Dissecting the Functional Impacts of Non-Coding Genetic Variation
by
Cong Guo
University Program in Genetics and Genomics Duke University
Date:______Approved:
______Timothy E. Reddy, Supervisor
______Jen-Tsan Ashley Chi, Chair
______Elizabeth R. Hauser
______Gregory E. Crawford
Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the University Program in Genetics and Genomics in the Graduate School of Duke University
2016
i
v
ABSTRACT
Dissecting the Functional Impacts of Non-Coding Genetic Variation
by
Cong Guo
University Program in Genetics and Genomics Duke University
Date:______Approved:
______Timothy E. Reddy, Supervisor
______Jen-Tsan Ashley Chi, Chair
______Elizabeth R. Hauser
______Gregory E. Crawford
An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the University Program in Genetics and Genomics in the Graduate School of Duke University
2016
i
v
Copyright by Cong Guo 2016
Abstract
A large proportion of the variation in traits between individuals can be attributed to variation in the nucleotide sequence of the genome. The most commonly studied traits in human genetics are related to disease and disease susceptibility. Although scientists have identified genetic causes for over 4,000 monogenic diseases, the underlying mechanisms of many highly prevalent multifactorial inheritance disorders such as diabetes, obesity, and cardiovascular disease remain largely unknown.
Identifying genetic mechanisms for complex traits has been challenging because most of the variants are located outside of protein-coding regions, and determining the effects of such non-coding variants remains difficult. In this dissertation, I evaluate the hypothesis that such non-coding variants contribute to human traits and diseases by altering the regulation of genes rather than the sequence of those genes. I will specifically focus on studies to determine the functional impacts of genetic variation associated with two related complex traits: gestational hyperglycemia and fetal adiposity. At the genomic locus associated with maternal hyperglycemia, we found that genetic variation in regulatory elements altered the expression of the HKDC1 gene. Furthermore, we demonstrated that HKDC1 phosphorylates glucose in vitro and in vivo, thus demonstrating that HKDC1 is a fifth human hexokinase gene. At the fetal-adiposity associated locus, we identified variants that likely alter VEPH1 expression in
iv
preadipocytes during differentiation. To make such studies of regulatory variation high- throughput and routine, we developed POP-STARR, a novel high throughput reporter assay that can empirically measure the effects of regulatory variants directly from patient DNA. By combining targeted genome capture technologies with STARR-seq, we assayed thousands of haplotypes from 760 individuals in a single experiment. We subsequently used POP-STARR to identify three key features of regulatory variants: that regulatory variants typically have weak effects on gene expression; that the effects of regulatory variants are often coordinated with respect to disease-risk, suggesting a general mechanism by which the weak effects can together have phenotypic impact; and that nucleotide transversions have larger impacts on enhancer activity than transitions.
Together, the findings presented here demonstrate successful strategies for determining the regulatory mechanisms underlying genetic associations with human traits and diseases, and value of doing so for driving novel biological discovery.
v
Dedication
I dedicate this work to my family. Dad, thank you for your advice throughout graduate school. It really helped to have someone older and wiser who has been through a Ph.D. in the family. Mom, you are awesome. Thank you for motivating me to be the best that I can be. You are the strongest person that I will ever know. Sherry, keep on working hard. Thanks for taking care of the family while I was at Duke, and I hope that you achieve your goals of becoming a scientist as well. Elaine, thank you for being my wife. Marrying you was the best decision that I’ve made in my life. You were always there when I needed emotional support. The unfaltering support of my family is the main reason that I was able to reach all of my goals in graduate school.
vi
Contents
Abstract ...... iv
List of Tables ...... xii
List of Figures ...... xiv
Acknowledgements ...... xxii
Chapter 1: Background ...... 1
1.1 The human population is genetically diverse ...... 1
1.2 Determining the genetic basis of human traits ...... 3
1.3 The molecular state of the human genome and epigenome...... 8
1.4 Associating SNPs with the expression of target genes...... 11
1.5 Strategies and technologies for investigating trait-associated non-coding variation ...... 13
1.6 The genetics of maternal glycaemia and fetal adiposity ...... 16
Chapter 2: Identification of non-coding regulatory variation associated with maternal glycaemia ...... 19
2.1 Overview ...... 19
2.2 Introduction ...... 20
2.3 Methods ...... 22
2.3.1 Luciferase Reporter Assays ...... 22
2.3.2 RT-qPCR ...... 23
2.3.3 Western Blots ...... 23
2.3.4 Adenovirus Construction and Transduction ...... 24
vii
2.3.5 Protein Purification ...... 25
2.3.6 Cellular Hexokinase Assays ...... 26
2.3.7 Purified HKDC1 Hexokinase Assays ...... 27
2.3.8 siRNA Knockdown ...... 27
2.3.9 Genome Wide Association with Imputed Genotypes ...... 28
2.3.10 Liver eQTL Analysis ...... 29
2.3.11 Multiple Sequence Alignment ...... 31
2.4 Results ...... 31
2.4.1 Identification of regulatory variants in the HKDC1 locus ...... 31
2.4.2 The identified regulatory variants have coordinated effects ...... 37
2.4.3 HKDC1 is a novel human hexokinase gene ...... 39
2.5 Discussion ...... 43
Chapter 3. Massively parallel quantification of the regulatory effects of non-coding genetic variation in a human cohort ...... 46
3.1 Overview ...... 46
3.2 Introduction ...... 47
3.3 Methods ...... 49
3.3.1 TruSeq Custom Amplicon Sequencing ...... 49
3.3.2 Variant Calling and Phasing ...... 50
3.3.3 Reporter Input Library Construction ...... 51
3.3.4 Reporter Output Library Construction ...... 53
3.3.5 Identifying Regulatory Variants in Population STARR-seq...... 54
viii
3.3.6 Luciferase Validation Assays ...... 55
3.3.7 GEUVADIS eQTL Analysis ...... 56
3.3.8 Allele-specific H3K27ac Analysis ...... 57
3.3.9 Data Visualization ...... 57
3.3.10 Data Access...... 57
3.4 Results ...... 58
3.4.1 Population-scale reporter assay approach ...... 58
3.4.2 Targeted sequencing of candidate regulatory elements from a GWAS population ...... 59
3.4.3 Quantifying the effects of non-coding variation in a GWAS population ...... 62
3.4.4 Quantifying the effects of non-coding variation in a GWAS population ...... 64
3.4.5 Effects of haplotypes on regulatory element activity ...... 65
3.4.6 Fine mapping genetic associations with phenotypes ...... 66
3.5 Discussion ...... 68
Chapter 5: Regulatory variants associated with fetal adiposity regulate adipogenesis ... 73
5.1 Overview ...... 73
5.2 Introduction ...... 73
5.3 Methods ...... 75
5.3.1 Custom Amplicon Design and Capture ...... 75
5.3.2 Variant Calling and Phasing ...... 75
5.3.3 Adipocyte RNA-seq Time course ...... 75
5.3.4 Statistical Methods for Association ...... 76
ix
5.3.5 POP-STARR ...... 77
5.4 Results ...... 78
Chapter 6: Transversions have larger regulatory effects than transitions ...... 84
6.1 Overview ...... 84
6.2 Introduction ...... 84
6.3 Methods ...... 85
6.3.1 Predicted Effects of Mutations on TF Binding ...... 85
6.3.2 Effects of Ts’s and Tv’s in Patwardhan et al. Dataset ...... 86
6.3.3 Allele Specific Binding Analysis ...... 86
6.3.4 Genome-wide Depletion of Tv’s in DHS’s ...... 87
6.3.5 Custom Amplicon Design and Capture ...... 88
6.3.6 Variant Calling and Phasing ...... 88
6.3.7 POP-STARR-seq ...... 88
6.3.8 Comparing effects of Ts’s and Tv’s on Regulatory Element Activity ...... 89
6.3.9 Web Resources ...... 90
6.4 Results ...... 90
6.5 Discussion ...... 96
Chapter 7: Conclusions and Future Outlook ...... 97
Appendix A: Identification of non-coding regulatory variation associated with maternal glycaemia ...... 104
Appendix B: Massively parallel quantification of the regulatory effects of non-coding genetic variation in a human cohort ...... 122
x
Appendix C: Regulatory variants associated with fetal adiposity regulate adipogenesis ...... 133
Appendix D: Transversions have larger regulatory effects than transitions...... 142
References ...... 144
Biography ...... 174
xi
List of Tables
Table 1: Association of functional genetic variants with regulatory activity (β-luciferase (β-luc), HKDC1 expression (β-eQTL) and gestational hyperglycaemia (β-GWA) 37...... 36
Table 2: Results for associated SNPs and regulatory elements...... 83
Table 3: Putative regulatory element chromatin marks ...... 114
Table 4: Haplotype frequencies across the regulatory elements ...... 115
Table 5: 1000 Genomes individual IDs and ancestries...... 116
Table 6: Pre- and post-mutagenesis rare allele frequencies ...... 117
Table 7: Table of significant regulatory variants ...... 118
Table 8: Concordant SNP effects in four different cell lines ...... 118
Table 9: Discordant SNP effects in four different cell lines ...... 119
Table 10: RPKM for primary hepatocytes and HepG2 cells ...... 119
Table 11: Amino acid percent identity matrix...... 119
Table 12: DNA percent identity matrix ...... 119
Table 13: Primer sequences for amplifying regulatory elements ...... 120
Table 14: Primer sequences for site directed mutagenesis ...... 120
Table 15: Primer sequences for qPCR ...... 121
Table 16: Transition:Transversion ratios in 1000 Genomes and Custom Amplicon Sequencing ...... 129
Table 17: Proportion of assayed variation in Population STARR-seq ...... 130
