DOCSLIB.ORG

Transient Tetraploidy As a Route to Chromosomal Instability

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Transient Tetraploidy As a Route to Chromosomal Instability Dissertation zur Erlangung des Doktorgrades der Fakultät für Biologie der Ludwig-Maximilians-Universität München Transient tetraploidy as a route to chromosomal instability vorgelegt von Anastasia Yurievna Kuznetsova aus Moskau, Russland 2013 Erklärung Die vorliegende Arbeit wurde zwischen October 2008 und Mai 2013 unter Anleitung von Frau. Dr. Zuzana Storchova - - Martinsried Wesentliche Teile dieser Arbeit sind in folgenden Publikationen veröffentlicht: Abnormal mitosis triggers p53-dependent cell cycle arrest in human tetraploid cells Kuffer C, Kuznetsova AY, Zuzana Storchova. Chromosoma. DOI 10.1007/s00412-013-0414-0 2 Ehrenwörtliche Versicherung Diese Dissertation wurde selbstständig, ohne unerlaubte Hilfe erarbeitet. Martinsried, am Anastasia Kuznetsova Dissertation eingereicht am: 1. Gutachter: Herr Prof. Dr. Stefan Jentsch 2. Gutachter: Herr Prof. Dr. Peter Becker Mündliche Prüfung am: 3 Table of Contents Summary ......................................................................................................................... 7 Introduction ..................................................................................................................... 8 1. Tetraploidy: causes and proliferation control. ....................................................... 8 2. Tetraploid state as an intermediate to aneuploidy, chromosomal instability and tumorigenesis. ........................................................................................................... 11 3. Molecular mechanisms triggering CIN. ............................................................... 15 3.1. Aneuploid state per se as a trigger of CIN. .................................................. 15 3.2. Loss of sister chromatid cohesion as a cause of CIN. ................................. 16 3.3. Alterations in the spindle assembly checkpoint (SAC). ............................... 17 3.4. Multiple centrosomes and multipolar division. ............................................. 20 3.5. Alteration in mitotic spindle function. ........................................................... 22 3.5.1. Defects in kinetochore organization and function. ................................... 22 3.5.2. Alterations in the mitotic spindle machinery. ............................................ 23 3.5.2.1. MAPs and their role in MT dynamics ................................................ 26 3.5.2.2. Kinesins and their role in MT dynamics ............................................ 27 3.5.3. Defects in mitotic error correction. ........................................................... 32 3.6. Deregulation of the cell cycle arrest pathways. ........................................... 33 Aim of This Study .......................................................................................................... 37 Results .......................................................................................................................... 38 1. Isolation and characterization of posttetraploid cells. ......................................... 38 1.1. In vitro evolution of cells after tetraploidization. ........................................... 38 1.2. Cell cycle and growth characteristics of the posttetraploid cells. ................. 39 2. Aneuploidy and chromosomal instability of the posttetraploid cells. ................... 41 2.1. Chromosome numbers in the posttetraploid cells. ....................................... 41 2.2. Chromosomal instability in the posttetraploid cells. ..................................... 42 2.3. Chromosome segregation errors in the posttetraploids. .............................. 49 3. Causes of chromosomal instability in the posttetraploids. .................................. 52 3.1. Contribution of supernumerary centrosomes to chromosomal instability. ... 52 3.2. Sister chromatid cohesion in posttetraploids. .............................................. 56 3.3. Global gene expression changes in the posttetraploids. ............................. 57 3.3.1. Altered mitotic spindle dynamics. ............................................................. 57 4 3.3.2. Altered mitotic spindle geometry of posttetraploid cells. .......................... 60 3.3.3. Other changes potentially causing chromosomal instability. .................... 62 3.4. Spindle assembly checkpoint alterations in the posttetraploids. .................. 63 3.5. Tolerance to chromosome missegregation in the posttetraploids. ............... 66 Discussion ..................................................................................................................... 71 Tetraploidization drives chromosomal instability independently of the p53 status. .... 71 Erroneous mitosis is a source of CIN. ........................................................................ 74 Supernumerary centrosomes are not the sole source of CIN in posttetraploid cells. 76 Sister chromatid cohesion is not altered in posttetraploids. ....................................... 78 Altered levels of mitotic kinesins change the spindle geometry and enhance the frequency of segregation errors. ................................................................................ 78 Increased tolerance to mitotic errors contributes to CIN in posttetraploid cells. ......... 83 Supplementary Information ........................................................................................... 88 Materials and Methods ................................................................................................ 101 1. Materials ........................................................................................................... 