DOCSLIB.ORG

Russula Crassotunicata Identified As Host for Dendrocollybia Racemosa

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Russula Crassotunicata Identified As Host for Dendrocollybia Racemosa Pacific Northwest Fungi Volume 1, Number 9, Pages 1-7 Published August 24, 2006 Russula crassotunicata identified as host for Dendrocollybia racemosa N. Machnicki1*, L.L. Wright2, A. Allen2, C. P. Robertson2, C. Meyer2, J.M. Birkebak2, and J.F. Ammirati1 1Biology Department, Box 351800, University of Washington, Seattle, WA 98195-1800 2Shadow Lake Bog Macrofungi Survey, 5349 S. Creston Street, Seattle, WA, 98178 Machnicki, N., L. L. Wright, A. Allen, C. P. Robertson, C. Meyer, J. M. Birkeback, and J. F. Ammirati. 2006. Russula crassotunicata identified as host for Dendrocollybia racemosa. Pacific Northwest Fungi 1(9): 1-7. DOI: 10.2509/pnwf.2006.001.009 *Corresponding author [email protected] Accepted for publication August 11, 2006. ISSN 1931-3349. Copyright © 2006 Pacific Northwest Fungi Project. All rights reserved. Abstract: Russula crassotunicata was identified as a host species for the mycosaprobic basidiomycete Dendrocollybia racemosa. Sclerotia of the latter species were harvested from the gills of sporocarps known to be R. crassotunicata and isolated in pure culture. DNA sequences of the ribosomal ITS1-5.8S-ITS2 region of these sclerotia were used to identify and phylogenetically place the species as D. racemosa. This paper represents the first report of a confirmed host for D. racemosa. Key Words: Dendrocollybia racemosa, Russula crassotunicata, Collybia, mycoparasite, mycosaprobe, sclerotia. 2 Machnicki et al. 2006. Russula crassotunicata on Dendrocollybia racemosa. Pacific Northwest Fungi 1 (9): 1-7. Introduction: Russula crassotunicata Materials and Methods Singer is an ectomycorrhizal basidiomycete distributed in the western part of North Field collections Since August 2003, the America from northern California to British authors have made weekly collections along Columbia, and east in the boreal forests of one of three transects at our field site for a Canada as far as the northern Great Lakes survey of the macrofungi of Shadow Lake region (Singer, 1957). R. crassotunicata Bog, in Maple Valley, Washington. The produces large, fleshy basidiocarps area, a lacustrine bog that was formed by characterized by an unusually thick, rubbery glacial recession at the end of the pellicle, which can be easily separated from Pleistocene, is dominated by Tsuga the pileal context (Fig. 1A). In the Pacific heterophylla, Rhododendron Northwest, we have observed R. groenlandicum, Kalmia microphylla, crassotunicata to be common under Sphagnum, and other moss species. conifers and is often locally abundant to In February 2004 we collected several prolific. decomposing R. crassotunicata fruiting bodies that had two types of sclerotia At our field site, a low-elevation Sphagnum located within the decaying gills. The bog southeast of Seattle, Washington, specimens were transported back to the lab Russula crassotunicata (identified using and photographed. Thiers 1997), actively fruits from late June through October (Fig. 1B). However, the Cultures The black, globose sclerotia were basidiocarps are slow to decay and are removed from the R. crassotunicata gills present almost year-round in various states and gently agitated in a 2% hypochlorite of decomposition. The basidiocarps of R. solution for 15 minutes to achieve surface crassotunicata provide a substrate for many sterilization. The sclerotia were then triple- mycosaprobic organisms, including Collybia rinsed in DI water and plated on various tuberosa (Bull.: Fr.) Kummer, a growing media. The most abundant hyphal mycosaprobic basidiomycete that is widely growth was observed on 33% V8 agar distributed and common in the northern containing 0.5% ampicillin, tetracycline, and latitudes. C. tuberosa is frequently