proteins (+TIPs) that regulate microtubule dynamic instability by promoting plus-end dynamics (18-20). EB1 tracks the microtubule plus-end and activates the auto- inhibited CLIP-170. The EB1/CLIP-170 complex then co-polymerizes with heterodimer tubulins to promote microtubule polymerization (18,19). In contrast, the mitotic centromere-associated kinesin (MCAK) is a microtubule destabilizer that depolymerizes microtubules on both the plus- and minus-ends. MCAK binds loosely to the microtubule lattice and diffuses along the microtubule protofilament until it reaches the end, where the protofilament spontaneously adopts a curved conformation (21) (Figure 1.1). MCAK then binds tightly to stabilize the curved conformation of the protofilament and promotes microtubule catastrophe (22). Stathmin is a microtubule destabilizer that sequesters tubulin heterodimers to prevent microtubule assembly. By reducing the rate of microtubule polymerization, Stathmin destabilizes microtubules by increasing the frequency of microtubule catastrophe (23,24).
5 Microtubule-severing proteins are unique MAP destabilizers that disassemble microtubules by generating an internal break within the microtubule lattice. Through
ATP hydrolysis, these proteins undergo a conformational change to release tubulin heterodimers from the microtubule lattice and break microtubules into shorter fragments. By generating additional microtubule-ends, microtubule-severing proteins can complement end-regulating MAP destabilizers such as MCAK to enhance microtubule depolymerization. Alternatively, microtubule fragments generated by microtubule-severing can polymerize into individual microtubules. Thus, microtubule- severing proteins can also promote formation of cellular structures that require microtubule enrichment, such as the mitotic spindle.
1.5 Structures of microtubule-severing proteins
Microtubule-severing proteins belong to the AAA (ATPase Associated with various cellular Activities) superfamily, which is characterized by one or more of the highly conserved, ~250-amino-acid AAA ATPase domain. AAA proteins are conserved across all organisms and are involved in a wide range of cellular processes such as molecular transport, protein degradation, membrane fusion, transcriptional activation and spindle formation. The AAA subfamily that includes the microtubule-severing proteins contains an N-terminal microtubule-interacting and trafficking (MIT) domain and a single C-terminal AAA domain (25). There are currently three known microtubule- severing proteins: Katanin was the first microtubule-severing protein that was discovered in mitotic Xenopus egg extract and has been studied extensively; Spastin was identified from a mutated gene that causes autosomal dominant hereditary spastic
6 paraplegia (AD-HSP) in humans; and Fidgetin was identified in mutant mice that had reduced or absent semicircular canals, microphthalmia, various skeletal abnormalities and displayed “fidgeting” behavior (26-28). VPS4 is the only non-microtubule-severing protein in this AAA subfamily (29). Instead, VPS4 disassembles the endosomal-sorting- complex-required-for-transport (ESCRT)-III polymers in the budding membrane neck to drive the final abscission step of cytokinesis in endosomal membrane trafficking (30).
AAA domain structure
All AAA proteins share the common features of forming oligomeric rings and harvesting chemical energy from ATP hydrolysis to remodel nucleic acid or protein substrates. The microtubule-severing proteins Katanin, Spastin and Fidgetin form hexameric rings upon binding to ATP, while VPS4 has been reported to form a dodecameric double-ringed structure (31-33). Both the structures of human and
Drosophila Spastin AAA domains have been solved by X-ray crystallography, and the core structures of the two orthologs are highly conserved (33,34). The AAA domain consists of a central α/β nucleotide-binding domain (NBD) and a smaller four-helix bundle domain (HBD) that form the nucleotide pocket. The NBD contains the conserved
Walker A and Walker B motifs that are involved in nucleotide binding and hydrolysis.
Inside the Walker A motif is a highly conserved phosphate-binding loop (P-loop) that is critical for nucleotide hydrolysis; a single mutation within the P-loop can abolish the
ATPase activity of the AAA domain (33). Atomic docking coupled with small-angle X-ray scattering (SAXS) reconstruction of hexameric Spastin shows three highly conserved solvent-exposed pore loops that are projected into the hexameric ring (33). These loops
7 are critical for substrate remodeling activity and mutation of residues in any of the three loops can completely inhibit or severely cripple the enzyme (33,35). In the current model, the pore loops interact with the C-terminal tail of tubulin and translocate it through the central pore of the AAA ATPase ring. This process partially unfolds the tubulin subunit, destabilizes the microtubule lattice, and eventually generates an internal break within the microtubule. The partially unfolded tubulin subunit is then released by the microtubule-severing protein and becomes available to repolymerize into microtubules. This model is supported by recent studies showing that: 1) mutations within the C-terminal tails of tubulin perturb the microtubule-severing activity of Katanin, and 2) addition of tubulin C-terminal fragments inhibits Katanin activity in severing assays (35-37).
8
9 Figure 1.2 - Structures and mechanisms of microtubule-severing proteins.
A) Structural model combining crystal structure of Drosophila Spastin AAA domain (light blue ribbons) and small-angle X-ray scattering (SAXS) reconstruction of full-length (MIT + AAA domain) Spastin hexamer (pink envelope). The ribbon representation shows the N-terminal helix/loop (magenta) and the C-terminal helix (dark blue) of an individual AAA subunit in the hexameric ring. The nucleotide-binding domain (NBD, dark green) and the four-helix bundle domain (HBD, light green) are colored to denote one subunit. The hexameric ring is about 220-Å in diameter. B) Current model of microtubule-severing by Spastin. The Spastin hexameric ring (cyan) is shown via equatorial cross-section view with the AAA domain pore loops (blue ribbons, labeled 1, 2 and 3). The functions of the MIT domains (gold ovals) are not included in this model. A microtubule is shown via cross-section and each tubulin heterodimer (green ribbons) represents a subunit within an individual protofilament. The schematic shows the pore loops “grabbing” the tubulin C-terminal tail (red) and translocate it through the core of the ring to partially unfold the tubulin subunit and destabilize it. (Figure modified from Antonina Roll-Mecak and Ronald D Vale, “Structural Basis of Microtubule Severing by the Hereditary Spastic Paraplegia Protein Spastin.,” Nature 451, no. 7176 (January 17, 2008): 363–7, doi:10.1038/nature06482.)
MIT domain structure
In addition to the AAA domain, the MIT domain is also conserved in the microtubule-severing proteins and the VPS4 AAA subfamily. NMR analysis of mouse
Katanin p60 MIT domain reveals the structure of a three-stranded helix bundle arranged in an anti-parallel manner, where the second and third helices form a positively charged surface that binds to microtubules. In contrast, the VPS4 MIT domain recognizes the
ESCRT-III MIT interacting motifs (MIM) and recruit VPS4 to the ESCRT-III polymer lattice. SAXS reconstruction of the Spastin hexamer predicts the N-terminal MIT domains extend outward from the hexameric ring, possibly reaching out to “latch” onto the microtubule lattice and position the AAA ATPase ring for microtubule disassembly
(25,33,38). Although the MIT domain increases microtubule affinity of microtubule- severing proteins, it is not required for microtubule-severing.
10
1.6 Katanin is a heterodimer consisting of a catalytic subunit and a regulatory subunit
Katanin was originally discovered as a heterodimer consisting of one 60-kDa and one 80-kDa subunit, named p60 and p80, respectively (39). The catalytic p60 (KATNA1) subunit contains the conserved MIT domain and AAA domain, a functionally unknown coiled-coil domain, and a C-terminal VPS4 oligomerization domain that is required for forming hexameric rings. The regulatory p80 (KATNB1) subunit interacts with the catalytic subunit and modulates its microtubule-severing activity (40). KATNB1 contains a WD40 domain, a functionally unknown proline-rich region, and a conserved p80 domain (con80). The WD40 domain, which consists of six WD40 repeats, does not directly interact with KATNA1, but is required for spindle pole targeting of KATNA1 during cell division (41). Co-transfection of KATNA1 and WD40-less KATNB1 results in a dominant negative effect and abolishes localization of KATNA1 to the spindle pole. In addition, the WD40 domain inhibits KATNA1 microtubule-severing activity when co- transfected with KATNA1 in vivo (40). Interestingly, the con80 domain interacts with
KATNA1 and increases both microtubule-binding affinity and microtubule-severing activity of KATNA1 as shown by in vitro experiments (40). It remains unclear why N- terminal and C-terminal of KATNB1 have opposite effects on Katanin microtubule- severing regulation. In addition, in vitro microtubule-severing assays showed that
Xenopus egg extract co-transfected with both KATNA1 and full-length KATNB1 had higher microtubule-severing activities than extract transfected with KATNA1 alone (41).
However, this observation could be due to the presence of other proteins in the extract
11 and has yet to be verified using purified KATNA1 and full-length KATNB1 (31,40,41).
Although KATNA1 and KATNB1 were isolated as heterodimers, KATNA1 can self- assembles into hexameric ring and severs microtubules with or without KATNB1.
Similar to Spastin, Katanin assembles into hexameric rings upon binding to ATP and disassembles back into monomers upon ATP hydrolysis (31).
1.7 The functions of Katanin in cell division are species-specific
Katanin plays an essential role in regulating spindle morphology. In C. elegans, the homologs of KATNA1 and KATNB1, MEI-1 and MEI-2, contribute to spindle shortening at the spindle poles to maintain proper spindle size in embryos during meiosis (42,43). In addition, MEI-1 microtubule-severing and γ-tubulin-dependent nucleation increase the number of microtubule polymers during spindle assembly to enrich spindle density. (42,43). Partial loss-of-function mutations in the MEI-1/MEI-2 complex leads to elongated spindle and reduced spindle density. However, MEI-1 must be degraded prior to entering mitosis, and persistence of MEI-1 in mitosis leads to defect in chromosome segregation (44,45). In contrast, mammalian Katanin is required in both meiosis and mitosis. In addition to spindle assembly regulation, KATNA1 and
KATNB1 are also required for proper cytokinesis progression (46,47). Depletion of
KATNA1 or KATNB1 leads to incomplete cleavage-furrow ingression, resulting in multinucleate cells (47). Finally, Drosophila Katanin Dm-Kat60 primarily functions at the chromosomes instead of the spindle poles to facilitate plus-end depolymerization during anaphase, suggesting a major difference in its role and regulation in mitosis (48).
12 Together, these results show distinctive species-specific functions of Katanin in cell division.
1.8 Katanin is subject to multiple models of regulations in cell division
To ensure Katanin severs microtubules at the right place and the right time, it is important to precisely control the localization and activity of Katanin. For example, overexpression of KATNA1 leads to complete disassembly of cytoskeleton microtubules in HeLa cells, indicating that KATNA1 microtubule-severing activity is controlled by precise mechanisms (40). Unsurprisingly, multiple models of regulation, including phosphorylation, ubiquitination and protein-protein interaction, have been shown to regulate Katanin in cell division.
Phosphorylation
A number of studies from various species have shown that the microtubule- severing function of Katanin is inhibited by phosphorylation. In C. elegans, the microtubule-severing activity of MEI-1 is enhanced by protein phosphatase 4 complex
(PP4)-mediated dephosphorylation during meiosis (49). PP4 recognizes MEI-1 through a PP4 regulatory subunit PPFR-1, and depletion of PPFR-1 results in an enlarged polar body and elongated spindle, similar to the MEI-1 loss-of-function phenotype. These observations are consistent with in vitro studies showing that a Xenopus laevis phosphomimetic mutant p60 has reduced microtubule-severing compared to wild type
(50). Furthermore, phosphorylation-dependent inhibition can be overcome by increasing
13 the concentration of phosphomimetic mutant p60, suggesting a switch-like mechanism in Katanin phosphorylation regulation (50).
Ubiquitination
In C. elegans, MEI-1 is required to form meiotic spindles in meiosis but must be inactivated before entering mitosis (51,52). At the end of meiosis, Mel-26, a substrate- specific adaptor of the Cul-3 E3 ubiquitin ligase, recruits MEI-1 and PPFR-1 for Cul-3- mediated polyubiquitination and subsequent proteasomal degradation (49). Persistence of MEI-1 beyond meiosis leads to failure in mitosis and is lethal to C. elegans embryos.
In higher eukaryotes, Katanin is regulated by at least two ubiquitination pathways in cell division. In the first pathway, the Cul-3 binding protein Ctb9/KLHDC5 targets
KATNA1 for Cul-3-mediated polyubiquitination and subsequent proteasomal degradation in mitosis (53). In the second pathway, DYRK2, a kinase that also serves as a scaffold for the E3 ligase complex containing EDD, DDB1 and VPRBP proteins
(EDVP) complex, phosphorylates KATNA1 and promotes its polyubiquitination and subsequent proteasomal degradation by the EDVP complex (54). Further studies are needed to understand why multiple ubiquitination pathways regulate Katanin and the mechanism by which these pathways regulate Katanin in different stages of mitosis.
Protein-protein interaction
In addition to KATNB1, a number of proteins have been shown to regulate
Katanin microtubule-severing activity. XMAP230 is a Xenopus homolog of MAP4 that regulates microtubule dynamics by promoting microtubule assembly (55). McNally et al.
14 showed that XMAP230 isolated from Xenopus interphase extract inhibits KATNA1 microtubule-severing activity in vitro; this inhibitory effect is reversed by pre-incubating interphase XMAP230 with CyclinB/Cdk1 prior to the in vitro assay (56). These results indicate that XMAP230 specifically inhibits KATNA1 during interphase to prevent disassembly of the cytoskeleton. KATNB1 has been shown to interact with a pluripotent tumor suppressor, LAPSER1/LZTS2, to inhibit KATNA1 microtubule-severing activity by weakening the microtubule binding affinity of the heterodimer (57). Overexpression of
LAPSER1 leads to cytokinesis defects and results in multinucleate cells, a phenotype similar to KATNB1 depleted cells. NDEL1 is primarily a dynein regulator involved in neurogenesis but also localizes to centrosomes in cell division and may plays a role in astral microtubule regulation (58). KATNA1 localizes to the nucleus in NDEL1-null cells, suggesting that NDEL1 regulates localization of KATNA1 during interphase (59).
Together, these results demonstrate multiple models of Katanin regulation throughout the cell cycle, but the temporal control of Katanin in cell division is still not well understood.
Chapter 2 – Introduction and Rationale
The remodeling of microtubule structures is important for many aspects of cell physiology including cell division, motility, morphogenesis and signaling (60). A major group of proteins that remodel microtubules through microtubule-severing activities are the AAA ATPase containing proteins that include Spastin, Fidgetin and the Katanins
(26,48,60,61). Katanins are composed of a catalytic p60 subunit (A subunit, which contains the AAA ATPase domain) and a regulatory p80 subunit (B subunit) (26).
15 However, in vitro biochemical studies have shown that the A subunit can form an unstable 14-16 nm hexameric ring structure, which can sever microtubules in the presence or absence of the B subunit (26,31,62), indicating that the A subunit does not require the B subunit for microtubule-severing activity. However, the B subunit has been shown to regulate the rate of microtubule-severing by the A subunit (40,41), hence its designation as a regulatory subunit. The Katanins have been implicated in the regulation of multiple processes that are important for cellular homeostasis, proliferation, and invasion including the severing of spindle microtubules to generate microtubule density during meiosis and mitosis, the severing of the cilia axoneme microtubules during ciliary resorption, the severing of intercellular bridge microtubules during cytokinesis and the severing of cytoplasmic microtubules to promote cell morphogenesis and migration (47,52,62-65). For example, in Caenorhabditis elegans, the microtubule-severing activity of the Katanin A subunit MEI-1 is required for regulating spindle length and density during meiotic spindle formation and for stabilizing the association of the meiosis I spindle to the oocyte cortex (42,43,66). Additionally, inactivation of a temperature sensitive MEI-1 mutant during metaphase disrupts bipolar spindle assembly and the alignment of chromosomes to the metaphase plate (67). In
Drosophila melanogaster, the microtubule-severing activity of the Katanin p60-like 1
(Kat-60L1) A subunit is critical for neuronal development (68). Kat-60L1 mutants exhibit a reduced number and length of dendrites in neurons and a diminished neuronal responsiveness to chemical and thermal stimuli (69). Additionally, during mitosis the
Katanin p60 (DmKat-60) A subunit localizes to chromosomes and facilitates microtubule depolymerization during chromosome segregation (48). In other organisms such as
16 Tetrahymena thermophila, Chlamydomonas reinhardtii and Trypanosoma brucei,
Katanin A subunits are important for flagellar biogenesis and cell division (64,70-72).
Finally, the microtubule-severing activity of Katanin A subunits in Arabidopsis thaliana are critical for regulating cell specification, cell growth and cell wall biosynthesis (73-79).
Although the majority of Katanin studies have focused on understanding the function of the canonical p60 and p80 subunits in lower organisms, many organisms encode additional p60-like and p80-like proteins known as Katanin-like proteins. For example the human genome encodes two alternatively spliced isoforms of the canonical p60 A subunit (KATNA1 chromosomal locus 6q25.1, protein IDs NP_001191005.1 and
NP_008975.1) and two additional p60-like proteins (KATNAL1 chromosomal locus
13q12.3, protein ID NP_115492.1; KATNAL2 chromosomal locus 18q21.1, protein ID
NP_112593.2). Similarly, in addition to the canonical p80 B subunit (KATNB1 chromosomal locus 16q21, protein ID NP_005877.2), the human genome encodes an additional p80-like protein (KATNBL1 chromosomal locus 15q14, protein ID
NP_078989.1) (25). Interestingly, all human Katanin subunits are ubiquitously expressed across most tissue types including brain, lung, kidney, liver, pancreas and skin and in established cell lines like HeLa cells (80). Human Katanins have important roles in regulating microtubule-dependent processes like mitotic spindle length and structure during cell division and mutation of Katanin subunits has been linked to human disorders like cerebral cortical malformation and male infertility (42,46,81-83). Domain analyses of the human Katanin subunits indicate that KATNA1 and KATNAL1 share a similar domain architecture with an N-terminal microtubule interacting and trafficking domain (MIT) followed by a coiled coil domain (CC), a AAA ATPase domain (AAA) and
17 a C-terminal VPS4 domain (VPS4_C) (84) (Fig. 1A). In contrast, KATNAL2 only contains the AAA domain, lacks the MIT, CC and VPS_4 domains, and has an N- terminal LisH (LIS1 homology) domain (Fig. 1A). Because KATNAL2 harbors a AAA domain that is required for Katanin microtubule-severing activity, it is predicted to have a role in microtubule-severing, however this has yet to be tested. Additionally, KATNAL2 lacks the MIT domain that is important for microtubule binding in other Katanin A subunits and whether the MIT domain is critical for microtubule-severing activity remains to be determined (38). Although KATNB1 and KATNBL1 both harbor a conserved C-terminal region (con80), only KATNB1 contains additional N-terminal proline-rich (Pro-rich) and WD40 domains that are absent in KATNBL1 (25,40) (Fig.
1A). Interestingly, full length KATNB1 and the KATNB1 con80 domain alone have been shown to stimulate KATNA1 microtubule-severing activity, whereas the KATNB1 WD40 domain alone inhibits microtubule-severing (40,41). However, the underlying mechanism of how the B subunits regulate the activity of the A subunits is still unclear.
Additionally, outside of KATNA1 and KATNB1, the remaining human Katanin subunits remain poorly characterized.
Our previous proteomic analyses of human mitotic microtubule co-purifying proteins identified a then hypothetical p60-like protein KATNAL1 (85). Tandem affinity purification and mass proteomic analysis of KATNAL1 identified KATNA1, KATNAL1,
KATNB1 and a then hypothetical p80-like protein C15orf29 (KATNBL1) as interactors, indicating that in humans multiple Katanins were likely involved in microtubule-severing
(86). Consistent with this idea, depletion of human KATNA1 or KATNAL1 alone leads to mild changes in spindle size and mitotic defects (83,87), indicating that multiple
18 Katanins may be involved in regulating spindle size in mammals and/or that other microtubule-severing activities are able to compensate in the absence of either Katanin.