101 1.1. Cell lines. ................................................................................................... 101 1.2. Primary antibodies. .................................................................................... 101 1.3. Sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) gel electrophoresis and immunoblotting materials. ............................................................................. 102 1.4. Other materials. ......................................................................................... 103 2. Methods ............................................................................................................ 103 2.1. Cryopreservation and cultivation of cells. .................................................. 103 2.2. Generation of posttetraploid cell lines. ...................................................... 104 2.3. Determination of non-viable cells in culture. .............................................. 104 2.4. Protein biochemistry methods. .................................................................. 105 2.4.1. Cell lysis and protein concentration measurement. ............................... 105 2.4.2. SDS-PAGE and immunoblotting. ........................................................... 105 2.5. Microscopy. ............................................................................................... 106 2.5.1. Live cell imaging. ................................................................................... 106 2.5.1.1. Live imaging of untreated cells and cells treated with mitotic poisons. ........................................................................................................ 106 2.5.1.2. RNA interference followed by live imaging. .................................... 107 5 2.5.2. Determination of the chromosome copy number and chromosomal structural aberrations in cells. ........................................................................... 107 2.5.2.1. Chromosome spreads (standard karyotyping). ............................... 107 2.5.2.2. Fluorescence in situ hybridization (FISH) on centromeric region. ... 108 2.5.2.3. Whole chromosome multicolor FISH (mFISH) ................................ 108 2.5.3. Mitotic error analyses in fixed cells. ....................................................... 109 2.5.3.1. Mitotic abnormalities scoring in anaphase and early telophase. ..... 109 2.5.3.2. Micronucleation test. ....................................................................... 110 2.5.4. Immunofluorescent staining. .................................................................. 110 2.5.4.1. Mitotic spindle staining. ................................................................... 110 2.5.4.2. Staining for interkinetochore distance, kinetochore distribution measurements and high-resolution mitotic error visualization. ...................... 111 2.5.4.3. Centrosome staining. ...................................................................... 111 2.6. High-throughput methods. ......................................................................... 112 2.6.1. Array comparative genomic hybridization (aCGH). ................................ 112 2.6.2. mRNA microarray-based gene expression analysis. ............................. 112 2.7. Statistical analysis. .................................................................................... 113 2.8. Image processing. ..................................................................................... 114 Figure list ..................................................................................................................... 115 References .................................................................................................................. 117 Abbreviations .............................................................................................................. 138 Acknowledgements
Load more

Recommended publications
  • Htpx2 Is Required for Normal Spindle Morphology and Centrosome Integrity During Vertebrate Cell Division
    Current Biology, Vol. 12, 2055–2059, December 10, 2002, 2002 Elsevier Science Ltd. All rights reserved. PII S0960-9822(02)01277-0 hTPX2 Is Required for Normal Spindle Morphology and Centrosome Integrity during Vertebrate Cell Division Sarah Garrett,2 Kristi Auer,1 Duane A. Compton,1 hTPX2 Knockdown by siRNA Results and Tarun M. Kapoor2,3 in Multipolar Spindles 1Department of Biochemistry To examine hTPX2 function in vertebrate cells, we Dartmouth Medical School sought to disrupt the expression of human TPX2 by Hanover, New Hampshire 03755 using siRNA [4]. An RNA duplex corresponding to bases 2 Laboratory of Chemistry and Cell Biology 74–94 of the human TPX2 open reading frame was trans- Rockefeller University fected into HeLa cells. Thirty hours after transfection, we New York, New York 10021 consistently found hTPX2 protein levels to be reduced below 1% of those in untreated cells (Figure 2D). Knockdown of hTPX2 resulted in two effects. First, loss of hTPX2 arrested cells in mitosis. In three indepen- Summary dent experiments, cells treated with hTPX2 siRNA showed a mitotic index of 30%, whereas control cells Bipolar spindle formation is essential for the accurate showed a mitotic index of 3% (n ϭ at least 300 cells; segregation of genetic material during cell division. Figure 2E). Second, more than 40% of the mitotic cells Although centrosomes influence the number of spin- after siRNA treatment had spindles with more than two dle poles during mitosis, motor and non-motor micro- poles (Figures 2A–2C and 2E). Each pole in these tubule-associated proteins (MAPs) also play key roles multipolar spindles had several microtubule bundles in determining spindle morphology [1].