Table 18: STARR-seq Primers ...... 130
Table 19: Luciferase Validation Primers ...... 131
xii
Table 20: Proportion of assayed haplotypes ...... 141
Table 21: Effects of Tv’s on regulatory element activity in Patwardhan et al dataset ..... 142
Table 22: Population STARR-seq Primer Sequences ...... 142
xiii
List of Figures
Figure 1: Studies, traits and SNP-trait associations from 2005–2013 reveal the growth in eligible studies29...... 5
Figure 2: This diagram shows all SNP-trait associations with p-value ≤ 5.0 × 10-8, published in the GWAS catalogue (http://www.genome.gov/gwastudies) up to the end of May 201430...... 6
Figure 3: STARR-seq construct design. Adapted from Arnold et al101...... 15
Figure 4: Transgenerational cycle of gestational diabetes and obesity. Adapted from Dabelea et al134...... 17
Figure 5: Coordinated allelic regulation of HKDC1. (A) Map of chromatin landscape and the HKDC1 genome wide association (GWA) locus target regions. Evidence of active regulatory elements – genomic regions with the covalent histone modifications H3K4me1 and H3K27ac as measured by ChIP-seq and open chromatin measured by DNase-seq – is shown across the genomic locus associated with gestational hyperglycemia. Green boxes indicate candidate the regulatory elements whose activity was measured with luciferase reporter assays. Histone modification and open chromatin data were obtained from the ENCODE project. (B) For each regulatory element in a, the enhancer activity (y-axis) is plotted against DNase-seq signal averaged across the element (x-axis) in HepG2 cells (n= 8 to 19). Enhancer activity was determined by dividing the relative luciferase signal from the most active haplotype by that of a control vector with the same promoter but no enhancer. The red line indicates the Pearson correlation between DNase-seq signal and enhancer activity. Error bars show standard deviation (s.d.). (C) Coordinated regulatory variation in the HKDC1 locus. SNPs that are significantly associated with gestational hyperglycemia (“GWA SNPs”), HKDC1 mRNA expression (“HKDC1 eQTLs”), or regulatory activity in allele-specific luciferase reporter assays (“Reg. Vars”) are marked with an asterisk. (D) Example box plots showing allele specific regulatory activity for the four SNPs that were significantly associated with gestational hyperglycemia, HKDC1 expression, and luciferase reporter gene expression. In each example, they associated with increased 2 hr plasma glucose are shown in bold face. The bottom and top boxes are the first and third quartiles, and the band inside the box is the median. The ends of the whiskers represent the lowest and highest data points within 1.5 interquartile range of the lower and upper quartiles. Black squares represent outliers defined as 1.5 times the interquartile range above the upper quartile or below the lower quartile. The number of replicate measurements followed by each allele are as
xiv
follows: 103 of rs10762264A, 79 of rs10762264G, 80 of rs4746822C, 115 of rs4746822T, 129 of rs2394529C, 47 of rs2394529G, 80 of rs9645501A, and 80 of rs9645501G37...... 32
Figure 6: HKDC1 is a hexokinase. (A) Two different siRNAs were used to knockdown HKDC1 in HepG2 cells. Quantification of hexokinase (HK) activity from whole cell lysates shows a dose-dependent decrease in HK activity with reduced HKDC1 expression (n = 4). (B) siRNAs are specific to HKDC1 and do not impact the expression of the other human hexokinase genes that are expression in HepG2 cells (n = 4). (C,D) Transient overexpression of HKDC1 increases total hexokinase activity in HepG2 cells compared to controls which were transfected with a plasmid expression a truncated HKDC1 (n = 2). (E,F) Adenoviral-mediated overexpression of HKDC1 overexpression in INS-1 cells increased the amount of HKDC1 protein and cellular HK activity across a range of 0-50 mM glucose shown in f. The level of hexokinase activity was determined by dividing the optical density at 490 nm (OD490) at each glucose concentration by the OD490 at 50 mM glucose in all 3 transduction conditions, respectively (n = 3). (G) HKDC1 and HK1 protein was expressed in bacterial cells and isolated. Purity of the isolated protein was demonstrated with Coomassie-blue staining. (H) Hexokinase assays performed on the purified protein demonstrate that both HKDC1 and HK1 have hexokinase activity. Specific activity was defined as micromoles of NADPH generated per hour per microgram of protein (n = 2). All error bars show s.d37...... 41
Figure 7: Identification of regulatory variants using population-scale STARR-seq assays. (A) Schematic of population STARR-seq assay design. (B) Candidate regulatory sites were sequenced in 95 members of the HAPO study patient cohort using Custom Amplicon sequencing. The targeted regions overlap open chromatin (DNase I HS) in multiple cell types as described in the methods. (C) Population STARR-seq is highly reproducible. Rep1-7 are biological replicates generated from independent transfections. The X- and Y- axes represent element activity (output RNA reads / input DNA reads). In each case, Spearman's ρ is greater than 0.90. (D) Plotted is a comparison of the allele frequency of each SNP in the cohort DNA to the allele frequency of each SNP in the resulting reporter library. Allele frequencies of the cohort DNA used are shown on the X-axis; and the allele frequency in the resulting reporter library are on the Y-axis. The allele frequencies are highly correlated, as evaluated by a Pearson correlation (r2 = 0.94, p < 1 x 10-5). (E) Log2(effect sizes) for non-significant (pink) and significant (FDR < 0.05, blue) variants. The effect sizes are small and range between 0.25 - 3.96 fold-change. (F) Firefly luciferase assay validations for population STARR-seq. In all cases, the higher expressing allele in our high-throughput reporter assay, shown in green, also had higher luciferase expression216...... 61
xv
Figure 8: Comprehensive measurement of haplotype-specific regulatory element activity provides mechanistic insights into gene regulation (A) Distribution of enhancer activity scores for fragments containing regulatory variants (red) and fragments containing non- regulatory variants (blue) (B) Histogram of number of SNPs per assayed element. (C) Manhattan plot of eQTLs for the long non-coding RNA LINC00881. Blue dots indicate - log10(p-value) of LINC00881 eQTL from the GEUVADIS database (left Y-axis); red bars indicate -log10(FDR) for variants that alter regulatory activity in the population STARR- seq assay (right Y-axis). Red dotted line indicates a FDR = 1.0. (D) Association between normalized expression of long noncoding gene LINC00881 in LCLs as measured by the GEUVADIS project (Y-axis) and the measured effect size in population STARR-seq assay (X-axis) for SNP rs73170828 (r2 = 0.07, p = 7.6 x 10-9). (E) Allele-specific H3K27ac analysis of variants rs62274098 and rs73170828, both eQTLs proximal to and 5' of LINC00881; read counts (Y-axis) differed substantially between alleles for rs73170828 (Wilcoxon p=0.058, binomial p=0.004) but not for rs62274098 (Wilcoxon p=0.9; binomial p=0.92)216. 68
Figure 9: SNP rs4266144 resides within a TEAD4 ChIP-seq binding site as assayed in HepG2 cells. The C>G variant is located in a largely invariant region of the TEAD4 canonical consensus binding motif. The binding site is located within a region that is enriched for H3K27ac and p300 occupancy. Concordantly, ChromHMM segmentation analysis scores the locus as a putative weak enhancer223. Multispecies conservation analysis suggests that this motif resides within a region that is conserved between the great apes216...... 71
Figure 10: 3q25 fine mapping and POP-STARR in adipocytes. (A) SNP associations with sum of skinfolds in 760 individuals from the 10th and 90th percentiles of adiposity after fine-mapping in the Thai population. (B) expression time-course results for adipocyte differentiation over 21 days. (C) schematic of experimental design of POP-STARR in primary pre-adipocytes. (D) number of functional variants discovered...... 81
Figure 11: The activity of regulatory elements is directly associated with sum of skinfolds. (A) association of amplicon acivity scores with sum of skinfolds in preadipocytes and adipocytes. (B) associated amplicons that contain functional GWAS SNPs...... 82
Figure 12: Tv’s are depleted at TF binding sites. (A,B) Changes to PWM scores for JASPAR TFs caused by Ts’s and Tv’s. Black squares are changes >1.5x above the interquartile range. P-values for parameter estimates were calculated using a t test. (C) The percentage of Tv’s in allele-specific CTCF across six LCL lines (left), and for allele- specific binding across seven TFs (right). Error bars show the s.e.m. (D) Genome-wide
xvi
Ts:Tv ratios within non-exonic DHS’s, flanking regions, and remaining non-coding genome. (E,F) Distribution of proximities between (E) nearest gene and Tv rich and sparse elements, and (F) Ts rich and Ts sparse elements...... 92
Figure 13: Tv’s have greater regulatory effects than Ts’s. (A) Ts/Tv within DHS and 150 bp flanking regions. (B) schematic of POP-STARR experimental design. (C) Changes in haplotype effect magnitudes due to the presence of a Ts or Tv within a haplotype. Black squares are effects 1.5x of the interquartile range above the upper quartile or below the lower quartile. (D) Correlation between change in haplotype effect magnitude and the number of Ts/Tv differences between haplotypes. The red line is the regression line. P- values were calculated using a t test. (E) Correlation between change in haplotype effect magnitude and the number of Ts/Tv differences between haplotypes which overlap DHS centers. The red line is the regression line. P-values were calculated using a t test. 95
