University of Limerick Ollscoil Luimnigh
Genotypic and Phenotypic Analysis of Ralstonia pickettii High Purity Water Isolates
Michael P Ryan B.Sc.
Chemical and Environmental Sciences Dept., University of Limerick
A thesis submitted to the University of Limerick in candidature for the degree of Doctor of Philosophy
Supervisors: Dr. Catherine C Adley and Prof. J Tony Pembroke
Submitted to the University of Limerick: June 2009
Declaration
I hereby declare that the work detailed in this thesis is the result of my own investigations. No part of this work has been or is being submitted in candidature for any other degree.
______
Michael Ryan
Date ______
i Abstract
Ralstonia is a newly characterised genus that includes former members of the Burkholderia species (Ralstonia pickettii and Ralstonia solanacearum). The type species of the genus-Ralstonia pickettii (type strain, ATCC27511) is a clinical isolate which has been isolated from a wide variety of clinical specimens. Recently it has been isolated mainly as a contaminant of industrial high purity water circulation systems, in space ship water systems and in laboratory high purity water systems including the Millipore systems.
To generate a strain collection of R. pickettii for phenotypic and genotypic analysis strains were initially isolated from Millipore laboratory purified water; these were supplemented with culture collection strains, clinical and industrial isolates until a culture collection of fifty-eight strains from different geographic locations and environmental origins was generated. All were initially identified as R. pickettii. A review of the literature demonstrated that this collection represents one of the largest collections of R. pickettii in the world. These fifty-eight strains gave a wide range of isolates from several different environmental niches allowing a phylogenetic analysis of R. pickettii to be undertaken.
Characterisation of the fifty-eight R. pickettii isolates of our strain collection using phenotypic and genotypic techniques was undertaken. To determine if any genomic variations were present in the strains, species-specific PCR was preformed. Fourteen strains were found to be in fact the closely related species Ralstonia insidiosa. Following this it was decided to investigate phylogenetic markers such as the 16S rDNA gene. Given that the analysis on the published 16S rDNA gene of R. pickettii from a wide range of environments and geographic locations showed almost no variation, two other sequences were selected for typing and were analysed, the 16S-23S rDNA ISR and the fliC gene. Like the 16S rDNA gene analysis, the 16S-23S rDNA ISR analysis (through RFLP and sequencing) showed very little variation between the R. pickettii isolates. The 16S-23S rDNA ISR analysis also supported the species-specific PCR and showed fourteen strains to be R. insidiosa. The fliC gene sequencing analysis indicated that there are four different types of fliC gene in R. pickettii but these types do not group together based on the origin of the source strain.
ii Further genotypic characterisation was undertaken using RAPD (Random Amplification of Polymorphic DNA)-PCR and BOX-PCR and the results of these experiments were analysed by dendrogram analysis. Four different primers were used for the RAPD analysis P3, P15, M13 and OPA3OU which gave twenty-five, twenty-one, twenty-one and fifteen groups respectively. BOX primer BOX-A1R was used for the BOX-PCR and resulted in eighteen groups. No relationship was discovered between or within the different groupings based on their origin.
Phenotypic analysis was carried out using both biochemical identification kits (Remel RapID NF Plus, BioMérieux API 20NE) and traditional biochemical tests such as nitrate usage tests, virulence factor determination (elastase, protease, haemolysin) and motility testing to establish if their was any variation due to different environments of isolation. No major variations were found based on the isolate source or between the R. pickettii isolates and those found to be R. insidiosa. Antibiogram profiles for the R. insidiosa subset of strains showed that the majority for were multi-resistant to a range of antibiotics similar to previously published reports for R. pickettii.
Mobile Genetic Elements (MGE) can allow bacteria to survive in different environments. To determine if these could be aiding the adaptability of R. pickettii to different environments a study was undertaken to determine if any MGE’s were present in the R. pickettii culture collection. Three ICE-like elements related to Tn4371 were discovered in R. pickettii strains ULM001, ULM003 and ULM006 form our collection and were partially characterised using a PCR approach. Bioinformatic analysis led to the discovery of ten previously uncharacterised Tn4371-like ICE’s in the genomes of several different bacteria. These elements were bioinformatically characterised. Several different genes putatively involved in metabolism and antibiotic and heavy metal resistance were identified. No known virulence determinates were discovered. A common genetic scaffold for all Tn4371-like ICE’s was found and a new nomenclature for all Tn4371-ICE’S was proposed.
R. pickettii is a persistant contaminant of HPW and this study provides both phenotypic and genotypic analysis of a collection of R. pickettii and its close neighbour R. insidiosa.
iii Acknowledgements
I would like to express my sincere thanks to Dr. Catherine Adley and Prof. Tony Pembroke for their invaluable supervision, advice and encouragement throughout the course of my research.
I would like to thank all the lads from LG007 for all good times, laughs, debates, cups of tea and free chocolate.
Thanks to the guys from the lab Farag, Camelia, Karen, Kamila and Colm for putting up with me at times I probably didn’t really deserve it.
I would like to thank my Mum, Dad and sister for all their encouragement and support throughout the years of the PhD.
I would like to thanks all my friends Roibeard, Kev, Ivor, Maurice, Mary, Finola, Nicola, Conor, Damien, Rob, Vincent, Sarah and the undoubted many names that I’m forgetting for their friendship and all their support through both good and not so good times.
iv Table of Contents
DECLARATION ...... I
ABSTRACT ...... II
ACKNOWLEDGEMENTS ...... IV
TABLE OF CONTENTS ...... V
LIST OF TABLES ...... VIII
LIST OF FIGURES ...... X
LIST OF ABBREVIATIONS ...... XII
UNITS OF MEASUREMENT ...... XIII
CHAPTER 1: INTRODUCTION ...... 1
1.1.TAXONOMY OF THE RALSTONIA GENUS ...... 2 1.2.PHENOTYPIC CHARACTERISTICS OF THE GENUS RALSTONIA ...... 7 1.3.NATURAL HABITAT OF RALSTONIA SPP ...... 8 1.4. RALSTONIA PICKETTII ...... 9 1.4.1. Taxonomy of Ralstonia pickettii ...... 9 1.4.2. Genotypic and Phenotypic Characteristics of Ralstonia pickettii ...... 10 1.4.3. Clinical significance of Ralstonia pickettii ...... 11 1.4.4. Antibiotic Resistance Patterns of Ralstonia pickettii ...... 16 1.4.5. Industrial significance of Ralstonia pickettii ...... 19 1.5. RALSTONIA INSIDIOSA ...... 21 1.6. CLINICAL INSTANCES OF R. MANNITOLILYTICA ...... 23 1.7. BACTERIA IN HIGH-PURITY WATER ...... 23 1.7.1. Oligotrophic Bacteria ...... 24 1.7.2. Water Quality ...... 25 1.8. GENOTYPIC TYPING OF BACTERIAL ISOLATES ...... 31 1.8.1. The 16S rRNA Gene ...... 32 1.8.2. The 16S-23S rRNA spacer region ...... 34 1.8.3. fliC gene Analysis ...... 36 1.8.4. RAPD PCR Analysis ...... 37 1.8.5. BOX-PCR Analysis ...... 38 1.8.6. Molecular Typing of Ralstonia pickettii ...... 38 1.9. MOBILE ELEMENTS OF THE ICE\CTN TYPE ...... 39 1.9.1 ICE\CTn structure ...... 39 1.9.2. The Common Scaffold of ICEs\Ctns ...... 41 1.9.3. Tn4371 ...... 43 1.10. THE AIMS OF THIS PROJECT ...... 44
v CHAPTER 2: GENERAL MATERIALS ...... 45
2.1. SOURCE OF CHEMICAL REAGENTS ...... 46 2.2. EQUIPMENT ...... 46 2.3. BIOCHEMICAL KITS ...... 46 2.4. MEDIA AND SUPPLEMENTS ...... 48 2.5. MCFARLAND STANDARD ...... 48 2.6. GENERAL BUFFERS AND REAGENTS ...... 49 2.7. BACTERIAL STRAINS AND GROWTH CONDITIONS ...... 50
CHAPTER 3: PHENOTYPIC AND GENOTYPIC DIVERSITY AMONGST STRAINS OF RALSTONIA PICKETTII ISOLATED FROM DIFFERENT ENVIRONMENTS...... 54
3.1. SUMMARY ...... 55 3.2. INTRODUCTION ...... 55 3.3. MATERIALS AND METHODS ...... 57 3.3.1. Water Testing ...... 57 3.3.2. Phenotypic Characteristics for the differentiation of R. pickettii and R. insidiosa ...... 59 3.3.3. Genotypic Analysis ...... 63 3.4. RESULTS ...... 68 3.4.1. Water Testing ...... 68 3.4.2. Ralstonia insidiosa identification using species-specific PCR ...... 70 3.4.3. Genetic and phenotypic diversity of Ralstonia pickettii strains from clinical and environmental sources ...... 75 3.5. DISCUSSION ...... 111 3.5.1. Water Testing ...... 111 3.5.2. Biotyping and Ralstonia insidiosa identification ...... 112 3.5.3. PCR-Ribotyping, 16S-23S ISR and fliC RFLP and ISR and fliC Sequence Analysis ...... 116 3.5.4. Genotypic Fingerprinting ...... 117
CHAPTER 4: DISCOVERY AND CHARACTERISATION OF MOBILE ELEMENTS IN RALSTONIA PICKETTII...... 120
4.1. SUMMARY ...... 121 4.2. INTRODUCTION ...... 121 4.3. MATERIALS AND METHODS ...... 123 4.3.1. Plasmid Profiles of Ralstonia pickettii ...... 123 4.3.2. Design of PCR Primers for Intergrase genes of Mobile Elements of the ICE Variety ...... 123 4.3.3. Mapping the Tn4371-like element ...... 125 4.3.4. Assembly of the Tn4371-like element genome ...... 126 4.3.5. Antibiotic susceptibility testing of Strains containing the Tn4371-like element .. 127 4.4. RESULTS AND DISCUSSION ...... 127 4.4.1. Plasmid Profiling of Ralstonia pickettii strains...... 127 4.4.2. Detection of Integrase genes ...... 128 4.4.3. Molecular characterization of Tn4371-like element found in R. pickettii strains ...... 128 4.4.4. The attL and attR region of Tn4371 ICE-like elements...... 131
vi 4.4.5. Antibiotic Resistance patterns of Ralstonia pickettii isolates with Tn4371-like elements...... 131 4.4.6. Bioinformatic characterisation of Tn4371-like elements in whole genome sequences...... 132 4.4.7. Defining the Tn4371 family of elements and nomenclature ...... 152
CONCLUSION ...... 156
BIBLIOGRAPHY ...... 159
APPENDICES ...... 213
APPENDIX 1: NCBI ACCESSION NUMBER OF 16S RDNA GENES IN FIGURE 1.1 ...... 214 APPENDIX 2: ANTIMICROBIAL SENSITIVITY TESTING, ZONE DIAMETER INTERPRETATION BASED ON PSEUDOMONAS (NCCLS 2001) ...... 215 APPENDIX 3: PROTOCOL FOR NUCLEOSPIN KIT ...... 216 APPENDIX 4: 16S-23S ISR RFLP GELS ...... 217 APPENDIX 5: ALIGNMENT OF 16S-23S SPACER REGION OF RALSTONIA PICKETTII STRAINS .. 228 APPENDIX 6: CTN’S/ICES IDENTIFIED IN THE LITERATURE ...... 233
APPENDIX 7: ALIGNMENT OF THE LEFT ENDS OF ICETN43716402 AND RELATED TN4371- LIKE ICE’S ...... 252 APPENDIX 8: ORFS OF TN4371-LIKE ELEMENTS DISCOVERED IN THIS STUDY ...... 253 APPENDIX 9: LIST OF DNA SEQUENCES SUBMITTED TO THE EMBL DATABASE ...... 276 APPENDIX 10: LIST OF PUBLICATIONS ...... 277 APPENDIX 11: PUBLICATIONS ...... 279
vii List of Tables
TABLE 1.1: SPECIES OF THE TWO DIFFERENT RALSTONIA LINEAGES ...... 3 TABLE 1.2: PHENOTYPIC CHARACTERISTICS OF THE GENERA RALSTONIA AND WAUTERSIA [CUPRIAVIDUS] ...... 3 TABLE 1.3: RALSTONIA PICKETTII INFECTIONS ...... 14 TABLE 1.4: BREAKDOWN OF SIXTY-THREE CASES OF RALSTONIA PICKETTII INFECTIONS FOUND IN THE LITERATURE ...... 16 TABLE 1.5: REVIEW OF PREVIOUS ANTIBIOTYPING OF RALSTONIA PICKETTII ...... 17 TABLE 1.6: TOXIC COMPOUNDS DEGRADED BY RALSTONIA PICKETTII ...... 20 TABLE 1.7: BIOCHEMICAL DIFFERENCES BETWEEN RALSTONIA INSIDIOSA AND RALSTONIA PICKETTII ...... 21 TABLE 1.8: REVIEW OF PREVIOUS ANTIBIOTYPING OF RALSTONIA INSIDIOSA ...... 22 TABLE 1.9: REVIEW OF PREVIOUS ANTIBIOTYPING OF RALSTONIA MANNITOLILYTICA ...... 23 TABLE 1.10: INSTANCES OF BACTERIA IN DISTILLED WATER ...... 27 TABLE 1.11: INSTANCES OF BACTERIA IN PURIFIED WATER ...... 27 TABLE 1.12: INSTANCES OF BACTERIA IN ULTRA-PURE AND HIGH-PURITY WATER ...... 29 TABLE 1.13: INSTANCES OF BACTERIA IN OTHER PURIFIED WATER ...... 30 TABLE 2.1: API 20NE KIT ...... 47 TABLE 2.2: REMEL RAPID NF PLUS KIT ...... 47 TABLE 2.3: MEDIA USED IN THIS STUDY ...... 48 TABLE 2.4: MCFARLAND STANDARD PROTOCOL ...... 48 TABLE 2.5: MOLECULAR BIOLOGY REAGENTS...... 50 TABLE 2.6: GENERAL BACTERIAL STRAINS USED IN THIS STUDY ...... 51 TABLE 2.7: RALSTONIA SPECIES USED IN THIS STUDY ...... 52 TABLE 2.8: RALSTONIA PICKETTII STRAINS USED IN THIS WORK ...... 53 TABLE 3.1: PCR PRIMERS USED IN THE DIFFERENTIATION OF R. PICKETTII AND R. INSIDIOSA ...... 64 TABLE 3.2: PCR PRIMERS USED IN RAPD ANALYSIS ...... 67 TABLE 3.3: ISOLATING FREQUENCY (%) OF THE IDENTIFIED MICROORGANISMS FROM PURIFIED WATER SYSTEM ...... 68 TABLE 3.4: CLASSIFICATION OF OLIGOTROPHY OF STRAINS ISOLATED FROM LABORATORY PURIFIED WATER ...... 69 TABLE 3.5: GROWTH OF RALSTONIA PICKETTII ON POLYMER SUBSTANCES ...... 69 TABLE 3.6: CHARACTERISATION OF STRAINS OF R. PICKETTII ISOLATES USING PHENOTYPIC AND THE SPECIES-SPECIFIC PCR ASSAY ...... 78 TABLE 3.7: BIOVAR IDENTIFICATION OF PCR IDENTIFIED R. INSIDIOSA STRAINS ...... 79 TABLE 3.8: ANTIBIOTIC RESISTANCE PATTERNS OF RALSTONIA INSIDIOSA ISOLATES .... 80 TABLE 3.9: INFORMATION ON R. PICKETTII 16S RDNA SEQUENCES DEPOSITED IN THE GENBANK DATABASE ...... 81 TABLE 3.10: INFORMATION ON 16S-23S RRNA SEQUENCES DEPOSITED IN THE GENBANK DATABASE ...... 83 TABLE 3.11: % NUCLEOTIDE SIMILARITY OF SEQUENCED 16S-23S ISR STRAINS WITH R. PICKETTII LMG5942 ...... 97 TABLE 3.12: % NUCLEOTIDE SIMILARITY OF SEQUENCED FLIC GENE STRAINS WITH R. PICKETTII DSM6297 ...... 99 TABLE 3.13: NO. OF GROUPINGS WITH FOUR DIFFERENT RAPD PRIMERS ...... 101 TABLE 3.14: SIMPSON'S DISCRIMINATORY INDEX FOR RALSTONIA PICKETTII WITH FOUR DIFFERENT RAPD PRIMERS ...... 102 TABLE 3.15: CLUSTERS OF STRAINS OF R. PICKETTII ISOLATES BASED ON GENOTYPIC FINGERPRINTING ...... 109
viii TABLE 3.16: CLUSTERS OF STRAINS OF R. INSIDIOSA ISOLATES BASED ON GENOTYPIC FINGERPRINTING ...... 110 TABLE 4.1: INTEGRASE PRIMERS DESIGNED IN THIS STUDY ...... 124 TABLE 4.2: PRIMERS DESIGNED TO MAP TN4371-LIKE ELEMENT ...... 125 TABLE 4.3: ANTIBIOTIC RESISTANCE PATTERNS OF RALSTONIA PICKETTII ISOLATES WITH TN4371-LIKE ELEMENTS ...... 132 TABLE 4.4: SIZE AND %GC CONTENT, ACCESSORY GENES FITNESS DETERMINANTS CONTAINED IN AND THE LOCATION AND ENVIRONMENT OF ISOLATED STRAINS CONTAINING TN4371-LIKE ELEMENTS ...... 133 TABLE 4.5: FUNCTIONS OF TYPE VI SECRETION SYSTEM PROTEINS ...... 140 TABLE 4.6: ORFS ASSOCIATED WITH THE TN4371-LIKE ICE FROM THE GENOME OF RALSTONIA PICKETTII 12J ...... 142
ix List of Figures
FIG 1.1: PHYLOGENETIC TREE BASED ON 16S RRNA GENE SEQUENCE HOMOLOGY FOR SPECIES OF THE GENERA RALSTONIA AND CUPRIAVIDUS ...... 7 FIG 1.2: GRAM STAIN OF R. PICKETTII DSM6297 ...... 8 FIG 1.3: SCHEMATIC REPRESENTATION OF AN ULTRAPURE WATER SYSTEM...... 26 FIG 1.4: SECONDARY-STRUCTURE MODEL OF THE 16S RRNA ...... 34 FIG 1.5: SCHEMATIC REPRESENTATION OF A 16S-23S SPACER REGION ...... 35 FIG 1.6: DIAGRAM OF FLIC GENE SHOWING THE CONSERVED AND VARIABLE REGIONS ... 37 FIG 3.1: SPECIES-SPECIFIC PCR OF RALSTONIA PICKETTII INDUSTRIAL ISOLATES ...... 71 FIG 3.2: SPECIES-SPECIFIC PCR OF RALSTONIA PICKETTII INDUSTRIAL ISOLATES ...... 72 FIG 3.3: SPECIES-SPECIFIC PCR OF RALSTONIA PICKETTII CLINICAL ISOLATES ...... 73 FIG 3.4: SPECIES-SPECIFIC PCR OF RALSTONIA PICKETTII PURCHASED STRAINS ...... 73 FIG 3.5: SPECIES-SPECIFIC PCR OF RALSTONIA PICKETTII LABORATORY WATER ISOLATES ...... 74 FIG 3.6: CLUSTER ANALYSIS OF API 20NE RESULTS...... 76 FIG 3.7: EXAMPLE OF Α- HEMOLYSIS OF R. PICKETTII DSM6297 ...... 77 FIG 3.8: PHYLOGENETIC TREE BASED ON 16S RDNA GENE FOR TWELVE STRAINS OF R. PICKETTII...... 82 FIG 3.9: PARTIAL ALIGNMENT OF TWELVE 16S RDNA GENE SEQUENCES OF R. PICKETTII 82 FIG 3.10: PHYLOGENETIC TREE BASED ON INTERGENIC SPACE BETWEEN 16S AND 23S RRNA GENE FOR FOUR STRAINS OF R. PICKETTII...... 83 FIG 3.11: ALIGNMENT OF FOUR INTERGENIC SEQUENCES OF R. PICKETTII (CARRIED OUT WITH GENEDOC) ...... 84 FIG 3.12: PCR-RIBOTYPING OF R. PICKETTII PURCHASED AND INDUSTRIAL ISOLATES ... 85 FIG 3.13: PCR-RIBOTYPING OF R. PICKETTII INDUSTRIAL AND CLINICAL ISOLATES ...... 86 FIG 3.14: PCR-RIBOTYPING OF R. PICKETTII LABORATORY WATER ISOLATES ...... 87 FIG 3.15: PCR-RIBOTYPING OF RALSTONIA INSIDIOSA ISOLATES ...... 87 FIG 3.16: ALUI 1 DIGEST OF 16S-23S ISR OF R. PICKETTII ISOLATES ...... 90 FIG 3.17: HAEIII 2 DIGEST OF 16S-23S ISR OF R. PICKETTII ISOLATES ...... 91 FIG 3.18: HAEIII 4 DIGEST OF 16S-23S ISR OF R. INSIDIOSA ISOLATES ...... 92 FIG 3.19: TAQI 1 DIGEST OF 16S-23S ISR OF R. PICKETTII ISOLATES ...... 93 FIG 3.20: CFOI 1 DIGEST OF 16S-23S ISR OF R. PICKETTII ISOLATES ...... 94 FIG 3.21: CFOI 4 DIGEST OF 16S-23S ISR OF R. INSIDIOSA ISOLATES ...... 95 FIG 3.22: PHYLOGENETIC TREE OF R. PICKETTII 16S-23S ISR OF NINETEEN SEQUENCED STRAINS AND SEQUENCE DATA AVAILABLE ON THE GENBANK DATABASE...... 98 FIG 3.23: PHYLOGENETIC TREE OF R. PICKETTII FLIC GENES OF NINETEEN SEQUENCED STRAINS AND THE TWO SEQUENCE DATA AVAILABLE ON THE GENBANK DATABASE...... 100 FIG 3.24: RAPD PRIMER M13. DENDROGRAM OF FIFTY-NINE STRAINS OF R. PICKETTII BY THE PEARSON CORRELATION USING THE UPGMA LINKAGE METHOD ...... 103 FIG 3.25: RAPD PRIMER OPA3OU. DENDROGRAM OF FIFTY-NINE STRAINS OF R. PICKETTII BY THE PEARSON CORRELATION USING THE UPGMA LINKAGE METHOD104 FIG 3.26: RAPD PRIMER P3. DENDROGRAM OF FIFTY-NINE STRAINS OF R. PICKETTII BY THE PEARSON CORRELATION USING THE UPGMA LINKAGE METHOD ...... 105 FIG 3.27: RAPD PRIMER P15. DENDROGRAM OF FIFTY-NINE STRAINS OF R. PICKETTII BY THE PEARSON CORRELATION USING THE UPGMA LINKAGE METHOD ...... 106 FIG 3.28: BOX-PCR. DENDROGRAM OF FIFTY-NINE STRAINS OF R. PICKETTII BY THE PEARSON CORRELATION USING THE UPGMA LINKAGE METHOD ...... 108 FIG 3.29: DENDROGRAM OF COMPARISON OF ALL METHODS USING FIFTY-NINE STRAINS OF R. PICKETTII BY THE PEARSON CORRELATION USING THE UPGMA LINKAGE METHOD ...... 119
x FIG 4.1: AMPLIFICATION OF GENES OF THE PUTATIVE TN4371-LIKE ICE IN RALSTONIA PICKETTII STRAIN ULM001 ...... 129 FIG 4.2: A) SCHEMATIC REPRESENTATION OF TN4371 EXCISION AND INSERTION INTO THE R. PICKETTII CHROMOSOME. B) AGAROSE GEL OF ATTP OF TN4371-LIKE ICE IN ULM001 AND ULM003 ...... 130 FIG 4.3: ALIGNMENT OF THE CONSERVED DOMAINS AMONG THE SITE-SPECIFIC RECOMBINASES OF THE TYROSINE INTEGRASE FAMILY FROM PHAGES, CONJUGATIVE TRANSPOSONS, PLASMIDS AND OTHER SOURCES ...... 134 FIG 4.4: PHYLOGENETIC TREE OF THE INTEGRASE PROTEINS ALL AVAILABLE TN4371-LIKE INTEGRASES ...... 135 FIG 4.5: PHYLOGENETIC TREE OF THE REPA GENES OF THE TN4371 TYPE...... 137 FIG 4.6: PHYLOGENETIC TREE OF THE PARA PROTEINS OF THE TN4371 TYPE...... 138 FIG 4.7: PHYLOGENETIC TREE OF THE TRAG PROTEINS OF ALL AVAILABLE TN4371-LIKE TRAG PROTEINS ...... 140 FIG 4.8: DEFINING THE COMMON CORE SCAFFOLD OF TN4371-LIKE ICE’S WITH GENES
PRESENT IN ICETN43716033 ...... 151 FIG. 4.9A: ARTEMIS REPRESENTATION SHOWING SIMILARITY BETWEEN FIVE DIFFERENT TN4371-LIKE ICE’S...... 153 FIG. 4.9B: ARTEMIS REPRESENTATION SHOWING SIMILARITY BETWEEN SIX DIFFERENT TN4371-LIKE ICE’S...... 154
xi List of Abbreviations aa Amino acid int Integrase ATCC American Type Culture ID Identification Collection att Attachment site JCM Japan Collection Of Microorganisms bp Base pair Kb Kilobase BSA Bovine Serum albumin Km Kanamycin C Chloramphenicol LMG Laboratorie voor Microbiologie Ghent CCM Czech Collection of MgCl2 Magnesium chloride Microorganisms CCUG Culture Collection MWRH Mid-West Regional Hospital University of Goteborg CDC Centers for Disease NCCLS National Committee for Clinical Control and Prevention Laboratory Standards CF Cystic Fibrosis NCTC National Collection of Type Cultures cfu Colony forming units nt Nucleotide CIP Collection de Institut OD Optical density Pasteur Cn Gentamicin PCR Polymerase Chain Reaction Cp Ciprofloxacin PFGE Pulsed Field Gel Electrophoresis CTn Conjugative transposon R Resistant Ctx Cefotaxime SDS Sodium Dodecyl Sulphate DMSO Dimethyl sulphoxide spp. Species DNA Deoxyribonucleic Acid TBE Tris Borate EDTA DSM German Collection of TE Tris EDTA Microorganisms dNTP Deoxynucleoside S Susceptible triphosphate dH2O Distilled water tRNA Transfer RNA EtBr Ethidium Bromide TVC Total Viable Count I Intermediate resistance WFI Water For Injection ICE Integrating Conjugative Element
xii Units of Measurement °C degrees Celsius g gram kg kilogram µg microgram µL Microlitre µm micrometre mg milligram ml millilitre M molar mM millimolar nm nanometre rpm revolutions per minute *g times gravity V volts
xiii
Chapter 1: Introduction
1.1. Taxonomy of the Ralstonia genus
The genus Ralstonia was created in 1995 to accommodate bacteria from diverse ecological niches previously classified as Burkholderia and Alcaligenes [Burkholderia pickettii, Burkholderia solanacearum and Alcaligenes eutrophus] (Yabuuchi et al., 1995). Ralstonia pickettii (ATCC27511, formerly called Pseudomonas pickettii or Burkholderia pickettii) is the Type strain of this genus. In 2004 it was proposed to split this genus into two: Ralstonia and Wausteria, with R. pickettii remaining in the Ralstonia genus (Vaneechoutte et al., 2004). Originally the genus Pseudomonas was classified into five rRNA homology groups with Ralstonia pickettii belonging to Pseudomonas homology group II. This classification was consequently altered with four of the five-homology groups being reclassified into separate genera (Gilligan and Whittier, 1999). One such reorganisation occurred in 1992 with the proposal of the genera Burkholderia with seven species from Pseudomonas rRNA homology group II. This was based on the results of cellular lipid and fatty acid analysis and analysis of the 16S rRNA of the seven species (Yabuuchi et al., 1992). It was observed that two of the species within the genus were different to the other Burkholderia species but were similar to each other. These were B. pickettii and B. solanacearum (Gillis et al., 1995). In 1995, a series of tests demonstrated a close phenotypic and phylogenetic relationship between Burkholderia pickettii, Burkholderia solanacearum and Alcaligenes eutrophus. Morphological, physiological, and biochemical characterisation, cellular lipid and fatty acid analysis and phylogenetic analysis of both 16S rRNA nucleotide sequences and rRNA-DNA hybridisation were carried out to elucidate the taxonomic position of these three species (Gillis et al., 1995), the outcome was to classify these three species in a new genus, Ralstonia. As a result of these changes, new species names were introduced: Ralstonia pickettii, Ralstonia solanacearum, Ralstonia eutropha (Yabuuchi et al., 1995). Since 1995, the taxonomy of the genus had been expanded to include several new species, reaching thirteen species in 2004. In March 2004, Vaneechoutte et al., proposed a new genus Wautersia gen. Nov.
2 Table 1.1: Species of the Two Different Ralstonia lineages Ralstonia pickettii Lineage Ralstonia (Wautersia) eutropha lineage R. insidiosa (Coenye et al., 2003a) Wautersia basilensis (Steinle et al., 1999) R. mannitolilytica (De Baere et al., 2001) W. campinensis (Goris et al., 2001) R. solanacearum (Smith 1896; Yabuuchi W. eutropha (Davis 1969; Yabuuchi et al. et al., 1995) 1995) R. syzygii (Roberts et al., 1990) W. gilardii (Coenye et al., 1999) R. pickettii (Ralston et al., 1973; Yabuuchi W. metallidurans (Goris et al., 2001) et al., 1995) W. oxalatica (Khambata and Bhat 1953; Sahin et al., 2000 comb. nov.) W. paucula (Vandamme et al., 1999), W. respiraculi (Coenye et al., 2003b), W. taiwanensis (Chen et al., 2001)
This split the genus Ralstonia into two separate groups, the Ralstonia pickettii lineage and the Ralstonia (Wautersia) eutropha lineage. The species in both are outlined in Table 1.1. Sequence analysis of the 16S rRNA genes of these bacteria (Fig. 1.1) based on data available in August 2008 indicated that two distinct sublineages, with sequence dissimilarity of >4%, supported by a bootstrap value of 100%, were present within the genus Ralstonia sensu lato. This genotypic discrimination is supported by several clear phenotypic differences as can be seen Table 1.2. In late 2004 a new species was added to the Wautersia genus; Wautersia numadzuensis sp. nov. One of the main characteristics of this bacterium is that it can degrade trichloroethylene (Kageyama et al., 2005).
Table 1.2: Phenotypic Characteristics of the Genera Ralstonia and Wautersia [Cupriavidus] (Vaneechoutte et al., 2004). *Not applicable to R. syzygii (No growth on TSA) Characteristic Ralstonia Wautersia [Cupriavidus] Flagellation Polar, 1–4 Peritrichous Colistin (10 µg discs) Resistant Susceptible Viability on TSA at 25 °C* <6 days >9 days Acid production from carbohydrates + -
3 During the course of a long-term study of the biodiversity of various Burkholderia cepacia-like bacteria, Vandamme and Coenye (2004), discovered that a nearly complete 16S rRNA gene sequence that was deposited for Cupriavidus necator in the National Centre for Biotechnology Information (NCBI) database under the accession number AF191737 was very similar to that of Wautersia eutropha isolates. The similarity level between the 16S rRNA gene sequences of strains C. necator LMG8453 and W. eutropha LMG1199 was 99.7% (Vandamme and Coenye 2004). Cupriavidus necator was described by Makkar and Casida (1987) to accommodate a non-obligate bacterial predator of various Gram-Negative and Gram-Positive soil bacteria and fungi (Byrd et al., 1985; Sillman and Casida, 1986; Zeph and Casida, 1986). The single known isolate, LMG8453, was obtained from soil in the vicinity of University Park, PA, USA. When confronted with Agromyces ramosus mycelia during the so-called ‘attack–counterattack’ predation process, this strain produces several chemical signals, one of which chelates copper. C. necator is highly resistant to copper and its growth initiation is strongly stimulated by copper (Makkar and Casida, 1987). They reported the DNA base ratio and a wide range of morphological, biochemical and nutritional properties of this organism but did not examine its phylogenetic position through 16S rRNA gene studies as is currently standard procedure in prokaryotic taxonomy. They noticed several characteristics their organism shared with members of the genus Alcaligenes, which, at that time, comprised multiple species, including Alcaligenes faecalis (the Type species), Alcaligenes xylosoxidans and allied species (now all classified in the genus Achromobacter; Yabuuchi et al., 1998) and Alcaligenes eutrophus [first reclassified in the genus Ralstonia (Yabuuchi et al., 1995) and recently transferred again, to the novel genus Wautersia (Vaneechoutte et al., 2004)]. However, a few unique biochemical characteristics and the spectacular predatory activity convinced Makkar and Casida, (1987) to classify their strain into a novel genus and species namely Cupriavidus. Subsequently, they compared the whole-cell protein electrophoretic profiles of C. necator and W. eutropha isolates. The whole-cell protein profiles of C. necator LMG8453 and of W. eutropha LMG1199 and LMG1201, two established W. eutropha reference strains (Jenni et al., 1988), were very similar. DNA-DNA hybridisation experiments and DNA base ratio were also carried out. The DNA-DNA binding values obtained were 100% between W. eutropha LMG1199 and LMG1201, 79% between W. eutropha LMG1199 and C. necator LMG8453 and 92% between W. eutropha LMG1201 and C. necator LMG8453. These data indicate unambiguously that the three
4 isolates represent the same genospecies and confirm that, in the genera Ralstonia and Wautersia; high protein electrophoretic similarity correlates with a high level of DNA- DNA hybridisation (Coenye et al., 1999, 2003a; Vandamme et al., 1999; Goris et al., 2001). Given the reported difference in DNA base ratio for the two taxa (67% GC for W. eutropha (Goris et al., 2001) versus 57% for C. necator (Makkar and Casida, 1987), the %GC content of C. necator LMG8453 was determined by two different methods. Theses methods yielded a %GC content of 65 and 66. These values are similar to values previously determined for W. eutropha (Goris et al., 2001; Jenni et al., 1988) and clearly different from the value for C. necator determined by Makkar and Casida, (1987), which is believed to be due to experimental error in the original study. The results of the extensive biochemical characterization of C. necator LMG8453 generally correlate well with those provided by Yabuuchi et al., (1995) and De Baere et al., (2001) for W. eutropha. Both organisms are reported as Gram-Negative, peritrichously flagellated bacteria. They produce catalase and oxidase and reduce nitrate to nitrite but exhibit no DNase activity. They hydrolyse Tween 80, but not urea, gelatin or aesculin. The remarkable resistance to (and growth stimulation by) copper was one of the key arguments for excluding strain LMG8453 from the genus Alcaligenes (Makkar and Casida, 1987). However, resistance to copper and a range of other metals is well documented for species now classified in Wautersia and are often plasmid-borne (Mergeay et al., 2003). All these results from the study by Vandamme and Coenye, (2004) indicate that, in the 1980s, the isolate described by Makkar and Casida, 1987 should have been classified as Alcaligenes eutrophus (Davis, 1969). Alcaligenes eutrophus was reclassified in the novel genus Ralstonia, together with two former Burkholderia species, Burkholderia solanacearum and Burkholderia pickettii (Yabuuchi et al., 1995). Subsequently, the genus Ralstonia was divided into Ralstonia sensu stricto and the novel genus Wautersia, with W. eutropha as the type species. As outlined above, the name C. necator was validly published in 1987 and the names Ralstonia and Wautersia were only published much later. Rule 23a of the International Code of Nomenclature of Bacteria (Lapage et al., 1992) specifies that each taxon can allow only one correct name, that is, the earliest that is in accordance with the Rules of the Code. In addition, the nomenclatural type of a taxon is that element of the taxon with which it is permanently associated. Rule 42 specifies that, in the case of subspecies, species, subgenera and genera, if two or more taxa of the same rank are united, the oldest legitimate name is retained. Therefore, the
5 genus name Wautersia is a later synonym of the genus Cupriavidus, for which the type species is C. necator (Rule 15 of the Code). Furthermore, the Code stipulates that the type determines the application of the name of a taxon if the taxon is subsequently divided or united with another taxon (Rule 17). Conforming to Rule 37a, that the name of a taxon must be changed if the nomenclatural type is excluded, the name Wautersia was replaced by Cupriavidus and that all species of the genus Wautersia are considered species of the genus Cupriavidus. Therefore the remaining Wautersia species were reclassified, i.e. Wautersia basilensis, Wautersia campinensis, Wautersia gilardii, Wautersia metallidurans, Wautersia oxalatica, Wautersia paucula, Wautersia respiraculi and Wautersia taiwanensis, into the genus Cupriavidus. The genus Cupriavidus made up of the species Cupriavidus basilensis, Cupriavidus campinensis, Cupriavidus gilardii, Cupriavidus metallidurans, Cupriavidus oxalaticus, Cupriavidus pauculus, Cupriavidus respiraculi, Cupriavidus taiwanensis and the Type strain Cupriavidus necator (Wautersia eutropha). Figure 1.1 shows a phylogenetic tree of the 16S rRNA gene sequence of C. necator LMG8453 with those of strains representing Wautersia, Ralstonia and other β-Proteobacteria.
6
Fig 1.1: Phylogenetic tree based on 16S rRNA gene sequence homology for species of the genera Ralstonia and Cupriavidus and representative species of the β-Proteobacteria. Cluster analysis was based upon the neighbour-joining method. Numbers at branch-points are percentages of 1000 bootstrap resamplings that support the topology of the tree. The scale bar represents 0.01 substitutions per nucleotide position. (Accession Numbers can be seen in Appendix 1, Jan 2009).
1.2. Phenotypic Characteristics of the Genus Ralstonia
Members of the Ralstonia genus are Gram-Negative, straight rods (Fig 1.2), which are 1 to 5 µm in diameter and 0.5 to 1.0 µm in width (Gilligan and Whittier, 1999; MacFaddin, 2000). Ralstonia spp. are non-spore forming, motile, oxidase positive bacteria that are nonencapsulated (MacFaddin, 2000). Organisms of this genus grow under aerobic conditions at an optimum growth temperature of between 30-37°C and they appear as nonfermenters on MacConkey agar (Gilligan and Whittier, 1999; MacFaddin, 2000).
7
Fig 1.2: Gram stain of R. pickettii DSM6297 grown overnight in TSB, visualised using a SEM microscope (JEOL JCM-840). Magnification 7000x Bar scale 1 micron (Adley et al., 2005)
1.3. Natural Habitat of Ralstonia spp
Ralstonia spp. have been isolated worldwide from a diverse range of ecological niches. These include plants and soils that are contaminated with heavy metals (Coenye et al., 2002a). Members of this genus are primarily environmental organisms found in water, soils and on plant surfaces particularly on both fruits and vegetables (R. solanacearum). They are significant plant pathogens (Hayward, 1991; Hayward, 1994; Gilligan et al., 2003), R. solanacearum, for example, is the cause of wilting disease in over 200 plant species worldwide. Its hosts include potato, tobacco and tomato (Flavier et al., 1997). Members of this genus have been identified as clinical pathogens of varying significance; Ralstonia insidiosa (Coenye et al., 2003a), R. mannitolilytica (Vaneechoutte et al., 2001) with R. pickettii being the only species of this genus that is of high clinical importance (De Baere et al., 2001). Ralstonia spp. are also capable of surviving in aqueous environments and can also form biofilms (Gilligan et al., 2003).
8 1.4. Ralstonia pickettii
Ralstonia pickettii was first described in 1964 amongst a group of nonfermentative Gram-Negative rods. However, at the time it was not recognised as a different species due to it similarly to both Pseudomonas aeruginosa and P. cepacia (Pickett and Greenwood, 1980). In 1973 it was recognized as a separate and distinct species due to its biochemical utilisation properties and its DNA base composition and hybridisation. The organism originally was isolated from hospital specimens and was misidentified as P. pseudoalcaligenes. Further studies revealed over forty distinguishing properties when compared to both P. pseudoalcaligenes and P. alcaligenes. DNA-DNA hybridisation studies later revealed the close homology of the bacterium with P. solanacearum. The name Pseudomonas pickettii was proposed for the newly identified species (Ralston et al., 1973). This new species also turned out to include strains of Centre for Disease Control (CDC) group Va-2 (Tatum et al., 1974; Riley and Weaver, 1975) and possibly other strains. The CDC groups Va-1 and Va-2 were regarded as two different biovars of Pseudomonas pickettii (Pickett and Greenwood, 1980).
1.4.1. Taxonomy of Ralstonia pickettii King et al., (1979) concluded that Pseudomonas pickettii contained several biovars, including strains, which had been designated “Pseudomonas thomasii”. The first reported case (Phillips et al., 1972) dealt with bacteremia and bacteriuria in twenty five patients due to the administration of parenteral fluids prepared at the hospital pharmacy, where deionised water contaminated with “P. thomasii” had been used. Although this name was never validated, it had been used several times (Baird et al., 1976; King et al., 1979; Costas et al., 1990). Pickett, (1994) proposed that the taxonomic situation of R. pickettii should be reduced to the recognition of three biovars, with biovar 1 equal to CDC group Va-1, biovar 2 equal to CDC group Va-2 and biovar 3 mostly consistent with the invalid “Pseudomonas thomasii”. This “Pseudomonas thomasii” was later reclassified as a separate species Ralstonia mannitolilytica (De Baere et al., 2001). The distinctiveness of R. mannitolytica (R. pickettii biovar "3/thomasii") and R. pickettii biovar Va-1 and biovar Va-2 had been recognised previously (Pan et al., 1992). Although the study of King et al., (1979) was not decisive and it failed to establish “P. thomasii” as a valid species, Costas et al., 1990 concluded that SDS-PAGE of whole-cell proteins provided clear evidence that R. pickettii and “P. thomasii” were separate species, a finding that was confirmed by De Baere et al., (2001). In contrast, Pan et al., 1992 reported that HPLC analysis of cell wall fatty acids
9 could not distinguish R. pickettii biovar Va-1 from R. pickettii biovar 3` “Pseudomonas thomasii”. R. mannitolytica (R. pickettii biovar "3/thomasii") strains also differ from R. pickettii by its resistance to desferrioxamine and because of its lack of alkalinisation of tartrate and of nitrate reductase (De Baere et al., 2001).
1.4.2. Genotypic and Phenotypic Characteristics of Ralstonia pickettii In De Baere et al., (2001), it has been shown that two DNA groups could be distinguished, based on both 16S rDNA sequencing and DNA-DNA hybridisation for the CDC groups Va-2 and Va-1. The DNA groups differed at positions 256 and 266 (Escherichia coli numbering; Woese et al., 1983), with strains of DNA group 1 having the nucleotides A and T at those positions, whereas strains of DNA group 2 have G and C. By using restriction enzyme analysis of the amplified 16S rRNA gene with HaeIII, these DNA groups could be distinguished quickly. Although it had been previously reported that genotypic groups and biovars corresponded to each other, these findings were not reproduced by Vaneechoutte et al., (2004). Extensive attempts to confirm the differential acidification of glucose and maltose in isolates of R. pickettii biovars Va-1 and Va-2 failed and turned out to be quantitative rather than qualitative. It proved impossible to delineate the biovars unambiguously on the basis of lactose and maltose acidification, due to the high variability observed and the absence of a clear gap between slow and rapid reactivity. Despite further extensive screening of biochemical characteristics, no clear-cut, unambiguous differentiation was possible between the two DNA groups. Therefore, it was suggested that the biovar designations should no longer be used (De Baere et al., 2001; Vaneechoutte et al., 2004). Ralstonia pickettii itself can be described as an aerobic, nonfermentative, Gram-Negative rod shaped, oxidase positive, non-spore forming microorganism. The individual cells are usually 0.5 to 0.6 µm in width and 1.5 to 3.0 µm in length. Colonies are not pigmented and soluble pigments are not produced. This species is an obligate aerobe with an optimum growth temperature of 35°C. It can grow at 41°C but not at 4°C (Ralston et al., 1973). In a series of experiments carried out by Anderson et al., (1985), R. pickettii was demonstrated to grow at a wide range of temperatures (15-42°C) as well as in saline solution. Guanine and cytosine nucleotide base pairs comprise approximately 64% of its DNA content (De Baere et al., 2001). R. pickettii is a motile organism with polar monotrichous flagellum (Yabuuchi et al., 1992). R. pickettii can be distinguished from all other member of the genus Ralstonia and other nonfermentative, Gram-Negative rods by resistance to polymixin B, acid production from glucose but not
10 from ethanol, sucrose, or mannitol, alkali production from urea and malonate, and gas production from nitrate at between 20-30°C (Pickett and Greenwood, 1980). Microscopically, it may appear as single or paired rods or occasionally in short chains (Hugh and Gilardi, 1980; Adley et al., 2005, Fig. 1.2). Incubation of R. pickettii on blood agar plates reveals colonies that are opaque, circular, convex, approximately 1 mm in diameter, and nonhemolytic (Riley and Weaver, 1975; Trotter et al., 1990). The organism is slow growing and barely visible after 24 hr of incubation (Trotter et al., 1990; Verschraegen et al., 1985). It has several biochemical characteristics that separate it from other Pseudomonas species includes species growth on Salmonella-Shigella agar, carbohydrate oxidation and arginine dihydrolase production (Riley and Weaver, 1975).
1.4.3. Clinical significance of Ralstonia pickettii R. pickettii is not considered to be a major pathogen and its virulence is thought to be low, therefore it is not usually checked for in routine hospital analysis (Gilligan et al., 2003). Investigating this claim has however, identified a wide range of R. pickettii infections reported in the literature. This indicates that the organism may be a more widespread pathogen then was previously thought and the types of infections more invasive and severe. A review of the types of infection are summarised in Table 1.3. Many of the cases of infection with R. pickettii are due to contaminated solutions (Chetoui et al., 1997; Moreira et al., 2005), which can include: WFI [Water For Injection] (Roberts et al., 1990), saline solutions made with purified water (McNeil et al., 1985) or sterile drug solutions (Fernandez et al., 1996). These can be given intravenously (Roberts et al., 1990), as a drip solution (Chetoui et al., 1997), used to clean wounds, or for endotracheal suctioning (McNeill et al., 1985). These have lead to both bloodstream (bacteraemia) and respiratory infections. In many of these incidences contamination of the product usually happens at the manufacturing stage. There can be many reasons for this but one of the most important is the ability of R. pickettii to pass through both 0.45 and 0.22 µm filters used for the terminal (end-stage) sterilisation of several medicinal products e.g. saline solution (Anderson et al., 1985). Investigations in our laboratory have also found that R. pickettii can flow through 0.2µm Millipore filters (Adley et al., 2005). An example of how contamination occurs at the manufacturing stage was seen in 1983, where five infants became infected with R. pickettii associated with a contaminated respiratory therapy solution (MMWR, 1983). The organism gained entry into the solution because an 82°C holding tank was by-passed during distilled 11 water manufacture. This contaminated solution was then used for endotracheal suctioning and this allowed colonisation of the patients. R. pickettii has the ability to survive in hospital disinfectants including chlorhexidine (Verschraegen et al., 1985) and ethacridine lactate (acrinol) (Oie and Kamiya, 1996). In 1983 six patients were infected with R. pickettii that caused septicaemia; the source of the contamination was traced back to the bidistilled water used to make up the 0.05% aqueous solution of chlorhexidine (Kahan et al., 1983). This was then used for skin antisepsis before the insertion of a venous catheter. R. pickettii has also been associated with permanent indwelling intravenous devices [PIIDs] (Raveh et al., 1993) where four female patients became infected with R. pickettii, the ultimate source of the bacteria was not determined. In contrast contaminated sterile distilled water was implicated in a series of Hickman catheter associated R. pickettii infections when seven patients developed septicaemias in a paediatric oncology unit (Lacey and Want, 1991). R. pickettii has also been isolated from unusual clinical situations and severe invasive infections including osteomyelitis (Wertheim and Markovitz, 1992; Degeorges et al., 2005), a seminal infection (Carrell et al., 2003), septic arthritis in a drug user (Zellweger et al., 2004), invasive infections in drug users (Maki et al., 1991) and meningitis (Fass and Barnishan, 1976; Heagney, 1998; T'Sjoen et al., 2001) while T'Sjoen et al., also reported the case of a 38 year old female who contracted both bacteremia and meningitis due to R. pickettii infection. In many of these cases the aetiology was unknown. R. pickettii has been associated with pseudo-outbreaks (Costas et al., 1990; Luk, 1996), which can cause unnecessary treatments to be administered to patients, and is also a waste of valuable time and resources in hospital laboratories. Pseudo-outbreaks maybe due to many different causes; these may include contaminated distilled water used in the bacterial testing procedures (Verschraegen et al., 1985; Heard et al., 1990), phlebotomist error (Luk, 1996) or contamination at the manufacturing stage of materials used in the laboratory testing (Boutros et al., 2002). Verschraegen et al., (1985) reported that R. pickettii was the cause of pseudobacteremia in nineteen patients in a surgical ward. The patients did not demonstrate any signs of bacteremia, even though the organism was isolated from blood samples. The contamination was traced to distilled water (used in the testing procedures) and a 0.5% chlorhexidine solution prepared using the distilled water that was used to wipe the bench. Both of these were found in the hospital pharmacy (Verschraegen et al., 1985). R. pickettii has been
12 isolated from cystic fibrosis patients (Burns et al., 1998) and Crohn’s disease sufferers (Parent et al., 1978).
1.4.3.1. Underlying Causes Many of the patients in these reported instances of R. pickettii infection (Table 1.3) had an underlying disease or condition that allowed the organism to infect them. Examples of this include: Fujita et al.,(1985) where the patient, a 53 year old man, who had suffered a myocardial infarction contracted R. pickettii related bacteraemia; Yuen et al., (1998) where the patient, a 32-year old man, was suffering from Hepatitis C related liver cirrhosis acquired R. pickettii related nonneutrocytic bacterascites (peritonitis); Ahkee et al., (1995) where the patient, a 41-year-old male, who contracted R. pickettii pneumonia was suffering from diabetes mellitus. Wertheim and Markovitz, (1992) reported a 71-year-old male patient that had chronic renal failure; diabetes mellitus, hypertension and alcoholic cirrhosis had contracted R. pickettii related osteomyelitis.
1.4.3.2. Morbidity Related to R. pickettii Four instances of death have been recorded in cases linked to R. pickettii infection. The first known instance of R. pickettii related death was recorded in 1968. A 33 year old man (drug user) died of Group IVd related endocarditis (Graber et al., 1968). This was later identified as R. pickettii by Dimech et al., (1993). The second known instance of death was recorded in Poty et al., (1987) where two patients (71 and 74 years old), who were both diabetic died of R. pickettii related septicaemia. The source of the R. pickettii contamination was found to be the ion-exchange resins used to purify water for hospital use (Poty et al., 1987). The third instance of death was recorded by Timm et al., in 1995 where a premature infant died due to R. pickettii related pneumonia. The fourth known instance of death found to be R. pickettii related was recorded by Moreira et al., (2005), in this case the deaths of two premature babies were found to be associated with R. pickettii. Case 1 (male, birth weight (BW) 770 g) became septicaemic, deteriorated rapidly and died the following day. B. cepacia complex and R. pickettii isolates grew on antemortem blood cultures. Case 2 (male, BW 785 g) had clinical sepsis diagnosed. A few days later he had a documented episode of R. pickettii bacteraemia, his condition deteriorated and he died soon after. The infection of R. pickettii was shown to be due to contaminated vials of WFI (Moreira et al., 2005).
13 Table 1.3: Ralstonia pickettii Infections Condition Country Number of Source of Outbreak References Patients Endocarditis USA 1 N/A Graber et al., 1968 Meningitis USA 1 N/A Fass and Barnishan 1976 Infection USA 1 Crohn's disease sufferer Parent et al., 1978 Bacteremia Japan 1 Catheter Fujita et al., 1981 Septicaemia Switzerland 1 N/A Japp et al., 1981 Bacteremia France 2 Catheter Hansen et al., 1982 Respiratory USA 5 Respiratory Therapy MMWR., 1983 Infection Solution Septicaemia France 6 Chlorhexidine Solution Kahan et al., 1983 Respiratory France 9 Respiratory Therapy Gardner et al., 1984 Infection Solution Pseudobacteremia Belgium 17 Distilled Water Verschraegen et al., 1985 Asymptomatic USA 5 Purified Saline McNeil et al., 1985 Bacteremia France 1 N/A Chomarat et al., 1985 Asymptomatic USA N/A Myelosuppressed Cancer Minah et al., 1986 Patients Septicaemia France 4 Ion-exchange resin Poty et al., 1987 Bacteremia Australia 19 WFI Roberts et al., 1990 Pneumonia USA 1 N/A Trotter et al., 1990 Pseudo-outbreak UK 28 N/A Costas et al., 1990 Pseudobacteremia USA 14 Hospital Water Heard et al., 1990 Septicaemia South 7 Distilled Water Lacey and Want, Africa 1991 Bacteremia USA 1 Bone-marrow Lazarus et al., 1991 Transplantation Bacteremia USA 9 Distilled Water Maki et al., 1991 Osteomyelitis USA 1 N/A Wertheim and Markovitz, 1992 Nosocomial China 24 Distilled Water/Saline Pan et al., 1992 Infection Bacteremia USA 4 Permanent Indwelling Raveh et al., 1993 Devices Pneumonia USA 1 Respiratory Therapy Ahkee et al., 1995 Solution Bacteremia Greece 13 Indwelling lines Paraskaki et al., 1995 Bacteremia USA 6 Purified Saline Melin et al., 1995 Pneumonia USA 10 Acetic acid cleaning Timm et al., 1995 solution Nosocomial Spain 46 Intravenous Ranitidine Fernandez et al., Infection 1996 Pseudobacteremia Hong Kong 25 Phlebotomist Error Luk, 1996 Pneumonia USA 1 Home Water Birth Hagadorn et al., 1997 Bacteremia Belgium 6 Purified Saline Chetoui et al., 1997
14 Condition Country Number of Source of Outbreak References Patients Spinal Osteitis Germany 1 Haemodialysis machine Elsner et al., 1998 Respiratory USA 19 PW Saline MMWR 1998 Infection Nonneutrocytic Hong Kong 1 N/A Yuen et al., 1998 bacterascites (peritonitis) Respiratory USA 2 Cystic Fibrosis Sufferer Burns et al., 1998 Infection Meningitis USA 1 N/A Heagney, 1998 Respiratory USA 34 Respiratory Therapy Labarca et al., 1999 Infection Solution Asymptomatic France 6 Distilled Water/ Maroye et al., 2000 Chlorhexidine Asymptomatic UK 1 N/A Morar et al., 2000 Asymptomatic Japan 7 Water Still Yoneyama et al., 2000 Pneumonia Spain 1 N/A Minambres et al., 2001 Bacteremia Italy 1 N/A Candoni et al., 2001 Bacteraemia Belgium 1 Surgical Shunt T'Sjoen et al., 2001 Pseudobacteremia France N/A Water Cooling Bath Boutros et al., 2002 Bacteremia Hong Kong 1 Cord Blood Transplant Woo et al., 2002 Septic Arthritis Switzerland 1 Intravenous Drug User Zellweger et al., 2004 Seminal Infection USA 1 N/A Carrell et al., 2003 Septicaemia Italy 9 Heparin solution Marroni et al., 2003 Pneumonia Turkey 2 Distilled Water Kendirli et al., 2004 Nosocomial Turkey 1 Distilled Incubator Water Adiloglu et al., 2004 Infection Bacteremia Turkey 2 Port-A-Caths Kismet et al., 2005 Blood Stream Brazil 4 WFI Moreira et al., 2005 Infection Spondylitis USA 1 N/A Sudo et al., 2005 Osteomyelitis France 1 N/A Degeorges et al., 2005 Bacteremia Italy 16 Catheter Pasticci et al., 2005 Bacteremia USA 18 heparin flush Kimura et al., 2005 Pseudobacteremia France 6 detergent-disinfectant Barbut et al., 2006
Blood Stream Germany 8 Heparin solution Zuschneid et al., Infection 2006 Bacteremia Canada 2 extracorporeal membrane Forgie et al., 2007 oxygenation Blood Stream Brazil 19 contaminated intravenous Pellegrino et al., Infection solution 2008 Sepsis Unknown Unknown Unknown Vitaliti et al., 2008 N/A- Not Available WFI- Water for Injection
15 1.4.3.3. Review of the clinical incidences of R. pickettii In the literature search presented in Table 1.3 sixty-one separate identified instances of a clinical presence or infection with R. pickettii to January 2009 are listed. An earlier version of this table was published in the Journal of Hospital Infection (March 2006, Ryan et al., 2006). The major conditions that are associated with R. pickettii infection are bacteremia/septicaemia and respiratory infections/pneumonia. The breakdowns of conditions can be seen in Table 1.4. Thirty-nine of these instances (62%) are directly attributable to hospital-based acquisition. Fourteen of the instances (22%) presented in the table had unknown aetiology. Six of these instances (10%) were due to miscellaneous causes. Four instances of infection were recorded as having caused death (6.5%). The total number of patients involved in separate R. pickettii infections/ pseudo- infections was 418 (mean 7, median 4, range 1-46).
Table 1.4: Breakdown of Sixty-three Cases of Ralstonia pickettii Infections Found in the Literature Condition Number of Percentage of Incidents Incidents Bacteremia\Septicaemia 26 41 Pneumonia 6 10 Respiratory Infection 5 8 Meningitis 2 3 Osteomyelitis 2 3 Spondylitis 1 2 Spinal Osteitis 1 2 Nonneutrocytic 1 2 bacterascites (peritonitis) Septic Arthritis 1 2 Seminal Infection 1 2 Endocarditis 1 2 Bacteremia/ Meningitis 1 2 Infection 3 5 Pseudobacteremia 6 10 Asymptomatic 5 9 Crohn’s Disease 1 2
1.4.4. Antibiotic Resistance Patterns of Ralstonia pickettii R. pickettii has also been shown to be resistant to a wide range of antibiotics (Hansen et al., 1982). A naturally occurring chromosomal and inducible Ambler class D ß-lactamase, oxacillinase 22 (OXA-22), in a clinical isolate of R. pickettii was described by Nordmann et al., (2000). OXA-22-like genes were further identified in five other clinical isolates. In susceptibility tests where Minimum Inhibitory Concentrations (MIC) of selected β-lactams were determined R. pickettii isolates were resistant, or had decreased susceptibility, against amino- and ureidopenicillins, restricted spectrum
16 cephalosporins, ceftazidime, and aztreonam, while susceptibility to ceftriaxone was not studied. Though not tested, it is reasonable to assume that ceftriaxone is also, at least partially, hydrolysed by OXA-22. In addition, the expression of OXA-22 is inducible in R. pickettii (Nordmann et al., 2000). In 2004 it was discovered that R. pickettii also has OXA-60, a chromosomal, inducible Class D β-lactamase that has a narrow-spectrum hydrolysis profile that includes imipenem, piperacillin, cefotaxime, cefoxitin, cefuroxime, and cefepime (Girlich et al., 2004). A full list of the antibiotic susceptibility of R. pickettii, based on previously published reports, is outlined in Table 1.5.
Table 1.5: Review of Previous Antibiotyping of Ralstonia pickettii Reference Condition Susceptible to Resistance to Fujita et al., Bacteremia Sulphamethoxazole-trimethoprim, Ampicillin, amikacin, 1981 cefoxitin, cephalexin, minocycline kanamycin, gentamicin, chloramphenicol, sulbenicillin, cefazolin, cephaloridine, linocomycin, colistin Japp et al., Carbenicillin, cefoxitin, Ampicillin, Polymixin 1981 kanamycin, gentamicin, B, nitrofurantoin chloramphenicol, Sulphamethoxazole-trimethoprim, amikacin, kanamycin, gentamicin, tobramycin, erythromycin, cephalothin, cefamandole Hansen et al., Bacteremia Sulphamethoxazole-trimethoprim, Penicillin G, colistin 1982 chloramphenicol Kahan et al., Septicaemia Cephalothin, carbenicillin, Colistin, streptomycin, 1983 tetracycline, minocycline, kanamycin, erythromycin, rifampin, gentamicin, pristinamycin, nalidixic acid, tobramycin, amikacin, sulphonamides, spiramycin, sulphamethoxazole-trimethoprim, lincomycin, tetracycline clindamycin, novobiocin, ampicillin, nitrofurantoin, pipemidic acid Verschraegen Pseudo- Sulphamethoxazole-trimethoprim, Polymixin, gentamicin, et al., 1985 bacteremia ampicillin, cefazolin, tetracycline tobramycin, netilmicin, amikacin Roberts et al., Bacteremia Sulphamethoxazole-trimethoprim, Polymixin, gentamicin, 1990 ticarcillin, piperacillin, nalidixic tobramycin, amikacin, acid, ciprofloxacin, cephalothin, nitrofurantoin, chloroamphenicol, tetracycline, aztreonam cefoxitin, cefotaxime Lacey and Septicaemia Cefotaxime, cephradine, Ampicillin, Want 1991 piperacillin, cefoxitin, tetracycline Maki et al., Bacteremia Cefoxitin, cefotaxime, gentamicin, Ampicillin, ticarcillin,
17 1991 tobramycin, sulphamethoxazole- polymixin, cephalothin trimethoprim, tetracycline Reference Condition Susceptible to Resistance to Wertheim and Osteomyelitis Ampicillin, ampicillin-sulbactam, N/A Markovitz, piperacillin, cephalothin, cefoxitin, 1992 trimethoprim-sulfamethoxazole, ciprofloxacin, amoxicillin- clavulanic acid, cefuroxime, ceftriaxone, ceftazidime, imipenem, aztreonam, ticarcillin- clavulanic acid, cefotaxime, cefoperazone, mezlocillin. Raveh et al., Bacteremia Cefotaxime, mezlocillin, Gentamicin, 1993 sulphamethoxazole-trimethoprim, polymixin, amikacin cefazolin, cefuroxine Dimech et al., Typing Cefotaxime, cephalothin, Colistin, erythromycin, 1993 experiment ciprofloxacin, imipenem, fusidic acid, oxacillin, piperacillin, methicillin, trimethoprim nitrofurantoin, novobiocin, rifampin, vancomycin Elsner et al., Spinal- Osteitis Ampicillin, mezlocillin, N/A 1998 piperacillin, cefoxitin, cefotaxime, tetracycline, sulphamethoxazole- trimethoprim, ciprofloxacin Yuen et al., Nonneutrocytic Ampicillin, gentamicin, ofloxacin, N/A 1998 bacterascites sulperazon, cefuroxime, septrin, (peritonitis) cephalothin Heagney, 1998 Meningitis Ceftazidime, imipenem, Gentamicin, aztreonam ciprofloxacin, ceftriaxone Labarca et al., Respiratory Ceftazidime, Piperacillin, N/A 1999 Infection imipenem, sulphamethoxazole- trimethoprim, gentamicin, tobramycin Maroye et al., Asymptomatic Piperacillin, cefotaxime, Ceftazidime, 2000 Piperacillin-tazobactam, aztreonam, cefsulodin, imipenem, cefepime, colistin ciprofloxacin, ofloxacin, sulphamethoxazole-trimethoprim Candoni et al., Bacteremia Piperacillin, Piperacillin- Amikacin, gentamicin, 2001 tazobactam, cefotaxime, cefoxitin, netilmicin, tobramycin, ciprofloxacin, imipenem- ceftazidime, ampicillin cilastatine Woo et al., Bacteremia Piperacillin, cefaperazone- Gentamicin, 2002 sulbactum, sulphamethoxazole- tobramycin, amikacin, trimethoprim, Piperacillin- ticarcillin- clavulanate, tazobactam, ciprofloxacin, ceftazidime imipenem Zellweger et Septic Arthritis Piperacillin, Piperacillin- Gentamicin, al., 2004 tazobactam, cefuroxime, tobramycin, amikacin, ceftriaxone, ceftazidime, ampicillin-clavulanate, cefepime, imipenem, ticarcillin- clavulanate
18 sulphamethoxazole-trimethoprim, ciprofloxacin Reference Condition Susceptible to Resistance to Kendirli et al., Pneumonia Piperacillin-tazobactam Meropenem 2004 Kismet et al., Bacteremia Meropenem N/A 2005 Pasticci et al., Bacteremia Imipenem, cefotaxime, Aminoglycosides, 2005 quinolones, ceftazidime aztreonam Adley and Antibiotyping Sulphamethoxazole-trimethoprim, Cefotaxime, Saieb 2005b experiment ciprofloxacin, oxacillin Ticarcillin, gentamicin, chloramphenicol Barbut et al., Pseudo- Sulphamethoxazole-trimethoprim, Polymixin, gentamicin, 2006 bacteremia piperacillin-tazobactam, tobramycin, amikacin, imipenem, amoxicillin- netilmicin, cefoxitin, clavulanate cefalothin, cefepim, fosfomycin, fluoroquinolones
1.4.5. Industrial significance of Ralstonia pickettii R. pickettii has the ability to grow in aqueous environments and to develop biofilms that can create problems in industrial settings. It has been identified in biofilm formation in plastic water piping (Anderson et al., 1990). It has been isolated in many industrial purified water systems (Adley et al., 2005). Its potential to form biofilm is putatively due to its ability to produce homoserine lactones (Adley and Saieb, 2005a), which are known cell-signalling molecules involved in biofilm formation (Davies et al., 1998). R. pickettii has also been identified in the Space Shuttle water system, which has a once-through water system that is initially filled on the ground, partially drained before launch and then refilled with fuel cell generated water on orbit. The microbial standard for the Space Shuttle potable water system during this study period allowed only 1 microbe of any kind per 100 ml and no detectable coliforms. In the samples taken from the contaminated water of the Space shuttle, it is noted that these samples contained on average 55 CFU/100 ml. Further assessment of water samples taken during the STS-70 mission aboard the Space Shuttle Discovery revealed that these samples were contaminated (> 20 CFU/ml) with B. cepacia and R. pickettii (Koenig and Pierson, 1997). Five isolates of R. pickettii were also isolated from the Mars Odyssey probe encapsulation facility (La Duc et al., 2004). R. pickettii can also be used to create Poly [hydroxyalkanoic] acids (PHAs) that make biodegradable plastics (Bonatto et al., 2004).