    [Show full text]
  • Emerging Molecular Mechanisms That Power and Regulate the Anastral Mitotic Spindle of Flowering Plants
    Cell Motility and the Cytoskeleton 65: 1–11 (2008) Review Article Emerging Molecular Mechanisms that Power and Regulate the Anastral Mitotic Spindle of Flowering Plants Alex Bannigan, Michelle Lizotte-Waniewski, Margaret Riley, and Tobias I. Baskin* Biology Department, University of Massachusetts, Amherst, Massachusetts Flowering plants, lacking centrosomes as well as dynein, assemble their mitotic spindle via a pathway that is distinct visually and molecularly from that of ani- mals and yeast. The molecular components underlying mitotic spindle assembly and function in plants are beginning to be discovered. Here, we review recent evidence suggesting the preprophase band in plants functions analogously to the centrosome in animals in establishing spindle bipolarity, and we review recent progress characterizing the roles of specific motor proteins in plant mitosis. Loss of function of certain minus-end-directed KIN-14 motor proteins causes a broad- ening of the spindle pole; whereas, loss of function of a KIN-5 causes the forma- tion of monopolar spindles, resembling those formed when the homologous motor protein (e.g., Eg5) is knocked out in animal cells. We present a phylogeny of the kinesin-5 motor domain, which shows deep divergence among plant sequences, highlighting possibilities for specialization. Finally, we review information con- cerning the roles of selected structural proteins at mitosis as well as recent find- ings concerning regulation of M-phase in plants. Insight into the mitotic spindle will be obtained through continued comparison of mitotic mechanisms in a diver- sity of cells. Cell Motil. Cytoskeleton 65: 1–11, 2008. ' 2007 Wiley-Liss, Inc. Key words: kinesin-5; kinesin-14; mitosis; monopolar spindle; phylogeny INTRODUCTION The mitotic spindle has fascinated biologists for centuries.
    [Show full text]
  • KIAA0556 Is a Novel Ciliary Basal Body Component Mutated in Joubert Syndrome Anna A
    Sanders et al. Genome Biology (2015) 16:293 DOI 10.1186/s13059-015-0858-z RESEARCH Open Access KIAA0556 is a novel ciliary basal body component mutated in Joubert syndrome Anna A. W. M. Sanders1†, Erik de Vrieze2,3†, Anas M. Alazami4†, Fatema Alzahrani4, Erik B. Malarkey5, Nasrin Sorusch6, Lars Tebbe6, Stefanie Kuhns1, Teunis J. P. van Dam7, Amal Alhashem8, Brahim Tabarki8, Qianhao Lu9,10, Nils J. Lambacher1, Julie E. Kennedy1, Rachel V. Bowie1, Lisette Hetterschijt2,3, Sylvia van Beersum3,11, Jeroen van Reeuwijk3,11, Karsten Boldt12, Hannie Kremer2,3,11, Robert A. Kesterson13, Dorota Monies4, Mohamed Abouelhoda4, Ronald Roepman3,11, Martijn H. Huynen7, Marius Ueffing12, Rob B. Russell9,10, Uwe Wolfrum6, Bradley K. Yoder5, Erwin van Wijk2,3*, Fowzan S. Alkuraya4,14* and Oliver E. Blacque1* Abstract Background: Joubert syndrome (JBTS) and related disorders are defined by cerebellar malformation (molar tooth sign), together with neurological symptoms of variable expressivity. The ciliary basis of Joubert syndrome related disorders frequently extends the phenotype to tissues such as the eye, kidney, skeleton and craniofacial structures. Results: Using autozygome and exome analyses, we identified a null mutation in KIAA0556 in a multiplex consanguineous family with hallmark features of mild Joubert syndrome. Patient-derived fibroblasts displayed reduced ciliogenesis potential and abnormally elongated cilia. Investigation of disease pathophysiology revealed that Kiaa0556-/- null mice possess a Joubert syndrome-associated brain-restricted phenotype. Functional studies in Caenorhabditis elegans nematodes and cultured human cells support a conserved ciliary role for KIAA0556 linked to microtubule regulation. First, nematode KIAA0556 is expressed almost exclusively in ciliated cells, and the worm and human KIAA0556 proteins are enriched at the ciliary base.