Additionally, whether KATNAL2 has microtubule-severing activity that can compensate for the absence of other Katanin A subunits remains to be determined. Finally, the effect, if any, that KATNBL1 has on Katanin A subunit microtubule-severing activity also remains to be determined. To better understand the human Katanins and more broadly the mechanisms controlling mammalian microtubule-severing, we analyzed the human
Katanin interactome (Katan-ome) through biochemical tandem affinity purifications and mass proteomic analyses. We further focused on the characterization of the poorly understood KATNBL1 subunit and its role in microtubule-severing through binding assays, microtubule-severing assays, competition binding assays, and subcellular localization studies. Our results showed that KATNBL1 is uniquely sequestered to the nucleus during interphase and associates with spindle poles in mitosis, is a regulator of
KATNAL1 microtubule-severing activity, and competes with KATNB1 for binding to
KATNA1 and KATNAL1. These results indicate that in humans microtubule-severing is complex and likely regulated by the concerted action of KATNB1 and KATNBL1.
Chapter 3 - Results
3.1 Defining the mammalian Katanin interactome (Katan-ome)
Our recent proteomic screen to identify novel mitotic microtubule co-purifying proteins led to the identification of KATNAL1 (NP_115492.1), a hypothetical KATNA1- like protein (85,86). Interestingly, KATNA1, KATNB1 and a KATNB1-like protein 1
(C15orf29, KATNBL1) co-purified with KATNAL1, indicating that microtubule-severing
19 was complex in higher eukaryotes and that potentially multiple Katanin heterodimers were involved in microtubule-severing (86). To better understand the human Katanins and more broadly the mechanisms controlling mammalian microtubule-severing, we sought to define the mammalian Katanin interactome. To do this, we generated doxycycline-inducible localization and affinity purification (LAP= EGFP-TEV-S-Peptide)- tagged-KATNA1, KATNAL1, KATNAL2, KATNB1 and KATNBL1 HeLa stable cell lines
(86) (Fig. 1A). These cell lines were used to express and tandem affinity purify LAP-
Katanins from cells arrested in mitosis with the treatment of Taxol. The purification eluates were resolved by SDS-PAGE and six gel slices containing the entire eluates were excised, trypsinized, and the interacting proteins were identified by 2D-LC MS/MS
(supplemental Tables S1 and S2). The mass spectrometry data from each purification was used to generate an interaction module for each subunit and the Katanin interactome (Katan-ome) was assembled from the five individual interaction modules using Cytoscape (88) (Fig. 1B). Several insights were gained from the Katan-ome. First, while KATNA1, KATNAL1, KATNB1 and KATNBL1 were able to co-purify with each other in reciprocal purifications, KATNAL2 only co-purified with KATNA1 (Fig. 1B and supplemental Tables S1 and S2). Second, each Katanin interacted with a unique subset of proteins composed primarily of spindle-associated proteins. Third, all Katanins shared interactions with microtubule-associated proteins and finally, all Katanins interacted with various tubulin isoforms (Fig. 1B and supplemental Tables S1 and S2).
20
21 Figure 3.1 - The mammalian Katanin interactome (Katan-ome).
A) Domain architecture of the KATNA1 (UniProt ID O75449), KATNAL1 (UniProt ID Q9BW62), KATNAL2 (UniProt ID Q8IYT4), KATNB1 (UniProt ID Q9BVA0), and KATNBL1 (UniProt ID Q9H079) proteins. The numbers of amino acid residues are indicated for each protein. Major domains within each Katanin are annotated and include the microtubule interacting and trafficking domain (MIT), coiled coil domain (CC), AAA ATPase domain (AAA), VPS4 C-terminal domain (VPS4_C), proline-rich domain (Pro-rich) and the C-terminal region that binds to the N-terminal domain of KATNA1 (con80). B) The human Katanin interactome, Katan-ome. Cytoscape analysis of the KATNA1, KATNAL1, KATNAL2, KATNB1 and KATNBL1 interactomes assembled from the proteins identified by mass spectrometric analyses of each Katanin subunit purification from mitotic cells. Highlighted in yellow nodes are the Katanin bait proteins and green nodes represent the identified interacting proteins. Red edges represent interactions between Katanin subunits. Subunit specific interactions are highlighted with dashed boxes. See supplemental Tables S1 and S2 for a complete list of identified proteins and their associated information.
3.2 Validation of Katanin subunit interactions
To further validate the interactions between the Katanin subunits and to determine if these interactions were direct, we performed pairwise binding assays from cell extracts and an in vitro system in the presence of the microtubule depolymerizing agent nocodazole. First, LAP-Katanin B subunit expressing cell lines were transfected with HA-tagged Katanin A subunits and the A subunits were immunoprecipitated and the immunoprecipitates were immunoblotted for LAP-Katanin B subunits (Fig. 2A and
B). Similar reciprocal co-IPs were carried out with LAP-Katanin A subunit expressing cell lines that had been transfected with HA-tagged Katanin B subunits (supplemental
Fig. S1A-B). Finally, reciprocal co-IPs were carried out with LAP-Katanin B subunit expressing cell lines that had been transfected with HA-tagged Katanin B subunits
(supplemental Fig. S1C-D). This subunit binding analysis revealed that KATNB1 and
KATNBL1 were each able to associate with KATNA1 and KATNAL1 but not with
22 KATNAL2. Additionally, no interaction was detected between KATNB1 and KATNBL1.
Next we sought to determine whether the observed interactions between KATNB1 and
KATNBL1 with KATNA1 and KATNAL1 were direct. To do this, we performed pairwise binding in vitro co-IPs with in vitro transcribed and translated 35S labeled A and B subunits. Consistent with our cell extract binding assays both KATNB1 and KATNBL1 bound to KATNA1 and KATNAL1 directly (Fig. 2C and D and supplemental Fig. S1E).
Together these data indicated that KATNB1 and KATNBL1 could each bind to either
KATNA1 or KATNAL1 directly and that KATNAL2 failed to interact with any of the
Katanin subunits (Fig. 2E).
23
24 Figure 3.2 - The Katanin-Katanin pairwise binding assays.
A-B) In cell Katanin subunit pairwise binding reactions. LAP-tagged GFP-B1 (A) or GFP-BL1 (B) HeLa stable cell lines were transfected with HA-tagged A1, AL1 or AL2 subunits or the negative control (Ctrl) STARD9-START. HA-A1, HA-AL1, HA-AL2 or HA-Ctrl were immunoprecipitated from 140µg of protein extracts. 6% of the input and all of the immunoprecipitates were western blotted (WB) for the indicated GFP- tagged B subunits (using anti-GFP antibodies) and the HA-tagged A subunits or HA- Ctrl (using anti-HA antibodies). Note that the negative control HA-Ctrl does not bind to either Katanin B subunit. Additionally, the negative control GAPDH protein is not found in any of the immunoprecipitations. C-D) In vitro 35S-radiolabeled Katanin subunit pairwise binding reactions. In vitro transcribed and translated 35S-radiolabeled FLAG-tagged A subunits or negative control (Ctrl) STARD9-MD and HA-tagged B1 (C) or BL1 (D) subunits were used for pairwise in vitro binding reactions as indicated. HA-tagged Katanin B subunits were then immunoprecipitated and the radiolabeled Katanin A and B subunits and Ctrl in the immunoprecipitates were visualized by autoradiography. Note that FLAG-A1 and FLAG-AL1 co-precipitate with HA-B1 and HA-BL1, whereas FLAG-AL2 and the negative control FLAG-Ctrl do not. E) Summary of in cell and in vitro binding data. Arrows indicate the direction of the interaction, double arrows indicate that the interaction was recapitulated in reciprocal co- immunoprecipitations. See supplemental Fig. S1 for in cell and in vitro reciprocal Katanin subunit binding data.
3.3 KATNBL1 has dynamic cell cycle dependent subcellular localization
Because KATNBL1 bound directly to KATNA1 and KATNAL1, we sought to determine if it also localized to the cytoplasm in interphase and the spindle poles during mitosis, as previously shown for KATNB1 (40). Immunofluorescence microscopy of
HeLa cells expressing LAP-Katanin A or B subunits showed that KATNA1, KATNAL1,
KANTAL2 and KATNB1 localized within the cytoplasm, partially overlapping with microtubules, in interphase and to the mitotic spindle and spindle poles during mitosis, consistent with previous reports (39,40,83,86,89) (Fig. 3A-C). Surprisingly, KATNBL1 failed to localize to the cytoplasm in interphase cells and instead was enriched in the nucleus (Fig. 3A and B). However, similar to KATNA1, KATNAL1, KATNAL2 and
25 KATNB1 it also localized to the spindle poles in mitosis (Fig. 3C). Together, these results indicated that compared to other Katanin A or B subunits, KATNBL1 was uniquely localized to the nucleus during interphase and only associated with spindle poles during mitosis.
26 Figure 3.3 - Katanin subunit cell cycle subcellular localization.
A-C) Immunofluorescence microscopy of paraformaldehyde fixed LAP-tagged GFP- Katanin subunit expressing HeLa cells stained with Hoechst 33342 to detect the DNA, anti-α-tubulin antibodies to detect microtubules, and anti-GFP antibodies to detect GFP-Katanin subunit localization. Images show the subcellular localization of each Katanin subunit during interphase, either whole view (A) or zoomed view of cytoplasmic microtubules (B), and metaphase of mitosis (C). Note that KATNA1, KATNAL1, KATNAL2 and KATNB1 localize to the cytoplasm in interphase and the spindle poles during mitosis, while KATNBL1 localizes to the nucleus in interphase and spindle poles during mitosis. Bar= 5µm.
3.4 Regulation of Katanin microtubule-severing activity by KATNBL1
Although KATNA1 and KATNAL1 had been shown to have microtubule-severing activities (26,40,83), there had been no characterization of the putative KATNAL2 microtubule-severing activities. Therefore, we overexpressed KATNAL2 and analyzed its ability to sever microtubules by immunofluorescence microscopy. In contrast to cells overexpressing KATNA1 or KATNAL1 that displayed a loss of α–tubulin signal indicative of microtubule-severing, overexpression of KATNAL2 had no effect on the microtubule lattice, indicating that it had no detectable microtubule-severing activity
(supplemental Fig. S2). Similarly, although KATNB1 had been shown to regulate microtubule-severing activity of KATNA1 (40), the effect of KATNBL1 on A subunit microtubule-severing had not been determined. Thus, we analyzed the effect of
KATNBL1 on the KATNAL1 microtubule-severing activity using in vitro microtubule- severing assays coupled to live total internal reflection fluorescence microscopy
(TIRFM). Briefly, recombinant KATNAL1 and KATNBL1 subunits were added to immobilized rhodamine labeled microtubules at various ratios and microtubule-severing was monitored every 10 seconds for seven minutes using TIRFM. Consistent with
27 previous results, KATNAL1 showed microtubule-severing activity, and this activity was enhanced by the addition of the KATNB1 procon80 domain at a 1:1 ratio (40) (Fig. 4A and B and supplemental Fig. S3). Interestingly the addition of full-length KATNBL1 at a
1:0.125 ratio (KATNAL1:KATNBL1) inhibited the microtubule-severing activity of
KATNAL1 and increasing the concentration of KATNBL1 to a 1:0.5 ratio did not further inhibit KATNAL1 activity (Fig. 4A and B and supplemental Fig. S3). However, the addition of KATNBL1 at a ratio of 1:0.0625 enhanced KATNAL1 microtubule-severing activity and decreasing the concentration of KATNBL1 further to a ratio of 1:0.03125 did not further enhance the KATNAL1 activity (Fig. 4A and B and supplemental Fig. S3).
Together, these results indicated that KATNBL1 was able to regulate the KATNAL1 microtubule-severing activity in a concentration dependent manner.
28 Figure. 3.4 - KATNBL1 regulates Katanin microtubule-severing activity.
A) Total internal reflection fluorescence microscopy (TIRFM) in vitro microtubule- severing assays using recombinant purified GST-KATNAL1, rhodamine-labeled microtubules and the indicated GST-tagged B subunits. Time (t) is in seconds. B) Summary of the relative Katanin microtubule-severing activity (- =no activity, + =weak activity, ++ =medium activity, and +++ =fast activity) for the indicated molar ratio of A-subunit : B-subunit. Average fluorescence signals of time-lapse TIRF images were measured with ImageJ. Data represent results from three independent experiments. See supplemental Fig. S3 for quantification of time-lapse microtubule TIRFM fluorescence signals.
3.5 Sequestration of KATNBL1 to the nucleus is dependent on a nuclear localization signal
The strong localization of KATNBL1 to the nucleus during interphase indicated
that KATNBL1 was being actively localized to the nucleus and could potentially harbor a
nuclear localization signal (NLS). Analysis of the KATNBL1 amino acid sequence with
cNLS Mapper (90) indicated that KATNBL1 had at least two putative bipartite NLS’s;
NLS1 corresponding to amino acids 9-28 (basic cluster 1 amino acids 9-11 and basic
cluster 2 amino acids 26-28 ) and NLS2 corresponding to amino acids 71-87 (basic
cluster 1 amino acids 71-74 and basic cluster 2 amino acids 85-87) (Fig. 5A). Therefore,
we performed an analysis of NLS1 and NLS2 mutants, by substituting amino acid
residues within these motifs to alanines and assessing their subcellular localization with
immunofluorescence microscopy. Mutation of the NLS1 basic cluster 1 or basic cluster
1 and 2 had no effect on the localization of KATNBL1 and it remained in the nucleus
(Fig. 5A and B). Consistently, a KATNBL1 truncation mutant missing the first 55 amino
acids (Δ1-55) also maintained its nuclear localization and fusion of the first 69 N-
terminal amino acids of KATNBL1 to GFP did not localize it to the nucleus (Fig. 5A and
B and supplemental Fig. S4). This indicated that NLS1 was not necessary for KATNBL1
29 nuclear localization. Next, we mutated NLS2 basic cluster 1 or basic cluster 1 and 2.
Interestingly, mutation of the NLS2 basic cluster 1 led to the redistribution of KATNBL1 from the nucleus to both the nucleus and cytoplasm, while mutation of both basic cluster
1 and 2 did not further redistribute KATNBL1 to the cytoplasm (Fig. 5A and B and supplemental Fig. S4). This indicated that NLS2 basic cluster 1 was important for the localization of KATNBL1 to the nucleus. Consistently, fusion of the first 98 N-terminal amino acids of KATNBL1 to GFP localized it to the nucleus (Fig. 5A and B).
Furthermore, mutation of NSL1 basic cluster 1 or 2 in combination with NLS2 basic cluster 1 did not further redistribute KATNBL1 to the cytoplasm (Fig. 5A and B).
However, mutation of all three (NLS1 basic cluster 1 and 2 and NLS2 basic cluster 1) led to the complete redistribution of KATNBL1 to the cytoplasm (Fig. 5A and B).
Together, these data indicated that NLS2 basic cluster 1 was important for targeting
KATNBL1 to the nucleus during interphase and that NLS1 basic cluster 1 and 2 also played a role.
30
Figure 3.5 - KATNBL1 localization to the nucleus during interphase requires an N- terminal nuclear localization sequence.
A) cNLS Mapper analysis of KATNBL1 identified two putative bipartite nuclear localization signals (NLS) corresponding to amino acids 9-28 (NLS1) and 71-87 (NLS2). The generated KATNBL1 NLS1 and NLS2 mutants and KATNBL1 truncation mutants are indicated. B) Immunofluorescence microscopy, as in Fig. 2.3, was used to visualize the subcellular localization of KATNBL1 wildtype (WT), NLS1 mutants, NLS2 mutants, deletion mutants and N-terminal fusions as indicated. + indicates nuclear localization, +/- indicates partial nuclear localization and – indicates no nuclear localization. Bar= 5µm. Note that wildtype KATNBL1 localizes to the nucleus, whereas mutation of NLS2 basic cluster 1 (amino acids 71-74) in combination with NLS1 basic cluster 1 (amino acids 9-11) and 2 (amino acids 26-28) inhibits its transport to the nucleus and it remains in the cytoplasm. See supplemental Fig. S4 for the localization of additional mutants. For a list of primers used for generating KATNBL1 mutants see supplemental Table S3.
31 3.6 KATNB1 competes with KATNBL1 for binding to KATNA1 and KATNAL1
Because KATNB1 and KATNBL1 both interacted directly with KATNA1 and
KATNAL1 it was possible that they were competing for binding to KATNA1 and
KATNAL1. To test this we performed in vitro Katanin A and B subunit binding experiments as described previously, except that increasing concentrations of recombinant B subunits were added. Indeed, KATNB1 was able to compete the
KATNA1-KATNBL1 and KATNAL1-KATNBL1 interactions in a dose dependent manner
(percent KATNBL1 bound decreased from 100% to ~20%) (Fig. 6A and B). However, reciprocal competition studies with increasing concentrations of KATNBL1 showed that
KATNBL1 was only able to weakly compete the KATNA1-KATNB1 and KATNAL1-
KATNB1 interactions (percent KATNB1 bound decreased from 100% to ~84%) (Fig. 6C and D). Together, these results indicated that KATNB1 and KATNBL1 were likely in competition for binding to KATNA1 and KATNAL1 and that KATNB1 had a higher affinity for KATNA1 and KATNAL1 than KATNBL1.
32
Figure 3.6 - KATNB1 competes the KATNA1-KATNBL1 and KATNAL1-KATNBL1 interactions.
A-D) Competition binding assays, using increasing concentrations of recombinant KATNB1 or KATNBL1. HA or Myc-tagged in vitro 35S-radiolabeled Katanin subunits were used in pairwise binding competition reactions as indicated and the results of the competition binding assays were visualized by autoradiography. A-B, Increasing concentrations of KATNB1 competes the KATNA1-KATNBL1 and KATNAL1-KATNBL1 interactions. The intensity of the KATNBL1 bands were measured using ImageJ and the percent KATNBL1 bound is indicated. Note that the percent KATNBL1 bound decreases as the concentration of KATNB1 increases. C-D, Increasing concentrations of KATNBL1 weakly compete the KATNA1-KATNB1 and KATNAL1-KATNB1 interactions. The intensity of the KATNB1 bands were measured using ImageJ and the percent KATNB1 bound is indicated. Note that the percent KATNB1 bound decreases only slightly as the concentration of KATNBL1 increases.
33 Chapter 4 - Discussion and Conclusions
By coupling Katanin subunit tandem affinity purifications from mitotic cells with mass proteomic analyses, we identified the protein interaction module for each of the five human Katanin subunits. These interaction modules were combined to generate the human Katanin interactome (Katan-ome): a mitotic protein network comprised of all the
Katanin subunits and their interacting partners (Fig. 1B). The identified protein-protein interactions could be used to further understand the cells microtubule-severing machinery, their mechanisms of action and their regulation. For example, the Katanin interactors may represent factors that regulate Katanin activity, localization, complex assembly or that coordinate with the Katanins to promote microtubule-severing and the generation of microtubule density that is required for proper spindle assembly and cell division. Along these lines, reports in Xenopus laevis have indicated that Katanin function may be regulated through posttranslational modifications like phosphorylation
(50,56,91). Interestingly several kinases were identified in the Katan-ome, including
Aurora A (KATNA1 interactor); PLK2 (KANTAL1 interactor); CDK1 and CDK2
(KATNAL1 and KATNAL2 interactors); and the kinase regulatory protein CDK5RAP2
(KATNAL2 interactor) (Fig. 1B and supplemental Tables S1 and S2). Aurora A, PLK2,
CDK1, CDK2 and CDK5RAP2 all have critical roles in mitosis predominantly through the regulation of centriole and centrosome homeostasis and could be modulating
Katanin activity at the spindle poles during mitosis through phosphorylation (92-97).