19 1.4.5.1. Biodegradative abilities of Ralstonia pickettii R. pickettii can survive in nutrient poor environments and conditions by using various toxic compounds as carbon and energy sources. It can degrade a variety of toxic compounds including chlorophenols, aromatic hydrocarbons, 2,4-Dichlorophenoxyolic acid, nitroaromatics, 3,4-Dichloropropionanilide (propanil), lantadenes and pentacyclic triterpenoid compounds. Such properties are encoded by chromosome and plasmid associated genes (Bruins et al., 2000). A full list of the biodegradative abilities of R. pickettii can be seen in Table 1.6. These abilities may also have biotechnological potential. Some strains of the organism have been shown to be resistant to heavy metals e.g. copper, zinc and cadmium (Bruins et al., 2003). A review of the biodegradative properties of R. pickettii has been published in the Journal of Applied Microbiology (Ryan et al., 2007).
Table 1.6: Toxic Compounds Degraded by Ralstonia pickettii Substrate Genes Responsible Reference(s) Benzene tbu pathway Kukor and Olsen, 1992; Massol-Deya et al., 1997 Meta-cresol tbu pathway Kukor and Olsen, 1992; McClay et al., 1996 Ortho-cresol tbu pathway McClay et al., 1996 Para-cresol tbu pathway McClay et al., 1996 1, 4-Dioxane tbu pathway Mahendra and Alvarez-Cohen 2006 tdf genes in pKA4 Ka and Tiedje, 1994, Ka et al., 2,4-dichlorophenoxy acetic acid 1994 a, b 3,4-Dichloropropionanilide Unknown Hirase and Matsunaka, 1991 2, 3 and 4-Monochlorophenol Unknown Fava et al., 1995 N-nitrosodimethylamine tbu pathway Sharp et al., 2005 Nitrobenzene pnb locus Yabannavar and Zylstra 1995 tbu pathway Haigler and Spain 1991 Pentacyclic triterpenoids Unknown Sharma et al., 1997 Phenol tbu pathway Kukor and Olsen, 1992 Quinoline Unknown Jianlong et al. 2002 Toluene tbu pathway Kahng et al., 2000; Kukor and Olsen 1992; Massol-Deya et al., 1997; McClay et al., 1996 Trichloroethylene tbu pathway Leahy et al., 1996 2, 4, 6-Trichlorophenol had locus Kiyohara et al., 1992; Takizawa et al., 1995 2-chlorophenol Unknown Farrell and Quilty 1999. Pentachlorophenol Unknown Kiyohara et al., 1992 Table adapted from that published in Ryan et al., 2007
20 1.4.5.2. Lipase Evaluation studies have been carried out to discover the efficacy of removal of triglyceride stains on laundry by lipase from R. pickettii both with and without detergents (Hemachander and Puvanakrishnan, 1999). Lipase from R. pickettii improved the removal of oil from cotton fabrics as an additive to two commercial detergents: ‘Ariel’ and ‘Surf Ultra’ under the optimum conditions of 100 U of lipase, 40°C as washing temperature, twenty minutes as washing time and 0.6% as detergent concentration. Some of the detergents were in fact shown to actually increase the activity of the lipase. This compares favourably with studies carried out on lipases from other bacterial and fungal strains. This study indicated that R. pickettii lipase could be used as a very effective additive in detergent formulations (Hemachander and Puvanakrishnan, 1999). The bacteria can produce this enzyme in industrial friendly manner i.e. immobilised within beads (Hemachander et al., 2001). The possibility exists that this system may be adapted for use in industrial systems to clear triglyceride stains that block pipes or clog up machinery and in environmental situations.
1.5. Ralstonia insidiosa
R. insidiosa is a closely related species to R. pickettii and is a Gram-Negative, non-sporulating, aerobic, non-fermentative, motile rod, with one to three polar flagella. Aerobic growth is observed at 28, 32 and 37°C. Growth is also detected on Burkholderia cepacia-selective agar. Catalase, oxidase, lipase, phosphatase, proline aminopeptidase, pyrrolidonyl aminopeptidase and γ-L-glutamyl aminopeptidase activities are present (Coenye et al., 2003a). R. insidiosa has been shown to be negative for lysine decarboxylase, arginine dihydrolase, gelatinase, α-glucosidase, β-glucosidase, tryptophan aminopeptidase and N-benzyl-arginine aminopeptidase activities. Indole is not produced. No acid is produced from either sucrose or mannitol. The major biochemical differences between R. pickettii and R. insidiosa can be seen in Table 1.7
Table 1.7: Biochemical Differences Between Ralstonia insidiosa and Ralstonia pickettii Nutrient Source Ralstonia pickettii Ralstonia insidiosa Nitrate Reduction + - Arabinose + - N-acetylglucosamine + - Desferrioxamine + - Susceptibility
21 The original description (Coenye et al., 2003a) mentions a lack of acid production from glucose, but in Vaneechoutte et al., 2004, oxidative acid production was observed from glucose, L-arabinose and xylose. Acid production from lactose is variable. Glucose, gluconate, caprate, adipate, malate and citrate are assimilated, but L- arabinose, mannose, mannitol and maltose are not. Alkalinisation occurs on minimal mineral agar with acetate, allantoin, lactate and malonate, but not with galacturonate, oxalate or maleate. Nitrate reduction is negative. The bacterium is resistant to colistin and desferrioxamine. Two biovars can be distinguished. One group biovar 1 (which includes the Type strain of Ralstonia insidiosa LMG21421) are negative for acid production, assimilation of N-acetylglucosamine, gelatin hydrolysis and alkalinisation of mucate on Simmons' base agar, whereas strains of the other group biovar 2 (which includes strain CCUG46389) are positive for these characteristics. The first group is adipate-positive on API 20NE (BioMérieux), whereas the second group is negative for this characteristic. Reciprocal DNA-DNA hybridisation values for strains LMG21421 and CCUG46389 are 87.9 and 87.4%, indicated that both of these biovars belong to the same species. The DNA %GC content is 63.9-64.3. The type strain of this species is LMG21421, which was isolated from the sputum of a patient with acute lymphoblastic leukaemia in the USA in 2001. The strain’s %GC content is 64.3. The type strain has no urease activity, does not assimilate N-acetylglucosamine and assimilates phenylacetate (Vaneechoutte et al., 2004). R. insidiosa has been isolated from the respiratory tracts of cystic fibrosis patients (Coenye et al., 2003a; Coenye et al., 2005), river and pond water, soil, activated sludge (Coenye et al., 2003a) and has also been detected in water distribution systems (Hoefel et al., 2005). It has also been the cause of two cases of serious hospital infection in two immunocompromised individuals (Van der Beek et al., 2005). Only one previous antibiotyping study of Ralstonia insidiosa has been carried out the results of which can be seen in Table 1.8.
Table 1.8: Review of Previous Antibiotyping of Ralstonia insidiosa Reference Condition Susceptible to Resistance to Van der Beek et al., Respiratory Cefotaxime, cefepime, co- Ampicillin, 2005 infection trimoxazole, ciprofloxacin, gentamicin, and piperacillin-tazobactam, and amikacin meropenem
22 1.6. Clinical instances of R. mannitolilytica
R. mannitolilytica is also closely related species to R. pickettii. R. mannitolilytica had previously been called “Pseudomonas thomasii” and R. pickettii biovar 3/“thomasii” and has been described in a limited number of cases of hospital outbreaks (Baird et al., 1976; Dowsett, 1972; Pan et al., 1992; Phillips and Eykyn, 1972). The first report (Phillips, et al., 1972) dealt with bacteremia and bacteriuria in twenty patients due to parenteral fluids prepared with deionised water contaminated with “P. thomasii”. Pan et al., (1992) reported that twenty-three of thirty-nine R. pickettii isolates of an epidemic involving twenty-four patients that was caused by contaminated saline solution (prepared by the hospital pharmacy) belonged to “P. thomasii.” A pseudo-outbreak has also been described as well (Costas et al., 1990). Reports have described it as causing meningitis and hemoperitoneum infection (Vaneechoutte et al., 2001), renal transplant infection (Mukhopadhyay et al., 2003) and bacteremia (Daxboeck et al., 2005). R. mannitolilytica is the most prevalent species of the R. pickettii linage to be found in Cystic Fibrosis suffers (Coenye et al., 2005). Reports of previous antibiotyping of Ralstonia mannitolilytica are outlined in Table 1.9.
Table 1.9: Review of Previous Antibiotyping of Ralstonia mannitolilytica Reference Condition Susceptible to Resistance to Vaneechoutte et al., Meningitis and Cotrimoxazole, Ampicillin, 2001 Hemoperitoneum piperacillin, gentamicin, Infection cefuroxime, temocillin, cefotaxime, aztreonam ceftazidime, imipenem, quinolones Mukhopadhyay et Renal transplant Ampicillin, ampicillin- Cephalexin, al., 2003 infection sulbactum, amoxicillin, ceftazidime, amoxicillin-clavulanic ciprofloxacin, acid, cefaperazone- amikacin, sulbactum, piperacillin, gentamicin cefuroxime, ceftriaxone, cefotaxime Daxboeck et al., Bacteremia Cefepime, Gentamicin, 2005 ciprofloxacin amikacin
1.7. Bacteria in High-purity water
High-purity water (HPW) also known as ultrapure water has become essential for the pharmaceutical industry in the manufacture of medical devices. As biotechnology moves from laboratory to production, HPW needs will rise sharply. In the clinical environment HPW is used in flushing out biochemical analysers and in
23 dialysis machines. In the semiconductor industry where the contamination of silicon wafer surfaces can cause reduced performances, the final stages of wafer manufacturing consist of frequent HPW rinse procedures (Governal et al., 1991). Flat screen monitor manufacturing also uses HPW. Coal-fired power plants use of HPW is enormous and requires three times the quantity used for combined cycle gas turbine plants. Asia has embarked on a programme of coal-fired power plant construction with most of the activity in China. The market for HPW systems, products, and services are estimated to grow from under $3 billion in 2004 to over $4.8 billion in 2010 (McIlvaine, 2006). Organisms that survive in HPW can be considered to be oligotrophic.
1.7.1. Oligotrophic Bacteria Oligotrophic bacteria can be broadly defined as organisms that grow on low concentrations of organic (carbon) sources. While aquatic ecologists have had an interest in oligotrophic bacteria (Baxter et al., 1984; Carlucci et al., 1986; Kuznetsov et al., 1979; Wainwright et al., 1991), these organisms are still relatively unknown to many microbiologists, especially clinical microbiologists. Oligotrophs are ubiquitous in the environment and have been isolated from soil (Hattori and Hattori, 1980; Hattori, 1984), rivers (Yanagita et al., 1978), lakes (Lango, 1988), oceans (Deming, 1986; Stahl et al., 1992), and tap water lacking organic substances (Jaeggi and Schmidt-Lorenz, 1990). Some oligotrophs have been detected growing in clinical materials e.g. urine, vaginal discharge, sputum, pharyngeal mucus, ear discharge and drainage (Tada et al., 1995). Two different types of oligotrophs can be distinguished. Oligotrophs that grow only on low concentrations of carbon are called obligate oligotrophs (Fry, 1990; Ishida and Kadota, 1981). Those that are able to grow at both low and high concentrations of organic substances are called facultative oligotrophs (Fry, 1990; Ishida et al., 1982). These bacteria have received little study, and little is known about them. The mechanism by which they grow under extremely poor nutritional conditions is not known. Oligotrophic bacteria have been used to monitor aseptic pharmaceutical production units (Nagarkar et al., 2001) and as biosensors for heavy metals (Burkholderia cepacia KPC01 and KPC02, Sphingomonas paucimobilis KPS01) (Tada and Inoue, 2000) and other environmental pollutants (Tada et al., 2001) as some oligotrophic organisms are highly susceptible to small quantities of toxic compounds thus they can alert to the presence of these compounds.
24 1.7.2. Water Quality Water is the universal solvent for many scientific experimentations. The commercial systems most commonly used in academic laboratories for HPW are the MilliQ system (www.millipore.com) or the Barnstead NANOpure system (www.barnsteadthermolyne.com). These produce Type I water or HPW, which is of Pharmacopoeia standard. HPW manufacturing instruments must comply with international codes and regulations and are set down in various regional Pharmacopoeias such as PhEur, USP, and JP (European Union, USA and Japan). The European Pharmacopoeia (PhEur 2005) defines Type I water (Aqua valde purificata), as highly purified and sets an action limit, if total viable aerobic count (TVAC) of 10cfu/100 ml, determined using membrane filtration, and S (R2A) media at 30-35°C for five days, are obtained. HPW cannot be stored in tanks as it will pick up contaminants from air (such as carbon dioxide, ions, organic solvents) or from storage containers. It can acquire ions and silica from glassware and plasticisers from plastic containers. The current high standards of HPW have generated a false sense of security regarding HPW circulation systems. It leads people to believe that HPW circulation systems are unsuitable for bacterial colonisation. Several grades of water are used as both the components of pharmaceutical products and for washing equipment. The grade of water is selected according to its role in the process. The production of pharmaceutical water is a complex multistep process. High-purity Water (HPW) production incorporates both pretreatment and polishing stages to remove organics and inorganics (Fig.1.3). A variety of treatments are used to make and maintain HPW including: filtration, the use of UV light; heating and the incorporation of several design features e.g. piping slopes for drainage and smooth uniform internal surface are employed in order to remove, destroy, and control bacteria in the purification system. In particular, treatment with UV254 light and ozonation (treatment with O3) are present in some parts of a facility solely to prevent microbial contamination. Another feature in some water purification systems is the usage of nitrogen gas instead of air, above stored ultrapure water to prevent carbon dioxide and oxygen from dissolving in the water (Mittelman, 1995). Despite these precautions, piping, filters, tanks, and other surfaces within the water supply system provide favourable places for bacterial adhesion and cell growth. The complete removal of contaminating microorganisms is considered to be almost impossible (Henley, 1992; McFeters et al., 1993; Mittleman, 1995). It is generally accepted that Gram-negative bacteria predominate in HPW (Favero et al., 1971; Matsuda et al., 1996; White and Mittleman, 1990) and there are
25 reports describing the ability of these bacteria to survive and proliferate in distilled water (Carson et al., 1975; Favero et al., 1971). A study carried out by Kulakov et al., (2002) showed that the bacteria isolated from the ultrapure water systems were mostly Gram-Negative, and several groups seem to be indigenous for purified water production systems. These included Ralstonia pickettii, Bradyrhizobium, Pseudomonas saccharophilia, Stenotrophomonas and other Ralstonia strains. A more extensive list can be seen in Table 1.10-1.13. The influences of dead bacterial cells and viable or non culturable cells in ultrapure water have been overlooked, to some extent due to the current industry standards that recommend standard plating techniques for bacterial enumeration (ASTM, 2000 a, b). However, some bacteria can utilise the lysis products from dead biomass as carbon and energy sources, a phenomenon known as cryptic growth (Ryan 1959; McAlister et al., 2002). Although it is unclear if all bacteria are capable of cryptic growth, it seems more than likely that oligotrophs possess this attribute, which allows them to survive. Under the extreme conditions of ultrapure water, oligotrophs are likely to utilise whatever viable nutrient resources, are available, or they face potential starvation.
Fig 1.3: Schematic representation of an ultrapure water system. The shaded areas refer to the pre- treatment stages and the clear areas indicate the polishing loop. (From Kulakov et al., 2002)
26 Table 1.10: Instances of Bacteria in Distilled Water Organism Area Reference Year Pseudomonas aeruginosa H Favero et al., 1971 Pseudomonas cepacia H Carson et al., 1973 Pseudomonas cepacia H Gelbart et al., 1976 Pseudomonas pickettii H Kahan et al., 1983 Pseudomonas pickettii H Verschraegen et al., 1985 Caulobacter spp. Pseudomonas paucimobilis H Perez del Molino and 1989 Garcia-Ramos Pseudomonas pickettii H Lacey and Want 1991 Pseudomonas pickettii H Maki et al., 1991 Burkholderia cepacia H Acinetobacter junii/johnsonii Sphingomonas paucimobilis Ralstonia pickettii H Maroye et al., 2000 Ralstonia pickettii H Boutros et al., 2002 Ralstonia pickettii H Kendirli et al., 2004 Key: H- Hospital water system
Table 1.11: Instances of Bacteria in Purified Water Organism Area Reference Year Pseudomonas pickettii H/I McNeil et al., 1983 Pseudomonas pickettii H/I Gardner et al., 1984 Pseudomonas pickettii H/I Anderson et al., 1985 Pseudomonas paucimobilis H Perez del Molino and 1989 Garcia-Ramos Pseudomonas pickettii H Ahkee et al., 1995 Ralstonia pickettii S Koenig and Pierson 1997 Burkholderia cepacia Xanthomonas maltophilia Sphingomonas paucimobilis Bacillus spp. Ralstonia pickettii H Chetoui et al., 1997 Acinetobacter baumannii, I Martino et al., 1998 Acinetobacter johnsonni These samples were Alcaligenes xylosoxidans all isolated from Aeromonas salmonicida various sampling Bacillus polymixa points a Bacillus lentus pharmaceutical plant Bacillus firmus Comamonas acidovrans Chryseomonas luteola Chromobacterium violaceum Comamonas testosteroni Enterobacter aglomerans Enterobacter cloacae Enterobacter sakasaki Erwinia nigrifluens Flavobacterium indologenes Flavimonas coryzihabitants
27 Organism Area Reference Year Pseudomonas pickettii Pseudomonas putida Pseudomonas fluorescens Pseudomonas stutzeri Pseudomonas cepacia Pseudomonas vesiculares Pseudomonas diminuta Pseudomonas aureofasciens Pseudomonas pseudoalcaligenes Micrococcus luteus Micrococcus lylae Micrococcus sedentarius Ochrobactrum anthropi Shewanella putrefasciens Sphingomonas paucimobilis Staphylococcus capitis Staphylococcus cohnni Staphylococcus epidermidis Staphylococcus hominis Staphylococcus intermedius Staphylococcus lentus Staphylococcus sciuri Staphylococcus xylosus Xanthomonas maltophilia Ralstonia pickettii H/I Labraca et al., 1999 Stenotrophomonas maltophilia Microbacterium testaceum S Kawamura et al., 2001 Sphingobacterium spiritivorum Brevundimonas intermedia Delftia acidovrans Sphingomonas subarctica Chryseobacterium toruloides Bradyrhizobium spp. L Kawai et al., 2002 Stenotrophomonas spp. Xanthomonas spp. Pseudomonas aeruginosa I Penna et al., 2002 Pseudomonas pickettii Pseudomonas vesiculares Pseudomonas diminuta Flavobacterium aureum Pseudomonas fluorescens Acinetobacter lwoffi Pseudomonas putida Pseudomonas alcaligenes Pseudomonas paucimobilis Flavobacterium multivorum Aquaspirillum spp. L Kawai et al., 2004 Cellvibrio spp. Mycobacterium spp. Sphingomonas paucimobilis S Castro et al., 2004 Ralstonia eutropha
28 Organism Area Reference Year Sphingomonas stygialis Sphingomonas spp. Methylobacterium fujisawaense Blastobacter denitrificans Bradyrhizobium japonicum Pseudomonas stygialis Acinetobacter calcoaceticus Acinetobacter baumannii Microbacterium liquefaciens Microbacterium luteolum Microbacterium oxydans Enterobacter spp. Klebsiella spp. Delftia acidovorans Key: I- Industry water system, H- Hospital water system, L- Laboratory water system, H- Hospital water system, S- Space vehicle water system
Table 1.12: Instances of Bacteria in Ultra-Pure and High-purity Water Organism Area Reference Year Pseudomonas aeruginosa L Kayser et al., 1975 Pseudomonas cepacia Pseudomonas pickettii I Clancy and Cimini 1991 Alcaligenes paradoxus Pseudomonas spp. Pseudomonas spp. I Patterson et al., 1991 Moraxella spp. Morganella spp. Flexibacter spp. Caulobacter spp. Pseudomonas fluorescens I Matsuda et al., 1996 Pseudomonas putida Pseudomonas stutzeri Ralstonia pickettii H Chetoui et al., 1997 Bradyrhizobium spp. I McAlister et al., 2001 Burkholderia spp. Flavobacterium spp. Pseudomonas spp. Ralstonia pickettii L Kulakov et al., 2002 Bradyrhizobium spp Flavobacterium spp Burkholderia spp. Stenotrophomonas spp. Mycobacterium spp. Bacillus spp. Pseudomonas saccharophilia Ralstonia pickettii I Bradyrhizobium spp Pseudomonas saccharophilia Sphingomonas spp. Pseudomonas fluorescens
29 Ralstonia pickettii L McAlister et al., 2002 Bradyrhizobium spp Ralstonia pickettii L Adley et al., 2005 Ralstonia insidiosa Sphingomonas paucimobilis Stenotrophomonas maltophilia Pseudomonas luteola Bacillus cereus Key: I- Industry water system, H- Hospital water system, L- Laboratory water system, H- Hospital water system
Table 1.13: Instances of Bacteria in Other Purified Water Organism Area Type of Water Reference Year Pseudomonas pickettii H/I Water for Injection Roberts et al., 1989 Ralstonia pickettii H/I Water for Injection Moreira et al., 1995 Burkholderia cepacia Ralstonia pickettii H Chetoui et al., 1997 Sphingomonas paucimobilis H Ultrafiltration Oie et al., 1998 Moraxella spp. H Reverse Osmosis Sphingomonas spp. L Microfiltration Chen et al., 2004 Rhodopseudomonas spp. Bradyrhizobium spp. Rhodopseudomonas spp. Dermacoccus spp. Microbacterium spp. Bacillus spp. Bradyrhizobium spp. L Reverse Osmosis Chen et al., 2004 Zoogloea spp. Rhizobium spp. Caulobacter spp. Bosea spp. Mesorhizobium spp. Agrobacterium spp. Bordetella hinzii Stenotrophomonas acidaminiphila Nevski ramose Brevibacterium spp. Gordonia spp. Aureobacterium spp. Bacillus spp. Staphylococcus spp. Flavobacterium ferrugineum Key: I- Industry water system, H- Hospital water system, L- Laboratory water system, H- Hospital water system
30 1.8. Genotypic Typing of Bacterial Isolates
The term “typing” is used to indicate the differentiation of strains at a subspecies level or below and can be either identifying or comparative. Identifying or determinative typing is utilised in the allocation of organisms to a previously described type in an existing classification scheme. With comparative typing, microbial isolates of a defined set are compared to each other for similarity, with reference to existing classification schemes (Dijkshoorn and Towner, 2001). Diversity refers to the degree of genetic variation within bacterial populations and is related to bacterial systematics at multiple taxonomic and phylogenetic levels (Louws et al., 1999). Taxonomy can be divided into three parts; classification, nomenclature and identification of unknown organisms (Vandamme et al., 1996). Diversity exists at the species level, meaning that organisms isolated from different sources at different times and in different geographical regions can be classified into subtypes and strains (Olive and Bean, 1999). It is essential to determine the genetic diversity of bacterial populations to establish a stable taxonomy, which leads to better classification schemes. Phylogenetics is the process of reconstructing possible evolutionary relationships and uses nucleotide sequences from conserved genes that act as molecular markers (Owen, 2004). There are several criteria that molecular typing methods must meet in order to be broadly useful. Firstly, a molecular typing method should require no previous knowledge of DNA sequence. Secondly, all organisms within a species must be typeable by the method used. Thirdly, any typing method must have a high discrimination power and lastly, a typing method has to provide reproducible results that can be easily interpreted (Olive and Bean, 1999). The choice of typing method depends on the technical difficulty, cost, laboratory resources and the length of time needed to obtain a result. Molecular typing techniques can be characterised into two categories: specific gene analysis and random whole-genome analysis. Random whole- genome analysis techniques recognise random sites on the genome, which cannot be predicted without knowledge of the whole genome sequence (Gürtler and Mayall, 2001). These sites include repetitive elements and restriction sites. Techniques include Repetitive Extragenic Palindromic-PCR (REP-PCR), Random Amplification of Polymorphic DNA (RAPD), Amplified Fragment Length Polymorphism (AFLP) and Pulsed-Field Gel Electrophoresis (PFGE). Specific gene variation includes single-locus and multi-locus typing. Highly variable genes, such as pathogenicity islands, can be targeted by the single-locus approach as they have been directly implicated in causing 31 disease (Gürtler and Mayall, 2001). Multilocus sequence typing (MLST) and the analysis of multi-gene families such as the RNA operons and the tRNA genes are examples of the multi-locus approach to molecular typing. MLST involves sequencing of several housekeeping alleles where the unique sequence of each gene fragment is considered a unique allele (Gürtler and Mayall, 2001). The rRNA operon contains three rRNA genes (16S, 23S and 5S) and three spacer regions that include tRNA genes. 16S rRNA gene sequence is commonly used for phylogenetic analyses, while the 23S rRNA gene and the tRNA are only used to a limited extent. It has been reported that gyrB (encoding the B-subunit of DNA gyrase, a type II DNA topoisomerase), rpoD (encoding σ70 factor which is one of the sigma factors that confer promoter-specific transcription initiation on RNA polymerase) and recA (a multifunctional protein contributing to homologous recombination, DNA repair, and the SOS response), could also be suitable phylogenetic markers for bacterial systematics (Gruber and Bryant, 1997; Huang, 1996; Karlin et al., 1995; Watanabe et al., 2001; Yamamoto et al., 2000).
1.8.1. The 16S rRNA Gene In the 1960s, Smith et al., (1968) noted conservation in the 16S rRNA gene sequence relationships in Bacillus spp. The widespread use of this gene sequence for bacterial identification and taxonomy followed a body of pioneering work primarily by Carl Woese, who defined its important properties. The 16S rRNA gene seems to behave as a molecular chronometer, as pointed out in a review by Woese, (1987); the level of conservation is thought to result from the importance of the 16S rRNA as a vital component of cell function. This is in contrast to the genes needed to make enzymes; mutations in these genes can ordinarily be tolerated more frequently since they may affect structures not as unique and essential as rRNA. For example if a bacterium does not have the gene to make the enzymes necessary to utilize lactose, it can use an alternative sugar or protein as an energy source. Thus, few other genes are as highly conserved as the 16S rRNA gene. Although the absolute rate of change in the 16S rRNA gene sequence is not known, it does mark evolutionary distance and relatedness of organisms (Harmsen and Karch, 2004; Kimura, 1980; Pace, 1997; Thorne et al., 1998). Problems in assigning a numerical value to the rate of change include the possibility that this rate of change of the 16S rRNA gene may not be identical for all organisms (different taxonomic groups could have different rates of change), the rates could vary at times during evolution, and the rates could be different at different sites throughout the 16S rRNA gene. There are so-called "hot spots" that show larger numbers of mutations (Tortoli, 2003; Ueda et al., 1999) and these areas are not the same for all
32 species. 16S rRNA is also the target for antimicrobial agents such as tetracyclines and oxazolidinones (Ross et al., 1998; Matassova et al., 1999). As such, mutations in the 16S rRNA gene can affect the susceptibility of the organism to these agents and the 16S rRNA gene sequence can distinguish phenotypic resistance to antimicrobial agents (Pfister et al., 2003). However, these characteristics do not preclude or affect the use of 16S rRNA gene sequence for bacterial identification or assignment of close relationships at the genus and species level, as used in clinical microbiology. They can have a greater impact on the assignment of relationships of the deeper (more distantly related) branches (Garrity and Holt, 2001). The 16S rRNA gene sequence is approximately 1550bp long and is composed of both variable and conserved regions. The gene is large enough, with sufficient interspecific polymorphisms of the 16S rRNA gene, to provide distinguishing and statistically valid measurements. Universal primers are usually chosen as complementary to the conserved regions at the beginning of the gene and at the end of the whole sequence (about the 1550bp region), and the sequence of the variable regions in between is used for the comparative taxonomy (Relman, 1999). Although 500bp and 1,500bp are common lengths to sequence and compare, sequences in databases can be of various lengths. The 16S rRNA gene sequence has been determined for a large number of strains. GenBank, the largest databank of nucleotide sequences, has over 20 million deposited sequences, of which over 90,000 are of 16S rRNA gene (Clarridge, 2004) this allows the comparison of many previously deposited sequences against the sequence of an unknown strain. Finally, the 16S rRNA gene is universal amongst bacteria, and so relationships can be measured among all bacteria (Woese et al., 1983; Woese, 1987). Generally, the comparison of the 16S rRNA gene sequences allows differentiation between organisms at the genus level across all of the major phyla of bacteria, in addition to classifying strains at multiple levels, including species and subspecies level. The exceptions to the usefulness of 16S rRNA gene sequencing usually relate to more than one well-known species having the same or very similar sequences or multiple sequences within one strain.
33
Fig 1.4: Secondary-structure model of the 16S rRNA (double lines indicate variable or hypervariable; gray lines indicate highly conserved; V1 to V9 indicate major variable regions) (from Tortoli, 2003).
1.8.2. The 16S-23S rRNA spacer region Prokaryotes have genes coding for the different RNAs of an assembled ribosome organised into an operon as a functional transcription unit. The number of these operons for a given species depends mainly on its growth rate and can vary from one to eleven (Kostman et al., 1992; García-Martínez et al., 1996; Gürtler and Stanisich, 1996). Since the need for newly synthesised proteins are greater at the stages when the cell is more physiologically active (i.e. at the beginning of cell division) they are usually located close to both sides of the origin of replication. As shown in Fig. 1.5, the most common gene arrangement for the different subunits within the operon, with few exceptions mostly in small genome bacteria, follows the order 16S–23S–5S (Gürtler and Stanisich, 1996; Andersson and Kurland, 1998; Pisabarro et al., 1998; Roth et al., 1998). This means that between 16S and 23S genes and between the 23S and 5S lie intergenic spacer regions (ITS) of variable length. The size of the spacer may differ significantly for different species, and may even differ among the different operons within a single cell, in the case of multiple operons (Condon et al., 1995). The variation in length is due primarily to the presence of several functional units within them such as tRNA genes; these are present in most of the microorganisms studied with one or two per spacer (Gürtler and Stanisich, 1996; Normand et al., 1996).
34
Fig 1.5: Schematic representation of a 16S-23S Interspacial region and organization of its functional regions (shadowed boxes). Indicated by brackets, the presence of tRNA genes is not universal and their number and type may vary among species.
The seven rRNA operons of Escherichia coli contain two types of 16S-23S ISR, four of them contain a single tRNAGlu and the other three have tRNAIle and tRNAAla (Young et al., 1979). R. pickettii ITS regions have been previously found to contain the tRNA sequences for both isoleucine and alanine (Tyler et al., 1995). Other functional units found in some bacterial 16S-23S ISR are enzyme recognition sites for enzymes such as ribonuclease III (Bram et al., 1980). This is involved in the process of splicing to yield the mature ribosomal RNA. This enzyme acts by recognizing and cleaving the stem-like structures formed as the result of the base pairing of the sequences flanking the ribosomal genes. In this way, the mature rRNA genes are released. Because the formation of secondary structures in both tRNAs and stem-like sequences are of such importance, nucleotide changes affecting their stability are usually tolerated at very low degrees or only allowed when compensatory mutations appear. Another sequence involved in enzymatic recognition is called boxA, with an antiterminator role during transcription (Harvey et al., 1988; Berg et al., 1989). The ribonuclease III recognition sequences are located at the 5′ and 3′ ends of the spacer while boxA is usually near the middle. Although they are of great importance for the proper expression of the operon, they are not universally conserved among all microorganisms, which is especially true for the ribonuclease III and boxA that are only similar among closely related microorganisms. Regardless, these functional units within
35 the spacer do not usually account for more than 50% of its whole size. The rest of this region consists of non-essential sequences that are subject to frequent insertion–deletion events, such as the ribosomal spacer loop (rsl) in some operons of E. coli (Condon et al., 1995), the absence of which in mutant strains does not apparently affect their growth. It is possible that due to the lack of functional value, these areas are less subjected to the evolutionary constraints ruling for the rest of the spacer and theoretically could show a higher degree of variation. The fast divergence of the spacer region even within relatively short evolutionary distance hints at this relative lack of functional restriction (Smart et al., 1996; Sawada et al., 1997). However, within discrete species or operational taxonomic units of closely related strains, the spacer region can be quite conserved regarding the alignable nucleotides (Antón et al., 1998; Pisabarro et al., 1998). The reasons for this conservation among closely related strains is likely due to its location between two highly conserved genes and to the concerted evolution of a multi-gene family that helps homogenising and conserving the sequences within individual cells but also within groups among which horizontal genetic exchange is relatively common. On the other hand, the spacer regions of closely related strains often diverge at the level of non- alignable nucleotides probably reflecting frequent insertion–deletion events (García- Martínez et al., 1996). These differences can be used for strain characterisation and can be extremely useful for typing for e.g. epidemiology or biotechnology (Amann et al., 1995). Ribotyping techniques have enabled detection of genetic variations among epidemiologically unrelated isolates of the same species of eubacteria (Kostman et al., 1995; Berridge et al., 1998; Houpikian and Raoult, 2001). The polymorphisms consist mostly of insertions and/or deletions within the ISR (Anton et al., 1998; Luz et al., 1998) and sequence analysis of ISR has been extremely useful in detecting interstrain (Gürtler and Barrie, 1995) and interspecies variations (Bourque et al., 1995).
1.8.3. fliC gene Analysis The bacterial flagellin gene (fliC) is a highly variable biomarker and has been targeted in a number of bacteria as an indicator of genetic diversity; this is due to their structure, which is conserved in the terminal regions that flank a variable, central region (Fig 1.6). Flagellin genes are regarded as good candidates for PCR-based detection (Winstanley and Morgan, 1997). The suitability of flagellin fliC genes for taxonomic applications has been shown in a number of studies for a large variety of bacterial species of several major bacterial groups: for α-proteobacteria (Shah et al., 2000); for ß- 36 proteobacteria (Hales et al., 1998); for low %GC Gram-Positive bacteria (Tasteyre et al., 2000); for the genus Pseudomonas (Bellingham et al., 2001); and most notably for most enterobacterial species (Machado et al., 2000). Flagellin genes have been used for detection, studies of population genetics, and epidemiological analyses (Winstanley and Morgan, 1997).
Fig 1.6: Diagram of fliC gene showing the conserved and variable regions
1.8.4. RAPD PCR Analysis Randomly amplified polymorphic DNA assay (RAPD); also referred to as arbitrarily primed PCR (AP-PCR); employs a single short (typically 10bp) primer that is not designed to amplify any specific bacterial DNA sequence (Williams et al., 1990). The primer hybridises at multiple random chromosomal locations and initiates DNA synthesis. Amplification is conducted at low annealing temperatures, which allows for DNA mismatches and thus allows the arbitrary primer sequences to bind non- specifically as well as specifically to the DNA template. Identification of a suitable primer, that provides consistent results, however is difficult and must be done empirically (Tyler et al., 1997). The discriminatory power of the method is dependent on the primers used (Kerr, 1994). Due to its arbitrary nature, RAPD-PCR is susceptible to technical variation, which may cause problems in reproducibility (Tyler et al., 1997). RAPD-PCR results can be affected by a number of factors including DNA extraction methods, ratio of DNA template concentration to primer concentration, batch-to-batch variation in primer synthesis, Mg2+-concentration, PCR conditions such as cycle time, model of thermocycler used, and supplier and concentration of Taq DNA polymerase. These problems can be overcome by optimising the reaction conditions for each organism analysed (Penner et al., 1993; Berg et al., 1994).
37 1.8.5. BOX-PCR Analysis Several short interspersed repetitive DNA sequences have been identified in prokaryotic genomes. Examples of well-characterised repetitive DNA sequences in bacteria include the repetitive extragenic palindromes (REP) and enterobacterial repetitive intergenic consensus (ERIC). One of the interspersed repetitive DNA sequence, BOX, was identified from the Gram-Positive bacterium Streptococcus pneumoniae. BOX elements have dyad symmetry with the possibility to form stable stem-loop structures and are located within intergenic regions. BOX elements are mosaic repetitive sequences composed of various combinations of three subunits, boxA, boxB, and boxC, which are 59, 45, and 50 nucleotides long, respectively (Martin et al., 1992). The DNA sequences of the BOX elements are completely different from the repetitive DNA sequences REP and ERIC, although there are similarities to REP and ERIC in size, copy number, and potential to form stable stem-loop structures. The presence of these repetitive DNA sequences can be exploited for rapid physical mapping procedures and for DNA fingerprinting of prokaryotic genomes. REP and ERIC sequences were used to design primers for PCR, in a technique known as repetitive sequence-based PCR (rep-PCR), to obtain DNA fingerprints from various microorganisms. Interspersed repetitive sequences can act as primer binding sites that are separated by various distances in the bacterial chromosome. PCR of unique sequence located between interspersed repeats results in differently sized DNA amplification products. PCR products of different sizes form polymorphic DNA markers and yield DNA fingerprints that may be specific for individual bacterial strains or isolates. The evolutionary conservation of these repetitive elements allows the use of a limited primer selection for DNA fingerprinting of a wide range of bacteria including Enterobacter sakazakii (Proudy et al., 2008), Aeromonas spp. (Tacao et al., 2005), Stenotrophomonas maltophilia (Berg et al., 1999) and Burkholderia cepacia (Coenye et al., 2002b).
1.8.6. Molecular Typing of Ralstonia pickettii Several molecular typing schemes have been used to determine the relatedness of strains of R. pickettii, these include infection ribotyping (Chetoui et al., 1997), arbitrarily primed PCR/random amplified polymorphic DNA (Luk, 1996; Maroye et al., 2000; Boutros et al., 2002) and pulsed-field gel electrophoresis (PFGE). However these have only been carried out on limited numbers of samples. PFGE has been preformed using SmaI, DraI, SspI, and SpeI for R. pickettii. Among these methods, PFGE has been shown to be highly discriminatory and reproducible (Dimech et al., 1993; Chetoui et al.,
38 1997; Labraca et al., 1999), it is however laborious and time-consuming. The possibility of limited genetic diversity within this species was suggested by Chetoui et al., (1997) from this data.
1.9. Mobile Elements of the ICE\CTn type
Mobile genetic elements (MGE) are a type of DNA that can move around within the genomes of bacteria and between bacteria. They include: Transposons of all types, Insertion sequences, Plasmids, Bacteriophage elements and Group II introns (Frost et al., 2005). A specific type of transposons is the Integrating and Conjugative Elements (ICE’s) and the Conjugative transposons (CTn’s). Similar to plasmids, ICEs\Ctn’s transfer via conjugation and like many bacteriophages they integrate into and replicate within the host chromosome. The earliest ICEs\Ctns described were Tn916 from Enterococcus faecalis and CTnDOT from Bacteroides thetaiotaomicron (Salyers et al., 1995). They have now been described in almost all major groups of bacteria including α-Proteobacteria (Sullivan et al., 2002), β-Proteobacteria (Toussaint et al., 2003; Mergeay et al., 2003), γ-Proteobacteria (Boltner et al., 2002), High G+C Gram-Positive bacteria (Pernodet et al., 1984), Low G+C Gram-Positive bacteria (Burrus et al., 2002; Marenda et al., 2006) and the Cytophaga-Flavobacter-Bacteroides (CFB) group (Gupta et al., 2003).
1.9.1 ICE\CTn structure The structure of ICEs/Ctns is simple and consists of three distinct functional modules. These three modules types are found in all self-transmissible mobile elements and enable the maintenance, distribution and regulation of the elements (Toussaint and Merlin 2002). The modules consist of genes and sequences that can be exchanged between other mobile elements such as phages and plasmids and the chromosome of the host organism. One the best example of this is the R391 element from Providencia rettgeri. This element contains an integrase and excisionase that are phage related (McGrath and Pembroke 2004; O’Halloran et al., 2007) and other phage related genes including the cI repressor homolog, single-strand binding proteins and DNA primases (Boltner et al., 2002). The conjugative transfer functions are related to those from a number of plasmids including and pNL1 from Novosphingobium and the IncH plasmids R27, from Salmonella and the R478 plasmid, from Serratia marcescens (Gilmour et al., 2004; Boltner et al., 2002). Inserted into the backbone of R391 are a few transposons and the mercury resistance operon, whose origin is unknown. One-third of the ninety-six
39 genes of R391 are related to homologs from Salmonella, in particular the transfer regions and eight genes that are homologous to a chromosomal region of Salmonella enterica serovar Typhimurium LT2 (Boltner et al., 2002).
1.9.1.1. ICE\ CTns Maintenance modules ICEs/Ctns integrate into either a plasmid or the chromosome of a host to guarantee their inheritance and are similar to most phages, not like plasmids that are preserved in their hosts via self-governing replication. The modules that support this integration are diverse but always contain some kind of a recombinase that is usually designated as int. The integrase catalyses a recombination event between a specific sequence, attP that is located within the recombination module and a target sequence, attB that is found on the chromosome. A circular form of an ICE integrates into the chromosome by recombination between attP and attB, generating two ICE–chromosome junction sequences, attL and attR. These int proteins differ in the specificity of their recombination reactions. attB sites can be extremely variable as in the case of Tn916 and Tn916-like elements, which integrates into A+T-rich regions in its natural host E. faecalis (Scott et al., 1994). The SXT\R391 family of ICEs from γ-proteobacteria on the other hand can integrate into a single attB site in a genome, the 5’-end of prfC encoding peptide release factor 3, at a unique 17bp integration site (McGrath and Pembroke, 2004). Most Int proteins are tyrosine recombinases, but some are serine recombinases, such as the integrase from Tn5397 found in Clostridium difficile, have also been reported (Wang et al., 2000). In addition to both Int and attP, most ICE\CTn integration modules have an excisionase (Xis); this is a small protein required for excision of the element from the chromosome or plasmid. The Xis proteins of ICEs\Ctns are diverse with very little homology between different Xis’s from different elements (Lewis and Hatfull 2001). Very similar elements can contain dissimilar integration modules. Tn916 and Tn5397 for example share homologous regulation and conjugation modules but their integration modules are unrelated as Tn916 encodes a tyrosine recombinase and Tn5397 encodes a serine recombinase (Roberts et al., 2001). This suggests that the modules that comprise ICEs can be exchanged.
1.9.1.2. ICE\ CTns distribution modules ICEs\Ctns distribute themselves via conjugation. They contain genes that specify the creation of the ‘mating machinery’ that enables contact between donor and recipient cells and the delivery of DNA into the recipient cell. The distribution modules
40 of ICEs\Ctns are very diverse. In most experimental verified cases, they are thought to transfer as single-stranded DNA. In some cases, such as in the SXT\R391 family, the transfer genes bear similarity to those found in IncH plasmids (Gilmour et al., 2004). The transfer genes of LpPI-1 from Legionella pneumophila are related to those of the F plasmid (Brassinga et al., 2003). The transfer genes in Tn1549 from Enterococcus spp., are somewhat related to those found in Gram-Positive conjugative plasmids (Garnier et al., 2000). Tn4371 transfer genes are related to those of IncP and Ti plasmids (Toussaint et al., 2003). The genes required for the transfer of some elements, such as CTnDOT from Bacteroides sp. are unrelated to previously characterized transfer genes (Bonheyo et al., 2001).
1.9.1.3. ICE\ CTns Regulation modules The mechanisms that control the transfer of ICE\Ctns are still not understood. It is known however that ICE\Ctn regulation modules are very diverse. The expression of the int gene of the clc element of Pseudomonas sp. is stimulated by growing the bacterium on 3-chlorobenzoate-containing medium, which is one of the substrates for the degradation pathway encoded by clc but not by high cell density, heat or osmotic shock, UV irradiation or ethanol stress (Sentchilo et al., 2003). The transfer of both Tn916 and CTnDOT is induced by tetracycline in subinhibitory concentrations (Salyers et al., 1995). While not fully understood, the mechanisms by which tetracycline induces the transfer of these two unrelated element are distinct (Mullany et al., 2002). Thus, for these elements specific compounds in the environment prompt their propagation conferring upon new hosts the ability to resist or to metabolise these compounds. Stress or SOS responses have also been found to regulate transfer. Examples include the SXT ICE, whose transfer is induced 400-fold by mitomycin C treatment of cells (Beaber et al., 2004). Similarly exposure to UV radiation increases the transfer rate of the R391 and pMERPH elements (McGrath et al., 2005). It is unknown if the environmental factors that are known to control transfer of some conjugative plasmids, such as cell population density, also control transfer of any ICEs/Ctns.
1.9.2. The Common Scaffold of ICEs\Ctns The functional modules that make up ICEs\Ctns can be thought of as scaffolds that can incorporate other genes that give the elements a fitness potential. One of the best examples of this arrangement can be seen in the SXT\R391 family of elements. Comparison of the genomes of these two elements shows that they share nearly identical backbone modules controlling regulation, transfer and integration/excision
41 across nearly 65kb of shared DNA sequences (Beaber et al., 2002a). Both elements contain DNA insertions at the same points in the backbone that give each element specific fitness potential like antibiotic or mercury resistances. These areas are termed hotspots and the mechanism that accounts for this is unknown. This has also been shown to be the case in other SXT\R391 elements including ICESpuPO1 (Pembroke and Piterina, 2006), ICEVchMex1 (Burrus et al., 2006) and ICEPdaSpa1 (Osorio et al., 2008).
1.9.2.1. ICE\ Ctn encoded functions To start with some ICEs\Ctns were identified as they gave an easily identifiable phenotype like resistance to a particular antibiotic. With the availability of sequences for many ICEs\Ctns, it has become evident that ICEs\Ctns have acquired many properties that have increased their fitness potential. They contain genes that mediate resistance to different kinds of antibiotic resistance including: CTnDOT, which has resistance genes for tetracycline and erythromycin (Cheng et al., 2000) and SXT, which has resistance genes for sulfamethoxazole, trimethoprim; chloramphenicol; and streptomycin (Beaber et al., 2002b). Heavy metal resistance genes have also been found in several elements including mercury resistance in both R391 and pMERPH (Coetzee et al., 1972; Peters et al., 1991) and cadmium resistance in ICELm1 of Listeria monocytogenes (Burrus et al., 2002). Several ICEs\Ctns posses degradative pathways for a variety of toxic compounds including the clc element of Pseudomonas sp. B13 which degrades chlorocatechol (Ravatn et al., 1998), the bph-sal element from Pseudomonas putida which degrades Biphenyl and salicylate degradation (Nishi et al., 2000) and the Tn4371 element of Ralstonia sp. which degrades biphenyl (Toussaint et al., 2003). Other elements can contain genes for the biosynthesis of antimicrobial compounds such as the lantibiotic nisin by Tn5276 from Lactococcus lactis (Rauch and De Vos 1992). ICEs\CTns can allow their hosts to occupy new environments, and an example of this is the element found in Mesorhizobium loti that has genes that allow the bacterium to grow and live in symbiosis with plant roots. These genes allow for the biosynthesis of enzymes that are required for nitrogen fixation and symbiosis (Sullivan et al., 2002). Other functions encoded by ICEs\CTns include many functions that can enhance their genomic plasticity such as an error-prone DNA repair system in Tn5252 from Streptococcus pneumoniae (Munoz-Najar and Vijayakumar, 1999), UV sensitisation in R391 and a rumA'B DNA recombination system in SXT and R391 (Boltner et al., 2002; Beaber et al., 2002b). Some elements also carry virulence factors
42 such as ICEKp1 from Klebsiella pneumoniae (Lin et al., 2008) and ICEEc1 from E. coli (Schubert et al., 2004), which carry similar genes to those of the HPI of Yersinia pestis these genes are involved in virulence. The SPI-7 element from Salmonella enterica Typhi also has genes encoding the Vi antigen (Pickard et al., 2003). ICEPdaSpa1 an element of the SXT\R391 family has also been shown to mobilise a virulence plasmid to allow it to transfer more easily to other strains (Osorio et al., 2008).
1.9.3. Tn4371 Tn4371 is a 54657bp transposable element, which allows its host to degrade biphenyl and 4-chlorobiphenyl. Its average percent %GC content is 63.5 (Toussaint et al., 2003). It was isolated after a mating between Ralstonia oxalatica strain A5 carrying the broad-host-range conjugative plasmid RP4 and Ralstonia metallidurans CH34. Selection was applied for transconjugants that expressed the heavy metal resistance genes from CH34 and grew with biphenyl as a sole source of carbon and energy (Springael et al., 1993). This provided transconjugants, which carried an RP4 plasmid with a 55kb insert near its Tet resistance operon. The insert was shown to transpose to other locations and hence was called Tn4371 (Merlin et al., 1999; Springael et al., 1993, 1994). It was found to carry biphenyl and 4-chlorobiphenyl degradation genes (bph) that have a comparable organization and nucleotide sequence to the bph gene cluster characterized in Achromobacter georgiopolitanum KKS102 (Kimbara et al., 1989). Tn4371 transposition involves a site-specific excision/integration process as the ends of the element can be detected to be covalently bound (Merlin et al., 1999). In the CH34 chromosome and on the pMOL30 plasmid of that strain, transposition is targeted to a low number of sites, as is the case on the RP4 plasmid, where two sites were identified to date. The main target site in RP4 consists of a 5'-TTTTTCAT-3' sequence, which is also present between the covalently joined ends of the transposon (Merlin et al., 1999). The element was sequenced in 2003 (AJ536756) and similar elements were found in other bacteria including the β-proteobacteria Ralstonia solanacearum GMI1000, a phytopathogen isolated from a tomato in French Guyana (Boucher et al., 1985), Ralstonia metallidurans CH34, a heavy metal resistant bacteria from a zinc factory waste water in Belgium (Mergeay et al., 1978), the γ-proteobacteria Erwinia chrysanthemi 3937, a phytopathogen isolated from the Saintpaulia plant (Kotoujansky et al., 1982) and Azotobacter vinelandii AvOP, a nitrogen fixing bacterium isolated from soil in the USA (Burgess et al., 1980, Toussaint et al., 2003).
43 1.10. The Aims of This Project
• To study the microbial ecology of laboratory high purity water with special attention to the detection of R. pickettii through water sampling and growth on R2A agar-Chapter 3. • To carry out a comprehensive study of both the phenotypic and genotypic diversity of R. pickettii isolates using several different techniques including RAPD, BOX and PCR-RFLP and sequencing of the fliC gene and the 16S-23S Intergenic spacer region of strains isolated from different environments-Chapter 3. • To determine the best method to differentiate between R. pickettii and R. insidiosa through the use of biochemical and PCR testing- Chapter 3. • To study the antibiotic resistance profiles of clinical and high purity water isolates of R. insidiosa- Chapter 3. • To detect the presence of and to characterise Mobile Genetic Elements (MGE) in R. pickettii through the use of PCR and plasmid profiling- Chapter 4. • To investigate the Tn4371-family of ICE-like elements present in the GenBank database and increase the knowledge about theses elements- Chapter 4.
44
Chapter 2: General Materials
2.1. Source of Chemical Reagents
The chemical reagents used in this study were analytical grade reagents and supplied by BDH, Pooles, Dorset, UK; Merck, Darmstadt, Germany; Sigma Chemical Co., St. Louis, Mo, USA; May and Baker Laboratory chemicals Ltd (M&B), Degenham, U.K; Bectan Dickinson Co, (BBL) Cockeysville, MD, USA, or other sources as indicated.
2.2. Equipment
Item Manufacturer -20oC freezer unit Whirlpool, Comerio, Italy -85oC freezer unit NUAIRE, Plymouth, MN USA Autoclave Nuve, Ankara, Turkey Biofuge centrifuge- Heraeus Thermo-Scientific, Epsom, Surrey UK UV Products Gel Documentation System Ultra Violet Products, Cambridge, UK Imagestore Gilson pipettes (P10.P20, P100, P1000) Gilson Ltd, United Kingdom Horizontal Gel Electrophoresis system Jencons, Dublin 15, Ireland Magnetic stirrer AGB, Dublin 15, Ireland Microscope model CX41 Olympus, Hertfordshire, UK Microwave Samsung, UK Microcentrifuge Thermo-Scientific, Epsom, Surrey UK Miximatic vortex Snijders, The Netherlands Orbital shaker incubator Stuart Scientific, Dublin, Ireland Spectrophotometer: Spectronic Genesys 20 Thermo-Scientific, Epsom, Surrey UK Static incubator BDH, Dublin 15, Ireland Perkin Elmer Gene Amp PCR system 2400 Applied Biosystems, Warrington, UK UV Transilluminator UVP, Inc, Belfast, Ireland Water bath- Clifton Bennett-Scientific, Devon, UK Hotplate AGB, Dublin 15, Ireland
2.3. Biochemical Kits
BioMérieux API 20NE system, and its reagents AUX medium, JAMES, NIT 1, NIT 2, Zinc (Table 2.1). Remel RapID NF Plus commercial system and its reagents, RapID inoculation fluid, RapID NF Plus reagent, IDS Nitrate and IDS spot Indole (Table 2.2). Oxidase identification sticks were purchased from Oxoid (Basingstokes, Hants, England, UK).
46 Table 2.1: API 20NE kit: Media and Reagent Required for Biochemical Identification of Bacteria Strains (BioMérieux UK Limited, Hampshire, UK) API 20NE Composition of media and reagents Test for media/reagent Content weight/volume NaCl 0.85% Sodium chloride 8.5 g NA Demineralised water 1000 ml AUX Medium Ammonium sulphate 2 g NA Agar 1.5 g Mineral base 82.8 mg Amino acids 250 mg Vitamins 35.9 mg Phosphate buffer 1000 ml 0.04 M pH 7.1 JAMES Compound J 2183 0.5g Indole production (confidential) HCl 1M 100 ml NIT 1 Sulfanilic acid 0.4 g NO2 production Acetic acid 30 g H2O 70 ml NIT 2 N,N-dimethl-1- 0.6 g NO2 production naphthylamine Acetic acid 30 g H2O 70 ml Zn Zinc dust Reduction of nitrates to nitrogen NA – not applicable
Table 2.2: Remel RapID NF Plus Kit: Media and Reagent Required for Biochemical identification of bacteria strains (Remel, Lenexa, Kans, USA) RapID NF Plus Catalogue Code Test for media/reagent RapID inoculation fluid 83-25102 NA
RapID NF Plus reagent 83-11005 Enzymatic hydrolysis of the arylamide releases free β- naphthylamine IDS Nitrate and 83-09003 Utilization of nitrate ion results in the formation of nitrite IDS spot Indole 83-09002 Utilization of tryptophane results in the formation of indole NA – not applicable
47 2.4. Media and Supplements
Culture media obtained from various suppliers (as listed in Table 2.3) were prepared using manufactures instructions. Powder media was prepared with distilled
H2O and sterilised by autoclaving at 121°C and 15lbs pressure per square inch for fifteen minutes.
Table 2.3: Media Used in this Study Media Supplier Location Nutrient Broth Biolab Budapest, Hungary Nutrient Agar Biolab Budapest, Hungary Tryptone Soya Broth Biolab Budapest, Hungary Mueller Hinton Broth Biolab Budapest, Hungary Bacteriological Agar Biolab Budapest, Hungary Mueller Hinton Agar Biolab Budapest, Hungary AUX Medium BioMérieux Hampshire, UK R2A Agar Difco Oxford, UK
2.5. McFarland Standard
McFarland standard was made up according to Chapin and Lauderdale, 2003 (Table 2.4)
Table 2.4: McFarland Standard Protocol Standard Vol (ml) Corresponding 1% (w/v) BaCl2 1% (v/v) H2SO4 bacteria suspension (108/ml) 0.5 0.05 9.95 1.5 1 0.1 9.9 3 2 0.2 9.8 6 3 0.3 9.7 9 4 0.4 9.6 12 5 0.5 9.5 15 6 0.6 9.4 18 7 0.7 9.3 21 8 0.8 9.2 24 9 0.9 9.1 27 10 1.0 9.0 30
48 2.6. General buffers and reagents
The recipes for theses solutions were obtained from Sambrook et al., 1989 and/or Ausubel et al., 1997 unless otherwise indicated. All solutions were stored at room temperature and sterilised by autoclaving unless otherwise indicated. • Agarose Gel-Loading Buffer: 0.25% (w/v) bromophenol blue, 0.25% (w/v) Xylene-Cyanol FF, and 30% (w/v) Glycerol solution. The solution was filter- sterilized using a 0.22 µm Millipore Swinex filter. • 10 mg/ml Ethidium Bromide: 0.1 g of ethidium bromide was added to 10 ml of
distilled H2O and stirred for several hours using a magnet stirrer until the dye had completely dissolved. The solution was then stored in foil to prevent light damage. • 0.85% Saline Solution: 8.5 g NaCl per litre of distilled water and dispensed into aliquots.
• 5M NaCl: 140 g of NaCl in 1 litre of distilled H2O. • 1 M Tris Stock Solution: 12.11 g of Tris base was dissolved in 80 ml distilled
H2O and the pH was adjusted using concentrated HCl to a value of between pH 7.0 and 8.5 (depending on the application). The solution volume was adjusted to
100 ml using distilled H2O.
• 0.5 EDTA, pH8.0: 186.1 g of disodium ethylenedeamine tetraacetate. H2O was
dissolved in 800 ml of distilled H2O. The pH was adjusted to 8.0 using concentrated NaOH. • TBE (0.5x): 0.045M Tris-HCl, 0.045M boric acid, 1mM EDTA, pH 8.3. The components were mixed in distilled water and the pH adjusted to 8.3 with concentrated HCl. A 5x concentration of TBE was usually prepared and diluted 1 in 10 prior to use. • TE Buffer, pH 8.0: 10 ml 1M Tris-HCl (pH 8.0), 2ml 0.5M EDTA (pH 8.0)
were mixed and diluted to 1 litre with distilled H2O. • CTAB/NaCl solution (10% CTAB in 0.7 M NaCl): 4.1 g NaCl was dissolved
in 80 ml of distilled H2O and 10 g CTAB (hexadecyltrimethylammonium bromide) was slowly added while heating to 65°C on a hot plate. The final volume was adjusted to 100 ml. This was not autoclaved.
• 5x Gitschier buffer: 83 mM (NH4)2SO4, 33.5 mM MgCl2, 335 mM Tris/HCl, pH 8.8, 33.5 µM EDTA, 150 mM ß-mercaptoethanol (Kogan et al., 1997).
49 Table 2.5: Molecular Biology Reagents Reagent/Enzyme Details Supplier Location Taq Polymerase 5 U/µL Bioline London, UK Phusion Polymerase 2 U/L NEB Bray, Ireland GC Buffer 10x Concentration NEB Bray, Ireland dNTP Solution 10 mM of each dNTP Bioline London, UK PCR Buffer 10x Concentration Bioline London, UK Magnesium Chloride 25mM Bioline London, UK Primers 100 ng/ml MWG Ebersberg, Germany Agarose 1.5-2.0% (w/v) Sigma Arklow, Ireland Ethidium Bromide 10 mg/ml Sigma Arklow, Ireland Hyperladder 1 200-10000 bp range Bioline London, UK AluI 10 U/µL Promega Hampshire, UK CfoI 10 U/µL Roche West Sussex, United Kingdom HaeIII 10 U/µL Promega Hampshire, UK TaqI 10 U/µL Promega Hampshire, UK Proteinase K 25 mg/ml Sigma Arklow, Ireland BSA 10 mg/ml Promega Hampshire, UK
2.7. Bacterial strains and growth conditions
General bacterial strains used in this study are presented in Table 2.6. Ralstonia species used in this study are presented in Table 2.7. Fifty-nine strains of Ralstonia pickettii were obtained from different sources (Table 2.8). The type strains of R. pickettii, a clinical isolate was purchased from five different culture collections. One additional clinical isolated R. pickettii ATCC49129 (Ralston et al., 1973; Yabuuchi et al., 1995) deposited as Pseudomonas cepacia (Burkholder) Palleroni and Holmes, was obtained from the American Type Culture Collection, Manassas, Virginia, USA and a further soil isolate from a rice field in Senegal (Garcia et al., 1977; Vandamme et al., 1999) of R. pickettii and deposited in two separate culture collections repositories, CCUG18841 and CCM2846 Culture Collection University of Göteborg, Department of Clinical Bacteriology, Göteborg, Sweden and Czech Collection of Microorganisms, Masaryk University, Brno, Czech Republic respectively, were analysed. In addition, eight clinical strains were obtained from the collection of the Microbiology Laboratory of the Mid-West Regional Hospital (MWRH), which were originally isolated from cystic fibrosis patients. These strains were found to be resistant to ampicillin, amikacin, augmentin, tobramycin and gentamicin using the automatic reading and incubation system (ARIS) by the hospital laboratory. The remaining strains consist of thirty-two industrial strains, which were provided by a local industry and isolated from their water system are outlined in Table 2.8. All the above strains were stored at -20°C in nutrient broth (NB) with 50% glycerol.
50 In addition to storage in 50% glycerol/50% Nutrient broth (Oxoid), strains were stored using the Cryobank Microbial Preservation System (MAST diagnostics, Merseyside, UK) according to manufactures instructions, briefly; the surface culture of a Nutrient Agar plate was aseptically harvested into sterile cryogenic preservation vials containing hypertonic “cryopreservative solution” and glass beads to density equivalent of McFarland 3 or 4 standard (equivalent to 9 x 108 - 12 x 108 cells / ml (Table 2.4). The caps were replaced and the culture mixed carefully by inverting the tube to completely distribute the organism; with a sterile pipette as much of the “cryopreservative solution” as possible was removed from the vial. The vials were stored at -85°C. Recovery of the organism was performed by removing a single bead from the vial and streaking immediately over the surface of a Nutrient Agar plate, which was incubated at 37°C for 24 hours.