collected streptomycin. Cultures were incubated for at our field site, and its characteristic one month in ambient temperature and light reddish brown, ellipsoid sclerotia are often conditions. observed growing on the rotten basidiocarps of R. crassotunicata. The DNA Extractions DNA was extracted using presence of these distinctive sclerotia the FastDNA® Kit and the FastPrep® facilitates the quick identification of C. FP120 Bead Beater (Qbiogene, Inc., CA). tuberosa, even when C. tuberosa Approximately 0.1g of mycelium was basidiocarps are not present. In our survey, scraped from the surface colonies growing we frequently checked the underside of on a V8 agar media and placed in lysing rotten R. crassotunicata basidiocarps for the tubes containing 1 ml of CLS-Y buffer. The presence of C. tuberosa sclerotia. On mycelium was disrupted at a setting of 5.0 several occasions, along with sclerotia for 20 seconds and DNA purified according characteristic of C. tuberosa, we observed to the FastDNA kit instructions. blackish, irregularly globose sclerotia (Fig. 1C) growing between the gills of decaying PCR and DNA Sequencing Amplification R. crassotunicata sporocarps. Because using PCR was accomplished using 20 μl these sclerotia were clearly morphologically reaction volumes consisting of 20 ng different than those of C. tuberosa, we genomic DNA, 10 mM Tris-HCl (pH 9.0), 50 decided to investigate them further. mM KCl, 2.5 mM MgCl2, 0.2% Triton X-100, dNTPs and 200 μl each, 0.5 units of Taq DNA polymerase (Promega), and 0.125 μM Machnicki et al. 2006. Russula crassotunicata on Dendrocollybia racemosa. Pacific Northwest Fungi 1 (9): 1-7. 3 primers. The ITS1-5.8s-ITS2 region of rDNA Results: A GenBank nucleotide BLAST was amplified with ITS1F (5' search with our sequences using the default TTGGTCATTTAGAGGAAGTAA 3') and NCBI parameters for BLAST returned an ITS4 (5' TCCTCCGCTTATTGATATGC 3') exact match for Dendrocollybia racemosa primers (White et al., 1990). PCR’s were with 100% sequence similarity (708/708 initiated with a 93 °C dwell for 2 min, identities). Maximum parsimony analyses followed by 39 cycles of the following: 93°C performed using the branch and bound denature for 15 sec, 60°C for 1.5 min, 72° C search method resulted in 36 equally for 1.5 min. Amplified DNA fragments were parsimonious trees. A consensus tree with electrophoresed in a 1.5% agarose gel, 1000 bootstrap replicates is represented in stained with ethidium bromide, and checked Figure 2. under ultraviolet light to confirm a single product. PCR products were cut out of Discussion: Dendrocollybia racemosa agarose gels and centrifuged through glass (Pers. : Fr) R. H. Petersen & Redhead has wool at 6000 rpm for 4 min. PCR products been collected from Northern California to were sequenced by Northwoods DNA Inc. British Columbia. It is less common than the (http://www.nwdna.com) using ITS1F and more widely distributed species, C. ITS4 primers (White et al., 1990). tuberosa. Both species are often collected from badly decayed basidiocarps, in a Phylogenetic Trees Sequences of the condition that makes identification of the ITS1-5.8S-ITS2 region were analyzed and exact host taxon impossible. Some authors compared using Sequencher (Gene Codes (Hughes et al.. 2001, Aurora 1986) have Corporation, USA). A BLAST search was suggested members of the genera Lactarius performed to identify similar sequences in and Russula as probable hosts. To our GenBank. Phylogenetic trees were knowledge, there have been no published constructed with the rDNA sequences we reports definitively identifying the host(s) of generated and GenBank sequences of these mycosaprobic fungi. The degree of related taxa. Along with our sequence, host specificity of these species is still eighteen accessions representing 7 species unclear, and R. crassotunicata may were selected from the GenBank sequence represent one of several possible