DOCSLIB.ORG

A Network Analysis Based Proteomic and Transcriptomic Investigation Into HIV-Tat Induced Neuronal Dysfunction and the Neuroprotective Effect of Lithium

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Network Analysis Based Proteomic and Transcriptomic Investigation Into HIV-Tat Induced Neuronal Dysfunction and the Neuroprotective Effect of Lithium A network analysis based proteomic and transcriptomic investigation into HIV-Tat induced neuronal dysfunction and the neuroprotective effect of lithium By Tariq Ahmad Ganief University of Cape Town GNFTAR001 Dissertation submitted for the degree of Doctor of Philosophy In the Department of Integrative Biomedical Sciences University of Cape Town October 2015 Supervisor: Professor Jonathan M. Blackburn 1 The copyright of this thesis vests in the author. No quotation from it or information derived from it is to be published without full acknowledgement of the source. The thesis is to be used for private study or non- commercial research purposes only. Published by the University of Cape Town (UCT) in terms of the non-exclusive license granted to UCT by the author. University of Cape Town Declaration I, Tariq Ahmad Ganief, declare that this thesis is my own work (except where acknowledgements indicate otherwise). Neither the whole work nor part thereof has been, is being, or is to be submitted for any degree or examination at any other university. I empower the University of Cape Town to reproduce for the purposes of research either the whole or any part of the contents of this thesis, in any manner whatsoever. Signature of candidate: Tariq Ganief Signed on the 28 day of October, 2015 2 | P a g e Acknowledgements During the years of my PhD, I have received a tremendous amount of support both personally and professionally; without which, this road would have proved significantly more arduous. While words are an abysmal return for all your friendship and counsel, please do accept them, even if only as an acknowledgement in gratitude. Shaun, through all the debates and discussions in the years we have worked together I have come to appreciate your single-minded determination to achieve. Through your determination and help, I myself have learned and achieved. Your help and friendship has been invaluable. Nelson, despite being a ‘recent’ addition to our lab, you quickly proved your value and became indispensable to the success of our group. Your knowledge and advice has and will always be appreciated. To my supervisor and mentor, Professor Jonathan Blackburn; your brilliant mind, positive attitude, simple solutions countering seemingly incalculable complexity, unwavering support, patience and guidance have been a source of inspiration and motivation throughout this PhD. You have undoubtedly shaped me as a scientist and I truly and sincerely appreciate all the opportunities you have given me. I am proud to have been your student. Lastly and most importantly; to my dear my parents, Sofwaan and Mariam Ganief; I thank you for the years of quiet sacrifice, continued support and pride in spite of difficulties. I thank you for raising me with a sense of wonder, perseverance and determination; traits which have been paramount to the completion of this PhD. i Table of Contents Acknowledgements ........................................................................................ i Abbreviations ............................................................................................... vii Abstract ......................................................................................................... 1 Chapter 1 General introduction ..................................................................... 3 HIV-Associated Dementia ..................................................................................... 3 HIV Life cycle ......................................................................................................... 4 HIV in the brain ..................................................................................................... 7 Innate antiviral response and inflammation ......................................................... 9 Neuroinflammation and neurodegeneration ..................................................... 12 Possible origins of disease .................................................................................. 14 ARV therapy and HIV Dementia .......................................................................... 14 Neuroinflammation in HIV infection ................................................................... 15 Neurotoxic viral proteins .................................................................................... 16 HIV Transactivator of transcription ..................................................................... 17 HIV and protein translation ................................................................................. 20 HIV and the cytoskeleton .................................................................................... 22 Glycogen Synthase Kinase in HAND .................................................................... 