Table 2.6: General Bacterial Strains Used in this Study Species Strain Source Enterococcus faecalis ATCC29212 Gift from Microbiology Laboratory, Mid-West Regional Hospital (MWRH), Limerick. Pseudomonas aeruginosa ATCC27853 American Type Culture Collection Escherichia coli AB1157 The E. coil Genetic Stock Centre Escherichia coli NCTC50192 National Collection of Type Cultures Escherichia coli NCTC10418 National Collection of Type Cultures Staphylococcus epidermidis NCTC11407 National Collection of Type Cultures Staphylococcus aureus ATCC25923 American Type Culture Collection Staphylococcus aureus ATCC5571 American Type Culture Collection Pseudomonas aeruginosa PA01 Gift from Barbara Iglewski, University of Rochester, USA Acinetobacter calcoaceticus ATCC19606 American Type Culture Collection
51 Table 2.7: Ralstonia Species Used in this Study Species Source/References R. eutropha linage Strain No. R. metallidurans LMG1195 Goris et al., 2001 R. metallidurans CCUG45957 Goris et al., 2001; Vaneechoutte et al., 2004 R. metallidurans CCUG43015 Goris et al., 2001; Vaneechoutte et al., 2004 R. basilensis LMG18990 Goris et al., 2001 R. campinensis LMG19282 Goris et al., 2001 R. eutropha LMG1199 Yabuuchi et al., 1995 R. gilardii LMG5886 Coenye et al., 1999 R. oxalatica LMG2235 Sahin et al., 2000 R. paucula LMG3244 Vandamme et al., 1999 R. respiraculi LMG21510 Coenye et al., 2003b R. taiwanensis LMG19424 Chen et al., 2001 R. pickettii linage R. insidiosa LMG21421 Coenye et al., 2003a; Vaneechoutte et al., 2004 R. mannitolilytica LMG6866 De Baere et al., 2001 R. syzygii DSM7385 Roberts et al., 1990; Vaneechoutte et al., 2004 R. solanacearum 20S Gift from Timothy Denny, University of Georgia, USA. Flavier et al., 1997.
Strains were purchased from the different sources: LMG Bacteria collection, Laboratorium voor Microbiologie, Universiteit Gent; DSM German Collection of Microorganisms and Cell Cultures; CCUG Culture Collection University of Goteborg
52 Table 2.8: Ralstonia pickettii Strains Used in this Work Species Strain Source References Type strains: JCM5969 Japan Collection of microorganisms Ralston et al., 1973; NCTC11149 National Collection of Type Cultures Yabuuchi et al., 1995 DSM6297 Deutsche Sammlung von Mikroorganismen und Zellkulturen CIP73.23 Collection Bactèrienne de l’Institut Pasteur CCUG3318 Culture Collection University of Göteborg Soil strains: CCM2846 Czech Collection of Microorganisms Culture Garcia et al., 1977; CCUG18841 Collection University of Göteborg Vandamme et al., 1999 Clinical strain: ATCC49129 American Type Culture Collection Ralston et al., 1973; Yabuuchi et al., 1995 Clinical Isolates: ULC193, ULC194, ULC277, ULC297, ULC298, Microbiology laboratory of Mid-West Regional UL Microbiology ULC224, ULC421 Hospital (Cystic Fibrosis Patients) Laboratory Collection Industrial isolates: ULI784, ULI785, ULI788, ULI790, ULI791, Isolated from USP Grade water from a local UL Microbiology ULI794, ULI795, ULI796, ULI797, ULI798, industrial plant (Limerick, Ireland) Laboratory Collection ULI800, ULI801, ULI804, ULI806, ULI807, ULI818, ULI819, ULI821, ULI159, ULI162, ULI163, ULI165, ULI166, ULI167, ULI169, ULI171, ULI174, ULI181, ULI185, ULI187, ULI188, ULI193 Laboratory isolates: ULM001, ULM002, ULM003, ULM004, Isolated from various Millipore Purified water This Study ULM005, ULM006 systems (France) ULM007, ULM008, ULM009, ULM010, ULM011 Isolated from various Millipore Purified water This Study systems (Ireland)
53
Chapter 3: Phenotypic and Genotypic diversity amongst strains of Ralstonia pickettii isolated from different environments
3.1. Summary
Purified water systems were analysed to determine their bacterial ecology via traditional culture techniques. A Millipore laboratory purified water system was analysed. Several strains were isolated and identified using biochemical identification methods. The level of oligotrophy of all strains was determined. How bacteria may survive in purified water using several polymer compounds (Polyvinyl Chloride, Polyethylene and Polypropylene) that make up the piping in water systems was tested by using a minimal media to see if the bacteria isolated in this study could use these as a carbon source. This chapter also presents the results of a detailed analysis of fifty-nine Ralstonia pickettii strains isolated from our study and from water systems around the world provided to us through our collaborators. Techniques included standard biochemical techniques, antibiograms, virulence factor profiling and genotypic analysis using four different systems (PCR and sequence analysis of the 16S-23S Interspacial region (ISR) and fliC gene and RAPD and BOX analysis). The results obtained show that fourteen of the fifty-eight strains studied were Ralstonia insidiosa and that it is difficult to distinguish the two species apart using biochemical testing. All these R. insidiosa strains had multiple antibiotic resistances. All Ralstonia pickettii and R. insidiosa strains were found to have haemolysins but did not contain detectable extracellular proteases or elastase. RAPD and BOX analysis showed several different genotypic groupings indicating some genetic diversity, however none of these genotype groups could be grouped together based on the environmental location of isolation.
3.2. Introduction
A study was carried out to evaluate the extent of the bacterial colonisation of laboratory purified water systems. The efficient operation of water purification systems is vital, as the microbiological quality of ultrapure water is of fundamental importance in laboratory accreditation in a wide range of industries. High Purity Water (HPW) is used for analytical analysis and molecular biology (Adley and Saieb, 2005a; Kano et al., 2004; Regnault et al., 2004). Bacterial growth and biofouling within these systems present potential problems for these applications because of biodeterioration of products of the purified water (Mittleman, 1987a, 1990). Oligotrophic bacteria (oligotrophs) are microorganisms that grow in extremely nutritionally deficient conditions in which the
55 concentrations of organic substances are extremely low (as low as one part per million) (Tada et al., 1995). They are capable of reproduction under conditions that are usually considered nutrient-restricted (Ishida and Kadota, 1981). Such organisms are found in low-nutrient environments e.g. drinking water (LeChevallier et al., 1987, 1991) and can attain population densities of 106 cells per ml in distilled water (Carson et al., 1973). Oligotrophic aquatic environments are also favourable for the colonisation of surfaces (Marshall, 1988), where bacteria may be physiologically more active than their planktonic counterparts (Davies and McFeters, 1988; Fletcher, 1985). The extremely high surface/volume ratio in ultrapure water systems, including tubing and tank surfaces, activated carbon and ion-exchange particles, and filters, is conducive to the formation of biofilms that are very difficult to control (Mittleman, 1990). Circumstances are favourable for the establishment and maintenance of bacterial communities within purified water systems. Planktonic bacteria and biofilms have been observed previously in operating purified water systems and it has been shown that industrial waters will support bacteria regardless of the effort to filter them and maintain aseptic conditions (Mittleman, 1985, 1987a, 1987b, 1990, 1995). Despite this significance, surprisingly little research has focused on the microbiology of these systems with few comprehensive studies having addressed their microbial ecology (McFeters et al., 1993a, 1993b; Kulakov et al., 2002; Kawai et al., 2002, 2004). It is generally accepted that Gram-Negative bacteria predominate in HPW (Favero et al., 1971; Matsuda et al., 1996; White and Mittleman, 1990) and there are reports describing the ability of bacteria to survive and proliferate in distilled water (Carson et al., 1973; Favero et al., 1971). Previous research showed that various representatives of the genus Pseudomonas are present in Ultra Pure Water (UPW) (Clancy and Cimini, 1991; Martyak et al., 1993; Patterson et al., 1991). A study carried out by Kulakov et al., (2002) showed that the bacteria isolated from UPW systems were mostly Gram-Negative, and several species seem to be indigenous for purified water production systems as can be seen from the literature. However as industries do not release results of their water testing this is incomplete information. To date, no major study to determine the phenotypic and genotypic diversity of Ralstonia pickettii has been carried out. The typing schemes that have been undertaken to date, such as that carried out by Dimech et al., (1993) have shown that R. pickettii appears to be an organism of limited phenotypic diversity. Limited Pulsed- Field Gel Electrophoresis (PFGE) patterns have shown the existence of several genomic
56 groups of R. pickettii and limited genetic diversity within the species has been hypothesised (Chetoui et al., 1997). The question posed was, “could the phenotypic and genotypic typing of R. pickettii strains isolated from clinical and environmental situations and from purified water determine if any major differences between the isolates could be identified”. This would assist in understanding how the organism survives in different environments. The epidemiology of R. pickettii infections has been studied by the analysis of phenotypic markers, including antimicrobial susceptibility profiles (Hsueh et al., 1998; Henry et al., 2001; Coenye et al., 2002b; Girlich et al., 2004). In this study two examinations of individual genomic targets were first used to examine the diversity of Ralstonia pickettii. The genomic targets chosen were the 16S-23S Interspacial region (Tyler et al., 1995) and the fliC gene (Schönfeld et al., 2003); these were chosen as sequence information was available at the time the study was undertaken. These previous studies were not carried out with Ralstonia pickettii as their main target and so only limited numbers of isolates were analysed providing very little data (Tyler et al., 1995; Schönfeld et al., 2003). A whole genome approach was then carried out to further investigate R. pickettii diversity. RAPD and BOX-PCR were chosen as these had been found to work with species closely related to R. pickettii (Moissenet et al., 1999; Daxboeck et al., 2005). R. pickettii is becoming an increasingly important pathogen (Ryan et al., 2006) and industrial contaminant. A comprehensive study was therefore undertaken investigating the diversity within this species using phenotypic testing and by the determination of the sequence of the ISR’s and the fliC gene of a large number of newly isolated R. pickettii isolates from different environments including clinical, industrial and environmental niches.
3.3. Materials and Methods
3.3.1. Water Testing
3.3.1.1. Sampling Method Fifty-four separate water samples were collected from a Millipore Synergy 185 system, which incorporates a dual-wavelength UV lamp (185 and 254 nm). The feed water was pre-treated using the Millipore Elix system, which incorporates electrodeionisation, RiOs (Reverse Osmosis), and an Ultra Violet (UV) lamp (www.millipore.com). These systems are designed to produce water with a Total
57 Organic Carbon (TOC) level of less than five ppb and a microorganism count of < 1 cfu/ml. Before taking water samples, the ports' exteriors were cleaned with 70% ethanol, and water was allowed to flow for 3-5 min (approximately 250 ml/min). 500 ml samples were collected in sterile containers (autoclaved Duran bottles) from each sampling point in duplicate, filtered using a sterile Nalgene 1 L filter unit and Nalgene 0.22 µm pre- sterilised cellulose nitrate filters.
3.3.1.2. Microorganism Isolation Samples were filtered twice under aseptic conditions and were processed within two hours of collection. The filters were incubated at 25-28°C on R2A media (Reasoner and Geldreich 1985, Difco) or Plate Count Agar (PCA) (Oxoid) for five to seven days. Autoclaved HPW samples were used as controls. Heterotrophic plate counts at 25°C were made by means of the pour-plate method (American Public Health Association, 1995) using PCA, and the final count obtained was the arithmetic mean of the values found. Each type of colony observed on the two media was counted and the final number obtained was the arithmetic mean (there were negative samples) of the values found. All samples were then restreaked for isolated colonies onto R2A plates. Colonies that grew were stored in 50% glycerol at -20°C and further tests were carried out.
3.3.1.3. Microorganism Identification Isolates were identified using Gram staining, spore production and the oxidase and catalase tests (Harley and Prescott 1993). The Remel Rapid NF Plus (Remel Lenexa USA) interpreted with IDS Electronic Code Compendium V1.3.97 or the BioMérieux API 20NE and API CH50, interpreted using APILAB plus 3.3.3 according to manufacturers instructions.
3.3.1.4. Determination of Oligotrophy To determine if the strains isolated were oligotrophic (either facultative or obligate), each bacterial strain was inoculated onto full strength and diluted R2A. Incubation was up to twenty-five days at ~25°C. Dehydration was prevented by wrapping in parafilm. Growth was scored as either + (growth observed) or – (no growth observed). Obligate oligotrophs were defined as those isolates that were capable of growth on 1:100 or 1:1000 R2A only, with no growth on 1:10 R2A or full strength R2A. Facultative oligotrophs are capable of growth on all media tested (McAlister et al., 2001).
58 3.3.1.5. Utilisation of Polymer Compounds as a Sole Carbon Source In an effort to understand how bacteria survive in purified water, several polymer compounds that make up the piping in water systems were tested as sole carbon sources. Polyvinyl Chloride, Polyethylene and Polypropylene (Sigma) were the polymer compounds used as sole carbon sources in M9 minimal media (64 g Na2HPO4-
7H2O, 15 g KH2PO4, 2.5 g NaCl, 5.0 g NH4Cl, 12 g of bacteriological agar were added to 1000 ml of sterile Millipore Synergy purified H2O). 2.5 g of the polymer substance was added to act as a carbon source. This was then autoclaved. Following this 2 ml of
1M MgSO4 (filter sterilised) and 100 µL of 1M CaCl2 (filter sterilised) were added. Bacteria were subcultured onto the plates from O/N cultures grow on M9 minimal media supplemented with glucose. Dehydration was prevented by wrapping in parafilm. Incubation was up to sixty five days at ~20°C. The bacterial strains used in this study are listed in Table 3.5.
3.3.2. Phenotypic Characteristics for the differentiation of R. pickettii and R. insidiosa Classical phenotypic tests were performed using the BioMérieux API 20NE system (http://www.biomerieux.com) and the Remel RapID NF Plus commercial system (http://www.remelinc.com). These are miniaturised micromethods for the identification of Gram-Negative rods (non-fermentative in the case of the API 20NE) that do not belong to the family Enterobacteriaceae. All bacteria were grown on the media suggested by the manufacturer. The same lot was used if possible to minimise any potential differences in the expression of genes due to the differences in media content.
3.3.2.1. BioMérieux API 20NE The BioMérieux API 20NE system (BioMérieux UK Limited, Hampshire, UK) was used in accordance with the manufacturer’s instructions. Biochemical reactions were read as either positive or negative, translated into numerical profiles, and interpreted with the manufacturer’s software (APILAB Plus update 3.3.3). Phenotypic characters were scored as discrete variables (0 or 1; 0, when the character was negative or missing; 1, when character was positive or present). Isolates with the same pattern were grouped into Biotypes numbering 1 to 35 (Table 3.6). Unweighted pair group method (Sneath and Sokal 1973) was used for cluster analysis using the MultiVariate Statistical Package (MVSP) software program ver. 3.13 by means of the Jaccard coefficient (Jaccard 1901). R. pickettii strains were evaluated by using the
59 discrimination index as described by Hunter and Gaston (1980) as given by the equation:
where D is the numerical index of discrimination, N is the total number of strains, and nj is the number of strains pertaining to the jth type. D values calculated by the Simpson’s index range from 0 to 1, a value of 0 indicate no discrimination, and a value of 1 indicates that every strain can be discriminated. D is the value of the probability that two unrelated strains sampled from the test population will be placed into different typing groups.
3.3.2.2. Remel RapID NF Plus The Remel RapID NF Plus commercial system (Remel, Lenexa, Kansas, USA) consists of eighteen test scores based on microbial degradation of specific substrates and was used in accordance with the manufactures instructions. Each strain was inoculated into the RapID inoculation fluid, and turbidity was adjusted to between 1.0 and 3.0 MacFarland standard. The test strips were inoculated and read after 4-hour incubation at 37°C. Reactions were read as positive or negative, translated into a biocode, and interpreted with the IDS Electronic Code Compendium V1.3.97.
3.3.2.3. BioMérieux Vitek Analysis For identification of the strains, a Vitek card; the Non-Fermenter Identification Card (NFC) (BioMérieux UK Limited, Hampshire, UK), was used. The NFC has been developed for the industrial identification of non-fermenters. The Vitek analysis was carried out by a local company.
3.3.2.4. Oxidase test The oxidase test was carried out using oxidase test strips (Oxoid) following the manufacturers instructions. This test determines the presence or absence of oxidase. This test was for the detection of cytochrome oxidase, which is an enzyme that participates in the electron transport, and nitrate metabolism mechanisms of some bacteria. Staphylococcus aureus ATCC25923 and E. coli NCTC50192 were used as negative controls. Pseudomonas aeruginosa PAO1 was used as a positive control.
3.3.2.5. Catalase test
Hydrogen peroxide (H2O2) is used to determine if bacteria produce the enzyme catalase. A test colony was transferred to a clean slide and one drop of 3% H2O2 was
60 added. Development of bubbles is considered a positive result, Staphylococcus aureus ATCC5571 and Enterococcus faecalis ATCC29212 was used as positive control and negative respectively (Harley and Prescott, 1993).
3.3.2.6. Nitrate Reduction Test Nitrate reduction was examined by the cultivation of isolates in nitrate broth (Fluka) and addition of NIT 1 (sulfanilic acid, acetic acid) and NIT 2 (N, N-dimethyl-1- naphthylamine) and zinc after 48 hr of incubation at 30°C (Blazevic and Ederer, 1975). A colour change to pink after addition of the NIT 1 and NIT 2 to the broth indicates a positive reaction. If there is no colour change zinc is added and a red colour is created then the organism is nitrate reduction positive. Acinetobacter calcoaceticus ATCC19606 was used as a negative control.
3.3.1.7. Desferrioxamine Susceptibility Susceptibility to desferrioxamine was determined using 6 mm (diameter) filter paper discs loaded with 250 µg of desferrioxamine. Staphylococcus epidermidis NCTC11047 (susceptible to desferrioxamine), and Ralstonia mannitolilytica LMG6866 (inhibited by desferrioxamine) were used as control organisms (De Baere et al., 2001; Laffineur et al., 2002; Lindsay and Riley, 1991).
3.3.2.8. Motility Assays Swimming, swarming and twitching motility tests were carried out as outlined below. Pseudomonas aeruginosa PAO1 was used as a positive control. i) Swimming The media used to assay for swimming motility was made using tryptone broth [10 g/litre tryptone (Difco)/5 g/litre NaCl] that contained 0.3% (w/v) agarose (GIBCO/BRL). Swim plates were inoculated with bacterial colonies from an overnight culture in LB agar (1.5%, w/v) plates at 37°C with a sterile toothpick. The plates were then wrapped with Parafilm to prevent dehydration and incubated at 30°C for 12-14 hrs. Swimming was assessed by examining the circular turbid zone around the inoculation point (Rashid and Kornberg, 2000). ii) Swarming The swarming media consisted of 0.5% (w/v) Difco bacto-agar with 8 g/litre Difco nutrient broth, to which 5 g/litre glucose was added. Swarm plates were typically allowed to dry at room temperature overnight before being used. Swarming efficiency was improved when cells were inoculated onto swarm plates from swim agar (0.3%,
61 w/v) plates incubated overnight at 30°C; inoculation from overnight LB agar (1.5%, w/v) plates also supported swarming. Swarming motility was indicated by irregular branching that appeared at the periphery of the colonies after 12-24 hrs of incubation (Rashid and Kornberg, 2000). iii) Twitching Plates containing a medium consisting of LB broth (Difco) solidified with 1% (w/v) bacto-agar were used; bacteria were inoculated to the bottom of the Petri dish and incubated for 24 hrs at 37°C. Twitching motility was indicated by a hazy zone of growth at the interface between the agar and the polystyrene surface (Leone et al., 2008).
3.3.2.9. Total Protease Activity Determination Proteolytic activity was determined on LB agar (Difco) supplemented with 5% skim milk (Oxoid). The milk solution was autoclaved at 121°C for 5 minutes and added to the molten agar at 60°C. P. aeruginosa PAO1 was used as a positive control. Positive results were indicated by clear haloes around the colonies after incubation at 30°C for 36 hrs (Sokol et al., 1979; Huber et al., 2001).
3.3.2.10. Detection of Elastase Activity Strains tested were spotted onto nutrient agar coated with 5 ml of agar containing 3% bovine neck ligament elastin. These plates were incubated for 24 hours at 37°C and then examined. A clear zone below and around the colonies indicates the proteolysis of elastin due to elastase activity. P. aeruginosa PAO1 was used as a positive control (Williams et al., 1988). E. coli NCTC10418 was used as a negative control.
3.3.2.11. Detection of Haemolytic Activity Strains tested were streaked out on nutrient agar and incubated overnight at 30°C. From these cultures, two-three pure colonies were selected and streaked onto Columbia Blood Agar with 5% sheep blood, incubated at 30°C for 48 hours and examined. P. aeruginosa PAO1 was used as a positive control. Enterococcus faecalis ATCC29212 was used as a negative control
3.3.2.12. Antibiotic Susceptibility Testing of Ralstonia insidiosa In vitro antimicrobial susceptibility testing was performed by disc diffusion tests using eleven antibiotics Tic- Ticarcillin 75 µg/ml; Ctx-Cefotaxime 30 µg/ml; Cn- Gentamicin 10 µg/ml; Te-Tetracycline 30 µg/ml; Cip-Ciprofloxacin 5 µg/ml; Ofl-
62 Ofloxacin 5 µg/ml; SxT-Sulphamethoxazole/trimethoprim 23.75/1.25 µg/ml; C- Chloramphenicol 30 µg/ml. Mez-Mezlocillin 75 µg/ml, Feb-Cefepime 30 µg/ml, Tor- Tobramycin 10 µg/ml and was carried out on Muller Hinton agar according to the National Committee for Clinical Laboratory Standards (NCCLS [M2-A7] 2000) on fifteen strains of R. insidiosa. This were chosen as to have a representative of each family of antibiotics. The NCCLS had not developed guidelines for the Ralstonia genus and interpretation of results for Pseudomonas and other non-Enterobacteriaceae criteria were used (NCCLS [M100-S11] 2001). The breakpoints are outlined in Appendix 2. Zones of inhibition were measured to the nearest whole millimetre using Venier callipers (Junior). Zones diameters were interpreted as being Susceptible (S), Intermediate (I) or Resistant (R) according to NCCLS (M100-S11) 2001.
3.3.3. Genotypic Analysis The methods used to carry out genotypic analysis in this study included:
(i) 16S-23S ISR PCR (ii) fliC PCR (iii) RAPD-PCR (iv) BOX-PCR
3.3.3.1. Chromosomal DNA Purification Ralstonia strains were grown overnight at 30ºC in 5 ml of nutrient broth media. 1.5 ml of the culture was spun in a microcentrifuge for 2 min until a compact pellet was formed. The pellet was resuspended in 567 µL TE buffer by repeated pipetting and 30 µL of 10% (w/v) sodium dodecyl sulfate (SDS) and 3 µL of 20 mg/ml proteinase K was added to give a final concentration of 100 µg/ml proteinase K in 0.5% SDS. This was mixed thoroughly and incubated for one hour at 37°C. 100 µL of 5 M NaCl was then added and mixed thoroughly. 80 µL of CTAB/NaCl solution was then added, mixed thoroughly and incubated for 10 min at 65°C. An approximately equal volume (0.7 to 0.8 ml) of chloroform/isoamyl alcohol was added, mixed and spun down for 4 to 5 min in a microcentrifuge. The aqueous layer was moved to a fresh microcentrifuge tube, leaving the interface behind. An equal volume of 25:24:1 phenol/chloroform/isoamyl alcohol was added, extracted thoroughly, and spun in a microcentrifuge for 5 min. The supernatant was transferred to a new tube. 0.6 volume of isopropanol was added to precipitate the nucleic acids. The tubes were shaken back and forth until a stringy white DNA precipitate became clearly visible. The precipitate was pelleted by spinning briefly at room temperature in a centrifuge. The supernatant was discarded. 70% ethanol was then added. The supernatant was carefully removed; the
63 pellet was dried and was then redissolved in 100 µL TE buffer. This was then stored at - 20°C
3.3.3.2. Simple DNA Preparation DNA for PCR was prepared by the method outlined in Coenye et al., (2001). Briefly one colony (picked from a culture grown overnight) was heated at 95°C for 20 min in 25 µL of lysis buffer containing 0.25% (v/v) sodium dodecyl sulfate and 0.05 M NaOH. Following the heating step, 180 µL of sterile purified water was added to the lysis buffer. The DNA solutions were then stored at -20°C.
3.3.3.3. Species-specific PCR for Identification of R. pickettii and R. insidiosa The primers used in this study were designed by Coenye et al., (2002a, 2003a) detailed in Table 3.1 PCR assays were performed in 25 µL reaction mixtures, containing 1 µL DNA solution, 1U Taq polymerase, 250 mM (each) deoxynucleotide triphosphate,
1.5 mM MgCl2, 1x PCR buffer (Bioline), and 20 pmol of Oligonucleotide primer Rp-F1 and 10 pmol of Oligonucleotide primers Rp-R1 and R38R1 (Table 3.1) (MWG Biotech, Ebersberg, Germany). Amplification was carried out with a GeneAmp 2400 Thermocycler. After initial denaturation for 2 min at 94°C, 30 amplification cycles were completed, each consisting of 1 min at 94°C, 1 min at 55°C, and 1 min 30 s at 72°C. A final extension of 10 min at 72°C was then applied. Negative control PCRs with all reaction mixture components except template DNA were used for every experiment. The PCR products were analysed by electrophoresis in a 1.5% (w/v) agarose gel (Agarose MP, Roche Diagnostics) for 1 hour (100 V) and ethidium bromide staining in the TBE buffer and photographed under the UV light (UV Products Gel Documentation System Imagestore, Ultra Violet Products, Cambridge). A 200-10000bp DNA ladder was included on all gels to allow standardization and sizing.
Table 3.1: PCR Primers used in the Differentiation of R. pickettii and R. insidiosa Primer Oligonucleotide Sequence 5’-3’ Target a Product Reference (Nucleotide size positions) Rp-F1 ATGATCTAGCTTGCTAGATTGAT 49- 71 210bp b Rp-R1 ACTGATCGTCGCCTTGGTG 240-259 R38R1 CACACCTAATATTAGTAAGTGCG 429-452 403bp c a Positions are relative to the 16S rRNA gene sequence of Ralstonia pickettii (2000030635, AY268180) b Coenye et al., 2002a c Coenye et al., 2003a
64 3.3.3.4. PCR-Ribotyping Polymorphisms were sought in the 16S-23S spacer region of the rRNA genes by DNA amplification using the primers complimentary to the conserved regions of the 16S and 23S bacterial rRNA genes. The primers that were used were 16SF 5′- TTGTACACACCGCCCGTCA-3′ and 23SR 5′-GGTACCTTAGATGTTTCAGTTC-3′ (Kostman et al., 1992). Amplification was carried out with a 10× PCR buffer (in a total reaction of 100 µL containing 0.2 mM deoxynucleoside triphosphates, 2.5 mM magnesium chloride, 100 pmol of each primer, 4 µL of genomic template DNA, and 1.25 units of Taq DNA polymerase. Amplification was carried out using a GeneAmp 2400 Thermocycler according to the following procedure. Initial denaturation at 95°C for 5 min followed by 30 cycles of PCR consisting of denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 1 min; in the last cycle, the extension time was 10 min. The PCR products (5 µL) were analysed as described previously (Section 3.3.3.3).
3.3.3.5. 16S-23S ISR RFLP Restriction digests were performed on the 16S-23S ISR PCR product in 20 µL reaction mixtures, containing 5 U restriction enzyme, 1× appropriate buffer, 0.2 µL bovine serum albumin at a concentration of 10 mg per ml and 15 µL of the PCR product. Restriction digests were carried out at the temperature recommended by the manufacturer for 4 hrs. Restriction enzymes used included CfoI, AluI, TaqI and HaeIII (Roche, UK). Restriction fragments were separated in 2% (w/v) agarose gels (Sigma) in 0.5x TBE buffer at 100 V for 75 min. A 100bp DNA ladder was included on all gels to allow standardization and sizing. Gels were stained with ethidium bromide, visualized and recorded as described previously (Section 3.3.3.3).
3.3.3.6. PCR- amplification of the fliC gene The Ral_fliC primer system was adapted (forward [5'- CCTCAGCCTCAATACCAACATC -3'] and reverse [5'- CATGTTCGACGTTTCMGAWGC -3']) and used to obtain a 724bp fragment of the fliC gene (Schönfeld et al., 2003). Amplification was carried out with a 10× PCR buffer (in a total reaction of 100 µL containing 0.2 mM deoxynucleoside triphosphates, 2.5 mM magnesium chloride, 100 pmol of each primer, 4 µL of genomic template DNA, and 1.25 U of Taq DNA polymerase. Amplification was carried out using a GeneAmp 2400 Thermocycler according to the following procedure. Initial denaturation at 95°C for 5 min followed by 30 cycles of PCR consisting of denaturation at 94°C for 1 min,
65 annealing at 55°C for 1 min, and extension at 72°C for 1 min; in the last cycle, the extension time was 10 min. The PCR product (5 µL) was analysed on a 1.5% (w/v) agarose gel in the TBE buffer.
3.3.3.7. DNA Sequencing The 16S-23S ISR and the fliC gene were amplified using PCR, as described above. The PCR product was purified using the NucleoSpin Extract II kit (Macherey- Nagel, Düren, Germany) according to the manufacturer’s instructions (Appendix 3). Sequence analysis was performed by MWG using fluorescently labelled forward and reverse primers as above.
3.3.3.8. Bioinformatic Analysis DNA and protein sequences necessary for this study were retrieved from the public databases GenBank and EMBL Bank distributed by the National Centre for Biotechnology Information (NCBI, USA) and the European Bioinformatics Institute (EBI, UK). The databases were accessed at http://www.ncbi.nlm.nih.gov/ and http://www.ebi.ac.uk/embl, respectively (Benson et al., 2009; Sterk et al., 2008). The Basic Local Alignment Search Tool (BLAST) program was used for searching for DNA and protein databases for similar sequences (Altschul et al., 1990; 1997). Blast searches were preformed on NCBI’s web site: http://www.ncbi.nlm.nih.gov/BLAST/. Nucleotide and protein sequences were aligned using the computer program Clustal W (Thompson et al., 1994; Higgins et al., 1994). This program calculates the best match and shows the similarities and differences between selected sequences. The program was accessed at http://align.genome.jp/. The GeneDoc program was used to visually represent these alignments (Nicholas et al., 1997). Phylogenetic and molecular evolutionary analyses were conducted using genetic-distance-based neighbour-joining algorithms (Saitou and Nei, 1987) within MEGA Version 4.0 (http://www.megasoftware.net/, Tamura et al., 2007). Bootstrap analysis for 1000 replicates was performed to estimate the confidence of tree topology (Felsenstein, 1985). The Aragorn program Ver 1.1 was used to investigate for the presence of tRNA genes in the 16S-23S rRNA spacer regions (Laslett and Canback, 2004). The program was accessed at: http://pcmbioekol-bioinf2.mbioekol.lu.se/ARAGORN1.1/HTML/.
66 3.3.3.9. RAPD PCR Analysis Primers used for RAPD-PCR experiment are outlined in Table 3.2. Each 25 µl
PCR sample contained 2.5 µL of 10X buffer, 2 mM of MgCl2, 40 pmol of each primer, 200 mM of each of four dNTPs, 2 µL of template genomic DNA and 1 U of Taq polymerase. Amplification for all strains was performed in a Perkin-Elmer GeneAmp 2400 Thermocycler. The samples were carried out as follows: an initial denaturation (94°C for 5 min) followed by 40 cycles of denaturation (94°C for 60 sec), annealing (36°C for 60 sec) and extension (72°C for 90 s). Amplified products were analysed by electrophoresis in a 2% (w/v) agarose gel containing ethidium bromide at 50 V for 2 h 30 min and were detected by UV transillumination. A 200-10000bp DNA ladder was included on all gels to allow standardization and sizing.
Table 3.2: PCR Primers used in RAPD Analysis Primer Oligonucleotide Sequence 5’-3’ References M13 TTATGTAAAACGACGGCCAGT de la Puente-Redondo et al., 2000 P3 AGACGTCCAC Welsh and McClelland, 1990 P15 AATGGCGCAG Welsh and McClelland, 1990 OPA03U AGTCAGCCAC Albibi et al., 1998
3.3.3.10. BOX-PCR Analysis BOX-PCR typing was carried out with the BOX-A1R primer (5'- CTACGGCAAGGCGACGCTGACG-3') (Louws et al., 1994). 2 µL of DNA solution was mixed with 2 U of Taq polymerase, 200 mM of each of four dNTPs, 2.5 µL of dimethyl sulfoxide (DMSO), 0.8 µL of bovine serum albumin (10 mg /ml) (Promega), 5 µL of 5x Gitschier buffer and 10 pmol of primer in a final volume of 25 µL. Amplification was carried out with a Perkin-Elmer GeneAmp 2400 Thermocycler. After initial denaturation for 2 min at 95°C, 35 amplification cycles were completed, each consisting of 40 sec at 92°C, 1 min at 50°C, and 8 min at 65°C. A final extension of 8 min at 65°C was applied. PCR products were separated on 25 cm long 1.5% (w/v) agarose gels in 0.5x TBE buffer (60 V for 4 hrs at room temperature). A 10000-bp DNA ladder was included on all gels to allow standardization and sizing.
3.3.3.11. Analysis of DNA Relatedness The analysis of the BOX and RAPD gels was performed using BioNumerics software (Version 5.1, Applied Maths, Kortrijk, Belgium), based on the Pearson correlation coefficient, and clustering by the unweighted pair group method with arithmetic means (UPGMA method) (Li, 1981). Banding patterns were compared using a densitometric curve-based method that evaluates the intensity as well as the position
67 of the bands. Clusters were defined as strains that clustered together at a level of 80% similarity or more. These were considered clonally related that were classified into the same RAPD or BOX-PCR group. The discriminatory power of the BOX and RAPD- PCR techniques for typing R. pickettii strains was evaluated by using the discrimination index as described by Hunter and Gaston (1988) as given by the equation:
where D is the numerical index of discrimination, N is the total number of strains, and nj is the number of strains pertaining to the jth type. The values calculated by the Simpson's index range from 0 to 1, a value of 0 indicates no discrimination, and a value of 1 indicates that every strain can be discriminated. D is the value of the probability that two unrelated strains sampled from the test population will be placed into different typing groups.
3.4. Results
3.4.1. Water Testing
3.4.1.1. Water Testing Fifty-eight 500 ml samplings of the Millipore Synergy system were taken. R2A media was found to recover more colony forming units than the PCA. Upon restreaking the majority (fifty-three colonies out of forty samplings that produced bacterial colonies for the Millipore Synergy system) of the purified water isolates failed to grow. Those that did grow underwent biochemical testing. Non-fermentative Gram- Negative rods made up the bulk of strains detected in this study include Ralstonia pickettii, Stenotrophomonas maltophilia, Sphingomonas paucimobilis, Pseudomonas luteola and the Gram-Positive Bacillus cereus was also isolated (Table 3.3).
Table 3.3: Isolating Frequency (%) of the Identified Microorganisms from Purified Water System Microorganism % Numbers of isolates Ralstonia pickettii 38 5 Sphingomonas paucimobilis 23 3 Stenotrophomonas maltophilia 23 3 Pseudomonas luteola 8 1 Bacillus cereus 8 1
68 3.4.1.2. Determination of Oligotrophy The strains that were isolated using R2A media were tested to determine if they were capable of oligotrophic growth (Table 3.4). These results show that all the Gram-Negative strains isolated were facultatively oligotrophic as they had the ability to grow on both full strength and diluted R2A, while the Gram-Positive Bacillus cereus was only able to grow on the full strength R2A media.
Table 3.4: Classification of Oligotrophy of Strains Isolated from Laboratory Purified Water Microorganism Number R2A 1:10 1:100 1:1000 of Isolates
Ralstonia pickettii 5 + + + + Sphingomonas paucimobilis 3 + + + + Stenotrophomonas maltophilia 3 + + + + Pseudomonas luteola 1 + + + + Bacillus cereus 1 + - - -
3.4.1.3. Polymer Growth Testing The testing of bacterial stains to use polymer media was performed to test the hypothesis that the water borne bacteria obtained nutrients from the polymers in the plastic water piping in order to survive (Table 3.5). All strains isolated in this study were tested and all failed to grow on the polymer enhanced minimal media with the conditions used.
Table 3.5: Growth of Ralstonia pickettii on Polymer Substances R. pickettii Strain Polyvinyl Chloride Polyethylene Polypropylene JCM5969 - - - CCUG18841 - - - LMG21421 - - - ULI187 - - - ULI785 - - - ULC193 - - - ULM001 - - - ULM002 - - - ULM003 - - - ULM004 - - - ULM005 - - - ULM006 - - - ULM007 - - - ULM008 - - - ULM009 - - - ULM010 - - - ULM011 - - -
69 3.4.2. Ralstonia insidiosa identification using species-specific PCR In order to confirm that the isolated strains were in fact R. pickettii a species- specific PCR was carried out using the primers listed in Table 3.1. The results on the experimental analysis of fifty-eight strains from our study and the R. insidiosa Type strain LMG21421 (used as a positive control for the R. insidiosa primers), which include industrial, clinical, laboratory purified water and seven purchased strains are presented in Fig 3.1-Fig 3.5. Eleven of the industrial strains (ULI821, ULI797, ULI785, ULI181, ULI794, ULI185, ULI166, ULI819, ULI784, ULI163, ULI795), two laboratory water isolates (ULM008, ULM009) and one purchased strain (ATCC49129) were identified as R. insidiosa through use of the species-specific primers (Table 3.1.). The multiplex PCR gave a 403 bp band and a 210 bp band for R. insidiosa and only the 210 bp band for R. pickettii. The reverse primer R38R1 in combination with the forward primer Rp-F1 (Coenye et al., 2002a; Coenye et al., 2003a) gave the specific amplification of a 403 bp 16S rDNA fragment for all R. insidiosa strains. All R. insidiosa strains cross-reacted with primer pair Rp-F1/Rp-R1 (developed for the identification of R. pickettii) giving the 210 bp band. PCR with Rp-F1 and Rp-R1 resulted in the amplification of fragments of 210 bp only for R. pickettii. This is the first demonstration that R. insidiosa is present and can survive in HPW.
70
Fig 3.1: Species-Specific PCR of Ralstonia pickettii Industrial Isolates
1. Marker- Hyper ladder 1 (Bioline 200-10000bp) 2. R. insidiosa LMG21421 (61.70% 0050577 API20NE) (99.94% 400414 Remel) 3. R. pickettii (insidiosa) ATCC49129 (92.40% 0040475 API20NE) (99.99% 404414 Remel) 4. Negative Control- Sterile Purified Water 5. ULI187 R. pickettii (97.70% 1041565 API20NE) (98.34% 404614 Remel) 6. ULI188 R. pickettii (95.10% 0045445 API20NE) (99.99% 404414 Remel) 7. ULI798 R. pickettii (95.10% 0045445 API20NE) (99.99% 404414 Remel) 8. ULI807 R. pickettii (84.10% 0045455 API20NE) (99.99% 404414 Remel) 9. ULI171 R. pickettii (84.10% 0045455 API20NE) (99.99% 404414 Remel) 10. Marker- Hyper ladder 1 (Bioline 200-10000bp) 11. ULI821 R. pickettii (insidiosa) (84.10% 0045455 API20NE) (99.94% 400414 Remel) 12. ULI797 R. pickettii (insidiosa) (84.10% 0045455 API20NE) (98.34% 404614 Remel) 13. ULI788 R. pickettii (80.40% 0245455 API20NE) (99.94% 400414 Remel) 14. ULI800 R. pickettii (80.40% 0245455 API20NE) (99.99% 404414 Remel) 15. ULI169 R. pickettii (80.40% 0245455 API20NE) (99.99% 404414 Remel) 16. ULI165 R. pickettii (67.90% 1045455 API20NE) (99.99% 404414 Remel) 17. ULI174 R. pickettii (67.90% 1045455 API20NE) (98.34% 404614 Remel) 18. ULI193 R. pickettii (61.70% 0050577 API20NE) (98.38% 400614 Remel) 19. ULI796 R. pickettii (60.00% 1241455 API20NE) (98.34% 404614 Remel) 20. Marker- Hyper ladder 1 (Bioline 200-10000bp)
71 Fig 3.2: Species-Specific PCR of Ralstonia pickettii Industrial Isolates
21. ULI791 Ralstonia pickettii (56.90% 0044455 API20NE) (99.99% 404414 Remel) 22. ULI785 Ralstonia pickettii (insidiosa) (53.10% 0045457 API20NE) (99.99% 404414 Remel) 23. Marker- Hyper ladder 1 (Bioline 200-10000bp) 24. ULI790 Ralstonia pickettii (44.80% 0255455 API20NE) (98.34% 404614 Remel) 25. ULI181 Ralstonia pickettii (insidiosa) (39.50% 1045555 API20NE) (99.99% 404414 Remel) 26. ULI818 Ralstonia pickettii (39.50% 1045555 API20NE) (99.94% 400414 Remel) 27. ULI804 Ralstonia pickettii (24.50% 0055455 API20NE) (98.34% 404614 Remel) 28. ULI794 Ralstonia pickettii (insidiosa) (6.40% 1141455 API20NE) (34.18% 400404 Remel) 29. ULI185 Ralstonia pickettii (insidiosa) (5.70% 1251575 API20NE) (98.34% 404614 Remel) 30. Marker- Hyper ladder 1 (Bioline 200-10000bp) 31. ULI166 Ralstonia pickettii (insidiosa) (0.00% 1054555 API20NE) (99.94% 400414 Remel) 32. ULI819 Ralstonia pickettii (insidiosa) (0.00% 1372004 API20NE) (99.99% 404414 Remel) 33. ULI159 Ralstonia pickettii (0.00% 1200004 API20NE) (99.94% 400414 Remel) 34. ULI806 Ralstonia pickettii (0.00% 1044444 API20NE) (99.99% 404414 Remel) 35. ULI167 Ralstonia pickettii (0.00% 1050555 API20NE) (99.94% 400414 Remel) 36. ULI784 Ralstonia pickettii (insidiosa) (0.00% 1310000 API20NE) (99.99% 404414 Remel) 37. ULI163 Ralstonia pickettii (insidiosa) (0.00% 1245555 API20NE) (98.34% 404614 Remel) 38. ULI795 Ralstonia pickettii (insidiosa) (0.00% 1041645 API20NE) (98.34% 406414 Remel) 39. ULI162 Ralstonia pickettii (0.00% 1145455 API20NE) (99.99% 404414 Remel) 40. Marker- Hyper ladder 1 (Bioline 200-10000bp)
72 Fig 3.3: Species-Specific PCR of Ralstonia pickettii Clinical Isolates
41. R. insidiosa LMG21421T (61.70% 0050577 API20NE) (99.94% 400414 Remel) 42. R. pickettii JCM 5969T (99.00% 1041465 API20NE) (99.94% 400414 Remel) 43. ULI298 R. pickettii (90.10% 0051574 API20NE) (99.99% 404414 Remel) 44. ULI297 R. pickettii (70.03% 0050557 API20NE) (99.94% 400414 Remel) 45. ULI277 R. pickettii (61.70% 0050577 API20NE) (99.99% 404414 Remel) 46. Marker- Hyper ladder 1 (Bioline 200-10000bp) 47. ULI244 R. pickettii (56.70% 0050555 API20NE) (99.94% 400414 Remel) 48. ULI193 R. pickettii (56.70% 0050555 API20NE) (99.99% 404414 Remel) 49. ULI194 R. pickettii (56.70% 0050555 API20NE) (99.99% 404414 Remel) 50. ULI421 R. pickettii (28.50% 0045455 API20NE) (99.99% 404414 Remel)
Fig 3.4: Species-Specific PCR of Ralstonia pickettii Purchased Strains
51. R. insidiosa LMG21421 (61.70% 0050577 API20NE) (99.94% 400414 Remel) 52. R. pickettii JCM5969 (99.00% 1041465 API20NE) (99.94% 400414 Remel) 53. R. pickettii NCTC11159 (95.10% 1041455 API20NE) (99.94% 400414 Remel) 54. R. pickettii DSM6927 (95.10% 1041455 API20NE) (99.94% 400414 Remel) 55. Marker- Hyper ladder 1 (Bioline 200-10000bp) 56. R. pickettii CCUG3318 (91.10% 1041555 API20NE) (99.94% 400414 Remel) 57. R. pickettii CIP73.23 (91.10% 1041555 API20NE) (99.94% 400414 Remel) 58. R. pickettii (insidiosa) ATCC49129 (92.40% 0040475 API20NE) (99.99% 404414 Remel) 59. R. pickettii CCM2846 (00.00% 1055555 API20NE) (99.71% 400616 Remel) 60. R. pickettii CCUG18841 (00.00% 1055555 API20NE) (99.71% 400616 Remel)
73 Fig 3.5: Species-Specific PCR of Ralstonia pickettii Laboratory Water Isolates
61. Marker- Hyper ladder 1 (Bioline 200-10000bp) 62. R .insidiosa LMG21421 (61.70% 0050577 API20NE) (99.94% 400414 Remel) 63. R. pickettii JCM5969 (99.00% 1041465 API20NE) (99.94% 400414 Remel) 64. ULM001 R. pickettii (95.10% 1041455 API20NE) (99.99% 404416 Remel) 65. ULM002 R. pickettii (95.10% 1041455 API20NE) (99.99% 404416 Remel) 66. ULM003 R. pickettii (88.60% 1041457 API20NE) (99.28% 400406 Remel) 67. ULM004 R. pickettii (91.10% 1041555 API20NE) (99.99% 404416 Remel) 68. ULM005 R. pickettii (95.10% 1040455 API20NE) (00.00% 600416 Remel) 69. ULM006 R. pickettii (95.10% 1040455 API20NE) (99.28% 400406 Remel) 70. ULM007 R. pickettii (95.10% 1040455 API20NE) (99.99% 404416 Remel) 71. Marker- Hyper ladder 1 (Bioline 200-10000bp) 72. ULM008 R. pickettii (insidiosa) (80.20% 0041455 API20NE) (99.94% 400414 Remel) 73. ULM009 R. pickettii (insidiosa) (80.20% 0041455 API20NE) (99.94% 400414 Remel) 74. ULM010 R. pickettii (99.40% 1041575 API20NE) (99.94% 400414 Remel) 75. ULM011 R. pickettii (99.40% 1041575 API20NE) (99.99% 404414 Remel) 76. Marker- Hyper ladder 1 (Bioline 200-10000bp)
Using the species-specific primers listed in Table 3.1
74 3.4.3. Genetic and phenotypic diversity of Ralstonia pickettii strains from clinical and environmental sources
3.4.3.1. Biotyping Biotyping using commercial identification kits, oxidase and catalase tests, protease activity tests, haemolytic activity tests, antibiotic typing and motility testing were carried out for all strains listed in Table 2.8. The biochemical identification results obtained for all strains are presented in Table 3.6. All isolates were Gram-Negative non-fermentative rods. All isolates were oxidase and catalase positive. In this study, all fifty-nine strains (eight purchased, seven clinical, eleven laboratory water and thirty-two industrial isolates) except the R. insidiosa type strain LMG21421 were identified initially as R. pickettii. These results were confirmed using the BioMérieux Vitek Junior system using the Non-Fermenter identification card (NFC) identified all isolates as R. pickettii at 99% except for CCM2846, which was identified as R. pickettii at 97%. The R. insidiosa type strain was identified as R. pickettii 61.70% (‘Low Discrimination’ 0050577) with the API 20NE, R. pickettii 99.94% (‘Implicit’ 400414) with the RapID NF Plus and R. pickettii 99% on the Vitek Junior system with the NFC Card. The API 20NE identified all the purchased strains as R. pickettii, all seven clinical strains were identified as R. pickettii, all eleven laboratory water isolates were identified as R. pickettii and seventeen of the thirty-two industrial isolates were identified as R. pickettii species with cut-off points higher then 50%, the rest of the industrial isolates were all identified as non R. pickettii species. The RapID NF Plus identified fifty-seven isolates as R. pickettii, with results of over 98% in all identified R. pickettii strains. The strains identified as R. insidiosa were checked to see which biovar they were (based on the Adipate assimilation test of the API 20NE) (Table 3.7). Twelve out of the fifteen isolates were identified as biovar 2 as they failed to assimilate adipate. Statistical analysis of the API 20NE results were also carried out, percent similarities based on the Jaccard similarity coefficient correlation coefficients and clustering by the UPGMA method, the results of which can be seen in Fig 3.6. Seventeen groups were found that clustered together above 80%. The results showed no major grouping of the industrial, clinical, purchased type strains, soil strains and laboratory-purified water. Strains identified as R. insidiosa using the PCR method did not group together. A Simpson’s Discriminatory Index of 0.9813 was calculated for this study (Hunter and Gaston, 1988) indicating limited phenotypic diversity in R. pickettii and R. insidiosa.
75 This analysis was not carried out with the Remel RapID NF plus as the results with this systems were too similar to each other for any statistical analysis to be carried out.
Fig 3.6: Cluster analysis of API 20NE results. B: Biotype 1 to 35- numbers assigned to API 20NE profile, strains belonging to each biotype can be seen in Table 3.6. Scale is a measure of the phenotypic relatedness of strains.
3.4.3.1.1. Desferrioxamine susceptibility All R. insidiosa isolates were resistant to desferrioxamine (no zone of inhibition). Of the forty-four R. pickettii strains that were tested, eleven were resistant to desferrioxamine and thirty-three were susceptible (Table 3.6).
3.4.3.1.2. Nitrate reduction Test Nitrate reduction test results varied with six R. insidiosa strains giving positive results (the rest were negative) and several R. pickettii strains giving negative results (Table 3.6).
76 3.4.3.1.3. Protease Activity To determine if R. pickettii possessed any extracellular proteolytic activity all strains listed in Table 2.8 and the R. insidiosa Type strain were tested on LB agar supplemented with skimmed milk (Sokol et al., 1979; Huber et al., 2001). No clear zones were found around any of the strains tested indicating that they had no extracellular proteolytic activity.
3.4.3.1.4. Elastase activity Following overnight incubation of all R. pickettii strains listed in Table 2.8 and the R. insidiosa Type strain on nutrient agar supplemented with elastin powder, no clear zones were visible around the R. pickettii strains indicating that all strains had no elastase activity.
3.4.3.1.5. Haemolytic activity Haemolysins are proteins that lyse red blood cells and degrade haemoglobin. Different bacteria and different strains of bacteria can cause different types of haemolysis: α, β and γ. β haemolysin breaks down the red blood cells and haemoglobin completely and the colony is surrounded by a white or clear zone. α-Haemolysin partially breaks down the red blood cells and leaves a greenish or brownish-green colour which is due to the presence of biliverdin, which is a by-product of the breakdown of haemoglobin that causes greenish colour of bacterial growth, with γ- Haemolysis no visible haemolysis takes place. All strains listed in Table 2.8 and the R. insidiosa Type strain were found to produce α-Haemolysins.
Fig 3.7: Example of α- Haemolysis of R. pickettii DSM6297
77 Table 3.6: Characterisation of Strains of R. pickettii Isolates Using Phenotypic and the Species-Specific PCR Assay Strain API 20 NE RapID NF Plus Vitek NT DfS PCR (NFC) b c Biotype % ID % ID RapID % ID a R. API 20NE R. NF Plus R. pickettii Code pickettii Code pickettii Purchased Strains JCM5969 B1 99.00 1041465 99.94 400414 99.00 + + R. pickettii NCTC11149 B4 95.10 1041455 99.94 400414 99.00 + + R. pickettii DSM6297 B4 95.10 1041455 99.94 400414 99.00 + + R. pickettii CCUG3318 B7 91.10 1041555 99.94 400414 99.00 + + R. pickettii CIP73.23 B7 91.10 1041555 99.94 400414 99.00 - + R. pickettii ATCC49129 B6 92.40 0040475 99.99 404414 99.00 - - R. insidiosa CCUG18841 B30 00.00 1055555 99.71 400616 99.00 + - R. pickettii CCM2846 B30 00.00 1055555 99.71 400616 97.00 + - R. pickettii LMG21421 B15 61.70 0050577 99.94 400414 99.00 - - R. insidiosa Industrial Strains ULI187 B3 97.70 1041565 98.34 404614 99.00 + + R. pickettii ULI188 B4 95.10 1041455 99.99 404414 99.00 + + R. pickettii ULI798 B5 95.10 0045445 99.99 404414 99.00 + - R. pickettii ULI807 B10 84.10 0045455 99.99 404414 99.00 + - R. pickettii ULI171 B10 84.10 0045455 99.99 404414 99.00 - + R. pickettii ULI821 B10 84.10 0045455 99.94 400414 99.00 + - R. insidiosa ULI797 B10 84.10 0045455 98.34 404614 99.00 + - R. insidiosa ULI788 B11 80.40 0245455 99.94 400414 99.00 - - R. pickettii ULI800 B11 80.40 0245455 99.99 404414 99.00 + + R. pickettii ULI169 B11 80.40 0245455 99.99 404414 99.00 + - R. pickettii ULI165 B14 67.90 1045455 99.99 404414 99.00 - - R. pickettii ULI174 B14 67.90 1045455 98.34 404614 99.00 + + R. pickettii ULI193 B15 61.70 0050577 98.38 400614 99.00 + + R. pickettii ULI796 B16 60.00 1241455 98.34 404614 99.00 + + R. pickettii ULI801 B17 56.90 0044455 99.99 404414 99.00 + + R. pickettii ULI791 B17 56.90 0044455 99.99 404414 99.00 + + R. pickettii ULI785 B19 53.10 0045457 99.99 404414 99.00 + - R. insidiosa ULI790 B20 44.80 0255455 98.34 404614 99.00 + - R. pickettii ULI181 B21 39.50 1045555 99.99 404414 99.00 - - R. insidiosa ULI818 B21 39.50 1045555 99.94 400414 99.00 - - R. pickettii ULI804 B23 24.50 0055455 98.34 404614 99.00 + - R. pickettii ULI794 B24 06.40 1141455 34.18 400404 99.00 - - R. insidiosa ULI185 B25 05.70 1251575 98.34 404614 99.00 - - R. insidiosa ULI166 B32 00.00 1054555 99.94 400414 99.00 - - R. insidiosa ULI819 B26 00.00 1372004 99.99 404414 99.00 - - R. insidiosa ULI159 B29 00.00 1200004 99.94 400414 99.00 + + R. pickettii ULI806 B34 00.00 1044444 99.99 404414 99.00 + + R. pickettii ULI167 B33 00.00 1050555 99.94 400414 99.00 + - R. pickettii ULI784 B27 00.00 1310000 99.99 404414 99.00 - - R. insidiosa ULI163 B28 00.00 1245555 98.34 404614 99.00 - - R. insidiosa ULI795 B35 00.00 1041645 98.34 404614 99.00 + - R. insidiosa ULI162 B30 00.00 1145455 99.99 404414 99.00 + + R. pickettii Clinical Strains ULC298 B8 90.10 0051574 99.99 404414 99.00 + + R. pickettii ULC297 B13 70.03 0050557 99.94 400414 99.00 + + R. pickettii ULC277 B15 61.70 0050577 99.99 404414 99.00 + + R. pickettii ULC244 B18 56.70 0050555 99.94 400414 99.00 + + R. pickettii ULC193 B18 56.70 0050555 98.34 404614 99.00 + + R. pickettii ULC194 B18 56.70 0050555 99.99 404414 99.00 + + R. pickettii ULC421 B21 28.50 0050575 99.99 404414 99.00 + + R. pickettii Laboratory Purified Water Strains ULM001 B4 95.10 1041455 99.99 404416 99.00 + + R. pickettii ULM002 B4 95.10 1041455 99.99 400416 99.00 + + R. pickettii ULM003 B9 88.60 1041457 99.28 400406 99.00 - + R. pickettii
78 Strain API 20 NE RapID NF Plus Vitek NT DfS PCR (NFC) b c Biotype % ID % ID RapID % ID a R. API 20NE R. NF Plus R. pickettii Code pickettii Code pickettii Laboratory Purified Water Strains ULM004 B7 91.10 1041555 99.99 400416 99.00 + + R. pickettii ULM005 B4 95.10 1040455 00.00 600416 99.00 + + R. pickettii ULM006 B4 95.10 1041455 99.28 400406 99.00 - + R. pickettii ULM007 B4 95.10 1041455 99.99 400416 99.00 + + R. pickettii ULM008 B12 80.20 0041455 99.99 400416 99.00 + - R. insidiosa ULM009 B12 80.20 0041455 99.99 400416 99.00 + - R. insidiosa ULM010 B2 99.40 1041575 99.99 400416 99.00 + + R. pickettii ULM011 B2 99.40 1041575 99.99 400416 99.00 + + R. pickettii a biotype assigned on the basis of API 20NE utilization, Figure 3.6 b Nitrate Reduction c Desferrioxamine Susceptibility
Table 3.7: Biovar Identification of PCR Identified R. insidiosa Strains Strain Adipate Biovar Assimilation * LMG21421 + Biovar 1 ATCC49129 + Biovar 1 ULI797 - Biovar 2 ULI785 - Biovar 2 ULI788 - Biovar 2 ULI181 - Biovar 2 ULI794 - Biovar 2 ULI185 + Biovar 1 ULI166 - Biovar 2 ULI819 - Biovar 2 ULI784 - Biovar 2 ULI163 - Biovar 2 ULI795 - Biovar 2 ULM008 - Biovar 2 ULM009 - Biovar 2 * Based on Adipate Assimilation test on the API 20NE
79 3.4.3.1.6. Antibiogram Analysis of R. insidiosa The antibiogram results are presented in Table 3.8. The antibiotyping results of a selection of the R. pickettii isolates listed in Table 2.8 have been previously published (Adley and Saieb, 2005a). The purchased culture collection strains of R. insidiosa were resistant to the Penicillin-ticarcillin (Tic), the Aminoglycides-gentamicin (Cn) and Tobramycin (Tor), the Phenicol-chloramphenicol (C) and the tetracycline- tetracycline (Te). Ten of the fifteen R. insidiosa isolates showed resistance to Gentamicin, Tetracycline, Chloramphenicol, Ticarcillin and Tobramycin. Isolate ULI185 showed resistance to six antibiotics Gentamicin, Tetracycline, Chloramphenicol, Ticarcillin, Mezlocillin and Tobramycin. R. insidiosa isolate ULI794 showed resistance to seven antibiotics Gentamicin, Tetracycline, Chloramphenicol, Ticarcillin, Mezlocillin, Cefepime and Tobramycin. Isolate ULI797 failed to show resistance of any kind.
Table 3.8: Antibiotic Resistance Patterns of Ralstonia insidiosa Isolates Strain/Isolate No. Antibiotic Resistance R. insidiosa LMG21421 Cn, Te, Tor, Tic, C R. insidiosa ATCC49129 Cn, Te, Tor, Tic, C ULI797 Susceptible to all ULI821 Cn, Te, Tor, Tic, C ULI785 Cn, Te, Tor, Tic, C ULI181 Cn, Te, Tor, Tic, C ULI794 Cn, Te, Tor, Tic, Mez, Feb C ULI185 Cn, Te, Tor, Tic, Mez, C ULI166 Cn, Te, Tor, Tic, C ULI819 Cn, Tor, Tic, Mez, C ULI784 Cn, Te, Tor, Tic, C ULI163 Cn, Te, Tor, Tic, C ULI795 Cn, Te, Tor, Tic, C ULM008 Cn, Te, Tor, Tic, C ULM009 Cn, Te, Tor, Tic, C Tic- Ticarcillin 75 µg/ml; Ctx-Cefotaxime 30µg/ml; Cn-Gentamicin 10µg/ml; Te-Tetracycline 30µg/ml; Cip-Ciprofloxacin 5µg/ml; Ofl-Ofloxacin 5µg/ml; SxT-Sulphamethoxazole/trimethoprim 23.75/1.25 µg/ml; C-Chloramphenicol 30µg/ml. Mez-Mezlocillin 75µg/ml, Feb-Cefepime 30µg/ml, Tor-Tobramycin 10µg/ml Control strain: Pseudomonas aeruginosa ATCC 27853
3.4.3.1.6. Motility Assays All Ralstonia pickettii strains possessed very poor swimming motility, poor swarming motility and no twitching motility. These results indicate that R. pickettii is not a very motile bacterium under the conditions used in these experiments.
80 3.4.3.2. Analysis of the 16S rRNA gene of Ralstonia pickettii The sequence information of the 16S rRNA gene (for all genes available in the database that were over 1350bp) of R. pickettii strains was retrieved from the GenBank database (Benson et al., 2009, twelve Sequences, Table 3.9). The sequences were then aligned using the Clustal W software program (Higgins et al., 1994) and the data analysed using the GeneDoc Software program (Nicholas et al., 1997) to determine the heterogeneity between the different sequences of the 16S rRNA gene.
Table 3.9: Information on R. pickettii 16S rDNA Sequences Deposited in the GenBank Database Strain GenBank Source Location Year Reference Accession (Sequence) Number MSP3 AB004790 Soil Isolate Japan 1997 Ikeda et al., 1998 TA DQ908951 Environmental USA 2006 Dodge et al., 2006 Isolate 2000032023 AY268176 Human USA 2000 Gee et al., 2003 ATCC 27511 AY741342 Tracheotomy USA 1972 N/A N/A AB167381 Environmental Japan 2000 Watanabe et al., Isolate 2005 2002721592 AY268177 Human USA 2000 Gee et al., 2003 2002721591 AY268178 Human USA 2000 Gee et al., 2003 2000030791 AY268179 Human USA 2000 Gee et al., 2003 2000030635 AY268180 Human USA 2000 Gee et al., 2003 LMG7160 AJ270260 Blood culture France 1974 De Baere et al., 2003 TRW AY865607 Environmental USA 2004 Elango et al., Isolate 2006 149 EU730922 Water Korea 2008 N\A
Similarity percentages (calculated using the Clustal W program) within 16S rDNA sequences of R. pickettii ranged from 97 to 100%, which shows the high degree of conservation in this sequence. The lowest level of similarity (97%) was found between the USA environmental isolate TRW and the rest of the R. pickettii strains. A phylogenetic tree devised from this analysis is presented in Fig 3.8. The R. pickettii strains divide into four groups with clinical strains in group 1, a mixture of environmental and clinical strains in group 2 and groups 3 and 4 being made up of one environmental isolate each. These findings agree with other reports, which describe a low level of divergence in the 16S rRNA gene, even among distinct species (Clarridge, 2004). Leblond-Bourget et al., (1996) analysed the 16S rDNA sequences of eighteen different species of Bifodobacterium and encountered a similarity level of 92-99%. A mean similarity value of 98.2% was found within the genus Xanthomonas (Hauben et al., 1997).
81 Very few differences in base-pair sequence were found between the 16S rDNA sequences of the twelve R. pickettii strains. The main difference can be seen in Fig 3.9, which was also reported by Vaneechoutte et al., (2004). This is where some strains have a G and C at positions 257 and 266 and the rest have an A and T, the difference does not break down based on environment of isolation. This suggests that there is limited genetic diversity within the species. Major differences were not found between different 16S rRNA sequences of R. pickettii, and therefore it was concluded that this sequence is not a good target for determining genetic differences between R. pickettii isolates based on different environmental and geographic isolation.
Fig 3.8: Phylogenetic Tree based on 16S rDNA gene for twelve strains of R. pickettii. Cluster analysis was based upon the neighbour-joining method. Numbers at branch-points are percentages of 1000 bootstrap resamplings that support the topology of the tree. The scale bar represents 0.001 substitutions per nucleotide position
Fig 3.9: Partial alignment of twelve 16S rDNA gene sequences of R. pickettii (Carried out with GeneDoc)
82 3.4.3.3. Analysis of the 16S rRNA gene to 23S rRNA gene Intergenic Spacer Region of Ralstonia pickettii As the 16S rRNA gene was not a viable option to test the potential genetic diversity of R. pickettii another target was considered. The 16S rRNA gene to 23S rRNA gene Intergenic Spacer Region was chosen as some sequence information was available for genotypic analysis. All of the sequence information available for the intergenic region between the 16S rRNA and 23S rRNA gene of R. pickettii was retrieved from the GenBank database and are presented below in Table 3.10 (Benson et al., 2009). A phylogenetic tree was determined from these sequences and is presented in Fig 3.10. These were then aligned using the Clustal W software program (Higgins et al., 1994) and the data was analysed using the GeneDoc Software program (Nicholas et al., 1997, Fig 3.11) to determine the heterogeneity between the different sequences of the intergenic region. As can be seen from Fig 3.10 there is very little variation between the four sequences with only about seven base pair differences in total (Fig 3.11). Each separate sequence was then inputted in the NEBcutter tool to determine the restriction enzyme digestion pattern for each sequence (Vincze et al., 2003). This allowed us to compare the patterns of two or more sequences of the intergenic region to determine if any differences in the restriction pattern were present. The results demonstrate that there is limited variance from the sequence data available.