Interestingly, the Katan-ome contained a good degree of connectivity between the individual Katanin subunits, indicating that they may share common modes of inhibition/activation and/or may have redundant roles. However, our analysis of
34 mitotically associated Katanin interacting proteins could have precluded the identification of important interactors that only associate with Katanins during interphase. Therefore, additional proteomic analyses of Katanin purifications from interphase cells could elucidate additional interacting proteins important for regulating microtubule–severing.
Our binding experiments indicated that KATNAL2 did not bind to other Katanin subunits, however it is possible that the epitope-tagged KATNAL2 was not properly folded or that different KATNAL2 isoforms were binding to themselves and potentially excluding other interactions, as has been shown for the five alternatively spliced mouse
KATNAL2 isoforms (89). However, there is no evidence for alternatively spliced forms of
KATNAL2 in humans. Additionally, KATNAL2 had more mitotic interactors than any other Katanin subunit in the network. KATNAL2 interactors included CDK5RAP2, and
CEP295, which are important regulators of centriole amplification (92,98); CDK5RAP2,
WDR62, and CEP97, which are critical for maintaining a bipolar spindle and
CDK5RAP2 also plays a role in promoting cytokinesis and maintaining a normal nuclear size (92,99,100); and CEP97 and PCM1, which have roles in primary cilium formation
(99,101). This is interesting in light of a recent study, which showed that mouse
KATNAL2 has multiple roles in microtubule-based processes such as centriole amplification, spindle bipolarity, cytokinesis, nuclear morphology and ciliogenesis (89).
Although we were unable to detect KATNAL2 microtubule-severing activity in cells
(supplemental Fig. S2), it is possible that KATNAL2 can regulate these cellular processes through its protein-protein interactions. Along these lines, in Caenorhabditis elegans the spindle assembly function of the Katanin A subunit MEI-1 does not require
35 its microtubule-severing activity, indicating that Katanins may have microtubule-severing independent roles in spindle assembly (102).
A key unanswered question is how does KATNBL1 localize to the spindle poles during mitosis. KATNB1 has been shown to localize to the spindle poles through its
WD40 domain, however KATNBL1 lacks the WD40 domain (41). Interestingly,
KATNBL1 interacted with WDR62, which is known to localize to the spindle poles and is required for spindle organization (103). Therefore it is possible that WDR62 may be targeting KATNBL1 to the spindle poles during mitosis and should be explored further.
Additionally, KATNBL1 contains the C-terminal con80 domain that in KATNB1 binds to
KATNA1 and our binding studies indicated that KATNBL1 was able to interact with
KATNA1 and KATNAL1 (40,102) (Fig. 2). Thus it is also possible that KATNBL1 localizes to the spindle poles through its interaction with KATNA1 and KATNAL1.
Whereas KATNB1 was able to robustly compete the KATNA1-KATNBL1 and
KATNAL1-KATNBL1 interactions in a dose dependent manner (Fig. 6A and B),
KATNBL1 was only able to weakly compete the KATNA1-KATNB1 and KATNAL1-
KATNB1 interactions (Fig. 6C and D), indicating that in vitro KATNBL1 had a weaker association with KATNA1 and KATNAL1 compared to KATNB1. Interestingly, these observations are consistent with a previous study showing that the N-terminus of
KATNAL1 bound to either KATNB1 or KATNBL1 and that depletion of the first 29 amino acids of KATNAL1 drastically decreased its association with KATNBL1 and only had a minor effect on its association with KATNB1 (102). These data indicate that KATNB1 likely has multiple sites of interaction with KATNAL1 and therefore we would expect
KATNB1 to have a stronger association with KATNAL1 compared to KATNBL1. Finally,
36 the inhibition of KATNAL1 microtubule-severing activity with equimolar concentrations of
KATNBL1 was surprising (Fig. 4A and B), however a possible explanation could be that each KATNBL1 monomer binds to a KATNAL1 monomer and associates it with microtubules, thereby depleting the levels of free KATNAL1 monomers that are available to form homo-hexamers needed for microtubule-severing. Consistent with this, the con80 domain that is found at the C-terminus of KATNBL1 has been shown to bind to both microtubules and to the Katanin A subunit (40). Therefore, lower concentrations of KATNBL1 would facilitate KATNAL1 microtubule-binding and still allow the formation of KATNAL1 homo-hexamers, thereby stimulating microtubule-severing.
To our knowledge this is the first characterization of KATNBL1’s function in regulating microtubule-severing. KATNBL1 co-purified and co-immunoprecipitated with
KATNA1 and KATNAL1 indicating that it was associating directly with these enzymes in cells (Figs. 1B and 2). In vitro, KATNBL1 was able to regulate the microtubule-severing activity of KATNAL1 in a concentration dependent manner (Fig. 4 and supplemental Fig.
S3). However, the localization of KATNBL1 to the nucleus during interphase implies that
KATNBL1 is only able to bind and regulate KATNA1 and KATNAL1 microtubule- severing during mitosis, when the nuclear membrane is dissolved. This also implies that
KATNB1 and KATNBL1 may be in competition/equilibrium to stimulate or inhibit Katanin microtubule-severing during mitosis. How KATNB1 and KATNBL1 coordinate and are regulated to ensure the appropriate amount of microtubule-severing during mitosis remains to be explored.
37 Chapter 5 - Future Directions
Both KATNA1 and KATNAL1 have been shown to sever microtubules and regulate spindle morphology in cell division. However, it is still unclear why mammalian cells express multiple Katanin subunits that have redundant roles in cell division. Since
KATNA1 and KATNAL1 co-purified in LAP-tag purification, it is possible that mammalian
Katanins can form hetero-hexamers in addition to homo-hexamers. Further, it is not clear how Katanin catalytic subunits form hexameric ring in the presence of regulatory subunits. The Katanin hexamer is very unstable and structural characterization of the intact hexamer remains challenging for NMR and X-ray crystallography. High-resolution cryo-electron microscopy (cryo-EM) requires less proteins and minimal sample manipulation and may provide a valuable tool for visualizing Katanin hexameric rings with different combinations of mammalian Katanin subunits.
Although the role of KATNAL1 in mitosis has been characterized, it is still unclear how KATNAL1 is regulated or if these pathways overlap with the regulation of KATNA1
(83). KATNA1 and KATNAL1 have redundant microtubule-severing function in mitosis, which could explain why depletion of KATNA1 only leads to mild mitotic defects in dividing cells. Our proteomic analysis identified a number of proteins that can potentially regulate KATNAL1 through post-translational modification, such as CDK1, CDK2 and
PLK2. Interestingly, KATNA1 and KATNAL1 are the only pair of mammalian Katanin proteins that did not share any common interactors (except tubulins). These results suggest that separate pathways may regulate microtubule-severing activities of
KATNA1 and KATNAL1 during mitosis. Future work should focus on the regulation of
38 KATNAL1 to understand how KATNA1 and KATNAL1 complement each other to regulate microtubule dynamics during cell division.
Our results identified KATNBL1 as a novel Katanin regulator in mammalian cells, which suggest a more complex microtubule-severing regulatory mechanism than previously expected. KATNB1 has been shown to regulate Katanin either directly or through interactions with other proteins and can modulate both microtubule-severing activity and localization of KATNA1 (40,57). Future studies should also focus on understanding how KATNBL1 regulates the Katanin catalytic subunits and on the identified KATNBL1 interactors that can regulate Katanin catalytic subunits through
KATNBL1-interactions.
Mammalian KATNAL2 colocalizes with all other Katanin family members to the spindle poles during mitosis. Although we did not observe microtubule-severing activity of KATNAL2, it interacts with a broad number of mitotic proteins in mitosis. Consistent with our results, KATNAL2 depleted cells show a variety of spindle defects including multipolar spindles, mis-aligned chromosomes and cytokinetic failure. Finally, it will be interesting to investigate the functional relationship between KATNAL2 and its mitotic interactors such as CDK5RAP2, CDK1 and CDK2, which regulate centriole and centrosome homeostasis in mitosis.
Chapter 6 - Materials and Methods
6.1 Cell culture and cell cycle synchronization
All chemicals were purchased from Thermo Scientific unless otherwise noted. HeLa and
HeLa Flp-In T-REx LAP-tagged stable cell lines were grown in F12:DMEM 50:50
39 o medium (GIBCO) with 10% FBS, 2 mM L-glutamine and antibiotics, in 5% CO2 at 37 C.
Cells were induced to express the indicated LAP-tagged proteins by the addition of
.2µg/ml doxycycline (Sigma-Aldrich). For synchronization of cells in mitosis, cells were treated with 100 nM Taxol (Sigma-Aldrich) for 16 hours.
6.2 Plasmids, mutation and generation of LAP-tagged Katanin inducible stable cell lines
For full-length KATNA1, KATNAL1, KATNAL2, KATNB1, and KATNBL1, or STARD9-
START and STARD9-MD expression, cDNA corresponding to the full-length open reading frame of each Katanin or the indicated STARD9 domains was fused to the C- terminus of either HA (pCS2-HA-DEST vector), Myc (pCS2-Myc-DEST vector), FLAG
(pCDNA3-FLAG-DEST vector), GST (pGEX-6p-1-DEST vector) or EGFP (pGLAP1 vector) using the Gateway cloning system (Invitrogen) as described previously (85). The pGLAP1-Katanin vectors were used to generate doxycycline inducible HeLa Flp-In T-
REx LAP-KATNA1, KATNAL1, KATNAL2, KATNB1, and KATNBL1 stable cell lines that express the fusion protein from a specific single locus within the genome as described previously (86). For KATNBL1 mutations, pGLAP1-KATNBL1 was mutated using the
QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) with primers carrying the desired mutations, as described previously (104), whereas truncation mutants were generated by PCR amplification and cloning into pGLAP1 as described above. All primers were purchased from Fisher Scientific. For a list of primers used see supplemental Table S3.
40 6.3 Immunoprecipitations
For cell extract immunoprecipitations (IPs), LAP-KATNA1, LAP-KATNAL1, LAP-
KATNB1, or LAP-KATNBL1 HeLa stable cells lines were transfected with the indicated
HA-tagged Katanin subunit expression vectors for 24 hours and whole cell extracts were prepared in LAP150 lysis buffer (50 mM Tris pH 7.4, 150 mM KCl, 1 mM EDTA, 1 mM MgCl2, 10% glycerol) plus 250 µM ATP, 0.3% NP40, 0.5 mM DTT and protease and phosphatase inhibitor cocktail (Thermo Scientific). Cell extracts were cleared by centrifugation at 15K RPM for 10 minutes. 140µg of cleared lysate was incubated with
5µl packed bead volume of anti-HA antibody conjugated magnetic beads (MBL) for 1 hour at 4oC. The beads were then washed 3 times with 50µl of LAP150 lysis buffer and bound proteins were eluted with 20µl of 1X Laemmli SDS sample buffer (Bio-Rad). 6% of the sample inputs, 6% of the unbound fractions and the entire eluates from the immunoprecipitations were resolved on a 10% Tris gel (Bio-Rad) with Tris-Glycine SDS running buffer, transferred to a Immobilon PVDF membrane (EMD Millipore), immunoblotted with the indicated antibodies, and imaged with a LI-COR Odyssey imager (LI-COR Biosciences).
6.4 In vitro binding assays
For in vitro binding assays, HA, Myc, or FLAG-tagged KATNA1, KATNAL1, KATNAL2,
KATNB1, or KATNBL1 were in vitro transcribed and translated (TnT® Quick Coupled
Transcription/Translation System, Promega) in 50µl reactions. Two different Katanin reactions were combined and incubated with 5µl packed bead volume of anti-HA antibody conjugated magnetic beads (MBL) for 1 hour. Beads were washed four times
41 with a wash buffer containing 10 mM Tris pH 7.4, 100 mM NaCl, and 0.1% NP40. The beads were then boiled in 20µl of 1X Laemmli SDS sample buffer (Bio-Rad). 6% of the sample inputs, 6% of the unbound fractions (where indicated), and the entire eluates from the immunoprecipitations were resolved on a 10% Tris gel (Bio-Rad) with Tris-
Glycine SDS running buffer, transferred to a Immobilon PVDF membrane (EMD
Millipore), and binding was monitored by radiometric analysis with a PharosFX Plus molecular imaging system (Bio-Rad).
6.5 Tandem affinity purification of Katanins
The LAP-KATNA1, KATNAL1, KATNAL2, KATNB1, and KATNBL1 inducible stable cell lines were grown in roller bottles and induced with .2µg/ml Dox for 16 hours in the presence of 100 nM Taxol prior to harvesting cells, as described in (86). Mitotic cells were then harvested in the presence of protease (Thermo Scientific), phosphatase
(Thermo Scientific), and proteasome inhibitors (MG132, Enzo lifesciences). LAP-
KATNA1, KATNAL1, KATNAL2, KATNB1, and KATNBL1 were purified from cleared extracts using a previously established tandem affinity purification protocol (86).
6.6 In gel protein digestions
Sample lanes from SDS-PAGE were sliced into six pieces and placed into individual micro-centrifuge tubes. Each gel slice was dehydrated with 100% acetonitrile for 30 minutes. Cysteines were reduced with 100 mM dithiothreitol in 50 mM ammonium bicarbonate for 60 minutes at 37°C, followed by the removal of buffer, and subsequently alkylated with 55 mM iodoacetamide in 50 mM ammonium bicarbonate for 45 minutes at
42 room temperature in the dark. Buffer was decanted and gel slices were dehydrated with
100% acetonitrile followed by rehydration with 50 mM ammonium bicarbonate, repeated twice, except swelling in 5ng/µL trypsin with the second 50 mM ammonium bicarbonate rehydration step on ice for 45 minutes. Trypsin solution was decanted and samples were incubated at 37°C overnight. Peptides were extracted from the gel slices using
100µL of 50% acetonitrile for 20 minutes using water-bath sonication, repeated twice.
Extracted peptides were dried using Speed-Vac and reconstituted in 80µL of 3% acetonitrile with 0.1% formic acid. Peptides were desalted using C18 StageTips as previously described (105).
6.7 Nano-liquid chromatography with tandem mass spectrometry (LC-MS/MS) analysis
Nano-LC-MS/MS with collision-induced dissociation was performed on an Orbitrap XL
(Thermo Fisher) integrated with an Eksigent 2D nano-LC instrument. A laser-pulled reverse-phase column, 75 µm x 200 mm, containing 5-µm C18 resin with 300-Å pores
(AcuTech) was used for online peptide chromatography. Electrospray ionization conditions using the nanospray source (Thermo Fisher) for the Orbitrap were set as follows: capillary temperature at 200°C, tube lens at 110 V, and spray voltage at 2.3 kV.
The flow rate for reverse-phase chromatography was 300nl/min for loading and analytical separation (buffer A, 0.1% formic acid and 3% acetonitrile; buffer B, 0.1% formic acid and 100% acetonitrile). Peptides were loaded onto the column for 30 minutes and resolved by a gradient of 0–40% buffer B over 60 minutes. The Orbitrap was operated in data-dependent mode with a full precursor scan at high resolution
43 (60,000 at m/z 400) from 300-1,800 m/z and 10 MS/MS fragmentation scans at low resolution in the linear trap using charge-state screening excluding both unassigned and
+1 charge ions. For collision-induced dissociation, the intensity threshold was set to 500 counts, and a collision energy of 40% was applied. Dynamic exclusion was set with a repeat count of 1 and exclusion duration of 30 seconds.
6.8 Experimental design and statistical rational
Database searches of the acquired spectra were analyzed with Mascot (v2.4; Matrix
Science). The UniProt human database (March 19, 2014; 88,647 sequences;
35,126,742 residues) was used. The following search parameters were used: trypsin digestion allowing up to 2 missed cleavages, carbamidomethyl on cysteine as a fixed modification, oxidation of methionine as a variable modification, 10-ppm peptide mass tolerance, and 0.5-Da fragment mass tolerance. With these parameters, an overall 5% peptide false discovery rate, which accounts for total false positives and false negatives, was obtained using the reverse UniProt human database as the decoy database.
Peptides that surpassed an expectation cut-off score of 20 were accepted. All raw mass spectrometry files can be accessed at the UCSD Center for Computational Mass
Spectrometry MassIVE datasets ftp://[email protected] (login:
Torres, password: mitosis1). Peptides meeting the above criteria were filtered further.
First, peptides corresponding to common contaminants identified in the CRAPome (106) and an internal LAP purification database were excluded from further analysis. The lists of proteins identified from each of the Katanin subunit purifications as a single pass are listed in supplemental Table S1 and the spectrums of significant single peptides are in
44 supplemental Table S2. The final Katanin interactor lists were compiled and Cytoscape
(88), an open access software used for complex network analysis and visualization, was used to generate the human Katanin interactome (Katan-ome) (Fig. 1B).
6.9 Immunofluorescence microscopy
Immunofluorescence was carried out essentially as described previously (107) with minor modifications. HeLa stable cell lines were induced to express LAP-KATNA1,
KATNAL1, KATNAL2, KATNB1, and KATNBL1 for 16 hours, fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100/PBS, and co-stained with
0.5µg/ml Hoechst 33342 and the indicated antibodies. Images were captured with a
Leica DMI6000 microscope (Leica DFC360 FX Camera, 63x/1.40-0.60 NA oil objective,
Leica AF6000 software) at room temperature. Images were deconvolved with Leica
Application Suite 3D Deconvolution software and exported as TIFF files.
6.10 Preparation of GOPTS-PEG-biotin functional coverslips
Coverslips (22 mm × 30 mm) were cleaned by incubating with 2% Hellmanex® II solution at 60°C for 60 minutes, rinsed five times with Milli-Q water and dried in an oven.
In the silanization step, a drop of (3-Glycidyloxypropyl)-trimetoxysilane (GOPTS)
(Sigma, 440167) was sandwiched between every two coverslips and baked at 70°C for
60 minutes. Each coverslip was then rinsed through three beakers of 30mL glass- distilled acetone (Electron Microscopy Sciences, 10015) and air-dried. To functionalize coverslips with PEG-Biotin, 144mg of methoxy PEG Amine MW 3000 (Jenkem
Technology) and 16mg of biotin-PEG-NH2 MW 3,400 (Laysan Bio) were dissolved in
45 700µL DMF and 35µL was applied between each pair of GOPTS silanized coverslips followed by 75°C incubation in an oven for 8 hours. The coverslip sandwiches were quickly disassembled, rinsed in Milli-Q water, air-dried and stored at 4°C.
6.11 Katanin microtubule-severing TIRF assays
Flow cells were constructed with GOPTS-PEG-biotin functional coverslips and glass slides were separated by double-sided tape, four chambers were made for each coverslip. To prepare for microtubule immobilization, each chamber was first incubated with blocking buffer (5% pluronic F-127, 100µg/mL casein, 1× PBS) for 1 minute, followed by 1 minute incubation in 80 nM streptavidin in BRB80 (80 mM PIPES pH 7.5,
2 mM MgCl2, 2 mM EGTA). Chambers were rinsed with wash buffer (80 mM PIPES pH
7.5, 2 mM MgCl2, 2 mM EGTA, 40 mM D-glucose, 10 mM DTT) after each step.
Microtubules labeled with 10% rhodamine and 10% biotin were added and allowed to bind for 3 minutes. Chambers were then rinsed with TIRF buffer (80 mM PIPES pH 7.5,
2 mM MgCl2, 2 mM EGTA, 40 mM D-glucose, 10 mM DTT, 5 mM ATP, 1mg/mL glucose oxidase, 1mg/mL catalase) to remove unattached microtubules. To record time-lapse assays, the flow cell was placed on a DMI6000 TIRF microscope (Leica) and microtubules were brought to focus. 20µL of Katanin subunits were quickly flowed through the chamber at the indicated concentrations in TIRF buffer and images were collected every 10 seconds for 7 minutes. To measure the rate of microtubule-severing, the average fluorescence intensities of the time-lapse images were measured using
ImageJ and the background fluorescence was subtracted.