    [Show full text]
  • Dual Proteome-Scale Networks Reveal Cell-Specific Remodeling of the Human Interactome
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Dual Proteome-scale Networks Reveal Cell-specific Remodeling of the Human Interactome Edward L. Huttlin1*, Raphael J. Bruckner1,3, Jose Navarrete-Perea1, Joe R. Cannon1,4, Kurt Baltier1,5, Fana Gebreab1, Melanie P. Gygi1, Alexandra Thornock1, Gabriela Zarraga1,6, Stanley Tam1,7, John Szpyt1, Alexandra Panov1, Hannah Parzen1,8, Sipei Fu1, Arvene Golbazi1, Eila Maenpaa1, Keegan Stricker1, Sanjukta Guha Thakurta1, Ramin Rad1, Joshua Pan2, David P. Nusinow1, Joao A. Paulo1, Devin K. Schweppe1, Laura Pontano Vaites1, J. Wade Harper1*, Steven P. Gygi1*# 1Department of Cell Biology, Harvard Medical School, Boston, MA, 02115, USA. 2Broad Institute, Cambridge, MA, 02142, USA. 3Present address: ICCB-Longwood Screening Facility, Harvard Medical School, Boston, MA, 02115, USA. 4Present address: Merck, West Point, PA, 19486, USA. 5Present address: IQ Proteomics, Cambridge, MA, 02139, USA. 6Present address: Vor Biopharma, Cambridge, MA, 02142, USA. 7Present address: Rubius Therapeutics, Cambridge, MA, 02139, USA. 8Present address: RPS North America, South Kingstown, RI, 02879, USA. *Correspondence: [email protected] (E.L.H.), [email protected] (J.W.H.), [email protected] (S.P.G.) #Lead Contact: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Microtubule-Severing Enzymes at the Cutting Edge
    Commentary 2561 Microtubule-severing enzymes at the cutting edge David J. Sharp1,* and Jennifer L. Ross2 1Department of Physiology and Biophysics, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461, USA 2Department of Physics, University of Massachusetts-Amherst, 302 Hasbrouck Laboratory, Amherst, MA 01003, USA *Author for correspondence ([email protected]) Journal of Cell Science 125, 2561–2569 ß 2012. Published by The Company of Biologists Ltd doi: 10.1242/jcs.101139 Summary ATP-dependent severing of microtubules was first reported in Xenopus laevis egg extracts in 1991. Two years later this observation led to the purification of the first known microtubule-severing enzyme, katanin. Katanin homologs have now been identified throughout the animal kingdom and in plants. Moreover, members of two closely related enzyme subfamilies, spastin and fidgetin, have been found to sever microtubules and might act alongside katanins in some contexts (Roll-Mecak and McNally, 2010; Yu et al., 2008; Zhang et al., 2007). Over the past few years, it has become clear that microtubule-severing enzymes contribute to a wide range of cellular activities including mitosis and meiosis, morphogenesis, cilia biogenesis and disassembly, and migration. Thus, this group of enzymes is revealing itself to be among the most important of the microtubule regulators. This Commentary focuses on our growing understanding of how microtubule-severing enzymes contribute to the organization and dynamics of diverse microtubule arrays, as well as the structural and biophysical characteristics that afford them the unique capacity to catalyze the removal of tubulin from the interior microtubule lattice. Our goal is to provide a broader perspective, focusing on a limited number of particularly informative, representative and/or timely findings.