Fig 3.10: Phylogenetic tree based on intergenic space between 16S and 23S rRNA gene for four strains of R. pickettii. Cluster analysis was based upon the neighbour-joining method. Numbers at branch-points are percentages of 1000 bootstrap resamplings that support the topology of the tree. The scale bar represents 0.0005 substitutions per nucleotide position.
Table 3.10: Information on 16S-23S rRNA Sequences Deposited in the GenBank Database Strain GenBank Source Location Year Reference Accession (Sequence) Number RP277DL AY847456 Rodents China 2004 N/A RP273DL AY847457 Rodents China 2004 N/A LMG5942 AJ783972 Tracheotomy USA 1972 N/A N/A L28163 N/A USA 1995 Tyler et al., 1995
83
Fig 3.11: Alignment of four Intergenic Sequences of R. pickettii (Carried out with GeneDoc)
3.4.3.4. PCR-Ribotyping Primers 16S F and 23S R (See Section 3.3.2.4.), were used to amplify the Interspacial Region (ISR) of all R. pickettii strains listed in Table 2.8 and the R. insidiosa Type Strain. A PCR product of approximately 870bp was obtained for all strains indicating that the ISR’s of all R. pickettii strains and R. insidiosa are highly similar (Fig 3.12-3.15). This corresponds to the results of the limited experiments carried out by Moissenet et al., (2001); who found that Ralstonia species including R. paucula, R. pickettii (six isolates) and R. solanacearum (three isolates) had similar length ISR’s. These results therefore demonstrate that PCR Ribotyping analysis is a
84 poor method to distinguish between different isolates of R. pickettii, between R. pickettii and R. insidiosa isolates or between R. pickettii and other Ralstonia spp.
Fig 3.12: PCR-Ribotyping of R. pickettii Purchased and Industrial Isolates
1. Marker- 100 bp ladder (New England Biolabs 100-1517bp) 2. R. pickettii JCM5969 (99.00% 1041465 API20NE) (99.94% 400414 Remel) 3. R. pickettii NCTC11159 (95.10% 1041455 API20NE) (99.94% 400414 Remel) 4. R. pickettii DSM6927 (95.10% 1041455 API20NE) (99.94% 400414 Remel) 5. R. pickettii CCUG3318 (91.10% 1041555 API20NE) (99.94% 400414 Remel) 6. R. pickettii CIP73.23 (91.10% 1041555 API20NE) (99.94% 400414 Remel) 7. R. pickettii CCM2846 (00.00% 1055555 API20NE) (99.71% 400616 Remel) 8. R. pickettii CCUG18841 (00.00% 1055555 API20NE) (99.71% 400616 Remel) 9. ULI187 R. pickettii (97.70% 1041565 API20NE) (98.34% 404614 Remel) 10. ULI188 R. pickettii (95.10% 0045445 API20NE) (99.99% 404414 Remel) 11. Marker- 100 bp ladder (New England Biolabs 100-1517bp) 12. ULI798 R. pickettii (95.10% 0045445 API20NE) (99.99% 404414 Remel) 13. ULI807 R. pickettii (84.10% 0045455 API20NE) (99.99% 404414 Remel) 14. ULI171 R. pickettii (84.10% 0045455 API20NE) (99.99% 404414 Remel) 15. ULI821 R. pickettii (84.10% 0045455 API20NE) (99.94% 400414 Remel) 16. ULI800 R. pickettii (80.40% 0245455 API20NE) (99.99% 404414 Remel) 17. ULI169 R. pickettii (80.40% 0245455 API20NE) (99.99% 404414 Remel) 18. ULI165 R. pickettii (67.90% 1045455 API20NE) (99.99% 404414 Remel) 19. ULI174 R. pickettii (67.90% 1045455 API20NE) (98.34% 404614 Remel) 20. Marker- 100 bp ladder (New England Biolabs 100-1517bp
85 Fig 3.13: PCR-Ribotyping of R. pickettii Industrial and Clinical Isolates
1. Marker- Hyper ladder 1 (Bioline 200-10000bp) 2. ULI193 R. pickettii (61.70% 0050577 API20NE) (98.38% 400614 Remel) 3. ULI796 R. pickettii (60.00% 1241455 API20NE) (98.34% 404614 Remel) 4. ULI791 R. pickettii (56.90% 0044455 API20NE) (99.99% 404414 Remel) 5. ULI790 R. pickettii (44.80% 0255455 API20NE) (98.34% 404614 Remel) 6. ULI818 R. pickettii (39.50% 1045555 API20NE) (99.94% 400414 Remel) 7. ULI804 R. pickettii (24.50% 0055455 API20NE) (98.34% 404614 Remel) 8. ULI159 R. pickettii (0.00% 1200004 API20NE) (99.94% 400414 Remel) 9. ULI806 R. pickettii (0.00% 1044444 API20NE) (99.99% 404414 Remel) 10. ULI167 R. pickettii (0.00% 1050555 API20NE) (99.94% 400414 Remel) 11. Marker- Hyper ladder 1 (Bioline 200-10000bp) 12. ULI162 R. pickettii (0.00% 1145455 API20NE) (99.99% 404414 Remel) 13. ULC298 R. pickettii (90.10% 0051574 API20NE) (99.99% 404414 Remel) 14. ULC297 R. pickettii (70.03% 0050557 API20NE) (99.94% 400414 Remel) 15. ULC277 R. pickettii (61.70% 0050577 API20NE) (99.99% 404414 Remel) 16. ULC244 R. pickettii (56.70% 0050555 API20NE) (99.94% 400414 Remel) 17. ULC193 R. pickettii (56.70% 0050555 API20NE) (99.99% 404414 Remel) 18. ULC194 R. pickettii (56.70% 0050555 API20NE) (99.99% 404414 Remel) 19. ULC421 R. pickettii (28.50% 0045455 API20NE) (99.99% 404414 Remel) 20. Marker- Hyper ladder 1 (Bioline 200-10000bp)
86 Fig 3.14: PCR-Ribotyping of R. pickettii Laboratory Water Isolates
1. Marker- Hyper ladder 1 (Bioline 200-10000bp) 2. ULM001 R. pickettii (95.10% 1041455 API20NE) (99.99% 404416 Remel) 3. ULM002 R. pickettii (95.10% 1041455 API20NE) (99.99% 404416 Remel) 4. ULM003 R. pickettii (88.60% 1041457 API20NE) (99.28% 400406 Remel) 5. ULM004 R. pickettii (91.10% 1041555 API20NE) (99.99% 404416 Remel) 6. ULM005 R. pickettii (95.10% 1040455 API20NE) (00.00% 600416 Remel) 7. ULM006 R. pickettii (95.10% 1040455 API20NE) (99.28% 400406 Remel) 8. ULM007 R. pickettii (95.10% 1040455 API20NE) (99.99% 404416 Remel) 9. ULM010 R. pickettii (99.40% 1041575 API20NE) (99.94% 400414 Remel) 10. ULM011 R. pickettii (99.40% 1041575 API20NE) (99.99% 404414 Remel) 11. Marker- Hyper ladder 1 (Bioline 200-10000bp)
Fig 3.15: PCR-Ribotyping of Ralstonia insidiosa Isolates
1. Marker- Hyper ladder 1 (Bioline 200-10000bp) 2. R. insidiosa LMG21421 (61.70% 0050577 API20NE) (99.94% 400414 Remel) 3. R. pickettii (insidiosa) ATCC49129 (92.40% 0040475 API20NE) (99.99% 404414 Remel) 4. ULI797 R. pickettii (insidiosa) (84.10% 0045455 API20NE) (98.34% 404614 Remel) 5. ULI785 R. pickettii (insidiosa) (53.10% 0045457 API20NE) (99.99% 404414 Remel) 6. ULI181 R. pickettii (insidiosa) (39.50% 1045555 API20NE) (99.99% 404414 Remel) 7. ULI794 R. pickettii (insidiosa) (6.40% 1141455 API20NE) (34.18% 400404 Remel) 8. ULI 185 R. pickettii (insidiosa) (5.70% 1251575 API20NE) (98.34% 404614 Remel 9. Marker- Hyper ladder 1 (Bioline 200-10000bp) 10. ULI166 R. pickettii (insidiosa) (0.00% 1054555 API20NE) (99.94% 400414 Remel) 11. ULI819 R. pickettii (insidiosa) (0.00% 1372004 API20NE) (99.99% 404414 Remel) 12. ULI784 R. pickettii (insidiosa) (0.00% 1310000 API20NE) (99.99% 404414 Remel) 13. ULI163 R. pickettii (insidiosa) (0.00% 1245555 API20NE) (98.34% 404614 Remel) 14. ULI795 R. pickettii (insidiosa) (0.00% 1041645 API20NE) (98.34% 406414 Remel) 15. ULM008 R. pickettii (insidiosa) (80.20% 0041455 API20NE) (99.94% 400414 Remel) 16. ULM009 R. pickettii (insidiosa) (80.20% 0041455 API20NE) (99.94% 400414 Remel) 17. Marker- Hyper ladder 1 (Bioline 200-10000bp)
87 3.4.3.5. 16S-23S ISR RFLP Analysis of R. pickettii strains 16S-23S rRNA spacer region PCR products from all fifty-eight strains of R. pickettii (Table 2.8) and the R. insidiosa Type strain LMG21421 were digested with the restriction endonucleases: AluI, HaeIII, TaqI and CfoI. The fifty-eight strains of R. pickettii and the R. insidiosa Type strain LMG21421 showed identical RFLP patterns for AluI with three bands of approximately 410, 220 and 120 (Fig 3.16 and Fig A4-1-3 in Appendix 4). A sample gel of seventeen isolates is presented in Figure 3.16 for the AluI digests. Only three bands adding to approximately 750bp are present; however NEBcutter (Vincze et al., 2003) analysis indicated the presence of two 120bp bands that would not be separated on the gel, leading to the approximately 860bp seen in the 16S-23S rRNA ribotyping of R. pickettii and R. insidiosa strains (Section 3.4.3.5.) In Fig A4-3 the R. insidiosa type strain LMG21421 (Lane 2), ULM008 (Lane 15) and ULM009 (Lane 16), a band appears at approximately 350bp, due to partial digestion of this band as it can be seen that the 220 and 120 are lighter than they are for other isolates. ULI821 (Lane 4) failed to digest. The HaeIII digests demonstrated two different patterns: four bands of 430, 360, 40 and 20bp and three bands of 810 and 60bp; these can be seen in Fig 3.17, Fig 3.18, Fig A4-4 and 5. Fig 3.17 is the sample gel for R. pickettii with seventeen isolates presented. In Fig 3.17 and Fig 3B-5 there is a 60bp that did not digest to give the 40bp and 20bp bands. This partial digest could be due to failure to fully digest. In Fig A4-4 in Appendix 4, CCUG18841 (Lane 7), CCM2846 (Lane 8), ULI188 (Lane 10), ULI807 (Lane 13) and ULI169 (Lane 17), a light band is present this is just due to partial digestion of this band. ULI788 (Lane 15) failed to digest properly. The second HaeIII digest is shown in Fig A4-5 bands of 800 and 60bp were found for the second pattern, eleven of the industrial strains (ULI797, ULI788, ULI785, ULI181, ULI185, ULI166, ULI819, ULI159, ULI806, ULI167, ULI784, ULI163, ULI795), two laboratory water isolates (ULM008, ULM009) and one purchased strain (ATCC49129) were found to have the same pattern as the R. insidiosa Type strain LMG21421. This agreed with the results of the PCR with the species-specific primers. ULI794 has two extra bands at approximately 430 and 360bp similar to the bands of the R. pickettii Type Strain. This was most likely due to contamination of the isolated DNA of ULI794 with another strain of R. pickettii. Fig 3.18 is the sample gel for R. insidiosa with fourteen isolates presented. The fifty-eight strains of R. pickettii and the R. insidiosa Type strain LMG21421 showed identical RFLP patterns for TaqI digest. Four bands of
88 approximately 390, 290, 150 and 50bp are seen for all isolates and are presented in Fig 3.19, Fig A4-6-8. Fig 3.17 is the sample gel for R. pickettii with seventeen isolates presented. The R. insidiosa isolates are presented in Fig A4-8 in Appendix 4. The CfoI digests showed two different patterns two bands approximately of 530 and 350bp were obtained as presented in Fig 3.20, Fig A4-9, 10 and one band of approximately 880bp, as is presented in Fig 3.21. This second banding pattern corresponds to the pattern for the R. insidiosa type strain, LMG21421. Eleven of the industrial strains (ULI797, ULI788, ULI785, ULI181, ULI794, ULI185, ULI166, ULI819, ULI159, ULI806, ULI167, ULI784, ULI163, ULI795), two laboratory water isolates (ULM008, ULM009) and one purchased strain (ATCC49129) were found to have the same pattern. These differing restriction patterns could be used as a means to identify R. insidiosa. The results of the restriction digests for all fifty-eight strains using AluI and TaqI are similar. The results for HaeIII and CfoI of all strains gave two different patterns one that was shared with the Type strain of R. pickettii and one that was shared with the R. insidiosa Type strain. For the two different enzymes the same strains were found to have the same pattern as the R. insidiosa Type Strain. These results also agreed with the results of the PCR with the species-specific primers as the same strains that were found to be R. insidiosa positive with the species-specific primers have the R. insidiosa Type strain pattern with HaeIII and CfoI. The rest of the results for all digests are presented in Appendix 4. The conclusion of this body of work shows that restriction endonuclease digestion using AluI and TaqI gave restriction patterns that are constant for all R. pickettii and R. insidiosa isolates tested. The restriction digestion analysis with HaeIII and CfoI showed different pattern for both the R. pickettii and R. insidiosa isolates so this could be used as a means to tell them apart.
89 Fig 3.16: AluI 1 Digest of 16S-23S ISR of R. pickettii Isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. R. pickettii JCM5969 (99.00% 1041465 API20NE) (99.94% 400414 Remel) 3. R. pickettii NCTC11159 (95.10% 1041455 API20NE) (99.94% 400414 Remel) 4. R. pickettii DSM6927 (95.10% 1041455 API20NE) (99.94% 400414 Remel) 5. R. pickettii CCUG3318 (91.10% 1041555 API20NE) (99.94% 400414 Remel) 6. R. pickettii CIP73.23 (91.10% 1041555 API20NE) (99.94% 400414 Remel) 7. R. pickettii CCM2846 (00.00% 1055555 API20NE) (99.71% 400616 Remel) 8. R. pickettii CCUG18841 (00.00% 1055555 API20NE) (99.71% 400616 Remel) 9. ULI187 R. pickettii (97.70% 1041565 API20NE) (98.34% 404614 Remel) 10. ULI188 R. pickettii (95.10% 0045445 API20NE) (99.99% 404414 Remel) 11. Marker- Hyperladder II (Bioline 50-2000bp) 12. ULI798 R. pickettii (95.10% 0045445 API20NE) (99.99% 404414 Remel) 13. ULI807 R. pickettii (84.10% 0045455 API20NE) (99.99% 404414 Remel) 14. ULI171 R. pickettii (84.10% 0045455 API20NE) (99.99% 404414 Remel) 15. ULI788 R. pickettii (80.40% 0245455 API20NE) (99.94% 400414 Remel) 16. ULI800 R. pickettii (80.40% 0245455 API20NE) (99.99% 404414 Remel) 17. ULI169 R. pickettii (80.40% 0245455 API20NE) (99.99% 404414 Remel) 18. ULI165 R. pickettii (67.90% 1045455 API20NE) (99.99% 404414 Remel) 19. ULI174 R. pickettii (67.90% 1045455 API20NE) (98.34% 404614 Remel) 20. Marker- Hyperladder II (Bioline 50-2000bp)
90 Fig 3.17: HaeIII 2 Digest of 16S-23S ISR of R. pickettii Isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. ULI193 R. pickettii (61.70% 0050577 API20NE) (98.38% 400614 Remel) 3. ULI796 R. pickettii (60.00% 1241455 API20NE) (98.34% 404614 Remel) 4. ULI791 R. pickettii (56.90% 0044455 API20NE) (99.99% 404414 Remel) 5. ULI790 R. pickettii (44.80% 0255455 API20NE) (98.34% 404614 Remel) 6. ULI818 R. pickettii (39.50% 1045555 API20NE) (99.94% 400414 Remel) 7. ULI804 R. pickettii (24.50% 0055455 API20NE) (98.34% 404614 Remel) 8. ULI159 R. pickettii (0.00% 1200004 API20NE) (99.94% 400414 Remel) 9. ULI806 R. pickettii (0.00% 1044444 API20NE) (99.99% 404414 Remel) 10. ULI167 R. pickettii (0.00% 1050555 API20NE) (99.94% 400414 Remel) 11. Marker- Hyperladder II (Bioline 50-2000bp) 12. ULI162 R. pickettii (0.00% 1145455 API20NE) (99.99% 404414 Remel) 13. ULC298 R. pickettii (90.10% 0051574 API20NE) (99.99% 404414 Remel) 14. ULC297 R. pickettii (70.03% 0050557 API20NE) (99.94% 400414 Remel) 15. ULC277 R. pickettii (61.70% 0050577 API20NE) (99.99% 404414 Remel) 16. ULC244 R. pickettii (56.70% 0050555 API20NE) (99.94% 400414 Remel) 17. ULC193 R. pickettii (56.70% 0050555 API20NE) (99.99% 404414 Remel) 18. ULC194 R. pickettii (56.70% 0050555 API20NE) (99.99% 404414 Remel) 19. ULC421 R. pickettii (28.50% 0045455 API20NE) (99.99% 404414 Remel) 20. Marker- Hyperladder II (Bioline 50-2000bp)
91 Fig 3.18: HaeIII 4 Digest of 16S-23S ISR of R. insidiosa Isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. R. insidiosa LMG21421 (61.70% 0050577 API20NE) (99.94% 400414 Remel) 3. R. pickettii (insidiosa) ATCC49129 (92.40% 0040475 API20NE) (99.99% 404414 Remel) 4. ULI821 R. pickettii (insidiosa) (84.10% 0045455 API20NE) (99.94% 400414 Remel) 5. ULI785 R. pickettii (insidiosa) (53.10% 0045457 API20NE) (99.99% 404414 Remel) 6. ULI181 R. pickettii (insidiosa) (39.50% 1045555 API20NE) (99.99% 404414 Remel) 7. ULI794 R. pickettii (insidiosa) (6.40% 1141455 API20NE) (34.18% 400404 Remel) 8. ULI185 R. pickettii (insidiosa) (5.70% 1251575 API20NE) (98.34% 404614 Remel 9. ULI166 R. pickettii (insidiosa) (0.00% 1054555 API20NE) (99.94% 400414 Remel) 10. ULI819 R. pickettii (insidiosa) (0.00% 1372004 API20NE) (99.99% 404414 Remel) 11. ULI784 R. pickettii (insidiosa) (0.00% 1310000 API20NE) (99.99% 404414 Remel) 12. Marker- Hyperladder II (Bioline 50-2000bp) 13. ULI163 R. pickettii (insidiosa) (0.00% 1245555 API20NE) (98.34% 404614 Remel) 14. ULI795 R. pickettii (insidiosa) (0.00% 1041645 API20NE) (98.34% 406414 Remel) 15. ULM008 R. pickettii (insidiosa) (80.20% 0041455 API20NE) (99.94% 400414 Remel) 16. ULM009 R. pickettii (insidiosa) (80.20% 0041455 API20NE) (99.94% 400414 Remel)
92 Fig 3.19: TaqI 1 Digest of 16S-23S ISR of R. pickettii isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. R. pickettii JCM5969 (99.00% 1041465 API20NE) (99.94% 400414 Remel) 3. R. pickettii NCTC11159 (95.10% 1041455 API20NE) (99.94% 400414 Remel) 4. R. pickettii DSM6927 (95.10% 1041455 API20NE) (99.94% 400414 Remel) 5. R. pickettii CCUG3318 (91.10% 1041555 API20NE) (99.94% 400414 Remel) 6. R. pickettii CIP73.23 (91.10% 1041555 API20NE) (99.94% 400414 Remel) 7. R. pickettii CCM2846 (00.00% 1055555 API20NE) (99.71% 400616 Remel) 8. R. pickettii CCUG18841 (00.00% 1055555 API20NE) (99.71% 400616 Remel) 9. ULI187 R. pickettii (97.70% 1041565 API20NE) (98.34% 404614 Remel) 10. ULI188 R. pickettii (95.10% 0045445 API20NE) (99.99% 404414 Remel) 11. Marker- Hyperladder II (Bioline 50-2000bp) 12. ULI798 R. pickettii (95.10% 0045445 API20NE) (99.99% 404414 Remel) 13. ULI807 R. pickettii (84.10% 0045455 API20NE) (99.99% 404414 Remel) 14. ULI171 R. pickettii (84.10% 0045455 API20NE) (99.99% 404414 Remel) 15. ULI788 R. pickettii (80.40% 0245455 API20NE) (99.94% 400414 Remel) 16. ULI800 R. pickettii (80.40% 0245455 API20NE) (99.99% 404414 Remel) 17. ULI169 R. pickettii (80.40% 0245455 API20NE) (99.99% 404414 Remel) 18. ULI165 R. pickettii (67.90% 1045455 API20NE) (99.99% 404414 Remel) 19. ULI174 R. pickettii (67.90% 1045455 API20NE) (98.34% 404614 Remel) 20. Marker- Hyperladder II (Bioline 50-2000bp)
93 Fig 3.20: CfoI 1 Digest of 16S-23S ISR of R. pickettii Isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. R. pickettii JCM5969 (99.00% 1041465 API20NE) (99.94% 400414 Remel) 3. R. pickettii NCTC11159 (95.10% 1041455 API20NE) (99.94% 400414 Remel) 4. R. pickettii DSM6927 (95.10% 1041455 API20NE) (99.94% 400414 Remel) 5. R. pickettii CCUG3318 (91.10% 1041555 API20NE) (99.94% 400414 Remel) 6. R. pickettii CIP73.23 (91.10% 1041555 API20NE) (99.94% 400414 Remel) 7. R. pickettii CCM2846 (00.00% 1055555 API20NE) (99.71% 400616 Remel) 8. R. pickettii CCUG18841 (00.00% 1055555 API20NE) (99.71% 400616 Remel) 9. ULI187 R. pickettii (97.70% 1041565 API20NE) (98.34% 404614 Remel) 10. ULI188 R. pickettii (95.10% 0045445 API20NE) (99.99% 404414 Remel) 11. Marker- Hyperladder II (Bioline 50-2000bp) 12. ULI798 R. pickettii (95.10% 0045445 API20NE) (99.99% 404414 Remel) 13. ULI807 R. pickettii (84.10% 0045455 API20NE) (99.99% 404414 Remel) 14. ULI171 R. pickettii (84.10% 0045455 API20NE) (99.99% 404414 Remel) 15. ULI788 R. pickettii (80.40% 0245455 API20NE) (99.94% 400414 Remel) 16. ULI800 R. pickettii (80.40% 0245455 API20NE) (99.99% 404414 Remel) 17. ULI169 R. pickettii (80.40% 0245455 API20NE) (99.99% 404414 Remel) 18. ULI165 R. pickettii (67.90% 1045455 API20NE) (99.99% 404414 Remel) 19. ULI174 R. pickettii (67.90% 1045455 API20NE) (98.34% 404614 Remel) 20. Marker- Hyperladder II (Bioline 50-2000bp)
94 Fig 3.21: CfoI 4 Digest of 16S-23S ISR of R. insidiosa Isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. R. insidiosa LMG21421 (61.70% 0050577 API20NE) (99.94% 400414 Remel) 3. R. pickettii (insidiosa) ATCC49129 (92.40% 0040475 API20NE) (99.99% 404414 Remel) 4. ULI821 R. pickettii (insidiosa) (84.10% 0045455 API20NE) (99.94% 400414 Remel) 5. ULI785 R. pickettii (insidiosa) (53.10% 0045457 API20NE) (99.99% 404414 Remel) 6. ULI181 R. pickettii (insidiosa) (39.50% 1045555 API20NE) (99.99% 404414 Remel) 7. ULI794 R. pickettii (insidiosa) (6.40% 1141455 API20NE) (34.18% 400404 Remel) 8. ULI185 R. pickettii (insidiosa) (5.70% 1251575 API20NE) (98.34% 404614 Remel 9. ULI166 R. pickettii (insidiosa) (0.00% 1054555 API20NE) (99.94% 400414 Remel) 10. ULI819 R. pickettii (insidiosa) (0.00% 1372004 API20NE) (99.99% 404414 Remel) 11. ULI784 R. pickettii (insidiosa) (0.00% 1310000 API20NE) (99.99% 404414 Remel) 12. Marker- Hyperladder II (Bioline 50-2000bp) 13. ULI163 R. pickettii (insidiosa) (0.00% 1245555 API20NE) (98.34% 404614 Remel) 14. ULI795 R. pickettii (insidiosa) (0.00% 1041645 API20NE) (98.34% 406414 Remel) 15. ULM008 R. pickettii (insidiosa) (80.20% 0041455 API20NE) (99.94% 400414 Remel) 16. ULM009 R. pickettii (insidiosa) (80.20% 0041455 API20NE) (99.94% 400414 Remel) 17. Marker- Hyperladder II (Bioline 50-2000bp)
95 3.4.3.6. 16S-23S ISR Sequence Analysis The sequence of the 16S-23S ISR of nineteen randomly selected strains of the R. pickettii, and the Type strain of R. insidiosa LMG21421, were analysed. The sequence of several strains, ULI821, ULI819, ULI795, ULI785, ULI185, ATCC49129, indicated that these were more closely related to the sequenced R. insidiosa Type strain than to R. pickettii, sharing greater homology with the R. insidiosa type strain, confirming the results of the species specific PCR reaction. The results of a detailed alignment of all strains are presented in Appendix 5. The 16S-23S rRNA spacer region comprised a length of 513bp for R. pickettii and 515bp for R. insidiosa. This agreed with the results of the PCR reaction as no length polymorphisms could be observed. The sequence percentage similarity for the R. pickettii strains to the R. pickettii Type strain LMG5942 ranged from 98-100% and the percentage similarity for all R. insidiosa strains to the R. pickettii Type strain was 95%. The percentage similarity values for all the individual strains are presented in Table 3.11. Both had a %GC content of approximately 52.5%. This spacer region of all strains also contains two tRNA genes: tRNAIle and tRNAAla comprising 77 and 78bp respectively. This is a common feature of the ISR in rrn operons in Gram-Negative bacteria (Gürtler and Stanisich, 1996) and was as reported previously for four R. pickettii (Tyler et al., 1995). The 16S-23S ISR sequenced in this study were positioned in the following order: 16S rRNA – tRNAIle – tRNAAla –23S rRNA. The nucleotide sequences of tRNAIle were identical in all strains and the tRNAAla gene differed by only one nucleotide between R. pickettii and R. insidiosa in the strains studied.
96 Table 3.11: % Nucleotide Similarity of Sequenced 16S-23S ISR Strains with R. pickettii LMG5942 Strain % Similarity with LMG5942 JCM5969 100 12J 99 12D 99 RP277DL 99 RP273DL 99 ULC193 100 ULC194 100 ULC244 100 ULC421 100 ULM001 99 ULM004 98 ULM005 100 ULM006 99 ULI187 100 ULI174 100 ULI798 98 CCUG18841 98 ATCC49129 95 LMG521421 95 ULI819 95 ULI185 95 ULI821 95 ULI785 95 ULI795 95
3.4.3.7. Phylogenetic Analysis of the 16S-23S rRNA spacer region The phylogenetic analysis of the 16S-23S rRNA spacer region is presented in Fig 3.22. This analysis supports the positioning of R. pickettii and R. insidiosa as two separate groups (bootstrap values of 95%), with B. cepacia as an out-group. The strains identified as R. pickettii themselves divide into two different groups (bootstrap value of 99%). The division into groups did not correlate to clinical or environmental association or indeed to their isolation location.
97
Fig 3.22: Phylogenetic tree of R. pickettii 16S-23S ISR of nineteen sequenced strains and sequence data available on the GenBank database. Cluster analysis was based upon the neighbour-joining method. Numbers at branch-points are percentages of 1000 bootstrap resamplings that support the topology of the tree. The scale bar represents 0.005 substitutions per nucleotide position.
3.4.3.8. fliC gene Sequence Analysis Sequencing was carried out on the fliC gene of sixteen (of the strains listed in Table 2.8) randomly selected strains of R. pickettii, and the Type strains of both R. pickettii and R. insidiosa. This was chosen as sequence information was available for this gene at the time of the study. The strains that were sequenced divided into three different groups. One grouping was made up of R. pickettii strains with 97-100% similarity to the R. pickettii Type strain, one group of R. insidiosa strains with 85%
98 similarity to the R. pickettii Type strain and one group that was a mixture of both with 86-87% similarity to the R. pickettii Type strain. The third group was made up of two soil isolates from Senegal and two industrial purified water isolates (ULI796, ULI818). This indicates that the fliC gene is not useful for distinguishing between the two species. The fliC gene of the two R. pickettii strains that have been sequenced, 12J and 12D (100% similarity), make another group with 87% similarity to the R. pickettii type strain, 84% the R. insidiosa Type strain and 85% similarity to the soil strain CCM2846. The percentage similarity values for all the individual strains to the Type strain can be seen in Table 3.12.
Table 3.12: % Nucleotide Similarity of Sequenced fliC gene Strains with R. pickettii DSM6297
Strain % Similarity with DSM6297 JCM5969 100 ULC244 99 ULC421 99 LMG21421 85 ULM001 99 ULM004 97 ULM008 85 ULM011 99 ULI159 99 ULI162 99 ULI174 99 ULI185 85 ULI187 99 ULI791 99 ULI818 86 ULI795 86 LMG5942 99 CCM2846 87 LMG6871 87 LMG7001 99 12J 87 12D 87
3.4.3.9. Phylogenetic Analysis of the fliC gene The phylogenetic analysis of the fliC genes are presented in Fig 3.23, with the strains divided into two branches with B. cepacia as an out-group. Group 1 is made up of R. pickettii strains from clinical and environmental sources. Group 2 is made up of R. insidiosa; Group 3 is made up of both R. insidiosa and R. pickettii and Group 4 is made up of the available fliC genome sequences of the fully sequenced R. pickettii strains.
99 The strains identified as R. insidiosa in group two grouped together with groups three and four. The division of the groups did not correlate to clinical or environmental association or to their isolation location.
Fig 3.23: Phylogenetic tree of R. pickettii fliC genes of nineteen sequenced strains and the two sequence data available on the GenBank database. Cluster analysis was based upon the neighbour-joining method. Numbers at branch-points are percentages of 1000 bootstrap resamplings that support the topology of the tree. The scale bar represents 0.1 substitutions per nucleotide position.
100
3.4.3.10. RAPD PCR Results and Analysis Random Amplified Polymorphic DNA analysis was carried out using four different primers three of which (P3, P15 and M13, Table 3.2) have been shown to work on closely related Ralstonia spp. including R. mannitolilytica and R. paucula (Moissenet et al., 1999; Daxboeck et al., 2005). The reproducibility of the RAPD method was tested by repeating the RAPD assays at least three times for each primer used. The results revealed that apart from some variations in the band intensity, no significant differences were observed between the profiles obtained. This confirmed the reproducibility of the method. Fifty-eight strains of R. pickettii plus the Ralstonia insidiosa type strain were characterised by RAPD analysis using all four primers (P3, P15, OPA3OU and M13, Table 3.2). Percentage similarities based on the Pearson correlation coefficients and clustering by the UPGMA method using BioNumerics software (Applied Maths), for these strains are presented in Fig 3.24 (M13), 3.25 (OPA3OU), 3.26 (P3) and 3.27 (P15). Fragments ranged from approximately 100 to 1800bp for all primers. The Pearson correlation coefficient generated for the strains analysed varied from approximately 98 to 30% for primer M13 (Fig 3.24), 99 to 46% for primer OPA3OU (Fig 3.25), 99 to 43% for primer P3 (Fig 3.26) and 99 to 39% for primer P15 (Fig 3.27). Clusters were distinguished at a similarity cut-off level of 80%. Using the M13 primer (Fig 3.24) twenty-one separate groups were present with each group possessing a separate banding pattern. With primer OPA3OU (Fig 3.25) fifteen different groups were found at a cut-off level of 80%. With primers P3 (Fig 3.26) and P15 (Fig 3.27) twenty- five and twenty-one groups were found. The numbers of groups determined for all primers can be seen in Table 3.13. Table 3.15 and 3.16 list the names given to each group for each primer and the strains that fall into each of these groups.
Table 3.13: No. of Groupings with Four Different RAPD Primers RAPD Primer No. of Groupings M13 21 OPA3OU 15 P3 25 P15 21
The number of strains for each of the groups varied from groups made up of a single strain like groups T and U (ULM002 and ULI185 respectively) with primer M13,
101 groups XXIV and XXV (ULI165 and ULI797 respectively) with primer P3 to groups such as with primer P15 where there is one large group, group 13, that contains twenty- eight strains including all the Type strains, the soil strains, ten of laboratory water purified isolates and the industrial water isolates. No other primer produced such a large group. No major correlation existed between the strains that comprised the different groups for each of the primers i.e. the same strains were not found in the same groups for different primers. No major differentiation between the clinical, industrial, laboratory purified water and type strains could be observed as these all fell into separate groups (Table 3.15 and Table 3.16) with each primer. The clinical strains grouped together with two of the primers, with M13 they clustered together in Genotype A with the type strain JCM5969, three laboratory water strains and three industrial water strains tested, with primer P3 they clustered together in Genotype X with nine of the industrial water strains (including the industrial strains that grouped together with the clinical strains in Genotype A with the M13 primer), with primers P15 and OPA30U they fell into several clusters six with P15. The industrial purified water strains also fell into different groups with all four primers, nine groups with primer P15, thirteen groups with primer M13, fifteen groups with primer P3 and eleven groups with primer OPA3OU. The laboratory purified water strains fell into two different groups with primer P15, six groups with primer M13, five groups with primer P3 and three groups with primer OPA3OU. The strains identified as R. insidiosa failed to group together with any of the RAPD primers. The diversity of the bacterial populations studied was calculated using Simpson's Discriminatory Index (Di) (Hunter and Gaston, 1988) and the results of each individual primer are presented in Table 3.14. The average diversity for the four primers was 0.869. These values demonstrate that there is limited diversity in the R. pickettii and R. insidiosa.
Table 3.14: Simpson's Discriminatory Index for Ralstonia pickettii with Four Different RAPD Primers RAPD Primer Discrimination index M13 0.897 OPA3OU 0.899 P3 0.918 P15 0.771
102
Fig 3.24: RAPD primer M13. Dendrogram of fifty-nine strains of R. pickettii by the Pearson correlation using the UPGMA linkage method
103
Fig 3.25: RAPD primer OPA3OU. Dendrogram of fifty-nine strains of R. pickettii by the Pearson correlation using the UPGMA linkage method
104
Fig 3.26: RAPD primer P3. Dendrogram of fifty-nine strains of R. pickettii by the Pearson correlation using the UPGMA linkage method
105
Fig 3.27: RAPD primer P15. Dendrogram of fifty-nine strains of R. pickettii by the Pearson correlation using the UPGMA linkage method
106 3.4.3.11. BOX-PCR Results and Analysis Fifty-eight strains of R. pickettii plus the Ralstonia insidiosa Type strain were characterised by the BOX-PCR analysis using the BOX-A1R primer. The reproducibility of the BOX method was tested by repeating the BOX assay three times. The results revealed that while there were some variations in the band intensity, no significant differences were observed between the profiles obtained. This confirmed the reproducibility of the method. Percent similarities based on the Pearson correlation coefficients and clustering by the UPGMA method using BioNumerics software (Applied Maths), for these strains are presented in Fig 3.28. Clusters were distinguished at a similarity cut-off level of 80%. Fragments ranged from approximately 300 to 3000bp for all primers. With the BOX primer eighteen groups were found at this cut-off level. The groups can be seen in Table 3.15 and Table 3.16. The groups, in contrast to the RAPD primers, mostly contained bacteria isolated from the same environment e.g. Group F clustered all the Type strains together, Group M the soil strains and groups K, L and P the clinical strains. The industrial strains grouped together in-group A, B, C, D, E, G and J. The laboratory water isolates grouped together in groups N, O, Q and R. As with all four RAPD primers the strains identified as R. insidiosa failed to group together. The Di (Simpson’s Discriminatory Index) using BOX-A1R was 0.915. This value demonstrates that there is limited diversity in the R. pickettii and R. insidiosa. Based on a thorough literature search this is thought to be the first study of the diversity of R. pickettii carried out with using BOX analysis; however previous studies have been carried out with BOX analysis on the closely related bacterium R. solanacearum (Smith et al., 1995).
107
Fig 3.28: BOX-PCR. Dendrogram of fifty-nine strains of R. pickettii by the Pearson correlation using the UPGMA linkage method
108
Table 3.15: Clusters of Strains of R. pickettii Isolates Based on Genotypic Fingerprinting Strains RAPD BOX M13 OPA3OU P3 P15 BOX-A1R JCM5969 A e VIII 13 F NCTC11149 D a IX 13 F DSM6297 D e XX 13 F CCUG3318 D a XIX 13 F CIP73.23 D n XX 13 F CCUG18841 L k VI 13 L CCM 846 L k VI 13 L ULI187 I e VII 13 G ULI188 M k VII 13 G ULI798 K k VII 13 H ULI807 K k XIX 13 F ULI171 I c VI 13 G ULI788 J f XIV 13 J ULI800 I e XXIII 13 A ULI169 K k VI 13 A ULI165 N e XXIV 13 D ULI174 A e XIX 13 A ULI193 A e X 6 A ULI796 H e X 6 A ULI801 A a X 6 A ULI791 B j XI 19 A ULI790 H m X 10 B ULI818 H k X 9 B ULI804 B a XI 19 B ULI159 F c X 8 B ULI806 A a X 7 A ULI167 H k X 9 A ULI162 A e X 6 C ULC298 A b X 5 K ULC297 A e X 2 K ULC277 A b X 1 K ULC244 A e X 3 L ULC193 A a X 4 K ULC194 A a X 3 L ULC421 A a XVI 15 P ULM001 P h III 14 R ULM002 T h XVI 13 Q ULM003 R h XVI 13 ULM004 S h XVIII 13 Q ULM005 A e XVII 13 O ULM006 Q h XVII 13 N ULM007 R h XVI 13 N ULM010 A g XVI 13 N ULM011 A g XXII 13 N
109 Table 3.16: Clusters of Strains of R. insidiosa Isolates Based on Genotypic Fingerprinting Strains RAPD BOX M13 OPA3OU P3 P15 BOX-A1R ATCC49129 B b III 14 H LMG21421 E d XVII 13 H ULI821 E d XV 18 E ULI797 O e XXV 13 E ULI785 H l XXI 13 B ULI181 B f II 14 B ULI794 G f II 14 B ULI185 U o IV 12 B ULI166 B f I 17 B ULI819 C i V 21 B ULI784 H e V 17 A ULI163 B j VI 11 D ULI795 B f I 20 A ULM008 E e XII 16 N ULM009 E d XII 16 N
110 3.5. Discussion
3.5.1. Water Testing Bacteria isolated in our laboratory from MilliQ water are listed in Table 3.3, they include ULM007-ULM011. Many are persistent isolates in HPW/UPW and in purified water. The isolation of bacterial species from HPW is a concern for both the molecular biology community and for industrial applications. The presence of Ralstonia pickettii is of particular importance as this organism is found in many purified water systems through out the world (Adley, personnel communication). This organism has been found in many different environments including water, soil and clinical situations (Ryan et al., 2006; Gilligan et al., 2003). The detection of Stenotrophomonas maltophilia in three separate water samples is consistent with reports from other laboratories. It is found in a variety of environments and geographical regions as well as inside and outside hospitals. It has been isolated from water, soil, plants and oil (Gilligan et al., 2003). This opportunistic microorganism is often highly resistant to routinely tested antibiotics. Increasing numbers of this microorganism are isolated in specimens from patients with nosocomial infections (Denton and Kerr, 1998). Pseudomonas luteola (CDC group Ve-1) is a Gram-Negative, non-sporing, non-motile rod, producing non-diffusible yellow pigment; a saprophyte or a commensal of human and other warm-blooded animals. Human infections are rare; victims include immunocompromised as well as apparently immunocompetent individuals, some having a foreign body in situ e.g. a catheter. It has been identified from human clinical specimens (Anzai et al., 1997). P. luteola is not a persistent contaminant of HPW and is occasionally detected by traditional culture techniques. Sphingomonas paucimobilis was found in three separate water samples, it is a yellow-pigmented, nonfermenting, Gram-Negative bacillus that has a single polar flagellum with slow motility (Yabuuchi et al., 1990). This organism is widely distributed in the natural environment (especially water and soil), is a persistant contaminate of purified water (Penna et al., 2002) and has been implicated in a variety of community-acquired and nosocomial infections, including bacteremia, catheter- related sepsis, meningitis, peritonitis, cutaneous infections, visceral abscesses, and positive urinary tract infections, adenitis, and diarrheal disease (Hsueh et al., 1998). Bacillus cereus was isolated in one sample; it is most frequently isolated bacterial foodborne pathogen (Ehling-Schulz et al., 2005; Lindbäck et al., 2006). Growth of B cereus, results in production of several highly active toxins therefore
111 consumption of food containing >106 bacteria per gram may results in emetic and diarrhoeal syndromes. The most common source of this bacterium is liquid, milk powder, mixed food products and is of particular concern in the baby formula industry (Arshak et al., 2007). It has been isolated from: rice, meat, eggs and pasta (Lindbäck et al., 2006). It is rare that B. cereus is detected in HPW but personnel communications with industrial sources have stated that this can be isolated from industrial purified water (Adley, personal communications). All the bacteria except Bacillus cereus are found in the α, β and γ Proteobacteria classes. This is as expected as bacteria from these classes have large metabolic repertoires that could enable them to survive in the nutrient-limited conditions of purified water. All the strains isolated from purified water were tested to determine if they were oligotrophic. The results of these tests are presented in Table 3.4. Oligotrophs are those bacteria that grow on anything less than 1:10 strength media. As can be seen all the Gram-Negative strains were facultatively oligotrophic with their ability to grow on both full strength and diluted R2A, while the Gram- Positive Bacillus cereus was not. The results of the polymer testing are presented in Table 3.5. The hypothesis was that the water-borne bacteria were taking nutrients from the polymers in the plastic water piping in order to survive. Previous studies have shown that specialised bacteria such as Pseudomonas sp. and Streptomyces sp. can degrade polymeric substances such as polypropylene, that make up the piping in purified water systems (Cacciari et al., 1993). Our analysis of seventeen strains of R. pickettii and one strain of Sphingomonas paucimobilis tested in order to determine if the three polymeric compounds could be used as a nutrient source. No growth was found with any of the strains tested. This indicated that the three polymers are not utilised as a carbon source under the conditions tested.
3.5.2. Biotyping and Ralstonia insidiosa identification All strains including, the R. insidiosa type strain, were identified as R. pickettii using the Vitek Nonfermenter Card (NFC). This card has previously been shown to identify R. pickettii well (100%), however the study group was limited to four isolates (van Pelt et al., 1999). According to Coenye et al., (2003a) with the API 20NE system, the R. insidiosa strains (thirteen strains altogether) they tested were identified as Achromobacter xylosoxidans (‘good identification’, profile 1040477) or R. pickettii (‘good identification’, profile 5240477 or ‘low discrimination’, profile 1240575)
112 (Coenye et al., 2003a). The API results of the strains from this study differed from these previous experiments, as no single biochemical pattern could be identified for the isolates that were shown to be R. insidiosa by PCR. Using primers Rp-F1, Rp-R1 and R38R1 the purchased clinical strain (ATCC49129) and the R. insidiosa Type strain were both identified as R. insidiosa (ATCC49129 at 92.40% ‘good identification’ profile 0040475 and LMG21421 at 61.70% ‘low discrimination’ profile 0050577). Of the eleven industrial isolates identified as R. insidiosa using the PCR method, using the API system three organisms were identified as R. pickettii (84.10%, 84.10% and 53.10%), two were identified as Pseudomonas aeruginosa (93.80% and 98.40%), two were identified as Ochrobactrum anthropi (93.90% and 69.10%), one was identified as Pseudomonas putida (65.70%), one was identified as P. fluorescens (52.70%) and two were unidentifiable (Table 3.6). The two laboratory water isolates ULM008 and ULM009 that were shown to be R. insidiosa were both identified as R. pickettii at 80.20%. These results also disagreed with those of Van der Beek et al., (2005) where with the API 20NE; two isolates were identified as A. xylosoxidans at 76.4% (‘low discrimination’ profile 0040477). When testing with the RapID NF Plus system Coenye et al, (2003a) gave all R. insidiosa strains as Shewanella putrefaciens (‘adequate identification’, profile 430616 or ‘questionable identification’, profile 434616). The results obtained with the RapID NF Plus system in these experiments were all R. pickettii (‘Satisfactory’ profile 404614/400416/404416 or ‘implicit’ profile 404414 or 400414) except for ULI794 (‘Inadequate’ profile 400404), which was identified as Moraxella osloensis at 46.80%, R. pickettii at 34.18% and Moraxella lincollnii at 19.02% and ULM005 (‘Satisfactory’ profile 600416) which was identified as Comamonas acidovorans at 99.00%. Glass and Popovic (2005) carried similar testing for Burkholderia mallei and Burkholderia pseudomallei for both the API 20NE and the RapID NF Plus. These results verified the previously published results that R. pickettii is more accurately identified by the Remel RapID NF Plus system in comparison with the API 20NE (Adley and Saieb, 2005b). According to Vaneechoutte et al. (2004) nitrate reduction is negative for R. insidiosa, however it was found that ULI185, ULI166, ULI819, ULI159, ULI 806, ULI167, ULI784, ULI163, ULI795 are all nitrate positive according to the API 20NE. These results contradicted those of the individual nitrate reduction tests, in these tests; ULI797, ULI785 and ULI795 were shown to be nitrate reduction positive, all the rest were negative. According to Vaneechoutte et al., (2004) nitrate reduction is positive for R. pickettii; however in both the API 20NE and Nitrate Reduction Broth test many
113 isolates appeared to be nitrate reduction negative (Table 3.6). The API 20NE of the R. pickettii isolates again demonstrated differences between the API 20NE and the nitrate reduction test. This can be clearly seen in the clinical isolates, which are all nitrate reduction-negative according to the API 20NE but are all positive according to the nitrate reduction (NT) broth test. Daxboeck et al., (2005) demonstrated similar results, where different isolates of R. mannitolilytica were shown to have conflicting nitrate reduction results with both the API 20NE and individual Nitrate Reduction test. This shows that nitrate reduction test results are variable for R. pickettii, R. insidiosa and R. mannitolilytica and therefore they cannot be used in species differentiation. These results indicate that although biochemical test kits offer an easy way to identify bacteria, individual biochemical culture techniques are still superior. The results of the desferrioxamine susceptibility testing for R. pickettii are in contrast to those of Laffineur et al., (2002) who found that out of twenty-two isolates of R. pickettii tested, all were susceptible to desferrioxamine. These results indicate that susceptibility to desferrioxamine cannot be used to differentiate between R. pickettii and R. insidiosa as a quarter of the R. pickettii strains tested in this study were resistant (eleven out of forty-four). This is the first demonstration of R. insidiosa in both industrial and laboratory HPW system. Pili and flagella are responsible for bacterial motility and there are three main types of bacterial motility: swimming, swarming, and twitching. The first two types are sustained by flagella, whereas the latter is sustained by type IV pili. Swimming is due to the polar flagella and occurs when the bacterium, also defined as planktonic, is free to move in a fluid. When, instead, the bacterium is confined in a thin fluid layer on a surface, it becomes hyperflagellated and elongated, and moves in the coordinated manner known as swarming (Fraser and Hughes, 1999; Rashid and Kornberg, 2000). Twitching, which is mediated by pilus retraction and extension, occurs when bacteria grow on a solid surface, and is required for infectivity and biofilm formation in P. aeruginosa (Beatson et al., 2002; Overhage et al., 2008). Poor motility was found for all R. pickettii and R. insidiosa strains. This was unexpected as previous reports all indicated that Ralstonia pickettii is a very motile bacterium (Vaneechoutte et al., 2004) and the close relative Ralstonia solanacearum have been found to have good motility (Liu et al., 2001). These results could potentially be due to long-term storage of the strains. A study carried by Vaneechoutte et al., (2001) found that three clinical R. mannitolytica strains were motile by a single polar flagellum, while in our study motility was not observed for the R. mannitolytica type
114 strain LMG6866. They observed that freshly isolated strains were very motile and that this motility decreased upon prolonged preservation and subculture. Elastase was so named because of its ability to degrade elastin and is very important in lung infections in cystic fibrosis (Döring et al., 1985). It can also function as a proteolytic enzyme with elastase displaying four times the activity toward casein as opposed to trypsin and about ten times the proteolytic activity of the alkaline proteinase from Pseudomonas (Morihara et al., 1965). The qualitative assay for elastase yielded results that indicated that Ralstonia pickettii does not produce elastase. α-Haemolysin is a major virulence factor for some pathogenic bacteria involved in diseases (Cavalieri et al., 1994). α-Haemolysin owes its name to the fact that it causes haemolysis, or lysis of red blood cells, and this is indeed the basis for its most commonly used assay. (The prefix α, that is often omitted nowadays, indicated originally the extracellular form of the toxin). In spite of its name, α-haemolysin is widely believed to act mainly by attacking the immune system cells of the host, usually without inducing cell lysis, yet severely impairing their function (Coote, 1996). The results of this study indicated that all R. pickettii strains tested posses α-Haemolysin activity. The results of the antibiotyping of R. insidiosa from this study agree with the results of a previous study carried out on two isolates of R. insidiosa that infected two immunocompromised individuals in Belgium (Van der Beek et al., 2005). The isolates from this study generally demonstrated susceptibility to Cefotaxime, Ciprofloxacin, Ofloxacin, Sulphamethoxazole-Trimethoprim, Mezlocillin and Cefepime and were in general resistant to Gentamicin, Tobramycin, Tetracycline, Ticarcillin and Chloramphenicol. These results generally agree with the susceptibility patterns of R. pickettii reported in the literature as can be seen in Table 1.5 except in relation to Tetracycline which R. pickettii is shown to be susceptible to and the R. insidiosa is shown to be resistant. Correct identification of Ralstonia species is important because misidentification can compromise infection control measures. It has to be noted that the three commercially available identification systems tested in this study were not updated to identify R. insidiosa. However, given that the biochemical profile of R. insidiosa is most similar to that of R. pickettii, none of the three commercial biochemical test methods gave a clearly better performance in identifying the two bacteria apart. The performance of additional biochemical tests could not clearly define a difference between the two bacteria. The PCR assay for identification of the two
115 organisms described by Coenye et al., (2002a, 2003a) is the only easily applicable means to differentiate between the two bacteria species. Therefore, identification of Ralstonia species based on conventional methods should always be confirmed with molecular (PCR-based) assays.
3.5.3. PCR-Ribotyping, 16S-23S ISR and fliC RFLP and ISR and fliC Sequence Analysis The 16S-23S ISR has been used for bacterial strain differentiation in multiple studies such as for Staphylococcus aureus (Gürtler and Barrie, 1995) and Leuconostoc oenos (Zavaleta et al., 1996). For example, a study of the ISR from twenty-nine bifidobacterial strains has revealed an overall intraspecific sequence divergence of <6% (the maximum level was 12.7%), indicating that the evolutionary rate of the 16S-23S rDNA spacer is much greater than that of the 16S rDNA (Leblond-Bourget et al., 1996). Primers 16SF and 23SR (Kostman et al., 1992) were used in this study to amplify the ISR of fifty-nine R. pickettii and R. insidiosa strains and one strain of R. mannitolilytica. A PCR product of approximately 860bp was obtained for all strains indicating that the ISR’s of all R. pickettii strains and R. insidiosa are highly similar (Fig 3.12-3.15). This corresponds to the results of experiments carried out by Moissenet et al., (2001); who found that several (at the time) Ralstonia species including R. paucula, R. pickettii, and R. solanacearum had similar length ISR’s that were indistinguishable on an agarose gel due to length polymorphisms. The RFLP patterns of the ISR sequence were identical for all R. pickettii strains and differed with respect to HaeIII and CfoI for all R. insidiosa strains (Fig 3.16- 3.18, Appendix 4). Examination of the newly released whole genome sequence of R. pickettii 12J from the JGI (Joint Genome Institute) in late 2007 has revealed the presence of three copies of the 16S-23S rRNA spacer region, two on chromosome one (NC_010682) and the other on chromosome two (NC_010678). These are all the same length and have the exact same sequence. They are 99% similar to the other ISR’s sequenced in this study. The fliC gene has been used for bacterial strain differentiation in multiple studies such as Ralstonia solanacearum (Schönfeld et al., 2003) and Burkholderia cepacia complex (Winstanley, 2003). Four different types of flagellin gene have been found in R. pickettii strains analysed in this study. In P. aeruginosa two different types have been found (Spangenberg et al., 1996) and the Burkholderia cepacia complex where two different types of flagellin have also been found (Hales et al., 1998; Seo and
116 Tsuchiya, 2005). No similarities could be detected between the differences in the gene sequence of the isolates and differences in the phenotypic usage patterns. 3.5.4. Genotypic Fingerprinting Genotypic methods, such as PFGE, are an important tool for the characterisation and identification of bacterial strains, like R. pickettii (Chetoui et al., 1997; Pasticci et al., 2005). The result from genomic DNA analysis using PFGE with SpeI revealed eight groups at a cut-off level of more than 80% correlation using sources of R. pickettii (twenty-seven strains in total, Adley and Saieb, unpublished data). However Chetoui et al., (1997) found nine groups of twenty-six strains of R. pickettii isolated from different sources (bloodstream, saline solution, pleural fluid, respiratory, catheter, water, sputum, and throat). In a previous study with sixteen strains of R. pickettii eight different RAPD profiles were found. These strains had been isolated from blood culture, distilled water and an aqueous chlorhexidine solution (Maroye et al., 2000). Another study in 2002, with fourteen strains of R. pickettii from various biological samples, presented the same pattern in all instances (Boutros et al., 2002). Pasticci et al., (2005) carried out a study involving fifteen strains of R. pickettii that gave three patterns. Only two strains fell into the same group with all four RAPD primers, the BOX primer and the same Biotype, the soil strains CCUG18841 and CCM2846. The Simpson’s Discriminatory Index was calculated as 0.869 for the RAPD primers and 0.915 for the BOX primer. An index of 0.90 or greater is a desirable property of a typing scheme (Hunter and Gaston, 1988). These values indicate that there is limited diversity in R. pickettii and R. insidiosa. These results indicate that there is some diversity in the studied populations but this is limited; this could potentially be due to the numbers of strains (six to ten strains) tested in these studies. In this study fifty-nine strains from different environments were looked at to overcome this drawback. Numerous groupings were found with all four primers indicting that there is greater diversity than anticipated when looking at the previous studies. BOX-PCR has been carried out on bacterial species such as Stenotrophomonas maltophilia. In a study carried out by Berg et al., (1999), forty strains of this bacterium from various clinical and environmental sources under went BOX-PCR analysis and five major groupings were found that clustered together at a similarity level of 90%. BOX-PCR has not been previously carried out on R. pickettii and R. insidiosa. A combined dendrogram of our results from four RAPD primers and the BOX primer are
117 presented in Fig 3.29. The results mirrored those of the individual primers with twenty- seven groups and no background based on environment or location of isolation. The conclusion drawn from the genotyping results for 16S-23S ISR and fliC gene sequencing, BOX-PCR and RAPD-PCR demonstrate that while there is some diversity in Ralstonia pickettii, it is rather limited. While the RFLP and the sequencing of the 16S-23S ISR indicated that the results of the species-specific PCR were correct, it also indicated that there is not much diversity within the Ralstonia pickettii species itself. Some of the strains were selected for sequencing and the results of the RFLP were confirmed. Following on this a whole genome approach was undertaken to determine the diversity of Ralstonia pickettii using two different systems (RAPD and BOX-PCR) to establish the state of diversity in Ralstonia pickettii. These techniques indicated that there is a limited diversity in Ralstonia pickettii and the diversity that there is does not appear to be based on the environment of isolation.
118
Fig 3.29: Dendrogram of comparison of all methods using fifty-nine strains of R. pickettii by the Pearson correlation using the UPGMA linkage method
119
Chapter 4: Discovery and Characterisation of Mobile Elements in Ralstonia pickettii
4.1. Summary
This chapter focuses on the analysis to determine the variety of mobile genetic elements in Ralstonia pickettii. Plasmid purifications were carried to determine the plasmid profiles of all strains. No extrachromosomal DNA was detected. A PCR testing programme was carried out on all strains to see if any integrase genes could be found for Integrating and Conjugative elements. Three strains were found positive for Tn4371, an element that had been previously sequenced. These isolates characterised through PCR and sequencing. An incomplete map of the element was created for the element found in ULM001 and a circular intermediate was also detected. Following this a search of the GenBank database found ten elements in several different bacterial genomes that had been unannotated. These elements were bioinformatically characterised and a common core scaffold region shared between all the elements was deduced. A naming system was also devised for the Tn4371 family of elements.
4.2. Introduction
Ralstonia pickettii can survive in a large variety of different environments. This ability to survive could be due to fitness genes present in mobile genetic elements. A large number of bacterial transferable elements, such as prophages, conjugative elements or mobilisable elements and plasmids are involved in horizontal gene transfer that could potentially bestow on R. pickettii the genes to survive in different environments including purified water. Examples of this can be seen with the CTX prophage that carries the cholera toxin genes of epidemic Vibrio cholerae (Waldor and Mekalanos, 1996); cyanophages in photosynthetic marine blue-green bacteria carry genes involved in photosynthesis as well as other genes that help their host bacteria to survive the relatively nutrient-poor conditions of the ocean (Paul and Sullivan, 2005). Plasmids have also been shown to help form and maintain biofilms by the use of their conjugative pilus to aid attachment to surfaces or other bacterial cells (Ghigo, 2001). Mobilisable elements such as Salmonella genomic island 1 (SPI-1) that carries antibiotic resistance genes (Doublet et al., 2005); ICE\CTns (Integrating and Conjugative Elements\ Conjugative Transposons) such as ICEMlSymR7A (a symbiosis island) that allows Mesorhizobium loti to survive in new environmental niches and the element related to the clc/ICEHin1056\PAP1 family of ICE’s from Pseudomonas fluorescens PfO-1 that contains genes that help the organism form and maintain biofilm (Mohd-Zain et al., 2004). ICE’s are a class of element that contains members that excise
121 by site-specific recombination into a circular form, self transfer by conjugation and integrate into the host genome, whatever the specificity and the mechanism of integration and conjugation (Burrus et al., 2002). Sequences and genes involved in a specific function for propagation (e.g. encapsidation, recombination, conjugation) of these elements are normally found in functional modules (Toussaint and Merlin, 2002). Conjugative elements carry modules involved in their own conjugative transfer. Mobilisable elements carry a module that includes an origin of transfer and one or two mobilisation genes, but they use the mating apparatus provided by conjugative elements to transfer (Smith et al., 1998). Some conjugative elements are maintained in their host by integration in either a unique site, in few sites or in a large array of sites (Burrus et al., 2002; Churchward, 2002). They could be considered as site-specific integrative elements and/or transposable elements. Various elements that excise by site-specific recombination, self-transfer the resulting circular form by conjugation and integrate by recombination between a specific site of this circular form and a site in the genome of their host have been found in different bacteria (Burrus et al., 2002; Churchward, 2002). Various groupings of large subsets of these elements were proposed, including novel classes like CONSTINs (Hochhut and Waldor, 1999), conjugative genomic islands (Osborn and Boltner, 2002) or extension of a more ancient class, the conjugative transposons (Merlin et al., 2000). All these elements were recently proposed as ICEs, irrespective of the mechanisms of conjugative transfer (cell-to-cell contact using pili or cell aggregation, transfer as single- or double-stranded DNA) and integration (low or high specificity, serine or tyrosine recombinase) (Burrus et al., 2002). Numerous putative ICEs were found by sequence analyses in genomes of various low G+C Gram-Positive bacteria, α-Proteobacteria, β- Proteobacteria and γ-Proteobacteria, Bacteroides species and the high G+C Gram- Positive bacteria (Burrus and Waldor, 2004). Several different mobile elements including plasmids and a bacteriophage have been detected in R. pickettii. A small plasmid (2200bp) called pMBCP (AF144733) from a bovine R. pickettii strain confers resistance to cadmium (Bruins et al., 2003). Another plasmid from the R. pickettii strain US321 provides resistance to copper (Gilotra and Srivastava, 1997). A large plasmid called pRPIC01 (80934bp, CP001070) has been sequenced from R. pickettii 12J. This plasmid contains a Czc (cadmium, zinc, and cobalt) family heavy metal efflux pump. A filamentous phage p12J (7118bp, AY374414) has also been found in R. pickettii, this however only contained genes for the function of the phage. To date none of the ICE family of mobile genetic
122 elements has been found in R. pickettii, however Tn4371-like elements have been found in closely related bacteria Ralstonia solanacearum GMI1000, a phytopathogen isolated from a tomato in French Guyana (Boucher et al., 1985; Salanoubat et al., 2002) and Ralstonia metallidurans CH34, a heavy metal resistant bacteria from zinc factory waste water in Belgium (Mergeay et al., 1978; Toussaint et al., 2003). A member of the clc/ICEHin1056\PAGI-2(C) family of ICE’s has also been found in Ralstonia metallidurans CH34 that has degradative and metabolic enzymes and pathogenesis- related proteins (Mohd-Zain et al., 2004; Mergeay et al., 2003). The presence of mobile elements was investigated in R. pickettii as a possible mean of genetic versatility in and to allow it to survive in oligotrophic conditions.
4.3. Materials and Methods
The R. pickettii strains (Table 2.8) available were checked for mobile elements including plasmids and ICE-like elements. A strategy was devised to detect the integrase genes of various ICE-like elements that have been found in α-Proteobacteria, β-Proteobacteria and γ-Proteobacteria (Appendix 6) in R. pickettii.
4.3.1. Plasmid Profiles of Ralstonia pickettii Putative plasmid profiles for all Ralstonia pickettii strains (Table 2.8) were investigated using the QIAprep Spin Miniprep kit from Qiagen. E. coli NCTC50192 (which required 10 µg ml-1 tetracycline and chloroamphenicol for plasmid maintenance) was used as a positive control and E. coli AB1157 was used as a negative control. Purification was carried out according to the manufacturers’ instructions. Isolates were grown in 5 ml of Luria-Bertani broth overnight. Cells were harvested by centrifugation and resuspended in 250 µL of resuspension buffer (50 mM Tris HCl [pH 8.0], 10 mM EDTA) and 100 µg of RNase A per ml. Cells were lysed by addition of 250 µL of lysis buffer (200 mM NaOH, 1% [w/v] sodium dodecyl sulfate). Lysate was then neutralised with the proprietary neutralisation buffer (composition not specified), and plasmid DNA was adsorbed onto a silica gel membrane in the presence of a high-salt buffer. After washing, plasmid DNA was eluted from the gel with 10 mM Tris-Cl (pH 8.5). Plasmid samples were run on a 0.7% (w/v) agarose gel made using SeaKem Gold agarose.
4.3.2. Design of PCR Primers for Intergrase genes of Mobile Elements of the ICE Variety PCR primers were designed for the integrase genes of ICE-like elements of the α, β, γ-proteobacteria (Appendix 6) using the Primer 3 program (Rozen and Skaletsky,
123 2000, http://frodo.wi.mit.edu/) plus the R391\SXT integrase primers (McGrath et al., 2006). The parameters were set at Primer length: 20-25bp, Primer Tm: 55-65°C, Primer %GC: 20-80 and Product Length: 800-1900bp. The primers designed in this study can be seen in Table 4.1. All strains listed in Table 2.8 were analysed. A positive control using the species-specific PCR described in Section 3.3.3.3 was carried out on all DNA to ensure that amplification could take place. The cycling conditions were standardised as follows for all designed primers: initial denaturation (98°C, 2 min); 35 cycles
consisting of denaturation (98°C for 15 s), primer annealing (TA [estimated primer annealing temperature], 1 min), and extension (72°C, 1 min/kb); followed by a final extension step (72°C, 10 min). Amplification was carried out with a GC buffer (in a total reaction of 100 µL containing 0.2 mM deoxynucleoside triphosphates, 100 pmol of each primer, 8 µL of genomic template DNA, and three units of Phusion polymerase. PCR for the R391\SXT integrase were carried out under the following conditions: 95°C for 10 min, 80°C for 2 min (95°C for 45 s, 64°C for 45 s, 72°C for 90s) × 5 cycles, (95°C for 4 s, 61°C for 45 s, 72°C for 90 s) × 30 cycles, 72°C for 8 min and 4°C hold (McGrath et al., 2006). Amplification was carried out using a GeneAmp 2400 Thermocycler according to the above procedures. The Tn4371 integrase primers were designed using sequence data from R. pickettii 12J (CP001068). The PCR products were analysed by electrophoresis as described in Section 3.3.3.3.