hosts. database (http://evolve.zoo.ox.ac.uk/software.html?id We were able to identify the host fungus of =seal) based on previously published Dendrocollybia racemosa as Russula. phylogenetic trees (http://mor.clarku.edu, crassotunicata with confidence and without Hughes, et al. 2001). Accession numbers the need for molecular analysis of the are listed in Table 1. Tricholoma decayed sporocarps due to the unique atroviolaceum Smith was included to serve nature of our survey, which included weekly as an outgroup and to root the trees. The trips to our field site for a period of over two sequences were aligned using ClustalW years. During this time, we collected (http://www.ebi.ac.uk/clustalw) and visually sporocarps and phenological data along checked using Se-Al v2.0a11 three transects. For many of the fleshier and (http://evolve.zoo.ox.ac.uk/software.html?id more persistent species, these weekly visits =seal). Any alignment errors observed allowed us to observe the progression of among sequences were corrected manually. individual sporocarps from button stage Maximum parsimony trees were generated through maturity and into decomposition. using PAUP* v4.0. A branch and bound Thus we were able to definitively identify search method using PAUP* default individual R. crassotunicata sporocarps in parameters was used to search for trees, the field before they began to decay, and with MAXTREES set to 1000. Branching return to the same individuals to check for order significance was assessed by the presence of sclerotia once bootstrapping with 1000 replicates. decomposition had progressed to an 4 Machnicki et al. 2006. Russula crassotunicata on Dendrocollybia racemosa. Pacific Northwest Fungi 1 (9): 1-7. advanced state. Based on this familiarity distinguished morphologically by its with individual R. crassotunicata formation of short conidia-producing sporocarps, we are confident that the outgrowths along the length of its
Load more

Recommended publications
  • Antiviral Bioactive Compounds of Mushrooms and Their Antiviral Mechanisms: a Review
    viruses Review Antiviral Bioactive Compounds of Mushrooms and Their Antiviral Mechanisms: A Review Dong Joo Seo 1 and Changsun Choi 2,* 1 Department of Food Science and Nutrition, College of Health and Welfare and Education, Gwangju University 277 Hyodeok-ro, Nam-gu, Gwangju 61743, Korea; [email protected] 2 Department of Food and Nutrition, School of Food Science and Technology, College of Biotechnology and Natural Resources, Chung-Ang University, 4726 Seodongdaero, Daeduck-myun, Anseong-si, Gyeonggi-do 17546, Korea * Correspondence: [email protected]; Tel.: +82-31-670-4589; Fax: +82-31-676-8741 Abstract: Mushrooms are used in their natural form as a food supplement and food additive. In addition, several bioactive compounds beneficial for human health have been derived from mushrooms. Among them, polysaccharides, carbohydrate-binding protein, peptides, proteins, enzymes, polyphenols, triterpenes, triterpenoids, and several other compounds exert antiviral activity against DNA and RNA viruses. Their antiviral targets were mostly virus entry, viral genome replication, viral proteins, and cellular proteins and influenced immune modulation, which was evaluated through pre-, simultaneous-, co-, and post-treatment in vitro and in vivo studies. In particular, they treated and relieved the viral diseases caused by herpes simplex virus, influenza virus, and human immunodeficiency virus (HIV). Some mushroom compounds that act against HIV, influenza A virus, and hepatitis C virus showed antiviral effects comparable to those of antiviral drugs. Therefore, bioactive compounds from mushrooms could be candidates for treating viral infections. Citation: Seo, D.J.; Choi, C. Antiviral Bioactive Compounds of Mushrooms Keywords: mushroom; bioactive compound; virus; infection; antiviral mechanism and Their Antiviral Mechanisms: A Review.