23 Lithium ................................................................................................................ 24 Teasing apart the Differences ............................................................................. 26 Assaying complex biology ................................................................................... 26 Two-dimensional gel electrophoresis ................................................................. 27 A new ‘proteomics’ ............................................................................................. 28 Mass spectrometry ............................................................................................. 29 Mass spectrometry-based proteomics ............................................................... 32 Limitations of MS ................................................................................................ 35 Decreasing biological complexity for MS analysis .............................................. 36 Chromatographic particle/bead size ................................................................... 37 Bottom-up proteomics data processing ............................................................. 38 Aims of This Thesis .................................................................................................. 45 Chapter 2 Establishing a model for HIV-Tat induced neuronal apoptosis ...... 46 ii | P a g e Introduction ............................................................................................................ 46 Materials and Methods ........................................................................................... 48 Cell culture .......................................................................................................... 48 Subculture ........................................................................................................... 48 MTT assay ............................................................................................................ 48 Results and Discussion ............................................................................................ 49 Remnants of apoptotic cells produce formazan ................................................. 50 Reduced, monomeric HIV-Tat is essential for the induction of apoptosis ......... 51 Chapter 3 Quantitative proteomic analysis of HIV-1 Tat-induced damage in SH-SY5Y neuroblastoma cells ................................................................... 56 Abstract ................................................................................................................... 56 Introduction ............................................................................................................ 57 Materials and Methods ........................................................................................... 59 Cell culture and SILAC labelling ........................................................................... 59 Treatment with recombinant HIV-1 Tat CLADE-B: .............................................. 59 Sample preparation ............................................................................................. 60 Mass spectrometry ............................................................................................. 61 Data processing and bioinformatic analysis ....................................................... 62 Functional enrichment analysis .......................................................................... 62 Results ..................................................................................................................... 63 Monomeric HIV-Tat is required to induced apoptosis in SH-SY5Y cells ............. 63 Proteome dynamics ............................................................................................ 64 Discussion ................................................................................................................ 68 HIV clade-B Tat as an HIV dementia causative agent ......................................... 68 Bioinformatic identification of dysregulated proteins upon HIV-Tat treatment 68 HIV-Tat alters protein translation and cytoskeletal regulation .......................... 72 Cytoskeletal dysregulation features prominently in highly differentially regulated dataset ................................................................................................ 73 HIV-Tat affects key systems seemingly unrelated to protein translation or cytoskeletal regulation ........................................................................................ 75 Chapter 4 Extensive pathway analysis of SILAC labelled proteomic and transcriptomic data from HIV-Tat treated SY-SY5Y neuroblastoma cells ...... 77 iii | P a g e Abstract ..................................................................................................................
Load more

Recommended publications
  • PDF Document Created by Pdffiller