Figure 14: Loci associated with 2 hr glucose during pregnancy imputed to HAPMAP (A) and 1000 Genomes (B). Peak of association is in the first intron of HKDC1. Black bars delineate a 30kb block with the strongest association (F-test, p < 1 x10-5, n = 1,367) and LD (r2 > 0.3)...... 105
Figure 15: Significant HKDC1 eQTLs [log10(Bayes Factor) > 2.5] and GWA SNPs (F-test, p < 1 x 10-8 ) in the maternal 2 hr glucose level associated locus. An enrichment of open chromatin is located in a 30kb block between the 1st and 5th exons of HKDC1, flanked by two regulatory “deserts” on either side. Open chromatin for each cell line is denoted by DNaseI hypersensitivity (ENCODE). Putative enhancer marks are marked by H3KMe1 and H3K27AC. Black bars delineate the same 30 kb block in Supplementary Figure 1...... 105
Figure 16: eQTL analysis in primary liver for all genes within 500 kb of HKDC1. The red line represents the lead GWAS SNP rs4746822...... 106
Figure 17: Enhancer strength of selected regulatory elements. Firefly luciferase intensity was normalized by dividing by the Renilla luciferase intensity. Enhancer strength was determined by dividing the normalized luciferase intensity of each construct by the normalized intensity of the empty vector. Error bars show s.d (n = 8 to 19)...... 107
Figure 18: Enhancer strength vs DHS peak width. Spearman ρ =0.5 ,p = 0.117 (n = 8 to 19) . Error bars show s.d...... 107
Figure 19: Experimental design for luciferase reporter assays. Multiple haplotypes of each regulatory element were cloned upstream of the promoter and site directed
xvii
mutagenesis was used to segregate alleles which do not segregate naturally in the population. A linear regression model was used to determine the effect of each SNP on luciferase expression. The bottom and top boxes are the first and third quartiles, and the band inside the box is the median. The ends of the whiskers represent the lowest and highest data points within 1.5 interquartile range of the lower and upper quartiles. Circles represent outliers defined as 1.5 times the interquartile range above the upper quartile or below the lower quartile...... 108
Figure 20: Plots of predicted luciferase values versus observed luciferase values. In a-f, predicted luciferase values are positively and significantly associated with observed luciferase values, suggesting that the effects of individual variants may combine additively within haplotypes. The blue line is y = x and the black line is the regression line. Error bars show s.d...... 109
Figure 21: Full blot and gel images. (A) Coomassie stain for HKDC1 and HK1. The numbers representing the following: 1:Preinduction, 2:Induction, 3:Clarified Lysate, 4:Column Flow through, 5:Fraction 1, 6:Fraction 2, 7:Fraction 3, 8:Fraction 4, 9:Fraction 5. Full western blot images are shown for INS-1 cells induced with GFP and HKDC1 adenovirus using an HKDC1 (B) and anti-β Actin antibody (C)...... 110
Figure 22: Un-normalized HKDC1 virus transduction results. HKDC1 overexpression in INS-1 cells via adenovirus shows increased HK activity between a range of 0-50mM glucose. Error bars show s.d...... 111
Figure 23: Expression of other HK mRNAs in INS-1 cells after either GFP or HKDC1 adenovirus transduction. Expression was quantified via qPCR and expression was normalized using the ΔΔ CT method (n = 3). Error bars show s.d...... 111
Figure 24: Cell number is consistent between groups of INS-1 cells treated with adenovirus. Cell number was quantified using the Cell-Titer Glo assay (Promega) (n = 3). Error bars show s.d...... 112
Figure 25: Replicate of HKDC1 activity dose response curve. This experiment is a duplicate experiment represented in Supplementary Figure 4 (n = 3). Error bars show s.d...... 112
Figure 26: Power analysis to detect independent additive effects of regulatory variants. The beta of SNP1 (rs10762264) = 0.48 and the MAF = 0.4. R2 values between the 4 SNPs range from 0.8-0.99...... 113
xviii
Figure 27: Standard curve for specific activity versus fluorescence (n = 3)...... 114
Figure 28: Distribution of TruSeq Custom Amplicon sequencing coverage for 95 individuals. For each individual, the read depth was determined by calculating the median coverage per amplicon for that specific individual. The median read depth for an individual in the cohort is 1500x...... 122
Figure 29: Distribution of allele frequencies in the 1000 Genomes Project and our TruSeq Custom Amplicon Sequencing for 95 individuals. The high coverage permitted confidently calling a higher number of private variants per individual...... 123
Figure 30: Distribution of median coverage per amplicon of STARR-seq DNA plasmid input library sequencing. The Y-axis represents the number of amplicons and the X-axis represents the median depth per fragment. The median number of times an amplicon was sequenced was 2200 times...... 124
Figure 31: Distribution of median coverage per amplicon of the RNA-seq output library sequencing. The Y-axis represents the number of amplicons and the X-axis represents the median depth per fragment. The median number of times an amplicon was sequenced was 13,000 times...... 125
Figure 32: Allele ratio in the DNA plasmid library (X-axis) versus allele ratio in RNA- seq output libraries (Y-axis) for each replicate. Allele ratio is defined as (number of reads containing Allele0) / (number of reads containing Allele1). Allele0 is the reference allele and Allele1 is the alternate allele defined by the VCF file. Generally, the alternative allele has lower frequency, although this is not always the case...... 126
Figure 33: Plotted is a comparison of the allele frequency of each SNP in the cohort DNA determined by variant calling to the allele frequency of each SNP in the resulting reporter library. Allele frequencies of the cohort DNA used are shown on the X-axis; and the allele frequency in the resulting reporter library are on the Y-axis...... 127
Figure 34: Correlation between minor allele frequency (MAF: X-axis) and variant effect size (Y-axis) for functional variants identified in our population STARR-seq assay (Spearman ρ = -0.18, p = 0.28)...... 127
Figure 35: Correlation between SNP effect sizes (X-axis: log of product of effect sizes of SNPs on haplotype) and log of observed haplotype effects (Y-axis) for putative regulatory haplotypes containing more than one SNP (r = 0.54, p = 0.007). Observed haplotype effect sizes were computed as normalized ratios for each haplotype versus all
xix
pooled haplotypes at a locus: (RNAhaplotype/DNAhaplotype)/(RNApooled/DNApooled). Solid line: regression line (slope=0.8, intercept=-0.019); dotted line: 1:1 diagonal...... 128
Figure 36: Pearson correlation coefficients for five genes (LINC00881:ENSG00000241135.1, LINC00880:ENSG00000243629.1, CCNL1:ENSG00000163660.7, TIPARP:ENSG00000163659.8, LEKR1:ENSG00000197980.6) and 67 proximal SNPs. Blue points correspond to eQTLs for LINC00881 as defined by the GEUVADIS consortium...... 129
Figure 37: Association with sum of skinfolds using variant call data from the custom capture sequencing using model 1 as described in Urbanek et al201...... 133
Figure 38: Association with sum of skinfolds using variant call data from the custom capture sequencing using model 2 as described in Urbanek et al201...... 134
Figure 39: Association with sum of skinfolds using variant call data from the custom capture sequencing using model 3 as described in Urbanek et al201...... 135
Figure 40: Association with sum of skinfolds after subsetting the original GWAS data to 760 individuals using model 1 as described in Urbanek et al201...... 136
Figure 41: Association with sum of skinfolds after subsetting the original GWAS data to 760 individuals using model 2 as described in Urbanek et al201...... 137
Figure 42: Association with sum of skinfolds after subsetting the original GWAS data to 760 individuals using model 3 as described in Urbanek et al201...... 138
Figure 43: Quantification of oil red o staining for adipocyte differentiation during 21 days. N = 3 for each time point...... 139
Figure 44: log2 fold changes in gene expression for adipogenic markers over 21 days. N = 4 for each time point...... 139
Figure 45: log2 fold changes in gene expression for cell cycle genes over 21 days. N = 4 for each time point...... 140
Figure 46: log2 fold changes in gene expression for genes at 3q25 over 21 days. N = 4 for each time point...... 140
xx
Figure 47: Amplicons targeting DHS and active histone markers in multiple cell lines. In total, 104 DHS were captured using 174 amplicons. Amplicons were tiled across target regions and also captured at least 50 bp upstream and downstream of each DHS. Amplicon are ~400-425 bp in length...... 142
xxi
Acknowledgements
None of this work would have been possible without the guidance of my advisor
Tim. Tim, thank you accepting me as your trainee and shaping me into the scientist I am today. The same appreciation extends to my lab, collaborators, family, and friends. I would also like to thank the UPGG students and administration for making graduate school an enjoyable experience.
xxii
Chapter 1: Background
1.1 The human population is genetically diverse
No two people are genetically identical1. But how genetically diverse is the human population? The genome consists of ~3 billion base pairs (bp) organized in 23 pairs of chromosomes2. The first human genome sequences were completed in parallel by the Human Genome Project and Celera Genomics. Both were massive efforts. For example, the Human Genome Project was an international effort comprised of 20 institutions across six countries that required over a decade of sequencing to complete.