Table 4.1: Integrase Primers Designed in This Study
Element Size Primers Tm References (bp) (°C) ICEMlSymR7A 950 intMlF GTAAGTCGCAAAAGGCTTCG 60 This Study intMlR TGTCCCCCAATCGAGATTAC Tn4371-like 1035 intFor1 TTTCATTTCACCATGACTCCAG 61.7 This Study elements intRev1 GAGAGCAGTCGATAGGCTTCC R391\SXT 1378 intFor1 66.1 McGrath et AAACTAGGGCTGGGCTTATAACATGGCG al., 2006 intRev1 AAAGATGGCAGCTTGCCGCAACCTC clc element 1836 intclcF GGTTAAGCATCTGGTTCCTGAC 63.8 This Study intclcR GATGATCTTGTCGAGATT CGTG ICEKp1 850 intKpF TATCCAGCCATCTCCCTGTC 60 This Study intKpR TTTCGTGTCGTAACCCATCA ICEHin1056 1337 intHinF GGCGTAAAGCAGTTGTTGGT 60 This Study intHinR GAATGCGAAGCTCGTTTTTC PAPI-1 914 IntPAPF AGCCATCAGAGTGAACAGCA 60 This Study IntPAPR TCAACCCGTTCAGAAAGACC
124 4.3.3. Mapping the Tn4371-like element Following the discovery of the integrase gene of Tn4371-like element in three Ralstonia pickettii strains ULM001, ULM003, ULM006, an approach was taken to mapping the element to see if the whole element was present in the strains in which the integrase was detected. Primers were designed by using the Primer 3 program (Rozen and Skaletsky, 2000, http://frodo.wi.mit.edu/) except for the CirIm primers RE1 and LE1, which were designed by hand. These were designed using sequence data from R. pickettii 12J (CP001068). The parameters for Primer 3 were set as in Section 4.3.2 except for the Product Length, which was set at 1200-1750bp. The primers designed in this study are presented in Table 4.2. Amplification was carried out with a GC buffer (in a total reaction of 100 µL containing 0.2 mM deoxynucleoside triphosphates, 100 pmol of each primer, 8 µL of genomic template DNA, and three units of Phusion polymerase. The cycling conditions were as follows: initial denaturation (98°C, 2 min); 35 cycles consisting of denaturation
(98°C for 15 s), primer annealing (TA [estimated primer annealing temperature], 1 min), and extension (72°C, 1 min/kb); followed by a final extension step (72°C, 10 min). Amplification was carried out using a GeneAmp 2400 Thermocycler. The PCR products were analysed by electrophoresis in a 1.5% (w/v) agarose gel (Agarose MP, Roche Diagnostics) for 1 hour (100 V) and ethidium bromide staining in the TBE buffer and photographed under the UV light (UV Products Gel Documentation System Imagestore, Ultra Violet Products, Cambridge). A 200-10000bp DNA ladder was included on all gels to allow standardization and sizing.
Table 4.2: Primers Designed to Map Tn4371-like Element
Gene Size Primers Tm R. pickettii 12J (bp) (°C) Position Start Stop CirIm ~220 RE1 GCATGGAAGACTTGACAG 54 N\A N\A LE1 GAGCTTGAGTTTTGCCACG int 1035 intFor1 TTTCATTTCACCATGACTCCAG 61.7 2715201 2716235 intRev1 GAGAGCAGTCGATAGGCTTCC RepA, 1657 RepAF GAGACTACCAGCGCCTCAAG 55 2734598 2736255 ParA RepAR ParB ACGTGTTCATGAGGACTTCTCC traG 1483 traGF GTTCGAGTGGTGGTTCTTCTTC 61 2757179 2758661 traGR GAAATTGCTGTCCGCGTAGTAG trbI 1597 trbIF AACTGACCATGAGCCAGGAC 62 2767516 2769113 trbIR AAAGCTCCTCAAAAGCGAAAG
125 4.3.3.1. DNA Sequencing The PCR products were purified using the NucleoSpin Extract II kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions (Appendix 3). Sequence analysis was performed by MWG using fluorescently labelled forward and reverse primers as above.
4.3.4. Assembly of the Tn4371-like element genome DNA and protein sequences similar to the Tn4371 (Toussaint et al., 2003,
AJ536756) were detected within the NCBI nucleotide and protein databases (via BLASTP and BLASTN analysis using Tn4371 sequences (Altschul. et al., 1990, 1997, http://www.ncbi.nlm.nih.gov/BLAST/). This element was assembled and compared with the Tn4371 sequence using the Artemis Comparison Tool (ACT) (Carver et al., 2005, http://www.sanger.ac.uk/Software/ACT). The complete DNA sequences were manually annotated to verify the deposited sequence. Size and total %GC content of large DNA sequences was determined using the GC-Profile program (Gao and Zhang, 2006). The program was accessed at http://tubic.tju.edu.cn/GC-Profile/. The Artemis Comparison Tool (ACT) was used to view and compare large DNA sequences (Carver et al., 2000, http://www.sanger.ac.uk/Software/ACT). The similarity of proteins encoded by the element was determined as % amino acid identities over the entire protein to its Tn4371 equivalent via BLASTP. CLUSTALW alignments with Tn4371 protein encoding sequences were used to verify alignment and similarity (Higgins et al., 1994; Thompson et al., 1994). Each ORF was also analysed using InterProScan (http://www.ebi.ac.uk/InterProScan/, Zdobnov and Apweiler, 2001, Bendtsen et al., 2004) to locate motifs or domains where similarity with known proteins was low or absent. The DNA sequences from Tn4371 and the novel elements were aligned via BLAST2 (http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi), and the percent similarity at the DNA level determined. Size and total %GC Content was determined using the GC-Profile program (Gao and Zhang, 2006, at http://tubic.tju.edu.cn/GC-Profile/). Phylogenetic and molecular evolutionary analyses were conducted using genetic-distance-based neighbour-joining algorithms (Saitou and Nei, 1987) within MEGA version 4.0 (http://www.megasoftware.net/, Tamura et al., 2007). Bootstrap analysis for 1000 replicates was performed to estimate the confidence of tree topology (Felsenstein, 1985).
126 4.3.5. Antibiotic susceptibility testing of Strains containing the Tn4371-like element In vitro antimicrobial susceptibility testing was performed by disc diffusion tests using eleven antibiotics and was carried out on Muller Hinton agar according to the National Committee for Clinical Laboratory Standards (NCCLS [M2-A7] 2000) on fifteen strains of R. insidiosa. The NCCLS has not developed guidelines for the Ralstonia genus and interpretation of results for Pseudomonas and other non- Enterobacteriaceae criteria were used (NCCLS [M100-S11] 2001). The inoculum was prepared by adding isolated colonies of the microorganism from an overnight nutrient agar plate into 2 ml TSB. The suspension was adjusted to match the 0.5 McFarland turbidity standards. A sterile cotton swab was dipped into the adjusted suspension. The swap was rotated several times and pressed firmly on the inside wall of the tube above the fluid level to remove excess inoculum from the swab. The swab was streaked over the entire surface of the sterile Mueller Hinton Agar plate. This procedure was repeated by streaking two more times, rotating the plate approximately 90° each time to ensure an even distribution of inoculum. The plates were allowed to dry for 5 minutes and then the antimicrobial disks were dispensed onto the surface of the inoculated agar plates using the Oxoid antibiotic disk dispenser. The plates were then incubated at 35°C for 16-18 hours. Zones of inhibition were then measured to the nearest whole millimetre using Venier callipers (Junior). Zones diameters were interpreted as being Susceptible (S), Intermediate (I) or Resistant (R) according to NCCLS (M100-S11) 2001. NCCLS Breakpoints are presented in Appendix 2.
4.4. Results and Discussion
4.4.1. Plasmid Profiling of Ralstonia pickettii strains No plasmid DNA was found in any of the fifty-nine strains of R. pickettii that were analysed. These results agreed with previous published studies where plasmid profiling of R. pickettii took place. These include a study where six clinical strains isolated from pneumonia had no plasmids (Timm et al., 1995), in another study nine strains from bacteremia cases no plasmids were found (Maki et al., 1991) and an analysis of twenty stains isolated from bacteremia patients and WFI (Water for Injection) where the results were inconsistent. The isolates had up to two bands detected at times; however, the profile patterns were not consistently reproducible (Dimech et al., 1993).
127 4.4.2. Detection of Integrase genes PCR was carried out with all seven sets of integrase primers (Table 4.1) on all strains listed in (Table 2.8), however only the Tn4371 integrase primers amplified any product and only in three strains ULM001, ULM003 and ULM006. Lane 1 in Figure 4.1 shows the PCR product of the gene at approximately 1050bp.
4.4.3. Molecular characterization of Tn4371-like element found in R. pickettii strains Following the discovery of these Tn4371- like ICE’s, PCR primers (Table 4.2) were designed for select genes of the core scaffold to quickly characterise the element in other bacteria and a collection of sixty Ralstonia pickettii strains were analysed. An analysis such as this could be applied to determine if Tn4371-like ICE’s are present in other bacterial species and to characterise them. The results of the experiment are shown in Fig. 4.1. Lanes 2 to 4 show the genes encoding a putative integrase (int), the putative stabilisation system (repA, parA, parB), a homologue to the DNA transfer protein (traG) and a putative pilus assembly and synthesis protein (trbI). DNA sequencing of the four amplicons in the tester strains demonstrated that Tn4371-like sequences exist in the genome of R. pickettii ULM001. Three of the sixty isolates, ULM001, ULM003 and ULM006 (laboratory purified water isolates from different locations in France) were positive for intTn4371 integrase gene when tested with the intFor1 and intRev1 primer pair in PCR amplification (Table 4.2). Sequencing revealed that the ULM001 int gene showed 85% and 99% nucleotide identity to the Tn4371 int gene and Tn4371-like element from R. pickettii int gene, respectively. The RepAF and RepAR amplified the RepA gene and the ParA gene in ULM001, ULM003 and ULM006. Sequencing showed that the ULM001 RepA and ParA genes had 88% and 99% nucleotide identity to the RepA and ParA genes from Tn4371 and the Tn4371-like element from R. pickettii respectively. A traGTn4371 was also detected in ULM001, ULM003 and ULM006.
Sequencing showed that the ULM001 traGTn4371 showed 91% and 89% nucleotide identity to traG from Tn4371 and Tn4371-like element from R. pickettii respectively. TrbIF and TrbIR were used to amplify the trbI gene in ULM001 and ULM003. No amplification occurred in ULM006. Sequencing showed that the ULM001 trbI gene had 88% and 99% nucleotide identity to the gene from Tn4371 and the Tn4371-like element from R. pickettii respectively. The absence of the trbI gene indicates that the element in ULM006 maybe truncated or an insertion could possibly have disrupted it so that it could not be amplified. A general map of the elements was constructed and is presented in Fig 4.1.
128
Fig 4.1: Amplification of genes of the putative Tn4371-like ICE in Ralstonia pickettii strain ULM001 (a laboratory purified water isolate). A schematic diagram of the amplified genes is presented above the 0.7% agarose gel of the PCR products generated with the primers listed in Table 4.2. Open white arrows denote ORFs of the Ralstonia pickettii ICE, and small black arrows represent the relative location of primers. Lanes M1 and M2 contain 200-10000bp molecular size markers (Bioline Hyperladder I), respectively. The lanes and the product sizes are as follows: Lane 1, int gene and flanking bases (1035bp); Lane 2 RepA gene (1657bp), Lane 3 traG gene (1483bp); Lane 4 trbI gene (1597bp).
Tn4371 has been shown to excise from the RP4 plasmid in Ralstonia eutropha forming a circular extrachromosomal intermediate (Merlin et al., 1999). The strains that had Tn4371-like elements were tested to see if they also excised forming extrachromosomal intermediates using a PCR assay. Primer LE1 is specific to integrated Tn4371-like element DNA at the left-end; primer RE1 is specific to integrated Tn4371-like element, right-end (Fig. 4.2a, Table 4.2). Both primers are oriented towards the Tn4371-like element junctions, and PCR product will be generated only if the respective left and right ends (attL and attR sites) excise from the chromosome and circularise, reconstituting attP (attachment locus on the element). PCR products of ~220bp were obtained from ULM001 and ULM003, indicating that a circular extrachromosomal form of the element was present in these cells, while no PCR
129 product was obtained from ULM006 (Fig. 4.2b). This indicated that the element in ULM006 may be non functional.
Fig 4.2: A) Schematic representation of Tn4371 excision and insertion into the R. pickettii chromosome. B) Agarose gel of attP of the elements in ULM001 and ULM003. Lanes M contains 200-10000 bp molecular size markers (Bioline Hyperladder I), Lane 1 ULM001, Lane 2 ULM002, Lane 3 ULM006.
130 4.4.4. The attL and attR region of Tn4371 ICE-like elements Analysis of hosts harbouring Tn4371-like elements indicated that integration occurred at an 8bp attB site generating attL and attR element chromosomal junctions (Merlin et al., 1999, Fig 4.2a). An alignment of the first and last 200bp of the elements analysed in this study with Tn4371-like element from previous studies showed the attL site had a sequence of TTTTC/TAT and attR had a sequence of TAC/TTTTTT (Appendix 7). Tn4371 has been shown to excise from the RP4 plasmid in Ralstonia eutropha forming a circular extrachromosomal intermediate (Merlin et al., 1999, Fig 4.2a.) as a transfer intermediate. The strains in which Tn4371-like elements were detected were examined to see if they also excised forming extrachromosomal intermediates. A PCR assay that allowed amplification across the circular junction but which would not amplify if the element were integrated was used. Primer LE1 is specific to integrated Tn4371-like ICE DNA at the attL left-end where as primer RE1 is specific to integrated Tn4371-like ICE at the attR right-end (Fig. 4.2a, Table 4.2). Both primers are oriented towards the Tn4371-like ICE junctions, and PCR product will be generated only if the respective left and right ends (attL and attR sites) excise from the chromosome and circularise, reconstituting attP (attachment locus on the element). A model of integration and excision of the ICE are presented in Fig 4.2a. PCR products of ~220bp were obtained from ULM001 and ULM003 (Fig. 4.2b), indicating that a circular extrachromosomal form of the element is present in these cells, while no PCR product was obtained from ULM006 (Fig. 4.2b). The sequencing of the attP region of the ULM001 element gave an attL region of TTTTTCAT and an attR region of TACTTTTT. This indicates that the elements can excise from the chromosome or plasmid that are integrated and can then circularise inside the bacterial cell. This rapid amplification across the circular attP junction can also be utilised for the rapid identification of Tn4371-like elements.
4.4.5. Antibiotic Resistance patterns of Ralstonia pickettii isolates with Tn4371-like elements In order to determine if there was any difference in antibiotic resistant between strains of R. pickettii that contained the element and those that did not antibiotic resistance testing was carried out, results can be seen in Table 4.3.
131 Table 4.3: Antibiotic Resistance Patterns of Ralstonia pickettii Isolates with Tn4371- like Elements Strain/Isolate No. Antibiotics CTX CN TE CIP OFX C SXT TIC MEZ FEB TOR JCM5969 S R S S S I S R S S R ULM 001 S R S S S I S R S S R ULM 003 S R I S S R S R S S R ULM 006 S R I S S I S R S S R Tic- Ticarcillin 75 µg/ml; Ctx- Cefotaxime 30 µg/ml; Cn- Gentamicin 10 µg/ml; Te-Tetracycline 30 µg/ml; Cip-Ciprofloxacin 5 µg/ml; Ofl- Ofloxacin 5 µg/ml; SxT- Sulphamethoxazole/trimethoprim 23.75/1.25 µg/ml; C- Chloramphenicol 30 µg/ml. Mez- Mezlocillin 75 µg/ml, Feb- Cefepime 30 µg/ml, Tor-Tobramycin 10 µg/ml Control strain: Pseudomonas aeruginosa ATCC 27853
The antibiotic resistance testing of these strains found no difference to antibiotic resistance profile of other strains of R. pickettii. Comparison with the R. pickettii type strain and comparison with the literature (Table 1.4) also found no differences. This indicated that the elements found in this study did not contain any antibiotic resistance genes.
4.4.6. Bioinformatic characterisation of Tn4371-like elements in whole genome sequences Through BLAST searches of the NCBI genome databases (National Centre for Biotechnology Information), elements similar to the Tn4371 element were found in the genomes of several different bacteria including the β-proteobacteria Delftia acidovorans SPH-1, Comamonas testosteroni KF-1, Acidovorax avenae subsp. citrulli AAC00-1, Bordetella petrii DSM 12804 and Acidovorax sp. JS42 and the γ-proteobacteria Congregibacter litoralis KT71, Shewanella sp. ANA-3, Pseudomonas aeruginosa 2192 and Pseudomonas aeruginosa PA7 (Table 4.4). Comparisons of all elements with Tn4371 can be seen in Appendix 8. All the bacterial strains harbouring the Tn4371-like elements were isolated in different locations across the world, including Europe and the Americas and in many different environments including activated sludge, polluted water and clinical situations. All contained different fitness determinants except for those found in Delftia acidovorans SPH-1 and Comamonas testosteroni KF-1 (Table 4.4). Size varied from 45 to 60 kb and %GC content from 59 to 64. A full breakdown of the size, GC% content, etc., can be seen in Table 4.4.
132 Table 4.4: Size and %GC Content, Accessory Genes Fitness Determinants Contained in and the Location and Environment of Isolated Strains Containing Tn4371- like Elements Tn4371-like Size %GC Location Environment Accessory Genes Reference Proposed Accession Number Elements (bp) Content Name Ralstonia 54121 64.63 USA Copper- Lipid metabolism Konstantinidis et al., ICETn43716033 CP001068 pickettii 12J contaminated 2003 sediment from a lake Shewanella sp. 45233 59.43 USA Arsenate treated Multidrug resistance pump Saltikov et al., 2003 ICETn43716034 NC_008577 ANA-3 wood pier Congregibacter 50661 59.52 North Sea Ocean-surface RND type multidrug efflux Fuchs et al., 2004 ICETn43716035 NZ_AAOA01000008 litoralis KT71 water pump Acidovorax 59884 63.12 USA Watermelon Insertion Sequences Walcott et al., 2004 ICETn43716036 NC_008752 avenae subsp. metabolism citrulli AAC00-1 Delftia 57901 63.66 Germany Activated sludge czc metal resistance pumps Schleheck et al., ICETn43716037 NC_010002 acidovorans 2004 SPH-1 Comamonas 52455 63.77 Switzerland Activated sludge czc metal resistance pumps Schleheck et al., ICETn43716038 NZ_AAUJ0100000 testosteroni KF-1 2004 Acidovorax sp. 53489 62.88 USA Groundwater Multidrug resistance pump Haigler et al., 1994 ICETn43716039 NC_008782 JS42 Insertion Sequences Bordetella petrii 47190 63.73 Germany River sediment Aromatic compounds von Wintzingerode ICETn43716040 NC_010170 DSM12804 metabolism et al., 2001 Pseudomonas 48538 62.62 USA Cystic fibrosis RND type multidrug efflux Hanna et al., 2000 ICETn43716041 NZ_AAKW01000024 aeruginosa 2192 patient pump Pseudomonas 52759 63.76 Argentina Clinical wound Multiple antibiotic Brodinova et al., ICETn43716042 NC_009656 aeruginosa PA7 isolate resistance genes 1984 Potassium transporter system 133 The integrase of the element was analysed to determine which type of recombinase family it belonged to, the tyrosine recombinase or serine recombinases family. Tyrosine recombinases have a special R-H-R-Y tetrad present. An alignment was carried with the tyrosine recombinases of several phages and ICEs\Ctns to see if the R-H-R-Y tetrad was present, with R (Arginine) being in Domain I and H (Histidine)-R-Y (Tyrosine) in Domain II (Nunes-Düby et al., 1998). As can be seen from Figure 4.3, the element present in R. pickettii 12J has a tyrosine integrase. The int gene (that bears similarities to phage encoded tyrosine recombinases of the λ phage family, sub-family P4 [Nunes- Düby et al., 1998]) was in all cases followed by nonconserved ORFs.
Fig 4.3: Alignment of the conserved domains among the site-specific recombinases of the tyrosine integrase family from phages, conjugative transposons, plasmids and other sources.
134
Fig 4.4: Phylogenetic tree of the Integrase proteins all available Tn4371-like integrases available on the GenBank database and the integrase gene sequenced in this study. Cluster analysis was based upon the neighbour-joining method. Numbers at branch-points are percentages of 1000 bootstrap resamplings that support the topology of the tree. The scale bar represents 0.05 substitutions per nucleotide position.
A phylogenetic tree of all the integrase genes from all known Tn4371-like elements found to date (including the gene sequenced in this study) is presented in Figure 4.4. Identity levels between the integrase genes at the protein level ranged from 67-100%. After the integrase are a group of unconserved orfs. These ORFs include putative DNA helicases and nucleases, proteins with β-lactamase domains, homologues to RadC DNA repair proteins, putative reductases, transposases of insertion sequences, putative ubiquitin-activating enzymes and putative transcriptional regulators and are found in differing arrangements in different elements. Immediately after this region two conserved genes (ORF00013 and ORF00014 in Tn4371) were present in most elements except those in C. litoralis KT71 and Shewanella sp. ANA-3. These are related to proteins encoded by genes located near the transfer origin of Escherichia coli F plasmid (Q9WTE4 and Q9S4W2). The function of the first protein is unknown and the second shows homology to ParB-like nucleases. Par (partitioning) B nucleases were initially identified as critical elements of a mechanism
135 involved in the faithful partitioning of plasmid DNA during cell division in the absence of selection pressure (Austin et al., 1981, Gerlitz et al., 1990). Subsequently, a number of similar proteins have been identified in prokaryotes and archaea, which carry out the function of segregation of genomic DNA during cell division. ParB homologs are present in almost all eubacterial chromosomes (Bignell and Thomas, 2001). All elements except B. petrii DSM12804 (the XRE regular of B. petrii DSM 12804, Bpet2181, differs from all the other elements), contain a homologue of the XRE (Xenobiotic Responsive Element) family transcriptional regular, a putative lipoprotein with a DNA binding domain and a protein of unknown function. The XRE family of transcriptional regulars are prokaryotic DNA-binding proteins belonging to the xenobiotic response element family of transcriptional regulators which behave as lambda repressor-like proteins for different phages, including Staphylococcus aureus phage phi11 (Das et al., 2007) and the Bacillus subtilis defective prophage PBSX (McDonnell and McConnell 1994). This can be seen in the schematic diagram of the common scaffold of Tn4371-like elements presented in Fig. 4.8. The next region on the element contains a protein (ORF00035 of Tn4371), which was found to posses similarity to the RdfS (excisionase, CAD31514) of ICEMlSymR7A, the symbiosis island of Mesorhizobium loti R7A (Ramsay et al., 2006). Most excisionases share a few conserved features: small (usually <100 amino acids) DNA-binding proteins and typically basic with the majority of known RDFs having isoelectric points in the range of pH 8-10 (Lewis and Hatfull, 2001). The size of the protein homologues ranged from 89-98 aa (amino acid) and the pI from 8.14 to 9.59. BlastP scores were approximately 50% aa identity of the ICEMlSymR7A RdfS over approximately 55 aa for all of the putative RdfSs discovered in this study (Fig. 4.6). The placement was unusual as usually excisionases are found close to the integrase gene in most ICE’s as in R391 (O'Halloran et al., 2007).
136
Fig 4.5: Phylogenetic tree of the RepA genes of the Tn4371 type. Phylogenetic tree of the RepA proteins of all available Tn4371-like RepA proteins available on the GenBank database and the RepA gene sequenced in this study. Cluster analysis was based upon the neighbour-joining method. Numbers at branch-points are percentages of 1000 bootstrap resamplings that support the topology of the tree. The scale bar represents 0.05 substitutions per nucleotide position.
The next region of the elements contain plasmid-related genes whose predicated products were related to the RepA protein of Pseudomonas plasmid pVS1 (BAA96327, Heeb et al., 2000), plasmid pMLb of M. loti MAFF303099 (NP_109574, Kaneko et al., 2000) and plasmid pEMT8 (CAC94910, Gstalder et al., 2003); the ParA partition protein of the type Ib family (Gerdes et al., 2000) and its associated ParB protein which was in all cases truncated. This is followed by an ORF that encodes a conserved hypothetical protein (ORF00040 in Tn4371). The Rep and Par proteins have been proposed to act as a stabilisation system for the element (Bignell and Thomas, 2001; Burrus and Waldor, 2004), similar to the toxin-anti-toxin system encoded by ORFs s044 and s045 of the SXT-ICE (Dziewit et al., 2007), or the Soj protein in PAPI- 1 of Pseudomonas aeruginosa, which is similar to ParA proteins, that is required for maintenance of the element (Qiu et al., 2006). A phylogenetic tree of all known RepA and ParA proteins from all known Tn4371-like elements found to date are presented in Figure 4.5 and 4.6 respectively. Identity levels between the RepA proteins ranged from 80-100% and from 90-100% for the ParA proteins.
137 Next to repA, parA and parB genes are a putative conjugation protein TraF, which is related to the pilus assembly proteins of IncP plasmids and a putative relaxase- like protein (ORF00041 in Tn4371) that has homology to the VirD2 protein of Ti plasmids and to the RlxS (relaxase, CAD31511) of ICEMlSymR7A. Transfer and maintenance of ICEMlSymR7A in cells has been shown to be dependent on RlxS (Ramsay et al., 2006).
Fig 4.6: Phylogenetic tree of the ParA proteins of the Tn4371 type. Phylogenetic tree of the ParA proteins of all available Tn4371-like ParA proteins available on the GenBank database and the ParA gene sequenced in this study. Cluster analysis was based upon the neighbour-joining method. Numbers at branch-points are percentages of 1000 bootstrap resamplings that support the topology of the tree. The scale bar represents 0.05 substitutions per nucleotide position.
After the putative relaxase-like protein was a variable region encoding a number of different ORFs, which vary from element to element, these genes encoded putative antibiotic genes, heavy metal resistance pumps and degradative and metabolic enzymes which may have originated by transposition into the element. The sequence between the putative relaxase gene and the first gene of the variable region, in all elements, was similar to the sequence of an area of Tn5 (U00004) indicating that the diversity in this region maybe due to a Tn5 mediated event. In the ICE in R. pickettii 12J the variable region encoded a putative set of lipid metabolising genes. These were closely related to genes from Pseudomonas putida W619 (NZ_AAVY01000010.1) and
138 from the pREC1 plasmid from Rhodococcus erythropolis PR4 (NC_007486) (Sekine et al, 2006). In P. aeruginosa PA7 homologs of genes for antibiotic resistance including neomycin/kanamycin resistance, bleomycin resistance, and streptomycin resistance related to the antibiotic resistance genes from Tn5 (U00004) were encoded in this region. A set of genes homologous to the KdpFABC system, a high-affinity potassium transporter system for potassium limitation, follows the homologues of the antibiotic resistance genes. D. acidovorans SPH-1 and C. testosteroni KF-1 contain a predicted czc (Cd/Zn/Co) efflux system (van der Lelie et al., 1997; Grosse et al., 1999). C. litoralis KT71 and P. aeruginosa 2192 have a putative resistance nodulation division (RND) type multidrug efflux pump related to the mex system of Pseudomonas aeruginosa (Kohler et al., 1997) and the oqx system of E. coli plasmid pOLA52 (Hansen et al., 2004). Shewanella sp. ANA-3 has genes that are homologous to chloramphenicol efflux pump. Acidovorax sp. JS42 contains a homologue to a multidrug resistance pump and insertion sequences. A. avenae subsp. citrulli AAC00-1 also contained insertion sequences and homologues to general metabolism proteins. Following this is a putative transcriptional regulator protein TraR and a homologue of the type IV coupling protein TraG (similar to those in IncP plasmids), which is responsible for DNA transfer during conjugation and a putative DNA binding protein (Gomis-Ruth et al., 2002). A phylogenetic tree of all the TraG proteins from all known Tn4371-like elements found to date is presented in Figure 4.7. Identity levels between the proteins ranged from 87-100%. The next region of the element was a group of proteins with homology to the mating-pair formation (mpf) apparatus or type IV secretion system from IncP and Ti plasmids, this system may mediate the DNA transfer of the ICE to recipient cells (Schroder and Lanka, 2005; Lawley et al., 2003). The mpf genes were named trbB-I according to their orthologues in RP4, as in Tn4371; despite their different organization e.g. BCDEJLFGI in all elements found in this study they are similar to ICEMlSymR7A (Sullivan et al., 2002). The various functions of each are presented in Table 4.5.
139 Table 4.5: Functions of Type VI Secretion System Proteins IncP α Tn4371-like element Function TrbB TrbB Secretion TrbC TrbC Pilin TraF TraF Cyclase TrbD TrbD Pore TrbE TrbE Secretion TrbF TrbF Pore TrbJ TrbJ Pore TrbL TrbL Pore TrbG TrbG Secretion TrbI TrbI Pore
Fig 4.7: Phylogenetic tree of the TraG proteins of all available Tn4371-like TraG proteins available on the GenBank database and the TraG gene sequenced in this study. Cluster analysis was based upon the neighbour-joining method. Numbers at branch-points are percentages of 1000 bootstrap resamplings that support the topology of the tree. The scale bar represents 0.02 substitutions per nucleotide position.
The ICE’s are integrated into various locations in the genomes of their host bacteria. In D. acidovorans SPH-1 and Acidovorax sp. JS42, other partial copies of Tn4371-like elements were found in addition to a full element elsewhere. This is similar to R. metallidurans CH34 and indicates that duplication of the elements may occur in bacteria. Near complete copies of Tn4371-like elements were found in Burkholderia
140 ambifaria AMMD and Burkholderia multivorans ATCC17616, but both were found to lack the Tn4371-like integrase gene. A full bioinformatic analysis was carried out on the element found in R. pickettii 12J using BlastP and InterPro Scan analysis and the results are presented in Table 4.6. The analysis shows that the genes present in this element and those in the other elements found in this study potentially come from a wide variety of sources including other bacterial genomes e.g. the lipid metabolism genes in R. pickettii 12J come from Pseudomonas putida W619, the integrase and some of the transcriptional regulators come from various phages, the putative excisionase from the ICEMlSymR7A mobile element and the putative Type IV secretion system from IncP plasmid.
141 Table 4.6: ORFs Associated with the Tn4371-like ICE from the Genome of Ralstonia pickettii 12J R. pic 12J % GC Size pI Putative Role Nearest blast Homologue Blast Score InterPro Scan Content (aa) ORF2601 66.51 415 9.91 Phage Intergrase Bacteriophage SfX Identities: 24% Integrase, catalytic core, MW: 46.1 KDa AAD10295 Positives: 42% phage (169) IPR002104 ORF2602 63.50 378 9.07 Unknown N/A N/A Protein of unknown function (PD- (D/E) XK nuclease DUF1016 superfamily) IPR009362 ORF2603 54 262 9.55 Unknown N/A N/A Unintegrated Signal-peptide Transmembrane regions ORF2604 56.70 300 6,72 Transcriptional regulator R391 Orf 15 Identities: 32% Unintegrated COG2378 Positives: 47% Predicted transcriptional AAM08019 (249) regulator, DeoR type ORF2605 57.79 397 5.15 Unknown Saccharophagus degradans Identities: 43% No hits reported. Cobyric acid synthase CobQ Positives: 60% YP_525683 (397)
ORF2606 60.46 751 5.47 UBA/ThiF-type NAD/FAD binding N/A N/A UBA/THIF-type NAD/FAD fold pfam00899: ThiF binding fold IPR000594 ORF2607 56.96 356 5.36 Unknown- Predicted hydrolase N/A N/A Unintegrated (metallo-beta-lactamase G3DSA: 3.60.15.10 superfamily) [General function prediction only] COG2333 ORF2608 65 116 4.93 Unknown N/A N/A No hits reported. ORF2609 65 92 5.44 Unknown N/A N/A No hits reported.
142 R. pic 12J % GC Size pI Putative Role Nearest blast Homologue Blast Score InterPro Scan Content (aa) ORF2610 63 99 4.05 Unknown N/A N/A No hits reported. ORF2611 63 274 9.16 Unknown Plasmid F Identities: 54% Protein of unknown function hypothetical protein Positives: 74% DUF932 NP_061448 (271) IPR009276 ORF2612 66.37 679 5.07 ParB-like nuclease Plasmid F Identities: 31% ParB-like nuclease NP_061441 Positives: 46% IPR003115 Over whole protein (615) ORF2613 72.00 91 11.45 Unknown N/A N/A No hits reported. ORF2614 57.00 85 10.78 Unknown Only found in R. pickettii N/A No hits reported. 12J ORF2615 63.00 104 6.07 Unknown N/A N/A Protein of unknown function DUF736 IPR007948 ORF2616 60.00 97 6.08 Transcriptional regulator, XRE Bacteriophage phi-105 Identities: 32% Helix-turn-helix type 3 family CAA26567 Positives: 60% IPR001387 (53) Lambda repressor-like, DNA-binding IPR010982 ORF2617 64.00 115 5.65 Lipoprotein (DNA binding domain) N/A N/A No hits reported. ORF2618 69.00 249 8.47 Unknown N/A N/A Unintegrated Signal-peptide Transmembrane regions ORF2619 68.00 98 9.22 Unknown RdfS Identities: 55% No hits reported ICEMlSymR7A Positives: 61% (55) ORF2620 69.00 282 9.86 repA pEMT8 Identities: 33% No hits reported. COG5534 CAC94910 (316 aa’s) Positives: 49% Plasmid replication initiator protein (258)
143 R. pic 12J % GC Size pI Putative Role Nearest blast Homologue Blast Score InterPro Scan Content (aa) ORF2621 70.00 212 10.12 parA Vibrio phage VP882 Identities: 40% Cobyrinic acid a,c-diamide YP_001039864 (212 aa’s) Positives: 59% synthase (202) IPR002586 ORF2622 67.00 87 10.25 parB N/A N/A No hits reported. ORF2623 69.00 177 9.89 Unknown N/A N/A No hits reported. ORF2624 69.00 195 10.43 traF Birmingham IncP-alpha Identities: 36% Peptidase S24, S26A, S26B Maturase (Serine Protease) CAJ85723 Positives: 53% and S26C (100) IPR015927 ORF2625 67.52 660 9.64 Unknown (possible relaxase) ICEMlSymR7A Identities: 40% No hits reported. COG3843: VirD2 msi106 Positives: 58% Type IV secretory pathway, VirD2 (653) components (relaxase) [Intracellular trafficking and secretion] ORF2626 64.00 NA NA pseudogene NA NA NA
ORF2627 64.00 260 6.37 short-chain Pseudomonas putida W619 Identities: 82% Short-chain dehydrogenase/reductase acyl-CoA dehydrogenase- Positives: 89% dehydrogenase/reductase like (260) SDR ZP_01639356 IPR002198 Glucose/ribitol dehydrogenase IPR002347 ORF2628 66.00 261 5.64 enoyl-CoA hydratase Pseudomonas putida W619 Identities: 81% Crotonase, core Enoyl-CoA Positives: 86% IPR001753 hydratase/isomerase (256) ZP_01639347
144 R. pic 12J % GC Size pI Putative Role Nearest blast Homologue Blast Score InterPro Scan Content (aa) ORF2629 67.77 393 5.55 Acetyl-CoA C-acyltransferase Pseudomonas putida W619 Identities: 85% Thiolase Acetyl-CoA C- Positives: 91% IPR002155 acyltransferase (392) ZP_01639348 ORF2630 63.92 558 5.96 medium-chain acyl-CoA ligase Pseudomonas putida W619 Identities: 84% AMP-dependent synthetase AMP-dependent synthetase Positives: 92% and ligase and ligase (555) IPR000873 ZP_01639349 ORF2631 68.86 349 6.05 L-carnitine dehydratase/bile acid- Pseudomonas putida W619 Identities: 84% Extradiol ring-cleavage inducible protein F L-carnitine dehydratase/bile Positives: 92% dioxygenase, classes I and II acid-inducible protein F (344) IPR000486 ZP_01639350 CoA-transferase family III IPR003673 ORF2632 63.44 381 5.87 acyl-CoA dehydrogenase Pseudomonas putida W619 Identities: 82% Acyl-CoA acyl-CoA dehydrogenase- Positives: 90% oxidase/dehydrogenase, like (381) type 1 ZP_01639351 Central region N-terminal C-terminal Middle and N-terminal type1/2, C-terminal IPR006090 ORF2633 67.74 342 10.06 transcriptional regulator, AraC Pseudomonas putida W619 Identities: 68% Helix-turn-helix, AraC type family transcriptional regulator, Positives: 80% IPR000005 AraC family (345) Homeodomain-like ZP_01639424 IPR009057 SurA N-terminal domain IPR015391
145 R. pic 12J % GC Size pI Putative Role Nearest blast Homologue Blast Score InterPro Scan Content (aa) ORF2634 61.00 35 6.05 Hypothetical protein NA NA No hits reported. ORF2635 61.14 349 5.80 beta-lactamase-like protein Ralstonia eutropha H16 Identities: 57% Beta-lactamase-like Metallo-beta-lactamase Positives: 71% IPR001279 YP_840703 (341) ORF2636 64.00 101 11.22 Unknown N/A N/A No hits reported. ORF2637 64.40 455 9.43 major facilitator superfamily Polaromonas Identities: 62% Sugar transporter MFS_1 naphthalenivorans Positives: 78% superfamily CJ2 (447) IPR005829 major facilitator superfamily Major facilitator MFS_1 superfamily IPR007114 Major facilitator superfamily MFS-1 IPR011701 ORF2638 69.53 593 5.60 acyl-CoA dehydrogenase Pseudomonas putida W619 Identities: 22% Acyl-CoA acyl-CoA dehydrogenase- Positives: 89% oxidase/dehydrogenase, like (593) type 1 ZP_01639356 central region N-terminal C-terminal middle and N-terminal type1/2, C-terminal IPR006090 ORF2639 63.00 249 8.32 electron transfer flavoprotein beta- Acidovorax sp. JS42 Identities: 98% Electron transfer subunit electron transfer Positives: 94% flavoprotein, beta-subunit, flavoprotein beta-subunit (249) core YP_987916 IPR000049 Electron transfer,
146 R. pic 12J % GC Size pI Putative Role Nearest blast Homologue Blast Score InterPro Scan Content (aa) ORF2640 67.42 310 5.62 electron transfer flavoprotein alpha- Polaromonas sp. Identities: 82% Electron transfer subunit JS666 Positives: 88% flavoprotein, alpha subunit electron transfer (310) IPR001308 flavoprotein, alpha subunit Rossmann-like alpha/beta/alpha sandwich fold IPR014729 Electron transfer flavoprotein, alpha/beta- subunit, N-terminal IPR014730 Electron transfer flavoprotein, alpha subunit, C-terminal IPR014731 ORF2641 60.52 308 5.62 traR BphR Burkholderia cepacia Identities: 66% Bacterial regulatory protein, putative transcription regulator AAZ08184 Positives: 80% LysR protein (295) IPR000847 LysR, substrate-binding IPR005119 Winged helix repressor DNA-binding IPR011991 ORF2642 66.02 672 6.06 traG Plasmid QKH54 IncP-1 Identities: 39% TRAG protein Coupling protein YP_619869 Positives: 58% IPR003688 (538)
147 R. pic 12J % GC Size pI Putative Role Nearest blast Homologue Blast Score InterPro Scan Content (aa) ORF2643 67.00 154 8.17 CopG-like DNA-binding N/A N/A No hits reported. ORF2644 68.21 345 5.65 trbB pTi-SAKURA_p018 Identities: 49% Bacterial type II secretion Energise the DNA transport process NP_053257 Positives: 67% system protein E (NTPase) (303) IPR001482 P-type conjugative transfer ATPase TrbB IPR014149 ORF2645 65.00 130 11.25 trbC pB3 IncP-1β Identities: 33% Conjugal transfer, TrbC Precursor the major pilus subunit CAG26000 Positives: 61% IPR007039 (73) ORF2646 65.00 94 10.57 trbD pRi1724_p129 Identities: 29% Unintegrated Secretion apparatus NP_066709 Positives: 50% PIRSF017854 (71) ORF2647 66.79 825 5.73 trbE pTi-SAKURA_p015 Identities: 39% AAA+ ATPase, core Energise the DNA transport process NP_053254 Positives: 56% IPR003593 (NTPase) (803) CagE, TrbE, VirB component of type IV transporter system IPR004346 ORF2648 65.00 251 9.41 trbJ pTi-SAKURA_p014 Identities: 26% P-type conjugative transfer Entry exclusion NP_053253 Positives: 50% protein TrbJ (188) IPR014147 ORF2650 68.66 450 9.48 trbL pRi1724_p125 Identities: 24% TrbL/VirB6 plasmid Secretion apparatus NP_066705 Positives: 46% conjugal transfer protein (231) IPR007688 P-type conjugative transfer protein TrbL IPR014150
148 R. pic 12J % GC Size pI Putative Role Nearest blast Homologue Blast Score InterPro Scan Content (aa) ORF2651 66.00 234 9.75 trbF pKJK5 IncP-1 Identities: 32% Conjugal transfer protein, Minor pilus subunit/ chaperone YP_709147 Positives: 49% TrbF involved in pilus assembly (207) IPR007665 ORF2652 65.66 331 7.73 trbG Birmingham IncP-alpha Identities: 38% Conjugal transfer protein Secretion apparatus/ OM Pore CAJ85693 Positives: 56% TrbG/VirB9/CagX (204) IPR010258 P-type conjugative transfer protein TrbG IPR014142 ORF2653 68.63 423 7.87 trbI pTi-SAKURA_p008 Identities: 37% Bacterial conjugation TrbI- Secretion apparatus NP_053247 Positives: 54% like protein (259) IPR005498 ORF2654 65.00 81 10.01 Unknown Uncharacterised conserved N/A No hits reported. small protein [Function unknown] COG5639
149 All of the elements share a common scaffold or backbone that was 24kb in size and was composed of a 1.5kb integrase gene; an 8.5kb replication/stability gene cluster and a 14kb conjugal transfer/mating pair formation cluster (Fig. 4.8). A visual representation of this can be seen in Fig 4.9 a, b where using the Artemis Comparison Tool software the sequence of all elements were aligned and the core scaffold and the differences in accessory genes can easily be seen. The integrase gene is seen at the start with the area of unconserved orfs following this. As can be seen this area was more closely related between certain bacteria including D. acidovorans SPH-1
(ICETn43716037), C. testosteroni KF-1 (ICETn43716036) and R. pickettii 12J
(ICETn43716033). The replication/stability gene cluster follows these unconserved orfs. This is then followed by another region of unconserved orfs that encode the various functions as described above. After this are the genes that code for the Type IV secretion system that putatively mediate the transfer of the element. Comparisons were performed between the genes that make up the core scaffold region of the ICE. The identity levels between Tn4371-encoded proteins and their orthologues ranged from the highly conserved traG gene, with 87 to 100% aa identity, trbE gene, with 87 to 93% aa identity, and the parA gene, with 90 to 100% aa identity, to the less-conserved traR gene, with 53 to 84% aa identity. It averaged at around 75% aa identity for most of the other proteins in the core scaffold region. A general diagram of Tn4371-like elements is presented in Figure 4.8. The full genome comparisons between all ten elements are presented in Fig 4.9a and b.
150
Fig 4.8: Defining the common core scaffold of Tn4371-like ICE’s with genes present in ICETn43716033 (Core scaffold genes in blue, insert genes in yellow)
151 4.4.7. Defining the Tn4371 family of elements and nomenclature Although the elements identified in this study, presented in Table 4.4, are not identical, they share a similar core backbone that warrants their inclusion into the Tn4371 ICE family. All encode a related integrase, related maintenance and transfer genes and the gene order of homologous genes are similar, if one were to remove variable inserted regions, which differ from element to element. It is proposed that any
ICE that encodes an integrase gene closely related to intTn4371 (this is defined as over 75% protein homology) and that has similar maintenance and transfer genes be considered part of the Tn4371 family of ICEs. Given the number of Tn4371-like elements discovered in this study, it seems sensible to name newly described ICEs of the Tn4371 family with a uniform nomenclature. It was proposed to adapt the system used for naming transposons described by Roberts et al., (2008). This system can be viewed at a website (http://www.ucl.ac.uk/eastman/tn/). The system assigns Tn numbers in sequence e.g.
Tn6033, Tn6034, etc and the elements are then called ICETn43716033, ICETn43716034, etc to distinguish that they are ICE’s of the Tn4371 family. The proposed names assigned to the elements discovered in this study are presented in Table 4.4. This system was chosen as other systems such as that used by Burrus et al., 2006 for naming members of the SXT\R391 family of ICE’s are not regulated and can differ between laboratories leading to confusion.
152
Fig. 4.9a: Artemis representation showing similarity between five different Tn4371-like ICE’s.
153
Fig. 4.9b: Artemis representation showing similarity between six different Tn4371-like ICE’s.
154 These Tn4371-like elements are found in a wide range of different bacteria both in γ-proteobacteria and β-proteobacteria from both clinical and environmental sources and can be classed as both antibiotic resistance islands and metabolic islands. This way of classifying these elements as different classes of islands is similar to the clc/ICEHin1056\PAGI-2(C) family of ICE’s that has been shown to be in γ- proteobacteria and β-proteobacteria with metabolic and degradative enzymes, antibiotic, heavy metal and antiseptic resistance, type IV secretion systems, type I ant-restriction systems and virulence factors (Mohd-Zain et al., 2004). These types of bacteria are known for their wide metabolic repertoires and these elements could potentially be a source for this repertoire. The discovery of the Tn4371-like elements in both P. aeruginosa 23192 and P. aeruginosa PA7 in this study is the first incidence of this element found in human pathogens. This along with the discovery of antibiotic resistance proteins indicated that this element may have a widespread impact in not just environmental survival but clinical survival also.
155
Conclusion
This study focused on the characterization of R. pickettii and its ability to survive in a wide variety of environments including purified water.
A total of fifty-eight strains isolated from different sources and the R. insidiosa Type strain were used in this study. In the course of this study it was discovered that fourteen of the strains used in this study were the closely related bacteria Ralstonia insidiosa. Investigations were carried on these strains and it was found that the R. insidiosa strains in this study are multi antibiotic resistance. Attempts to differentiate R. insidiosa and R. pickettii using biochemical tests such as desferrioxamine resistance and nitrate reduction were not specific enough.
R. pickettii is not a prevalent pathogen in hospital environments but is isolated on occasion and can be serious in immunocompromised patients. A study of the virulence factors was carried out on the strains available for this study including seven strains isolated from the lungs of cystic fibrosis suffers. Several virulence factors were tested for including, extracellular protease activity, elastase and motility but only α- Hemolysis activity was detected.
In testing the diversity of the species two areas that were looked at were phenotypic diversity and genotypic diversity. These are the largest studies to date carried out on the phenotypic and genotypic diversity of R. pickettii.
The phenotypic testing were based on the API 20NE, RapID NF Plus and various other biochemical tests. These indicated that R. pickettii has a somewhat limited phenotypic diversity with no major differences being observed between strains based on the environment or location of isolation.
The genotypic testing was carried out using a variety of methods including analysis of single genomic targets (16S-23S ISR and the fliC gene) and whole genome analysis (RAPD and BOX-PCR). This analysis’s indicated that R. pickettii has a somewhat limited diversity but that there are no major differences between strains based on the environment or location of isolation. This indicated that methods such as RAPD and BOX-PCR would be a poor way for differentiating between different clinical/environmental and type isolates of R. pickettii.
157 The ability of R. pickettii to survive in purified water was investigated by searching for Mobile Genetic Elements (MGE’s). No plasmids were found in any of the strains tested in this study indicating that R. pickettii posses no detectable plasmid elements. Various elements of the ICE variety were searched for using a PCR strategy targeted at their integrase genes but only one element related to the Tn4371 family of ICE-like elements was found. This integrase was found in three laboratory purified water strains ULM001, ULM003 and ULM006. Following this a search was conducted on the GenBank database and ten novel elements including an element found in a R. pickettii strain were found in ten different whole genome sequences. This allowed a common scaffold to be developed increasing the knowledge available about these elements. This also allowed a characterisation method to be devised for the characterisation of the elements discovered in the laboratory purified water strains. This method could be potentially applied to other finds of the Tn4371-like ICE to allow for their description. To the best of our knowledge this is the first report of an ICE-like element found in R. pickettii The testing of the Millipore Purified Water system led to the isolation of several different bacterial species but the main species found was R. pickettii.
The results of this study indicate that Ralstonia pickettii is a prevalent microbe found in purified water of all types. There is however little difference between strains isolated from different environments indicating that it is probable that strains are not specially adapted to their different environments based on our data. It was decided to investigate if any MGE’s were present as these could potentially give the bacteria the ability to survive in purified water. A single ICE-like element related to Tn4371 was found during this study.
158
Bibliography
Adiloglu A.K., Ayata A., Sirin C., Yondem C. and Okutan H. 2004. Case report: nosocomial Ralstonia pickettii infection in neonatal intensive care unit. Mikrobiyoloji Bülteni, 38: 257-260.
Adley C.C. and Saieb F. 2005a. Biofilm formation in high purity water: Ralstonia pickettii a special case for analysis. Ultrapure Water, 22: 14-17.
Adley C.C. and Saieb F. M. 2005C. Comparison of BioMérieux API 20NE and Remel RapID NF Plus Identification Systems of Type Strains of Ralstonia pickettii. Letters in Applied Microbiology, 41: 136-140.
Adley C.C. and Saieb F.M. 2005b. Ralstonia pickettii: A Potential Nosocomial Infectious Pathogen. NIHS Research Bulletin, 3: 53-55.
Adley C.C., Ryan M.P., Pembroke J.T. and Saieb F.M. 2005. Ralstonia pickettii: Biofilm formation in high-purity water. In McBain A., Allison D., Pratten J., Spratt D., Upton M., Verran J. eds. Biofilms: persistence and ubiquity. Biofilm Club: Cardiff, 261-271.
Ahkee S., Srinath L., Tolentino A., Scortino C. and Ramirez J. 1995. Pseudomonas pickettii pneumonia in a diabetic patient. Journal of the Kentucky Medical Association, 93: 511-513.
Albibi R., Chen J., Lamikanra O., Banks D., Jarret R.L., Smith B.J. 1998. RAPD fingerprinting Xylella fastidiosa Pierce's disease strains isolated from a vineyard in North Florida. FEMS Microbiology Letters, 65: 347-352.
Altschul S.F., Gish W., Miller W., Myers E.W. and Lipman D.J. 1990. Basic local alignment search tool. Journal of Molecular Biology, 215: 403-410.
Altschul S.F., Madden T.L., Schäffer A.A., Zhang J., Zhang Z., Miller W. and Lipman D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research, 25: 3389-3402.
160 Amann R.I., Ludwig W. and Schleifer K.H. 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiological Reviews, 59: 143-169.
American Public Health Association. 1995. Section 9215A and B. Standard methods for the examination of water and wastewater. 19th ed. Washington, D.C.: American Public Health Association.
American Society for Testing and Materials. (ASTM). 2000. Standard test methods for microbiological monitoring of water used for processing electron and microelectronic devices by direct pressure tap sampling valve and by the presterilised plastic bag method (F-1094). Annual Book of ASTM Standards, Vol. 10.04. West Conshohocken, PA: ASTM, 287-290.
American Society for Testing and Materials. (ASTM). 2000. Standard guide for ultrapure water used in the electronics and semiconductor industry (D-5127). Annual Book of ASTM Standards, Vol 11.01., West Conshohocken, PA: ASTM, 495-499.
Anderson R.L., Bland L.A., Favero M.S., McNeil M.M., Davis B.J., Mackel D.C. and Gravelle C.R. 1985. Factors associated with Pseudomonas pickettii intrinsic contamination of commercial respiratory therapy solutions marketed as sterile. Applied and Environmental Microbiology, 50: 1343-1348.
Anderson R.L., Holland B.W., Carr J.K., Bond W.W. and Favero M.S. 1990. Effect of disinfectants on Pseudomonas colonized on the interior surface of PVC pipes. American Journal of Public Health, 80: 17-21.
Andersson S.G.E. and Kurland C.G. 1998. Reductive evolution of resident genomes. Trends in Microbiology, 6: 263-268.
Antón A.I., Martínez-Murcia A.J. and Rodríguez-Valera F. 1998. Sequence diversity in the 16S-23S intergenic spacer region (ISR) of the rRNA operons in representatives of the Escherichia coli ECOR collection. Journal of Molecular Evolution, 47: 62-72.
161 Anzai Y., Kudo Y. and Oyaizu H. 1997. The phylogeny of the genera Chryseomonas, Flavimonas, and Pseudomonas supports synonymy of these three genera. International Journal of Systematic Bacteriology, 47: 249-251.
Arshak K., Adley C.C., Moore E., Cunniffe C., Campion M. and Harris J. 2007. Characterisation of polymer nanocomposite sensors for quantification of bacterial cultures. Sensors and Actuators B, 126: 226-231.
Austin S., Ziese M. and Sternberg N. 1981. A novel role for site-specific recombination in maintenance of bacterial replicons. Cell, 25: 729-736.
Ausubel F.M., Brent R., Kingston R.E., Moore D.D., Seidman J.G., Smith J.A. and Struhl K. 1997. Current Protocols in Molecular Biology. John Wiley & Sons, New York.
Baird R.M., Elhag K.M. and Shaw E.J. 1976. Pseudomonas thomasii in a hospital distilled-water supply. Journal of Medical Microbiology, 9: 493-495.
Barbut F., Kosmann M.J., Lalande V., Neyme D., Coppo P. and Gorin N.C. 2006. Outbreak of Ralstonia pickettii pseudobacteremia among patients with hematological malignancies. Infection Control and Hospital Epidemiology, 27: 642-644.
Baxter M. and Sieburth J.M. 1984. Metabolic and ultrastructural response to glucose of two eurtrophic bacteria isolated from seawater at different enriching concentrations. Applied and Environmental Microbiology, 47: 31-38.
Beaber J.W., Burrus V., Hochhut B. and Waldor M.K. 2002a. Comparison of SXT and R391, two conjugative integrating elements: Definition of a genetic backbone for the mobilization of resistance determinants. Cellular and Molecular Life Sciences, 59: 2065-2070.
Beaber J.W., Hochhut B. and Waldor M.K. 2002b. Genomic and functional analyses of SXT, an integrating antibiotic resistance gene transfer element derived from Vibrio cholerae. Journal of Bacteriology, 184: 4259-4269.
162 Beaber J.W., Hochhut B. and Waldor M.K. 2004. SOS response promotes horizontal dissemination of antibiotic resistance genes. Nature, 427: 72-74.
Beatson S.A., Whitchurch C.B., Sargent J.L., Levesque R.C. and Mattick J.S. 2002. Differential regulation of twitching motility and elastase production by Vfr in Pseudomonas aeruginosa. Journal of Bacteriology, 184: 3605-3613.
Bellingham N.F., Morgan J.A.W., Saunders J.R. and Winstanley C. 2001. Flagellin gene sequence variation in the genus Pseudomonas. Systemic and Applied Microbiology, 24: 157-165.
Bendtsen J.D., Nielsen H., von Heijne G. and Brunak S. 2004. Improved prediction of signal peptides: SignalP 3.0. Journal of Molecular Biology, 340: 783-795.
Benson D.A., Karsch-Mizrachi I., Lipman D.J., Ostell J. and Sayers E.W. 2009. GenBank. Nucleic Acids Research, 37: D26-31.
Berg D.E., Akopyants N.S. and Kersulyte D. 1994. Fingerprinting microbial genomes using the RAPD or AP-PCR method. Methods in Molecular and Cellular Biology, 5: 13-24.
Berg G., Roskot N. and Smalla K. 1999. Genotypic and phenotypic relationships between clinical and environmental isolates of Stenotrophomonas maltophilia. Journal of Clinical Microbiology, 37: 3594-3600.
Berg K.L., Squires C. and Squires C.L. 1989. Ribosomal RNA operon antitermination function of leader and spacer region box B-Box A sequences and their conservation in diverse microorganisms. Journal of Molecular Biology, 209: 345-358.
Berridge B.R., Fuller J.D., de Azavedo J., Low D.E., Bercovier H. and Frelier P.F. 1998. Development of specific nested oligonucleotide PCR primers for the Streptococcus iniae 16S-23S ribosomal DNA intergenic spacer. Journal of Clinical Microbiology, 36: 2778-2781.
163 Bignell C. and Thomas C.M. 2001. The bacterial ParA-ParB partitioning proteins. Journal of Biotechnology, 91: 1-34.
Blazevic D.J. and Ederer G.M. 1975. Principles of Biochemical Tests In: Diagnostic Microbiology. John Wiley and Sons USA.
Boltner B., MacMahon C., Pembroke J.T., Strike P. and Osborn A.M. 2002. R391: A conjugative integrating mosaic comprised of phage, plasmid, and transposon elements. Journal of Bacteriology, 184: 5158-5169.
Bonatto D., Matias F., Lisbôa M.P., Bogdawa H.M. and Henriques J.A.P. 2004. Production of Short Side Chain-Poly [Hydroxyalkanoate] by a Newly Isolated Ralstonia Pickettii Strain. World Journal of Microbiology and Biotechnology, 20: 395-403.
Bonheyo G., Graham D., Shoemaker N.B. and Salyers A.A. 2001. Transfer region of a Bacteroides conjugative transposon, CTnDOT. Plasmid, 45: 41-51.
Boucher C.A., Barberis P.A., Trigalet A.P. and Demery D.A. 1985. Transposon mutagenesis of Pseudomonas solanacearum: Isolation of Tn5-induced avirulent mutants. Journal of General Microbiology, 131: 2449-2457.
Boucher C.A., Barberis P.A., Trigalet A.P. and Demery D.A. 1985. Transposon mutagenesis of Pseudomonas solanacearum: Isolation of Tn5-induced avirulent mutants. Journal of General Microbiology, 131: 2449-2457.
Bourque S.N., Valero J.R., Lavoie M.C. and Levesque R.C. 1995. Comparative analysis of the 16S to 23S ribosomal intergenic spacer sequences of Bacillus thuringiensis strains and subspecies and of closely related species. Applied and Environmental Microbiology, 61: 1623-1626.
Boutros N., Gonullu N., Casetta A., Guibert M., Ingrand D. and Lebrun L. 2002. Ralstonia pickettii traced in blood culture bottles. Journal of Clinical Microbiology, 40: 2666-2667.
164 Bram R.J., Young R.A. and Steitz J.A. 1980. The ribonuclease III site flanking 23S sequences in the 30S ribosomal precursor RNA of Escherichia coli. Cell, 19: 393-401.
Brassinga A.K., Hiltz M.F., Sisson G.R., Morash M.G., Hill N., Garduno E., Edelstein P.H., Garduno R.A. and Hoffman P.S. 2003. A 65-kilobase pathogenicity island is unique to Philadelphia-1 strains of Legionella pneumophila. Journal of Bacteriology, 185: 4630-4637.
Brodinova N.S., Baskakova N.V., Moroz A.F., Vertiev Iu.V. and Mokrievich N.M. 1984. [Exotoxin A production during Pseudomonas aeruginosa PA-7 cultivation in Martin's broth.] Zhurnal Mikrobiologii, Epidemiologii, i Immunobiologii, 4:22-26. [Article in Russian]
Bruins M.R., Kapil S. and Oehme F.W. 2000. Pseudomonas pickettii: a common soil and groundwater aerobic bacteria with pathogenic and biodegradation properties. Ecotoxicology and Environmental Safety, 47: 105-111.
Bruins M.R., Kapil S. and Oehme F.W. 2003. Characterization of a small plasmid (pMBCP) from bovine Pseudomonas pickettii that confers cadmium resistance. Ecotoxicology and Environmental Safety, 54: 241-248.
Burgess B.K., Jacobs D.B. and Stiefel E.I. 1980. Large-scale purification of high activity Azotobacter vinelandii nitrogenase. Biochimica et Biophysica Acta, 614: 196- 209.
Burns J.L, Emerson J., Stapp J.R., Yim D.L., Krzewinski J., Louden L., Ramsey B.W. and Clausen C.R. 1998. Microbiology of sputum from patients at cystic fibrosis centers in the United States. Clinical Infectious Diseases, 27: 158-163.
Burrus V. and Waldor M.K. 2004. Shaping bacterial genomes with integrative and conjugative elements. Research in Microbiology, 155: 376-386. Burrus V., Marrero J. and Waldor M.K. 2006. The current ICE age: biology and evolution of SXT-related integrating conjugative elements. Plasmid, 55:173-183.
165 Burrus V., Pavlovic G., Decaris B. and Guédon G. 2002. Conjugative transposons: the tip of the iceberg. Molecular Microbiology, 46: 601-610.
Burrus V., Pavlovic G., Decaris B. and Guédon G. 2002. The ICESt1 element of Streptococcus thermophilus belongs to a large family of integrative and conjugative elements that exchange modules and change their specificity of integration. Plasmid, 48: 77-97.
Burrus V., Quezada-Calvillo R., Marrero J. and Waldor M.K. 2006. SXT-related integrating conjugative element in New World Vibrio cholerae. Applied and Environmental Microbiology, 72: 3054-3057.
Byrd J.J., Zeph L.R. and Casida L.E. 1985. Bacterial control of Agromyces ramosus in soil. Canadian Journal of Microbiology, 31: 1157-1163.
Cacciari I., Quatrini P., Zirletta G., Mincione E., Vinciguerra V., Lupattelli P. and Giovannozzi Sermanni G. 1993. Isotactic polypropylene biodegradation by a microbial community: physicochemical characterization of metabolites produced. Applied and Environmental Microbiology, 59: 3695-3700.
Candoni A., Trevisan R., Patriarca F., Silvestri F. and Fanin R. 2001. Pseudomonas pickettii (Biovar VA-II): a rare cause of bacteremias in haematologic patients. European Journal of Haematology, 66: 355-356.
Carlucci A.F., Shimp S.L. and Craven D.B. 1986. Growth characteristics of low- nutrient bacteria from the north-east and central Pacific Ocean. FEMS Microbiology Ecology, 38: 1-10.
Carrell D.T., Emery B.R. and Hamilton B. 2003. Seminal infection with Ralstonia pickettii and cytolysosomal spermophagy in a previously fertile man. Fertility and Sterility, 79 Suppl 3: 1665-1667.
Carson L.A., Favero M.S., Bond W.W. and Petersen N.J. 1973. Morphological, biochemical, and growth characteristics of Pseudomonas cepacia from distilled water. Applied Microbiology, 25: 476-483.
166
Carson L.A., Favero M.S., Bond W.W. and Peterson N.J. 1973. Morphological, biochemical, and growth characteristics of Pseudomonas cepacia from distilled water. Applied Microbiology, 25: 476-483.
Carver T.J., Rutherford K.M., Berriman M., Rajandream M.A., Barrell B.G., Parkhill J. 2005. ACT: the Artemis Comparison Tool. Bioinformatics, 21: 3422-3423.
Castro V.A., Thrasher A.N., Healy M., Ott C.M. and Pierson D.L. 2004. Microbial characterization during the early habitation of the International Space Station. Microbial Ecology, 47: 119-126.
Cavalieri S.J., Bohach G.A. and Snyder I.S. 1994. Escherichia coli α-haemolysin: characteristics and probable role in pathogenicity. Microbiology Reviews, 48: 326-343.