    Patient: 1234567843314948-COtGx0053 CLIA ID#: 11D2066426 Larry Hung, MD, Laboratory Director GxTM Carrier Screen Testing Report Patient Information Provider Information Specimen Patient Name Haley Papevies Provider Harbin Clinic Women's Accession ID 1234567843314948 Center Cartersville Date of Birth Apr 16, 1998 Sample ID COtGx0053XX Provider ID 1124488556 Age 19 Specimen Type Saliva Physician Vicki Yates Sex female Collection Date Jul 20, 2017 Ethnicity Report Date Aug 5, 2017 Test Ordered CF Patient Results: Negative - No Pathogenic or Likely-Pathogenic Variant(s) Detected Additional Comments This report is based on the analysis of CFTR gene included in the Carrier Screen. No known pathogenic or likely pathogenic variant(s) detected in the coding sequences of CFTR gene. Followup Recommendations Follow up with physicians for updated carrier screen information. The sequencing for CFTR gene was carried out with the other genes included in the Carrier Screen Testing (listed below). The analysis of the other genes in the Carrier Screen could be ordered through your physicians. Genes Tested Targeted regions for “Carrier Screen Testing” includes the exonic regions of the following genes: ABCC8, ABCD1, ABCD4, ACAD8, ACADM, ACADS, ACADSB, ACADVL, ACAT1, ACSF3, ACTA2, ACTC1, ADA, ADAMTS2, AGXT, AHCY, APC, APOB, ARG1, ASL, ASPA, ASS1, ATP7B, AUH, BCKDHA, BBS2, BCKDHB, BLM, BTD, CBS, COL3A1, COL4A3, CD320, CFTR, CLRN1, CPT1A, CPT2, CYP1B1, CYP21A2, DBT, DHCR7, DHDDS, DLD, DMD, DNAJC19, DSC2, DSG2, DSP, DUOX2, ETFA, ETFB, ETFDH, FAH, FANCC, FBN1,
    [Show full text]
  • Abstracts from the 9Th Biennial Scientific Meeting of The
    International Journal of Pediatric Endocrinology 2017, 2017(Suppl 1):15 DOI 10.1186/s13633-017-0054-x MEETING ABSTRACTS Open Access Abstracts from the 9th Biennial Scientific Meeting of the Asia Pacific Paediatric Endocrine Society (APPES) and the 50th Annual Meeting of the Japanese Society for Pediatric Endocrinology (JSPE) Tokyo, Japan. 17-20 November 2016 Published: 28 Dec 2017 PS1 Heritable forms of primary bone fragility in children typically lead to Fat fate and disease - from science to global policy a clinical diagnosis of either osteogenesis imperfecta (OI) or juvenile Peter Gluckman osteoporosis (JO). OI is usually caused by dominant mutations affect- Office of Chief Science Advsor to the Prime Minister ing one of the two genes that code for two collagen type I, but a re- International Journal of Pediatric Endocrinology 2017, 2017(Suppl 1):PS1 cessive form of OI is present in 5-10% of individuals with a clinical diagnosis of OI. Most of the involved genes code for proteins that Attempts to deal with the obesity epidemic based solely on adult be- play a role in the processing of collagen type I protein (BMP1, havioural change have been rather disappointing. Indeed the evidence CREB3L1, CRTAP, LEPRE1, P4HB, PPIB, FKBP10, PLOD2, SERPINF1, that biological, developmental and contextual factors are operating SERPINH1, SEC24D, SPARC, from the earliest stages in development and indeed across generations TMEM38B), or interfere with osteoblast function (SP7, WNT1). Specific is compelling. The marked individual differences in the sensitivity to the phenotypes are caused by mutations in SERPINF1 (recessive OI type obesogenic environment need to be understood at both the individual VI), P4HB (Cole-Carpenter syndrome) and SEC24D (‘Cole-Carpenter and population level.
    [Show full text]
  • Evidence for Differential Alternative Splicing in Blood of Young Boys With
    Stamova et al. Molecular Autism 2013, 4:30 http://www.molecularautism.com/content/4/1/30 RESEARCH Open Access Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders Boryana S Stamova1,2,5*, Yingfang Tian1,2,4, Christine W Nordahl1,3, Mark D Shen1,3, Sally Rogers1,3, David G Amaral1,3 and Frank R Sharp1,2 Abstract Background: Since RNA expression differences have been reported in autism spectrum disorder (ASD) for blood and brain, and differential alternative splicing (DAS) has been reported in ASD brains, we determined if there was DAS in blood mRNA of ASD subjects compared to typically developing (TD) controls, as well as in ASD subgroups related to cerebral volume. Methods: RNA from blood was processed on whole genome exon arrays for 2-4–year-old ASD and TD boys. An ANCOVA with age and batch as covariates was used to predict DAS for ALL ASD (n=30), ASD with normal total cerebral volumes (NTCV), and ASD with large total cerebral volumes (LTCV) compared to TD controls (n=20). Results: A total of 53 genes were predicted to have DAS for ALL ASD versus TD, 169 genes for ASD_NTCV versus TD, 1 gene for ASD_LTCV versus TD, and 27 genes for ASD_LTCV versus ASD_NTCV. These differences were significant at P <0.05 after false discovery rate corrections for multiple comparisons (FDR <5% false positives). A number of the genes predicted to have DAS in ASD are known to regulate DAS (SFPQ, SRPK1, SRSF11, SRSF2IP, FUS, LSM14A). In addition, a number of genes with predicted DAS are involved in pathways implicated in previous ASD studies, such as ROS monocyte/macrophage, Natural Killer Cell, mTOR, and NGF signaling.