Both efforts were first published in 2001, at which point the first near-complete sequences of the human genome were made publically available3; 4. The completion of the project marked a tremendous accomplishment for humankind, and remains the largest collaborative biological project to date. Although the Human Genome Project provided a map of ~90% of the genome, over 70% of the sequence was derived from a single donor, and the remaining 30% from only a handful of others. Given the small number of individuals used to construct the sequence, only a tiny fraction of genetic diversity was annotated.
Started in 2002, the International HAPMAP Project was the first large-scale effort to map the genetic diversity across the human population5. The International HAPMAP
Project was a collaboration of academic institutions, non-profits, and private companies across six countries. In Phase I, one common single nucleotide polymorphism (SNP) was
1
genotyped every 5,000 bp in four ancestries. A SNP is a variation in a single position in the genome which is present in at least 1% of the population. During Phase I, the
Consortium also initiated a large re-sequencing project to identify additional SNPs which could be used to create a more detailed map. By the end of Phase III, 11 ancestries had been genotyped for 10 million common variants5-8. The genotypes of common alleles in the genome are typically correlated to those nearby, and less correlated with those farther away. That correlation occurs because mutations and those within close proximity are more likely to be passed down on the same chromosome from one generation to the next. During meiosis, recombination of chromosomes occurs through chromosomal crossover events. Homologous chromosomes pair together and exchange genetic material, resulting in unique combinations of alleles not present in either parent9;
10. Alleles that segregate together are in linkage disequilibrium (LD). SNPs that are farther apart in the genome are less likely to be in LD, because the number of crossovers between two alleles is positively correlated with their distance from each other11. The completion of the HAPMAP Project marked the identification of thousands of regions in high LD known as haplotype blocks. Because the majority of data in the HAPMAP
Project was generated using genotyping arrays, most rare and private variants were missed.
In 2012, 1092 human genomes were sequenced across 14 populations as part of the 1000 Genomes Project (1KGP)12. This was made possible by the advancement of next-
2
generation sequencing technologies. The primary goal of 1KGP was to identify more than 95% of SNPs at 1% frequency in a broad set of populations. In total, 36.7 million
SNPs, 1.28 million indels, and 13,800 large deletions were annotated in Phase 1. Since
1KGP Phase 1, the number of annotated variants has continued to increase steadily.
Currently, the Single Nucleotide Polymorphism Database (dbSNP) contains over 60 million annotated variants13. These databases suggest that the average proportion of nucleotide difference between two individuals is between one in 1,500 to one in 1,000 bp, or two to three million bp in total14; 15. Although nucleotide diversity is lower in humans compared to other species due to a more recent origin and small founder population, there still exists an enormous amount human genetic variation which influences traits16-
18.
1.2 Determining the genetic basis of human traits
Human genetics is the study of inherited human variation. One of the main motivations for studying human genetics is to gain a better understanding of how humans evolved and migrated over time. Based on differences in genetic structure between populations across the world, researchers have been able to trace migratory patterns in human populations19-23. Another primary motivation for studying human genetics is the vast potential for the improvement of human health. Over 4,000 genes have been implicated in single-gene defects including cystic fibrosis, muscular dystrophy, Huntington’s disease, and Rett’s syndrome24; 25. The majority of monogenetic
3
disorders were identified through linkage studies. Linkage studies involve looking at large families where a disease presents through multiple generations. The goal is to identify a genetic marker which is always present in individuals with the disease. The region is then narrowed down until the disease causing mutation is identified. Linkage approaches are most useful for identifying recessive, highly penetrant diseases inherited in a Mendelian fashion. Because many complex diseases such as diabetes and heart disease are polygenic, have low penetrance, and do not show patterns of Mendelian inheritance, alternative approaches are necessary for identifying causal variants.
Genome-wide association studies (GWAS) and whole-genome sequencing studies have narrowed the search for causal variants for many complex diseases26; 27.
GWAS involves correlating allele frequencies of markers distributed throughout the genome with a trait within a population. In doing so, risk haplotypes which presumably contain disease causing variants are associated with a specific phenotype. GWAS has the power to identify genetic loci which have not yet been implicated in disease. The first successful GWAS was published in 2002 and involved 94 individuals with myocardial infarction and 658 healthy individuals28. The study identified a SNP in the coding region of LTA, and one in the first intron which increased the expression of LTA. Elevated expression of LTA containing the risk allele was shown to cause an increase in cell- adhesion molecules in human vascular cells. This was the first example of large genetic study resulting in the identification of a mechanism for disease susceptibility. As of late
4
2015, there have been 2111 GWAS publications that have associated a total of 15,396
SNPs with various traits29; 30. The number of trait and SNP-trait associations has been growing steadily due to the decreasing cost of genotyping technologies as shown in
Figure 131.
Figure 1: Studies, traits and SNP-trait associations from 2005–2013 reveal the growth in eligible studies29.
For many complex trait groups including as cardiovascular disease, metabolic disease, and body measurements, associated loci are also broadly distributed across the genome (Figure 2).
5
Figure 2: This diagram shows all SNP-trait associations with p-value ≤ 5.0 × 10-8, published in the GWAS catalogue (http://www.genome.gov/gwastudies) up to the end of May 201430.
Analyses predicting the functional effects of identified variants have largely focused on variants in protein-coding regions of the genome, as the consequences are more interpretable. However, the vast majority of human genetic variation is non- coding32. Furthermore, about 88% of trait-associated variants with weak effects are non- coding26. This observation supports the hypothesis that weak-effect causal variants play gene regulatory roles26. This hypothesis is further supported by the identification of heritable factors which alter gene expression within GWAS loci33, and the observation that changes in regulatory sequence are the major drivers of morphological differences between related species34.
6
Knowledge of linkage between SNPs is particularly useful for GWAS, because it can help predict (impute) the genotype of unobserved variants. As a result, the number of SNPs genotyped in a given study could be dramatically reduced by genotyping the most informative SNPs and imputing those in LD. Large-scale studies could be conducted at lower costs without compromising the amount of information obtained. At the same time, LD also confounds precise functional interpretation of GWAS associations; haplotype blocks are often hundreds of kilobases wide and contain hundreds of SNPs associated with the trait. LD also makes using statistical methods alone difficult for pinpointing causal variants.
In summary, GWAS is an extremely useful approach for identifying loci associated with phenotypes. The follow-up of these results has yielded many discoveries that have been crucial to our understanding of specific genetic diseases. As the number identified of trait-associated variants continues to increase, understanding how variants cause disease rather than identification will become the rate-limiting step. Functional follow-up for such a vast number of non-coding SNPs has proven challenging. Although there have been a handful of cases for which the mechanism of action of these variants has been determined31; 35-37, the majority of associations remain unexplored due to the throughput required for testing thousands of candidates at once.
7
1.3 The molecular state of the human genome and epigenome
The human genome is densely packaged in the nucleus. The DNA is wrapped around proteins known as histones and condensed into euchromatin and heterochromatin. Euchromatin is lightly packed, high in gene concentration, and usually under active transcription38. In contrast, heterochromatin consists of stable, densely packed histones and is located towards the edge of the nucleus39. Genes which are silent generally reside within heterochromatic regions40. Only though this organization can a three meter-long genome to fit within a 0.1 nm sphere. Histones themselves are frequently modified by the addition of methyl and acetyl groups, and even the individual bases of the genome are modified by addition of methyl groups. The study of these modifications is known as epigenetics. These modifications, along with transcription factors (TFs) and other DNA-binding proteins, play pivotal roles in rapidly activating and deactivating genes during development and in response to environmental stimuli such as stress, drugs, and even diet41-48. The chromatin state of the genome is important for mediating interactions with the environment and maintaining gene regulatory networks in humans and other complex organisms.