Chapin K.C. and Lauderdale T. 2003. Reagents, Stains and Media: Bacteriology. In Murray P.R., Baron E.J., Jorgensen J.H., Pfaller M.A. and Yolken R.H. eds., Manual of Clinical Microbiology, 8th ed. Washington, DC: ASM Press, 729-748.
Chen C.L., Liu W.T., Chong M.L., Wong M.T., Ong S.L., Seah H. and Ng W.J. 2004. Community structure of microbial biofilms associated with membrane-based water purification processes as revealed using a polyphasic approach. Applied Microbiology and Biotechnology, 63: 466-473.
Chen K., Neimark H., Rumore P. and Steinman C.R. 1989. Broad-range DNA probes for detecting and amplifying eubacterial nucleic acids. FEMS Microbiology Letters, 57: 19-24.
Chen W.M., Laevens S., Lee T.M., Coenye T., De Vos P., Mergeay M. and Vandamme P. 2001. Ralstonia taiwanensis sp. nov., isolated from root nodules of Mimosa species and sputum of a cystic fibrosis patient. International Journal of Systematic and Evolutionary Microbiology, 51: 1729-1735.
167 Cheng Q., Paszkiet B.J., Shoemaker N.B., Gardner J.F. and Salyers A.A. 2000. Integration and excision of a Bacteroides conjugative transposon, CTnDOT. Journal of Bacteriology, 182: 4035-4043.
Chetoui H., Melin P., Struelens M.J., Delhalle E., Nigo M.M., De Ryck R. and De Mol P. 1997. Comparison of biotyping, ribotyping, and pulsed-field gel electrophoresis for investigation of a common-source outbreak of Burkholderia pickettii bacteremia. Journal of Clinical Microbiology, 35: 1398-1403.
Chomarat M., Lepape A., Riou J.Y. and Flandrois J.P. 1985. Pseudomonas pickettii septicemia. Pathologie Biologie (Paris), 33: 55-56.
Churchward G. 2002. Conjugative transposons. In Craig N.L., Craigue R., Gellert M., Lambowitz A.M. eds., Mobile DNA II. Washington, DC: ASM Press, 177-191.
Clancy J.L. and Cimini L. 1991. Improved method for recovering bacteria from HPW water. Ultrapure Water, 8: 25-37.
Clarridge J.E. 2004. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clinical Microbiology Reviews, 17: 840-862.
Coenye T., Falsen E., Vancanneyt M., Hoste B., Govan J.R.W., Kersters K. and Vandamme P. 1999. Classification of Alcaligenes faecalis-like isolates from the environment and human clinical samples as Ralstonia gilardii sp. Nov. International Journal of Systematic and Evolutionary Microbiology, 49: 405-413.
Coenye T., Goris J., De Vos P., Vandamme P. and LiPuma J.J. 2003a. Classification of Ralstonia pickettii-like isolates from the environment and clinical samples as Ralstonia insidiosa sp. Nov. International Journal of Systematic and Evolutionary Microbiology, 53: 1075-1080.
Coenye T., Liu L., Vandamme P. and LiPuma J.J. 2001. Identification of Pandoraea species by 16S ribosomal DNA-based PCR assays. Journal of Clinical Microbiology, 39: 4452-4455.
168
Coenye T., Spilker T., Martin A. and LiPuma J.J. 2002b. Comparative assessment of genotyping methods for epidemiologic study of Burkholderia cepacia genomovar III. Journal of Clinical Microbiology, 40: 3300-3307.
Coenye T., Spilker T., Reik R., Vandamme P. and LiPuma J.J. 2005. Use of PCR Analyses To Define the Distribution of Ralstonia Species Recovered from Patients with Cystic Fibrosis. Journal of Clinical Microbiology, 43: 3463-3466.
Coenye T., Vandamme P. and LiPuma J.J. 2002a. Infection by Ralstonia species in cystic fibrosis patients: identification of R. pickettii and R. mannitolilytica by polymerase chain reaction. Emerging Infectious Diseases, 8: 692-696.
Coenye T., Vandamme P. and LiPuma J.J. 2003b. Ralstonia respiraculi sp. Nov., isolated from the respiratory tract of cystic fibrosis patients. International Journal of Systematic and Evolutionary Microbiology, 53: 1339-1342.
Coetzee J.N., Datta N. and Hedges R.W. 1972. R factors from Proteus rettgeri. Journal of General Microbiology, 72: 543-552.
Condon C., Squires C. and Squires C.L. 1995. Control of rRNA transcription in Escherichia coli. Microbiological Reviews, 59: 623-645.
Coote J.G. 1996. The RTX toxins of gram-negative bacterial pathogens: modulators of the host immune system. Reviews in Medical Microbiology, 7: 53-62.
Costas M., Holmes B., Sloss L.L. and Heard S. 1990. Investigation of a pseudo- outbreak of 'Pseudomonas thomasii' in a special-care baby unit by numerical analysis of SDS-PAGE protein patterns. Epidemiology and Infection, 105: 127-137.
Das M., Ganguly T., Chattoraj P., Chanda P.K., Bandhu A., Lee C.Y. and Sau S. 2007. Purification and characterization of repressor of temperate S. aureus phage phi11. Journal of Biochemical and Molecular Biology, 40: 740-748.
169 Davies D.G. and McFeters G.A. 1988. Growth and comparative physiology of Klebsiella oxytoca attached to GAC and in liquid media. Microbial Ecology, 15: 165- 175.
Davies D.G., Parsek M.R., Pearson J.P., Iglewski B.H., Costerton J.W. and Greenberg E.P. 1998. The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science, 280: 295-298.
Davis D.H., Doudoroff M., Stanier R.Y. and Mandel M. 1969. Proposal to reject the genus Hydrogenomonas: Taxonomic implications. International Journal of Systemic Bacteriology, 19: 375-390.
Daxboeck F., Stadler M., Assadian O., Marko E., Hirschl A.M. and Koller W. 2005. Characterization of clinically isolated Ralstonia mannitolilytica strains using random amplification of polymorphic DNA (RAPD) typing and antimicrobial sensitivity, and comparison of the classification efficacy of phenotypic and genotypic assays. Journal of Medical Microbiology, 54: 55-61.
De Baere T., Steyaert S., Wauters G., De Vos P., Goris J., Coenye T., Suyama T., Verschraegen G. and Vaneechoutte M. 2001. Classification of Ralstonia pickettii biovar 3/‘thomasii’ strains (Pickett 1994) and of new isolates related to nosocomial recurrent meningitis as Ralstonia mannitolytica sp. nov. International Journal of Systematic and Evolutionary Microbiology, 51: 547-558. de la Puente-Redondo V.A., del Blanco N.G., Gutiérrez-Martín C.B., García-Peña F.J. and Rodríguez Ferri E.F. 2000. Comparison of different PCR approaches for typing of Francisella tularensis strains. Journal of Clinical Microbiology, 38: 1016-1022.
Degeorges R., Teboul F., Belkheyar Z. and Oberlin C. 2005. Ralstonia pickettii osteomyelitis of the trapezium. Chirurgie de la Main, 24: 174-176.
Deming J.W. 1986. Ecological strategies of barophilic bacteria in the deep ocean. Microbiological Sciences, 3: 205-211.
170 Denton M. and Kerr K.G. 1998. Microbiological and clinical aspects of infection associated with Stenotrophomonas maltophilia. Clinical Microbiology Review, 11: 57- 80.
Dijkshoorn L. and Towner K.J. 2001. An introduction to the generation and analysis of microbial typing data. In Dijkshoorn L., Towner K.J. and Struelens M. eds. New approaches for the generation and analysis of microbial typing data. Elsevier: Amsterdam, 1-30.
Dimech W.J., Hellyar A.G., Kotiw M., Marcon D., Ellis S. and Carson M. 1993. Typing of strains from a single-source outbreak of Pseudomonas pickettii. Journal of Clinical Microbiology, 31: 3001-3006.
Dodge A.G., Richman J.E., Johnson G. and Wackett L.P. 2006. Metabolism of Thioamides by Ralstonia pickettii TA. Applied and Environmental Microbiology, 72: 7468-7476.
Döring G., Goldstein W., Röll A., Schiøtz P.O., Høiby N. and Botzenhart K. 1985 Role of Pseudomonas aeruginosa exoenzymes in lung infections of patients with cystic fibrosis. Infection and Immunity, 49: 557-562.
Doublet B., Boyd D., Mulvey M.R. and Cloeckaert A. 2005. The Salmonella genomic island 1 is an integrative mobilizable element. Molecular Microbiology, 55: 1911-1924.
Dowsett E. 1972. Hospital infections caused by contaminated fluid. Lancet, i, 1338.
Dziewit L., Jazurek M., Drewniak L., Baj J. and Bartosik D. 2007. The SXT conjugative element and linear prophage N15 encode toxin-antitoxin-stabilizing systems homologous to the tad-ata module of the Paracoccus aminophilus plasmid pAMI2. Journal of Bacteriology, 189: 1983-1997.
Ehling-Schulz M., Svensson B., Guinebretiere M.H., Lindbäck T., Andersson M., Schulz A., Fricker M., Christiansson A., Granum P.E., Märtlbauer E., Nguyen-The C., Salkinoja-Salonen M. and Scherer S. 2005. Emetic Toxin Formation of Bacillus cereus
171 is restricted to a single evolutionary lineage of closely related strains. Microbiology, 151: 183-197.
Elango V.K., Liggenstoffer A.S. and Fathepure B.Z. 2006. Biodegradation of vinyl chloride and cis-dichloroethene by a Ralstonia sp. strain TRW-1. Applied Microbiology and Biotechnology, 72: 1270-1275.
Elsner H.A, Dahmen G.P., Laufs R. and Mack D. 1998. Ralstonia pickettii involved in spinal osteitis in an immunocompetent adult. Journal of Infection, 36: 352.
Farrell A. and Quilty B. 1999. The influence of Burkholderia pickettii LD1 on the degradation of 2-chlorophenol by a wastewater bioaugmentation product. Biology and Environment: Proceedings of the Royal Irish Academy, 99B: 154.
Fass R.J and Barnishan J. 1976. Acute meningitis due to a Pseudomonas-like Group Va-1 bacillus. Annals of Internal Medicine, 84: 51-52.
Fava F., Armenante P.M. and Kafkewitz D. 1995. Aerobic degradation and dechlorination of 2-chlorophenol, 3-chlorophenol and 4-chlorophenol by a Pseudomonas pickettii strain. Letters in Applied Microbiology, 21: 307-312.
Favero M.S., Carson L.A., Bond W.W. and Petersen N.J. 1971. Pseudomonas aeruginosa: growth in distilled water from hospitals. Science, 173: 836-838. Felsenstein J. 1985. Confidence limit on phylogenies: an approach using the bootstrap. Evolution, 39: 783-791.
Fernandez C., Wilhelmi I., Andradas E., Gaspar C., Gomez J., Romero J., Mariano J.A., Corral O., Rubio M., Elviro J. and Fereres J. 1996. Nosocomial outbreak of Burkholderia pickettii infection due to a manufactured intravenous product used in three hospitals. Clinical Infectious Diseases, 22: 1092-1095.
Flavier A.B., Ganova-Raeva L.M., Schell M.A. and Denny T.P. 1997. Hierarchical autoinduction in Ralstonia solanacearum: control of acyl-homoserine lactone production by a novel autoregulatory system responsive to 3-hydroxypalmitic acid methyl ester. Journal of Bacteriology, 179: 7089-7097.
172
Fletcher M. 1985. Effect of solid surfaces on the activity of attached bacteria. In Fletcher M. and Savage D.V. eds. Bacterial adhesion: mechanisms and physiological significance. New York: Plenum Press, 339-362.
Forgie S., Kirkland T., Rennie R., Chui L. and Taylor G. 2007. Ralstonia pickettii bacteremia associated with pediatric extracorporeal membrane oxygenation therapy in a Canadian hospital. Infection Control and Hospital Epidemiology, 28: 1016-1018.
Fraser G.M. and Hughes C. 1999. Swarming motility. Current Opinion in Microbiology, 2: 630-635.
Frost L.S., Leplae R., Summers A.O. and Toussaint A. 2005. Mobile genetic elements: the agents of open source evolution. Nature Reviews Microbiology, 3: 722-732.
Fry J.C. 1990. Oligotrophs. In Edwards C., eds., Microbiology of extreme environments. Milton Keynes, United Kingdom: Open University Press, 93-116.
Fuchs B.M., Spring S., Teeling H., Quast C., Wulf J., Schattenhofer M., Yan S., Ferriera S., Johnson J., Glöckner F.O. and Amann R. 2007. Characterization of a marine gammaproteobacterium capable of aerobic anoxygenic photosynthesis. Proceedings of the National Academies of Science USA, 104: 2891-2896.
Fujita S., Yoshida T. and Matsubara F. 1981. Pseudomonas pickettii bacteremia. Journal of Clinical Microbiology, 13: 781-782.
Gao F. and Zhang C.T. 2006. GC-Profile: a web-based tool for visualizing and analysing the variation of GC content in genomic sequences. Nucleic Acids Research, 34: W686-W691.
Garcia J.L., Pichinoty F., Mandel M. and Greenway B. 1977. A new denitrifying saprophyte related to Pseudomonas pickettii. Annales de Microbiologie, 128A: 229- 237.
173 Garcia-Martinez J., Acinas S.G., Anton A.I. and Rodriguez-Valera F. 1999. Use of the 16S-23S ribosomal genes spacer region in studies of prokaryotic diversity. Journal of Microbiological Methods, 36: 55-64.
García-Martínez J., Martínez-Murcia A.J., Antón A.I. and Rodríguez-Valera F. 1996. Comparison of the small 16S to 23S intergenic spacer region (ISR) of the rRNA operons of some Escherichia coli strains of the ECOR collection and E. coli K-12. Journal of Bacteriology, 178: 6374-6377.
Gardner S. and Shulman S.T. 1984. A nosocomial common source outbreak caused by Pseudomonas pickettii. Pediatric Infectious Disease, 3: 420-422.
Garnier F., Taourit S., Glaser P., Courvalin P. and Galimand M. 2000. Characterization of transposon Tn1549, conferring VanB-type resistance in Enterococcus spp. Microbiology, 146: 1481-1489.
Garrity G.M. and Holt J.G. 2001. The road map to the Manual. In Boone D.R. and Castenholz R.W. eds., Bergey's Manual of Systematic Bacteriology, 2nd ed., Vol. 1, Berlin: Springer-Verlag, 119-166.
Gee J.E., Sacchi C.T., Glass M.B., De B.K., Weyan R.S., Levett P.N., Whitney A.M., Hoffmaster A.R. and Popovic T. 2003. Use of 16S rRNA Gene Sequencing for Rapid Identification and Differentiation of Burkholderia pseudomallei and B. mallei. Journal of Clinical Microbiology, 41: 4647-4654.
Gelbart S.M., Reinhardt G.F. and Greenlee H.B. 1976. Pseudomonas cepacia strains isolated from water reservoirs of unheated nebulizers. Journal of Clinical Microbiology, 3: 62-66.
Gerdes K., Moller-Jensen J. and Bugge Jensen R. 2000. Plasmid and chromosome partitioning: surprises from phylogeny. Molecular Microbiology, 37: 455-466.
Gerlitz M., Hrabak O. and Schwab H. 1990. Partitioning of broad-host-range plasmid RP4 is a complex system involving site-specific recombination. Journal of Bacteriology, 172: 6194-6203.
174
Ghigo J.M. 2001. Natural conjugative plasmids induce bacterial biofilm development. Nature, 412: 442-445.
Gilligan P.H. 1991. Microbiology of airway disease in patients with cystic fibrosis. Clinical Microbiology Reviews, 4: 35-51.
Gilligan P.H. and Whittier S. 1999. Burkholderia, Stenotrophomonas, Ralstonia, Brevundimonas, Comamonas, and Acidovorax. In Murray P.R., Baron E.J., Pfaller M.A., Tenover F.C. and Yolken R.H. eds., Manual of Clinical Microbiology, 7th edn., Washington DC: ASM Press, 526-538.
Gilligan P.H., Lum G., Vandamme P.A.R. and Whittier S. 2003. Burkholderia, Stenotrophomonas, Ralstonia, Brevundimonas, Comamonas, Delftia, Pandoraea and Acidovorax. In. Murray P.R., Baron E.J., Jorgensen J.H., Pfaller M.A. and Yolken R.H. eds., Manual of Clinical Microbiology, 8th edn., Washington, DC: ASM Press, 729- 748.
Gillis M., Van T., Bardin R. Goor M., Hebbar P., Willems A., Segers P., Kersters K., Heulin T. and Fernandez M. 1995. Polyphasic Taxonomy in the Genus Burkholderia Leading to an Emended Description of the Genus and Proposition of Burkholderia vietnamiensis sp. nov. for N2-Fixing Isolates from Rice in Vietnam. International Journal of Systemic Bacteriology, 45: 274-289.
Gilmour M.W., Thomson N.R., Sanders M., Parkhill J. and Taylor D.E. 2004. The complete nucleotide sequence of the resistance plasmid R478: defining the backbone components of incompatibility group H conjugative plasmids through comparative genomics. Plasmid, 52: 182-202.
Gilotra U. and Srivastava S. 1997. Plasmid-encoded sequestration of copper by Pseudomonas pickettii strain US321. Current Microbiology, 34: 378-381.
Girlich D., Naas T. and Nordmann P. 2004. OXA-60, a chromosomal, inducible, and imipenem-hydrolyzing class D beta-lactamase from Ralstonia pickettii. Antimicrobial Agents and Chemotherapy, 48: 4217-4225.
175
Glass M.B. and Popovic T. 2005. Preliminary evaluation of the API 20NE and RapID NF plus systems for rapid identification of Burkholderia pseudomallei and B. mallei. Journal of Clinical Microbiology, 43: 479-483.
Gomis-Ruth F.X., de la Cruz F. and Coll M. 2002. Structure and role of coupling proteins in conjugal DNA transfer. Research in Microbiology, 153: 199-204.
Goris J., De Vos P., Coenye T., Hoste B., Janssens D., Brim H., Diels L., Mergeay M., Kersters K. and Vandamme P. 2001. Classification of metal-resistant bacteria from industrial biotopes as Ralstonia campinensis sp. nov., Ralstonia metallidurans sp. nov. and Ralstonia basilensis Steinle et al., 1998 emend. International Journal of Systematic and Evolutionary Microbiology, 51: 1773-1782.
Governal R.A., Yahya M.T., Gerba C.P. and Shadman F. 1991. Oligotrophic bacteria in ultrapure water systems: media selection and process component evaluations. Journal of Industrial Microbiology, 8: 223-228.
Graber C.D., Jervey L.P., Ostrander W.E., Salley L.H. and Weaver R.E. 1968. Endocarditis due to a lanthanic, unclassified Gram-negative bacterium (group IV d). American Journal of Clinical Pathology, 49: 220-223.
Grosse C., Grass G., Anton A., Franke S., Santos A.N., Lawley B., Brown N.L. and Nies D.H. 1999. Transcriptional organization of the czc heavy-metal homeostasis determinant from Alcaligenes eutrophus. Journal of Bacteriology, 181: 2385-2393.
Gruber T.M. and Bryant D.A. 1997. Molecular systematic studies of eubacteria, using 70-type sigma factors of group 1 and group 2. Journal of Bacteriology, 179: 1734-1747.
Gstalder M.E., Faelen M., Mine N., Top E.M., Mergeay M. and Couturier M. 2003. Replication functions of new broad host range plasmids isolated from polluted soils. Research in Microbiology, 154: 499-509.
Gupta A., Vlamakis H., Shoemaker N. and Salyers A.A. 2003. A new Bacteroides conjugative transposon that carries an ermB gene. Applied Environmental
176 Microbiology, 69: 6455-6463.
Gürtler V. and Barrie H.D. 1995. Typing of Staphylococcus aureus strains by PCR- amplification of variable-length 16S-23S rDNA spacer regions: characterization of spacer sequences. Microbiology, 141: 1255-1265.
Gürtler V. and Mayall B.C. 2001. Genomic approaches to typing, taxonomy and evolution of bacterial isolates. International Journal of Systematic and Evolutionary Microbiology, 51: 3-16.
Gürtler V. and Stanisich V.A. 1996. New approaches to typing and identification of bacteria using the 16S-23S rDNA spacer. Microbiology, 142: 3-16.
Hagadorn J.I., Guthrie E., Atkins V.A., DeVine C.W. and Hamilton L. 1997. Neonatal aspiration pneumonitis and endotracheal colonization with Burkholderia pickettii following home water birth. Paediatrics, 100: 506-506 Suppl. S SEP.
Haigler B.E. and Spain J.C. 1991. Biotransformation of nitrobenzene by bacteria containing toluene degradative pathways. Applied and Environmental Microbiology, 57: 3156-3162.
Haigler B.E., Wallace W.H. and Spain J.C. 1994. Biodegradation of 2-nitrotoluene by Pseudomonas sp. strain JS42. Applied and Environmental Microbiology, 60: 3466- 3469.
Hales B.A., Morgan C., Hart A. and Winstanley C. 1998. Variation in flagellin genes and proteins of Burkholderia cepacia. Journal of Bacteriology, 180: 1110-1118.
Hanna S.L., Sherman N.E., Kinter M.T. and Goldberg J.B. 2000. Comparison of proteins expressed by Pseudomonas aeruginosa strains representing initial and chronic isolates from a cystic fibrosis patient: an analysis by 2-D gel electrophoresis and capillary column liquid chromatography-tandem mass spectrometry. Microbiology, 146: 2495-2508.
177 Hansen L.H., Johannesen E., Burmolle M., Sorensen A.H. and Sorensen S.J. 2004. Plasmid-encoded multidrug efflux-pump conferring resistance to olaquindox in Escherichia coli. Antimicrobial Agents and Chemotherapy, 48: 3332-3337.
Hansen W., Glupczynski G. and Yourassowsky E. 1982. Infections à Pseudomonas pickettii. Médecine et Maladies Infectieuses, 12: 507-511.
Harley J.P. and Prescott L.M. 1993. Laboratory Exercises in Microbiology. 2nd edn, Iowa: McGraw-Hill.
Harmsen D. and Karch H. 2004. 16S rDNA for diagnosing pathogens: a living tree. ASM News, 70: 19-24.
Harvey S., Hill C.W., Squires C. and Squires C.L. 1988. Loss of the spacer loop sequence from the rrnB operon in the Escherichia coli K12 subline that bears the relA1 mutation. Journal of Bacteriology, 170: 1235-1238.
Hattori R. and Hattori T. 1980. Sensitivity to salts and organic compounds of soil bacteria isolated on diluted media. Journal of General and Applied Microbiology, 26: 1- 14.
Hattori T. 1984. Physiology of soil oligotrophic bacteria. Microbiological Sciences, 1: 102-104.
Hauben L., Vauterin L., Swings J. and Moore E.R.B. 1997. Comparison of 16S ribosomal DNA sequences of all Xanthomonas species. International Journal of Systematic Bacteriology, 47: 328-335.
Hayward A.C. 1991. Biology and epidemiology of bacterial wilt caused by Pseudomonas solanacearum. Annual Review of Phytopathology, 29: 65-87.
Hayward A.C. 1994. Systematic and phylogeny of Pseudomonas solanacearum and related bacteria. In Hartman G.L., Hayward A., eds. Systematics and phylogeny of Pseudomonas solanacearum and related bacteria. Oxford, England: CAB International, 127-135.
178
Heagney M.A. 1998. An unusual Case of Bacterial Meningitis Caused by Burkholderia pickettii. Clinical Microbiology Newsletter, 20: 102-103.
Heard S., Lawrence S., Holmes B. and Costas M. 1990. A pseudo-outbreak of Pseudomonas on a special care baby unit. Journal of Hospital Infection, 16: 59-65.
Heeb S., Itoh Y., Nishijyo T., Schnider U., Keel C., Wade J., Walsh U., O'Gara F. and Haas D. 2000. Small, stable shuttle vectors based on the minimal pVS1 replicon for use in gram-negative, plant-associated bacteria. Molecular Plant-Microbe Interactions, 13: 232-237.
Hemachander C. and Puvanakrishnan R. 1999. Lipase from Ralstonia pickettii as an additive in laundry detergent formulations. Process Biochemistry, 35: 809-814.
Hemachander C., Bose N. and Puvanakrishnan R. 2001. Whole cell immobilization of Ralstonia pickettii for lipase production. Process Biochemistry, 36: 629-633.
Henley M. 1992. Sanitization or sterilization? It depends on the final use for the high- purity water. Ultrapure Water, 9: 15-21.
Henry D.A., Mahenthiralingam E., Vandamme P., Coenye T. and Speert D.P. 2001. Phenotypic methods for determining genomovar status of the Burkholderia cepacia complex. Journal of Clinical Microbiology, 39:1073-1078.
Higgins D., Thompson J., Gibson T., Thompson J.D., Higgins D.G. and Gibson T.J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22: 4673-4680.
Higgins D., Thompson J., Gibson T., Thompson J.D., Higgins D.G. and Gibson T.J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22: 4673-4680.
179 Hirase K. and Matsunaka S. 1991. Purification and properties of propanil hydrolase in Pseudomonas pickettii. Pesticide Biochemistry and Physiology, 39: 302-308.
Hochhut B. and Waldor M.K. 1999. Site-specific integration of the conjugal Vibrio cholerae SXT element into prfC. Molecular Microbiology, 32: 99-110.
Hoefel D., Monis P.T., Grooby W.L., Andrews S. and Saint C.P. 2005. Profiling bacterial survival through a water treatment process and subsequent distribution system. Journal of Applied Microbiology, 99: 175-186.
Houpikian P. and Raoult D. 2001. 16S-23S rRNA intergenic spacer region for phylogenetic analysis, identification, and subtyping of Bartonella species. Journal of Clinical Microbiology, 39: 2768-2778.
Hsueh P.R., Teng L.J., Yang P.C., Chen Y.C., Pan H.J., Ho S.W. and Luh K.T. 1998. Nosocomial infections caused by Sphingomonas paucimobilis: clinical features and microbiological characteristics. Clinical Infectious Disease, 26: 676-681.
Huang W.M. 1996. Bacterial diversity based on type II DNA topoisomerase genes. Annual Review of Genetics, 30: 79-107.
Huber B., Riedel K., Hentzer M., Heydorn A., Gotschlich A., Givskov M., Molin S. and Eberl L. 2001. The cep quorum-sensing system of Burkholderia cepacia H111 controls biofilm formation and swarming motility. Microbiology, 147: 2517-2528.
Hugh R. and Gilardi G.L. 1980. Pseudomonas. In Lennette, E.H. ed., Manual of Clinical Microbiology, Washington, DC: ASM Press, 289-317.
Hunter P.R. and Gaston M.A. 1988. Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. Journal of Clinical Microbiology, 26: 2465-2466.
Ikeda K., Toyota K. and Kimura M. 1998. Role of extracellular pectinases in the rhizoplane competence of a rhizobacterium Burkholderia pickettii MSP3RIF. Soil Biology and Biochemistry, 30: 323-329.
180
Ishida Y. and Kadota H. 1981. Growth patterns and substrate requirements of naturally occurring obligate oligotrophs. Microbial Ecology, 7: 123-130.
Ishida Y., Imai Y., Miyagai T. and Kadota H. 1982. Growth and uptake kinetics of a facultatively oligotrophic bacterium at low nutrient concentrations. Microbial Ecology, 8: 23-32.
Jaccard P. 1901. Étude comparative de la distribution florale dans une portion des Alpes et des Jura. Bulletin de la Socit Vaudoise des Sciences Naturelles, 37:547-579.
Jaeggi N.E. and Schmidt-Lorenz W. 1990. Bacterial regrowth in drinking water. Bacterial flora in fresh and stagnant water in drinking water purification and in the drinking water distribution system. Zentralblatt für Hygiene und Umweltmedizin, 190: 217-235.
Japp H., von Graevenitz A., Wust J. and Gilardi G.L. 1981. Septicemia caused by Pseudomonas VA-1. Clinical Microbiology Newsletter, 3: 124.
Jenni B., Realini L., Aragno M. and Tamer U. 1988. Taxonomy of non H2-lithotrophic, oxalate-oxidizing bacteria related to Alcaligenes eutrophus. Systematic and Applied Microbiology, 10: 126-133.
Jianlong W., Xiangchun Q., Liping H., Yi Q. and Hegemann W. 2002. Microbial degradation of quinoline by immobilized cells of Burkholderia pickettii. Water Research, 36: 2288-2296.
Ka J.O. and Tiedje J.M. 1994. Integration and excision of a 2,4-dichlorophenoxyacetic acid-degradative plasmid in Alcaligenes paradoxus and evidence of its natural intergeneric transfer. Journal of Bacteriology, 176: 5284-5289.
Ka J.O., Holben W.E. and Tiedje J.M. 1994a. Analysis of competition in soil among 2,4-dichlorophenoxyacetic acid-degrading bacteria. Applied and Environmental Microbiology, 60: 1121-1128.
181 Ka J.O., Holben W.E. and Tiedje J.M. 1994b. Use of gene probes to aid in recovery and identification of functionally dominant 2,4-dichlorophenoxyacetic acid-degrading populations in soil. Applied and Environmental Microbiology, 60: 1116-1120.
Kageyama C., Ohta T., Hiraoka K., Suzuki M., Okamoto T. and Ohishi K. 2005. Chlorinated aliphatic hydrocarbon-induced degradation of trichloroethylene in Wautersia numadzuensis sp. nov. Archives of Microbiology, 183: 56-65.
Kahan A., Philippon A., Paul G., Weber S., Richard C., Hazebroucq G. and Degeorges M. 1983. Nosocomial infections by chlorhexidine solution contaminated with Pseudomonas pickettii (Biovar VA-I). Journal of Infection, 7: 256-263.
Kahng H.Y., Byrne A.M., Olsen R.H. and Kukor J.J. 2000. Characterization and role of tbuX in utilization of toluene by Ralstonia pickettii PKO1. Journal of Bacteriology, 182: 1232-1242.
Kaneko T., Nakamura Y., Sato S., Asamizu E., Kato T., Sasamoto S., Watanabe A., Idesawa K., Ishikawa A., Kawashima K., Kimura T., Kishida Y., Kiyokawa C., Kohara M., Matsumoto, M., Matsuno A., Mochizuki Y., Nakayama S., Nakazaki N., Shimpo S., Sugimoto M., Takeuchi C., Yamada M. and Tabata S. 2000. Complete genome structure of the nitrogen-fixing symbiotic bacterium Mesorhizobium loti. DNA Research, 7: 331- 338.
Kano I., Castillo E., Darbouret D. and Mabic S. 2004. Using ultrapure water in ion chromatography to run analyses at the ng/L level. Journal of Chromatography A, 1039: 27-31.
Karlin S., Weinstock G.M. and Brendel V. 1995. Bacterial classifications derived from recA protein sequence comparisons. Journal of Bacteriology, 77: 6881-6893.
Kawai M., Matsutera E., Kanda H., Yamaguchi N., Tani K. and Nasu M. 2002. 16S ribosomal DNA-based analysis of bacterial diversity in purified water used in pharmaceutical manufacturing processes by PCR and denaturing gradient gel electrophoresis. Applied and Environmental Microbiology, 68: 699-704.
182 Kawai M., Yamagishi J., Yamaguchi N., Tani K. and Nasu M. 2004. Bacterial population dynamics and community structure in a pharmaceutical manufacturing water supply system determined by real-time PCR and PCR-denaturing gradient gel electrophoresis. Journal Applied Microbiology, 97: 1123-1131.
Kawamura Y., Li Y., Liu H., Huang X., Li Z. and Ezaki T. 2001. Bacterial population in Russian space station "Mir". Microbiology and Immunology, 45: 819-828.
Kayser W.V., Hickman K.C., Bond W.W., Favero M.S. and Carson LA. 1975. Bacteriological evaluation of an ultra-pure water-distilling system. Applied Microbiology, 30: 704-706.
Kendirli T., Ciftci E., Ince E., Incesoy S., Guriz H., Aysev A.D., Tutar E., Yavuz G. and Dogru U. 2004. Ralstonia pickettii outbreak associated with contaminated distilled water used for respiratory care in a paediatric intensive care unit. Journal of Hospital Infection, 56: 77-78.
Kerr K.G. 1994. The rap of REP-PCR-based typing systems. Reviews in Medical Microbiology, 5: 233-244.
Khambata S.R. and Bhat J.V. 1953. Studies on a new oxalate-decomposing bacterium, Pseudomonas oxalaticus. Journal of Bacteriology, 66: 505-507.
Kimbara K., Hashimoto T., Fukuda M., Koana T., Takagi M., Oishi M. and Yano K. 1989. Cloning and sequencing of two tandem genes involved in degradation of 2,3- dihydroxybiphenyl to benzoic acid in the polychlorinated biphenyl-degrading soil bacterium Pseudomonas sp. strain KKS102. Journal of Bacteriology, 171: 2740-2747.
Kimura A.C, Calvet H., Higa J.I., Pitt H., Frank C., Padilla G., Arduino M. and Vugia D.J. 2005. Outbreak of Ralstonia pickettii bacteremia in a neonatal intensive care unit. Pediatric Infectious Disease Journal, 24: 1099-1103.
Kimura M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16: 111-120.
183
King A., Holmes B., Phillips I. and Lapage S.P. 1979. A taxonomic study of clinical isolates of Pseudomonas pickettii, `P. thomasii' and `Group IVd' bacteria. Journal of General Microbiology, 114: 137-147.
Kismet E., Atay A.A., Demirkaya E., Aydin H.I., Aydogan H., Koseoglu V. and Gokcay E. 2005. Two cases of Ralstonia pickettii bacteremias in a pediatric oncology unit requiring removal of the Port-A-Caths. Journal of Pediatric Haematology and Oncology, 27: 37-38.
Kiyohara H., Hatta T., Ogawa Y., Kakuda T., Yokoyama H. and Takizawa N. 1992. Isolation of Pseudomonas pickettii strains that degrade 2, 4, 6-trichlorophenol and their dechlorination of chlorophenols. Applied and Environmental Microbiology, 58: 1276- 1283.
Koenig D.W. and Pierson D.L. 1997. Microbiology of the space shuttle water system. Water Science and Technology, 35: 59-64.
Kogan S.C., Doherty M. and Gitschier J. 1987. An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences. Application to Haemophilia A. New England Journal of Medicine, 317: 985-990.
Kohler T., Michea-Hamzehpour M., Henze U., Gotoh N., Curty L.K. and Pechere J.C. 1997. Characterization of MexE-MexF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa. Molecular Microbiology, 23: 345-354.
Konstantinidis K.T., Isaacs N., Fett J., Simpson S., Long D.T. and Marsh T.L. 2003. Microbial diversity and resistance to copper in metal-contaminated lake sediment. Microbial Ecology, 45: 191-202.
Kostman J.R., Alden M.B., Mair M., Edlind T.D., LiPuma J.J. and Stull T.L. 1995. A universal approach to bacterial molecular epidemiology by polymerase chain reaction ribotyping. Journal of Infectious Disease, 171: 204-208.
184 Kostman J.R., Edlind T.D., LiPuma J.J. and Stull T.L. 1992. Molecular epidemiology of Pseudomonas cepacia determined by polymerase chain reaction ribotyping. Journal of Clinical Microbiology, 30: 2084-2087.
Kotoujansky A., Lemattre M. and Boitard P. 1982. Utilization of a thermosensitive episome bearing transposon Tn10 to isolate Hfr donor strains of Erwinia carotovora subsp. chrysanthemi. Journal of Bacteriology, 150: 122-131.
Kukor J.J. and Olsen R.H. 1992. Complete nucleotide sequence of tbuD, the gene encoding phenol/cresol hydroxylase from Pseudomonas pickettii PKO1, and functional analysis of the encoded enzyme. Journal of Bacteriology, 174: 6518-6526.
Kulakov L.A., McAlister M.B., Ogden K.L., Larkin M.J. and O’Hanlon J.F. 2002. Analysis of bacteria contaminating ultrapure water in industrial systems. Applied and Environmental Microbiology, 68: 1548-1555.
Kuznetsov S.I., Dubinina G.A. and Lapteva N.A. 1979. Biology of oligotrophic bacteria. Annual Review of Microbiology, 33: 377-387.
La Duc M.T., Kern R. and Venkateswaran K. 2004. Microbial monitoring of spaceship and associated environments. Microbial Ecology, 47: 150-158.
Labarca J.A., Trick W.E., Peterson C.L., Carson L.A., Holt S.C., Arduino M.J., Meylan M., Mascola L. and Jarvis W.R. 1999. A multistate nosocomial outbreak of Ralstonia pickettii colonization associated with an intrinsically contaminated respiratory care solution. Clinical Infectious Diseases, 29: 1281-1286.
Lacey S. and Want S.V. 1991. Pseudomonas pickettii infections in a paediatric oncology unit. Journal of Hospital Infection, 17: 45-51.
Laffineur K., Janssens M., Charlier J., Avesani V., Wauters G. and Delmee M. 2002. Biochemical and susceptibility tests useful for identification of nonfermenting Gram- negative rods. Journal of Clinical Microbiology, 40: 1085-1087.
185 Lango Z. 1988. Ring-forming, oligotrophic Microcyclus organisms in the water and mud of Lake Balaton. Acta Microbiologica Hungarica, 35: 277-282.
Lapage S.P., Sneath P.H.A., Lessel E.F., Skerman V.B.D., Seeliger H.P.R. and Clark W.A. (eds) 1992. International Code of Nomenclature of Bacteria (1990 Revision). Bacteriological Code. Washington, DC: American Society for Microbiology.
Laslett D. and Canback B. 2004. ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences. Nucleic Acids Research, 32: 11-16.
Lawley D., Klimke W.A., Gubbins M.J. and Frost L.S. 2003. F factor conjugation is a true type IV secretion system. FEMS Microbiology Letters, 224: 1-15.
Lazarus H.M., Magalhaes-Silverman M., Fox R.M., Creger R.J., and Jacobs M. 1991. Contamination during in vitro processing of bone marrow for transplantation: clinical significance. Bone Marrow Transplantation, 7: 241-246.
Leahy J.G., Byrne A.M. and Olsen R.H. 1996. Comparison of factors influencing trichloroethylene degradation by toluene-oxidizing bacteria. Applied and Environmental Microbiology, 62: 825-833.
Leblond-Bourget N., Philippe H., Mangin I. and Decaris B. 1996. 16S rRNA and 16S to 23S internal transcribed spacer sequence analyses reveal inter- and intraspecific Bifodobacterium phylogeny. International Journal of Systematic Bacteriology, 46: 102- 111.
LeChevallier M.W., Babcock T.M. and Lee R.G. 1987. Examination and characterization of distribution system biofilms. Applied and Environmental Microbiology, 53: 2714-2724.
LeChevallier M.W., Schulz W. and Lee R.G. 1991. Bacterial nutrients in drinking water. Applied and Environmental Microbiology, 57: 857-862. Leone I., Chirillo M.G., Raso T., Zucca M. and Savoia D. 2008. Phenotypic and genotypic characterization of Pseudomonas aeruginosa from cystic fibrosis patients. European Journal of Clinical Microbiology and Infectious Disease, 27: 1093-1099.
186
Lewis J.A. and Hatfull G.F. 2001. Control of directionality in integrase mediated recombination: Examination of recombination directionality factors (RDFs) including Xis and Cox proteins. Nucleic Acids Research, 29: 2205-2216.
Li W.H. 1981. Simple method for constructing phylogenetic trees from distance matrices. Proceedings of the National Academy of Sciences USA, 78: 1085-1089.
Lin T.L., Lee C.Z., Hsieh P.F., Tsai S.F. and Wang J.T. 2008. Characterization of integrative and conjugative element ICEKp1-associated genomic heterogeneity in a Klebsiella pneumoniae strain isolated from a primary liver abscess. Journal of Bacteriology, 190: 515-526.
Lindbäck T. and Granum P.E. 2006. Detection and Purification of Bacillus cereus Enteretoxins. In Adley C.C ed. Methods in Biotechnology, Food-Borne Pathogens: Methods and Protocols. New Jersey: Humana Press Inc, 15-26.
Lindsay J.A. and Riley T.V. 1991. Susceptibility to desferrioxamine: a new test for the identification of Staphylococcus epidermidis. Journal of Medical Microbiology, 35: 45- 48.
Liu H., Kang Y, Genin S, Schell M.A. and Denny T.P. 2001. Twitching motility of Ralstonia solanacearum requires a type IV pilus system. Microbiology, 147: 3215- 3229.
Louws F.J., Fulbright D.W., Stephens C.T. and de Bruijn F.J. 1994. Specific genomic fingerprints of phytopathogenic Xanthomonas and Pseudomonas pathovars and strains generated with repetitive sequences and PCR. Applied and Environ mental Microbiology, 60: 2286-2295.
Louws F.J., Pacemaker J.L.W. and de Bruijn F.J. 1999. The three Ds of PCR-based genomic analysis of phytobacteria: diversity, detection and disease diagnosis. Annual Review of Phytopathology, 37: 81-125.
187 Luk W.K. 1996. An outbreak of pseudobacteremia caused by Burkholderia pickettii: the critical role of an epidemiological link. Journal of Hospital Infection, 34: 59-69.
Luz S.P., Rodriguez-Valera F., Lan R. and Reeves P.R. 1998. Variation of the ribosomal operon 16S-23S gene spacer region in representatives of Salmonella enterica subspecies. Journal of Bacteriology, 180: 2144-2151.
MacFaddin J.F. 2000. Gram-Negative bacteria. In MacFaddin J.F. ed., Biochemical Tests for Identification of Medical Bacteria, 3rd edn. Philadelphia: Lippincott, Williams and Wilkins, 640-7198.
Machado J., Grimont F. and Grimont P.A.D. 2000. Identification of Escherichia coli flagellar types by restriction of the amplified fliC gene. Research in Microbiology, 151: 535-546.
Mahendra S. and Alvarez-Cohen L. 2006. Kinetics of 1,4-dioxane biodegradation by monooxygenase-expressing bacteria. Environmental Science and Technology, 40: 5435- 5442.
Maki D.G., Klein B.S., McCormick R.D., Alvarado C.J., Zilz M.A., Stolz S.M., Hassemer C.A., Gould J. and Liegel A.R. 1991. Nosocomial Pseudomonas pickettii bacteremias traced to narcotic tampering. A case for selective drug screening of health care personnel. Journal of the American Medical Association, 265: 981-986.
Maki D.G., Klein B.S., McCormick R.D., Alvarado C.J., Zilz M.A., Stolz S.M., Hassemer C.A., Gould J. and Liegel A.R. 1991. Nosocomial Pseudomonas pickettii bacteremias traced to narcotic tampering. A case for selective drug screening of health care personnel. Journal of the American Medical Association, 265: 981-986.
Makkar N.S. and Casida Jr L.E. 1987. Cupriavidus necator gen. nov., sp. nov.: a nonobligate bacterial predator of bacteria in soil. International Journal of Systematic Bacteriology, 37: 323-326.
Marenda M., Barbe V., Gourgues G., Mangenot S., Sagne E. and Citti C. 2006. A new integrative conjugative element occurs in Mycoplasma agalactiae as chromosomal and
188 free circular forms. Journal of Bacteriology, 188: 4137-4141.
Maroye P., Doermann H.P., Rogues A.M., Gachie J.P. and Megraud F. 2000. Investigation of an outbreak of Ralstonia pickettii in a paediatric hospital by RAPD. Journal of Hospital Infection, 44: 267-272.
Marroni M., Pasticci M.B., Pantosti A., Colozza M.A., Stagni G. and Tonato M. 2003. Outbreak of infusion-related septicemia by Ralstonia pickettii in the Oncology Department. Tumori, 89: 575-576.
Marshall K.C. 1988. Adhesion and growth of bacteria at surfaces in oligotrophic environments. Canadian Journal of Microbiology, 34: 503-506.
Martin B., Humbert O., Camara M., Guenzi E., Walker J., Mitchell T., Andrew P., Prudhomme M., Alloing G., Hakenbeck R., Morrison D.A., Boulnois G.J. and Claverys J. 1992. A highly conserved repeated DNA element located in the chromosome of Streptococcus pneumoniae. Nucleic Acids Research, 20: 3479-3483.
Martino T.K., Hernandez J.M., Beldarrain T. and Melo L. 1998. Identification of bacteria in water for pharmaceutical use. Revista Latinoamericana de Microbiología, 40: 142-150.
Martyak J.E., Carmody J.C. and Husted G.R. 1993. Characterizing biofilm growth in deionised ultrapure water piping systems. Microcontamination, 1993: 39-44.
Massol-Deya A., Weller R., Rios-Hernandez L., Zhou J.Z., Hickey R.F. and Tiedje JM. 1997. Succession and convergence of biofilm communities in fixed-film reactors treating aromatic hydrocarbons in groundwater. Applied and Environmental Microbiology, 63: 270-376.
Matassova N.B., Rodnina M.V., Endermann R., Kroll H.P., Pleiss U., Wild H., and Wintermeyer W. 1999. Ribosomal RNA is the target for oxazolidinones, a novel class of translational inhibitors. RNA, 5: 939-946.
189 Matsuda N., Agui W. Tougou T., Sakai, H., Ogino K. and Abe M. 1996. Gram-negative bacteria viable in ultrapure water isolated from ultrapure water and effect of temperature on their behaviour. Colloids and Surfaces B: Bio interfaces, 5: 279-289.
McAlister M.B., Kulakov L.A, Larkin M.J. and Ogden K.L. 2001. Analysis of bacterial contamination in different sections of a high-purity water system. Ultrapure Water, 18: 18-26.
McAlister M.B., Kulakov L.A., O'Hanlon J.F., Larkin M.J. and Ogden K.L. 2002. Survival and nutritional requirements of three bacteria isolated from ultrapure water. Journal Industrial Microbiology and Biotechnology, 29: 75-82.
McClay K., Fox B.G. and Steffan R.J. 1996. Chloroform mineralisation by toluene- oxidizing bacteria. Applied and Environmental Microbiology, 62: 2716-2722.
McDonnell G.E. and McConnell D.J. 1994. Overproduction, isolation, and DNA- binding characteristics of Xre, the repressor protein from the Bacillus subtilis defective prophage PBSX. Journal of Bacteriology, 176: 5831-5834.
McFeters G.A., Broadaway S.C., Pyle B.H. and Egozy Y. 1993b. Distribution of bacteria within operating laboratory water purification systems. Applied and Environmental Microbiology, 59: 1410-1415.
McFeters G.A., Broadway S.C., Pyle B.H., Siu K.K. and Egozy Y. 1993a. Bacterial ecology of operating laboratory water purification systems. Ultrapure Water, 10: 32-37.
McGrath B.M. and Pembroke J.T. 2004. Detailed analysis of the insertion site of the mobile elements R997, pMERPH, R392, R705 and R391 in E. coli K12. FEMS Microbiology Letters, 237: 19-26.
McGrath B.M., O'Halloran J.A. and Pembroke J.T. 2005. Pre-exposure to UV irradiation increases the transfer frequency of the IncJ conjugative transposon-like elements R391, R392, R705, R706, R997 and pMERPH and is recA+ dependent. FEMS Microbiology Letters, 243: 461-465.
190 McGrath B.M., O'Halloran J.A., Piterina A.V. and Pembroke J.T. 2006. Molecular tools to detect the IncJ elements: a family of integrating, antibiotic resistant mobile genetic elements. Journal of Microbiological Methods, 66: 32-42.
McIlvaine B. 2006. Ultrapure Water: World Markets. McIlvaine Company. www.mcilvainecompany.com Alerts link. Accessed September 2008
McNeil M.M., Solomon S.L., Anderson R.L., Davis B.J., Soengler R.F., Reisberg B.E., Thornsberry C. and Marton W.J. 1985. Nosocomial Pseudomonas pickettii colonization associated with a contaminated respiratory therapy solution in a special care nursery. Journal of Clinical Microbiology, 22: 903-907.
Melin P., Struelens M., Mutsers J., Delporte J., Derycy R., Chetoui H., Demonty J. and De Mol P. 1995. Nosocomial outbreak of Pseudomonas pickettii bacteremia originating from intrinsically contaminated ‘sterile’ saline. 35th Interscience Conference on Antimicrobial Agents and Chemotherapy: San Francisco; Abstract J50.
Mergeay M., Houba C. and Gerits J. 1978. Extrachromosomal inheritance controlling resistance to cadmium, cobalt and zinc ions: evidence from curving in a Pseudomonas. Archives Internationales de Physiologie et de Biochimie, 86: 440-442.
Mergeay M., Monchy S., Vallaeys T., Auquier V., Benotmane A., Bertin P., Taghavi S., Dunn J., van der Lelie D. and Wattiez R. 2003. Ralstonia metallidurans, a bacterium specifically adapted to toxic metals: towards a catalogue of metal-responsive genes. FEMS Microbiology Reviews, 27: 385-410.
Merlin C., Mahillon J., Nesvera J. and Toussaint A. 2000. Gene recruiters and transporters: The modular structure of bacterial mobile element. In Thomas C.M. Ed. The Horizontal Gene Pool: Bacterial Plasmids and Gene Spread. Amsterdam: Harwood Academic, 363-408.
Merlin C., Springael D. and Toussaint A. 1999. Tn4371: a modular structure encoding a phage-like integrase, a Pseudomonas-like catabolic pathway and RP4/Ti-like transfer. Plasmid, 41: 40-54.
191 Minah G.E., Rednor J.L., Peterson D.E., Overholser C.D., Depaola L.G. and Suzuki JB. 1986. Oral succession of gram-negative bacilli in myelosuppressed cancer patients. Journal of Clinical Microbiology, 24: 210-213.
Minambres E., Eliecer Cano M., Zabalo M. and Garcia C. 2001. [Ralstonia pickettii pneumonia in an immunocompetent adult]. Medicina Clínica. (Barc), 117: 558. [in Spanish]
Mittleman M.W. 1995. Biofilm development in purified water systems. In Lappin-Scott H.M. and Costerton J.W. eds., Microbial Biofilms. Cambridge: University Press, 133- 147.
Mittleman M.W. 1985. Biological fouling of purified water systems. Bacterial growth and replication. Microcontamination, 3: 51-70.
Mittleman M.W. 1987a. Biofilm development in a closed-loop purified water system. Medical Device and Diagnostics Industry, 9: 50-75.
Mittleman M.W. 1987b. Biological fouling of purified water systems. In Mittleman M.W. and Geesey G.G. eds., Biological fouling of industrial water systems: a problem solving approach. San Diego, Calif: Water Micro Associates, 194-233.
Mittleman M.W. 1990. Bacterial growth and biofouling control in purified water systems. In: Flemming H.C. and Geesey G.G. eds., Biofouling and biocorrosion in industrial water systems. Berlin: Springer-Verlag, 133-154.
MMWR 1983. Pseudomonas pickettii colonization associated with a contaminated respiratory therapy solution-Illinois. Morbidity and Mortality Weekly Report, 32: 495- 496, 501.
MMWR 1998. Nosocomial Ralstonia pickettii colonization associated with intrinsically contaminated saline solution-Los Angeles, California. Morbidity and Mortality Weekly Report, 47: 285-286.
Mohd-Zain Z., Turner S.L., Cerdeño-Tárraga A.M., Lilley A.K., Inzana T.J., Duncan
192 A.J., Harding R.M., Hood D.W., Peto T.E. and Crook D.W. 2004. Transferable antibiotic resistance elements in Haemophilus influenzae share a common evolutionary origin with a diverse family of syntenic genomic islands. Journal of Bacteriology, 186: 8114-8122.
Moissenet D., Bidet P., Garbarg-Chenon A., Arlet G. and Vu-Thien H. 2001. Ralstonia paucula (Formerly CDC Group IV c-2): Unsuccessful Strain Differentiation with PCR- Based Methods, Study of the 16S-23S Spacer of the rRNA Operon, and Comparison with Other Ralstonia Species (R. eutropha, R. pickettii, R. gilardii, and R. solanacearum). Journal of Clinical Microbiology, 39: 381-384.
Moissenet D., Goujon C.P., Garbarg-Chenon A. and Vu-Thien H. 1999. CDC group IV c-2: a new Ralstonia species close to Ralstonia eutropha. Journal of Clinical Microbiology, 37: 1777-1781.
Morar P., Makura Z., Jones A., Baines P., Selby A., Hughes J. and van Saene R. 2000. Topical antibiotics on tracheostoma prevents exogenous colonization and infection of lower airways in children. Chest, 117: 513-518.
Moreira B.M., Leobons M.B., Pellegrino F.L., Santos M., Teixeira L.M., de Andrade Marques E., Sampaio J.L. and Pessoa-Silva C.L. 2005. Ralstonia pickettii and Burkholderia cepacia complex bloodstream infections related to infusion of contaminated water for injection. Journal of Hospital Infection, 60: 51-55.
Morihara K., Tsuzuki H., Oka T., Inoue H. and Ebata M. 1965. Pseudomonas aeruginosa elastase. Journal of Biological Chemistry, 240: 3295-3304.
Mukhopadhyay C., Bhargava A. and Ayyagari A. 2003. Ralstonia mannitolilytica infection in renal transplant recipient: First report. Indian Journal of Medical Microbiology, 21: 284-286.
Mullany P., Roberts A.P. and Wang H. 2002. Mechanism of integration and excision in conjugative transposons. Cellular and Molecular Life Sciences, 59: 2017-2022.
193 Munoz-Najar U. and Vijayakumar M.N. 1999. An operon that confers UV resistance by evoking the SOS mutagenic response in streptococcal conjugative transposon Tn5252. Journal of Bacteriology, 181: 2782-2788.
Nagarkar P.P., Ravetkar S.D. and Watve M.G. 2001. Oligophilic Bacteria as tools to monitor aseptic pharmaceutical production units. Applied and Environmental Microbiology, 67: 1371-1374.
NCCLS, (National Committee for Clinical Laboratory Standards). Performance standards for antimicrobial susceptibility testing; Eleventh informational supplement; NCCLS document M100-S11. NCCLS, Wayne, Pennsylvania, 2001.
NCCLS, (National Committee for Clinical Laboratory Standards). Performance standards for antimicrobial disk susceptibility tests – Seventh Edition; approved standard. NCCLS document M2-A7. NCCLS, Wayne, Pennsylvania, 2000.
Nicholas K.B., Nicholas H.B. Jr., and Deerfield D.W. 1997. GeneDoc: Analysis and Visualization of Genetic Variation, Embnew News, 4: 14.
Nishi A., Tominaga K. and Furukawa K. 2000. A 90-kilobase conjugative chromosomal element coding for biphenyl and salicylate catabolism in Pseudomonas putida KF715. Journal of Bacteriology, 182: 1949-1955.
Nordmann P., Poirel L., Kubina M., Casetta A. and Naas T. 2000. Biochemical-genetic characterization and distribution of OXA-22, a chromosomal and inducible class D beta-lactamase from Ralstonia (Pseudomonas) pickettii. Antimicrobial Agents and Chemotherapy, 44: 2201-2204.
Normand P., Ponsonnet C., Nesme X., Neyra M. and Simonet P. 1996. ITS analysis of prokaryotes. In Molecular Microbial Ecology Manual, Springer, 1-12.
Nunes-Düby S.E., Kwon H.J., Tirumalai R.S., Ellenberger T, and Landy A. 1998. Similarities and differences among 105 members of the Int family of site-specific recombinases. Nucleic Acids Research, 26: 391-406.
194 O'Halloran J.A., McGrath B.M. and Pembroke J.T. 2007. The orf4 gene of the enterobacterial ICE, R391, encodes a novel UV-inducible recombination directionality factor, Jef, involved in excision and transfer of the ICE. FEMS Microbiology Letters, 272: 99-105.
Oie S. and Kamiya A. 1996. Bacterial contamination of commercially available ethacridine lactate (acrinol) products. Journal of Hospital Infection, 34: 51-58.
Oie S., Oomaki M., Yorioka K., Tatsumi T., Amasaki M., Fukuda T., Hakuno H., Nagano K., Matsuda M., Hirata N., Miyano N. and Kamiya A. 1998. Microbial contamination of 'sterile water' used in Japanese hospitals. Microbial contamination of 'sterile water' used in Japanese hospitals. Journal of Hospital Infection, 38: 61-65.
Olive D.M. and Bean P. 1999. Principles and applications of methods for DNA-based typing of microbial organisms. Journal of Clinical Microbiology, 37: 1661-1669.
Osborn A.M. and Böltner D. 2002. When phage, plasmids, and transposons collide: genomic islands, and conjugative- and mobilizable-transposons as a mosaic continuum. Plasmid, 48: 202-212.
Osorio C.R., Marrero J., Wozniak R.A., Lemos M.L., Burrus V. and Waldor M.K. 2008. Genomic and functional analysis of ICEPdaSpa1, a fish pathogen derived SXT- related ICE that can mobilize a virulence plasmid. Journal of Bacteriology, 190: 3353- 3361.
Overhage J., Bains M., Brazas M.D. and Hancock R.E. 2008. Swarming of Pseudomonas aeruginosa is a complex adaptation leading to increased production of virulence factors and antibiotic resistance. Journal of Bacteriology, 190: 2671-2679.
Owen R.J. 2004. Bacterial taxonomics: finding the wood through the phylogenetic trees. Methods in Molecular Biology, 266: 353-383.
Pace N.R. 1997. A molecular view of microbial diversity and the biosphere. Science, 276: 734-740.
195 Pan H.J., Teng L.J., Tzeng M.S., Chang S.C., Ho S.W., Luh K.T. and Hsieh W.C. 1992. Identification and typing of Pseudomonas pickettii during an episode of nosocomial outbreak. Zhonghua Min Guo Wei Sheng Wu Ji Mian Yi Xue Za Zhi, 25: 115-123.
Paraskaki I., Lebassi E., Kafetzis D.A., Deliyianni V. and Papadatos J. 1995. Pseudomonas pickettii bacteremia in a Pediatric Intensive Care Unit. Acta Microbiologica Hellenica, 40: 502-507.
Parent K. and Mitchell P. 1978. Cell wall-defective variants of Pseudomonas-like (group Va) bacteria in Crohn's disease. Gastroenterology, 75: 368-372.
Pasticci M.B., Baldelli F., Camilli R., Cardinali G., Colozza A., Marroni M., Morosi S., Pantosti A., Pitzurra L., Repettos A., Bistoni F. and Stagni G. 2005. Pulsed field gel electrophoresis and random amplified polymorphic DNA molecular characterization of Ralstonia pickettii isolates from patients with nosocomial central venous catheter related bacteremia. New Microbiologica, 28: 145-149.
Patterson M.K., Husted G.R., Rutkowski A., and Mayette D.C. 1991. Isolation, identification and microscopic properties of biofilms in high-purity water distribution systems. Ultrapure Water, 8: 18-23.
Paul J.H. and Sullivan M.B. 2005. Marine phage genomics: what have we learned? Current Opinion in Biotechnology, 16: 299-307.
Pellegrino F.L., Schirmer M., Velasco E., de Faria L.M., Santos K.R. and Moreira B.M. 2008. Ralstonia pickettii Bloodstream Infections at a Brazilian Cancer Institution. Current Microbiology, 56: 219-223.
Pembroke J.T. and Piterina A.V. 2006. A novel ICE in the genome of Shewanella putrefaciens W3-18-1: comparison with the SXT/R391 ICE-like elements. FEMS Microbiology Letters. 264: 80-88.
Penna V.T, Martins S.A. and Mazzola P.G. 2002. Identification of bacteria in drinking and purified water during the monitoring of a typical water purification system. BMC Public Health, 2: 2-13.
196
Penner G.A., Bush A., Wise R., Kim W., Domier L., Kasha K., Laroche A., Scoles G., Molnar S.J. and Fedak G. 1993. Reproducibility of random amplified polymorphic DNA (RAPD) analysis among laboratories. PCR Methods and Applications, 2: 341- 345.
Perez del Molino M.L. and Garcia-Ramos R. 1989. Pseudomonas paucimobilis in purified water for hospital use. Journal of Hospital Infection, 14: 373-374.
Pernodet J.L., Simonet J.M. and Guérineau M. 1984. Plasmids in different strains of Streptomyces ambofaciens: Free and integrated form of plasmid pSAM2, Molecular and General Genetics, 198: 35-41.
Peters S.E., Hobman J.L., Strike P. and Ritchie D.A. 1991. Novel mercury resistance determinants carried by IncJ plasmids pMERPH and R391. Molecular and General Genetics, 228: 294-299.
Pfister P., Risch M., Brodersen D.E. and Böttger E.C. 2003. Role of 16S rRNA helix 44 in ribosomal resistance to hygromycin, B. Antimicrobial Agents and Chemotherapy, 47: 496-1502.
PhEur (European Pharmacopoeia 5.0). 2005. Monographs: Ligugé: Aubin France, 2692- 2698.
Phillips I. and Eykyn S. 1972. Contaminated drip fluids. British Medical Journal, 1: 746.
Phillips I., Eykyn S. and Laker M. 1972. Outbreak of hospital infection caused by contaminated autoclaved fluids. Lancet, 2: 1258-1260.
Pickard D., Wain J., Baker S., Line A., Chohan S., Fookes M., Barron A., Gaora P.A., Chabalgoity J.A., Thanky N., Scholes C., Thomson N., Quail M., Parkhill J. and Dougan G. 2003. Composition, acquisition, and distribution of the Vi exopolysaccharide-encoding Salmonella enterica pathogenicity island SPI-7. Journal of Bacteriology, 185: 5055-5065.
197
Pickett M.J. 1994. Typing of strains from a single-source outbreak of Pseudomonas pickettii. Journal of Clinical Microbiology, 32: 1132-1133.
Pickett M.J. and Greenwood J.R. 1980. A study of the Va-1 group of Pseudomonas and its relationship to Pseudomonas pickettii. Journal of General Microbiology, 120: 439- 446.
Pisabarro A., Correia A. and Martín J. 1998. Characterization of the rrnB operon of the plant pathogen Rhodococcus fascians and targeted integrations of exogenous genes at rrn loci. Applied and Environmental Microbiology, 64: 1276-1282.
Poty F., Denis C. and Baufine-Ducrocq H. 1987. Nosocomial Pseudomonas pickettii infection. Danger of the use of ion-exchange resins. La Presse Médicale, 16: 1185- 1187.
Proudy I., Bougle D., Coton E., Coton M., Leclercq R. and Vergnaud M. 2008. Genotypic characterization of Enterobacter sakazakii isolates by PFGE, BOX-PCR and sequencing of the fliC gene. Journal of Applied Microbiology, 104: 26-34.
Qiu X., Gurkar A.U. and Lory S. 2006. Interstrain transfer of the large pathogenicity island (PAPI-1) of Pseudomonas aeruginosa. Proceedings of the National Academy of Sciences USA, 103: 19830-19835.
Ralston E., Palleroni N.J. and Doudoroff M. 1973. Pseudomonas pickettii, a new species of clinical origin related to Pseudomonas solanacearum. International Journal of Systematic Bacteriology, 23: 15-19.
Ramsay J.P., Sullivan J.T., Stuart G.S., Lamont I.L. and Ronson C.W. 2006. Excision and transfer of the Mesorhizobium loti R7A symbiosis island requires an integrase IntS, a novel recombination directionality factor RdfS, and a putative relaxase RlxS. Molecular Microbiology, 62: 723-734.
198 Rashid M.H. and Kornberg A. 2000. Inorganic polyphosphate is needed for swimming, swarming, and twitching motilities of Pseudomonas aeruginosa. Proceedings of the National Academies of Sciences USA, 97: 4885-4890.
Rauch P.J. and De Vos W.M. 1992. Characterization of the novel nisin-sucrose conjugative transposon Tn5276 and its insertion in Lactococcus lactis. Journal of Bacteriology, 174: 1280-1287.
Ravatn R., Studer S., Springael D., Zehnder A.J. and van der Meer J.R. 1998. Chromosomal integration, tandem amplification, and deamplification in Pseudomonas putida F1 of a 105-kilobase genetic element containing the chlorocatechol degradative genes from Pseudomonas sp. strain B13. Journal of Bacteriology, 180: 4360-4369.
Raveh D., Simhon A., Gimmon Z., Sacks T. and Shapiro M. 1987. Infections caused by Pseudomonas pickettii in association with permanent indwelling intravenous devices: four cases and a review. Clinical Infectious Diseases, 17: 877-880.