    [Show full text]
  • Chromosome Substitution Strain Assessment of a Huntington's
    Mamm Genome DOI 10.1007/s00335-014-9552-9 Chromosome substitution strain assessment of a Huntington’s disease modifier locus Eliana Marisa Ramos • Marina Kovalenko • Jolene R. Guide • Jason St. Claire • Tammy Gillis • Jayalakshmi S. Mysore • Jorge Sequeiros • Vanessa C. Wheeler • Isabel Alonso • Marcy E. MacDonald Received: 26 August 2014 / Accepted: 3 December 2014 Ó The Author(s) 2015. This article is published with open access at Springerlink.com Abstract Huntington’s disease (HD) is a dominant neu- with the human 6q23–24 region, is derived from the A/J rodegenerative disorder that is due to expansion of an (AJ) strain. Crosses were performed to assess the possi- unstable HTT CAG repeat for which genome-wide genetic bility of dominantly acting chr10 AJ-B6J variants of strong scans are now revealing chromosome regions that contain effect that may modulate CAG-dependent HdhQ111/? phe- disease-modifying genes. We have explored a novel notypes. Testing of F1 progeny confirmed that a single AJ human–mouse cross-species functional prioritisation chromosome had a significant effect on the rate of body approach, by evaluating the HD modifier 6q23–24 linkage weight gain and in HdhQ111 mice the AJ chromosome was interval. This unbiased strategy employs C57BL/6J (B6J) associated subtle alterations in somatic CAG instability in HdhQ111 knock-in mice, replicates of the HD mutation, and the liver and the formation of intra-nuclear inclusions, as the C57BL/6J-chr10A/J/NaJ chromosome substitution strain well as DARPP-32 levels, in the striatum. These findings in (CSS10), in which only chromosome 10 (chr10), in synteny relatively small cohorts are suggestive of dominant chr10 AJ-B6 variants that may modify effects of the CAG expansion, and encourage a larger study with CSS10 and sub-strains.
    [Show full text]
  • Aspm (NM 009791) Mouse Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR219160 Aspm (NM_009791) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Aspm (NM_009791) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Aspm Synonyms: Calmbp1; D330028K02Rik; MCPH5; Sha1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR219160 representing NM_009791 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGACGATGCAGGCAGCCTCCTGCCCAGAGGAGAGGGGGCGGCGGGCGCGACCAGATCCTGAGGCCG GGGACCCGTCTCCGCCGGTGCTGTTGCTCAGCCACTTCTGCGGCGTTCCCTTCCTCTGCTTCGGGGATGT CCGCGTGGGCACGTCGCGGACGCGGTCTCTGGTCCTGCACAACCCGCACGAGGAACCTCTGCAGGTGGAG CTGTCGCTGCTGCGCGCCGCAGGCCAGGGCTTCAGCGTGGCGCCGAACCGCTGCGAGCTGAAGCCTAAAG AAAAACTTACCATTTCCGTTACCTGGACGCCACTGCGAGAAGGGGGAGTGAGGGAGATTGTCACATTTCT TGTAAATGATTTCCTGAAGCACCAGGCTATATTACTAGGAAATGCAGAAGAGCCTAAGAAGAAAAAGAGA AGTCTTTGGAATACCAGTAAGAAGATTCCAGCCTCTTCAAAACATACAAAAAGGACTTCCAAAAACCAAC ATTTTAATGAATCATTTACTATTTCACAAAAAGACAGAATTAGGAGCCCACTGCAGCCTTGTGAAAATCT GGCTATGAGTGAATGCTCTTCCCCAACAGAAAACAAAGTCCCCACCCCATCCATTAGTCCTATTAGAGAA TGCCAGAGTGAAACTTGCTTGCCACTGTTTTTACGCGAGTCCACTGCCTATTCATCTCTTCATGAATCTG AAAATACACAAAATTTAAAAGTACAAGATGCCAGCATTTCACAAACTTTTGATTTTAATGAGGAAGTCGC AAATGAAACTTTTATTAATCCCATTAGTGTCTGTCACCAGAGTGAAGGGGATAGGAAACTCACGCTTGCC CCAAACTGTTCTTCACCTTTGAATAGTACACAGACCCAAATACACTTTCTAAGTCCAGATTCTTTTGTAA
    [Show full text]
  • Hsp72 and Nek6 Cooperate to Cluster Amplified Centrosomes in Cancer Cells
    Published OnlineFirst July 18, 2017; DOI: 10.1158/0008-5472.CAN-16-3233 Cancer Molecular and Cellular Pathobiology Research Hsp72 and Nek6 Cooperate to Cluster Amplified Centrosomes in Cancer Cells Josephina Sampson1, Laura O'Regan1, Martin J.S. Dyer2, Richard Bayliss3, and Andrew M. Fry1 Abstract Cancer cells frequently possess extra amplified centrosomes Unlike some centrosome declustering agents, blocking Hsp72 clustered into two poles whose pseudo-bipolar spindles exhib- or Nek6 function did not induce formation of acentrosomal it reduced fidelity of chromosome segregation and promote poles, meaning that multipolar spindles were observable only genetic instability. Inhibition of centrosome clustering triggers in cells with amplified centrosomes. Inhibition of Hsp72 in multipolar spindle formation and mitotic catastrophe, offer- acute lymphoblastic leukemia cells resulted in increased mul- ing an attractive therapeutic approach to selectively kill cells tipolar spindle frequency that correlated with centrosome with amplified centrosomes. However, mechanisms of centro- amplification, while loss of Hsp72 or Nek6 function in non- some clustering remain poorly understood. Here, we identify a cancer-derived cells disturbs neither spindle formation nor new pathway that acts through NIMA-related kinase 6 (Nek6) mitotic progression. Hence, the Nek6–Hsp72 module repre- and Hsp72 to promote centrosome clustering. Nek6, as well as sents a novel actionable pathway for selective targeting of its upstream activators polo-like kinase 1 and Aurora-A, tar- cancer cells with amplified centrosomes. Cancer Res; 77(18); geted Hsp72 to the poles of cells with amplified centrosomes. 4785–96. Ó2017 AACR. Introduction are nucleated (11, 12). The g-TuRC is concentrated at centrosomes through binding to components of the pericentriolar material The mitotic spindle is bipolar in nature as it is organized around (PCM), a highly ordered matrix of coiled-coil proteins that two poles, each possessing a single centrosome (1, 2).