Gene expression is controlled by regulatory elements. The four major classes of regulatory elements are promoters, enhancers, silencers, and insulators49-52. Promoters are regions of DNA upstream of gene transcription start sites (TSS) that initiate transcription by RNA polymerase II53-56. There are two types of promoters: focused and
8
dispersed. While focused transcription initiation involves a single strong TSS within a narrow region, dispersed transcription initiation involves multiple weak, broadly- distributed TSS’s55-57. In humans and other complex organisms, the majority of promoters are dispersed57. Enhancers and silencers are genomic regions enriched for TF and co-factor binding sequences. Those regulatory elements generally act through loop formations with promoters and the recruitment of additional activating or repressive factors58. Most enhancer-promoter interactions are also highly cell type-specific. This enhancer specificity mediated by chromatin allows thousands of cell-types within tissues present in our bodies to be derived from a single genome59. Insulators are elements which block enhancer-promoter interaction through the recruitment of DNA structure modifying proteins60; 61. Insulators are particularly important for separating genes with different regulatory requirements62. Together, regulatory elements play an integral role in controlling the expression of genes.
Chromatin features are particularly useful for identifying regions of the genome that play active roles in modulating the expression of genes. Features of functional DNA include the presence of histone 3 lysine 4 monomethylation (H3K4me1) and H3K27 acetylation63. Those two modifications are enriched at enhancers. Another hallmark of genomic regulatory activity is open chromatin marked by DNase I hypersensitivity and micrococcal nuclease sensitivity64-66 67. Early studies demonstrated that regions of the genome which were unbound by histones or other proteins were susceptible to
9
digestion via DNase I and enriched for regulatory elements66; 68. Because those studies relied on visualizing DNase I hypersensitive sites (DHS) using gel electrophoresis, they were not conducive to mapping DHS genome-wide. Gregory Crawford’s group was the first to use next-generation sequencing to characterize open chromatin across the genome. By sequencing DNA after DNase I digestion, they were able to identify enrichments of DNA fragments at DHS. DHS are enriched for TF binding, many of which are evolutionarily conserved across species64; 65; 69.
The vast number of regulatory elements across the genome and differences in epigenetic landscape between individuals, tissues, and cell types motivated the formation of large coordinated efforts such as the Encyclopedia of DNA Elements
(ENCODE) Project and Epigenetics Roadmap Consortium. Both consortiums involved dozens of laboratories and hundreds of scientists across the globe. The primary goal of the ENCODE Project was to identify all regulatory elements in the human genome. The primary goal of the Epigenetics Roadmap Consortium was to identify epigenetic markers associated with disease. Both efforts successfully mapped the state of the human epigenome for hundreds of TFs, histone modifications, and chromatin features across hundreds of cell lines and tissue types, creating valuable publically available resources for identifying regulatory elements and understanding the genetics of gene regulation70; 71. Knowledge of chromatin architecture has proven instrumental towards
10
the identification of phenotype-associated variants by minimizing the genomic search space while providing mechanistic insight into disease associations32; 72-76.
1.4 Associating SNPs with the expression of target genes.
While GWAS involves correlating genotypes with traits and diseases, the goal of expression qualitative trait loci (eQTL) studies is to associate genotype with the expression levels of genes. eQTLs are divided into two categories: cis and trans acting.
While some eQTLs act on genes within the same locus (cis), others can act on loci many megabases away and even as far as separate chromosomes (trans)77. Cis eQTLs are thought to act by disrupting the binding of TFs, resulting in altered gene expression.
Trans eQTLs are thought to act through long-range looping mechanisms or by affecting the expression of a gene which influences the expression of another.
eQTLs are also, at least in part, responsible for the gene expression differences between populations of individuals. Recent studies have estimated that upwards of 30% of the differences in gene expression between individuals can be attributed to eQTLs78. eQTLs can also provide clues to the function of uncharacterized genes through the associations of traits with the expression of a target genes79-84. Many groups have shown that eQTLs are highly enriched for variants identified through GWAS33; 85; 86. eQTLs can be useful for following-up GWAS, because they have the ability to link associations to candidate genes if the gene is not on the same LD block as the associated variant.
11
Like epigenetic markers, eQTLs vary between cell and tissue types. Although the majority of early eQTL studies were conducted using RNA isolated from whole blood, the concerted efforts of many teams have expanded the discovery of eQTLs to numerous cell types, primary tissues, and biological conditions87-91. Most notably, Genotype-Tissue
Expression (GTEx) Project was launched by the NIH with the goal of increasing our understanding of how inherited changes in gene expression can lead to disease92-94. The
GTEx consortium was a collaborative effort involving hundreds of scientists and physicians. As of early 2016, the database includes genotype and RNA-seq results for over 7,000 primary tissue samples and eQTLs for 19,000 genes.
DHS QTLs (dsQTLs) can also help narrow down regions of the genome which control gene expression. In dsQTL studies chromatin accessibility is associated with genotype. About 16% of dsQTLs are eQTLs, and 55% of eQTL SNPs are also dsQTLs75.
This observation further supports the hypothesis that a large proportion of regulatory variants are located within DHS. Although eQTL and dsQTL studies are useful for identifying variants, genes, and tissues associated with traits, they still face many of the same challenges as GWAS. For example, LD between variants limits the resolution of associations. Nevertheless, QTLs will continue to prove increasingly valuable for minimizing the search space for GWAS follow-up and assigning biological function to variants.
12
1.5 Strategies and technologies for investigating trait-associated non-coding variation
Although strategies for identifying trait-associated non-coding variants have improved drastically over the last few years, systematically identifying specific variants and regulatory elements that contribute to phenotype remains a major challenge. One of the biggest obstacles is that recombination across the genome limits the resolution of genetic association studies, preventing the identification of specific causal variants. This limitation motivates the development of complementary empirical approaches to assay the consequences of non-coding genetic variation on regulatory element activity31; 35-37.
Moreover, due to local context dependencies of regulatory variant effects, determining the functional consequences of polymorphisms requires empirical measurements in addition to associations95. One approach for determining whether a genomic region acts to regulate gene expression is a reporter expression assay. In a reporter assay, a candidate regulatory element is cloned into a plasmid, typically upstream of the promoter, where the element can control the expression of a fluorescent or chemiluminescent protein. The plasmid is then transfected into a chosen cell type, and the activity of the regulatory element is estimated by measuring the expression of the reporter gene using a luminometer or fluorometer. Several groups have shown that reporter assays can identify changes in enhancer activity caused by the presence of SNPs associated with phenotypes36; 37; 96. However, traditional reporter assays are low
13
throughput and therefore impractical for assaying genetic variation across large populations and genomic regions.
To overcome the throughput limitations of reporter assays, researchers developed adaptations that allowed high-throughput sequencing rather the fluorescence to be used as readout. The resulting massively parallel reporter assays allowed researchers to complete between thousands and millions of reporter assays at once. The first massively parallel reporter assay used saturation mutagenesis to fine map three promoters97. This was a great advancement in the reporter field, and demonstrated the potential of combining older functional assays with newer next-gen sequencing. Recent advances have greatly increased the throughput of reporter assays by embedding molecular barcodes within the reporter gene that can later be observed with sequencing97-100. These assays have the ability to measure the regulatory activities of more than one million unique DNA fragments in a single experiment101 and have been used to identify and fine-map enhancers throughout the genome49; 97; 100; 102. Barcode approaches require that each assayed regulatory element to be linked to a unique barcode. To bypass this requirement, Alexander Stark’s lab developed a massively parallel reporter assay known as self-transcribing active regulatory region sequencing
(STARR-seq). In STARR-seq the regulatory element is cloned into the 3’ untranslated region (UTR) of the reporter gene instead of upstream of the promoter (Figure 3)101. The advantage of this technique is that the cloned element effectively acts as its own barcode
14
by interacting with the promoter and creating more transcripts which contain its own sequence.
Figure 3: STARR-seq construct design. Adapted from Arnold et al101.
The simplified library construction makes this approach effective for assaying millions of unique fragments. STARR-seq has already been utilized to identify hormone responsive elements, changes in regulatory DNA during evolution, drug responsive elements, and cell-type specific enhancers103-106.
Reporter assays have two major limitations in that they assay regulatory element activity outside of the context of other elements, and that they do not reveal the target gene. An alternative strategy is editing the genome directly. There are three main classes of engineered transcription factors that have been used to introduce mutations into the genome: zing finger proteins, transcription activator-like effectors, and clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR associated proteins.
Although there have been many successes with zinc fingers and transcription activator- like effectors107-113, they are difficult to engineer and implement with a high degree of specificity and efficiency. Today the CRISPR/Cas9 system has become the primary tool 15
for genome editing in multiple species114-120. The engineered form of the CRISPR/Cas9 system uses a complementary guide RNA (gRNA) oligonucleotide to target the Cas9 nuclease to specific double-stranded DNA sequences where it creates a double-strand break that recruits the cellular DNA-repair machinery121. Without a homologous repair template, the DNA ends are re-ligated by error-prone non-homologous end joining
(NHEJ), typically leading to small deletions122. Alternatively, a repair template can be co- delivered with the nucleases to guide homology-directed repair (HDR) and insert or replace sequences at the target site. The NHEJ pathway can delete regions of human chromosomes as small as a few bp and as large as 15 Mb123. The HDR pathway can make single bp changes to correct genetic mutations or create models of human disease124.
Genome-editing approaches have the advantage over reporter assays by allowing researchers to measure the effects of introduced variants directly in the context of the native genome. Together, genome editing and high-throughput reporter assays are indispensable tools for identifying disease-causing mutations.
