Materials and Methods Reference Genome Sampling and DNA
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Myopia in African Americans Is Significantly Linked to Chromosome 7P15.2-14.2
Genetics Myopia in African Americans Is Significantly Linked to Chromosome 7p15.2-14.2 Claire L. Simpson,1,2,* Anthony M. Musolf,2,* Roberto Y. Cordero,1 Jennifer B. Cordero,1 Laura Portas,2 Federico Murgia,2 Deyana D. Lewis,2 Candace D. Middlebrooks,2 Elise B. Ciner,3 Joan E. Bailey-Wilson,1,† and Dwight Stambolian4,† 1Department of Genetics, Genomics and Informatics and Department of Ophthalmology, University of Tennessee Health Science Center, Memphis, Tennessee, United States 2Computational and Statistical Genomics Branch, National Human Genome Research Institute, National Institutes of Health, Baltimore, Maryland, United States 3The Pennsylvania College of Optometry at Salus University, Elkins Park, Pennsylvania, United States 4Department of Ophthalmology, University of Pennsylvania, Philadelphia, Pennsylvania, United States Correspondence: Joan E. PURPOSE. The purpose of this study was to perform genetic linkage analysis and associ- Bailey-Wilson, NIH/NHGRI, 333 ation analysis on exome genotyping from highly aggregated African American families Cassell Drive, Suite 1200, Baltimore, with nonpathogenic myopia. African Americans are a particularly understudied popula- MD 21131, USA; tion with respect to myopia. [email protected]. METHODS. One hundred six African American families from the Philadelphia area with a CLS and AMM contributed equally to family history of myopia were genotyped using an Illumina ExomePlus array and merged this work and should be considered co-first authors. with previous microsatellite data. Myopia was initially measured in mean spherical equiv- JEB-W and DS contributed equally alent (MSE) and converted to a binary phenotype where individuals were identified as to this work and should be affected, unaffected, or unknown. -
Genetic Profiling of a Cone-Dominated Retina and Cone Photoreceptor Subtypes
Genetic profiling of a cone-dominated retina and cone photoreceptor subtypes Vincent P. Kunze Date of birth June 8, 1986 Place of birth Kempten (Allgäu) Accepted thesis Doctor rerum naturalium (Dr. rer. nat.) Institute for Biology and Environmental Sciences Carl von Ossietzky Universität Oldenburg First examiner: Prof. Dr. Karl-Wilhelm Koch Second examiner: apl. Prof. Dr. Karin Dedek Date of thesis defense: December 18, 2017 2 Abstract Abstract Mammals have two major types of sensory neurons in the retina: rods, specialized for vision in dim-light, and cones for vision in well-lit conditions and the perception of color. In my thesis, I characterized features of cone photoreceptor subtypes and the cone-dominated retinae of the tree shrew and the thirteen-lined ground squirrel. In tree shrew, I described morphological and transcriptomic changes during development. Compared to mice, the general morphology of the developing retina was similar. There were subtle differences in the onset of transcription factors and in the relative timepoints of photoreceptor genesis. The transcriptomic analysis revealed and onset Wif1-expression after birth, a gene that could potentially suppress rod development in the tree shrew. Furthermore, I looked at molecular differences in cone photoreceptor subtypes. Most mammals have two cone types, namely S- and M-cones. They diverge in their sensitivity to different wavelengths of light, based on their expression of different light-sensitive proteins: S-opsin for blue light and M-opsin for green light. Until now, cones have been classified mostly by the opsin they express. The purpose of this project was to identify genetic differences in cones and, more specifically, to find genes that are involved in cone synapse formation. -
FSHD Region Gene 1 (FRG1) Is Crucial for Angiogenesis Linking FRG1 to Facioscapulohumeral Muscular Dystrophy-Associated Vasculopathy