Reasoner D.J. and Geldreich E.E. 1985. A new medium for the enumeration and subculture of bacteria from potable water. Applied and Environmental Microbiology, 49: 1-7.
Regnault C., Kano I., Darbouret D. and Mabic S. 2004. Ultrapure water for liquid chromatography-mass spectrometry studies. Journal of Chromatography A, 1030: 289- 295.
Relman D.A. 1999. The search for unrecognized pathogens. Science, 284:1308-1310. Riley P.S. and Weaver R.E. 1975. Recognition of Pseudomonas pickettii in the clinical laboratory: biochemical characterization of 62 strains. Journal of Clinical Microbiology, 1: 61-64.
Roberts A.P., Chandler M., Courvalin P., Guédon G., Mullany P., Pembroke T., Rood J.I., Smith C.J., Summers A.O., Tsuda M. and Berg D.E. 2008. Revised Nomenclature for Transposable Genetic Elements. Plasmid, 60:167-173.
199 Roberts A.P., Johanesen P.A., Lyras D., Mullany P. and Rood J.I. 2001. Comparison of Tn5397 from Clostridium difficile, Tn916 from Enterococcus faecalis and the CW459tet (M) element from Clostridium perfringens shows that they have similar conjugation regions but different insertion and excision modules. Microbiology, 147: 1243-1251.
Roberts L.A., Collignon P.J., Cramp V.B., Alexander S., McFarlane A.E. Graham E., Fuller A., Sinickas V., Hellyar A. 1990. An Australia-wide epidemic of Pseudomonas pickettii bacteremia due to contaminated "sterile" water for injection. Medical Journal of Australia, 152: 652-655.
Roberts S.J., Eden-Green S.J., Jones P. and Ambler D.J. 1990. Pseudomonas syzygii sp. nov., the cause of Sumatra disease of cloves. Systematic and Applied Microbiology, 13: 34-43.
Ross J.I., Eady E.A., Cove J.H. and Cunliffe W.J. 1998. 16S rRNA mutation associated with tetracycline resistance in a gram-positive bacterium. Antimicrobial Agents and Chemotherapy, 42: 1702-1705.
Roth A., Fischer M., Hamid M.E., Michalke S., Ludwig W. and Mauch H. 1998. Differentiation of phylogenetically related slowly growing mycobacteria based on 16S- 23S rRNA gene internal transcribed spacer sequences. Journal of Clinical Microbiology, 36: 139-147.
Rozen S. and Skaletsky H.J. 2000. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S. and Misener S. eds. Bioinformatics Methods and Protocols: Methods in Molecular Biology. Totowa, NJ: Humana Press, 365-386.
Ryan F.J. 1959 Bacterial mutation in a stationary phase and the question of cell turnover. Journal of General Microbiology, 21: 33-53.
Ryan M.P., Pembroke J.T. and Adley C.C. 2006. Ralstonia pickettii: a persistent gram- negative nosocomial infectious organism. Journal of Hospital Infection, 62: 278-284.
200 Sahin N., Isik K., Tamer A.U. and Goodfellow M. 2000. Taxonomic position of ‘Pseudomonas oxalaticus’ strain Ox14T (DSM 1105T) (Khambata and Bhat, 1953) and its description in the genus Ralstonia as Ralstonia oxalatica comb. Nov. Systematic and Applied Microbiology, 23: 206-209.
Saitou N. and Nei M. 1987. The neighbour-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4: 406-425.
Salanoubat M., Genin S., Artiguenave F., Gouzy J., Mangenot S., Arlat M., Billault A., Brottier P., Camus J.C., Cattolico L., Chandler M., Choisne N., Claudel-Renard C., Cunnac S., Demange N., Gaspin C., Lavie M., Moisan A., Robert C., Saurin W., Schiex T., Siguier P., Thébault P., Whalen M., Wincker P., Levy M., Weissenbach J. and Boucher C.A. 2002. Genome sequence of the plant pathogen Ralstonia solanacearum. Nature, 415: 497-502.
Saltikov C.W., Cifuentes A., Venkateswaran K. and Newman D.K. 2003. The ars detoxification system is advantageous but not required for As(V) respiration by the genetically tractable Shewanella species strain ANA-3. Applied and Environmental Microbiology, 69: 2800-2809.
Salyers A.A., Shoemaker N.B., Stevens A.M. and Li L.Y. 1995. Conjugative transposons: An unusual and diverse set of integrated gene transfer elements. Microbiology Reviews, 59: 579-590.
Sambrook J., Fritsch E.F and Maniatis T. 1989. Molecular cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press.
Sawada H., Takeuchi T. and Matsuda I. 1997. Comparative analysis of Pseudomonas syringae pv. actinidae and pv. phaseicola based on phaseolotoxin-resistant ornithine carbamoyltransferase gene (argK) and 16S-23S rRNA intergenic spacer sequences. Applied and Environmental Microbiology, 63: 282-288.
Schleheck D., Knepper T.P., Fischer K. and Cook A.M. 2004. Mineralization of individual congeners of linear alkylbenzenesulfonate by defined pairs of heterotrophic bacteria. Applied and Environmental Microbiology, 70: 4053-4063.
201
Schönfeld J., Heuer H., Van Elsas J.D. and Smalla K. 2003. Specific and sensitive detection of Ralstonia solanacearum in soil on the basis of PCR amplification of fliC fragments. Applied and Environmental Microbiology, 69: 7248-7256.
Schröder G. and Lanka E. 2005. The mating pair formation system of conjugative plasmids-A versatile secretion machinery for transfer of proteins and DNA. Plasmid. 54:1-25.
Schubert S., Dufke S., Sorsa J. and Heesemann J. 2004. A novel integrative and conjugative element (ICE) of Escherichia coli: the putative progenitor of the Yersinia high-pathogenicity island. Molecular Microbiology, 51: 837-848.
Scott J.R., Bringel F., Marra D., van Alstine G. and. Rudy, C.K. 1994. Conjugative transposition of Tn916: Preferred targets and evidence for conjugative transfer of a single strand and for a double-stranded circular molecule. Molecular Microbiology, 11: 1099-1108.
Sekine M., Tanikawa, S., Omata S., Saito M., Fujisawa T., Tsukatani N., Tajima T., Sekigawa T., Kosugi H., Matsuo Y., Nishiko R., Imamura K., Ito M., Narita H., Tago S., Fujita N. and Harayama S. 2006. Sequence analysis of three plasmids harboured in Rhodococcus erythropolis strain PR4. Environmental Microbiology, 8: 334-346.
Sentchilo V., Ravatn R., Werlen C., Zehnder A.J. and van der Meer J.R. 2003. Unusual integrase gene expression on the clc genomic island in Pseudomonas sp. strain B13. Journal of Bacteriology, 185: 4530-4538.
Seo S.T. and Tsuchiya K. 2005. Genotypic characterization of Burkholderia cenocepacia strains by rep-PCR and PCR-RFLP of the fliC gene. FEMS Microbiology Letters, 245: 19-24.
Shah D. S. H., Perehinec T., Stevens S.M., Aizawa S. and Sockett R.E. 2000. The flagellar filament of Rhodobacter sphaeroides: pH-induced polymorphic transitions and analysis of the fliC gene. Journal of Bacteriology, 182: 5218-5224.
202 Sharma O.P., Dawra R.K., Datta A.K. and Kanwar S.S. 1997. Biodegradation of lantadene A, the pentacyclic triterpenoid hepatotoxin by Pseudomonas pickettii. Letters Applied Microbiology, 24: 229-232.
Sharp J.O., Wood T.K. and Alvarez-Cohen L. 2005. Aerobic biodegradation of N- nitrosodimethylamine (NDMA) by axenic bacterial strains. Biotechnology and Bioengineering, 89: 608-618.
Sillman C.E. and Casida L.E. 1986. Isolation of non-obligate bacterial predators from soil. Canadian Journal of Microbiology, 32: 760-762.
Smart C.D., Schneider B., Blomquist C.L., Guerra L.J., Harrison N.A., Ahrens U., Lorenz K.H., Seemüller E. and Kirkpatrick B.C. 1996. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region. Applied and Environmental Microbiology, 62: 2988-2993.
Smith C.J., Tribble G.D. and Bayley D.P. 1998. Genetic elements of Bacteroides species: a moving story. Plasmid, 40:12-29.
Smith E.F. 1896. A bacterial disease of the tomato, eggplant and Irish potato (Bacillus solanacearum). Bulletin of the US Division of Vegetable Physiology and Pathology, 12.
Smith I., Dubnau D., Morrell P. and Marmur J.1968. Chromosomal location of DNA base sequences complementary to transfer RNA and to 5S, 16S and 23S ribosomal RNA in Bacillus subtilis. Journal of Molecular Biology, 33: 123-140.
Smith J.J., Offord L.C., Holderness M. and Saddler G.S. 1995. Genetic diversity of Burkholderia solanacearum (synonym Pseudomonas solanacearum) race 3 in Kenya. Applied and Environmental Microbiology, 61: 4263-4268.
Sneath P.H.A. and Sokal R.R. 1973. Numerical taxonomy: The principles and practice of numerical classification. San Francisco, Calif: W.H. Freeman & Co.
203 Sokol P.A., Ohman D.E. and Iglewski B.H. 1979. A more sensitive plate assay for detection of protease production by Pseudomonas aeruginosa. Journal of Clinical Microbiology, 9: 538-540.
Spangenberg C., Heuer T., Bürger C. and Tümmler B. 1996. Genetic diversity of flagellins of Pseudomonas aeruginosa. FEBS Letters, 396: 213-217.
Springael D., Diels L. and Mergeay M. 1994. Transfer and expression of PCB- degradative genes into heavy metal resistant Alcaligenes eutrophus strains. Biodegradation, 5: 343-357.
Springael D., Kreps S. and Mergeay M. 1993. Identification of a catabolic transposon, Tn4371, carrying biphenyl and 4-chlorobiphenyl degradation genes in Alcaligenes eutrophus A5. Journal of Bacteriology, 175: 1674-1681.
Stahl D.A., Key R., Flesher B., and Smit J. 1992. The phylogeny of marine and freshwater caulobacters reflects their habitat. Journal of Bacteriology, 174: 2193-2198.
Steinle P., Stucki G., Stettler R. and Hanselmann K.W. 1998. Aerobic mineralization of 2, 6-dichlorophenol by Ralstonia sp. strain RK1. Applied Environmental Microbiology, 64: 2566-2571.
Sterk P., Kulikova T., Kersey P. and Apweiler R. 2008. The EMBL Nucleotide Sequence and Genome Reviews Databases. Methods in Molecular Biology, 406: 1-22.
Sudo H., Hisada Y., Ito M., Kotaki H. and Minami A. 2005. Burkholderia pickettii spondylitis. Spinal Cord, 43: 499-502.
Sullivan J.T., Trzebiatowski, J.R., Cruickshank R.W., Gouzy J., Brown S.D., Elliot R.M., Fleetwood D.J., McCallum N.G., Rossbach U., Stuart G.S., Weaver J.E., Webby R.J., de Bruijn F.J. and Ronson C.W. 2002. Comparative sequence analysis of the symbiosis island of Mesorhizobium loti strain R7A. Journal of Bacteriology, 184: 3086- 3095.
204 Tacao M., Alves A., Saavedra M.J. and Correia A. 2005. BOX-PCR is an adequate tool for typing Aeromonas spp. Antonie Van Leeuwenhoek, 88: 173-179.
Tada Y. and Inoue T. 2000. Use of oligotrophic bacteria for the biological monitoring of heavy metals. Journal of Applied Microbiology, 88: 154 -160.
Tada Y., Ihmori M. and Yamaguchi J. 1995. Oligotrophic bacteria isolated from clinical materials. Journal of Clinical Microbiology, 33: 493-494.
Tada Y., Kobata T. and Nakaoka C. 2001. A simple and easy method for the monitoring of environmental pollutants using oligotrophic bacteria. Letters in Applied Microbiology, 32: 12-15.
Takizawa N., Yokoyama H., Yanagihara K., Hatta T. and Kiyohara H. 1995. A locus of Pseudomonas pickettii DTP0602, had, that encodes 2,4,6-trichlorophenol-4- dechlorinase with hydroxylase activity, and hydroxylation of various chlorophenols by the enzyme. Journal of Fermentation and Bioengineering, 80: 318-326.
Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 24: 1596-1599.
Tasteyre A., Karjalainen T., Avesani V., Delmee M., Collignon A., Bourlioux P. and Barc M.C. 2000. Phenotypic and genotypic diversity of the flagellin gene (fliC) among Clostridium difficile isolates from different serogroups. Journal of Clinical Microbiology, 38: 3179-3186.
Tatum H.W., Ewing W.H. and Weaver R.E. 1974. Miscellaneous Gram-negative bacteria. In Manual of Clinical Microbiology, 2nd edn. In Lennette E.H., Spaulding E.H. and Truant J.P. Washington DC ASM Press, 270-294.
Thompson J.D., Higgins D.G. and Gibson T.J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22: 4673-4680.
205
Thompson J.D., Higgins D.G. and Gibson T.J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22: 4673-4680.
Thorne J.L., Kishino H. and Painter I.S. 1998. Estimating the rate of evolution of the rate of molecular evolution. Molecular Biology and Evolution, 15: 1647-1657.
Timm W.D., Pfaff S.J., Land G.L., Warshauer D.L. and Dorff G.L. 1995. An outbreak of multi- drug resistant Pseudomonas pickettii pneumonia in a neonatal intensive care unit. 35th Interscience Conference on Antimicrobial Agents and Chemotherapy: San Francisco; Abstract J49.
Timm W.D., Pfaff S.J., Land G.L., Warshauer D.L. and Dorff G.L. 1995. An outbreak of multi- drug resistant Pseudomonas pickettii pneumonia in a neonatal intensive care unit. 35th ICAAC: San Francisco; Abstract J49.
Tortoli E. 2003. Impact of genotypic studies on mycobacterial taxonomy: the new mycobacteria of the 1990s. Clinical Microbiology Reviews, 16: 319-354.
Toussaint A. and Merlin C. 2002. Mobile elements as a combination of functional modules. Plasmid, 47: 26-35.
Toussaint A., Merlin C., Monchy S., Benotmane M.A., Leplae R., Mergeay M. and Springael D. 2003. The biphenyl- and 4-chlorobiphenylcatabolic transposon Tn4371, a member of a new family of genomic islands related to IncP and Ti plasmids. Applied and Environmental Microbiology, 69: 4837-4845.
Trotter J.A., Kuhls T.L., Pickett D.A., Reyes de la Rocha S. and Welch D.F. 1990. Pneumonia caused by a newly recognized pseudomonad in a child with chronic granulomatous disease. Journal of Clinical Microbiology, 28: 1120-1124.
T'Sjoen G., Verschraegen G., Steyaert S. and Vogelaers D. 2001. Avoidable "fever of unknown origin" due to Ralstonia pickettii bacteremia. Acta Clinica Belgica, 56: 51-54.
206
Tyler K.D., Wang G., Tyler S.D. and Johnson W.M. 1997. Factors affecting reliability and reproducibility of amplification-based DNA fingerprinting of representative bacterial pathogens. Journal of Clinical Microbiology, 35: 339-346.
Tyler S.D., Strathdee C.A., Rozee K.R. and Johnson W.M. 1995. Oligonucleotide primers designed to differentiate pathogenic pseudomonads on the basis of the sequencing of genes coding for 16S-23S rRNA internal transcribed spacers. Clinical and Diagnostic Laboratory Immunology, 2: 448-453.
Ueda K., Seki T., Kudo T., Yoshida T. and Kataoka M. 1999. Two distinct mechanisms cause heterogeneity of 16S rRNA. Journal of Bacteriology, 181:78-82.
Van der Beek D., Magerman K., Bries G., Mewis A., Declercq P., Peeters V., Rummens J.L., Raymaekers M. and Cartuyvels R. 2005. Infection with Ralstonia insidiosa in two patients. Clinical Microbiology Newsletter, 27: 159-161. van der Lelie D., Schwuchow T., Schwidetzky U., Wuertz S., Baeyens W., Mergeay M. and Nies D.H. 1997. Two-component regulatory system involved in transcriptional control of heavy-metal homoeostasis in Alcaligenes eutrophus. Molecular Microbiology, 23: 493-503. van Pelt C., Verduin C.M., Goessens W.H., Vos M.C., Tummler B., Segonds C., Reubsaet F., Verbrugh H. and van Belkum A. 1999. Identification of Burkholderia spp. in the clinical microbiology laboratory: comparison of conventional and molecular methods. Journal of Clinical Microbiology, 37: 2158-2164.
Vandamme P. and Coenye T. 2004. Taxonomy of the genus Cupriavidus: a tale of lost and found. International Journal of Systematic and Evolutionary Microbiology, 54: 2285-2289.
Vandamme P., Goris J., Coenye T., Hoste B., Janssens D., Kersters K., De Vos P. and Falsen E. 1999. Assignment of Centers for Disease Control group IVc-2 to the genus Ralstonia as Ralstonia paucula sp. nov. International Journal of Systematic and Evolutionary Microbiology, 49: 663-669.
207
Vandamme P., Pot B., Gillis M., de Vos P., Kersters K. and Swings J. 1996. Polyphasic taxonomy, a consensus approach to bacterial systematics. Microbiology Reviews, 60: 407-438.
Vaneechoutte M., De Baere T., Wauters G., Steyaert S., Claeys G., Vogelaers D. and Verschraegen G. 2001. One case each of recurrent meningitis and hemoperitoneum infection with Ralstonia mannitolilytica. Journal of Clinical Microbiology, 39: 4588- 4590.
Vaneechoutte M., De Baere T., Wauters G., Steyaert S., Claeys G., Vogelaers D. and Verschraegen G. 2001. One case each of recurrent meningitis and hemoperitoneum infection with Ralstonia mannitolilytica. Journal of Clinical Microbiology, 39: 4588- 4590.
Vaneechoutte M., Kampfer P., De Baere T., Falsen E. and Verschraegen G. 2004. Wautersia gen. nov., a novel genus accommodating the phylogenetic lineage including Ralstonia eutropha and related species, and proposal of Ralstonia [Pseudomonas] syzygii (Roberts et al.,. 1990) comb. nov. International Journal of Systematic and Evolutionary Microbiology, 54: 317-327.
Verschraegen G., Claeys G., Meeus G. and Delanghe M. 1985. Pseudomonas pickettii as a cause of pseudobacteremia. Journal of Clinical Microbiology, 21: 278-279.
Vincze T., Posfai J. and Roberts R.J. 2003. NEBcutter: a program to cleave DNA with restriction enzymes. Nucleic Acids Research, 31: 3688-3691.
Vitaliti S.M., Maggio M.C., Cipolla D., Corsello G. and Mammina C. 2008. Neonatal Sepsis Caused by Ralstonia pickettii. Pediatric Infectious Disease Journal, 27: 283-283. von Wintzingerode F., Schattke A., Siddiqui R.A., Rösick U., Göbel U.B. and Gross R. 2001. Bordetella petrii sp. nov., isolated from an anaerobic bioreactor, and emended description of the genus Bordetella. International Journal of Systemic and Evolutionary Microbiology, 51: 1257-1265.
208 Wainwright M., Barakah F., al-Turk I. and Ali T. 1991. Oligotrophic organisms in industry, medicine and the environment. Science Progress, 75: 313-322.
Walcott R.R., Fessehaie A. and Castro A.C. 2004. Differences in pathogenicity between two genetically distinct groups of Acidovorax avenae subsp. citrulli on cucurbit hosts. Journal of Phytopathology, 152: 277-285.
Waldor M.K. and Mekalanos J.J. 1996. Lysogenic conversion by a filamentous phage encoding cholera toxin. Science, 272: 1910-1914.
Wang H., Roberts A.P., Lyras D., Rood J.I., Wilks J.I. and Mullany P. 2000. Characterization of the ends and target sites of the novel conjugative transposon Tn5397 from Clostridium difficile: Excision and circularization is mediated by the large resolvases TndX. Journal of Bacteriology, 182: 3775-3783.
Watanabe K., Nelson J., Harayama S. and Kasai H. 2001. ICB database: the gyrB database for identification and classification of bacteria. Nucleic Acids Research, 29: 344-345.
Watanabe K., Takihana N., Aoyagi H., Hanada S., Watanabe Y., Ohmura N., Saiki H. and Tanaka H. 2005. Symbiotic association in Chlorella culture. FEMS Microbiology Ecology, 51: 187-196.
Welsh J. and McClelland M. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Research, 18: 7213-7218.
Wertheim W.A. and Markovitz D.M. 1992. Osteomyelitis and intervertebral discitis caused by Pseudomonas pickettii. Journal of Clinical Microbiology, 30: 2506-2508.
White D.C. and Mittleman M.W. 1990. Biological fouling of high purity waters: mechanisms and consequences of bacterial growth and replication. In Proceedings of the Ninth Annual Semiconductor Pure Water Conference, 17 and 18 January 1990, Santa Clara, Calif, 150-171.
209 Williams J.G., Kubelik A.R., Livak K.J., Rafalski J.A. and Tingey S.V. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research, 18: 6531-6535.
Williams K., Phillips K.D. and Willis A.T. 1987. A simple and sensitive method for detecting bacterial elastase production. Letters in Applied Microbiology, 7: 173-176.
Winstanley C. 2003. Improved flagellin genotyping in the Burkholderia cepacia complex. FEMS Microbiology Letters, 229: 9-14.
Winstanley C. and Morgan J.A. 1997. The bacterial flagellin gene as a biomarker for detection, population genetics and epidemiological analysis. Microbiology, 43: 3071- 8304.
Woese C.R 1987. Bacterial evolution. Microbiology Review, 51: 221-271.
Woese C.R., Gutell R., Gupta R. and Noller H.F. 1983. Detailed analysis of the higher- order structure of 16S-like ribosomal ribonucleic acids. Microbiological Reviews, 47: 621-669.
Woo P.C., Wong S.S. and Yuen K.Y. 2002. Ralstonia pickettii bacteremia in a cord blood transplant recipient. New Microbiology, 25: 97-102.
Yabannavar A.V. and Zylstra G.J. 1995. Cloning and characterization of the genes for p-nitrobenzoate degradation from Pseudomonas pickettii YH105. Applied and Environmental Microbiology, 61: 4284-4290.
Yabuuchi E., Kawamura Y., Kosako Y. and Ezaki T. 1998. Emendation of genus Achromobacter and Achromobacter xylosoxidans (Yabuuchi and Yano) and proposal of Achromobacter ruhlandii (Packer and Vishniac) comb. nov., Achromobacter piechaudii (Kiredjian et al.) comb. nov., and Achromobacter xylosoxidans subsp. denitrificans (Rüger and Tan) comb. nov. Microbiology and Immunology, 42: 429-438.
Yabuuchi E., Kosako Y., Oyaizu H., Yano I., Hotta H., Hashimoto Y., Ezaki T. and Arakawa M. 1992. Proposal of Burkholderia gen. nov. and transfer of seven species of
210 the genus Pseudomonas homology group II to the new genus, with the type species Burkholderia cepacia (Palleroni and Holmes 1981) comb. nov. Microbiology and Immunology, 36: 1251-1275.
Yabuuchi E., Kosako Y., Yano I., Hotta H. and Nishiuchi Y. 1995. Transfer of two Burkholderia and an Alcaligenes species to Ralstonia gen. Nov.: Proposal of Ralstonia pickettii (Ralston, Palleroni and Doudoroff 1973) comb. Nov., Ralstonia solanacearum (Smith 1896) comb. Nov. and Ralstonia eutropha (Davis 1969) comb. Nov. Microbiology and Immunology, 39: 897-904.
Yabuuchi E., Yano I., Oyaizu H., Hashimoto Y., Ezaki T. and Yammoto H. 1990. Proposals of Sphingomonas paucimobilis gen. nov. and comb. nov., paucimobilis: a Sphingomonas parapaucimobilis sp. nov., Sphingomonas yanoikuyae sp. nov., Sphingomonas adhaesiva sp. nov., Sphingomonas capsulata comb. nov., and two genospecies of the genus Sphingomonas paucimobilis. Microbiology and Immunology, 34: 99-119.
Yamamoto S., Kasai H., Arnold D.L., Jackson R.W., Vivian A. and Harayama S. 2000. Phylogeny of the genus Pseudomonas: intrageneric structure reconstructed from the nucleotide sequences of gyrB and rpoD genes. Microbiology, 146: 2385-2394.
Yanagita T., Ichikawa T., Tsuji T., Kamata Y., Ito K. and Sasaki M. 1978. Two trophic groups of bacteria, oligotrophs and eutrophs: their distributions in fresh and seawater areas in the central northern Japan. Journal of General and Applied Microbiology, 24: 59-88.
Yoneyama A., Yano H., Hitomi S., Okuzumi K., Suzuki R. and Kimura S. 2000. Ralstonia pickettii colonization of patients in an obstetric ward caused by a contaminated irrigation system. Journal of Hospital Infection, 46: 79-80.
Young R.A., Macklis R. and Steiz J.A. 1979. Sequence of the 16S-23S spacer region in two ribosomal RNA operons of Escherichia coli. Journal of Biological Chemistry, 254: 3264-3271.
211 Yuen K.H., Ng F.H., Mok K.Y. and Ng W.F. 1998. Monomicrobial nonneutrocytic bacterascites due to Burkholderia pickettii. American Journal of Gastroenterology, 93: 2308-2309.
Zavaleta A.I., Martínez-Murcia A.J. and Rodríguez-Valera F. 1996. 16S-23S rDNA intergenic sequences indicate that Leuconostoc oenos is phylogenetically homogeneous. Microbiology, 142: 2105-2114.
Zdobnov E.M. and Apweiler R. 2001. InterProScan-an integration platform for the signature-recognition methods in InterPro. Bioinformatics, 17: 847-848.
Zellweger C., Bodmer T., Tauber M.G. and Muhlemann K. 2004. Failure of ceftriaxone in an intravenous drug user with invasive infection due to Ralstonia pickettii. Infection, 32: 246-248.
Zeph L.R. and Casida L.E. 1986. Gram-negative versus Gram-positive (actinomycete) bacterial predators of bacteria in soil. Applied and Environmental Microbiology, 52: 819-823.
Zuschneid I., Stolze H., Wickmann L., Liebeskind A.K., Ruden H. and Weist K. 2006. An outbreak of Ralstonia pickettii infections in a pediatric hematology/oncology unit. International Journal of Medical Microbiology, 296: 58-58 Suppl. 42.
212
Appendices
Appendix 1: NCBI accession number of 16S rDNA genes in Figure 1.1
Table A1-1: Strain number and NCBI accession number of Ralstonia spp., and Cupriavidus spp. and other species used to create phylogenetic tree in Figure 1.1.
Species Strain No. Accession No. Ralstonia pickettii ATCC27512 X67042 Ralstonia solanacearum ATCC11696 X67036 Ralstonia syzygii ATCC49543 AB021403 Ralstonia mannitolilytica LMG6866 AJ270258 Ralstonia insidiosa LMG21421 AF488779 Cupriavidus necator LMG8453 AF191737 Cupriavidus respiraculi LMG21510 AF500583 Cupriavidus metallidurans LMG1995 Y10824 Cupriavidus pauculus LMG3413 AF085226 Cupriavidus basilensis DSM18990 AF312022 Cupriavidus taiwanensis LMG19424 AF300324 Cupriavidus campinensis LMG19282 AF312020 Cupriavidus oxalaticus LMG2235 AF155567 Cupriavidus gilardii LMG5886 AF076645 Cupriavidus pinatubonensis CIP108725 AB121221 Cupriavidus laharis CIP108726 AB054961 Cupriavidus numadzuensis DSM15562 AB104530 Pandoraea apista LMG16407 AF139173 Burkholderia cepacia ATCC24516 AF097530
214 Appendix 2: Antimicrobial sensitivity testing, zone diameter interpretation based on Pseudomonas (NCCLS 2001)
Antimicrobial Agent Zone Diameter Nearest Whole mm R I S Mezlocillin (MEZ 75 µg) <15 - >16 (Penicillin’s) Ticarcillin (TIC 75 µg) <14 - >15 (ß-Lactam) Tetracycline (TE 30 µg) <14 15-18 >19 (Tetracycline) Ofloxacin (OFX 5 µg) <12 13-15 >16 (Fluoroquinolones) Sulphamethoxazole (SXT 25 µg) <12 13-16 >17 (Folllate pathway inhibitors) Cefotaxime (CTX 30 µg) <14 15-22 >23 (Cephems) Chloramphenicol (C 30 µg) <12 13-17 >18 (Phenicols) Gentamicin (CN 10 µg) <12 13-14 >15 (Aminoglycosides) Ciprofloxacin (CIP 5 µg) <15 16-20 >21 (Fluoroquinolones)
215 Appendix 3: Protocol for NucleoSpin Kit
Protocol for direct purification of PCR products using NucleoSpin Kit
1. Adjust DNA binding conditions: mix two volumes of buffer NT with one volume of sample. 2. Bind DNA: place a NucleoSpin® Extract II column into a 2ml collecting tube and load the sample. Centrifuge for 1 min at 11,000 rpm. Discard flow-through and place the NucleoSpin® Extract II column back into the collecting tube. 3. Wash silica membrane: add 600 µL buffer NT3. Centrifuge for 1 min at 11,000 rpm. Discard flow-through and place the NucleoSpin® Extract II column back into the collecting tube. 4. Dry silica membrane: Centrifuge for 2 min at 11,000-x g to remove buffer NT3 quantitatively. 5. Elute DNA: place the NucleoSpin® Extract II column into a clean 1.5 ml microcentrifuge tube. Add 15-50 µL elution buffer NE, incubate at room temperature for 1 min to increase he yield of eluted DNA. Centrifuge for 1 min at 11,000 rpm
216 Appendix 4: 16S-23S ISR RFLP Gels
This appendix contains the gels for the 16S-23S ISR RFLP of the of the other strains not shown above
Fig A4-1: AluI 2 Digest of 16S-23S ISR of R. pickettii isolates Fig A4-2: AluI 3 Digest of 16S-23S ISR of R. pickettii isolates Fig A4-3: AluI 4 Digest of 16S-23S ISR of R. insidiosa isolates
Fig A4-4: HaeIII 1 Digest of 16S-23S ISR of R. pickettii isolates Fig A4-5: HaeIII 3 Digest of 16S-23S ISR of R. pickettii isolates
Fig A4-6: TaqI 2 Digest of 16S-23S ISR of R. pickettii isolates Fig A4-7: TaqI 3 Digest of 16S-23S ISR of R. pickettii isolates Fig A4-8: TaqI 4 Digest of 16S-23S ISR of R. insidiosa isolates
Fig A4-9: CfoI 2 Digest of 16S-23S ISR of R. pickettii isolates Fig A4-10: CfoI 3 Digest of 16S-23S ISR of R. pickettii isolates
217 Fig A4-1: AluI 2 Digest of 16S-23S ISR of R. pickettii isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. ULI193 R. pickettii (61.70% 0050577 API20NE) (98.38% 400614 Remel) 3. ULI796 R. pickettii (60.00% 1241455 API20NE) (98.34% 404614 Remel) 4. ULI791 R. pickettii (56.90% 0044455 API20NE) (99.99% 404414 Remel) 5. ULI790 R. pickettii (44.80% 0255455 API20NE) (98.34% 404614 Remel) 6. ULI818 R. pickettii (39.50% 1045555 API20NE) (99.94% 400414 Remel) 7. ULI804 R. pickettii (24.50% 0055455 API20NE) (98.34% 404614 Remel) 8. ULI159 R. pickettii (0.00% 1200004 API20NE) (99.94% 400414 Remel) 9. ULI806 R. pickettii (0.00% 1044444 API20NE) (99.99% 404414 Remel) 10. ULI167 R. pickettii (0.00% 1050555 API20NE) (99.94% 400414 Remel) 11. Marker- Hyperladder II (Bioline 50-2000bp) 12. ULI162 R. pickettii (0.00% 1145455 API20NE) (99.99% 404414 Remel) 13. ULC298 R. pickettii (90.10% 0051574 API20NE) (99.99% 404414 Remel) 14. ULC297 R. pickettii (70.03% 0050557 API20NE) (99.94% 400414 Remel) 15. ULC277 R. pickettii (61.70% 0050577 API20NE) (99.99% 404414 Remel) 16. ULC244 R. pickettii (56.70% 0050555 API20NE) (99.94% 400414 Remel) 17. ULC193 R. pickettii (56.70% 0050555 API20NE) (99.99% 404414 Remel) 18. ULC194 R. pickettii (56.70% 0050555 API20NE) (99.99% 404414 Remel) 19. ULC421 R. pickettii (28.50% 0045455 API20NE) (99.99% 404414 Remel) 20. Marker- Hyperladder II (Bioline 50-2000bp)
Analysis of the sequences of R. pickettii 16S to 23S ISR available in the GenBank database indicated that two bands of approximately 120 bp are presenting the samples. As these are close together they cannot be seen on the gel.
218 Fig A4-2: AluI 3 Digest of 16S-23S ISR of R. pickettii isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. ULM001 R. pickettii (95.10% 1041455 API20NE) (99.99% 404416 Remel) 3. ULM002 R. pickettii (95.10% 1041455 API20NE) (99.99% 404416 Remel) 4. ULM003 R. pickettii (88.60% 1041457 API20NE) (99.28% 400406 Remel) 5. ULM004 R. pickettii (91.10% 1041555 API20NE) (99.99% 404416 Remel) 6. ULM005 R. pickettii (95.10% 1040455 API20NE) (00.00% 600416 Remel) 7. ULM006 R. pickettii (95.10% 1040455 API20NE) (99.28% 400406 Remel) 8. ULM007 R. pickettii (95.10% 1040455 API20NE) (99.99% 404416 Remel) 9. ULM010 R. pickettii (99.40% 1041575 API20NE) (99.94% 400414 Remel) 10. ULM011 R. pickettii (99.40% 1041575 API20NE) (99.99% 404414 Remel) 11. ULM011 R. pickettii (99.40% 1041575 API20NE) (99.99% 404414 Remel) 12. Marker- Hyperladder II (Bioline 50-2000bp)
Analysis of the sequences of R. pickettii 16S to 23S ISR available in the GenBank database indicated that two bands of approximately 120 bp are presenting the samples. As these are close together they cannot be seen on the gel.
219 Fig A4-3: AluI 4 Digest of 16S-23S ISR of R. insidiosa isolates
1. Marker- Hyperladder I (Bioline 200-10000bp) 2. R. insidiosa LMG21421 (61.70% 0050577 API20NE) (99.94% 400414 Remel) 3. R. pickettii (insidiosa) ATCC49129 (92.40% 0040475 API20NE) (99.99% 404414 Remel) 4. ULI821 R. pickettii (insidiosa) (84.10% 0045455 API20NE) (99.94% 400414 Remel) 5. ULI785 R. pickettii (insidiosa) (53.10% 0045457 API20NE) (99.99% 404414 Remel) 6. ULI181 R. pickettii (insidiosa) (39.50% 1045555 API20NE) (99.99% 404414 Remel) 7. ULI794 R. pickettii (insidiosa) (6.40% 1141455 API20NE) (34.18% 400404 Remel) 8. ULI185 R. pickettii (insidiosa) (5.70% 1251575 API20NE) (98.34% 404614 Remel 9. ULI166 R. pickettii (insidiosa) (0.00% 1054555 API20NE) (99.94% 400414 Remel) 10. ULI819 R. pickettii (insidiosa) (0.00% 1372004 API20NE) (99.99% 404414 Remel) 11. ULI784 R. pickettii (insidiosa) (0.00% 1310000 API20NE) (99.99% 404414 Remel) 12. Marker- Hyperladder I (Bioline 200-10000bp) 13. ULI163 R. pickettii (insidiosa) (0.00% 1245555 API20NE) (98.34% 404614 Remel) 14. ULI795 R. pickettii (insidiosa) (0.00% 1041645 API20NE) (98.34% 406414 Remel) 15. ULM008 R. pickettii (insidiosa) (80.20% 0041455 API20NE) (99.94% 400414 Remel) 16. ULM009 R. pickettii (insidiosa) (80.20% 0041455 API20NE) (99.94% 400414 Remel) 17. Marker- Hyperladder I (Bioline 200-10000bp)
220 Fig A4-4: HaeIII 1 Digest of 16S-23S ISR of R. pickettii isolates
1. Marker- Hyper ladder 1 (Bioline 200-10000bp) 2. R. pickettii JCM5969 (99.00% 1041465 API20NE) (99.94% 400414 Remel) 3. R. pickettii NCTC11159 (95.10% 1041455 API20NE) (99.94% 400414 Remel) 4. R. pickettii DSM6927 (95.10% 1041455 API20NE) (99.94% 400414 Remel) 5. R. pickettii CIP73.23 (91.10% 1041555 API20NE) (99.94% 400414 Remel) 6. R. pickettii CCUG3318 (91.10% 1041555 API20NE) (99.94% 400414 Remel) 7. R. pickettii CCUG18841 (00.00% 1055555 API20NE) (99.71% 400616 Remel) 8. R. pickettii CCM2846 (00.00% 1055555 API20NE) (99.71% 400616 Remel) 9. ULI187 R. pickettii (97.70% 1041565 API20NE) (98.34% 404614 Remel) 10. ULI188 R. pickettii (95.10% 0045445 API20NE) (99.99% 404414 Remel) 11. Marker- Hyper ladder 1 (Bioline 200-10000bp) 12. ULI798 R. pickettii (95.10% 0045445 API20NE) (99.99% 404414 Remel) 13. ULI807 R. pickettii (84.10% 0045455 API20NE) (99.99% 404414 Remel) 14. ULI171 R. pickettii (84.10% 0045455 API20NE) (99.99% 404414 Remel) 15. ULI788 R. pickettii (80.40% 0245455 API20NE) (99.94% 400414 Remel) 16. ULI800 R. pickettii (80.40% 0245455 API20NE) (99.99% 404414 Remel) 17. ULI169 R. pickettii (80.40% 0245455 API20NE) (99.99% 404414 Remel) 18. ULI165 R. pickettii (67.90% 1045455 API20NE) (99.99% 404414 Remel) 19. ULI174 R. pickettii (67.90% 1045455 API20NE) (98.34% 404614 Remel) 20. Marker- Hyper ladder 1 (Bioline 200-10000bp)
Four bands of 430, 360, 40 and 20bp can be seen. In some lanes a further band of 60bp can be seen this is due to the failure of the enzyme to fully digest the DNA
221 Fig A4-5: HaeIII 3 Digest of 16S-23S ISR of R. pickettii isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. ULM001 R. pickettii (95.10% 1041455 API20NE) (99.99% 404416 Remel) 3. ULM002 R. pickettii (95.10% 1041455 API20NE) (99.99% 404416 Remel) 4. ULM003 R. pickettii (88.60% 1041457 API20NE) (99.28% 400406 Remel) 5. ULM004 R. pickettii (91.10% 1041555 API20NE) (99.99% 404416 Remel) 6. ULM005 R. pickettii (95.10% 1040455 API20NE) (00.00% 600416 Remel) 7. ULM006 R. pickettii (95.10% 1040455 API20NE) (99.28% 400406 Remel) 8. ULM007 R. pickettii (95.10% 1040455 API20NE) (99.99% 404416 Remel) 9. ULM010 R. pickettii (99.40% 1041575 API20NE) (99.94% 400414 Remel) 10. ULM011 R. pickettii (99.40% 1041575 API20NE) (99.99% 404414 Remel) 11. ULM011 R. pickettii (99.40% 1041575 API20NE) (99.99% 404414 Remel) 12. Marker- Hyperladder II (Bioline 50-2000bp)
Four bands of 430, 360, 40 and 20bp can be seen. In some lanes a further band of 60bp can be seen this is due to the failure of the enzyme to fully degrade
222 Fig A4-6: TaqI 2 Digest of 16S-23S ISR of R. pickettii isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. ULI193 R. pickettii (61.70% 0050577 API20NE) (98.38% 400614 Remel) 3. ULI796 R. pickettii (60.00% 1241455 API20NE) (98.34% 404614 Remel) 4. ULI791 R. pickettii (56.90% 0044455 API20NE) (99.99% 404414 Remel) 5. ULI790 R. pickettii (44.80% 0255455 API20NE) (98.34% 404614 Remel) 6. ULI818 R. pickettii (39.50% 1045555 API20NE) (99.94% 400414 Remel) 7. ULI804 R. pickettii (24.50% 0055455 API20NE) (98.34% 404614 Remel) 8. ULI159 R. pickettii (0.00% 1200004 API20NE) (99.94% 400414 Remel) 9. ULI806 R. pickettii (0.00% 1044444 API20NE) (99.99% 404414 Remel) 10. ULI167 R. pickettii (0.00% 1050555 API20NE) (99.94% 400414 Remel) 11. Marker- Hyperladder II (Bioline 50-2000bp) 12. ULI162 R. pickettii (0.00% 1145455 API20NE) (99.99% 404414 Remel) 13. ULC298 R. pickettii (90.10% 0051574 API20NE) (99.99% 404414 Remel) 14. ULC297 R. pickettii (70.03% 0050557 API20NE) (99.94% 400414 Remel) 15. ULC277 R. pickettii (61.70% 0050577 API20NE) (99.99% 404414 Remel) 16. ULC244 R. pickettii (56.70% 0050555 API20NE) (99.94% 400414 Remel) 17. ULC193 R. pickettii (56.70% 0050555 API20NE) (99.99% 404414 Remel) 18. ULC194 R. pickettii (56.70% 0050555 API20NE) (99.99% 404414 Remel) 19. ULC421 R. pickettii (28.50% 0045455 API20NE) (99.99% 404414 Remel) 20. Marker- Hyperladder II (Bioline 50-2000bp)
223 Fig A4-7: TaqI 3 Digest of 16S-23S ISR of R. pickettii isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. ULM001 R. pickettii (95.10% 1041455 API20NE) (99.99% 404416 Remel) 3. ULM002 R. pickettii (95.10% 1041455 API20NE) (99.99% 404416 Remel) 4. ULM003 R. pickettii (88.60% 1041457 API20NE) (99.28% 400406 Remel) 5. ULM004 R. pickettii (91.10% 1041555 API20NE) (99.99% 404416 Remel) 6. ULM005 R. pickettii (95.10% 1040455 API20NE) (00.00% 600416 Remel) 7. ULM006 R. pickettii (95.10% 1040455 API20NE) (99.28% 400406 Remel) 8. ULM007 R. pickettii (95.10% 1040455 API20NE) (99.99% 404416 Remel) 9. ULM010 R. pickettii (99.40% 1041575 API20NE) (99.94% 400414 Remel) 10. ULM011 R. pickettii (99.40% 1041575 API20NE) (99.99% 404414 Remel) 11. ULM009 R. pickettii (insidiosa) (80.20% 0041455 API20NE) (99.94% 400414 Remel) 12. Marker- Hyperladder II (Bioline 50-2000bp)
224 Fig A4-8: TaqI 4 Digest of 16S-23S ISR of R. insidiosa isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. R. insidiosa LMG21421 (61.70% 0050577 API20NE) (99.94% 400414 Remel) 3. R. pickettii (insidiosa) ATCC49129 (92.40% 0040475 API20NE) (99.99% 404414 Remel) 4. ULI821 R. pickettii (insidiosa) (84.10% 0045455 API20NE) (99.94% 400414 Remel) 5. ULI785 R. pickettii (insidiosa) (53.10% 0045457 API20NE) (99.99% 404414 Remel) 6. ULI181 R. pickettii (insidiosa) (39.50% 1045555 API20NE) (99.99% 404414 Remel) 7. ULI797 R. pickettii (insidiosa) (84.10% 0045455 API20NE) (98.34% 404614Remel) 8. ULI794 R. pickettii (insidiosa) (6.40% 1141455 API20NE) (34.18% 400404 Remel) 9. ULI185 R. pickettii (insidiosa) (5.70% 1251575 API20NE) (98.34% 404614 Remel 10. ULI166 R. pickettii (insidiosa) (0.00% 1054555 API20NE) (99.94% 400414 Remel) 11. ULI819 R. pickettii (insidiosa) (0.00% 1372004 API20NE) (99.99% 404414 Remel) 12. Marker- Hyperladder II (Bioline 50-2000bp) 13. ULI784 R. pickettii (insidiosa) (0.00% 1310000 API20NE) (99.99% 404414 Remel) 14. ULI163 R. pickettii (insidiosa) (0.00% 1245555 API20NE) (98.34% 404614 Remel) 15. ULI795 R. pickettii (insidiosa) (0.00% 1041645 API20NE) (98.34% 406414 Remel) 16. ULM008 R. pickettii (insidiosa) (80.20% 0041455 API20NE) (99.94% 400414 Remel)
225 Fig A4-9: CfoI 2 Digest of 16S-23S ISR of R. pickettii isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. ULI193 R. pickettii (61.70% 0050577 API20NE) (98.38% 400614 Remel) 3. ULI796 R. pickettii (60.00% 1241455 API20NE) (98.34% 404614 Remel) 4. ULI791 R. pickettii (56.90% 0044455 API20NE) (99.99% 404414 Remel) 5. ULI790 R. pickettii (44.80% 0255455 API20NE) (98.34% 404614 Remel) 6. ULI818 R. pickettii (39.50% 1045555 API20NE) (99.94% 400414 Remel) 7. ULI804 R. pickettii (24.50% 0055455 API20NE) (98.34% 404614 Remel) 8. ULI159 R. pickettii (0.00% 1200004 API20NE) (99.94% 400414 Remel) 9. ULI806 R. pickettii (0.00% 1044444 API20NE) (99.99% 404414 Remel) 10. ULI167 R. pickettii (0.00% 1050555 API20NE) (99.94% 400414 Remel) 11. Marker- Hyperladder II (Bioline 50-2000bp) 12. ULI162 R. pickettii (0.00% 1145455 API20NE) (99.99% 404414 Remel) 13. ULC298 R. pickettii (90.10% 0051574 API20NE) (99.99% 404414 Remel) 14. ULC297 R. pickettii (70.03% 0050557 API20NE) (99.94% 400414 Remel) 15. ULC277 R. pickettii (61.70% 0050577 API20NE) (99.99% 404414 Remel) 16. ULC244 R. pickettii (56.70% 0050555 API20NE) (99.94% 400414 Remel) 17. ULC193 R. pickettii (56.70% 0050555 API20NE) (99.99% 404414 Remel) 18. ULC194 R. pickettii (56.70% 0050555 API20NE) (99.99% 404414 Remel) 19. ULC421 R. pickettii (28.50% 0045455 API20NE) (99.99% 404414 Remel) 20. Marker- Hyperladder II (Bioline 50-2000bp)
226 Fig A4-10: CfoI 3 Digest of 16S-23S ISR of R. pickettii isolates
1. Marker- Hyperladder II (Bioline 50-2000bp) 2. ULM001 R. pickettii (95.10% 1041455 API20NE) (99.99% 404416 Remel) 3. ULM002 R. pickettii (95.10% 1041455 API20NE) (99.99% 404416 Remel) 4. ULM003 R. pickettii (88.60% 1041457 API20NE) (99.28% 400406 Remel) 5. ULM004 R. pickettii (91.10% 1041555 API20NE) (99.99% 404416 Remel) 6. ULM005 R. pickettii (95.10% 1040455 API20NE) (00.00% 600416 Remel) 7. ULM006 R. pickettii (95.10% 1040455 API20NE) (99.28% 400406 Remel) 8. ULM007 R. pickettii (95.10% 1040455 API20NE) (99.99% 404416 Remel) 9. ULM010 R. pickettii (99.40% 1041575 API20NE) (99.94% 400414 Remel) 10. ULM011 R. pickettii (99.40% 1041575 API20NE) (99.99% 404414 Remel) 11. ULM011 R. pickettii (99.40% 1041575 API20NE) (99.99% 404414 Remel) 12. Marker- Hyperladder II (Bioline 50-2000bp)
227 Appendix 5: Alignment of 16S-23S spacer region of Ralstonia pickettii strains * 20 * 40 * 60 * 80 * 100 LMG5942 : -...... : 106 L28163 : -...... : 106 JCM5969 : -...... : 106 RP277DL : -...... : 106 RP273DL : -...... : 106 12J : -...... : 106 ULC193 : -...... : 106 ULC194 : -...... : 106 ULC244 : -...... : 106 ULC421 : -...... : 106 ULI174 : -...... : 106 ULI187 : -...... : 106 ULI798 : -...... : 106 ULM001 : -...... : 106 ULM004 : -...... : 106 ULM005 : -...... : 106 ULM006 : ------...... : 26 CCUG18841: -...... : 106 LMG21421 : -...... : 106 ATCC49129: -...... : 106 ULI185 : -...... : 106 ULI795 : -...... : 106 ULI785 : -...... : 106 ULI819 : -...... : 106 ULI821 : -...... : 106 LMG6866 : -...... : 106 R.sol : ...... T.T.-...... : 106 agagcgtgcatccgacgttaggcgtccacacttatcggtttgtttgatgttacagccaagggtctgtagctcaggtggttAGAGCACCGTCTTGATAAGGCGGGGG
228
* 120 * 140 * 160 * 180 * 200 * LMG5942 : ...... : 213 L28163 : ...... : 213 JCM5969 : ...... : 213 RP277DL : ...... T...... : 213 RP273DL : ...... T...... : 213 12J : ...... T...... : 213 ULC193 : ...... : 213 ULC194 : ...... : 213 ULC244 : ...... : 213 ULC421 : ...... : 213 ULI174 : ...... : 213 ULI187 : ...... : 213 ULI798 : ...... T...... : 213 ULM001 : ...... A...... : 213 ULM004 : ...... A...... A...T...... : 213 ULM005 : ...... : 213 ULM006 : ...... A...... : 133 CCUG18841: ...... T...... : 213 LMG21421 : ...... A..A...... : 213 ATCC49129: ...... A..A...... : 213 ULI185 : ...... A..A...... : 213 ULI795 : ...... A..A...... : 213 ULI785 : ...... A..A...... : 213 ULI819 : ...... A..A...... : 213 ULI821 : ...... A..A...... : 213 LMG6866 : ...... A..A...... : 213 R.sol : ...... T...... ----...... : 209 TCGTAGGTTCAAGTCCTACCAGACCCACCAAgTTAcGGACGGTGgAAG gt CTCTGCCGTGACTGGGGGATTAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCA
229 220 * 240 * 260 * 280 * 300 * 320 LMG5942 : ...... ---...... : 317 L28163 : ....-...... ---...... : 316 JCM5969 : ...... ---...... : 317 RP277DL : ...... ---.T...... : 317 RP273DL : ...... ---.T...... : 317 12J : ...... ---.T...... : 317 ULC193 : ...... ---...... : 317 ULC194 : ...... ---...... : 317 ULC244 : ...... ---...... : 317 ULC421 : ...... ---...... : 317 ULI174 : ...... ---...... : 317 ULI187 : ...... ---...... : 317 ULI798 : ...... G...... ---.T.A...... : 317 ULM001 : ...... ---...... : 317 ULM004 : ...... ---.T...... : 317 ULM005 : ...... ---...... : 317 ULM006 : ...... ---...... : 237 CCUG18841: ...... G...... ---.T.A...... : 317 LMG21421 : ...... AA...... T.A...... T...... : 320 ATCC49129: ...... AA...... T.A...... T...... : 320 ULI185 : ...... AA...... T.A...... T...... : 320 ULI795 : ...... AA...... T.A...... T...... : 320 ULI785 : ...... AA...... T.A...... T...... : 320 ULI819 : ...... AA...... T.A...... T...... : 320 ULI821 : ...... AA...... T.A...... T...... : 320 LMG6866 : ...... AA...... T.A...... T...... : 320 R.sol : ...... A...... G.....G...... ------..TTTC...... A.T...... : 307 GGGGgTCGTCGGTTCGATCCCGTCATCCTCCACCAACCTTtTGGTTaCCAAACGCAAGCATCGAcg tGTcgatGGTGTTTGCGTTTGGCTaGCCAAGA
230
* 340 * 360 * 380 * 400 * 420 LMG5942 : ...... : 424 L28163 : ...... : 423 JCM5969 : ...... : 424 RP277DL : ...... A...... C-.C...... : 423 RP273DL : ...... A...... C-.C...... : 423 12J : ...... A...... C-.C...... : 423 ULC193 : ...... : 424 ULC194 : ...... : 424 ULC244 : ...... : 424 ULC421 : ...... : 424 ULI174 : ...... : 424 ULI187 : ...... : 424 ULI798 : ...... T...... : 424 ULM001 : ...... : 424 ULM004 : ...... A...... C-.C...... : 423 ULM005 : ...... : 424 ULM006 : ...... ------: 330 CCUG18841: ...... T...... : 424 LMG21421 : ...... A..A...... AT..T.GGTAGT...... : 427 ATCC4912 : ...... A..A...... AT..T.GGTAGT...... : 427 ULI185 : ...... A..A...... AT..T.GGTAGT...... : 427 ULI795 : ...... A..A...... AT..T.GGTAGT...... : 427 ULI785 : ...... A..A...... AT..T.GGTAGT...... : 427 ULI819 : ...... A..A...... AT..T.GGTAGT...... : 427 ULI821 : ...... A..A...... AT..T.GGTAGT...... : 427 LMG6866 : ...... A..A...... AT..T.GGTAGT...... : 427 R.sol : ....--...T.AC...... A..A...... AT..T..C.AC-...... : 411 CGAGcgTAAaAgtTCGGCTGTTCTTTAACAATATGGAATGTAGTAAAGGTGTCGCGG GC TTGATGAG GC C AACGCGACACTGggttgtgattgtat 231 * 440 * 460 * 480 * 500 * 520 * LMG5942 : ...... ------: 513 L28163 : ...... ------: 512 JCM5969 : ...... ------: 513 RP277DL : ...... ------: 512 RP273DL : ...... ------: 512 12J : ...... ------: 512 ULC193 : ...... ------: 513 ULC194 : ...... ------: 513 ULC244 : ...... ------: 513 ULC421 : ...... ------: 513 ULI174 : ...... ------: 513 ULI187 : ...... ------: 513 ULI798 : ...... -A...... ------: 512 ULM001 : ...... ------: 513 ULM004 : ...... ------: 512 ULM005 : ...... ------: 513 ULM006 : ------: - CCUG18841: ...... -A...... ------: 512 LMG21421 : ...... -A...... G..A...... ------: 515 ATCC49129: ...... -A...... G..A...... ------: 515 ULI185 : ...... -A...... G..A...... ------: 515 ULI795 : ...... -A...... G..A...... ------: 515 ULI785 : ...... -A...... G..A...... ------: 515 ULI819 : ...... -A...... G..A...... ------: 515 ULI821 : ...... -A...... G..A...... ------: 515 LMG6866 : ...... -A...... G..A...... ------: 515 R.sol : ...... --...TG.....-A...CC.-...... T...... ------: 491 caaccagtattaccagagcaatcga agattgtcttggaatacggcacaacgcgagaactcagcct ta cgagacatactcgttata
Fig A5-1: Alignment of 16S-23S spacer region of Ralstonia pickettii strains. Ralstonia insidiosa isolates are in red.
232 Appendix 6: Ctn’s/ICEs Identified in the Literature
Table A6-1: List of Ctn’s/ICEs Identified in the Literature Element Genus or Species Size Characterized Integrase Integration site Reference (kb) Function CFB group CTnDOT Bacteroides 65 Tcr Emr Tyrosine Few sites (GTTNNTTGG) Shoemaker and Salyers 1990 CTnBST Bacteroides 100 Emr Tyrosine ATAAATCTGGTAAATT Gupta et al., TA 2003 CTnGERM1 Bacteroides ovatus 75 Emr ND Few sites Wang et al., 2003 CTnERL Bacteroides 80 Tcr ND Few sites Shoemaker et al., 1989 CTn341 Bacteroides 51.9 Tcr Tyrosine bmhA methylase gene Bacic et al., vulgatus 2005 ααα-Proteobacteria ICEMlSymR7A Mesorhizobium loti 502 Symbiosis- type Tyrosine 3’- end of a gene encoding Sullivan et al., R7A IV secretion a tRNAPhe 2002 ICEMlSymMAFF303 Mesorhizobium loti 611 Symbiosis- type Tyrosine 3’- end of a gene encoding Sullivan et al., 099 MAFF303099 III secretion a tRNAPhe 2002 βββ-Proteobacteria Tn4371 Ralstonia sp. A5 53 Biphenyl Tyrosine Few sites Toussaint et degradation (TTTTTCAT) al., 2003
233 Element Genus or Species Size Characterized Integrase Integration site Reference (kb) Function UN Ralstonia ND Unknown Tyrosine Few sites Toussaint et solanacearum (TTTTTCAT) al., 2003 UN Azotobacter ND Unknown Tyrosine Few sites Toussaint et vinelandii (TTTTTCAT) al., 2003
UN Ralstonia ND Unknown Tyrosine Few sites Toussaint et metallidurans (TTTTTCAT) al., 2003 γγγ-Proteobacteria SXT/R391 Family SXT Vibrio cholerae 99.5 Sur Smr Cmr Tmr Tyrosine 5’- end of prfC gene Waldor et al., 1996 pJY1 Vibrio cholerae ND Sur Cmr Smr Unknown Unknown Yokota and Kuwahara 1977 ICEVchVie0 Vibrio cholerae ND Unknown Tyrosine Unknown Bani et al., 2007 ICEVchMex1 Vibrio cholerae ND Unknown Unknown Unknown Burrus et al., 2006 ICEVchHKo1 Vibrio cholerae ND Unknown Unknown Unknown Hochhut et al., 2001 ICEVchInd1 Vibrio cholerae ND Sur Smr Cmr Tmr Tyrosine Unknown Hochhut et al., 2001 ICEVchLao1 Vibrio cholerae ND Apr Sur Smr Cmr Tyrosine Unknown Iwanaga et al., Tcr 2004
234 Element Genus or Species Size Characterized Integrase Integration site Reference (kb) Function ICEVchBan1 Vibrio cholerae ND Sur Tmr Cmr Unknown Unknown Hochhut et al., 2001 ICEVchBan2 Vibrio cholerae ND Sur Tmr Unknown Unknown Marrero and Waldor 2007 ICEVchBan3 Vibrio cholerae ND Sur Tmr Cmr Unknown Unknown Marrero and Waldor 2007 ICEVchBan4 Vibrio cholerae ND Sur Tmr Unknown Unknown Marrero and Waldor 2007 ICEVchBan5 Vibrio cholerae ND Sur Tmr Unknown Unknown Hochhut et al., 2001 ICEVchBan6 Vibrio cholerae ND Sur Tmr Unknown Unknown Marrero and Waldor 2007 ICEVchBan7 Vibrio cholerae ND Unknown Unknown Unknown Marrero and Waldor 2007 ICEVchInd2 Vibrio cholerae ND Sur Tmr Unknown Unknown Marrero and Waldor 2007 ICEVchInd3 Vibrio cholerae ND Sur Tmr Unknown Unknown Marrero and Waldor 2007 ICEVchInd4 Vibrio cholerae ND Smr Cmr Unknown Unknown Marrero and Waldor 2007 ICEVchSL1 Vibrio cholerae ND Sur Smr Cmr Tmr Unknown Unknown Prager et al., 1994 ICEVchAng1 Vibrio cholerae ND ND Tyrosine Unknown Ceccarelli et al., 2006
235 Element Genus or Species Size Characterized Integrase Integration site Reference (kb) Function ICEVchAng2 Vibrio cholerae ND ND Tyrosine Unknown Ceccarelli et al., 2006 ICEVchMoz1 Vibrio cholerae ND Sur Smr Tmr Tyrosine Unknown Taviani et al., 2008 ICEVchMoz2 Vibrio cholerae ND Tmr Spr Tyrosine Unknown Taviani et al., 2008 ICEVchMoz3 Vibrio cholerae ND Spr Tyrosine Unknown Taviani et al., 2008 ICEVchMoz4 Vibrio cholerae ND Sur Smr Tyrosine Unknown Taviani et al., 2008 ICEVchMoz5 Vibrio cholerae ND Sur Apr Tmr Tyrosine Unknown Taviani et al., 2008 ICEVchMoz6 Vibrio cholerae ND Spr Sur Tyrosine Unknown Taviani et al., 2008 ICEVchMoz7 Vibrio cholerae ND Cmr Tmr Tyrosine Unknown Taviani et al., 2008 ICEVchMoz8 Vibrio cholerae ND Tmr Tyrosine Unknown Taviani et al., 2008 ICEVchMoz9 Vibrio cholerae ND Sur Smr Cmr Tmr Tyrosine Unknown Taviani et al., 2008 R391 Providencia rettgeri 89 Kmr Hgr Tyrosine 5’- end of prfC gene Coetzee et al., 1972 R392 Providencia rettgeri ND Kmr Hgr Tyrosine Unknown Coetzee et al., 1972
236 Element Genus or Species Size Characterized Integrase Integration site Reference (kb) Function R397 Providencia rettgeri ND Kmr Hgr Tyrosine Unknown Coetzee et al., 1972 R748 Providencia Spp. ND Kmr Hgr ND Unknown Hedges 1974
R749 Providencia Spp. ND Kmr Hgr ND Unknown Hedges 1974
R705 Proteus vulgaris ND Knr Hgr Tyrosine Unknown Hedges 1975
R706 Proteus vulgaris ND Knr Hgr Tyrosine Unknown Hedges 1975
R997 Proteus mirabilis 85 Apr Sur Smr Tyrosine Unknown Hedges 1975 pMERPH Shewanella ND Hgr Tyrosine 5’- end of prfC gene Peters et al., putrefaciens 1991 ICESpuPO1 Shewanella 110 Cur Tyrosine 5’- end of prfC gene Pembroke and putrefaciens Piterina 2006 ICEVpaAng1 Vibrio ND ND Tyrosine Unknown Ceccarelli et parahaemolyticus al., 2006 ICEVflInd1 Vibrio fluvialis ND Sur Smr Cmr Tmr Tyrosine 5’- end of prfC gene Ahmed et al., 2005 ICEPalBan1 Providencia ND ND Unknown Unknown Hochhut et al., alcalifaciens 2001
237 Element Genus or Species Size Characterized Integrase Integration site Reference (kb) Function ICEPdaSpa1 Photobacterium ND Sur Tmr Tyrosine 5’- end of prfC gene Juiz-Rio et al., damselae subsp. 2005 piscicida clc/ICEHin1056\ PAGI-2(C) family of ICE’s ICEHin1056 Haemophilus 59 Apr Tcr Tyrosine 3’- end of a gene encoding Mohd-Zain et influenzae a tRNALeu al., 2004 ICEHin299 Haemophilus 54 Apr Tyrosine 3’- end of a gene encoding Juhas et al., influenzae a tRNALeu 2007 ICEHin2866 Haemophilus 53 Apr Tyrosine 3’- end of a gene encoding Juhas et al., influenzae a tRNALeu 2007 ICEHin028 Haemophilus 55 ND Tyrosine 3’- end of a gene encoding Juhas et al., influenzae a tRNALeu 2007 ICEHinB Haemophilus 56 Apr Tyrosine 3’- end of a gene encoding Juhas et al., influenzae a tRNALeu 2007 ICEHpa8f Haemophilus 53 Apr Tyrosine 3’- end of a gene encoding Juhas et al., parainfluenzae a tRNALeu 2007 ICEHpaT3T1 Haemophilus 60 Tcr Tyrosine 3’- end of a gene encoding Juhas et al., parainfluenzae a tRNALeu 2007 UN Haemophilus 49 Type I Tyrosine NA Mohd-Zain et ducreyi antirestriction, al., 2004 cytolethal distending toxin
238 Element Genus or Species Size Characterized Integrase Integration site Reference (kb) Function UN Haemophilus 56 Type I Tyrosine NA Mohd-Zain et somnus antirestriction, al., 2004 Virulence factors UN Haemophilus 65 Antibiotic, metal, Tyrosine NA Mohd-Zain et somnus and antiseptic al., 2004 resistance clc Pseudomonas sp. 105 Chlorocatechol Tyrosine 3’- end of a gene encoding Ravatn et al., B13 degradation a tRNAGly 1998 SPI-7 Salmonella enterica 134 Antigen Vi Tyrosine 3’- end of a gene encoding Pickard et al., Typhi (capsule) a tRNAPhe 2003 UN Pseudomonas 140 Metabolic Tyrosine NA Mohd-Zain et luminescens enzymes, type IV al., 2004 secretion UN Pseudomonas 70 Biofilm Tyrosine NA Mohd-Zain et fluorescens regulators, al., 2004 fimbrial proteins, metabolic enzymes UN Pseudomonas 101 metabolic Tyrosine NA Mohd-Zain et fluorescens enzymes al., 2004 UN Ralstonia 77 Degradative Tyrosine NA Mohd-Zain et metallidurans enzymes, al., 2004 metabolic enzymes, Virulence factors UN Xanthomonas 86 Phage-related Tyrosine NA Mohd-Zain et axonopodis proteins, efflux al., 2004 pump, hemolysin 239 Element Genus or Species Size Characterized Integrase Integration site Reference (kb) Function PAPI-1 Pseudomonas 108 Virulence factors Tyrosine 3’- end of a gene encoding Qiu et al., aeruginosa a tRNALys 2006 PAG1-3 Pseudomonas 115 metabolic Tyrosine 3’- end of a gene encoding Larbig et al., aeruginosa enzymes a tRNAGly 2002 type I restriction- modification pKLC102 Pseudomonas 104 Virulence factors Tyrosine 3’- end of a gene encoding Klockgether et aeruginosa a tRNALys al., 2004 UN Yersinia 65 Type IV secretion, Tyrosine NA Mohd-Zain et enterocolitica arsenic resistance, al., 2004 hemagglutinin- related protein No family bph-sal Pseudomonas 90 Biphenyl and Unknown Unknown Nishi et al., putida salicylate 2000 degradation CTnscr94 Salmonella enterica 100 Sucrose utilisation Unknown 3’- end of a gene encoding Hochhut et al., Senftenberg a tRNAPhe 1997 ICEKp1 Klebsiella 76 Virulence factors Tyrosine 3’- end of a gene encoding Lin et al., 2008 pneumoniae a tRNAAsn ICEEc1 Escherichia coli 40.3 Virulence factors Tyrosine 3’- end of a gene encoding Schubert et al., a tRNAAsn 2004 LpPI-1 Legionella 65 Virulence factors Tyrosine tRNAPhe Brassinga et pneumophila al., 2003 High G+C Gram-Positive pSAM2 Streptomyces 10.9 produces Tyrosine 3’-end of a gene encoding a Pernodet et al., ambofaciens spiramycin tRNAPro 1984
240 Element Genus or Species Size Characterized Integrase Integration site Reference (kb) Function pSE211 Saccharopolyspora 18.1 Unknown Tyrosine 3’- end of a gene encoding Brown et al., erythraea a tRNAPhe 1990 pSA1 Streptomyces 9.1 Unknown Tyrosine Unknown Miyoshi et al., cyaneus 1986 pIJ408 Streptomyces 15 Unknown Tyrosine 3’- end of a gene encoding Sosio et al., glaucescens a tRNAThr 1989 pIJ110 Streptomyces 13.6 Unknown Unknown Unknown Hopwood parvulus et al., 1984 SLP1 Streptomyces 17.2 Unknown Tyrosine 3’- end of a gene encoding Vögtli and coelicolor a tRNAThr Cohen 1992 pMEA100 Amycolatopsis 23.7 Unknown Unknown 3’- end of a gene encoding Madon et al., mediterranei a tRNAPhe 1987 pMEA300 Amycolatopsis 13.3 Mutator - Tyrosine 3’- end of a gene encoding Vrijbloed et methanolica stimulation of a tRNAIIe al., 1994 transformation Low G+C Gram- Positive ICEBs1 Bacillus subtilis 20.5 ND Tyrosine 3’-end of a gene encoding a Burrus et al., tRNALeu 2002 ICESt1 Streptococcus 35.5 Type II Tyrosine 3’- end of a gene encoding Burrus et al., thermophilus Restriction- a fructose-1,6-bisphosphate 2000 Modification aldolase System, Sth368I ICESt3 Streptococcus 28 ND Tyrosine 3’- end of a gene encoding Pavlovic et al., thermophilus a fructose-1,6-bisphosphate 2004 aldolase ICEA Mycoplasma 30 Unknown Unknown CGTAATTTT Marenda et al., agalactiae 2006
241 Element Genus or Species Size Characterized Integrase Integration site Reference (kb) Function ICEF Mycoplasma 23 Unknown Unknown Numerous sites Calcutt et al., fermentans 2002 ICELm1 Listeria 21.3 Cdr Tyrosine 3’- end of a gene encoding Burrus et al., monocytogenes a GMP synthase 2002
Tn5397 Clostridium difficile 21 Tcr Serine Single Site Hachler et al., 1987 Tn1549 Enterococcus spp 34 Vmr Tyrosine A+T rich Regions Garnier et al., 2000 Tn916 Enterococcus 18 Tcr Tyrosine A+T rich Regions Franke and faecalis Clewell 1981 CW459tet(M) Clostridium Tcr Tyrosine 3’- end of a gene encoding Roberts et al., perfringens a GMP synthase 2001 Tn5386 Enterococcus 29.4 Lantibiotic Tyrosine Unknown Rice et al., faecium resistance 2001 CdiA1 Clostridium difficile 30.6 Unknown Tyrosine Unknown Burrus et al., 2002 CdiA2 Clostridium difficile ND Unknown Serine Unknown Burrus et al., 2002 CdiB3 Clostridium difficile 28.2 Unknown Tyrosine Unknown Burrus et al., 2002 CdiB4 Clostridium difficile ND Unknown Serine Unknown Burrus et al., 2002 EfaC1 Enterococcus 25.3 Unknown Tyrosine 3’- end of a gene encoding Burrus et al., faecalis a tRNAThr 2002
242 Element Genus or Species Size Characterized Integrase Integration site Reference (kb) Function EfaC2 Enterococcus 32.7 Unknown Tyrosine 3’- end of a gene encoding Burrus et al., faecalis a GMP synthase 2002 EfaD2 Enterococcus ND Unknown Tyrosine Unknown Burrus et al., faecalis 2002 SmuE Streptococcus 20.5 Unknown Tyrosine 3’-end of a gene encoding a Burrus et al., mutans tRNALeu 2002 Tn5252 Streptococcus 47 Cmr UVr Tyrosine Single Site Vijayakumar, pneumoniae and Ayalew 1992 Tn5801 Staphylococcus 25.5 Tcr Tyrosine 3’- end of a gene encoding Kuroda et al., aureus a GMP synthase 2001 Tn5276 Lactococcus lactis 70 Sucrose utilisation Tyrosine Few Sites (TTTTTG) Rauch and De Nisin synthesis Vos 1992 Sex factor/pRS01 Lactococcus lactis 48.4 Tellurium Unknown Single Site Gasson et al., Resistance 1995 Mills et al., 1994
Abbreviations: Ap, ampicillin; Cd, Cadmium; Cm, chloramphenicol; Em, erythromycin; Hg, mercury; Km, kanamycin; ND, not determined; Ser, serine recombinase; Sm, streptomycin; Sp, spectinomycin; Su, sulfamethoxazole; Tc, tetracycline; Tm, trimethoprim; UM, Unnamed; UV, ultra-violet light; Vm, Vancomycin
243 References: Ahmed A.M., Shinoda S. and Shimamoto T. 2005. A variant of Vibrio cholerae SXT element in a multidrug-resistant strain of Vibrio fluvialis. FEMS Microbiology Letters, 242: 241-247.