1.6 The genetics of maternal glycaemia and fetal adiposity
Determining how genetic variation in both the mother and offspring influence fetal outcomes will have both immediate and long-term effects for the health of newborns. Fetal growth and metabolism have both sort- and long-term implications for the health of the newborn125-138. As such, both low and high birth weights have been
16
associated with an increased chance of developing chronic metabolic disorders later in life including obesity and type-2 diabetes (T2D) (Figure 3)133-138.
Figure 4: Transgenerational cycle of gestational diabetes and obesity. Adapted from Dabelea et al134.
Twin studies have estimated the heritability of birth weight to be between 30-
70%139-147. In addition to fetal genetics, mothers with high glucose levels during pregnancy give birth to babies with increased fat accretion, resulting in elevated long- term health risks133; 134; 148-150. The transgenerational cycle of gestational diabetes and obesity has been a contributing factor to the increased percentage of obese and diabetic individuals within the population in recent years. Breaking this cycle will require identifying the mechanism for the risks conferred by maternal metabolism and fetal genes, which, in turn, requires improved understanding of genetic factors regulating maternal metabolism and fetal fat accretion.
17
SNPs associated with maternal glucose levels and fetal adiposity151; 152 were identified using DNA and phenotype information from a multi-ethnic cohort of ~18,000 mothers and their offspring who were enrolled in the NIH and American Diabetes
Association-funded Hyperglycemia and Adverse Pregnancy Outcome (HAPO) Study 153.
A GWAS performed in mothers who underwent glucose testing during gestation identified chr10q22.1 to show strong association with 2 hr maternal glucose levels during pregnancy, and a GWAS in babies showed 3q25.31 to associate with adiposity at birth151; 152. The association at chr10q22 was not present in nongravid individuals, suggesting that the association is pregnancy specific. While other studies have also associated 3q25 to birthweight, a follow-up study revealed that the locus is not associated with late childhood adiposity154-158. This evidence suggests that the association at 3q25 is specific to lipid accumulation during fetal development. High levels of adiposity at birth in land mammals is actually a trait unique to humans. Even our closest cousins the chimpanzee produce offspring with only 2-3% body fat. The prevailing hypothesis of why this occurs is that body fat is necessary for supporting the development of the large human brain159; 160. Learning how genetic variation affects fetal adiposity will not only prove clinically relevant, but also teach us more about our divergence from other hominids.
18
Chapter 2: Identification of non-coding regulatory variation associated with maternal glycaemia
This research chapter is based on a research article published by Cong Guo et al. in the journal
Nature Communications in 201537.
2.1 Overview
Maternal glucose levels during pregnancy impact the developing fetus, affecting metabolic health early and later in life. Both genetic and environmental factors influence maternal metabolism, but little is known about the genetic mechanisms that alter glucose metabolism during pregnancy. Here we report that haplotypes previously associated with gestational hyperglycemia in the third trimester disrupt regulatory element activity and reduce expression of the nearby HKDC1 gene. We further find that experimentally reducing or increasing HKDC1 expression reduces or increases hexokinase activity, respectively, in multiple cellular models; and that purified HKDC1 protein has hexokinase activity in vitro. Together, these results suggest a novel mechanism of gestational glucose regulation in which the effects of genetic variants in multiple regulatory elements alter glucose homeostasis by coordinately reducing expression of the novel hexokinase HKDC1.
19
2.2 Introduction
Regulation of glucose metabolism during pregnancy differs markedly from the non-gravid state as the mother must meet both her own and the growing fetus’s energy needs. The differences are characterized by the combination of lower fasting glucose levels, increased hepatic glucose output, increased nutrient-induced insulin secretion, and significant insulin resistance by the third trimester161. In 5-10% of pregnancies, however, glucose homeostasis is not maintained, resulting in hyperglycemia and gestational diabetes, i.e. diabetes that is first diagnosed during pregnancy. Gestational hyperglycemia is a major health risk to the mother, and is associated with adverse fetal outcomes including increased risk of T2D and obesity in the offspring126; 132; 162; 163. Despite the prevalence and health risks, the mechanisms leading to gestational hyperglycemia remain largely unknown.
We recently identified a strong association between genetic variants in the first intron of HKDC1 and 2 hr plasma glucose levels during an oral glucose tolerance test performed in a multiethnic cohort of 4,437 mothers at ~28 weeks gestation (F-test, p =
8.26 x 10-13, β = 0.167 - 0.229 √[mmol L-1])164. The association was replicated in a cohort of
2,192 additional European mothers and two smaller independent European and
Canadian cohorts (n = 228 and 606). In a separate study of ~47,000 non-gravid individuals of European ancestry, the same region had only marginal association with 2 hr plasma glucose, suggesting that the association with HKDC1 is largely pregnancy
20
specific165. In the 1KGP, there are 60 variants in the coding exons of HKDC1. Seven of those variants are common, defined by a minor allele frequency > 1%. According to computational predictions of the effects of those variants on HKDC1 activity, between one and four of the common variants may impact the function of HKDC1166; 167
(Appendix A, Figure 14) However, none of the coding SNPs were associated with 2 hr plasma glucose at genome-wide significance (p < 1 x 10-8). While the function of HKDC1 is unknown, the gene is broadly expressed including in liver and -islet cells164; 168; conserved across vertebrates; and may be a novel human hexokinase based on its sequence similarity to hexokinase I (HK1)169.
Based on these data, we hypothesized that genetic variation that alters gene regulation may contribute to the association with gestational hyperglycemia. Here we show that there are multiple variants that alter regulatory element activity in the region.
Moreover, the effects of those variants are coordinated across four enhancer elements in the associated HKDC1 locus. For each variant, alleles associated with reduced expression also associate with higher plasma glucose in mothers. We further show that modulating
HKDC1 levels alters hexokinase activity in multiple cellular models, and that purified
HKDC1 protein has hexokinase properties in vitro. Together, our results support a novel mechanism of gestational glucose regulation in which coordinated variation across multiple enhancer elements within regulatory haplotypes reduces expression of the novel hexokinase HKDC1.
21
2.3 Methods
2.3.1 Luciferase Reporter Assays
Selected regions were amplified from genomic DNA from 1KGP subjects and In-
Phusion cloned at the NheI cut site into pGL4.13 luciferase expression vector (Promega).
The construct was then transformed into TOP-10 competent cells and plated onto LB agar plates with ampicillin and incubated overnight at 37°C. In order to capture both haplotypes from subjects who were heterozygous in those regions, multiple colonies were selected and grown individually in LB media overnight. Plasmids were extracted using the PureYield Plasmid Miniprep System (Promega). Constructs were sequenced using Sanger sequencing and variants were confirmed in dbSNP170. Site directed mutagenesis was carried out by amplifying the plasmid using primers containing the allele of choice, treating with DpnI, and transforming into TOP-10 competent cells.
Primers for cloning and site directed mutagenesis are listed in Appendix A, Tables 13 and 14. HepG2 cells (Duke Cell Culture Facility) were plated into white flat-bottom 96- well plates at a density of 25,000 cells/well. After 48 hr, 100 ng of each construct/well was transfected with Fugene HD (Promega) at a 5.5:1 Fugene:DNA ratio. At least 16 biological replicates for each construct were transfected. After 24 hr, luciferase and renilla luciferase signal were quantified using the Dual-glo Luciferase Assay (Promega)
22
using a Victor3 1420 plate reader (PerkinElmer). Luciferase values were normalized by dividing the luciferase signal by the renilla signal. A linear regression model implemented in the R statistical package (R function lm) was used to determine the regulatory effect of individual SNPs where (normalized luciferase intensity) = β1 SNP1 +
β2 SNP2 +β3 SNP3 …+ ε.
2.3.2 RT-qPCR
RNA was isolated using the RNeasy kit (Qiagen). 2 μg of RNA per reaction was reverse transcribed using the SuperScript Vilo cDNA Kit (Life Technologies). All qPCR reactions were performed in biological triplicates and technical duplicate using the
PerfeCTa qPCR Fastmix (Quanta) on an ABI StepOnePlus cycler. Reactions were cycled at 95°C (10 s) and the primer annealing temperature (30 s) for 40 cycles. Calculations were performed using the ΔΔCt method using β-actin as a reference control. Primer sequences are listed in Appendix A, Table 15.
2.3.3 Western Blots
Transduced cell pellets were sonicated for 5 x 30 s pulses in 100 μL of RIPA buffer supplemented with protease inhibitors. The protein concentrations were quantified using a Bicinchoninic acid (BCA) assay (Thermo). The lysate was then mixed
1:1 with loading buffer supplemented with 5% 2-mercaptoethanol and incubated at 76°C for 15 m. 10 μg of protein along with the Precision Plus Protein Dual Color Standard
(Biorad) was loaded into each lane of a Mini-Protean TGX 4-20% gel (Biorad) and run at
23
100 V for 1 hr at 4°C. The membrane was blocked with 5% skim milk for 30 m and washed 3 times in 0.1% Tween-20 in PBS. The membrane was incubated overnight in anti-HKDC1 antibody produced in rabbit (Sigma) diluted 1:500 in skim milk. The membrane was washed 3 more times and incubated in horseradish peroxidase (HRP) conjugated anti-rabbit antibody diluted 1:2500 in skim milk for 75 m at room temperature (Santa Cruz Biotechnology). The membrane was washed 3 times and incubated at room temperature in 10 μL SuperSignal West Pico Chemiluminescent
Substrate (Thermo) for 15 m. After exposure and imaging, the membrane was stripped using Restore Western Blot Stripping Buffer (Thermo) and blotted using 1:500 anti β- actin antibody produced in mouse (Santa Cruz Biotechnology) and 1:2500 HRP conjugated anti-goat antibody (Santa Cruz Biotechnology) diluted in skim milk.