    [Show full text]
  • Involvement of DPP9 in Gene Fusions in Serous Ovarian Carcinoma
    Smebye et al. BMC Cancer (2017) 17:642 DOI 10.1186/s12885-017-3625-6 RESEARCH ARTICLE Open Access Involvement of DPP9 in gene fusions in serous ovarian carcinoma Marianne Lislerud Smebye1,2, Antonio Agostini1,2, Bjarne Johannessen2,3, Jim Thorsen1,2, Ben Davidson4,5, Claes Göran Tropé6, Sverre Heim1,2,5, Rolf Inge Skotheim2,3 and Francesca Micci1,2* Abstract Background: A fusion gene is a hybrid gene consisting of parts from two previously independent genes. Chromosomal rearrangements leading to gene breakage are frequent in high-grade serous ovarian carcinomas and have been reported as a common mechanism for inactivating tumor suppressor genes. However, no fusion genes have been repeatedly reported to be recurrent driver events in ovarian carcinogenesis. We combined genomic and transcriptomic information to identify novel fusion gene candidates and aberrantly expressed genes in ovarian carcinomas. Methods: Examined were 19 previously karyotyped ovarian carcinomas (18 of the serous histotype and one undifferentiated). First, karyotypic aberrations were compared to fusion gene candidates identified by RNA sequencing (RNA-seq). In addition, we used exon-level gene expression microarrays as a screening tool to identify aberrantly expressed genes possibly involved in gene fusion events, and compared the findings to the RNA-seq data. Results: We found a DPP9-PPP6R3 fusion transcript in one tumor showing a matching genomic 11;19-translocation. Another tumor had a rearrangement of DPP9 with PLIN3. Both rearrangements were associated with diminished expression of the 3′ end of DPP9 corresponding to the breakpoints identified by RNA-seq. For the exon-level expression analysis, candidate fusion partner genes were ranked according to deviating expression compared to the median of the sample set.
    [Show full text]
  • Oral Presentations
    Journal of Inherited Metabolic Disease (2018) 41 (Suppl 1):S37–S219 https://doi.org/10.1007/s10545-018-0233-9 ABSTRACTS Oral Presentations PARALLEL SESSION 1A: Clycosylation and cardohydrate disorders O-002 Link between glycemia and hyperlipidemia in Glycogen Storage O-001 Disease type Ia Hoogerland J A1, Hijmans B S1, Peeks F1, Kooijman S3, 4, Bos T2, Fertility in classical galactosaemia, N-glycan, hormonal and inflam- Bleeker A1, Van Dijk T H2, Wolters H1, Havinga R1,PronkACM3, 4, matory gene expression interactions Rensen P C N3, 4,MithieuxG5, 6, Rajas F5, 6, Kuipers F1, 2,DerksTGJ1, Reijngoud D1,OosterveerMH1 Colhoun H O1,Rubio-GozalboME2,BoschAM3, Knerr I4,DawsonC5, Brady J J6,GalliganM8,StepienKM9, O'Flaherty R O7,MossC10, 1Dep Pediatrics, CLDM, Univ of Groningen, Groningen, Barker P11, Fitzgibbon M C6, Doran P8,TreacyEP1, 4, 9 Netherlands, 2Lab Med, CLDM, Univ of Groningen, Groningen, Netherlands, 3Dep of Med, Div of Endocrinology, LUMC, Leiden, 1Dept Paediatrics, Trinity College Dublin, Dublin, Ireland, 2Dept Paeds and Netherlands, 4Einthoven Lab Exp Vasc Med, LUMC, Leiden, Clin Genetics, UMC, Maastricht, Netherlands, 3Dept Paediatrics, AMC, Netherlands, 5Institut Nat Sante et Recherche Med, Lyon, Amsterdam, Netherlands, 4NCIMD, TSCUH, Dublin, Ireland, 5Dept France, 6Univ Lyon 1, Villeurbanne, France Endocrinology, NHS Foundation Trust, Birmingham, United Kingdom, 6Dept Clin Biochem, MMUH, Dublin, Ireland, 7NIBRT Glycoscience, Background: Glycogen Storage Disease type Ia (GSD Ia) is an NIBRT, Dublin, Ireland, 8UCDCRC,UCD,Dublin,Ireland,9NCIMD, inborn error of glucose metabolism characterized by fasting hypo- MMUH, Dublin, Ireland, 10Conway Institute, UCD, Dublin, Ireland, glycemia, hyperlipidemia and fatty liver disease. We have previ- 11CBAL, NHS Foundation, Cambridge, United Kingdom ously reported considerable heterogeneity in circulating triglycer- ide levels between individual GSD Ia patients, a phenomenon that Background: Classical Galactosaemia (CG) is caused by deficiency of is poorly understood.