University of Massachusetts Medical School eScholarship@UMMS Peter Jones Lab Publications Cell and Developmental Biology Laboratories 2009-05-01 FSHD region gene 1 (FRG1) is crucial for angiogenesis linking FRG1 to facioscapulohumeral muscular dystrophy-associated vasculopathy Ryan Wuebbles University of Illinois at Urbana-Champaign Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/peterjones Part of the Cell Biology Commons, Developmental Biology Commons, Molecular Biology Commons, Molecular Genetics Commons, Musculoskeletal Diseases Commons, and the Nervous System Diseases Commons Repository Citation Wuebbles R, Hanel ML, Jones PL. (2009). FSHD region gene 1 (FRG1) is crucial for angiogenesis linking FRG1 to facioscapulohumeral muscular dystrophy-associated vasculopathy. Peter Jones Lab Publications. https://doi.org/10.1242/dmm.002261. Retrieved from https://escholarship.umassmed.edu/ peterjones/11 Creative Commons License This work is licensed under a Creative Commons Attribution 3.0 License. This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Peter Jones Lab Publications by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. Disease Models & Mechanisms 2, 267-274 (2009) doi:10.1242/dmm.002261 RESEARCH ARTICLE FSHD region gene 1 (FRG1) is crucial for angiogenesis linking FRG1 to facioscapulohumeral muscular dystrophy-associated vasculopathy Ryan D. Wuebbles1,*, Meredith L. Hanel1,* and Peter L. Jones1,‡ SUMMARY The genetic lesion that is diagnostic for facioscapulohumeral muscular dystrophy (FSHD) results in an epigenetic misregulation of gene expression, which ultimately leads to the disease pathology. FRG1 (FSHD region gene 1) is a leading candidate for a gene whose misexpression might lead to FSHD. -
Gene Expression During Normal and FSHD Myogenesis Tsumagari Et Al
Gene expression during normal and FSHD myogenesis Tsumagari et al. Tsumagari et al. BMC Medical Genomics 2011, 4:67 http://www.biomedcentral.com/1755-8794/4/67 (27 September 2011) Tsumagari et al. BMC Medical Genomics 2011, 4:67 http://www.biomedcentral.com/1755-8794/4/67 RESEARCHARTICLE Open Access Gene expression during normal and FSHD myogenesis Koji Tsumagari1, Shao-Chi Chang1, Michelle Lacey2,3, Carl Baribault2,3, Sridar V Chittur4, Janet Sowden5, Rabi Tawil5, Gregory E Crawford6 and Melanie Ehrlich1,3* Abstract Background: Facioscapulohumeral muscular dystrophy (FSHD) is a dominant disease linked to contraction of an array of tandem 3.3-kb repeats (D4Z4) at 4q35. Within each repeat unit is a gene, DUX4, that can encode a protein containing two homeodomains. A DUX4 transcript derived from the last repeat unit in a contracted array is associated with pathogenesis but it is unclear how. Methods: Using exon-based microarrays, the expression profiles of myogenic precursor cells were determined. Both undifferentiated myoblasts and myoblasts differentiated to myotubes derived from FSHD patients and controls were studied after immunocytochemical verification of the quality of the cultures. To further our understanding of FSHD and normal myogenesis, the expression profiles obtained were compared to those of 19 non-muscle cell types analyzed by identical methods. Results: Many of the ~17,000 examined genes were differentially expressed (> 2-fold, p < 0.01) in control myoblasts or myotubes vs. non-muscle cells (2185 and 3006, respectively) or in FSHD vs. control myoblasts or myotubes (295 and 797, respectively). Surprisingly, despite the morphologically normal differentiation of FSHD myoblasts to myotubes, most of the disease-related dysregulation was seen as dampening of normal myogenesis- specific expression changes, including in genes for muscle structure, mitochondrial function, stress responses, and signal transduction. -
SNF2 Chromatin Remodeler-Family Proteins FRG1 and -2 Are Required for RNA-Directed DNA Methylation