Bacic M., Parker A.C., Stagg J., Whitley H.P., Wells W.G., Jacob L.A. and Smith C.J. 2005. Genetic and structural analysis of the Bacteroides conjugative transposon CTn341. Journal of Bacteriology, 187: 2858-2869.
Bani S., Mastromarino P.N., Ceccarelli D., Le Van A., Salvia A.M., Ngo Viet Q.T., Hai D.H., Bacciu D., Cappuccinelli P. and Colombo M.M. 2007. Molecular characterization of ICEVchVie0 and its disappearance in Vibrio cholerae O1 strains isolated in 2003 in Vietnam. FEMS Microbiology Letters, 266: 42-48.
Brassinga A.K., Hiltz M.F., Sisson G.R., Morash M.G., Hill N., Garduno E., Edelstein P.H., Garduno R.A. and Hoffman P.S. 2003. A 65-kilobase-pathogenicity island is unique to Philadelphia-1 strains of Legionella pneumophila. Journal of Bacteriology, 185: 4630-4637.
Brown D.P., Idler K.B. and Katz L. 1990. Characterization of the genetic elements required for site-specific integration of plasmid pSE211 in Saccharopolyspora erythraea. Journal of Bacteriology, 172: 1877-1888.
Burrus V., Pavlovic G., Decaris B. and Guédon G. 2002. The ICESt1 element of Streptococcus thermophilus belongs to a large family of integrative and conjugative elements that exchange modules and change their specificity of integration. Plasmid, 48: 77-97.
Burrus V., Quezada-Calvillo R., Marrero J. and Waldor MK. 2006. SXT-related integrating conjugative element in New World Vibrio cholerae. Applied and Environmental Microbiology, 72: 3054-3057.
Burrus V., Roussel Y., Decaris B. and Guédon G. 2000. Characterization of a Novel Integrative Element, ICESt1, in the Lactic Acid Bacterium Streptococcus thermophilus. Applied and Environmental Microbiology, 66: 1749-1753.
244
Calcutt M.J., Lewis M.S. and Wise K.S. 2002. Molecular genetic analysis of ICEF, an integrative conjugal element that is present as a repetitive sequence in the chromosome of Mycoplasma fermentans PG18. Journal of Bacteriology, 184: 6929-6941.
Ceccarelli D., Bani S., Cappuccinelli P. and Colombo M.M. 2006. Prevalence of aadA1 and dfrA15 class 1 integron cassettes and SXT circulation in Vibrio cholerae O1 isolates from Africa. Journal of Antimicrobial Chemotherapy, 58: 1095-1097.
Coetzee J.N., Datta N. and Hedges R.W. 1972. R factors from Proteus rettgeri. Journal of General Microbiology, 72: 543-552.
Franke A.E. and Clewell D.B. 1981. Evidence for a chromosome-borne resistance transposon (Tn916) in Streptococcus faecalis that is capable of "conjugal" transfer in the absence of a conjugative plasmid. Journal of Bacteriology, 145: 494-502.
Garnier F., Taourit S., Glaser P., Courvalin P. and Galimand M. 2000. Characterization of transposon Tn1549, conferring VanB-type resistance in Enterococcus spp. Microbiology, 146: 1481-1489.
Gasson M.J., Godon J.J., Pillidge C.J., Eaton T.J., Jury K. and Shearman C.A. 1995. Characterization and exploitation of conjugation in Lactococcus lactis. International Dairy Journal, 5: 757-762.
Gupta A., Vlamakis H., Shoemaker N. and Salyers A.A. 2003. A new Bacteroides conjugative transposon that carries an ermB gene. Applied Environmental Microbiology, 69: 6455-6463.
Hachler H., Kayser F.H. and Berger-Bachi B. 1987. Homology of a transferable tetracycline resistance determinant of Clostridium difficile with Streptococcus (Enterococcus) faecalis transposon Tn916. Antimicrobial Agents and Chemotherapy, 31: 1033-1038.
Hedges R.W. 1974. R factors from Providence. Journal of General Microbiology, 81: 171-181.
245
Hedges R.W. 1975. R factors from Proteus mirabilis and P. vulgaris. Journal of General Microbiology, 87: 301-311.
Hochhut B., Jahreis K., Lengeler J.W. and Schmid K. 1997. CTnscr94, a conjugative transposon found in enterobacteria. Journal of Bacteriology, 179: 2097-2102.
Hochhut B., Lot W.Y., Mazel D., Faruque S.M., Woodgate R. and Waldor M.K. 2001. Molecular analysis of antibiotic resistance gene clusters in Vibrio cholerae O139 and O1 SXT constins. Antimicrobial Agents and Chemotherapy, 45: 2991-3000.
Hopwood D.A., Hintermann G., Kieser T. and Wright H.M. 1984. Integrated DNA sequences in three streptomycetes form related autonomous plasmids after transfer to Streptomyces lividans, Plasmid, 11: 1-16.
Iwanaga M., Toma C., Miyazato T., Insisiengmay S., Nakasone N. and Ehara M. 2004. Antibiotic resistance conferred by a class I integron and SXT constin in Vibrio cholerae O1 strains isolated in Laos. Antimicrobial Agents and Chemotherapy, 48: 2364-2369.
Juhas M., Power P.M., Harding R.M., Ferguson D.J., Dimopoulou I.D., Elamin A.R., Mohd-Zain Z., Hood D.W., Adegbola R., Erwin A., Smith A., Munson R.S., Harrison A., Mansfield L., Bentley S. and Crook D.W. 2007. Sequence and functional analyses of Haemophilus spp. genomic islands. Genome Biology, 8: R237.
Juiz-Ri S., Osorio C.R., de Lorenzo V. and Lemos M.L. 2005. Subtractive hybridisation reveals a high genetic diversity in the fish pathogen Photobacterium damselae subsp. piscicida: evidence of a SXT-like element. Microbiology, 151: 2659- 2669.
Klockgether J., Reva O., Larbig K. and Tümmler B. 2004. Sequence analysis of the mobile genome island pKLC102 of Pseudomonas aeruginosa C. Journal of Bacteriology, 86: 518-534.
Kuroda M., Ohta T., Uchiyama I., Baba T., Yuzawa H., Kobayashi I., Cui L., Oguchi A., Aoki K., Nagai Y., Lian J., Ito T., Kanamori M., Matsumaru H., Maruyama A.,
246 Murakami H., Hosoyama A., Mizutani-Ui Y., Takahashi N.K., Sawano T., Inoue R., Kaito C., Sekimizu K., Hirakawa H., Kuhara, S., Goto S., Yabuzaki J., Kanehisa M., Yamashita A., Oshima K., Furuya K., Yoshino C., Shiba T., Hattori M., Ogasawara N., Hayashi H. and Hiramatsu K. 2001. Whole genome sequencing of meticillin-resistant Staphylococcus aureus. Lancet, 357: 1225-1240.
Larbig K.D., Christmann A., Johann A., Klockgether J., Hartsch T., Merkl R., Wiehlmann L., Fritz H.J. and Tummler B. 2002. Gene Islands Integrated into tRNA(Gly) Genes Confer Genome Diversity on a Pseudomonas aeruginosa Clone. Journal of Bacteriology, 184: 6665-6680.
Lin T.L., Lee C.Z., Hsieh P.F., Tsai S.F. and Wang J.T. 2008. Characterization of integrative and conjugative element ICEKp1-associated genomic heterogeneity in a Klebsiella pneumoniae strain isolated from a primary liver abscess. Journal of Bacteriology, 190: 515-526.
Madon J., Moretti P. and Hutter R. 1987. Site-specific integration and excision of pMEA100 in Nocardia mediterranei. Molecular and General Genetics, 209: 257-264.
Marenda M., Barbe V., Gourgues G., Mangenot S., Sagne E. and Citti C. 2006. A new integrative conjugative element occurs in Mycoplasma agalactiae as chromosomal and free circular forms. Journal of Bacteriology, 188: 4137-4141.
Marrero J. and Waldor M. K. 2007. The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. Journal of Bacteriology, 189: 3302- 3305.
Mills D.A., Choi C.K., Dunny G.M. and McKay L.L. 1994. Genetic analysis of regions of the Lactococcus lactis subsp. lactis plasmid pRS01 involved in conjugative transfer. Applied and Environmental Microbiology, 60: 4413-4420.
Miyoshi Y.K., Ogata S. and Hayashida S. 1986. Multicopy derivative of pockforming plasmid pSA1 in Streptomyces azureus. Journal of Bacteriology, 168: 452-454.
Mohd-Zain Z., Turner S.L., Cerdeño-Tárraga A.M., Lilley A.K., Inzana T.J., Duncan
247 A.J., Harding R.M., Hood D.W., Peto T.E. and Crook D.W. 2004. Transferable antibiotic resistance elements in Haemophilus influenzae share a common evolutionary origin with a diverse family of syntenic genomic islands. Journal of Bacteriology, 186: 8114-8122.
Nishi A., Tominaga K. and Furukawa K. 2000. A 90-kilobase conjugative chromosomal element coding for biphenyl and salicylate catabolism in Pseudomonas putida KF715. Journal of Bacteriology, 182:1949-1955.
Pavlovic G., Burrus V., Gintz B., Decaris B. and Guédon G. 2004. Evolution of genomic islands by deletion and tandem accretion by site-specific recombination: ICESt1-related elements from Streptococcus thermophilus. Microbiology, 150: 759- 774.
Pembroke J.T. and Piterina A.V. 2006. A novel ICE in the genome of Shewanella putrefaciens W3-18-1: comparison with the SXT/R391 ICE-like elements. FEMS Microbiology Letters, 264: 80-88.
Pernodet J.L., Simonet, J.M. and Guérineau M. 1984. Plasmids in different strains of Streptomyces ambofaciens: Free and integrated form of plasmid pSAM2, Molecular and General Genetics, 198: 35-41.
Peters S.E., Hobman J.L., Strike P and Ritchie D.A., 1991. Novel mercury resistance determinants carried by IncJ plasmids pMERPH and R391. Molecular and General Genetics, 228: 294-299.
Pickard D., Wain J., Baker S., Line A., Chohan S., Fookes M., Barron A., Gaora P.A., Chabalgoity J.A., Thanky N., Scholes C., Thomson N., Quail M., Parkhill J. and Dougan G. 2003. Composition, acquisition, and distribution of the Vi exopolysaccharide-encoding Salmonella enterica pathogenicity island SPI-7. Journal of Bacteriology, 185: 5055-5065.
Prager R., Streckel W., Stephan R., Bockemuehl J., Shimada T. and Tschaepe H. 1994. Genomic fingerprinting of Vibrio cholerae O139 from Germany and south Asia in
248 comparison with strains of Vibrio cholerae O1 and other serogroups. Medical Microbiology Letters, 3: 219-227.
Qiu X., Gurkar A.U. and Lory S. 2006. Interstrain transfer of the large pathogenicity island (PAPI-1) of Pseudomonas aeruginosa. Proceedings of the National Academies of Sciences USA, 103: 19830-19835.
Rauch P.J. and De Vos W.M. 1992. Characterization of the novel nisin-sucrose conjugative transposon Tn5276 and its insertion in Lactococcus lactis. Journal of Bacteriology, 174: 1280-1287.
Ravatn R., Studer S., Springael D., Zehnder A.J. and van der Meer J.R. 1998. Chromosomal integration, tandem amplification, and deamplification in Pseudomonas putida F1 of a 105-kilobase genetic element containing the chlorocatechol degradative genes from Pseudomonas sp. strain B13. Journal of Bacteriology, 180: 4360-4369.
Rice L.B., Carias L.L., Marshall S., Rudin S.D., Hutton-Thomas R. 2005. Tn5386, a novel Tn916-like mobile element in Enterococcus faecium D344R that interacts with Tn916 to yield a large genomic deletion. Journal of Bacteriology, 187: 6668-6677.
Roberts A.P., Johanesen P., Lyras D., Mullany P. and Rood J.I. 2001. Comparison of Tn5397 from Clostridium difficile, Tn916 from Enterococcus faecalis and the CW459tet (M) element from Clostridium perfringens shows that they have similar conjugation regions but different insertion and excision modules. Microbiology, 147: 1243-1251.
Schubert S., Dufke S., Sorsa J. and Heesemann J. 2004. A novel integrative and conjugative element (ICE) of Escherichia coli: the putative progenitor of the Yersinia high-pathogenicity island. Molecular Microbiology, 51: 837-848.
Shoemaker N.B. and Salyers A.A. 1990. A cryptic 65 kilobase-pair transposon-like element isolated from Bacteroides uniformis has homology with Bacteroides conjugal tetracycline resistance elements. Journal of Bacteriology, 172: 1694-1702.
Shoemaker N.B., Barber R. and Salyers A.A. 1989. Cloning and characterization of a
249 Bacteroides conjugal tetracycline resistance element using a shuttle cosmid vector. Journal of Bacteriology, 171: 1294-1302.
Sosio M., Madon J. and Hutter R. 1989. Excision of pIJ408 from the chromosome of Streptomyces glaucescens and its transfer into Streptomyces lividans. Molecular and General Genetics, 218: 169-176.
Sullivan J.T., Trzebiatowski J.R., Cruickshank R.W., Gouzy J., Brown S.D., Elliot R.M., Fleetwood D.J., McCallum N.G., Rossbach U., Stuart G.S., Weaver J.E., Webby R.J., de Bruijn F.J. and Ronson C.W. 2002. Comparative sequence analysis of the symbiosis island of Mesorhizobium loti strain R7A. Journal of Bacteriology, 184: 3086- 3095.
Taviani E., Ceccarelli D., Lazaro N., Bani S., Cappuccinelli P., Colwell R.R. and Colombo M.M. 2008. Environmental Vibrio spp., isolated in Mozambique, contain a polymorphic group of integrative conjugative elements and class 1 integrons. FEMS Microbiology Ecology, 64: 45-54.
Toussaint A., Merlin C., Monchy S., Benotmane M.A., Leplae R., Mergeay M. and Springael D. The biphenyl- and 4-chlorobiphenylcatabolic transposon Tn4371, a member of a new family of genomic islands related to IncP and Ti plasmids. Applied and Environmental Microbiology, 69: 4837-4845.
Vijayakumar M.N. and Ayalew S. 1992. Nucleotide sequence analysis of the termini and chromosomal locus involved in site-specific integration of the streptococcal conjugative transposon Tn5252. Journal of Bacteriology, 175: 2713-2719.
Vögtli M. and Cohen S.N. 1992. The chromosomal integration site for the Streptomyces plasmid SLP1 is a functional tRNA (Tyr) gene essential for cell viability. Molecular Microbiology, 6: 3041-3050.
Vrijbloed J.W., Madon J. and Dijkhuizen L. 1994. A plasmid from the methylotrophic actinomycete Amycolatopsis methanolica capable of site-specific integration. Journal of Bacteriology, 176: 7087-7090.
250 Waldor M.K., Tschape H. and Mekalanos J.J. 1996. A new type of conjugative transposon encodes resistance to sulfamethoxazole, trimethoprim, and streptomycin in Vibrio cholerae O139. Journal of Bacteriology, 178: 4157-4165.
Wang Y., Wang G.R., Shelby A., Shoemaker N.B. and Salyers A.A. 2003. A newly discovered Bacteroides conjugative transposon, CTnGERM1, contains genes also found in gram-positive bacteria. Applied and Environmental Microbiology, 69: 4595-603.
Yokota T. and Kuwahara S. 1977. Temperature-sensitive R plasmid obtained from naturally isolated drug-resistant Vibrio cholerae (biotype El Tor). Antimicrobial Agents and Chemotherapy, 11: 13-20.
251 Appendix 7: Alignment of the left ends of ICETn43716402 and related Tn4371-like ICE’s
Fig A7-1: Alignment of the left ends of ICETn43716403 and related Tn4371-like ICE’s. A stretch of 200bp from the Tn4371 left end was compared to individual genome sequences of Comamonas testosteroni KF-1 and R. metallidurans CH34, Delftia acidovorans SPH-1, Shewanella sp. ANA-3, Congregibacter litoralis KT71 and R. solanacearum GMI1000 (TnRso) by using ClustalW.
252
Appendix 8: Orfs of Tn4371-like elements discovered in this study
The following tables lists all the genes (their ORF numbers) of the various Tn4371-like element discovered in this study and compares their nucleotide similarity to the original Tn4371 using the Blast Tool.
Table A8-1: ORFs Associated with the Tn4371-like Element from the Genome of Ralstonia pickettii 12J Ralstonia Similarity to Tn4371 equivalent Putative Role pickettii 12J Tn4371 ORF2601 84% ORF00001 Phage Intergrase (397) ORF2602 Absent PD-(D/E)XK nuclease superfamily ORF2603 Absent Unknown (contains several transmembrane regions and a signal peptide) ORF2604 Absent Transcriptional regulator, DeoR type ORF2605 Absent Unknown ORF2606 Absent ThiF family Ubiquitin-activating enzyme E1 ORF2607 Absent Unknown (beta-lactamase like domain) Absent ORF00002 Unknown Absent ORF00003 Unknown (Helix-turn-helix) Absent ORF00004 Unknown (contains several transmembrane regions) Absent ORF00005 IS1090- like truncated transposase Absent ORF00006 Unknown (37-kD nucleoid-associated bacterial protein) Absent ORF00007 Unknown (Phosphopantetheine attachment site) Absent ORF00008 DNA helicase, UvrD/REP type Absent ORF00009 Nuclease ORF2608 95% ORF00010 Unknown (116) ORF2609 Absent Unknown ORF2610 91% ORF00011 Unknown (99) Absent ORF00012 Unknown ORF2611 87% ORF00013 Unknown (272) ORF2612 81% ORF00014 ParB-like nuclease (667) ORF2613 86% ORF00015 Unknown (pI 11.4, 91 amino acids long) (69) ORF2614 Absent Unknown Absent ORF00016 Unknown Absent ORF00017 transcription regulator ORF2615 97% ORF00018 Unknown (104) ORF2616 95% ORF00055 transcriptional regulator, XRE family 253 (97) ORF2617 84% ORF00033 Lipoprotein (DNA binding domain) (115) ORF2618 91% ORF00034 Unknown (249) ORF2619 ORF00035 Putative Excisionase ORF2620 88% ORF00036 repA (282) ORF2621 96% ORF00037 parA (212) ORF2622 96% ORF00038 parB (87) ORF2623 89% ORF00039 Unknown (177) ORF2624 85% ORF00040 traF (193) ORF2625 84% ORF00041 Unknown (possible relaxase) (403) ORF2626 Absent enoyl-CoA hydratase ORF2627 Absent Enoyl-CoA hydratase/carnithine racemase- like ORF2628 Absent short-chain dehydrogenase/reductase ORF2629 Absent enoyl-CoA hydratase ORF2630 Absent Acetyl-CoA C-acyltransferase ORF2631 Absent medium-chain acyl-CoA ligase ORF2632 Absent L-carnitine dehydratase/bile acid-inducible protein F ORF2633 Absent acyl-CoA dehydrogenase ORF2634 Absent transcriptional regulator, AraC family ORF2635 Absent beta-lactamase-like protein ORF2636 Absent Unknown ORF2637 Absent general substrate transporter ORF2638 Absent acyl-CoA dehydrogenase ORF2639 Absent electron transfer flavoprotein beta-subunit ORF2640 Absent electron transfer flavoprotein alpha-subunit Absent ORF00056 bphS Absent ORF00042 bphE Absent ORF00043 bphG Absent ORF00044 bphF Absent ORF00046 bphA1 Absent ORF00047 bphA2 Absent ORF00048 bphA3 Absent ORF00049 bphB Absent ORF00050 bphC Absent ORF00051 bphD Absent ORF00052 Unknown Absent ORF00053 bphA4 ORF2641 67% ORF00054 traR (295) ORF2642 90% ORF00030 traG 9672)
254 ORF2643 89% ORF00029 Unknown (153) ORF2644 90% ORF00028 trbB (345) ORF2645 88% ORF00027 trbC (127) ORF2646 Absent trbD ORF2647 91% ORF00026 trbE (817) ORF2648 90% ORF00025 trbJ (251) Absent ORF00024 Unknown (lipoprotein domain) ORF2650 89% ORF00023 trbL (449) ORF2651 93% ORF00032 trbF (234) ORF2652 91% ORF00020 trbG (326) ORF2653 88% ORF00021 trbI (426) ORF2654 82% ORF00022 Unknown (80)
255 Table A8-2: ORFs Associated with the Tn4371-like Element from the Genome of Comamonas testosteroni KF-1 and from the Genome of Delftia acidovorans SPH-1 Comamonas Similarity Delftia Similarity Tn4371 Putative Role testosteroni to Tn4371 acidovorans to Tn4371 equivalent KF-1 SPH-1 ORF2305 84% ORF2745 84% ORF00001 Phage Intergrase (997) (397) ORF2304 99% ORF2744 99% Absent PD-(D/E)XK nuclease superfamily ORF2303 100% ORF2743 100% Absent Unknown (contains several transmembrane regions and a signal peptide) ORF2302 99% ORF2742 100% Absent Transcriptional regulator, DeoR type ORF2301 99% ORF2741 99% Absent Unknown ORF2300 100% ORF2740 100% Absent ThiF family Ubiquitin-activating enzyme E1 ORF2299 100% ORF2739 100% Absent Unknown (beta- lactamase like domain) Absent Absent ORF00002 Unknown Absent Absent ORF00003 Unknown (Helix- turn-helix) Absent Absent ORF00004 Unknown (contains several transmembrane regions) Absent Absent ORF00005 IS1090- like truncated transposase Absent Absent ORF00006 Unknown (37-kD nucleoid-associated bacterial protein) Absent Absent ORF00007 Unknown (Phosphopantetheine attachment site) Absent Absent ORF00008 DNA helicase, UvrD/REP type Absent Absent ORF00009 Nuclease ORF2298 95% ORF2738 94% ORF00010 Unknown (116) (166) ORF2297 100% ORF2737 100% Absent Unknown ORF2296 91% ORF2736 90% ORF00011 Unknown (99) (99) ORF2501 88% ORF2735 88% ORF00012 Unknown (87) (87) ORF2295 96% ORF2734 96% ORF00013 Unknown (275) (275)
256 ORF2294 82% ORF2733 82% ORF00014 ParB-like nuclease (688) (688) ORF2293 89% ORF2732 89% ORF00015 Unknown (pI 11.4, (69) (69) 91 amino acids long) Absent Absent Absent Unknown Absent Absent ORF00016 Unknown Absent Absent ORF00017 transcription regulator ORF2292 ORF2231 Absent GCN5-related N- acetyltransferase ORF2500 Absent Unknown ORF2291 97% ORF2730 97% ORF00018 Unknown (104) (104) ORF2499 Absent Absent Unknown ORF2290 98% ORF2729 98 ORF00055 transcriptional (97) (97) regulator, XRE family ORF2498 Absent Absent Putative lipoprotein ORF2289 93% ORF2728 93% ORF00033 Lipoprotein (DNA (115) (115) binding domain) ORF2288 86% ORF2727 84% ORF00034 Unknown (249) (252) Absent ORF2726 Absent Alpha/beta hydrolase fold Absent ORF2725 Absent Phage integrase Absent ORF2724 Absent Phage integrase Absent ORF2723 Absent Unknown Absent Absent Absent Unknown ORF2722 94% ORF2487 89% ORF00035 Putative Excisionase (73) (96) ORF2286 97% ORF2721 97% ORF00036 repA (285) (285) ORF2497 Unknown ORF2285 97% ORF2720 97% ORF00037 parA (212) (212) ORF2284 96% ORF2719 96% ORF00038 parB (87) (87) ORF2283 89% ORF2718 89% ORF00039 Unknown (173) (173) ORF2282 84% ORF2717 84% ORF00040 traF (194) (194) ORF2281 85% ORF2716 85% ORF00041 Unknown (possible (438) (438) relaxase) Absent Absent ORF00056 bphS Absent Absent ORF00042 bphE Absent Absent ORF00043 bphG Absent Absent ORF00044 bphF Absent Absent ORF00046 bphA1 Absent Absent ORF00047 bphA2 Absent Absent ORF00048 bphA3 Absent Absent ORF00049 bphB
257 Absent Absent ORF00050 bphC Absent Absent ORF00051 bphD Absent Absent ORF00052 Unknown Absent Absent ORF00053 bphA4 ORF2280 ORF2715 Absent Ferric reductase-like transmembrane component-like ORF2279 ORF2714 Absent two component transcriptional regulator, winged helix family ORF2278 ORF2713 Absent periplasmic sensor signal transduction histidine kinase ORF2277 ORF2712 Absent protein of unknown function DUF125 transmembrane ORF2276 ORF2711 Absent cytochrome B561 ORF2275 ORF2710 Absent Efflux transporter, RND Family, MFP subunit ORF2274 ORF2709 Absent heavy metal efflux pump, CzcA family ORF2273 ORF2708 Absent hypothetical protein Absent outer membrane ORF2272 ORF2707 efflux ORF2271 ORF2706 Absent hypothetical protein ORF2270 ORF2705 Absent Sulfatase Absent Diacylglycerol ORF2269 ORF2704 kinase ORF2268 ORF2703 Absent transcriptional regulator, LysR family ORF2703 68% ORF2703 68% ORF00054 traR (292) (292) Absent ORF2702 Absent Putative lipoprotein precursor ORF2267 95% ORF2701 95% ORF00030 traG (667) (667) ORF2666 92% ORF2700 93% ORF00029 Unknown (154) (154) ORF2265 95% ORF2699 93% ORF00028 trbB (325) (344) ORF2264 87% ORF2698 88% ORF00027 trbC (124) (122) ORF2263 90% ORF2697 90% Absent trbD ORF2262 88% ORF2696 88% ORF00026 trbE (816) (817) ORF2261 95% ORF2695 95% ORF00025 trbJ (251) (251)
258 Absent Absent ORF00024 Unknown (lipoprotein domain) ORF2260 93% ORF2694 93% ORF00023 trbL (449) (449) ORF2259 91% ORF2693 91% ORF00032 trbF (234) (234) ORF2258 88% ORF2692 88% ORF00020 trbG (236) (236) ORF2257 87% ORF2691 87% ORF00021 trbI (419) (419) ORF2256 79% ORF2690 79% ORF00022 Unknown (74) (74)
259
Table A8-3: ORFs Associated with the Tn4371-like Element from the Genome of Acidovorax avenae subsp. citrulli AAC00-1 and from the Genome of Acidovorax sp. JS42 Acidovorax Similarity Acidovorax Similarity Tn4371 Putative Role avenae to Tn4371 sp. JS42 to Tn4371 equivalent subsp. citrulli AAC00-1 Aave_0671 89% Ajs_2959 64% ORF00001 Phage Intergrase (401) (401) Absent Ajs_2958 Unknown Absent Ajs_2957 putative transcriptional regulator Absent Ajs_2956 Unknown Absent Ajs_2955 Unknown Absent Ajs_2954 transposase, IS4 family protein Absent Ajs_2953 Unknown Absent Ajs_2952 Unknown (possible ATPase) Absent Ajs_2951 Unknown Absent Ajs_2950 3'-phosphoadenosine 5'- phosphosulfate sulfotransferase Absent Ajs_2949 Unknown Absent Ajs_2948 Unknown Absent Ajs_2947 ATPase involved in chromosome partitioning-like protein Absent Ajs_2946 Unknown Absent Ajs_2945 Pseudogene Absent Absent ORF00002 Unknown Absent Absent ORF00003 Unknown (Helix-turn- helix) Absent Absent ORF00004 Unknown (contains several transmembrane regions) Absent Absent ORF00005 IS1090- like truncated transposase Absent Absent ORF00006 Unknown (37-kD nucleoid-associated bacterial protein) Absent Absent ORF00007 Unknown (Phosphopantetheine attachment site) Aave_0672 Absent Absent Unknown Aave_0673 Absent Absent IS1002 transposase Aave_0674 Absent Pseudogene Aave_0675 95% Absent ORF00008 DNA helicase, (559) UvrD/REP type Aave_0676 95% Absent ORF00009 Nuclease
260 (712) Aave_0677 85% Absent ORF00010 Unknown (115) Absent Absent ORF00011 Unknown Absent Absent ORF00012 Unknown Aave_0678 Absent Absent Unknown Aave_0679 83% Ajs_2944 90% ORF00013 Unknown (275) (279) Aave_0680 70% Ajs_2943 83% ORF00014 ParB-like nuclease (681) (662) Absent Ajs_2942 86% ORF00015 Unknown (pI 11.4, 91 (69) amino acids long) Absent Ajs_2941 Absent Unknown Absent Ajs_2940 Absent Pseudogene Absent Absent ORF00016 Unknown Absent Absent ORF00017 transcription regulator Aave_0681 87% Ajs_2939 94% ORF00018 Unknown (104) (104) Absent Ajs_2938 Absent Unknown Aave_0682 76% Ajs_2937 95% ORF00055 transcriptional regulator, (97) (97) XRE family Aave_0683 76% Ajs_2936 87% ORF00033 Lipoprotein (DNA (116) (115) binding domain) Aave_0684 62% Ajs_2935 84% ORF00034 Unknown (223) (249) Aave_0685 84% Ajs_2934 85% ORF00035 Putative Excisionase (69) (96) Aave_0686 82% Ajs_2933 95% ORF00036 repA (281) (285) Aave_0687 94% Ajs_2932 95% ORF00037 parA (212) (212) Aave_0688 92% Ajs_2931 94% ORF00038 parB (80) (84) Aave_0689 77% Ajs_2930 80% ORF00039 Unknown (154) (157) Aave_0690 78% Ajs_2929 71% ORF00040 traF (183) (203) Aave_0691 78% 81% ORF00041 Unknown (possible (403) (407) relaxase) Absent Absent ORF00056 bphS Absent Absent ORF00042 bphE Absent Absent ORF00043 bphG Absent Absent ORF00044 bphF Absent Absent ORF00046 bphA1 Absent Absent ORF00047 bphA2 Absent Absent ORF00048 bphA3 Absent Absent ORF00049 bphB Absent Absent ORF00050 bphC Absent Absent ORF00051 bphD Absent Absent ORF00052 Unknown Absent Absent ORF00053 bphA4
261 Aave_0692 Absent Absent transposase IS3/IS911 Aave_0693 Absent Absent transposase orfB, IS3 family Aave_0694 Absent Absent Integrase, catalytic region Aave_0695 Absent Absent transposition helper protein Aave_0696 Absent Absent transcriptional regulator, AraC family Aave_0697 Absent Absent 1-amino-cyclopropane- 1-carboxylate deaminase Aave_0698 Absent Absent transcriptional regulator, LysR family Aave_0699 Absent Absent (Acyl-carrier-protein) phosphodiesterase Aave_0700 Absent Absent major facilitator superfamily MFS_1 Aave_0701 Absent Absent putative transporter Aave_0702 Absent Absent transposase orfB, IS3 family Aave_0703 Absent Absent transposase IS3/IS911 family protein Aave_0704 Absent Absent Integral membrane protein Aave_0705 Absent Absent Transposase IS3/IS911 family protein Aave_0706 Absent Absent Transposase orfB, IS3 family Aave_0707 Absent Absent Transposase orfB, IS3 family Aave_0709 Absent Absent Transposase IS3/IS911 family protein Aave_0710 Absent Absent Transposase IS66 Aave_0711 Absent Absent IS66 Orf2 family protein Aave_0712 Absent Absent transposase IS3/IS911 family protein Aave_0713 Absent Absent NAD(P)H dehydrogenase (quinone) Aave_0714 Absent Absent GCN5-related N- acetyltransferase Aave_0715 Absent Absent Aldo/keto reductase Aave_0716 Absent Absent Transcriptional regulator, LysR family Aave_0717 Absent Absent Major facilitator superfamily MFS_1 Aave_0718 Absent Absent Small multidrug resistance protein Aave_0719 Absent Absent Transposition helper protein Aave_0720 Absent Absent Integrase, catalytic
262 region Aave_0721 Absent Absent small multidrug resistance protein Absent Ajs_2927 Absent transposase, IS4 family protein Absent Ajs_2926 Absent transcriptional regulator, MarR family Absent Ajs_2925 Absent transcriptional regulator, TetR family Absent Ajs_2924 Absent RND efflux system, outer membrane lipoprotein, NodT family Absent Ajs_2923 Absent transposase IS116/IS110/IS902 family protein Absent Ajs_2922 Absent Absent Ajs_2921 Absent secretion protein HlyD family protein Absent Ajs_2920 Absent Unknown Aave_0722 75% Ajs_2919 87% ORF00054 traR (314) (290) Aave_0724 87% Ajs_2913 93% ORF00030 traG (667) (665) Aave_0725 90% Ajs_2912 90% ORF00029 Unknown (154) (143) Aave_0726 82% Ajs_2911 90% ORF00028 trbB (345) (344) Aave_0727 88% Ajs_2910 90% ORF00027 trbC (124) (123) Aave_0728 Ajs_2909 Absent trbD Aave_0729 88% Ajs_2908 90% ORF00026 trbE (812) (809) Aave_0730 72% Ajs_2907 93% ORF00025 trbJ (249) (217) Aave_0731 48% Ajs_2906 70% ORF00024 Unknown (lipoprotein (60) (99) domain) Aave_0732 79% Ajs_2905 82% ORF00023 trbL (448) (444) Aave_0733 89% Ajs_2904 91% ORF00032 trbF (234) (234) Aave_0734 85% Ajs_2903 92% ORF00020 trbG (322) (326) Aave_0735 78% Ajs_2902 85% ORF00021 trbI (379) (420) Aave_0736 86% Ajs_2901 81% ORF00022 Unknown (81) (77)
263 Table A8-4: ORFs Associated with the Tn4371-like Element from the Genome of Bordetella petrii DSM 12804 Bordetella petrii Similarity Tn4371 Putative Role DSM 12804 to Tn4371 equivalent Bpet2166 74% ORF00001 Phage Intergrase (393) Bpet2167 Absent Unknown Bpet2168 Absent transcriptional regulator, XRE family Bpet2169 Absent Unknown Bpet2170 Absent Unknown Bpet2171 Absent Unknown Bpet2172 Absent radC DNA repair protein Absent ORF00002 Unknown Absent ORF00003 Unknown (Helix-turn-helix) Absent ORF00004 Unknown (contains several transmembrane regions) Absent ORF00005 IS1090- like truncated transposase Absent ORF00006 Unknown (37-kD nucleoid-associated bacterial protein) Absent ORF00007 Unknown (Phosphopantetheine attachment site) Absent ORF00008 DNA helicase, UvrD/REP type Absent ORF00009 Nuclease Bpet2173 94% ORF00010 Unknown (116) Bpet2174 Absent Unknown Absent ORF00011 Unknown Absent ORF00012 Unknown Bpet2175 84% ORF00013 Unknown (275) Bpet2176 85% ORF00014 ParB-like nuclease (661) Bpet2177 85% ORF00015 Unknown (pI 11.4, 91 amino acids long) (61) Bpet2178 Absent Unknown Bpet2179 Absent Unknown Absent ORF00016 Unknown Absent ORF00017 transcription regulator Bpet2180 96% ORF00018 Unknown (104) ORF00055 transcriptional regulator, XRE family Bpet2181 transcriptional regulator, XRE family Bpet2182 81% ORF00033 Lipoprotein (DNA binding domain) (115) Bpet2183 77% ORF00034 Unknown (253) Bpet2184 84% ORF00035 Putative Excisionase (71) Bpet2185 83% ORF00036 repA (285) Bpet2186 96% ORF00037 parA
264 (212) Bpet2187 88% ORF00038 parB (83) Bpet2188 72% ORF00039 Unknown (176) Bpet2189 74% ORF00040 traF (199) Bpet2190 90% ORF00041 Unknown (possible relaxase) (435) Bpet2191 Absent Acetyl-CoA acetyltransferase Bpet2192 Absent predicted oxidoreductase Bpet2193 Absent Unknown Bpet2194 Absent Acetyl-CoA acetyltransferase Bpet2195 Absent Protein involved in aromatic compounds catabolism Bpet2196 Absent transcriptional regulator, MarR family Bpet2197 Absent putative transmembrane transport protein Bpetpseudo_08 Absent NADH:flavin oxidoreductases, Old Yellow Enzyme family Bpetpseudo_09 Absent Unknown Bpet2198 Absent transcriptional regulator, LysR-family Bpet2199 Absent Threonine aldolase Bpet2000 Absent tautomerase Bpet2010 Absent probable MFS permease Absent ORF00056 bphS Absent ORF00042 bphE Absent ORF00043 bphG Absent ORF00044 bphF Absent ORF00046 bphA1 Absent ORF00047 bphA2 Absent ORF00048 bphA3 Absent ORF00049 bphB Absent ORF00050 bphC Absent ORF00051 bphD Absent ORF00052 Unknown Absent ORF00053 bphA4 Bpet2202 84% ORF00054 traR (311) Bpet2203 62% ORF00024 Unknown (lipoprotein domain) (53) Bpet2204 95% ORF00030 traG (667) Bpet2205 97% ORF00029 Unknown (137) Bpet2206 92% ORF00028 trbB (340) Bpet2207 95% ORF00027 trbC (121) Bpet2208 Absent trbD Bpet2209 92% ORF00026 trbE (817)
265 Bpet2210 83% ORF00025 trbJ (239) Bpet2211 52% ORF00024 Unknown (lipoprotein domain) (88) Bpet2212 82% ORF00023 trbL (449) Bpet2213 85% ORF00032 trbF (234) Bpet2214 87% ORF00020 trbG (326) Bpet2215 79% ORF00021 trbI (424) Bpet2216 83% ORF00022 Unknown (78)
266 Table A8-5: ORFs Associated with the Tn4371-like Element from the Genome of Shewanella sp. ANA-3 and from the Genome of Congregibacter litoralis KT71 Shewanella Similarity Congregibacter Similarity Tn4371 Putative Role sp. ANA -3 to Tn4371 litoralis KT71 to Tn4371 equivalent ORF2305 78% ORF2745 77% ORF00001 Phage Intergrase (391) (391) Absent Absent Absent PD-(D/E)XK nuclease superfamily ORF1245 ORF2355 Absent protein of unknown function DUF1044 ORF1246 ORF2360 Absent transcriptional regulator-like protein ORF1247 ORF2365 Absent ORF1248 ORF2370 Absent ORF1249 Absent Absent ATPase-like protein ORF1250 Absent Absent ISPsy14, transposase ORF1251 Absent Absent IstB domain protein ATP- binding protein Absent ORF2375 85% Absent Unknown (contains several transmembrane regions and a signal peptide) Absent ORF2380 89% Absent Transcriptional regulator, DeoR type Absent ORF2385 92% Absent Unknown Absent ORF2390 80% Absent ThiF family Ubiquitin- activating enzyme E1 Absent ORF2395 92% Absent Unknown (beta- lactamase like domain) ORF1252 ORF2400 Absent RadC/yeeS Absent ORF2405 Absent Unknown Absent ORF2410 Absent Unknown Absent ORF2415 Absent Unknown ORF1253 Absent Absent Unknown ORF1254 Absent Absent DNA helicase related protein ORF1255 Absent Absent Unknown ORF1256 Absent Absent Unknown ORF1257 Absent Absent Patatin
267 Absent Absent ORF00002 Unknown Absent Absent ORF00003 Unknown (Helix-turn- helix) Absent Absent ORF00004 Unknown (contains several transmembrane regions) Absent Absent ORF00005 IS1090- like truncated transposase Absent Absent ORF00006 Unknown (37- kD nucleoid- associated bacterial protein) Absent Absent ORF00007 Unknown (Phosphopanteth eine attachment site) Absent Absent ORF00008 DNA helicase, UvrD/REP type Absent Absent ORF00009 Nuclease Absent Absent ORF00010 Unknown Absent Absent Absent Unknown Absent Absent ORF00011 Unknown Absent Absent ORF00012 Unknown Absent Absent ORF00013 Unknown Absent Absent ORF00014 ParB-like nuclease Absent Absent ORF00015 Unknown (pI 11.4, 91 amino acids long) Absent Absent Absent Unknown Absent Absent ORF00016 Unknown Absent Absent ORF00017 transcription regulator Absent Absent ORF00018 Unknown ORF1258 75% ORF2420 78% ORF00055 transcriptional (90) (94) regulator, XRE family ORF1259 73% ORF2425 73% ORF00033 Lipoprotein (109) (109) (DNA binding domain) ORF1261 61% ORF2430 61% ORF00034 Unknown (242) (242) Absent Absent Absent Unknown ORF1262 81% ORF2435 80% ORF00035 Putative (91) (94) Excisionase ORF1263 82% ORF2430 81% ORF00036 repA (285) (281) ORF1264 90% ORF2435 91% ORF00037 parA
268 (211) (211) ORF1265 86% ORF2440 87% ORF00038 parB (80) (80) ORF1266 72% ORF2445 69% ORF00039 Unknown (177) (177) ORF1267 69% ORF2450 70% ORF00040 traF (191) (162) ORF1268 74% ORF2455 81% ORF00041 Unknown (420) (413) (possible relaxase) Absent Absent ORF00056 bphS Absent Absent ORF00042 bphE Absent Absent ORF00043 bphG Absent Absent ORF00044 bphF Absent Absent ORF00046 bphA1 Absent Absent ORF00047 bphA2 Absent Absent ORF00048 bphA3 Absent Absent ORF00049 bphB Absent Absent ORF00050 bphC Absent Absent ORF00051 bphD Absent Absent ORF00052 Unknown Absent Absent ORF00053 bphA4 Absent ORF2470 Absent 4-hydroxy- phenylacetate 3- monooxygenase, reductase component Absent ORF2475 Absent hypothetical protein Absent ORF2480 Absent Bacterial luciferase Absent ORF2485 Absent Transposase, IS204/IS1001/IS 1096/IS1165 Absent ORF2490 Absent conserved hypothetical protein, membrane Absent ORF2495 Absent transcriptional regulator, ArsR family protein Absent ORF2500 Absent Transcriptional regulator, TetR family protein Absent ORF2505 Absent Acriflavine resistance protein A (Precursor) Absent ORF2510 Absent Acriflavine resistance protein B Absent ORF2515 Absent RND efflux
269 system, outer membrane lipoprotein ORF1269 Absent Absent transcriptional regulator, XRE family ORF1270 Absent Absent major facilitator superfamily MFS_1 ORF1271 Absent Absent transcriptional regulator, LysR family ORF1272 Absent Absent hypothetical protein ORF1273 Absent Absent Smp-30/Cgr1 family protein ORF1274 Absent Absent Smp-30/Cgr1 family protein ORF1275 Absent Absent transcriptional regulator, IclR family ORF1276 Absent Absent protein of unknown function DUF336 ORF1277 Absent Absent probable multidrug/ chloramphenicol efflux transporter ORF1278 80% ORF2520 78% ORF00054 traR (299) (312) ORF1279 ORF2525 Absent lipoprotein ORF1280 87% ORF2530 88% ORF00030 traG (665) (665) ORF1281 90% ORF2535 90% ORF00029 Unknown (154) (141) ORF1282 84% ORF2540 81% ORF00028 trbB (345) (345) ORF1283 91% ORF2545 94% ORF00027 trbC (122) (107) ORF1284 86% ORF2550 87% Absent trbD ORF1285 88% ORF2555 88% ORF00026 trbE (816) (801) ORF1286 70% ORF2560 71% ORF00025 trbJ (241) (240) ORF1287 49% ORF2565 50% ORF00024 Unknown (lipoprotein domain) ORF1288 80% ORF2570 91% ORF00023 trbL (249) (271)
270 ORF1289 90% ORF2575 88% ORF00032 trbF (234) (234) ORF1290 83% ORF2580 86% ORF00020 trbG (236) (322) ORF1291 82% ORF2585 78% ORF00021 trbI (426) (425) ORF1292 85% ORF2690 86% ORF00022 Unknown (81) (81)
271 Table A8-6: ORFs Associated with the Tn4371-like Element from the Genome of P. aeruginosa PA7 and from the Genome of P. aeruginosa 2192. P. aeruginosa Similarity P. aeruginosa Similarity to Tn4371 Putative Role PA7 to Tn4371 2192 Tn4371 equivalent PSPA7_3747 75% Paer2_01002395 84% ORF00001 Phage (396) (397) Intergrase Absent Paer2_01002394 Absent Unknown Absent Paer2_01002393 Absent SAM- dependent methyltransfer ases Absent Paer2_01002392 Absent Thioredoxin reductase Absent Paer2_01002391 Absent RadC DNA repair protein PSPA7_3746 Absent Absent Unknown PSPA7_3745 Absent Absent transcriptional regulator, XRE family PSPA7_3744 Absent Absent Unknown PSPA7_3743 Absent Absent transcriptional regulator, XRE family PSPA7_3742 Absent Absent Unknown Absent Absent ORF00002 Unknown Absent Absent ORF00003 Unknown (Helix-turn- helix) Absent Absent ORF00004 Unknown (contains several trans- membrane regions) Absent Absent ORF00005 IS1090-like truncated transposase Absent Absent ORF00006 Unknown (37-kD nucleoid- associated bacterial protein) Absent Absent ORF00007 Unknown (Phospho- pantetheine attachment site) Absent Absent ORF00008 DNA helicase, UvrD/REP type Absent Absent ORF00009 Nuclease 272 Absent Absent ORF00010 Unknown Absent Absent ORF00011 Unknown Absent Absent ORF00012 Unknown PSPA7_3741 84% Paer2_01002390 84% ORF00013 Unknown (276) (276) PSPA7_3741 87% Paer2_01002389 86% ORF00014 ParB-like (690) (680) nuclease Absent Paer2_01002388 89% ORF00015 Unknown (pI (69) 11.4, 91 amino acids long) Absent Absent ORF00016 Unknown Absent Absent ORF00017 transcription regulator PSPA7_3738 84% Paer2_01002387 87% ORF00018 Unknown (104) (104) PSPA7_3737 78% Paer2_01002386 80% ORF00055 transcriptional (70) (78) regulator, XRE family PSPA7_3735 78% Paer2_01002385 75% ORF00033 Lipoprotein (111) (111) (DNA binding domain) PSPA7_3734 Absent Absent PSPA7_3733 63% Paer2_01002384 66% ORF00034 Unknown (246) (232) PSPA7_3732 84% Paer2_01002383 84% ORF00035 Putative (71) (70) Excisionase PSPA7_3731 83% Paer2_01002382 82% ORF00036 repA (280) (280) PSPA7_3730 94% Paer2_01002381 93% ORF00037 parA (212) (212) PSPA7_3729 96% Paer2_01002380 86% ORF00038 parB (29) (83) PSPA7_3728 78% Paer2_01002379 73% ORF00039 Unknown (155) (163) PSPA7_3727 72% Paer2_01002378 78% ORF00040 traF (203) (203) PSPA7_3726 87% Paer2_01002377 81% ORF00041 Unknown (400) (407) (possible relaxase) Absent Absent ORF00056 bphS Absent Absent ORF00042 bphE Absent Absent ORF00043 bphG Absent Absent ORF00044 bphF Absent Absent ORF00046 bphA1 Absent Absent ORF00047 bphA2 Absent Absent ORF00048 bphA3 Absent Absent ORF00049 bphB Absent Absent ORF00050 bphC Absent Absent ORF00051 bphD Absent Absent ORF00052 Unknown
273 Absent Absent ORF00053 bphA4 PSPA7_3725 Absent Absent DNA-binding protein PSPA7_3724 Absent Absent Absent PSPA7_3723 84% Paer2_01002372 78% ORF00054 transcriptional (310) (312) regulator, LysR family PSPA7_3722 52% Paer2_01002363 50% ORF00024 Unknown (57) (86) (lipoprotein domain) PSPA7_3721 Absent Absent Amino- glycoside 3'- phospho- transferase PSPA7_3720 Absent Absent bleomycin resistance protein PSPA7_3719 Absent Absent streptomycin 3''-kinase PSPA7_3718 Absent Absent VirD2 components relaxase PSPA7_3717 Absent Absent KDP operon transcriptional regulatory protein KdpE PSPA7_3716 Absent Absent sensor protein KdpD PSPA7_3715 Absent Absent PTS system, nitrogen regulatory IIA component PSPA7_3714 Absent Absent K+- transporting ATPase, C subunit PSPA7_3713 Absent Absent K+- transporting ATPase, B subunit PSPA7_3712 Absent Absent K+- transporting ATPase, A subunit PSPA7_3711 Absent Absent Unknown Absent Paer2_01002376 Absent Trans- criptional regulator Absent Paer2_01002375 Absent Membrane- fusion protein Absent Paer2_01002374 Absent Cation /multidrug 274 efflux pump Absent Paer2_01002373 Absent Outer membrane protein PSPA7_3710 84% Paer2_01002372 78% ORF00054 traR (310) (312) PSPA7_3708 92% Paer2_01002370 88% ORF00030 traG (667) (668) PSPA7_3707 95% Paer2_01002369 90% ORF00029 Unknown (153) (154) PSPA7_3706 95% Paer2_01002368 83% ORF00028 trbB (326 (332) PSPA7_3705 92% Paer2_01002367 94% ORF00027 trbC (127) (107) PSPA7_3704 Paer2_01002366 Absent trbD PSPA7_3703 92% Paer2_01002365 88% ORF00026 trbE (803) (815) PSPA7_3702 82% Paer2_01002364 72% ORF00025 trbJ (234) (239) PSPA7_3701 52% Paer2_01002363 50% ORF00024 Unknown (57) (86) (lipoprotein domain) PSPA7_3700 81% Paer2_01002362 90% ORF00023 trbL (461) (271) PSPA7_3699 87% Paer2_01002361 88% ORF00032 trbF (234) (234) PSPA7_3698 88% Paer2_01002360 86% ORF00020 trbG (326) (312) PSPA7_3697 81% Paer2_01002359 79% ORF00021 trbI (415) (425) PSPA7_3696 88% Paer2_01002358 86% ORF00022 Unknown (69) (81)
275 Appendix 9: List of DNA Sequences submitted to the EMBL Database
Accession Organism Strain Gene Number AM501933 Ralstonia pickettii JCM5969 16S rRNA, ITS1 and 23S rRNA AM501934 Ralstonia pickettii ULC193 16S rRNA, ITS1 and 23S rRNA AM501935 Ralstonia pickettii ULC194 16S rRNA, ITS1 and 23S rRNA AM501936 Ralstonia pickettii ULC244 16S rRNA, ITS1 and 23S rRNA AM501937 Ralstonia pickettii ULC421 16S rRNA, ITS1 and 23S rRNA AM501938 Ralstonia pickettii ULI174 16S rRNA, ITS1 and 23S rRNA AM501939 Ralstonia pickettii ULI187 16S rRNA, ITS1 and 23S rRNA AM501940 Ralstonia pickettii ULI798 16S rRNA, ITS1 and 23S rRNA AM501941 Ralstonia pickettii ULM001 16S rRNA, ITS1 and 23S rRNA AM501942 Ralstonia pickettii ULM004 16S rRNA, ITS1 and 23S rRNA AM501943 Ralstonia pickettii ULM005 16S rRNA, ITS1 and 23S rRNA AM501944 Ralstonia pickettii ULM006 16S rRNA, ITS1 AM501945 Ralstonia pickettii CCUG18841 16S rRNA, ITS1 and 23S rRNA AM501946 Ralstonia insidiosa LMG21421 16S rRNA, ITS1 and 23S rRNA AM501947 Ralstonia insidiosa ATCC49129 16S rRNA, ITS1 and 23S rRNA AM501948 Ralstonia insidiosa ULI815 16S rRNA, ITS1 and 23S rRNA AM501949 Ralstonia insidiosa ULI785 16S rRNA, ITS1 and 23S rRNA AM501950 Ralstonia insidiosa ULI795 16S rRNA, ITS1 and 23S rRNA AM501951 Ralstonia insidiosa ULI819 16S rRNA, ITS1 and 23S rRNA AM501952 Ralstonia insidiosa ULI821 16S rRNA, ITS1 and 23S rRNA FM244486 Ralstonia pickettii ULM001 partial int gene for putative Tn4371-like integrase FM244487 Ralstonia pickettii ULM001 partial repA gene and partial parA gene (Tn4371-like element) FM244488 Ralstonia pickettii ULM001 partial traG gene for putative DNA coupling protein (Tn4371- like element) FM244489 Ralstonia pickettii ULM001 partial trbI gene for putative type IV secretion system protein (Tn4371-like element) FM244490 Ralstonia pickettii ULM001 attP ICE Tn4371 associated recombination site (Tn4371-like element)
276 Appendix 10: List of Publications
Published Peer Reviewed Papers:
Adley C.C., Ryan M.P., Pembroke J.T. and Saieb F.M. 2005. Ralstonia pickettii: Biofilm formation in high-purity water. In McBain A., Allison D., Pratten J., Spratt D., Upton M., Verran J. eds. Biofilms: persistence and ubiquity. Biofilm Club: Cardiff, 261-271.
Ryan M.P., Pembroke J.T. and Adley C.C. 2006. Ralstonia pickettii: a persistent gram- negative nosocomial infectious organism. Journal of Hospital Infection, 62: 278-284.
Ryan M.P., Pembroke J.T. and Adley C.C. 2007. Ralstonia pickettii in Environmental Biotechnology: Potential and Applications. Journal of Applied Microbiology, 103: 754- 764.
Published Papers
Ryan M.P., Pembroke J.T. and Adley C.C. 2006. Ralstonia pickettii: A Growing Nosocomial Infectious Threat. National Institute of Health Sciences Research Bulletin, 3: 63-64.
Pembroke J.T., Adley C.C. and Ryan M.P. 2007. BAP-like proteins associated with meticillin resistant Staphylococcus aureus (MRSA) are involved in biofilm formation and virulence and may provide a target for drug intervention in Staphylococcal infection. National Institute of Health Sciences Research Bulletin, 4: 22-23.
Ryan M.P., Pembroke J.T. and Adley C.C. 2008. Ralstonia insidiosa: A Growing Nosocomial Infectious Threat. National Institute of Health Sciences Research Bulletin, 4: 59-61.
277 Submitted Papers
Ryan M.P., Pembroke J.T. and Adley C.C. 2009. Discovery of a number of novel Tn4371-like elements in the genomes of different bacteria. BMC Microbiology, Article in Review.
Oral Presentations:
Ryan M.P., Pembroke J.T. and Adley C.C. 2007. Diversity of Ralstonia pickettii. In Proceedings of the Society for General Microbiology. Biofilm: a systems microbiology analysis. Irish Branch Meeting, University of Limerick 19th-20th April 2007. p 16.
Conference Proceedings:
Ryan M.P., Pembroke J.T. and Adley C.C. Microbial contamination of high purity water. In Proceedings of the Society for General Microbiology. Environmental genomics: future microbiological perspectives. Irish Branch Meeting, University College Cork; 2005. p.25.
Adley C.C., Pembroke J.T. and Ryan M.P. Industrial, Clinical and Environmental Significance of Ralstonia pickettii In Proceedings of First Annual DOE Joint Genome Institute User Meeting, First Annual DOE Joint Genome Institute User Meeting; Walnut Creek, California; 2006. p.9.
Ryan M.P., Pembroke J.T. and Adley C.C. 2006. Comparison of Biochemical and PCR assays to distinguish Ralstonia pickettii and Ralstonia insidiosa. In Proceedings of the Society for General Microbiology. Mechanisms of Bacterial Adhesion and Invasion. Irish Branch Meeting, Trinity College Dublin; 2006. p.65.
Ryan M.P., Pembroke J.T. and Adley C.C. 2007. Diversity of Ralstonia pickettii. In Proceedings of the Society for General Microbiology. Biofilm: a systems microbiology analysis. Irish Branch Meeting, University of Limerick; 2007. p16.
278 Appendix 11: Publications
Chapter 1:
Ryan M.P., Pembroke J.T. and Adley C.C. 2006. Ralstonia pickettii: a persistent gram- negative nosocomial infectious organism. Journal of Hospital Infection, 62: 278-284.
Ryan M.P., Pembroke J.T. and Adley C.C. 2007. Ralstonia pickettii in Environmental Biotechnology: Potential and Applications. Journal of Applied Microbiology, 103: 754- 764.
Ryan M.P., Pembroke J.T. and Adley C.C. 2006. Ralstonia pickettii: A Growing Nosocomial Infectious Threat. National Institute of Health Sciences Research Bulletin, 3: 63-64.
Chapter 3:
Adley C.C., Ryan M.P., Pembroke J.T. and Saieb F.M. 2005. Ralstonia pickettii: Biofilm formation in high-purity water. In McBain A., Allison D., Pratten J., Spratt D., Upton M., Verran J. eds. Biofilms: persistence and ubiquity. Biofilm Club: Cardiff, 261-271.
Ryan M.P., Pembroke J.T. and Adley C.C. 2008. Ralstonia insidiosa: A Growing Nosocomial Infectious Threat. National Institute of Health Sciences Research Bulletin, 4: 59-61.
Chapter 4:
Ryan M.P., Pembroke J.T. and Adley C.C. 2009. Discovery of a number of novel Tn4371-like elements in the genomes of different bacteria. BMC Microbiology, Article in Press
279