46
6.12 Recombinant protein expression and purification
GST-fusion Katanin protein constructs were expressed in Escherichia coli BL21 (DE3) cells, grown in 6 L LB media with ampicillin (100µg/mL) to an optical density of 0.6-0.8, and induced using 0.3 mM isopropyl thio-β-D-galactoside for ~18 hours at 16°C. Fresh cultures were harvested and resuspended in 100mL lysis buffer [50 mM Tris-HCl pH
8.0, 300 mM NaCl, 2 mM MgCl2, 10% glycerol, 0.5 mM ATP, 1 mM DTT and complete
EDTA-free protease inhibitor cocktail (Roche)] followed by lysis with a microfluidizer®
M110-P. Lysates were cleared by centrifugation at 15K RPM, 45 minutes, 4°C and incubated with Glutathione Agarose (Pierce) for 2 hours at 4°C. Bound proteins were washed three times with wash buffer (50 mM Tris-HCl pH 8.0, 200 mM NaCl, 2 mM
MgCl2, 10% glycerol, 0.5 mM ATP, 1 mM DTT) and eluted with 50 mM glutathione in storage buffer (20 mM HEPES pH 7.8, 50 mM KCl, 1 mM MgCl2, 10% glycerol, 0.25 mM
ATP, 1 mM DTT), followed by dialysis into storage buffer at 4°C overnight. Dialyzed elutions were flash frozen in aliquots and stored at -80°C until use to prevent multiple freeze-thaw cycles. Katanin protein concentrations were determined using the Bradford reagent (Bio-Rad) and comparing to bovine serum albumin (BSA) standards with a
NanoDrop 2000 (Thermo Scientific). For in vitro binding experiments, 35S-radiolabeled
Katanins were expressed using the TnT® Quick Coupled Transcription/Translation
System (Promega) (104).
47
6.13 Antibodies
Immunofluorescence, immunoblotting, and immunoprecipitations were carried out using the following antibodies: GFP (Abcam), Gapdh (GeneTex), α-tubulin (Serotec), HA (Cell
Signaling). Secondary antibodies conjugated to FITC, Cy3 and Cy5 were from Jackson
Immuno Research (Affinipure).
48
Chapter 7 – Supplemental Figures
A""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""B"Bead%%HA% Bead%%HA% " B1/BL1% GFP)A1% B1/BL1% GFP)AL1% " % % " " " " GFP)A1% GFP)AL1% "WB% HA)B1% WB% HA)B1% " HA)BL1% HA)BL1% "
C"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""D"Bead%%HA% Bead%%HA% " B1/BL1% GFP)B1% %%%BL1% GFP)BL1% " % % " " " GFP)B1% GFP)BL1% " WB% WB% HA)B1% HA)BL1% " HA)BL1% " " E""" Myc)A1% Myc)AL1% Bead%%HA% A1/AL1/B1/BL1/PME% Myc)B1%% Myc)BL1%%
%%HA)tagged:% %%HA)tagged:% Myc)tagged:% Myc)tagged:%
*%%%%%%*%%%% *%%%%%%*%%%%%%*%%%%%%*%%%%%%%*%%%%%%%*%%%%%%%*%% *%%%% *%%%%
*%Asterisks%indicate%HA)tagged%immunoprecipitated%proteins% %%%Arrows%indicate%Myc)tagged%B1%or%BL1%that%co)precipitate%with%HA)tagged%A1%and%AL1%%
49 Figure S1 - Katanin subunit interactions.
A-D) In cell Katanin subunit pairwise binding reactions. (A-B) LAP-tagged GFP-A1 (A) or GFP-AL1 (B) HeLa stable cell lines were transfected with HA-tagged B1 or BL1 subunits. HA-B1 or HA-BL1 were immunoprecipitated from 140µg of protein extracts. 6% of the input and all of the immunoprecipitates were western blotted (WB) for the indicated GFP-tagged A subunits (using anti-GFP antibodies) and the HA-tagged B subunits (using anti-HA antibodies). NT denotes non-transfected. (C-D) same as in A-B, except that LAP-tagged GFP-B1 (C) or GFP-BL1 (D) HeLa stable cell lines were transfected with HA-tagged B1 or BL1 subunits. E) In vitro 35S-radiolabeled Katanin subunit pairwise binding reactions. In vitro transcribed and translated 35S-radiolabeled HA-tagged A subunits or B subunits or Myc-tagged A subunits or B subunits were used for pairwise in vitro binding reactions as indicated. HA-tagged Katanin subunits were then immunoprecipitated and the radiolabeled Katanin subunits in the immunoprecipitates were visualized by autoradiography. The bands corresponding to the immunoprecipitated HA-tagged Katanin subunits contain an asterisk below them. PME denotes the negative control protein PME-1. Note that Myc-B1 and Myc-BL1 (indicated by arrows) co-precipitate with both HA-A1 and HA-AL1.
&'(%% )*+% ,-./0/123% !"#$"% !"# !$"# !$%#
Figure S2 - KATNAL2 does not display microtubule-severing activity.
Immunofluorescence microscopy of cells transfected with GFP-KATNA1, GFP- KATNAL1 or GFP-KATNAL2 for 48 hours. Cells were fixed with paraformaldehyde and stained with Hoechst 33342 to detect the DNA, anti-α-tubulin antibodies to detect microtubules, and anti-GFP antibodies to detect GFP-Katanin subunit localization. Note
50 that in cells overexpressing GFP-KATNA1 or GFP-KATNAL1 (see arrows) microtubules are severed, whereas microtubules remain stabilized in cells overexpressing GFP- KATNAL2. Bar= 5µm.
120%#
100%# ,# +# 80%#
60%# ++# 40%# Fluorescence*signal*
20%# +++# 0%# 0# 50# 100# 150# 200# 250# 300# 350# 400# 450# Time*(seconds)* AL1##############################################AL1#+#B1#procon80#1:1############AL1#+#BL1#1:0.5# AL1#+#BL1#1:0.125#####################AL1#+#BL1#1:0.0625##################AL1#+#BL1#1:0.03125################## No#Katanin# ,,#No#ac2vity;#+,#Weak#ac2vity;#++,#Medium#ac2vity;#+++,#Fast#ac2vity# #
Figure S3 - Quantification of time-lapse microtubule TIRF fluorescence signals in the presence (or absence) of various katanin subunits.
Quantification of microtubule fluorescence signals of the TIRF data presented in Fig. 4B. Each data point represents the average of three individual experiments. Error bars indicate +/- SD. Average fluorescence signals of time-lapse TIRF images were measured with ImageJ. Each time point represents the percentage of the average fluorescence signal remaining in comparison to the initial amount of fluorescence signal at t = 0s. (+++) indicates fast microtubule-severing activity, (++) indicates medium microtubule-severing activity, (+) indicates weak microtubule-severing activity, and (-) no microtubule-severing activity.
51 !"#$%&'( 2)3(( 0!1(((((((2)3(((((456"7((((8%'9%( )*#&$+,&-*./( ( :6(( A(
(;35<<(( A(
;35<<(( ==5=>1( 5( >35>?1(
@5331( A(
F=5F>1( A(
@5331( F=5F>1( A(
==5=>1( A(
@5331( F=5F>1( A( ==5=>1( ==5=>1( >35>?1( 5DA(
G<5G>1( A(
>35>?1( G<5G>1( 5DA(
A(B(!"#$%&'($*#&$+,&-*.C(( 5DA(B(E&'-&$(."#$%&'($*#&$+,&-*.( 5(B(!*(."#$%&'($*#&$+,&-*.(
52 Figure S4 - KATNBL1 localization to the nucleus during interphase requires an N- terminal nuclear localization sequence.
Immunofluorescence microscopy of cells transfected with wildtype (WT) GFP- KATNBL1, GFP-KATNBL1 NLS1 and NLS2 mutants, and GFP-KATNBL1 truncation mutants as indicated for 24 hours. Cells were fixed with paraformaldehyde and stained with Hoechst 33342 to detect the DNA, anti-α-tubulin antibodies to detect microtubules, and anti-GFP antibodies to detect GFP-KATNBL1 localization. + indicates nuclear localization, +/- indicates partial nuclear localization and – indicates no nuclear localization. Bar= 5µm. See Fig. 5 for the localization of additional mutants. For a list of primers used for KATNBL1 mutagenesis see supplemental Table S3.
KATNA1
Protein Accession Num. of significant sequences % coverage Description KATNA1 O75449 450 78.8 Katanin p60 ATPase-containing subunit A1 OS=Homo sapiens GN=KATNA1 PE=1 SV=1 KATNAL1 Q9BW62 97 27.3 Katanin p60 ATPase-containing subunit A-like 1 OS=Homo sapiens GN=KATNAL1 PE=1 SV=1 HACE1 H0YC01 7 27.3 E3 ubiquitin-protein ligase HACE1 (Fragment) OS=Homo sapiens GN=HACE1 PE=4 SV=1 KATNB1 Q9BVA0 244 71.8 Katanin p80 WD40 repeat-containing subunit B1 OS=Homo sapiens GN=KATNB1 PE=1 SV=1 KATNBL1 Q9H079 67 63.5 KATNB1-like protein 1 OS=Homo sapiens GN=KATNBL1 PE=2 SV=1 TUBB P07437 31 41.4 Tubulin beta chain OS=Homo sapiens GN=TUBB PE=1 SV=2 TUBB4B P68371 25 38.7 Tubulin beta-4B chain OS=Homo sapiens GN=TUBB4B PE=1 SV=1 TUBB4A P04350 21 30.2 Tubulin beta-4A chain OS=Homo sapiens GN=TUBB4A PE=1 SV=2 TUBB2A Q13885 20 30.6 Tubulin beta-2A chain OS=Homo sapiens GN=TUBB2A PE=1 SV=1 TUBB3 Q13509 15 26.7 Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 TUBB8 Q3ZCM7 10 14.6 Tubulin beta-8 chain OS=Homo sapiens GN=TUBB8 PE=1 SV=2 TUBB6 K7ESM5 7 13.9 Tubulin beta-6 chain (Fragment) OS=Homo sapiens GN=TUBB6 PE=1 SV=1 TUBB1 Q9H4B7 3 4 Tubulin beta-1 chain OS=Homo sapiens GN=TUBB1 PE=1 SV=1 TUBA1A Q71U36 23 37.7 Tubulin alpha-1A chain OS=Homo sapiens GN=TUBA1A PE=1 SV=1 TUBA4A P68366 18 34.6 Tubulin alpha-4A chain OS=Homo sapiens GN=TUBA4A PE=1 SV=1 TUBA1B P68363 26 40.8 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 TUBA1C F5H5D3 23 32.2 Tubulin alpha-1C chain OS=Homo sapiens GN=TUBA1C PE=1 SV=1 TUBA3C Q13748 15 30.4 Tubulin alpha-3C/D chain OS=Homo sapiens GN=TUBA3C PE=1 SV=3 TUBA3E Q6PEY2 13 24 Tubulin alpha-3E chain OS=Homo sapiens GN=TUBA3E PE=1 SV=2 CLIP2 Q9UDT6 4 0.8 CAP-Gly domain-containing linker protein 2 OS=Homo sapiens GN=CLIP2 PE=1 SV=1 SEC16A F1T0I1 1 0 Protein transport protein Sec16A OS=Homo sapiens GN=SEC16A PE=1 SV=1 AURKA A3KFJ0 1 2.6 Aurora kinase A OS=Homo sapiens GN=AURKA PE=1 SV=1
53 KATNAL1
Protein Accession Num. of significant sequences % coverage Description KATNAL1 Q9BW62 379 74.3 Katanin p60 ATPase-containing subunit A-like 1 OS=Homo sapiens GN=KATNAL1 PE=1 SV=1 KATNA1 O75449 68 23.6 Katanin p60 ATPase-containing subunit A1 OS=Homo sapiens GN=KATNA1 PE=1 SV=1 KATNB1 Q9BVA0 214 60.6 Katanin p80 WD40 repeat-containing subunit B1 OS=Homo sapiens GN=KATNB1 PE=1 SV=1 KATNBL1 Q9H079 19 16.4 KATNB1-like protein 1 OS=Homo sapiens GN=KATNBL1 PE=2 SV=1 TUBB P07437 69 47.7 Tubulin beta chain OS=Homo sapiens GN=TUBB PE=1 SV=2 TUBB4B P68371 57 47.6 Tubulin beta-4B chain OS=Homo sapiens GN=TUBB4B PE=1 SV=1 TUBB6 Q9BUF5 26 18.8 Tubulin beta-6 chain OS=Homo sapiens GN=TUBB6 PE=1 SV=1 TUBB4A P04350 50 36.5 Tubulin beta-4A chain OS=Homo sapiens GN=TUBB4A PE=1 SV=2 TUBB3 Q13509 45 31.1 Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 TUBB2A Q13885 47 36.9 Tubulin beta-2A chain OS=Homo sapiens GN=TUBB2A PE=1 SV=1 TUBB8 Q3ZCM7 25 17.1 Tubulin beta-8 chain OS=Homo sapiens GN=TUBB8 PE=1 SV=2 TUBB1 Q9H4B7 16 6.4 Tubulin beta-1 chain OS=Homo sapiens GN=TUBB1 PE=1 SV=1 TUBA1B P68363 47 41.2 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 TUBA4A P68366 27 35 Tubulin alpha-4A chain OS=Homo sapiens GN=TUBA4A PE=1 SV=1 TUBA1C F5H5D3 42 30.1 Tubulin alpha-1C chain OS=Homo sapiens GN=TUBA1C PE=1 SV=1 TUBA1A Q71U36 38 35.3 Tubulin alpha-1A chain OS=Homo sapiens GN=TUBA1A PE=1 SV=1 TUBA3C Q13748 25 30 Tubulin alpha-3C/D chain OS=Homo sapiens GN=TUBA3C PE=1 SV=3 TUBA3E Q6PEY2 20 23.8 Tubulin alpha-3E chain OS=Homo sapiens GN=TUBA3E PE=1 SV=2 TUBA4B Q9H853 6 10.8 Putative tubulin-like protein alpha-4B OS=Homo sapiens GN=TUBA4B PE=5 SV=2 CDC2 A0A024QZP7 8 13.8 Cell division cycle 2, G1 to S and G2 to M, isoform CRA_a OS=Homo sapiens GN=CDC2 PE=1 SV=1 CDK1 A0A087WZZ9 7 12.9 Cyclin-dependent kinase 1 OS=Homo sapiens GN=CDK1 PE=1 SV=1 CDK2 E7ESI2 6 8 Cyclin-dependent kinase 2 OS=Homo sapiens GN=CDK2 PE=1 SV=1 CDK18 Q07002 6 4 Cyclin-dependent kinase 18 OS=Homo sapiens GN=CDK18 PE=1 SV=3 CDK16 A0A087WZU2 4 1.8 Cyclin-dependent kinase 16 OS=Homo sapiens GN=CDK16 PE=1 SV=1 IQGAP1 P46940 3 2.5 Ras GTPase-activating-like protein IQGAP1 OS=Homo sapiens GN=IQGAP1 PE=1 SV=1 UBAP2L Q5VU77 2 2.6 Ubiquitin-associated protein 2-like (Fragment) OS=Homo sapiens GN=UBAP2L PE=1 SV=1 SPEF2 Q9C093 6 0.7 Sperm flagellar protein 2 OS=Homo sapiens GN=SPEF2 PE=1 SV=2 PCM1 H0YBA1 1 1.4 Pericentriolar material 1 protein (Fragment) OS=Homo sapiens GN=PCM1 PE=1 SV=1 DIAPH3 Q9NSV4 1 0.8 Protein diaphanous homolog 3 OS=Homo sapiens GN=DIAPH3 PE=1 SV=4 PLK2 A0A087WUH9 1 1 Serine/threonine-protein kinase PLK OS=Homo sapiens GN=PLK2 PE=1 SV=1
54 KATNAL2
Protein Accession Num. of significant sequences % coverage Description KATNAL2 Q8IYT4 279 58.9 Katanin p60 ATPase-containing subunit A-like 2 OS=Homo sapiens GN=KATNAL2 PE=2 SV=3 TUBB P07437 158 54.3 Tubulin beta chain OS=Homo sapiens GN=TUBB PE=1 SV=2 TUBB4B P68371 150 54.2 Tubulin beta-4B chain OS=Homo sapiens GN=TUBB4B PE=1 SV=1 TUBB2A Q13885 133 46.7 Tubulin beta-2A chain OS=Homo sapiens GN=TUBB2A PE=1 SV=1 TUBB3 Q13509 98 33.6 Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 TUBB6 Q9BUF5 55 19.5 Tubulin beta-6 chain OS=Homo sapiens GN=TUBB6 PE=1 SV=1 TUBB4A P04350 122 38.7 Tubulin beta-4A chain OS=Homo sapiens GN=TUBB4A PE=1 SV=2 TUBB8 Q3ZCM7 82 17.1 Tubulin beta-8 chain OS=Homo sapiens GN=TUBB8 PE=1 SV=2 TUBB1 Q9H4B7 33 6.4 Tubulin beta-1 chain OS=Homo sapiens GN=TUBB1 PE=1 SV=1 TUBA1C F5H5D3 120 48.9 Tubulin alpha-1C chain OS=Homo sapiens GN=TUBA1C PE=1 SV=1 TUBA4A P68366 111 52.2 Tubulin alpha-4A chain OS=Homo sapiens GN=TUBA4A PE=1 SV=1 TUBA1B P68363 129 56.3 Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 TUBA1A Q71U36 120 53.2 Tubulin alpha-1A chain OS=Homo sapiens GN=TUBA1A PE=1 SV=1 TUBA3C Q13748 96 44.2 Tubulin alpha-3C/D chain OS=Homo sapiens GN=TUBA3C PE=1 SV=3 TUBA3E Q6PEY2 73 39.6 Tubulin alpha-3E chain OS=Homo sapiens GN=TUBA3E PE=1 SV=2 TUBAL3 A6NHL2 18 5.8 Tubulin alpha chain-like 3 OS=Homo sapiens GN=TUBAL3 PE=1 SV=2 DYNC1H1 Q14204 105 22.2 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 ASPM Q8IZT6 24 7 Abnormal spindle-like microcephaly-associated protein OS=Homo sapiens GN=ASPM PE=1 SV=2 CCAR2 Q8N163 21 20.8 Cell cycle and apoptosis regulator protein 2 OS=Homo sapiens GN=CCAR2 PE=1 SV=2 SEC16A F1T0I1 19 7.5 Protein transport protein Sec16A OS=Homo sapiens GN=SEC16A PE=1 SV=1 LMNA P02545 8 10.7 Prelamin-A/C OS=Homo sapiens GN=LMNA PE=1 SV=1 IQGAP3 F2Z2E2 11 7.4 Ras GTPase-activating-like protein IQGAP3 OS=Homo sapiens GN=IQGAP3 PE=1 SV=1 IQGAP1 P46940 3 1.6 Ras GTPase-activating-like protein IQGAP1 OS=Homo sapiens GN=IQGAP1 PE=1 SV=1 NUMA1 Q14980 8 4.8 Nuclear mitotic apparatus protein 1 OS=Homo sapiens GN=NUMA1 PE=1 SV=2 CASC5 Q8NG31 15 7 Protein CASC5 OS=Homo sapiens GN=CASC5 PE=1 SV=3 RANBP2 P49792 2 1 E3 SUMO-protein ligase RanBP2 OS=Homo sapiens GN=RANBP2 PE=1 SV=2 CHORDC1 E9PIZ4 1 12.9 Cysteine and histidine-rich domain-containing protein 1 OS=Homo sapiens GN=CHORDC1 PE=1 SV=1 KIF11 P52732 4 4.3 Kinesin-like protein KIF11 OS=Homo sapiens GN=KIF11 PE=1 SV=2 MAD2L1 Q13257 1 7.8 Mitotic spindle assembly checkpoint protein MAD2A OS=Homo sapiens GN=MAD2L1 PE=1 SV=1 CDC2 A0A024QZP7 4 9.8 Cell division cycle 2, G1 to S and G2 to M, isoform CRA_a OS=Homo sapiens GN=CDC2 PE=1 SV=1 CDK1 P06493-2 2 8.8 Isoform 2 of Cyclin-dependent kinase 1 OS=Homo sapiens GN=CDK1 CDK2 E7ESI2 3 8 Cyclin-dependent kinase 2 OS=Homo sapiens GN=CDK2 PE=1 SV=1 CDK16 A0A087WZU2 2 1.8 Cyclin-dependent kinase 16 OS=Homo sapiens GN=CDK16 PE=1 SV=1 MACF1 H3BPE1 3 0.6 Microtubule-actin cross-linking factor 1, isoforms 1/2/3/5 OS=Homo sapiens GN=MACF1 PE=1 SV=1 MTCL1 Q9Y4B5 5 2.7 Microtubule cross-linking factor 1 OS=Homo sapiens GN=MTCL1 PE=1 SV=5 ANAPC1 Q9H1A4 3 2 Anaphase-promoting complex subunit 1 OS=Homo sapiens GN=ANAPC1 PE=1 SV=1 BRCA2 P51587 3 0.6 Breast cancer type 2 susceptibility protein OS=Homo sapiens GN=BRCA2 PE=1 SV=2 CDK5RAP2 A0A0A0MRG9 1 0.7 CDK5 regulatory subunit-associated protein 2 OS=Homo sapiens GN=CDK5RAP2 PE=1 SV=1 PCM1 A6NNN6 4 2.2 Pericentriolar material 1 protein OS=Homo sapiens GN=PCM1 PE=1 SV=5 WDR62 O43379 3 2.5 WD repeat-containing protein 62 OS=Homo sapiens GN=WDR62 PE=1 SV=4 HAUS6 Q5VY60 2 2.1 HAUS augmin-like complex subunit 6 OS=Homo sapiens GN=HAUS6 PE=1 SV=1 CEP295 Q9C0D2 3 1.1 Centrosomal protein of 295 kDa OS=Homo sapiens GN=CEP295 PE=2 SV=4 DCTN1 E7EX90 3 2.3 Dynactin subunit 1 OS=Homo sapiens GN=DCTN1 PE=1 SV=1 KATNA1 B7ZBC8 1 3.6 Katanin p60 ATPase-containing subunit A1 (Fragment) OS=Homo sapiens GN=KATNA1 PE=1 SV=1 DIAPH3 Q9NSV4 1 0.8 Protein diaphanous homolog 3 OS=Homo sapiens GN=DIAPH3 PE=1 SV=4 ANAPC5 F5GY68 1 4.1 Anaphase-promoting complex subunit 5 (Fragment) OS=Homo sapiens GN=ANAPC5 PE=1 SV=1 LMNB1 E9PBF6 2 5.9 Lamin-B1 OS=Homo sapiens GN=LMNB1 PE=1 SV=1 NCAPD2 E7EN77 2 2.1 Condensin complex subunit 1 (Fragment) OS=Homo sapiens GN=NCAPD2 PE=1 SV=2 CEP97 Q8IW35 2 2.3 Centrosomal protein of 97 kDa OS=Homo sapiens GN=CEP97 PE=1 SV=1 KIF14 Q15058 1 0.7 Kinesin-like protein KIF14 OS=Homo sapiens GN=KIF14 PE=1 SV=1 KIF26B Q2KJY2 1 0.6 Kinesin-like protein KIF26B OS=Homo sapiens GN=KIF26B PE=2 SV=1 SPAG5 K7ELC8 1 3.8 Sperm-associated antigen 5 (Fragment) OS=Homo sapiens GN=SPAG5 PE=1 SV=1