    [Show full text]
  • Gymnomyces Xerophilus Sp. Nov. (Sequestrate Russulaceae), an Ectomycorrhizal Associate of Quercus in California
    MYCOLOGICAL RESEARCH I I0 (2006) 57 5-582 Gymnomyces xerophilus sp. nov. (sequestrate Russulaceae), an ectomycorrhizal associate of Quercus in California Matthew E. SMITHa1*,James M. TRAPPE~,Dauid M. RIZZOa, Steven I. MILLERC 'Department of Plant Pathology, University of California at Davis, Davis CA 95616, USA b~epartmentof Forest Science, Oregon State University, Camallis, OR 97331-5752, USA CDeparhnentof Botany, University of Wyoming, Laramie, WY 82071, USA ARTICLE INFO ABSTRACT Article history: Gymnomyces xerophilus sp. nov., a sequestrate species in the Russulaceae, is characterized Received 30 August 2005 and descn'bed morphologically as a new species from Quercus-dominated woodlands in Accepted 14 February 2006 California. ITS sequences recovered from healthy, ectomycorrhizal roots of Quercus dougla- Corresponding Editor: Michael Weiss sii and Q. wislizeni matched those of G. xerophfius basidiomata, confirming the ectomycor- -- rhizal status of this fungus. Phylogenetic analysis of the ITS region places G. xerophilus in Keywords: a clade with both agaricoid (Russula in the section Polychromae) and sequestrate (Gymno- Basidiomycota myces, Cystangium) relatives. We include a dichotomous key to the species of Gymnomyces Hypogeous fungi associated with Quercus. ITS O 2006 The British Mycological Society. Published by Elsevier Ltd. All rights reserved. Molecular phylogeny Russula Introduction mycelium, potentially reducing drought stress (Duddridge et al. 1980; Parke et al. 1983). Quercus-dominated ecosystems cover about one third of dali- Although the EM fungi associated with Quercus in California fornia's 404,000bm2(Pavlik et al. 1991). Quercus spp. are well have not been studied extensively, Thiers (1984) and Trappe adapted to the state's extensive areas of dry, Mediterranean and Claridge (2005) suggest that seasonally dry climates exert climate, with at least 7 species considered endemic (Nixon a selection pressure towards a sequestrate fruiting habit in 2002).
    [Show full text]
  • Ectomycorrhizal Synthesis of Lactarius Sanguifluus (Paulet) Fr
    European Journal of Biotechnology and Bioscience European Journal of Biotechnology and Bioscience ISSN: 2321-9122; Impact Factor: RJIF 5.44 Received: 13-09-2019; Accepted: 14-10-2019 www.biosciencejournals.com Volume 7; Issue 6; November 2019; Page No. 89-92 Ectomycorrhizal synthesis of Lactarius sanguifluus (Paulet) Fr. with Abies pindrow Royle Ex D. Don Shiv Kumar1, Anand Sagar2, Amit Kumar Sehgal3* 1 Additional Superintendent of Police, District Solan, Himachal Pradesh, India 2 Department of Biosciences, Himachal Pradesh University Summer Hill Shimla, Himachal Pradesh, India 3 Department of Botany, Govt. College Dhaliara District Kangra, Himachal Pradesh, India Abstract This study was aimed to perform in vitro mycorrhizal synthesis between Abies pindrow and Lactarius sanguifluus was achieved. A. pindrow seedlings inoculated with mycelial culture of L. sanguifluus resulted in the formation of short, branched lateral roots which ultimately form ectotrophic mycorrhizae. Synthesized mycorrhizae were light brown to pale yellow in colour. The transverse sections of the synthesized roots showed a typical ectomycorrhizal anatomy. The anatomical structure of mycorrhiza revealed the presence of thick fungal mantle and well developed “Hartig net”. Pure culture of L. sanguifluus was reisolated from both vermiculite peat moss mixture and synthesized ectomycorrhizae. These were compared with the original culture isolated from the fruiting bodies of L. sanguifluus and were found to have same cultural characteristics, thus confirming the symbiotic association. Keywords: Lactarius sanguifluus, ectomycorrhiza, in vitro Introduction systems of mycorrhizal synthesis have been developed and Lactarius sanguifluus is an ectomycorrhizal mushroom examined the ability of fungi to form ectomycorrhizae belonging in the family russulaceae grow scattered or in (Chilvers et al., 1986; Kottke et al., 1987; Kasuya et al., groups on the ground under conifers forest.