2.3.4 Adenovirus Construction and Transduction
A 2,789 bp BamHI/NotI fragment from plasmid RC221178 (OriGene), containing the 2,750 bp HKDC1 open reading frame, was cloned into the BamHI/NotI sites of the adenoviral shuttle vector pShuttle-CMV (Agilent). HKDC1 adenoviral shuttles were linearized with PmeI and transformed into BJ5183-AD1 cells (Agilent). Recombinant clones were isolated, digested with PacI, and recombinant adenoviruses were generated by transfecting HEK293 cells (ClonTech) with the PacI digested recombinant plasmid
DNA and FuGene171. To generate the HK1 adenovirus, a 3,600 bp DNA fragment containing the rat HK1 ORF was cloned into the shuttle vector pAC.CMV.pLpA.
24
Recombinant HKI virus was then generated by co-transfecting HEK293 cells with HKI shuttle clone and plasmid pJM17172
After transfection, viral lysate was collected, further amplified in HEK293 cells plated in 5 p150 tissue culture plates. Prior to complete lysis, media was removed, infected cells harvested in 2 mL Freeze/thaw buffer (10 mM Tris/Hcl, pH 8.0, 1 mM
MgCl2), lysed by 2 freeze/thaw cycles, and the virus purified by ultracentrifugation on a
CsCl gradient. Purified virus was de-salted with a 7k MWCO column (Thermo
Scientific) equilibrated with freeze/thaw buffer, and glycerol was added to a final concentration of 10%. Viruses were titered by measuring OD260 (1 OD260 = 1.1 x 1012 virions mL-1) as well as by plaque assay in HEK293 cells.
To prepare cells for transduction, INS-1 cells were first seeded at a density of 7 x
105 per well into 12-well plates. INS-1 832/13 cells were kindly provided by Christopher
Newgard (DMPI, Duke University)173. After 24 hr, the cells were transduced with
HKDC1-, HK1-, or GFP-expressing adenovirus in triplicate. Cells were grown for another
24 hr and pelleted with centrifugation.
2.3.5 Protein Purification
Rosetta 2 (DE3) (EMD Millipore) cells were transformed with pReceiver-B01 plasmid containing either HKDC1 or HK1. A single colony was grown overnight in 100 mL TPM media (20 g L-1 Tryptone, 15 g L-1 Yeast extract, 8 g L-1 NaCl, 2 g L-1 Na2HPO4 1 g L-1 KH2PO4) augmented with 50 μg mL-1 ampicillin and 34 μg μL-1 chloramphenicol at
25
37°C. The pregrowth culture was added to 500 mL of the same media and grown to an
OD of ~0.6. Isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM, and the cells were grown for an additional 4 hr at room temperature.
Cultures were centrifuged at 10,000 x g for 30 m and resuspended in lysis buffer
(50 mM NaH2PO4, 300 mM NaCl, 0.25% Tween-20, 5% sucrose, 5% glycerol, 2 mM imidazole, and 10 mM 2-mercaptoethanol) supplemented with protease inhibitors (1 mM phenylmethanesulfonyl fluoride [PMSF], 2 μg mL-1 aprotinin, 0.5 μg mL-1 leupeptin,
0.7 μg mL-1 pepstatin A). Cells were sonicated for 5 m followed by DNase I treatment
(4 U mL-1) for 15 m on ice. The lysates were clarified by centrifugation at 10,000 x g for 30 m and the supernatant passed over a HisTALON column (Clontech). The column was washed with 25 mL of wash buffer (Lysis buffer pH 7.0, 25 mM imidazole). The protein was eluted from the column in 1 mL fractions using wash buffer with 500 mM imidazole. DTT was added to each fraction to a final concentration of 1 mM.
2.3.6 Cellular Hexokinase Assays To measure cellular hexokinase activity in knockdown and overexpression experiments, we used an absorbance-based hexokinase assay (Sciencell #8408). Cell pellets were sonicated in 200 μL of 1% Triton at 4°C for 5 x 30 s pulses at medium intensity using a Bioruptor (Diagenode). The lysate was centrifuged at 1000 x g for 5 m to remove remaining cell debris. The assay was performed by combining 80 μL of
26
reaction mix (42 μL assay buffer, 20 μL cofactor, 2 μL developer, 6 μL enzyme mix, and
10 μL NADP), 10 μL of cell lysate, and 10 μL of 0-500 mM glucose was in each well of clear 96-well microplates. The plates were incubated in the dark for 90 m at room temperature. Absorbance at 490 nm was quantified in technical duplicates using a
Victor3 1420 plate reader (PerkinElmer).
2.3.7 Purified HKDC1 Hexokinase Assays
To assay hexokinase activity of purified HKDC1, 2 μg of purified protein was diluted in 20 μL of HK dilution buffer containing 20 mM KH2PO4, 100 mM KCl, 1 mM
MgCl2, 1 mM EDTA, 1 mM dithiothreitol (DTT), 60 g L-1 glycerol, and 1 g L-1 bovine serum albumin. Samples were loaded onto a microplate and mixed with 100 μL of reaction buffer containing 50 mM HEPES pH 7.4, 100 mM KCl, 8 mM MgCl2, 5 mM ATP,
0.5 mM NADP, 1 U mL-1 G6PDH (from Leuconostoc mesenteroides), 1 mM DTT, 1 g L-1 bovine serum albumin, and 10 mM D-(+)-glucose. Reactions were incubated at 37°C for 1 hr and stopped with 174 μL buffer C (0.46 mM SDS pH 8.0, 300 mM NaH2PO4, pH 8.0).
Fluorescence of NADPH was measured at excitation wavelength of 340 nm and an emission wavelength of 450 nm. Specific activity was determined using an NADPH standard (Appendix A, Figure 27).
2.3.8 siRNA Knockdown
HepG2 cells were plated at 1 x 105 cells/well into 24-well plates. After 48 hr, cells were transfected with either siRNAs targeting HKDC1 (Ambion Silencer Select s37044,
27
s37046) or siRNA not known to target any genes (Silencer Select Negative Control No. 1 siRNA cat. 4390843) using 6 pM of siRNA and 1 μL of Lipofectamine RNAiMax transfection reagent (Life Technologies) per well. Each siRNA was transfected in biological triplicate. Cells were harvested 24 hr later for RT-qPCR and hexokinase assays as described above.
2.3.9 Genome Wide Association with Imputed Genotypes
Genotypes from the previously published GWA study that identified the HKDC1 locus164 were imputed separately in each of the four quality-control (QC) cleaned and filtered genotyping sets using IMPUTE2 v2.3.0 and the 1KGP reference panel (December
2013 release). A cosmopolitan reference panel of unrelated individuals of the
Africa (“AFR”), Americas (“AMR”), Asia (“ASN”), and Europe (“EUR”) populations was used. The strand-checking utility of SHAPEIT v2 was used to ensure consistent strand assignments between the reference data set and the QC cleaned and filtered data sets. Strand was corrected as indicated, and SNPs for which strand could not be resolved were removed. A conservative info threshold (synonymous to allelic r2) of 0.9 was used to remove questionable imputed SNPs.
The genotype call probabilities from the filtered IMPUTE2 output were used in a linear regression model between each of the phenotypes and the genotypes probabilities under an additive model adjusting for age, BMI, and the first two principal components of ancestry. The frequentist approach in SNPTEST v2.4.1 was used to estimate the beta
28
and standard errors for each regression model and assess the significance of the association between the SNP and the phenotype of interest.
2.3.10 Liver eQTL Analysis
Liver gene expression and genotype data were generated as follows80: Gene expression array probes were aligned to the human reference genome (hg19) and gene models (RefSeq). Probes lacking unique genomic or transcriptomic alignments were discarded. Furthermore, probes overlapping common polymorphisms (minor allele frequency > 5%, based on 1KGP pilot release data) were discarded. Gene expression array feature intensities were extracted from arrays, background subtracted and log2 transformed. Missing data was imputed by k nearest neighbors (R package impute, function impute.knn, k = 10). The distribution of expression measurements on each array was normalized to the average empirical distribution across all arrays (R package limma, function normalizeBetweenArrays, method quantile). For each probe and across arrays, the distribution of expression values was transformed to the quantiles of the standard normal distribution (R function qqnorm). This matrix of processed gene expression values was then subjected to PCA (R package pcaMethods, function pca). We controlled for the effect of these PCs by taking the residuals of linear models using the first 15 PCs as covariates. Values from replicate arrays were then averaged. Because this sample set included both European and African American individuals, residual expression values were then transformed to the quantiles of the standard normal
29
distribution, within each population, and then pooled. Given the mappings of probes to gene models, if there were multiple probes that mapped to the same gene, probes were clustered [R package mclust, function Mclust(y,G=1:min(4,probe_count))] and the mean per cluster per individual was estimated. These residuals were then transformed by gene to standard normal. These data were used as phenotypes for the eQTL scan.