55 KATNB1
Protein Accession Num. of significant sequences % coverage Description KATNB1 Q9BVA0 619 619 Katanin p80 WD40 repeat-containing subunit B1 OS=Homo sapiens GN=KATNB1 PE=1 SV=1 KATNA1 O75449 157 45 Katanin p60 ATPase-containing subunit A1 OS=Homo sapiens GN=KATNA1 PE=1 SV=1 KATNAL1 Q9BW62 100 27.3 Katanin p60 ATPase-containing subunit A-like 1 OS=Homo sapiens GN=KATNAL1 PE=1 SV=1 TUBB P07437 108 43.5 Tubulin beta chain OS=Homo sapiens GN=TUBB PE=1 SV=2 TUBB4B P68371 102 43.4 Tubulin beta-4B chain OS=Homo sapiens GN=TUBB4B PE=1 SV=1 TUBB2A Q13885 81 36 Tubulin beta-2A chain OS=Homo sapiens GN=TUBB2A PE=1 SV=1 TUBB3 Q13509 54 28.7 Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 TUBB6 Q9BUF5 34 16.6 Tubulin beta-6 chain OS=Homo sapiens GN=TUBB6 PE=1 SV=1 TUBB4A P04350 92 32.4 Tubulin beta-4A chain OS=Homo sapiens GN=TUBB4A PE=1 SV=2 TUBB8 Q3ZCM7 64 16.9 Tubulin beta-8 chain OS=Homo sapiens GN=TUBB8 PE=1 SV=2 TUBB1 Q9H4B7 28 6.2 Tubulin beta-1 chain OS=Homo sapiens GN=TUBB1 PE=1 SV=1 WDR62 O43379 56 18.4 WD repeat-containing protein 62 OS=Homo sapiens GN=WDR62 PE=1 SV=4 TUBA1C Q9BQE3 49 31.2 Tubulin alpha-1C chain OS=Homo sapiens GN=TUBA1C PE=1 SV=1 TUBA4A P68366 32 23.4 Tubulin alpha-4A chain OS=Homo sapiens GN=TUBA4A PE=1 SV=1 TUBA3C Q13748 33 23.8 Tubulin alpha-3C/D chain OS=Homo sapiens GN=TUBA3C PE=1 SV=3 TUBA3E Q6PEY2 31 20 Tubulin alpha-3E chain OS=Homo sapiens GN=TUBA3E PE=1 SV=2 TUBA1B F8VVB9 26 38.6 Tubulin alpha-1B chain (Fragment) OS=Homo sapiens GN=TUBA1B PE=4 SV=2 TUBA1A F8VQQ4 19 39.7 Tubulin alpha-1A chain (Fragment) OS=Homo sapiens GN=TUBA1A PE=3 SV=1 TUBA8 C9J2C0 14 11.3 Tubulin alpha-8 chain (Fragment) OS=Homo sapiens GN=TUBA8 PE=3 SV=1 CEP170 Q5SW79 12 5.6 Centrosomal protein of 170 kDa OS=Homo sapiens GN=CEP170 PE=1 SV=1 KATNBL1 Q9H079 7 14.1 KATNB1-like protein 1 OS=Homo sapiens GN=KATNBL1 PE=2 SV=1 NUMA1 Q14980 7 3.6 Nuclear mitotic apparatus protein 1 OS=Homo sapiens GN=NUMA1 PE=1 SV=2 TUBGCP6 E7EQL8 6 3.3 Gamma-tubulin complex component 6 OS=Homo sapiens GN=TUBGCP6 PE=1 SV=1 ASPM Q8IZT6 7 2.3 Abnormal spindle-like microcephaly-associated protein OS=Homo sapiens GN=ASPM PE=1 SV=2 SEC16A J3KNL6 4 1.9 Protein transport protein Sec16A OS=Homo sapiens GN=SEC16A PE=1 SV=1 MPHOSPH9 Q99550 4 2.5 M-phase phosphoprotein 9 OS=Homo sapiens GN=MPHOSPH9 PE=1 SV=4 DYNC1H1 Q14204 6 1.4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 NUDC Q9Y266 5 9.1 Nuclear migration protein nudC OS=Homo sapiens GN=NUDC PE=1 SV=1 CASC5 Q8NG31 2 1.5 Protein CASC5 OS=Homo sapiens GN=CASC5 PE=1 SV=3 NEK3 J3KPF4 2 2.1 Serine/threonine-protein kinase Nek3 OS=Homo sapiens GN=NEK3 PE=1 SV=1 LMNB1 E9PBF6 1 3.6 Lamin-B1 OS=Homo sapiens GN=LMNB1 PE=1 SV=1 MACF1 H0Y390 2 0.5 Microtubule-actin cross-linking factor 1, isoforms 1/2/3/5 (Fragment) OS=Homo sapiens GN=MACF1 PE=1 SV=1 KIFC3 F5H3M2 2 1.5 Kinesin-like protein KIFC3 OS=Homo sapiens GN=KIFC3 PE=3 SV=1 PCM1 E5RGQ4 1 2.2 Pericentriolar material 1 protein (Fragment) OS=Homo sapiens GN=PCM1 PE=1 SV=1
KATNBL1
Protein Accession Num. of significant sequences % coverage Description KATNBL1 Q9H079 71 37.2 KATNB1-like protein 1 OS=Homo sapiens GN=KATNBL1 PE=2 SV=1 KATNB1 Q9BVA0 130 31.8 Katanin p80 WD40 repeat-containing subunit B1 OS=Homo sapiens GN=KATNB1 PE=1 SV=1 KATNA1 O75449 109 39.5 Katanin p60 ATPase-containing subunit A1 OS=Homo sapiens GN=KATNA1 PE=1 SV=1 KATNAL1 Q9BW62 54 23.1 Katanin p60 ATPase-containing subunit A-like 1 OS=Homo sapiens GN=KATNAL1 PE=1 SV=1 TUBB Q5JP53 20 26.8 Tubulin beta chain OS=Homo sapiens GN=TUBB PE=1 SV=1 TUBB4B P68371 19 25.6 Tubulin beta-4B chain OS=Homo sapiens GN=TUBB4B PE=1 SV=1 TUBB2A Q13885 15 18.2 Tubulin beta-2A chain OS=Homo sapiens GN=TUBB2A PE=1 SV=1 TUBB4A P04350 14 20.3 Tubulin beta-4A chain OS=Homo sapiens GN=TUBB4A PE=1 SV=2 TUBB3 A0A0B4J269 12 9 Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=1 TUBB8 Q3ZCM7 8 9.9 Tubulin beta-8 chain OS=Homo sapiens GN=TUBB8 PE=1 SV=2 TUBB6 K7ESM5 5 5.9 Tubulin beta-6 chain (Fragment) OS=Homo sapiens GN=TUBB6 PE=1 SV=1 TUBA1C Q9BQE3 6 13.1 Tubulin alpha-1C chain OS=Homo sapiens GN=TUBA1C PE=1 SV=1 TUBA4A P68366 3 7.8 Tubulin alpha-4A chain OS=Homo sapiens GN=TUBA4A PE=1 SV=1 TUBA3C Q13748 4 7.8 Tubulin alpha-3C/D chain OS=Homo sapiens GN=TUBA3C PE=1 SV=3 TUBA1A F8VQQ4 2 11 Tubulin alpha-1A chain (Fragment) OS=Homo sapiens GN=TUBA1A PE=1 SV=1 WDR62 O43379 1 1.1 WD repeat-containing protein 62 OS=Homo sapiens GN=WDR62 PE=1 SV=4 CDKL1 J3KMW1 2 2.5 Cyclin-dependent kinase-like 1 OS=Homo sapiens GN=CDKL1 PE=1 SV=1 MACF1 A0A0A6YYJ5 1 0.7 Microtubule-actin cross-linking factor 1, isoforms 1/2/3/5 OS=Homo sapiens GN=MACF1 PE=1 SV=1
56 Table S1 - Summary of the Katanin interactome (Katan-ome).
Summary of LAP-KATNA1 , KATNAL1 , KATNAL2 , KATNB1 and KATNBL1 interacting proteins identified by biochemical tandem affinity purifications and mass spectrometry analyses from mitotic cells. List includes protein name, UniProt accession number, number of peptides identified, the percent protein coverage and a description of each of the identified proteins.
57 KATNA1
AURKA
MS/MS Fragmentation of ATAPVGGPK Found in A3KFJ0 in UniProt-Human, Aurora kinase A OS=Homo sapiens GN=AURKA PE=1 SV=1
Match to Query 1287: 796.447854 from(399.231203,2+) index(4361) Title: jc_012214_Torres_AL-MIT-3.1058.1058.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\125 jc-012214-Torres-AL-MIT\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 796.4443 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 22 Expect: 0.056 Matches : 6/64 fragment ions using 7 most intense peaks (help)
# b b++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 72.0444 36.5258 A 9 2 173.0921 87.0497 155.0815 78.0444 T 726.4145 363.7109 709.3879 355.1976 708.4039 354.7056 8 3 244.1292 122.5682 226.1186 113.5629 A 625.3668 313.187 608.3402 304.6738 7 4 341.1819 171.0946 323.1714 162.0893 P 554.3297 277.6685 537.3031 269.1552 6 5 440.2504 220.6288 422.2398 211.6235 V 457.2769 229.1421 440.2504 220.6288 5 6 497.2718 249.1396 479.2613 240.1343 G 358.2085 179.6079 341.1819 171.0946 4 7 554.2933 277.6503 536.2827 268.645 G 301.187 151.0972 284.1605 142.5839 3 8 651.3461 326.1767 633.3355 317.1714 P 244.1656 122.5864 227.139 114.0731 2 9 K 147.1128 74.06 130.0863 65.5468 1
SEC16A
MS/MS Fragmentation of FRELLLYGR Found in F1T0I1 in UniProt-Human, Protein transport protein Sec16A OS=Homo sapiens GN=SEC16A PE=1 SV=1
Match to Query 7241: 1245.629124 from(623.821838,2+) index(8969) Title: jc_012214_Torres_AL-MIT-4.314.314.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\125 jc-012214-Torres-AL-MIT\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 1245.6271 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Variable modifications: Y7 : Phospho (Y) Ions Score: 31 Expect: 0.051 Matches : 8/78 fragment ions using 10 most intense peaks (help)
# b b++ b* b*++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 148.0757 74.5415 F 9 2 304.1768 152.592 287.1503 144.0788 R 1099.566 550.2866 1082.5394 541.7733 # 541.2813 8 3 433.2194 217.1133 416.1928 208.6001 415 208.1081 E 943.4649 472.2361 926.4383 463.7228 # 463.2308 7 4 546.3035 273.6554 529.2769 265.1421 528 264.6501 L 814.4223 407.7148 797.3957 399.2015 6 5 659.3875 330.1974 642.361 321.6841 641 321.1921 L 701.3382 351.1727 684.3117 342.6595 5 6 772.4716 386.7394 755.445 378.2262 754 377.7341 L 588.2541 294.6307 571.2276 286.1174 4 7 1015.5012 508.2543 998.4747 499.741 997 499.249 Y 475.1701 238.0887 458.1435 229.5754 3 8 1072.5227 536.765 1055.4962 528.2517 1055 527.7597 G 232.1404 116.5738 215.1139 108.0606 2 9 R 175.119 88.0631 158.0924 79.5498 1
58 KATNAL1
PCM1
MS/MS Fragmentation of ALYALQDIVSR Found in H0YBA1 in UniProt-Human, Pericentriolar material 1 protein (Fragment) OS=Homo sapiens GN=PCM1 PE=1 SV=1
Match to Query 9167: 1247.686624 from(624.850588,2+) index(3970) Title: jc_112413_IGD_Torres_AL2-2.2733.2733.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\77 Astrin\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 1247.6874 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 40 Expect: 0.00061 Matches : 13/100 fragment ions using 22 most intense peaks (help)
# a a++ a* a*++ b b++ b* b*++ Seq. y y++ y* y*++ # 1 44.0495 22.5284 72.0444 36.5258 A 11 2 157.1335 79.0704 185.1285 93.0679 L 1177.6576 589.3324 1160.631 580.8191 10 3 320.1969 160.6021 348.1918 174.5995 Y 1064.5735 532.7904 1047.5469 524.2771 9 4 391.234 196.1206 419.2289 210.1181 A 901.5102 451.2587 884.4836 442.7454 8 5 504.318 252.6627 532.313 266.6601 L 830.473 415.7402 813.4465 407.2269 7 6 632.3766 316.692 615.3501 308.1787 660.3715 330.6894 643.345 322.1761 Q 717.389 359.1981 700.3624 350.6849 6 7 747.4036 374.2054 730.377 365.6921 775.3985 388.2029 758.3719 379.6896 D 589.3304 295.1688 572.3039 286.6556 5 8 860.4876 430.7475 843.4611 422.2342 888.4825 444.7449 871.456 436.2316 I 474.3035 237.6554 457.2769 229.1421 4 9 959.556 480.2817 942.5295 471.7684 987.551 494.2791 970.5244 485.7658 V 361.2194 181.1133 344.1928 172.6001 3 10 1046.5881 523.7977 1029.5615 515.2844 1074.583 537.7951 1057.5564 529.2819 S 262.151 131.5791 245.1244 123.0659 2 11 R 175.119 88.0631 158.0924 79.5498 1
DIAPH3
MS/MS Fragmentation of LVTCLESLR Found in Q9NSV4 in UniProt-Human, Protein diaphanous homolog 3 OS=Homo sapiens GN=DIAPH3 PE=1 SV=4
Match to Query 6221: 1089.587014 from(545.800783,2+) index(881) Title: jc_112413_IGD_Torres_AL2-1.2010.2010.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\77 Astrin\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 1089.5852 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 33 Expect: 0.024 Matches : 7/64 fragment ions using 9 most intense peaks (help)
# a a++ b b++ Seq. y y++ y* y*++ # 1 86.0964 43.5519 114.0913 57.5493 L 9 2 185.1648 93.0861 213.1598 107.0835 V 977.5084 489.2579 960.4819 481 8 3 286.2125 143.6099 314.2074 157.6074 T 878.44 439.7237 861.4135 431 7 4 446.2432 223.6252 474.2381 237.6227 C 777.3924 389.1998 760.3658 381 6 5 559.3272 280.1673 587.3221 294.1647 L 617.3617 309.1845 600.3352 301 5 6 688.3698 344.6886 716.3647 358.686 E 504.2776 252.6425 487.2511 244 4 7 775.4019 388.2046 803.3968 402.202 S 375.235 188.1212 358.2085 180 3 8 888.4859 444.7466 916.4808 458.7441 L 288.203 144.6051 271.1765 136 2 9 R 175.119 88.0631 158.0924 79.5 1
59 KATNAL1
PLK2
MS/MS Fragmentation of QIVSGLK Found in A0A087WUH9 in UniProt-Human, Serine/threonine-protein kinase PLK OS=Homo sapiens GN=PLK2 PE=1 SV=1
Match to Query 1985: 823.422764 from(412.718658,2+) index(7357) Title: jc_112413_IGD_Torres_AL2-3.581.581.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\77 Astrin\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 823.4205 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Variable modifications: S4 : Phospho (ST), with neutral losses 0.0000(shown in table), 97.9769 Ions Score: 32 Expect: 0.021 Matches : 20/108 fragment ions using 41 most intense peaks (help)
# a a++ a* a*++ b b++ b* b*++ Seq. y y++ y* y*++ # 1 101.0709 51.0391 84.0444 42.5258 129.0659 65.0366 112.0393 56.5233 Q 7 2 214.155 107.5811 197.1285 99.0679 242.1499 121.5786 225.1234 113.0653 I 696.3692 348.6882 679.3426 340.1749 6 3 313.2234 157.1153 296.1969 148.6021 341.2183 171.1128 324.1918 162.5995 V 583.2851 292.1462 566.2586 283.6329 5 4 480.2218 240.6145 463.1952 232.1013 508.2167 254.612 491.1901 246.0987 S 484.2167 242.612 467.1901 234.0987 4 5 537.2432 269.1253 520.2167 260.612 565.2382 283.1227 548.2116 274.6094 G 317.2183 159.1128 300.1918 150.5995 3 6 650.3273 325.6673 633.3008 317.154 678.3222 339.6647 661.2957 331.1515 L 260.1969 130.6021 243.1703 122.0888 2 7 K 147.1128 74.06 130.0863 65.5468 1
60 KATNAL2
SPAG5
MS/MS Fragmentation of TTLEVLR Found in K7ELC8 in UniProt-Human, Sperm-associated antigen 5 (Fragment) OS=Homo sapiens GN=SPAG5 PE=1 SV=1
Match to Query 1787: 830.486664 from(416.250608,2+) index(2516) Title: jc_012214_Torres_AL2-2.1586.1586.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\124 jc-012214-Torres-AL2\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 830.4862 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 26 Expect: 0.017 Matches : 12/54 fragment ions using 28 most intense peaks (help)
# b b++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 102.055 51.5311 84.0444 42.5258 T 7 2 203.1026 102.055 185.0921 93.0497 T 730.4458 365.7265 713.4192 357.2132 712.4352 356.7212 6 3 316.1867 158.597 298.1761 149.5917 L 629.3981 315.2027 612.3715 306.6894 611.3875 306.1974 5 4 445.2293 223.1183 427.2187 214.113 E 516.314 258.6606 499.2875 250.1474 498.3035 249.6554 4 5 544.2977 272.6525 526.2871 263.6472 V 387.2714 194.1394 370.2449 185.6261 3 6 657.3818 329.1945 639.3712 320.1892 L 288.203 144.6051 271.1765 136.0919 2 7 R 175.119 88.0631 158.0924 79.5498 1
Kif26B
MS/MS Fragmentation of AAFFLDAAIASR Found in Q2KJY2 in UniProt-Human, Kinesin-like protein KIF26B OS=Homo sapiens GN=KIF26B PE=2 SV=1
Match to Query 8064: 1251.664034 from(626.839293,2+) index(3856) Title: jc_012214_Torres_AL2-2.3167.3167.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\124 jc-012214-Torres-AL2\mascot_daemon_merge
Monoisotopic mass of neutral peptide Mr(calc): 1251.6611 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 29 Expect: 0.0029 Matches : 18/98 fragment ions using 42 most intense peaks (help)