    [Show full text]
  • Appendix K. Survey and Manage Species Persistence Evaluation
    Appendix K. Survey and Manage Species Persistence Evaluation Establishment of the 95-foot wide construction corridor and TEWAs would likely remove individuals of H. caeruleus and modify microclimate conditions around individuals that are not removed. The removal of forests and host trees and disturbance to soil could negatively affect H. caeruleus in adjacent areas by removing its habitat, disturbing the roots of host trees, and affecting its mycorrhizal association with the trees, potentially affecting site persistence. Restored portions of the corridor and TEWAs would be dominated by early seral vegetation for approximately 30 years, which would result in long-term changes to habitat conditions. A 30-foot wide portion of the corridor would be maintained in low-growing vegetation for pipeline maintenance and would not provide habitat for the species during the life of the project. Hygrophorus caeruleus is not likely to persist at one of the sites in the project area because of the extent of impacts and the proximity of the recorded observation to the corridor. Hygrophorus caeruleus is likely to persist at the remaining three sites in the project area (MP 168.8 and MP 172.4 (north), and MP 172.5-172.7) because the majority of observations within the sites are more than 90 feet from the corridor, where direct effects are not anticipated and indirect effects are unlikely. The site at MP 168.8 is in a forested area on an east-facing slope, and a paved road occurs through the southeast part of the site. Four out of five observations are more than 90 feet southwest of the corridor and are not likely to be directly or indirectly affected by the PCGP Project based on the distance from the corridor, extent of forests surrounding the observations, and proximity to an existing open corridor (the road), indicating the species is likely resilient to edge- related effects at the site.
    [Show full text]
  • Major Clades of Agaricales: a Multilocus Phylogenetic Overview
    Mycologia, 98(6), 2006, pp. 982–995. # 2006 by The Mycological Society of America, Lawrence, KS 66044-8897 Major clades of Agaricales: a multilocus phylogenetic overview P. Brandon Matheny1 Duur K. Aanen Judd M. Curtis Laboratory of Genetics, Arboretumlaan 4, 6703 BD, Biology Department, Clark University, 950 Main Street, Wageningen, The Netherlands Worcester, Massachusetts, 01610 Matthew DeNitis Vale´rie Hofstetter 127 Harrington Way, Worcester, Massachusetts 01604 Department of Biology, Box 90338, Duke University, Durham, North Carolina 27708 Graciela M. Daniele Instituto Multidisciplinario de Biologı´a Vegetal, M. Catherine Aime CONICET-Universidad Nacional de Co´rdoba, Casilla USDA-ARS, Systematic Botany and Mycology de Correo 495, 5000 Co´rdoba, Argentina Laboratory, Room 304, Building 011A, 10300 Baltimore Avenue, Beltsville, Maryland 20705-2350 Dennis E. Desjardin Department of Biology, San Francisco State University, Jean-Marc Moncalvo San Francisco, California 94132 Centre for Biodiversity and Conservation Biology, Royal Ontario Museum and Department of Botany, University Bradley R. Kropp of Toronto, Toronto, Ontario, M5S 2C6 Canada Department of Biology, Utah State University, Logan, Utah 84322 Zai-Wei Ge Zhu-Liang Yang Lorelei L. Norvell Kunming Institute of Botany, Chinese Academy of Pacific Northwest Mycology Service, 6720 NW Skyline Sciences, Kunming 650204, P.R. China Boulevard, Portland, Oregon 97229-1309 Jason C. Slot Andrew Parker Biology Department, Clark University, 950 Main Street, 127 Raven Way, Metaline Falls, Washington 99153- Worcester, Massachusetts, 01609 9720 Joseph F. Ammirati Else C. Vellinga University of Washington, Biology Department, Box Department of Plant and Microbial Biology, 111 355325, Seattle, Washington 98195 Koshland Hall, University of California, Berkeley, California 94720-3102 Timothy J.