SNF2 chromatin remodeler-family proteins FRG1 and -2 are required for RNA-directed DNA methylation Martin Grotha, Hume Strouda,1, Suhua Fenga,b,c, Maxim V. C. Greenberga,2, Ajay A. Vashishtd, James A. Wohlschlegeld, Steven E. Jacobsena,b,c,3, and Israel Ausine,3 aDepartment of Molecular, Cell, and Developmental Biology, bEli & Edythe Broad Center of Regenerative Medicine & Stem Cell Research, dDepartment of Biological Chemistry, David Geffen School of Medicine, cHoward Hughes Medical Institute, University of California, Los Angeles, CA 90095; and eBasic Forestry and Biotechnology Center, Fujian Agriculture and Forestry University, Fujian, Fuzhou 350002, China Contributed by Steven E. Jacobsen, October 29, 2014 (sent for review August 2, 2014) DNA methylation in Arabidopsis thaliana is maintained by at least four (6, 7). Recruitment of Pol V is mediated by methyl-CG–binding different enzymes: DNA METHYLTRANSFERASE1 (MET1), CHROMO- noncatalytic Su(var)3-9 histone methyltransferase homologs METHYLASE3 (CMT3), DOMAINS REARRANGED METHYLTRANSFER- SUVH2 and SUVH9, and a putative chromatin remodeling ASE2 (DRM2), and CHROMOMETHYLASE2 (CMT2). However, DNA complex called the DRD1-DMS3-RDM1 complex (8, 9). In ad- methylation is established exclusively by the enzyme DRM2, which dition to SUVH2 and SUVH9, SUVR2 from the same family of acts in the RNA-directed DNA methylation (RdDM) pathway. Some SET-domain proteins was also identified as an RdDM factor by RdDM components belong to gene families and have partially redun- a systematic analysis of DNA methylation defects in mutants of dant functions, such as the endoribonucleases DICER-LIKE 2, 3,and4, Su(var)3-9 homologs (10). However, the precise molecular function and INVOLVED IN DE NOVO2 (IDN2) interactors IDN2-LIKE 1 and 2. -
Alzheimer's Disease Neuroimaging Initiative Biomarkers As Quantitative
Alzheimer’s & Dementia 6 (2010) 265–273 Alzheimer’s Disease Neuroimaging Initiative biomarkers as quantitative phenotypes: Genetics core aims, progress, and plans Andrew J. Saykina,b,*, Li Shena,c, Tatiana M. Foroudb, Steven G. Potkind, Shanker Swaminathana,b, Sungeun Kima,c, Shannon L. Risachera, Kwangsik Nhoa,e, Matthew J. Huentelmanf, David W. Craigf, Paul M. Thompsong, Jason L. Steing, Jason H. Mooreh,i, Lindsay A. Farrerj, Robert C. Greenj, Lars Bertramk, Clifford R. Jack, Jr.l, Michael W. Weinerm,n,o,p; and the Alzheimer’s Disease Neuroimaging Initiative aDepartment of Radiology and Imaging Sciences, Center for Neuroimaging, Indiana University School of Medicine, Indianapolis, IN, USA bDepartment of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, IN, USA cCenter for Computational Biology and Bioinformatics, Indiana University School of Medicine, Indianapolis, IN, USA dDepartment of Psychiatry and Human Behavior, University of California, Irvine, CA, USA eDivision of Medical Informatics, Regenstrief Institute, Indianapolis, IN, USA fNeurogenomics Division, The Translational Genomics Research Institute, Phoenix, AZ, USA gLaboratory of Neuro Imaging, UCLA School of Medicine, Los Angeles, CA, USA hDepartment of Genetics, Computational Genetics Laboratory, Dartmouth Medical School, Lebanon, NH, USA iDepartment of Community and Family Medicine, Computational Genetics Laboratory, Dartmouth Medical School, Lebanon, NH, USA jDepartments of Medicine (Genetics Program), Neurology, Epidemiology, Genetics, -
Neuroblastoma Cancer Stem Cells: the Role of NXPH1 and Its Receptor Α-NRXN1
Neuroblastoma cancer stem cells: The role of NXPH1 and its receptor α-NRXN1 Lucía Fanlo Escudero Aquesta tesi doctoral està subjecta a la llicència Reconeixement- NoComercial 4.0. Espanya de Creative Commons. Esta tesis doctoral está sujeta a la licencia Reconocimiento - NoComercial 4.0. España de Creative Commons. This doctoral thesis is licensed under the Creative Commons Attribution-NonCommercial 4.0. Spain License. UNIVERSITAT DE BARCELONA FACULTAD DE FARMÀCIA I CIÈNCIES DE L’ALIMENTACIÓ Neuroblastoma cancer stem cells: The role of NXPH1 and its receptor α-NRXN1 Lucía Fanlo Escudero 2019 UNIVERSITAT DE BARCELONA FACULTAT DE FARMÀCIA I CIÈNCIES DE L’ALIMENTACIÓ PROGRAMA DE DOCTORAT EN BIOMEDICINA Neuroblastoma cancer stem cells: The role of NXPH1 and its receptor α-NRXN1 Memoria presentada por Lucía Fanlo Escudero para optar al título de Doctora por la Universitat de Barcelona Este trabajo ha sido realizado bajo la dirección de la Dra. Elisa Martí Gorostiza y del Dr. Gwenvael Le Dréau, en el Instituto de Biología Molecular de Barcelona (IBMB-CSIC) Codirectores: Dra. Elisa Martí Gorostiza Dr. Gwenvael Le Dréau Doctoranda: Tutor: Lucía Fanlo Escudero Dr. Carles Enrich Bastús 2019 […] CLARA.