# b b++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 72.0444 36.5258 A 12 2 143.0815 72.0444 A 1181.6313 591.3193 1164.6048 582.806 1163.6208 582.314 11 3 290.1499 145.5786 F 1110.5942 555.8007 1093.5677 547.2875 1092.5837 546.7955 10 4 437.2183 219.1128 F 963.5258 482.2665 946.4993 473.7533 945.5152 473.2613 9 5 550.3024 275.6548 L 816.4574 408.7323 799.4308 400.2191 798.4468 399.7271 8 6 665.3293 333.1683 647.3188 324.163 D 703.3733 352.1903 686.3468 343.677 685.3628 343.185 7 7 736.3665 368.6869 718.3559 359.6816 A 588.3464 294.6768 571.3198 286.1636 570.3358 285.6715 6 8 807.4036 404.2054 789.393 395.2001 A 517.3093 259.1583 500.2827 250.645 499.2987 250.153 5 9 920.4876 460.7475 902.4771 451.7422 I 446.2722 223.6397 429.2456 215.1264 428.2616 214.6344 4 10 991.5247 496.266 973.5142 487.2607 A 333.1881 167.0977 316.1615 158.5844 315.1775 158.0924 3 11 1078.5568 539.782 1060.5462 530.7767 S 262.151 131.5791 245.1244 123.0659 244.1404 122.5738 2 12 R 175.119 88.0631 158.0924 79.5498 1
61
KATNAL2
KIF14
MS/MS Fragmentation of TIADSLINSFLK Found in Q15058 in UniProt-Human, Kinesin-like protein KIF14 OS=Homo sapiens GN=KIF14 PE=1 SV=1
Match to Query 9143: 1320.731544 from(661.373048,2+) index(4162) Title: jc_012214_Torres_AL2-2.3818.3818.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\124 jc-012214-Torres-AL2\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 1320.7289 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 31 Expect: 0.0013 Matches : 24/112 fragment ions using 75 most intense peaks (help)
# b b++ b* b*++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 102.055 51.5311 84 42.5258 T 12 2 215.139 108.0731 197 99.0679 I 1220.6885 610.8479 1203.662 602.3346 ## 601.8426 11 3 286.1761 143.5917 268 134.5864 A 1107.6045 554.3059 1090.5779 545.7926 ## 545.3006 10 4 401.2031 201.1052 383 192.0999 D 1036.5673 518.7873 1019.5408 510.274 ## 509.782 9 5 488.2351 244.6212 470 235.6159 S 921.5404 461.2738 904.5138 452.7606 ## 452.2686 8 6 601.3192 301.1632 583 292.1579 L 834.5084 417.7578 817.4818 409.2445 ## 408.7525 7 7 714.4032 357.7053 696 348.7 I 721.4243 361.2158 704.3978 352.7025 ## 352.2105 6 8 828.4462 414.7267 811.4196 406.2134 810 405.7214 N 608.3402 304.6738 591.3137 296.1605 ## 295.6685 5 9 915.4782 458.2427 898.4516 449.7295 897 449.2374 S 494.2973 247.6523 477.2708 239.139 ## 238.647 4 10 1062.5466 531.7769 1045.5201 523.2637 1045 522.7717 F 407.2653 204.1363 390.2387 195.623 3 11 1175.6307 588.319 1158.6041 579.8057 1158 579.3137 L 260.1969 130.6021 243.1703 122.0888 2 12 K 147.1128 74.06 130.0863 65.5468 1
ANAPC5
MS/MS Fragmentation of TSVVGLFLR Found in F5GY68 in UniProt-Human, Anaphase-promoting complex subunit 5 (Fragment) OS=Homo sapiens GN=ANAPC5 PE=1 SV=1
Match to Query 3874: 990.587434 from(496.300993,2+) index(6870) Title: jc_012214_Torres_AL2-3.3245.3245.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\124 jc-012214-Torres-AL2\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 990.5862 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 37 Expect: 0.00036 Matches : 16/66 fragment ions using 52 most intense peaks (help)
# b b++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 102.055 51.5311 84.0444 42.5258 T 9 2 189.087 95.0471 171.0764 86.0418 S 890.5458 445.7765 873.5193 437.2633 872.5352 436.7713 8 3 288.1554 144.5813 270.1448 135.5761 V 803.5138 402.2605 786.4872 393.7473 7 4 387.2238 194.1155 369.2132 185.1103 V 704.4454 352.7263 687.4188 344.213 6 5 444.2453 222.6263 426.2347 213.621 G 605.377 303.1921 588.3504 294.6788 5 6 557.3293 279.1683 539.3188 270.163 L 548.3555 274.6814 531.3289 266.1681 4 7 704.3978 352.7025 686.3872 343.6972 F 435.2714 218.1394 418.2449 209.6261 3 8 817.4818 409.2445 799.4713 400.2393 L 288.203 144.6051 271.1765 136.0919 2 9 R 175.119 88.0631 158.0924 79.5498 1
62 KATNAL2
DIAPH3
MS/MS Fragmentation of LVTCLESLR Found in Q9NSV4 in UniProt-Human, Protein diaphanous homolog 3 OS=Homo sapiens GN=DIAPH3 PE=1 SV=4
Match to Query 5446: 1089.585794 from(545.800173,2+) index(2963) Title: jc_012214_Torres_AL2-2.2082.2082.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\124 jc-012214-Torres-AL2\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 1089.5852 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 40 Expect: 0.0019 Matches : 11/72 fragment ions using 29 most intense peaks (help)
# b b++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 114.0913 57.5493 L 9 2 213.1598 107.0835 V 977.5084 489.2579 960.4819 480.7446 959.4979 480.2526 8 3 314.2074 157.6074 296.1969 148.6021 T 878.44 439.7237 861.4135 431.2104 860.4295 430.7184 7 4 474.2381 237.6227 456.2275 228.6174 C 777.3924 389.1998 760.3658 380.6865 759.3818 380.1945 6 5 587.3221 294.1647 569.3116 285.1594 L 617.3617 309.1845 600.3352 300.6712 599.3511 300.1792 5 6 716.3647 358.686 698.3542 349.6807 E 504.2776 252.6425 487.2511 244.1292 486.2671 243.6372 4 7 803.3968 402.202 785.3862 393.1967 S 375.235 188.1212 358.2085 179.6079 357.2245 179.1159 3 8 916.4808 458.7441 898.4703 449.7388 L 288.203 144.6051 271.1765 136.0919 2 9 R 175.119 88.0631 158.0924 79.5498 1
KATNA1
MS/MS Fragmentation of DIISQNPNVR Found in B7ZBC8 in UniProt-Human, Katanin p60 ATPase-containing subunit A1 (Fragment) OS=Homo sapiens GN=KATNA1 PE=1 SV=1
Match to Query 6442: 1154.606054 from(578.310303,2+) index(11874) Title: jc_012214_Torres_AL2-6.1003.1003.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\124 jc-012214-Torres-AL2\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 1154.6044 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 41 Expect: 0.0013 Matches : 18/88 fragment ions using 27 most intense peaks (help)
# b b++ b* b*++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 116.0342 58.5207 98 49.5155 D 10 2 229.1183 115.0628 211 106.0575 I 1040.5847 520.796 1023.5582 512.2827 ## 511.7907 9 3 342.2023 171.6048 324 162.5995 I 927.5007 464.254 910.4741 455.7407 ## 455.2487 8 4 429.2344 215.1208 411 206.1155 S 814.4166 407.7119 797.39 399.1987 ## 398.7067 7 5 557.293 279.1501 540.2664 270.6368 539 270.1448 Q 727.3846 364.1959 710.358 355.6826 6 6 671.3359 336.1716 654.3093 327.6583 653 327.1663 N 599.326 300.1666 582.2994 291.6534 5 7 768.3886 384.698 751.3621 376.1847 750 375.6927 P 485.2831 243.1452 468.2565 234.6319 4 8 882.4316 441.7194 865.405 433.2061 864 432.7141 N 388.2303 194.6188 371.2037 186.1055 3 9 981.5 491.2536 964.4734 482.7404 963 482.2483 V 274.1874 137.5973 257.1608 129.084 2 10 R 175.119 88.0631 158.0924 79.5498 1
63 KATNAL2
CDK5RAP2
MS/MS Fragmentation of SIETSSTLQSR Found in A0A0A0MRG9 in UniProt-Human, CDK5 regulatory subunit-associated protein 2 OS=Homo sapiens GN=CDK5RAP2 PE=1 SV=1
Match to Query 7263: 1207.605804 from(604.810178,2+) index(4673) Title: jc_012214_Torres_AL2-2.772.772.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\124 jc-012214-Torres-AL2\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 1207.6044 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 62 Expect: 8.9e-06 Matches : 10/102 fragment ions using 10 most intense peaks (help)
# b b++ b* b*++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 88.0393 44.5233 70 35.518 S 11 2 201.1234 101.0653 183 92.06 I 1121.5797 561.2935 1104.5531 552.7802 ## 552.2882 10 3 330.166 165.5866 312 156.5813 E 1008.4956 504.7515 991.4691 496.2382 ## 495.7462 9 4 431.2136 216.1105 413 207.1052 T 879.453 440.2302 862.4265 431.7169 ## 431.2249 8 5 518.2457 259.6265 500 250.6212 S 778.4054 389.7063 761.3788 381.193 ## 380.701 7 6 605.2777 303.1425 587 294.1372 S 691.3733 346.1903 674.3468 337.677 ## 337.185 6 7 706.3254 353.6663 688 344.661 T 604.3413 302.6743 587.3148 294.161 ## 293.669 5 8 819.4094 410.2084 801 401.2031 L 503.2936 252.1504 486.2671 243.6372 ## 243.1452 4 9 947.468 474.2376 930.4415 465.7244 929 465.2324 Q 390.2096 195.6084 373.183 187.0951 ## 186.6031 3 10 1034.5 517.7537 1017.4735 509.2404 1016 508.7484 S 262.151 131.5791 245.1244 123.0659 ## 122.5738 2 11 R 175.119 88.0631 158.0924 79.5498 1
MAD2L1
MS/MS Fragmentation of LVVVISNIESGEVLER Found in Q13257 in UniProt-Human, Mitotic spindle assembly checkpoint protein MAD2A OS=Homo sapiens GN=MAD2L1 PE=1 SV=1
Match to Query 12457: 1754.980804 from(878.497678,2+) index(13202) Title: jc_012214_Torres_AL2-6.2841.2841.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\124 jc-012214-Torres-AL2\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 1754.9778 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 97 Expect: 3.4e-09 Matches : 22/156 fragment ions using 29 most intense peaks (help)
# b b++ b* b*++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 114.0913 57.5493 L 16 2 213.1598 107.0835 V 1642.901 821.9542 1625.8745 813.4409 ## 812.9489 15 3 312.2282 156.6177 V 1543.8326 772.4199 1526.8061 763.9067 ## 763.4147 14 4 411.2966 206.1519 V 1444.7642 722.8857 1427.7376 714.3725 ## 713.8805 13 5 524.3806 262.694 I 1345.6958 673.3515 1328.6692 664.8383 ## 664.3462 12 6 611.4127 306.21 593 297.2047 S 1232.6117 616.8095 1215.5852 608.2962 ## 607.8042 11 7 725.4556 363.2314 708.4291 354.7182 707 354.2262 N 1145.5797 573.2935 1128.5531 564.7802 ## 564.2882 10 8 838.5397 419.7735 821.5131 411.2602 821 410.7682 I 1031.5368 516.272 1014.5102 507.7587 ## 507.2667 9 9 967.5823 484.2948 950.5557 475.7815 950 475.2895 E 918.4527 459.73 901.4262 451.2167 ## 450.7247 8 10 1054.6143 527.8108 1037.5877 519.2975 1037 518.8055 S 789.4101 395.2087 772.3836 386.6954 ## 386.2034 7 11 1111.6357 556.3215 1094.6092 547.8082 1094 547.3162 G 702.3781 351.6927 685.3515 343.1794 ## 342.6874 6 12 1240.6783 620.8428 1223.6518 612.3295 1223 611.8375 E 645.3566 323.1819 628.3301 314.6687 ## 314.1767 5 13 1339.7468 670.377 1322.7202 661.8637 1322 661.3717 V 516.314 258.6606 499.2875 250.1474 ## 249.6554 4 14 1452.8308 726.919 1435.8043 718.4058 1435 717.9138 L 417.2456 209.1264 400.2191 200.6132 ## 200.1212 3 15 1581.8734 791.4403 1564.8469 782.9271 1564 782.4351 E 304.1615 152.5844 287.135 144.0711 ## 143.5791 2 16 R 175.119 88.0631 158.0924 79.5498 1
64 KATNAL2
CHORDC1
MS/MS Fragmentation of TTDFSDFLSIVGCTK Found in Q9UHD1 in UniProt-Human, Cysteine and histidine-rich domain-containing protein 1 OS=Homo sapiens GN=CHORDC1 PE=1 SV=2
Match to Query 12126: 1689.795264 from(845.904908,2+) index(4107) Title: jc_012214_Torres_AL2-2.3664.3664.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\124 jc-012214-Torres-AL2\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 1689.7920 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 100 Expect: 2.1e-09 Matches : 27/138 fragment ions using 28 most intense peaks (help)
# b b++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 102.055 51.5311 84.0444 42.5258 T 15 2 203.1026 102.055 185.0921 93.0497 T 1589.7516 795.3794 1572.725 786.8662 1571.741 786.3741 14 3 318.1296 159.5684 300.119 150.5631 D 1488.7039 744.8556 1471.6774 736.3423 1470.6933 735.8503 13 4 465.198 233.1026 447.1874 224.0974 F 1373.677 687.3421 1356.6504 678.8288 1355.6664 678.3368 12 5 552.23 276.6186 534.2195 267.6134 S 1226.6086 613.8079 1209.582 605.2946 1208.598 604.8026 11 6 667.257 334.1321 649.2464 325.1268 D 1139.5765 570.2919 1122.55 561.7786 1121.566 561.2866 10 7 814.3254 407.6663 796.3148 398.661 F 1024.5496 512.7784 1007.523 504.2652 1006.539 503.7731 9 8 927.4094 464.2084 909.3989 455.2031 L 877.4812 439.2442 860.4546 430.7309 859.4706 430.2389 8 9 1014.4415 507.7244 996.4309 498.7191 S 764.3971 382.7022 747.3706 374.1889 746.3865 373.6969 7 10 1127.5255 564.2664 1109.515 555.2611 I 677.3651 339.1862 660.3385 330.6729 659.3545 330.1809 6 11 1226.5939 613.8006 1208.5834 604.7953 V 564.281 282.6441 547.2545 274.1309 546.2704 273.6389 5 12 1283.6154 642.3113 1265.6048 633.3061 G 465.2126 233.1099 448.186 224.5967 447.202 224.1047 4 13 1443.6461 722.3267 1425.6355 713.3214 C 408.1911 204.5992 391.1646 196.0859 390.1806 195.5939 3 14 1544.6937 772.8505 1526.6832 763.8452 T 248.1605 124.5839 231.1339 116.0706 230.1499 115.5786 2 15 K 147.1128 74.06 130.0863 65.5468 1
65 KATNB1
PCM1
MS/MS Fragmentation of MLQQQEQLR Found in E7ETA6 in UniProt-Human, Pericentriolar material 1 protein OS=Homo sapiens GN=PCM1 PE=1 SV=1
Match to Query 9125: 1188.599094 from(595.306823,2+) index(1) Title: jc_07111414_Torres_KATNB1-1.1001.1001.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\29 071114-jc-Torres-KATNB1\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 1188.5921 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Variable modifications: M1 : Oxidation (M), with neutral losses 0.0000(shown in table), 63.9983 Ions Score: 31 Expect: 0.01 Matches : 17/110 fragment ions using 49 most intense peaks (help)
# b b++ b* b*++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 148.0427 74.525 M 9 2 261.1267 131.067 L 1042.564 521.7856 1025.5374 513.2724 1024.5534 512.7803 8 3 389.1853 195.0963 372.1588 186.583 Q 929.4799 465.2436 912.4534 456.7303 911.4694 456.2383 7 4 517.2439 259.1256 500.2173 250.6123 Q 801.4213 401.2143 784.3948 392.701 783.4108 392.209 6 5 645.3025 323.1549 628.2759 314.6416 Q 673.3628 337.185 656.3362 328.6717 655.3522 328.1797 5 6 774.3451 387.6762 757.3185 379.1629 756.3345 378.6709 E 545.3042 273.1557 528.2776 264.6425 527.2936 264.1504 4 7 902.4036 451.7055 885.3771 443.1922 884.3931 442.7002 Q 416.2616 208.6344 399.235 200.1212 3 8 1015.4877 508.2475 998.4612 499.7342 997.4771 499.2422 L 288.203 144.6051 271.1765 136.0919 2 9 R 175.119 88.0631 158.0924 79.5498 1
LMNB1
MS/MS Fragmentation of LSSEMNTSTVNSAR Found in P20700 in UniProt-Human, Lamin-B1 OS=Homo sapiens GN=LMNB1 PE=1 SV=2
Match to Query 12905: 1511.700294 from(756.857423,2+) index(10517) Title: jc_07111414_Torres_KATNB1-3.831.831.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\29 071114-jc-Torres-KATNB1\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 1511.6886 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Variable modifications: M5 : Oxidation (M), with neutral losses 0.0000(shown in table), 63.9983 Ions Score: 53 Expect: 3.5e-05 Matches : 32/216 fragment ions using 49 most intense peaks (help)
# b b++ b* b*++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 114.0913 57.5493 L 14 2 201.1234 101.0653 183.1128 92.06 S 1399.6118 700.3095 1382.5852 691.7963 1381.6012 691.3043 13 3 288.1554 144.5813 270.1448 135.5761 S 1312.5798 656.7935 1295.5532 648.2802 1294.5692 647.7882 12 4 417.198 209.1026 399.1874 200.0973 E 1225.5477 613.2775 1208.5212 604.7642 1207.5372 604.2722 11 5 564.2334 282.6203 546.2228 273.615 M 1096.5051 548.7562 1079.4786 540.2429 1078.4946 539.7509 10 6 678.2763 339.6418 661.2498 331.1285 660.2658 330.6365 N 949.4697 475.2385 932.4432 466.7252 931.4592 466.2332 9 7 779.324 390.1656 762.2974 381.6524 761.3134 381.1604 T 835.4268 418.217 818.4003 409.7038 817.4163 409.2118 8 8 866.356 433.6816 849.3295 425.1684 848.3455 424.6764 S 734.3791 367.6932 717.3526 359.1799 716.3686 358.6879 7 9 967.4037 484.2055 950.3772 475.6922 949.3931 475.2002 T 647.3471 324.1772 630.3206 315.6639 629.3365 315.1719 6 10 1066.4721 533.7397 1049.4456 525.2264 1048.4616 524.7344 V 546.2994 273.6534 529.2729 265.1401 528.2889 264.6481 5 11 1180.515 590.7612 1163.4885 582.2479 1162.5045 581.7559 N 447.231 224.1191 430.2045 215.6059 429.2205 215.1139 4 12 1267.5471 634.2772 1250.5205 625.7639 1249.5365 625.2719 S 333.1881 167.0977 316.1615 158.5844 315.1775 158.0924 3 13 1338.5842 669.7957 1321.5576 661.2825 1320.5736 660.7904 A 246.1561 123.5817 229.1295 115.0684 2 14 R 175.119 88.0631 158.0924 79.5498 1
66 KATNBL1