    [Show full text]
  • Investigations Into the Early Steps of Cobalamin
    Investigations into the Early Steps of Cobalamin Metabolism Isabelle Racine Miousse Doctorate of Philosophy Department of Human Genetics McGill University Montreal, Quebec, Canada June 6, 2011 A thesis submitted to McGill University in partial fulfillment of the requirements of the degree of Doctorate of Philosophy Copyright 2011 All rights reserved. DEDICATION This work is dedicated to the persons living with cobalamin disorders and their families. ACKNOWLEDGMENTS I would like to thank my supervisors David Rosenblatt and James Coulton for their support and inspiration during the years I have spent in their company. I am grateful for all the opportunities they have opened for me, for their time and their patience. Thank you to my committee members, Dr. Eric Shoubridge and Dr. Rima Slim, for their advice and guidance. Special thanks also to Drs. David Watkins and Maria Plesa for their technical guidance and their great depth of knowledge. I would also like to thank them for proofreading work. Thank you to the students, particularly Woranontee Werarpachai for teaching me microcell-mediated chromosome transfer, Abigail Gradinger and Amanda Duval-Loewy for getting me started with PCR and cell culture, and all the other students I had the chance to work with. iii TABLE OF CONTENTS DEDICATION .......................................................................................................................ii ACKNOWLEDGMENTS...................................................................................................... iii TABLE OF
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Itemised List of Supplemental Material 1. Supplemental Materials And
    Itemised list of Supplemental Material 1. Supplemental Materials and Methods 2. Supplemental References 3. Supplemental Table S1. Summary of pathological abnormalities observed with variable penetrance in L597VBraf-expressing mice. 4. Supplemental Figures S1-7. Fig. S1: Multiplex PCR genotyping of Braf+/LSL-L597V mouse ear samples Fig. S2: H&E-stained sections of benign growths Fig. S3: PCR to detect Cre-mediated recombination in MEFs Fig. S4: Characterisation of the Erk pathway in MEFs: Dusp 6 knockdown and p90RSK phosphorylation Fig. S5: PCR to detection Cre-mediated recombination in lung Fig. S6: Expression of D-type cyclins in primary MEFs. Fig. S7: Heterodimer formation between L597VBRAF and CRAF in HEK293T cells. 5. Supplemental Table S2. Summary of microarray data 6. Supplemental Table S3. Genes whose expression is significantly altered in V600EBraf, G12DKras and L597VBraf/G12DKras MEFs. 7. Supplemental Table S4. Genes whose expression is altered in L597VBraf/G12DKras MEFs but not G12DKras or V600EBraf MEFs Supplemental Materials and Methods Transfection of HEK293T cells HEK293T cells were cultured in DMEM with 10% FCS and penicillin/streptomycin and transfected with lipofectamine 2000 using conditions recommended by the manufacturer (Invitrogen). Cells were either mock transfected or transfected with myc-tagged expression vectors for human WTBRAF or L597VBRAF. 48 hours after transfection, cells were harvested and protein lysates generated by previously reported methods (Huser et al. 2001). BRAF was immunoprecipitated using the BRAF antibody (Santa Cruz Inc. #SC-5284). Immunoblotting Protein lysates were prepared by previously published methods (Huser et al. 2001). Antibodies used were as follows: Cyclin d1 (Cell Signaling Tech. #2922), Cyclin d2 (Santa Cruz Inc.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Stem Cells® Original Article