- (Piensa:) ¿Cómo es posible que alguien quiera dormir cuando hay tanta hermosura en el aire, en las rocas, en los árboles? Yo no quiero dormir nunca, nunca; no quiero perder ni un segundo de vida, por que ahora que he visto la maravilla de esta noche, me figuro que siempre deben estar su- cediendo cosas maravillosas. Y si sucede una que no pueda ocurrir más que una vez y yo, por estarme durmiendo, no la veo, no me consolaré en mi vida entera. -
Developing a Neural Implant to Enable Controlled Alterations to Brain Architecture Nicholas J. Weir (N0389094) a Thesis Submitte
Developing a Neural Implant to Enable Controlled Alterations to Brain Architecture Nicholas J. Weir (N0389094) A thesis submitted in partial fulfilment of the requirements of Nottingham Trent University for the degree of Doctor of Philosophy December 2019 1 Copyright Statement This work is the intellectual property of the author. You may copy up to 5% of this work for private study, or personal, non-commercial research. Any re-use of the information contained within this document should be fully referenced, quoting the author, title, university, degree level and pagination. Queries or requests for any other use, or if a more substantial copy is required, should be directed in the owner(s) of the Intellectual Property Rights. 2 Acknowledgements First, I would like to thank my Director of Studies, Chris Tinsley, for his support and encouragement throughout the course of the PhD. His kind words and ability to find the silver lining in any situation made the past few years that much easier. Thanks also to my supervisory team, Alan Hargreaves, Bob Stevens and Martin McGinnity for their advice and thoughts on experiments and data that helped shape the PhD. Whilst not on my supervisory team, I’m also grateful to Amanda Miles for her help with mass spectrometry and endless technical knowledge and to Rich Hulse for his advice and support throughout. Special thanks go to my colleagues. Notably, to Awais and Jordan for their ability to distract and take my mind out of the lab during stressful times and to Charlotte for being a role model of scientific rigour and discipline. -
The DNA Sequence and Comparative Analysis of Human Chromosome 20
articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M. -
Human Proteins That Interact with RNA/DNA Hybrids
Downloaded from genome.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Resource Human proteins that interact with RNA/DNA hybrids Isabel X. Wang,1,2 Christopher Grunseich,3 Jennifer Fox,1,2 Joshua Burdick,1,2 Zhengwei Zhu,2,4 Niema Ravazian,1 Markus Hafner,5 and Vivian G. Cheung1,2,4 1Howard Hughes Medical Institute, Chevy Chase, Maryland 20815, USA; 2Life Sciences Institute, University of Michigan, Ann Arbor, Michigan 48109, USA; 3Neurogenetics Branch, National Institute of Neurological Disorders and Stroke, NIH, Bethesda, Maryland 20892, USA; 4Department of Pediatrics, University of Michigan, Ann Arbor, Michigan 48109, USA; 5Laboratory of Muscle Stem Cells and Gene Regulation, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Maryland 20892, USA RNA/DNA hybrids form when RNA hybridizes with its template DNA generating a three-stranded structure known as the R-loop. Knowledge of how they form and resolve, as well as their functional roles, is limited. Here, by pull-down assays followed by mass spectrometry, we identified 803 proteins that bind to RNA/DNA hybrids. Because these proteins were identified using in vitro assays, we confirmed that they bind to R-loops in vivo. They include proteins that are involved in a variety of functions, including most steps of RNA processing. The proteins are enriched for K homology (KH) and helicase domains. Among them, more than 300 proteins preferred binding to hybrids than double-stranded DNA. These proteins serve as starting points for mechanistic studies to elucidate what RNA/DNA hybrids regulate and how they are regulated. -