WDR62
MS/MS Fragmentation of VLVSSGQVDTGQQQAR Found in O43379 in UniProt-Human, WD repeat-containing protein 62 OS=Homo sapiens GN=WDR62 PE=1 SV=4
Match to Query 8216: 1671.863864 from(836.939208,2+) index(1043) Title: jc_07111414_Torres_KATNB2-2.1105.1105.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\30 071114-jc-Torres-KATNB2\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 1671.8540 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 66 Expect: 7.9e-07 Matches : 26/150 fragment ions using 39 most intense peaks (help)
# b b++ b* b*++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 100.0757 50.5415 V 16 2 213.1598 107.0835 L 1573.7929 787.4001 1556.7663 778.8868 1555.7823 778.3948 15 3 312.2282 156.6177 V 1460.7088 730.858 1443.6823 722.3448 1442.6982 721.8528 14 4 399.2602 200.1337 381.2496 191.1285 S 1361.6404 681.3238 1344.6138 672.8106 1343.6298 672.3186 13 5 486.2922 243.6497 468.2817 234.6445 S 1274.6084 637.8078 1257.5818 629.2945 1256.5978 628.8025 12 6 543.3137 272.1605 525.3031 263.1552 G 1187.5763 594.2918 1170.5498 585.7785 1169.5658 585.2865 11 7 671.3723 336.1898 654.3457 327.6765 653.3617 327.1845 Q 1130.5549 565.7811 1113.5283 557.2678 1112.5443 556.7758 10 8 770.4407 385.724 753.4141 377.2107 752.4301 376.7187 V 1002.4963 501.7518 985.4698 493.2385 984.4857 492.7465 9 9 885.4676 443.2374 868.4411 434.7242 867.4571 434.2322 D 903.4279 452.2176 886.4013 443.7043 885.4173 443.2123 8 10 986.5153 493.7613 969.4888 485.248 968.5047 484.756 T 788.4009 394.7041 771.3744 386.1908 770.3904 385.6988 7 11 1043.5368 522.272 1026.5102 513.7587 1025.5262 513.2667 G 687.3533 344.1803 670.3267 335.667 6 12 1171.5953 586.3013 1154.5688 577.788 1153.5848 577.296 Q 630.3318 315.6695 613.3053 307.1563 5 13 1299.6539 650.3306 1282.6274 641.8173 1281.6434 641.3253 Q 502.2732 251.6402 485.2467 243.127 4 14 1427.7125 714.3599 1410.686 705.8466 1409.7019 705.3546 Q 374.2146 187.611 357.1881 179.0977 3 15 1498.7496 749.8784 1481.7231 741.3652 1480.739 740.8732 A 246.1561 123.5817 229.1295 115.0684 2 16 R 175.119 88.0631 158.0924 79.5498 1
MACF1
MS/MS Fragmentation of EVTSTVLHGK Found in A0A0A6YYJ5 in UniProt-Human, Microtubule-actin cross-linking factor 1, isoforms 1/2/3/5 OS=Homo sapiens GN=MACF1 PE=1 SV=1
Match to Query 4545: 1069.575784 from(535.795168,2+) index(6092) Title: jc_07111414_Torres_KATNB2-5.1531.1531.2.dta Data file C:\Program Files (x86)\Matrix Science\Mascot Daemon\mgf\30 071114-jc-Torres-KATNB2\mascot_daemon_merge.mgf
Monoisotopic mass of neutral peptide Mr(calc): 1069.5768 Fixed modifications: Carbamidomethyl (C) (apply to specified residues or termini only) Ions Score: 22 Expect: 0.049 Matches : 9/80 fragment ions using 27 most intense peaks (help)
# b b++ b0 b0++ Seq. y y++ y* y*++ y0 y0++ # 1 130.0499 65.5286 112.0393 56.5233 E 10 2 229.1183 115.0628 211.1077 106.0575 V 941.5415 471.2744 924.5149 462.7611 923.5309 462.2691 9 3 330.166 165.5866 312.1554 156.5813 T 842.473 421.7402 825.4465 413.2269 824.4625 412.7349 8 4 417.198 209.1026 399.1874 200.0974 S 741.4254 371.2163 724.3988 362.703 723.4148 362.211 7 5 518.2457 259.6265 500.2351 250.6212 T 654.3933 327.7003 637.3668 319.187 636.3828 318.695 6 6 617.3141 309.1607 599.3035 300.1554 V 553.3457 277.1765 536.3191 268.6632 5 7 730.3981 365.7027 712.3876 356.6974 L 454.2772 227.6423 437.2507 219.129 4 8 867.4571 434.2322 849.4465 425.2269 H 341.1932 171.1002 324.1666 162.587 3 9 924.4785 462.7429 906.468 453.7376 G 204.1343 102.5708 187.1077 94.0575 2 10 K 147.1128 74.06 130.0863 65.5468 1
67 Table S2 - Spectra of one peptide IDs in the Katan-ome.
Spectra of one peptide IDs in the LAP-KATNA1, KATNAL1, KATNAL2, KATNB1 and KATNBL1 mass spectrometry analyses from mitotic cells.
68 Annealing Construct Seq Name Seq 5’ to 3’ Sequence GGGGACAAGTTTGTACAAAAAAGCAGGC ATGGCATCAGAAACCC KATNB2.For TTCGAAGGAGATAGAACCATGGCATCAG ACAATGTT KATNBL1 WT AAACCCACAATGTT ATGTAACTGTAATAAAT GGGGACCACTTTGTACAAGAAAGCTGGG KATNB2.RevS AA TCCTAATGTAACTGTAATAAATAA GGGGACAAGTTTGTACAAAAAAGCAGGC GGACAAACTGTGAAAA KATNB2_Δ1-55.For TTCATGGGGGGACAAACTGTGAAAAGCC GCCC KATNBL1 Δ1-55 C ATGTAACTGTAATAAAT GGGGACCACTTTGTACAAGAAAGCTGGG KATNB2.RevS AA TCCTAATGTAACTGTAATAAATAA GGGGACAAGTTTGTACAAAAAAGCAGGC ATGGCATCAGAAACCC KATNB2.For TTCGAAGGAGATAGAACCATGGCATCAG ACAATGTT AAACCCACAATGTT KATNBL1 1-55 GGGGACCACTTTGTACAAGAAAGCTGGG CAA CTG TTC TAT TTA KATNB2_1-55.RevS TGTCA CAA CTG TTC TAT TTA TGT AAG TGT AAG CAG CC CAG CC KATNB2.For Primer box - B3 GGGGACCACTTTGTACAAGAAAGCTGGG KATNBL1 1-69 GAT CAC TTT ACG AAG KATNB2_1-69.RevS TG TCA GAT CAC TTT ACG AAG TTT ATC TTT ATC TGG GC TGG GC KATNB2.For Primer box - B3 GGGGACCACTTTGTACAAGAAAGCTGGG KATNBL1 1-98 TGC CAT GTC ACA GCC KATNB2_1-98.RevS TG TCA TGC CAT GTC ACA GCC C C
ATGGCATCAGAAACCCACAATGTTGCAAAACGGAACTTTTGTAATAA B2_K9A KATNBL1 K9A/K10A/R11A GATTGAGG Step 1 CCTCAATCTTATTACAAAAGTTCCGTTTTGCAACATTGTGGGTTTCTG B2_K9A-r ATGCCAT AATGAAATGATCCTCAATCTTATTACAAAAGTTCGCTGCTGCAACATT B2_K9A/K10A/R11A KATNBL1 K9A/K10A/R11A GTGGGTTTCTGATGCCAT Step 2 ATGGCATCAGAAACCCACAATGTTGCAGCAGCGAACTTTTGTAATAA B2_K9A/K10A/R11A-r GATTGAGGATCATTTCATT CTT CAT GTT CTT ATT AGT GAA ATT AGA GAT CTT TGC TGC AGG B2_R26AK27A.For AAG ATC AAT GAA ATG ATC CTC AAT CTT ATT A KATNBL1 R26A/K27A TAA TAA GAT TGA GGA TCA TTT CAT TGA TCT TCC TGC AGC AAA B2_R26AK27A.Rev GAT CTC TAA TTT CAC TAA TAA GAA CAT GAA G GAACTTTCTTTCTGCGATAGATCACTGCAGCAAGTTTATCTGGGCTTT B2_R66A/K67A TCACAGTTTGTC KATNBL1 R66A/K67A GACAAACTGTGAAAAGCCCAGATAAACTTGCTGCAGTGATCTATCGC B2_R66A/K67A-r AGAAAGAAAGTTC GGAAAGGGATGATGAACTTTCTTTGCGGCATAGATCACTTTACGAAG B2_R71A/R72A KATNBL1 TTTATCTGG R71A/R72A/K73A/K74A CCAGATAAACTTCGTAAAGTGATCTATGCCGCAAAGAAAGTTCATCAT Step 1 B2_R71A/R72A-r CCCTTTCC CTGTAACAAGGATTTGGAAAGGGATGATGAACTGCCGCTGCGGCAT KATNBL1 B2_R7172A/K7374A AGATCACTTTACGAAGTTTATCTGGGCTTTTCACAGT R71A/R72A/K73A/K74A ACTGTGAAAAGCCCAGATAAACTTCGTAAAGTGATCTATGCCGCAGC Step 2 B2_R7172A/K7374A-r GGCAGTTCATCATCCCTTTCCAAATCCTTGTTACAG B2R85AK86Astep1.For CCC CAC TTC CAG GGG ACT GTT TTG CTG CGT AAC AAG GAT TTG KATNBL1 GAA AGG GAT R85A/K86A/K87A B2R85AK86Astep1.Rev ATC CCT TTC CAA ATC CTT GTT ACG CAG CAA AAC AGT CCC CTG Step 1 GAA GTG GGG CCC CAC TTC CAG GGG ACT GTG CTG CTG CGT AAC AAG GAT KATNBL1 B2R85AK86Astep2.For TTG GAA AGG GAT R85A/K86A/K87A ATC CCT TTC CAA ATC CTT GTT ACG CAG CAG CAC AGT CCC CTG Step 2 B2R85AK86Astep2.Rev GAA GTG GGG
Table S3 - List of primers used to mutate KATNBL1.
List of primers used to generate KATNBL1 nuclear localization sequence mutants and truncation mutants.
69 References/Bibliography
1. Mitchison, T., and Kirschner, M. (1984) Microtubule assembly nucleated by isolated centrosomes. Nature 312, 232-237
2. Hill, T. L., and Chen, Y. (1984) Phase changes at the end of a microtubule with a GTP cap. Proceedings of the National Academy of Sciences of the United States of America 81, 5772-5776
3. Unger, E. (1979) Microtubules. Journal of Basic Microbiology 21, 630-630
4. Lengauer, C., Kinzler, K. W., and Vogelstein, B. (1998) Genetic instabilities in human cancers. Nature 396, 643-649
5. Lengauer, C., Kinzler, K. W., and Vogelstein, B. (1997) Genetic instability in colorectal cancers. Nature 386, 623-627
6. Stephens, R. E. (1970) Thermal fractionation of outer fiber doublet microtubules into A- and B-subfiber components: A- and B-tubulin. Journal of Molecular Biology 47, 353-363
7. Downing, K. H., and Nogales, E. (1998) Tubulin and microtubule structure. Current Opinion in Cell Biology 10, 16-22
8. Chretien, D., Metoz, F., Verde, F., Karsenti, E., and Wade, R. H. (1992) Lattice defects in microtubules: Protofilament numbers vary within individual microtubules. Journal of Cell Biology 117, 1031-1040
9. Bergen, L. G., Kuriyama, R., and Borisy, G. G. (1980) Polarity of microtubules nucleated by centrosomes and chromosomes of Chinese hamster ovary cells in vitro. Journal of Cell Biology 84, 151-159
10. Weisenberg, R. C., and Deery, W. J. (1976) Role of nucleotide hydrolysis in microtubule assembly. Nature 263, 792-793
11. Walker, R. A., O'Brien, E. T., Pryer, N. K., Soboeiro, M. F., Voter, W. A., Erickson, H. P., and Salmon, E. D. (1988) Dynamic instability of individual microtubules analyzed by video light microscopy: rate constants and transition frequencies. Journal of Cell Biology 107, 1437-1448 12. Gould, R. R., and Borisy, G. G. (1977) The pericentriolar material in Chinese hamster ovary cells nucleates microtubule formation. Journal of Cell Biology 73, 601-615
13. Moritz, M., Braunfeld, M. B., Guénebaut, V., Heuser, J., Agard, D. A., Guenebaut, V., Heuser, J., and Agard, D. A. (2000) Structure of the gamma-tubulin ring complex: a template for microtubule nucleation. Nat Cell Biol 2, 365-370
70
14. Ferreira, A., Busciglio, J., and C??ceres, A. (1987) An immunocytochemical analysis of the ontogeny of the microtubule-associated proteins MAP-2 and Tau in the nervous system of the rat. Developmental Brain Research 34, 9-31
15. Panda, D., Goode, B. L., Feinstein, S. C., and Wilson, L. (1995) Kinetic stabilization of microtubule dynamics at steady state by tau and microtubule-binding domains of tau. Biochemistry 34, 11117-11127
16. Bunker, J. M., Wilson, L., Jordan, M. A., and Feinstein, S. C. (2004) Modulation of microtubule dynamics by tau in living cells: implications for development and neurodegeneration. Molecular biology of the cell 15, 2720-2728
17. Kadavath, H., Hofele, R. V., Biernat, J., Kumar, S., Tepper, K., Urlaub, H., Mandelkow, E., and Zweckstetter, M. (2015) Tau stabilizes microtubules by binding at the interface between tubulin heterodimers. Proceedings of the National Academy of Sciences of the United States of America 112, 7501-7506
18. Perez, F., Diamantopoulos, G. S., Stalder, R., and Kreis, T. E. (1999) CLIP-170 highlights growing microtubule ends in vivo. Cell 96, 517-527
19. Diamantopoulos, G. S., Perez, F., Goodson, H. V., Batelier, G., Melki, R., Kreis, T. E., and Rickard, J. E. (1999) Dynamic Localization of CLIP-170 to Microtubule Plus Ends Is Coupled to Microtubule Assembly. The Journal of Cell Biology 144, 99-112
20. Mimori-Kiyosue, Y., Shiina, N., and Tsukita, S. (2000) The dynamic behavior of the APC-binding protein EB1 on the distal ends of microtubules. Current Biology 10, 865-868
21. Ogawa, T., Nitta, R., Okada, Y., and Hirokawa, N. (2004) A common mechanism for microtubule destabilizers-M type kinesins stabilize curling of the protofilament using the class-specific neck and loops. Cell 116, 591-602
22. Desai, A., Verma, S., Mitchison, T. J., and Walczak, C. E. (1999) Kin I kinesins are microtubule-destabilizing enzymes. Cell 96, 69-78
23. Belmont, L. D., and Mitchison, T. J. (1996) Identification of a protein that interacts with tubulin dimers and increases the catastrophe rate of microtubules. Cell 84, 623-631
24. Amayed, P., Pantaloni, D., and Carlier, M.-F. (2002) The effect of stathmin phosphorylation on microtubule assembly depends on tubulin critical concentration. The Journal of biological chemistry 277, 22718-22724
25. Roll-Mecak, A., and McNally, F. J. (2010) Microtubule-severing enzymes. Curr Opin Cell Biol 22, 96-103
71
26. McNally, F. J., and Vale, R. D. (1993) Identification of katanin, an ATPase that severs and disassembles stable microtubules. Cell 75, 419-429
27. Hazan, J., Fonknechten, N., Mavel, D., Paternotte, C., Samson, D., Artiguenave, F., Davoine, C.-s. S., Cruaud, C., Dürr, A., Wincker, P., Brottier, P., Cattolico, L., Barbe, V., Burgunder, J.-m. M., Prud'homme, J. F., Brice, A., Fontaine, B., Heilig, B., Weissenbach, J., Prud, J.-f., Brice, A., Fontaine, B., Heilig, R., and Weissenbach, J. (1999) Spastin, a new AAA protein, is altered in the most frequent form of autosomal dominant spastic paraplegia. Nature genetics 23, 296-303
28. Cox, G. A., Mahaffey, C. L., Nystuen, A., Letts, V. A., and Frankel, W. N. (2000) The mouse fidgetin gene defines a new role for AAA family proteins in mammalian development. Nature genetics 26, 198-202
29. Babst, M., Sato, T. K., Banta, L. M., and Emr, S. D. (1997) Endosomal transport function in yeast requires a novel AAA-type ATPase, Vps4p. EMBO Journal 16, 1820- 1831
30. Babst, M., Wendland, B., Estepa, E. J., and Emr, S. D. (1998) The Vps4p AAA ATPase regulates membrane association of a Vps protein complex required for normal endosome function. EMBO Journal 17, 2982-2993
31. Hartman, J. J., and Vale, R. D. (1999) Microtubule disassembly by ATP-dependent oligomerization of the AAA enzyme katanin. Science 286, 782-785
32. Scott, A., Chung, H.-Y., Gonciarz-Swiatek, M., Hill, G. C., Whitby, F. G., Gaspar, J., Holton, J. M., Viswanathan, R., Ghaffarian, S., Hill, C. P., and Sundquist, W. I. (2005) Structural and mechanistic studies of VPS4 proteins. The EMBO journal 24, 3658- 3669
33. Roll-Mecak, A., and Vale, R. D. (2008) Structural basis of microtubule severing by the hereditary spastic paraplegia protein spastin. Nature 451, 363-367
34. Taylor, J. L., White, S. R., Lauring, B., and Kull, F. J. (2012) Crystal structure of the human spastin AAA domain. Journal of structural biology 179, 133-137
35. White, S. R., Evans, K. J., Lary, J., Cole, J. L., and Lauring, B. (2007) Recognition of C- terminal amino acids in tubulin by pore loops in Spastin is important for microtubule severing. Journal of Cell Biology 176, 995-1005
36. Bailey, M. E., Sackett, D. L., and Ross, J. L. (2015) Katanin Severing and Binding Microtubules Are Inhibited by Tubulin Carboxy Tails. Biophysical Journal 109, 2546- 2561
72 37. Johjima, A., Noi, K., Nishikori, S., Ogi, H., Esaki, M., and Ogura, T. (2015) Microtubule severing by katanin p60 AAA+ ATPase requires the C-terminal acidic tails of both α- and β-tubulins and basic amino acid residues in the AAA+ ring pore. Journal of Biological Chemistry 290, jbc.M114.614768-jbc.M614114.614768
38. Iwaya, N., Kuwahara, Y., Fujiwara, Y., Goda, N., Tenno, T., Akiyama, K., Mase, S., Tochio, H., Ikegami, T., Shirakawa, M., and Hiroaki, H. (2010) A common substrate recognition mode conserved between katanin p60 and VPS4 governs microtubule severing and membrane skeleton reorganization. J Biol Chem 285, 16822-16829
39. McNally, F. J., Okawa, K., Iwamatsu, A., and Vale, R. D. (1996) Katanin, the microtubule-severing ATPase, is concentrated at centrosomes. J Cell Sci 109 ( Pt 3), 561-567
40. McNally, K. P., Bazirgan, O. A., and McNally, F. J. (2000) Two domains of p80 katanin regulate microtubule severing and spindle pole targeting by p60 katanin. J Cell Sci 113 ( Pt 9), 1623-1633
41. Hartman, J. J., Mahr, J., McNally, K., Okawa, K., Iwamatsu, A., Thomas, S., Cheesman, S., Heuser, J., Vale, R. D., and McNally, F. J. (1998) Katanin, a microtubule-severing protein, is a novel AAA ATPase that targets to the centrosome using a WD40- containing subunit. Cell 93, 277-287
42. McNally, K., Audhya, A., Oegema, K., and McNally, F. J. (2006) Katanin controls mitotic and meiotic spindle length. J Cell Biol 175, 881-891