    ® Stem Cells Original Article Properties of Pluripotent Human Embryonic Stem Cells BG01 and BG02 XIANMIN ZENG,a TAKUMI MIURA,b YONGQUAN LUO,b BHASKAR BHATTACHARYA,c BRIAN CONDIE,d JIA CHEN,a IRENE GINIS,b IAN LYONS,d JOSEF MEJIDO,c RAJ K. PURI,c MAHENDRA S. RAO,b WILLIAM J. FREEDa aCellular Neurobiology Research Branch, National Institute on Drug Abuse, Department of Health and Human Services (DHHS), Baltimore, Maryland, USA; bLaboratory of Neuroscience, National Institute of Aging, DHHS, Baltimore, Maryland, USA; cLaboratory of Molecular Tumor Biology, Division of Cellular and Gene Therapies, Center for Biologics Evaluation and Research, Food and Drug Administration, Bethesda, Maryland, USA; dBresaGen Inc., Athens, Georgia, USA Key Words. Embryonic stem cells · Differentiation · Microarray ABSTRACT Human ES (hES) cell lines have only recently been compared with pooled human RNA. Ninety-two of these generated, and differences between human and mouse genes were also highly expressed in four other hES lines ES cells have been identified. In this manuscript we (TE05, GE01, GE09, and pooled samples derived from describe the properties of two human ES cell lines, GE01, GE09, and GE07). Included in the list are genes BG01 and BG02. By immunocytochemistry and reverse involved in cell signaling and development, metabolism, transcription polymerase chain reaction, undifferenti- transcription regulation, and many hypothetical pro- ated cells expressed markers that are characteristic of teins. Two focused arrays designed to examine tran- ES cells, including SSEA-3, SSEA-4, TRA-1-60, TRA-1- scripts associated with stem cells and with the 81, and OCT-3/4. Both cell lines were readily main- transforming growth factor-β superfamily were tained in an undifferentiated state and could employed to examine differentially expressed genes.
    [Show full text]
  • Plasma Microrna Profile in Canine Appendicular Osteosarcoma Patients
    Plasma microRNA Profile in Canine Appendicular Osteosarcoma Patients by Michael Edson A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Master of Science in Pathobiology Guelph, Ontario, Canada © Michael Edson, September, 2019 ABSTRACT PLASMA MICRORNA PROFILE IN CANINE APPENDICULAR OSTEOSARCOMA PATIENTS Michael Edson Advisor: University of Guelph, 2019 Dr. Geoffrey Wood Osteosarcoma (OSA) is the most common primary bone tumor in dogs. The standard of care for canine appendicular OSA involves amputation followed by chemotherapy. Currently, there are no established biomarkers to determine which dogs benefit the most from chemotherapy. MicroRNAs (miRNAs) are small non-coding RNAs that are potential biomarkers of osteosarcoma. Plasma miRNA levels were profiled in healthy dogs and OSA patients, collected before and after amputation. Quantitative real-time PCR was conducted to determine the levels of 277 miRNAs on a miRNome PCR array. From these findings, a custom PCR array was designed and used to examine miRNA levels and correlations to clinical outcome in 20 control and 28 OSA cases. Additionally, miRNA levels in erythrocytes were analyzed. Overall, 37 plasma miRNAs and 1 erythrocyte miRNA had significant level changes. Furthermore, 24 plasma miRNAs were correlated to clinical outcome. These miRNAs could improve decision making in treatments for OSA patients. iii ACKNOWLEDGEMENTS I’d like to thank my advisor, Dr. Geoffrey Wood, as well as my committee members, Dr. Anthony Mutsaers, Dr. Alicia Viloria-Petit, and Dr. R. Darren Wood for their advice and guidance on this project. Many thanks to Mary Ellen Clark, Dr. Karlee Craig, Gabhan Chalmers and Leah Read for their technical assistance and advice in the laboratory.
    [Show full text]