Supplemental Table 1
Carlisle et al. 1 Supplementary Table 1. Primers for PCR amplification of bacterial 16S rRNA. Primers for Group A TA-27FMID1 CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TA-27FMID2 CGTATCGCCTCCCTCGCGCCATCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TA-27FMID3 CGTATCGCCTCCCTCGCGCCATCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TA-27FMID4 CGTATCGCCTCCCTCGCGCCATCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TA-27FMID5 CGTATCGCCTCCCTCGCGCCATCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TA-27FMID6 CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TA-27FMID7 CGTATCGCCTCCCTCGCGCCATCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TA-27FMID8 CGTATCGCCTCCCTCGCGCCATCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG TA-27FMID9 CGTATCGCCTCCCTCGCGCCATCAGTAGTATCAGCAGAGTTTGATCCTGGCTCAG TA-27FMID10 CGTATCGCCTCCCTCGCGCCATCAGTCTCTATGCGAGAGTTTGATCCTGGCTCAG TA-27FMID11 CGTATCGCCTCCCTCGCGCCATCAGTGATACGTCTAGAGTTTGATCCTGGCTCAG TA-27FMID13 CGTATCGCCTCCCTCGCGCCATCAGCATAGTAGTGAGAGTTTGATCCTGGCTCAG TA-27FMID14 CGTATCGCCTCCCTCGCGCCATCAGCGAGAGATACAGAGTTTGATCCTGGCTCAG TB-338R CTATGCGCCTTGCCAGCCCGCTCAGTGCTGCCTCCCGTAGGAGT Primers for Group B TB-27FMID1 CTATGCGCCTTGCCAGCCCGCTCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TB-27FMID2 CTATGCGCCTTGCCAGCCCGCTCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TB-27FMID3 CTATGCGCCTTGCCAGCCCGCTCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TB-27FMID4 CTATGCGCCTTGCCAGCCCGCTCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TB-27FMID5 CTATGCGCCTTGCCAGCCCGCTCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TB-27FMID6 CTATGCGCCTTGCCAGCCCGCTCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TB-27FMID7 CTATGCGCCTTGCCAGCCCGCTCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TB-27FMID8 CTATGCGCCTTGCCAGCCCGCTCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG -
Cisplatin Treatment of Testicular Cancer Patients Introduces Long-Term Changes in the Epigenome Cecilie Bucher-Johannessen1, Christian M
Bucher-Johannessen et al. Clinical Epigenetics (2019) 11:179 https://doi.org/10.1186/s13148-019-0764-4 RESEARCH Open Access Cisplatin treatment of testicular cancer patients introduces long-term changes in the epigenome Cecilie Bucher-Johannessen1, Christian M. Page2,3, Trine B. Haugen4 , Marcin W. Wojewodzic1, Sophie D. Fosså1,5,6, Tom Grotmol1, Hege S. Haugnes7,8† and Trine B. Rounge1,9*† Abstract Background: Cisplatin-based chemotherapy (CBCT) is part of standard treatment of several cancers. In testicular cancer (TC) survivors, an increased risk of developing metabolic syndrome (MetS) is observed. In this epigenome- wide association study, we investigated if CBCT relates to epigenetic changes (DNA methylation) and if epigenetic changes render individuals susceptible for developing MetS later in life. We analyzed methylation profiles, using the MethylationEPIC BeadChip, in samples collected ~ 16 years after treatment from 279 Norwegian TC survivors with known MetS status. Among the CBCT treated (n = 176) and non-treated (n = 103), 61 and 34 developed MetS, respectively. We used two linear regression models to identify if (i) CBCT results in epigenetic changes and (ii) epigenetic changes play a role in development of MetS. Then we investigated if these changes in (i) and (ii) links to genes, functional networks, and pathways related to MetS symptoms. Results: We identified 35 sites that were differentially methylated when comparing CBCT treated and untreated TC survivors. The PTK6–RAS–MAPk pathway was significantly enriched with these sites and infers a gene network of 13 genes with CACNA1D (involved in insulin release) as a network hub. We found nominal MetS-associations and a functional gene network with ABCG1 and NCF2 as network hubs.