43. Srayko, M., O'Toole E, T., Hyman, A. A., and Muller-Reichert, T. (2006) Katanin disrupts the microtubule lattice and increases polymer number in C. elegans meiosis. Curr Biol 16, 1944-1949
44. Quintin, S., Mains, P. E., Zinke, A., and Hyman, A. A. (2003) The mbk-2 kinase is required for inactivation of MEI-1/katanin in the one-cell Caenorhabditis elegans embryo. EMBO reports 4, 1175-1181 45. Lu, C., and Mains, P. E. (2007) The C. elegans anaphase promoting complex and MBK-2/DYRK kinase act redundantly with CUL-3/MEL-26 ubiquitin ligase to degrade MEI-1 microtubule-severing activity after meiosis. Developmental biology 302, 438-447
46. O'Donnell, L., Rhodes, D., Smith, S. J., Merriner, D. J., Clark, B. J., Borg, C., Whittle, B., O'Connor, A. E., Smith, L. B., McNally, F. J., de Kretser, D. M., Goodnow, C. C., Ormandy, C. J., Jamsai, D., and O'Bryan, M. K. (2012) An essential role for katanin p80 and microtubule severing in male gamete production. PLoS Genet 8, e1002698
47. Matsuo, M., Shimodaira, T., Kasama, T., Hata, Y., Echigo, A., Okabe, M., Arai, K., Makino, Y., Niwa, S., Saya, H., and Kishimoto, T. (2013) Katanin p60 contributes to
73 microtubule instability around the midbody and facilitates cytokinesis in rat cells. PLoS One 8, e80392
48. Zhang, D., Rogers, G. C., Buster, D. W., and Sharp, D. J. (2007) Three microtubule severing enzymes contribute to the "Pacman-flux" machinery that moves chromosomes. J Cell Biol 177, 231-242
49. Gomes, J.-e., Tavernier, N., Richaudeau, B., Formstecher, E., Boulin, T., Mains, P. E., Dumont, J., and Pintard, L. (2013) Microtubule severing by the katanin complex is activated by PPFR-1–dependent MEI-1 dephosphorylation. The Journal of cell biology 202, 431-439
50. Whitehead, E., Heald, R., and Wilbur, J. D. (2013) N-terminal phosphorylation of p60 katanin directly regulates microtubule severing. J Mol Biol 425, 214-221
51. Clark-Maguire, S., and Mains, P. E. (1994) mei-1, a gene required for meiotic spindle formation in Caenorhabditis elegans, is a member of a family of ATPases. Genetics 136, 533-546
52. Srayko, M., Buster, D. W., Bazirgan, O. A., McNally, F. J., and Mains, P. E. (2000) MEI- 1/MEI-2 katanin-like microtubule severing activity is required for Caenorhabditis elegans meiosis. Genes Dev 14, 1072-1084
53. Cummings, C. M., Bentley, C. a., Perdue, S. a., Baas, P. W., and Singer, J. D. (2009) The Cul3/Klhdc5 E3 ligase regulates p60/katanin and is required for normal mitosis in mammalian cells. The Journal of biological chemistry 284, 11663-11675
54. Maddika, S., and Chen, J. (2009) Protein kinase DYRK2 is a scaffold that facilitates assembly of an E3 ligase. Nature Cell Biology 11, 409-419 55. Vasquez, R. J., Gard, D. L., and Cassimeris, L. (1994) XMAP from Xenopus eggs promotes rapid plus end assembly of microtubules and rapid microtubule polymer turnover. Journal of Cell Biology 127, 985-993
56. McNally, K. P., Buster, D., and McNally, F. J. (2002) Katanin-mediated microtubule severing can be regulated by multiple mechanisms. Cell Motil Cytoskeleton 53, 337- 349
57. Sudo, H., and Maru, Y. (2008) LAPSER1/LZTS2: a pluripotent tumor suppressor linked to the inhibition of katanin-mediated microtubule severing. Human molecular genetics 17, 2524-2540
58. Moon, H. M., Youn, Y. H., Pemble, H., Yingling, J., Wittmann, T., and Wynshaw-Boris, A. (2014) LIS1 controls mitosis and mitotic spindle organization via the LIS1- NDEL1-dynein complex. Human Molecular Genetics 23, 449-466
74 59. Toyo-Oka, K., Sasaki, S., Yano, Y., Mori, D., Kobayashi, T., Toyoshima, Y. Y., Tokuoka, S. M., Ishii, S., Shimizu, T., Muramatsu, M., Hiraiwa, N., Yoshiki, A., Wynshaw-Boris, A., and Hirotsune, S. (2005) Recruitment of katanin p60 by phosphorylated NDEL1, an LIS1 interacting protein, is essential for mitotic cell division and neuronal migration. Human molecular genetics 14, 3113-3128
60. Sharp, D. J., and Ross, J. L. (2012) Microtubule-severing enzymes at the cutting edge. J Cell Sci 125, 2561-2569
61. Evans, K. J., Gomes, E. R., Reisenweber, S. M., Gundersen, G. G., and Lauring, B. P. (2005) Linking axonal degeneration to microtubule remodeling by Spastin- mediated microtubule severing. J Cell Biol 168, 599-606
62. McNally, F. J., and Thomas, S. (1998) Katanin is responsible for the M-phase microtubule-severing activity in Xenopus eggs. Mol Biol Cell 9, 1847-1861
63. Ahmad, F. J., Yu, W., McNally, F. J., and Baas, P. W. (1999) An essential role for katanin in severing microtubules in the neuron. J Cell Biol 145, 305-315
64. Rasi, M. Q., Parker, J. D., Feldman, J. L., Marshall, W. F., and Quarmby, L. M. (2009) Katanin knockdown supports a role for microtubule severing in release of basal bodies before mitosis in Chlamydomonas. Mol Biol Cell 20, 379-388
65. Zhang, D., Grode, K. D., Stewman, S. F., Diaz-Valencia, J. D., Liebling, E., Rath, U., Riera, T., Currie, J. D., Buster, D. W., Asenjo, A. B., Sosa, H. J., Ross, J. L., Ma, A., Rogers, S. L., and Sharp, D. J. (2011) Drosophila katanin is a microtubule depolymerase that regulates cortical-microtubule plus-end interactions and cell migration. Nat Cell Biol 13, 361-370 66. Yang, H. Y., McNally, K., and McNally, F. J. (2003) MEI-1/katanin is required for translocation of the meiosis I spindle to the oocyte cortex in C elegans. Dev Biol 260, 245-259
67. McNally, K., Berg, E., Cortes, D. B., Hernandez, V., Mains, P. E., and McNally, F. J. (2014) Katanin maintains meiotic metaphase chromosome alignment and spindle structure in vivo and has multiple effects on microtubules in vitro. Mol Biol Cell 25, 1037-1049
68. Lee, H. H., Jan, L. Y., and Jan, Y. N. (2009) Drosophila IKK-related kinase Ik2 and Katanin p60-like 1 regulate dendrite pruning of sensory neuron during metamorphosis. Proc Natl Acad Sci U S A 106, 6363-6368
69. Stewart, A., Tsubouchi, A., Rolls, M. M., Tracey, W. D., and Sherwood, N. T. (2012) Katanin p60-like1 promotes microtubule growth and terminal dendrite stability in the larval class IV sensory neurons of Drosophila. J Neurosci 32, 11631-11642
75 70. Benz, C., Clucas, C., Mottram, J. C., and Hammarton, T. C. (2012) Cytokinesis in bloodstream stage Trypanosoma brucei requires a family of katanins and spastin. PLoS One 7, e30367
71. Casanova, M., Crobu, L., Blaineau, C., Bourgeois, N., Bastien, P., and Pages, M. (2009) Microtubule-severing proteins are involved in flagellar length control and mitosis in Trypanosomatids. Mol Microbiol 71, 1353-1370
72. Dymek, E. E., and Smith, E. F. (2012) PF19 encodes the p60 catalytic subunit of katanin and is required for assembly of the flagellar central apparatus in Chlamydomonas. J Cell Sci 125, 3357-3366
73. Stoppin-Mellet, V., Gaillard, J., and Vantard, M. (2006) Katanin's severing activity favors bundling of cortical microtubules in plants. Plant J 46, 1009-1017
74. Bouquin, T., Mattsson, O., Naested, H., Foster, R., and Mundy, J. (2003) The Arabidopsis lue1 mutant defines a katanin p60 ortholog involved in hormonal control of microtubule orientation during cell growth. J Cell Sci 116, 791-801
75. Lin, D., Cao, L., Zhou, Z., Zhu, L., Ehrhardt, D., Yang, Z., and Fu, Y. (2013) Rho GTPase signaling activates microtubule severing to promote microtubule ordering in Arabidopsis. Curr Biol 23, 290-297
76. Nakamura, M., Ehrhardt, D. W., and Hashimoto, T. (2010) Microtubule and katanin- dependent dynamics of microtubule nucleation complexes in the acentrosomal Arabidopsis cortical array. Nat Cell Biol 12, 1064-1070 77. Webb, M., Jouannic, S., Foreman, J., Linstead, P., and Dolan, L. (2002) Cell specification in the Arabidopsis root epidermis requires the activity of ECTOPIC ROOT HAIR 3--a katanin-p60 protein. Development 129, 123-131
78. Uyttewaal, M., Burian, A., Alim, K., Landrein, B., Borowska-Wykret, D., Dedieu, A., Peaucelle, A., Ludynia, M., Traas, J., Boudaoud, A., Kwiatkowska, D., and Hamant, O. (2012) Mechanical stress acts via katanin to amplify differences in growth rate between adjacent cells in Arabidopsis. Cell 149, 439-451
79. Burk, D. H., Liu, B., Zhong, R., Morrison, W. H., and Ye, Z. H. (2001) A katanin-like protein regulates normal cell wall biosynthesis and cell elongation. Plant Cell 13, 807-827
80. Rebhan, M., Chalifa-Caspi, V., Prilusky, J., and Lancet, D. (1997) GeneCards: integrating information about genes, proteins and diseases. Trends Genet 13, 163
81. Smith, L. B., Milne, L., Nelson, N., Eddie, S., Brown, P., Atanassova, N., O'Bryan, M. K., O'Donnell, L., Rhodes, D., Wells, S., Napper, D., Nolan, P., Lalanne, Z., Cheeseman, M., and Peters, J. (2012) KATNAL1 regulation of sertoli cell microtubule dynamics is essential for spermiogenesis and male fertility. PLoS Genet 8, e1002697
76
82. Mishra-Gorur, K., Caglayan, A. O., Schaffer, A. E., Chabu, C., Henegariu, O., Vonhoff, F., Akgumus, G. T., Nishimura, S., Han, W., Tu, S., Baran, B., Gumus, H., Dilber, C., Zaki, M. S., Hossni, H. A., Riviere, J. B., Kayserili, H., Spencer, E. G., Rosti, R. O., Schroth, J., Per, H., Caglar, C., Dolen, D., Baranoski, J. F., Kumandas, S., Minja, F. J., Erson-Omay, E. Z., Mane, S. M., Lifton, R. P., Xu, T., Keshishian, H., Dobyns, W. B., Chi, N. C., Sestan, N., Louvi, A., Bilguvar, K., Yasuno, K., Gleeson, J. G., and Gunel, M. (2014) Mutations in KATNB1 cause complex cerebral malformations by disrupting asymmetrically dividing neural progenitors. Neuron 84, 1226-1239
83. Sonbuchner, T. M., Rath, U., and Sharp, D. J. (2010) KL1 is a novel microtubule severing enzyme that regulates mitotic spindle architecture. Cell Cycle 9, 2403-2411
84. Iwaya, N., Akiyama, K., Goda, N., Tenno, T., Fujiwara, Y., Hamada, D., Ikura, T., Shirakawa, M., and Hiroaki, H. (2012) Effect of Ca2+ on the microtubule-severing enzyme p60-katanin. Insight into the substrate-dependent activation mechanism. FEBS J 279, 1339-1352
85. Torres, J. Z., Summers, M. K., Peterson, D., Brauer, M. J., Lee, J., Senese, S., Gholkar, A. A., Lo, Y. C., Lei, X., Jung, K., Anderson, D. C., Davis, D. P., Belmont, L., and Jackson, P. K. (2011) The STARD9/Kif16a Kinesin Associates with Mitotic Microtubules and Regulates Spindle Pole Assembly. Cell 147, 1309-1323
86. Torres, J. Z., Miller, J. J., and Jackson, P. K. (2009) High-throughput generation of tagged stable cell lines for proteomic analysis. Proteomics 9, 2888-2891
87. Buster, D., McNally, K., and McNally, F. J. (2002) Katanin inhibition prevents the redistribution of gamma-tubulin at mitosis. J Cell Sci 115, 1083-1092
88. Shannon, P., Markiel, A., Ozier, O., Baliga, N. S., Wang, J. T., Ramage, D., Amin, N., Schwikowski, B., and Ideker, T. (2003) Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res 13, 2498-2504
89. Ververis, A., Christodoulou, A., Christoforou, M., Kamilari, C., Lederer, C. W., and Santama, N. (2015) A novel family of katanin-like 2 protein isoforms (KATNAL2), interacting with nucleotide-binding proteins Nubp1 and Nubp2, are key regulators of different MT-based processes in mammalian cells. Cell Mol Life Sci
90. Kosugi, S., Hasebe, M., Tomita, M., and Yanagawa, H. (2009) Systematic identification of cell cycle-dependent yeast nucleocytoplasmic shuttling proteins by prediction of composite motifs. Proc Natl Acad Sci U S A 106, 10171-10176
91. Loughlin, R., Wilbur, J. D., McNally, F. J., Nedelec, F. J., and Heald, R. (2011) Katanin contributes to interspecies spindle length scaling in Xenopus. Cell 147, 1397-1407
77 92. Barrera, J. A., Kao, L. R., Hammer, R. E., Seemann, J., Fuchs, J. L., and Megraw, T. L. (2010) CDK5RAP2 regulates centriole engagement and cohesion in mice. Dev Cell 18, 913-926
93. Gopalan, G., Chan, C. S., and Donovan, P. J. (1997) A novel mammalian, mitotic spindle-associated kinase is related to yeast and fly chromosome segregation regulators. J Cell Biol 138, 643-656
94. Hinchcliffe, E. H., Li, C., Thompson, E. A., Maller, J. L., and Sluder, G. (1999) Requirement of Cdk2-cyclin E activity for repeated centrosome reproduction in Xenopus egg extracts. Science 283, 851-854
95. Vidwans, S. J., Wong, M. L., and O'Farrell, P. H. (2003) Anomalous centriole configurations are detected in Drosophila wing disc cells upon Cdk1 inactivation. J Cell Sci 116, 137-143 96. Warnke, S., Kemmler, S., Hames, R. S., Tsai, H. L., Hoffmann-Rohrer, U., Fry, A. M., and Hoffmann, I. (2004) Polo-like kinase-2 is required for centriole duplication in mammalian cells. Curr Biol 14, 1200-1207
97. Yanagi, T., Krajewska, M., Matsuzawa, S., and Reed, J. C. (2014) PCTAIRE1 phosphorylates p27 and regulates mitosis in cancer cells. Cancer Res 74, 5795-5807
98. Izquierdo, D., Wang, W. J., Uryu, K., and Tsou, M. F. (2014) Stabilization of cartwheel- less centrioles for duplication requires CEP295-mediated centriole-to-centrosome conversion. Cell Rep 8, 957-965
99. Spektor, A., Tsang, W. Y., Khoo, D., and Dynlacht, B. D. (2007) Cep97 and CP110 suppress a cilia assembly program. Cell 130, 678-690
100. Xu, D., Zhang, F., Wang, Y., Sun, Y., and Xu, Z. (2014) Microcephaly-associated protein WDR62 regulates neurogenesis through JNK1 in the developing neocortex. Cell Rep 6, 104-116
101. Kim, J., Krishnaswami, S. R., and Gleeson, J. G. (2008) CEP290 interacts with the centriolar satellite component PCM-1 and is required for Rab8 localization to the primary cilium. Hum Mol Genet 17, 3796-3805
102. McNally, K. P., and McNally, F. J. (2011) The spindle assembly function of Caenorhabditis elegans katanin does not require microtubule-severing activity. Mol Biol Cell 22, 1550-1560
103. Lim, N. R., Yeap, Y. Y., Ang, C. S., Williamson, N. A., Bogoyevitch, M. A., Quinn, L. M., and Ng, D. C. (2015) Aurora A phosphorylation of WD40-repeat protein 62 in mitotic spindle regulation. Cell Cycle, 0
78 104. Senese, S., Cheung, K., Lo, Y. C., Gholkar, A. A., Xia, X., Wohlschlegel, J. A., and Torres, J. Z. (2015) A unique insertion in STARD9's motor domain regulates its stability. Mol Biol Cell 26, 440-452
105. Rappsilber, J., Mann, M., and Ishihama, Y. (2007) Protocol for micro-purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nat Protoc 2, 1896-1906
106. Mellacheruvu, D., Wright, Z., Couzens, A. L., Lambert, J. P., St-Denis, N. A., Li, T., Miteva, Y. V., Hauri, S., Sardiu, M. E., Low, T. Y., Halim, V. A., Bagshaw, R. D., Hubner, N. C., Al-Hakim, A., Bouchard, A., Faubert, D., Fermin, D., Dunham, W. H., Goudreault, M., Lin, Z. Y., Badillo, B. G., Pawson, T., Durocher, D., Coulombe, B., Aebersold, R., Superti-Furga, G., Colinge, J., Heck, A. J., Choi, H., Gstaiger, M., Mohammed, S., Cristea, I. M., Bennett, K. L., Washburn, M. P., Raught, B., Ewing, R. M., Gingras, A. C., and Nesvizhskii, A. I. (2013) The CRAPome: a contaminant repository for affinity purification-mass spectrometry data. Nat Methods 10, 730-736
107. Xia, X., Gholkar, A., Senese, S., and Torres, J. Z. (2015) A LCMT1-PME-1 methylation equilibrium controls mitotic spindle size. Cell Cycle 14, 1938-1947
79