    [Show full text]
  • Germline Mutation Contribution to Chromosomal Instability
    249 S H Chan and J Ngeow Germline mutations and 24:9 T33–T46 Thematic Review chromosomal instability Germline mutation contribution to chromosomal instability Correspondence Sock Hoai Chan1 and Joanne Ngeow1,2 should be addressed to J Ngeow 1 Division of Medical Oncology, Cancer Genetics Service, National Cancer Centre Singapore, Singapore Email 2 Oncology Academic Clinical Program, Duke-NUS Medical School Singapore, Singapore Joanne.Ngeow.Y.Y@ singhealth.com.sg Abstract Genomic instability is a feature of cancer that fuels oncogenesis through increased Key Words frequency of genetic disruption, leading to loss of genomic integrity and promoting f molecular genetics clonal evolution as well as tumor transformation. A form of genomic instability prevalent f chromosome instability across cancer types is chromosomal instability, which involves karyotypic changes including f cancer chromosome copy number alterations as well as gross structural abnormalities such as transversions and translocations. Defects in cellular mechanisms that are in place to govern fidelity of chromosomal segregation, DNA repair and ultimately genomic integrity are known to contribute to chromosomal instability. In this review, we discuss the association of germline mutations in these pathways with chromosomal instability in the background of related cancer predisposition syndromes. We will also reflect on the impact of genetic predisposition to clinical management of patients and how we can exploit this vulnerability to promote catastrophic genomic instability as a Endocrine-Related Cancer Endocrine-Related Cancer Endocrine-Related therapeutic strategy. (2017) 24, T33–T46 Introduction Genomic instability is a hallmark of human cancers Pino & Chung 2010, Bakhoum & Compton 2012, (Negrini et al. 2010). It refers to the increased frequency Pikor et al.
    [Show full text]
  • Spindle Microtubule Dysfunction and Cancer Predisposition
    PERSPECTIVE 1881 JournalJournal ofof Cellular Spindle Microtubule Dysfunction Physiology and Cancer Predisposition JASON STUMPFF,1* PRACHI N. GHULE,2** AKIKO SHIMAMURA,3,4 JANET L. STEIN,2 5 AND MARC GREENBLATT 1Vermont Cancer Center and Department of Molecular Physiology and Biophysics, University of Vermont College of Medicine, Burlington, Vermont 2Vermont Cancer Center and Department of Biochemistry, University of Vermont College of Medicine, Burlington, Vermont 3Clinical Research Division, Fred Hutchinson Cancer Research Center, Seattle, Washington 4Seattle Children’s Hospital and University of Washington, Seattle, Washington 5Vermont Cancer Center and Department of Medicine, University of Vermont College of Medicine, Burlington, Vermont Chromosome segregation and spindle microtubule dynamics are strictly coordinated during cell division in order to preserve genomic integrity. Alterations in the genome that affect microtubule stability and spindle assembly during mitosis may contribute to genomic instability and cancer predisposition, but directly testing this potential link poses a significant challenge. Germ-line mutations in tumor suppressor genes that predispose patients to cancer and alter spindle microtubule dynamics offer unique opportunities to investigate the relationship between spindle dysfunction and carcinogenesis. Mutations in two such tumor suppressors, adenomatous polyposis coli (APC) and Shwachman–Bodian–Diamond syndrome (SBDS), affect multifunctional proteins that have been well characterized for their roles in Wnt signaling and interphase ribosome assembly, respectively. Less understood, however, is how their shared involvement in stabilizing the microtubules that comprise the mitotic spindle contributes to cancer predisposition. Here, we briefly discuss the potential for mutations in APC and SBDS as informative tools for studying the impact of mitotic spindle dysfunction on cellular transformation. J.