    [Show full text]
  • Field Guide to Common Macrofungi in Eastern Forests and Their Ecosystem Functions
    United States Department of Field Guide to Agriculture Common Macrofungi Forest Service in Eastern Forests Northern Research Station and Their Ecosystem General Technical Report NRS-79 Functions Michael E. Ostry Neil A. Anderson Joseph G. O’Brien Cover Photos Front: Morel, Morchella esculenta. Photo by Neil A. Anderson, University of Minnesota. Back: Bear’s Head Tooth, Hericium coralloides. Photo by Michael E. Ostry, U.S. Forest Service. The Authors MICHAEL E. OSTRY, research plant pathologist, U.S. Forest Service, Northern Research Station, St. Paul, MN NEIL A. ANDERSON, professor emeritus, University of Minnesota, Department of Plant Pathology, St. Paul, MN JOSEPH G. O’BRIEN, plant pathologist, U.S. Forest Service, Forest Health Protection, St. Paul, MN Manuscript received for publication 23 April 2010 Published by: For additional copies: U.S. FOREST SERVICE U.S. Forest Service 11 CAMPUS BLVD SUITE 200 Publications Distribution NEWTOWN SQUARE PA 19073 359 Main Road Delaware, OH 43015-8640 April 2011 Fax: (740)368-0152 Visit our homepage at: http://www.nrs.fs.fed.us/ CONTENTS Introduction: About this Guide 1 Mushroom Basics 2 Aspen-Birch Ecosystem Mycorrhizal On the ground associated with tree roots Fly Agaric Amanita muscaria 8 Destroying Angel Amanita virosa, A. verna, A. bisporigera 9 The Omnipresent Laccaria Laccaria bicolor 10 Aspen Bolete Leccinum aurantiacum, L. insigne 11 Birch Bolete Leccinum scabrum 12 Saprophytic Litter and Wood Decay On wood Oyster Mushroom Pleurotus populinus (P. ostreatus) 13 Artist’s Conk Ganoderma applanatum
    [Show full text]
  • Elias Fries – En Produktiv Vetenskapsman Redan Som Tonåring Började Fries Att Skriva Uppsatser Om Naturen
    Elias Fries – en produktiv vetenskapsman Redan som tonåring började Fries att skriva uppsatser om naturen. År 1811, då han fyllt 17 år, fick han sina första alster publi- cerade. Samma år påbörjade han universitetsstudier i Lund och tre år senare var han klar med sin magisterexamen. Därefter Elias Fries – ein produktiver Wissenschaftler följde inte mindre än 64 aktiva år som mykolog, botanist, filosof, lärare, riksdagsman och akademiledamot. Han var oerhört produktiv och författade inte bara stora och betydande böcker i mykologi och botanik utan också hundratals mindre artiklar och uppsatser. Dessutom ledde han ett omfattande arbete med att avbilda svampar. Dessa målningar utgavs som planscher och Bereits als Teenager begann Fries Aufsätze dem schrieb er Tagebücher und die „Tidningar i Na- Die Zeit in Uppsala – weitere 40 Jahre im das führte zu sehr erfolgreichen Ausgaben seiner und schrieb: „In Gleichheit mit allem dem das sich aus Auch der Sohn Elias Petrus, geboren im Jahre 1834, und Seth Lundell (Sammlungen in Uppsala), Fredrik über die Natur zu schreiben. Im Jahre 1811, turalhistorien“ (Neuigkeiten in der Naturalgeschich- Dienste der Mykologie Werke. Das erste, „Sveriges ätliga och giftiga svam- edlen Naturtrieben entwickelt, erfordert das Entstehen war ein begeisterter Botaniker und Mykologe. Leider Hård av Segerstad (publizierte 1924 eine Überarbei- te) mit Artikeln über beispielsweise seltene Pilze, Auch nach seinem Umzug nach Uppsala im Jahre par“ (Schwedens essbare und giftige Pilze), war ein dieser Liebe zur Natur ernste Bemühungen, aber es verstarb er schon in jungen Jahren. Ein dritter Sohn, tung von Fries’ Aufzeichnungen), Meinhard Moser bidrog till att kunskap om svamp spreds. Efter honom har givetvis det vetenskapliga arbetet utvecklats vidare men än idag an- in seinem 18.