    [Show full text]
  • Genetic and Chemical Modulation of Spastin-Dependent Axon Outgrowth
    Disease Models & Mechanisms 3, 743-751 (2010) doi:10.1242/dmm.004002 © 2010. Published by The Company of Biologists Ltd RESEARCH ARTICLE Genetic and chemical modulation of spastin-dependent axon outgrowth in zebrafish embryos indicates a role for impaired microtubule dynamics in hereditary spastic paraplegia Richard Butler1,*,‡, Jonathan D. Wood1,2,*,§, Jennifer A. Landers1 and Vincent T. Cunliffe1,§ SUMMARY Mutations in the SPAST (SPG4) gene, which encodes the microtubule-severing protein spastin, are the most common cause of autosomal dominant hereditary spastic paraplegia (HSP). Following on from previous work in our laboratory showing that spastin is required for axon outgrowth, we report here that the related microtubule-severing protein katanin is also required for axon outgrowth in vivo. Using confocal time-lapse imaging, we have identified requirements for spastin and katanin in maintaining normal axonal microtubule dynamics and growth cone motility in vivo, supporting a model in which microtubule severing is required for concerted growth of neuronal microtubules. Simultaneous knockdown of spastin and katanin caused a more severe phenotype than did individual knockdown of either gene, suggesting that they have different but related functions in supporting axon outgrowth. In addition, the microtubule-destabilising drug nocodazole abolished microtubule dynamics and growth cone motility, and enhanced phenotypic severity in spast-knockdown zebrafish embryos. Thus, disruption of microtubule dynamics might underlie neuronal DMM dysfunction
    [Show full text]
  • Models, Regulations, and Functions of Microtubule Severing by Katanin
    International Scholarly Research Network ISRN Molecular Biology Volume 2012, Article ID 596289, 14 pages doi:10.5402/2012/596289 Review Article Models, Regulations, and Functions of Microtubule Severing by Katanin Debasish Kumar Ghosh, Debdeep Dasgupta, and Abhishek Guha Department of Biological Sciences, Indian Institute of Science Education and Research, Kolkata, Mohanpur, Nadia 741252, India Correspondence should be addressed to Debasish Kumar Ghosh, [email protected] Received 1 August 2012; Accepted 20 August 2012 Academic Editors: H. Hashimoto, A. J. Molenaar, and A. Montecucco Copyright © 2012 Debasish Kumar Ghosh et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Regulation of microtubule dynamics depends on stochastic balance between polymerization and severing process which lead to differential spatiotemporal abundance and distribution of microtubules during cell development, differentiation, and morphogenesis. Microtubule severing by a conserved AAA family protein Katanin has emerged as an important microtubule architecture modulating process in cellular functions like division, migration, shaping and so on. Regulated by several factors, Katanin manifests connective crosstalks in network motifs in regulation of anisotropic severing pattern of microtubule protofilaments in cell type and stage dependent way. Mechanisms of structural disintegration of microtubules by Katanin involve heterogeneous mechanochemical processes and sensitivity of microtubules to Katanin plays significant roles in mitosis/meiosis, neurogenesis, cilia/flagella formation, cell wall development and so on. Deregulated and uncoordinated expression of Katanin has been shown to have implications in pathophysiological conditions. In this paper, we highlight mechanistic models and regulations of microtubule severing by Katanin in context of structure and various functions of Katanin in different organisms.
    [Show full text]