    [Show full text]
  • [Hypsizygus Ulmarius (Bull.:Fr.) Redhead] Mushroom
    Int.J.Curr.Microbiol.App.Sci (2018) 7(6): 2440-2445 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 06 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.706.290 Effect of Physiological Parameters on Mycelial Growth of Blue Oyster [Hypsizygus ulmarius (Bull.:Fr.) Redhead] Mushroom Pankaj Kumar Sharma1*, Fateh Singh2, Surjeet Singh1 and Aman Dhawan1 1Department of Plant Pathology, College of Agriculture, CCS Haryana Agricultural University, Hisar-125004, Haryana, India 2District Extension Specialist (Plant Pathology) Krishi Vigyan Kendra Jind – 126102, Haryana, India *Corresponding author ABSTRACT K e yw or ds Mushrooms are the fruiting bodies of macro fungi which serve as food, tonic and medicine. They are capable of producing the highest quantity of protein per unit area and Hypsizygus ulmarius, temperature, pH, mycelial time from agri-residues. This study was aimed to find out the physiological requirements growth, biomass for mycelial growth and biomass production of Hypsizygus ulmarius (Bull.: Fr.) Redhead. Article Info Four level of temperature (15±1˚C, 20±1˚C, 25±1˚Cand 30±1˚C) and pH (5.0, 6.0, 7.0 and 8.0) were studied to find out the best temperature and pH using PDA medium to obtain Accepted: maximum mycelial growth and biomass. Temperature level at 25±1˚C (89.8 mm; 2.6 20 May 2018 g/250 ml) and pH at 7 (90 mm; 2.5 g/250 ml) proved to be most favourable, recording the Avail able Online: maximum mycelial growth and biomass production.
    [Show full text]
  • Russulas of Southern Vancouver Island Coastal Forests
    Russulas of Southern Vancouver Island Coastal Forests Volume 1 by Christine Roberts B.Sc. University of Lancaster, 1991 M.S. Oregon State University, 1994 A Dissertation Submitted in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY in the Department of Biology © Christine Roberts 2007 University of Victoria All rights reserved. This dissertation may not be reproduced in whole or in part, by photocopying or other means, without the permission of the author. Library and Bibliotheque et 1*1 Archives Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition 395 Wellington Street 395, rue Wellington Ottawa ON K1A0N4 Ottawa ON K1A0N4 Canada Canada Your file Votre reference ISBN: 978-0-494-47323-8 Our file Notre reference ISBN: 978-0-494-47323-8 NOTICE: AVIS: The author has granted a non­ L'auteur a accorde une licence non exclusive exclusive license allowing Library permettant a la Bibliotheque et Archives and Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par Plntemet, prefer, telecommunication or on the Internet, distribuer et vendre des theses partout dans loan, distribute and sell theses le monde, a des fins commerciales ou autres, worldwide, for commercial or non­ sur support microforme, papier, electronique commercial purposes, in microform, et/ou autres formats. paper, electronic and/or any other formats. The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in et des droits moraux qui protege cette these.
    [Show full text]
  • Evolution of Complex Fruiting-Body Morphologies in Homobasidiomycetes
    Received 18April 2002 Accepted 26 June 2002 Publishedonline 12September 2002 Evolutionof complexfruiting-bo dymorpholog ies inhomobasidi omycetes David S.Hibbett * and Manfred Binder BiologyDepartment, Clark University, 950Main Street,Worcester, MA 01610,USA The fruiting bodiesof homobasidiomycetes include some of the most complex formsthat have evolved in thefungi, such as gilled mushrooms,bracket fungi andpuffballs (‘pileate-erect’) forms.Homobasidio- mycetesalso includerelatively simple crust-like‘ resupinate’forms, however, which accountfor ca. 13– 15% ofthedescribed species in thegroup. Resupinatehomobasidiomycetes have beeninterpreted either asa paraphyletic grade ofplesiomorphic formsor apolyphyletic assemblage ofreducedforms. The former view suggeststhat morphological evolutionin homobasidiomyceteshas beenmarked byindependentelab- oration in many clades,whereas the latter view suggeststhat parallel simplication has beena common modeof evolution.To infer patternsof morphological evolution in homobasidiomycetes,we constructed phylogenetic treesfrom adatasetof 481 speciesand performed ancestral statereconstruction (ASR) using parsimony andmaximum likelihood (ML)methods. ASR with both parsimony andML implies that the ancestorof the homobasidiomycetes was resupinate, and that therehave beenmultiple gains andlosses ofcomplex formsin thehomobasidiomycetes. We also usedML toaddresswhether there is anasymmetry in therate oftransformations betweensimple andcomplex forms.Models of morphological evolution inferredwith MLindicate that therate
    [Show full text]
  • Australia's Fungi Mapping Scheme
    November 2008 AUSTRALIA’S FUNGI MAPPING SCHEME Inside this Edition: th News from the Fungimap Co-ordinator by This is our 5 Fungimap Conference and we Lee Speedy..................................................1 have organised a great programme of Contacting Fungimap ..................................2 speakers from across Australia and covering From the Editor, Instructions for authors ....3 very diverse fungi topics. In this newsletter Collating information on fungi in Australian we have included a Questionnaire, to policy & strategy documents by T May …..3 discover which Workshop topics you would Yellow/orange Amanitas by Sapphire most like to see (your Top 5 topics). Please McMullan-Fisher……………………...…..4 return this along with your Registration form Mycoacia subceracea by Barbara Paulus ....7 and we will adapt our list of Workshops New additions in W.A.'s Flora Conservation where possible. codes by Neale Bougher..............................8 New Fungimap target species....................13 At previous Conferences, transportation and Fungimap survey on Kangaroo Island by distribution of microscopes have been Paul George ..............................................13 challenging and so we have decided to add a Fungi-mapping in Ivanhoe, Melbourne by truly unique one day Masterclass with Robert Bender ..........................................15 microscopes in Sydney, to run at the UNSW, Phallus merulinus in the top end by Matt just after our Conference. This will be on the Barrett & Ben Stuckey ..............................16 topic of Disc Fungi and led by Dr. Peter Exhibition Review: In Plain View by Sarah Johnston from New Zealand. Places for this Lloyd .........................................................16 workshop will be strictly limited. Fungal News: PUBF 2008.........................17 Fungal News: SA, SEQ - QMS.................18 In early October, I accompanied Dr.
    [Show full text]
  • Bountiful Gardens Heirloom, Untreated, Open-Pollinated Seeds for Sustainable Growing a Project of Ecology Action
    2014 Catalog Bountiful Gardens Heirloom, Untreated, Open-Pollinated Seeds for Sustainable Growing A Project of Ecology Action Bountiful Gardens is a non-profit. Since 1982 we have been educating gardeners about gardening organically and sustainably. All of our seeds are open-pollinated and untreated. New for 2014 VON-4589 Mill Creek Red Onion–115 days. We saw some red Contents onions at the farmer’s market and found About our work 4-7, 78-79 that they were the last of the onions that What the Seed Codes Mean 8 had been bred by local nursery owners Joe and Wanda Turi, who had since Spacing/Area Chart 8 died. We bought the whole box and How To Reach Us 76 took it to Ellen Bartholomew at Golden Rule Garden, who grew our seedstock. SEEDS 9-59 We could not meet the demand for this rare heirloom in 2012 and were unable to offer it last year, but Vegetables 9-32 thanks to Ellen, Jeff Myers, and Jason Menesini, we have been Mixes and Collections 33-35 able to multiply the seed to where we can offer it once again. Mill Compost Crops 36-39 Creek was the name of the Turi’s nursery. This is a Stockton Red Inoculants 63 type, bolt-resistant and very long-keeping. The USDA trials in our area found it to be the only onion they trialed that did equally well Grains and Fibers 40-45 planted either spring or fall. A very special heirloom onion. 100 Oil Crops and Forage Crops 46 seeds GB $2.50 Wild Trees and Shrubs 47-48 VLE-4127 Bronze Goldring Lettuce– Herbs 49-56 spring/fall 60 days.
    [Show full text]