Genotype data were processed and quality controlled as follows80. Genotyping was performed on the Illumina human 610 quad beadchip platform (GPL8887) at the
Northwestern University Center for Genetic Medicine Genomics Core Facility according to the manufacturer's instructions. One sample was removed because it had a no call rate >10%. The initial marker set comprised 620,901 markers. 8,300 markers were removed because they showed significant deviation from Hardy-Weinberg equilibrium
(HWE, Fischer's exact test, p < 0.001). 29,705 SNPs were removed from the analysis because they had a no call rate in more than >10% of the samples. Hence, our final marker set is comprised of 583,073 SNPs. Imputation was performed using impute2 and the full 1KGP reference panel, as per impute2 recommendations, in 5 Mb segments using the commands:
impute_v2.2.2_x86_64_dynamic/impute2 -prephase_g -Ne 20000
impute_v2.2.2_x86_64_dynamic/impute2 -Ne 20000
The cis-eQTL scan was conducted with Bayesian regression using all SNPs within 1 Mb of the gene using the command:
30
snptest_v2.5-beta4 -use_raw_phenotypes -bayesian 1 -method expected -pheno pheno1 -prior_qt_mean_b 0 -prior_qt_V_b 0.02 -prior_qt_a 3 -prior_qt_b 2
2.3.11 Multiple Sequence Alignment
Multiple sequence alignments and percent identity matrices were constructed using Clustal Omega using default settings http://www.ebi.ac.uk/Tools/msa/clustalo/)174.
Protein and DNA sequences were downloaded from UCSC genome browser175.
2.4 Results
2.4.1 Identification of regulatory variants in the HKDC1 locus
The strongest genetic association with 2 hr plasma glucose was located within the first intron of HKDC1 at rs4746822. That variant and variants in moderate LD with rs4746822 (r2 > 0.3) lie within a region of the genome exhibiting chromatin modifications consistent with active gene regulation across diverse tissues (Appendix A, Figures 14 and 15, Table 3). To investigate the potential for regulatory variation contributing to the association with gestational hyperglycemia, we focused on a ~30 kb region defined both by the observed pattern of LD in the region and by evidence of gene regulation. As shown in Appendix A, Figure 15, there is little evidence of regulatory activity immediately flanking the target region, increasing our confidence that any regulatory variants contributing to the genetic association will be evaluated. There were three genotyped variants and nine imputed variants in the target region that were associated
31
with 2 hr plasma glucose at genome-wide significance (p < 1 x 10-8). Together, those data led us to hypothesize that rs4746822 or variants in LD with rs4746822 influence maternal glucose metabolism by altering the activity of regulatory elements that control HKDC1 expression.
Figure 5: Coordinated allelic regulation of HKDC1. (A) Map of chromatin landscape and the HKDC1 genome wide association (GWA) locus target regions. Evidence of active regulatory elements – genomic regions with the covalent histone modifications H3K4me1 and H3K27ac as measured by ChIP-seq and open chromatin measured by DNase-seq – is shown across the genomic locus associated with gestational hyperglycemia. Green boxes indicate candidate the regulatory elements whose activity
32
was measured with luciferase reporter assays. Histone modification and open chromatin data were obtained from the ENCODE project. (B) For each regulatory element in a, the enhancer activity (y-axis) is plotted against DNase-seq signal averaged across the element (x-axis) in HepG2 cells (n= 8 to 19). Enhancer activity was determined by dividing the relative luciferase signal from the most active haplotype by that of a control vector with the same promoter but no enhancer. The red line indicates the Pearson correlation between DNase-seq signal and enhancer activity. Error bars show standard deviation (s.d.). (C) Coordinated regulatory variation in the HKDC1 locus. SNPs that are significantly associated with gestational hyperglycemia (“GWA SNPs”), HKDC1 mRNA expression (“HKDC1 eQTLs”), or regulatory activity in allele-specific luciferase reporter assays (“Reg. Vars”) are marked with an asterisk. (D) Example box plots showing allele specific regulatory activity for the four SNPs that were significantly associated with gestational hyperglycemia, HKDC1 expression, and luciferase reporter gene expression. In each example, they associated with increased 2 hr plasma glucose are shown in bold face. The bottom and top boxes are the first and third quartiles, and the band inside the box is the median. The ends of the whiskers represent the lowest and highest data points within 1.5 interquartile range of the lower and upper quartiles. Black squares represent outliers defined as 1.5 times the interquartile range above the upper quartile or below the lower quartile. The number of replicate measurements followed by each allele are as follows: 103 of rs10762264A, 79 of rs10762264G, 80 of rs4746822C, 115 of rs4746822T, 129 of rs2394529C, 47 of rs2394529G, 80 of rs9645501A, and 80 of rs9645501G37.
Within the target region, we identified 11 candidate regulatory elements based on increased chromatin accessibility across 16 tissues including the metabolically relevant liver stellate cells and pancreatic islet cells, (Figure 5A, Appendix A, Table
3)176; 177. The candidate regulatory regions account for 8.5 kb (28%) of the nucleotides in the 30 kb target region. Of the 425 variants in the target region identified by the 1KGP,
132 (30%) were in the candidate regulatory elements32. There were 203 total haplotypes of the individual regulatory elements, 60 of which were common in the 1KGP population (haplotype frequency > 1%). The 60 common haplotypes accounted for 98%
33
of all of the haplotypes for the regulatory elements sequenced by the 1KGP (Appendix
A, Table 4).
To determine if genetic variation in the identified regulatory elements influences endogenous HKDC1 expression, we compared the variants associated with gestational hyperglycemia to those associated with gene expression changes in an eQTL study performed in primary human livers80. To do so, we imputed the tag variants from both the GWA and eQTL studies to the variants identified in the 1KGP32. That analysis revealed four significant eQTLs for HKDC1 [log10(Bayes Factor) > 2.5] within DNase I
DHS that were also associated with maternal 2 hr glucose levels (Figure 5B, Appendix
A, Figure 15). We did not find evidence that the same variants also influence expression of nearby HK1 in the same study, and known HK1 eQTLs in other cell types do not overlap the variants associated with maternal glucose levels178. When we expanded our eQTL analysis to all genes within 500 kb of HKDC1, we did not find any evidence that variants associated with 2 hr maternal glucose levels were also eQTLs for those genes
(Appendix A, Figure 16). Together, these results suggest that genetic variants associated with gestational hyperglycemia near HKDC1 alter HKDC1 expression.
To identify causal variants that control HKDC1 expression, we used luciferase reporter assays to measure allele-specific regulatory activity of the candidate regulatory elements in the region in the HepG2 liver cell line. We identified 1KGP subjects that maximized the genetic diversity in the candidate regulatory elements, and used PCR to
34
clone the regulatory elements from those individuals upstream of a Simian Virus 40 promoter driving expression of a luciferase reporter gene. From the genomes of 19 individuals (Appendix A, Table 5), we cloned 60 different naturally occurring haplotypes representing 93% of the haplotypes of the 11 regulatory elements that were identified by the 1KGP. To disentangle the effects of individual variants on expression that do not segregate in the population and to increase our power to detect regulatory effects of variants that are rare in the population, we used site directed mutagenesis to generate reporter constructs for 45 additional haplotypes. By balancing the number of observations of each allele, we were able to alleviate some of the loss in power due to allele frequency differences (Appendix A, Table 6). In total, we assayed 105 haplotypes composed of 57 variants. Nine of the 11 regulatory elements had enhancer activity, with relative luciferase expression between 1.9 to 14-fold over control (Appendix A, Figure
17). Enhancer strength was positively and significantly correlated with average DHS peak intensity in HepG2 cells (Spearman ρ = 0.64, p < 0.05, Figure 5B), however, we did not find significant correlation between DHS peak width and enhancer strength
(Appendix A, Figure 18). We do not take these results as evidence that DHS peak intensity generally predicts enhancer strength, only that DHS sites are enriched for active regulatory elements.
To identify individual genetic variants in the regions that altered enhancer activity, we used a multiple linear regression model to estimate the effect of each variant
35
acting independently on reporter expression (Appendix A, Figure 19). That analysis revealed 14 variants distributed across six regulatory elements that significantly altered gene expression (Bonferroni-adjusted p < 0.01, Figure 5C, Table 1, and Appendix A,
Table 7).
Table 1: Association of functional genetic variants with regulatory activity (β- luciferase (β-luc), HKDC1 expression (β-eQTL) and gestational hyperglycaemia (β- GWA) 37.
Region SNPid Non Risk MAF β Luc 95% CI Luc β β log10(bf) p GWA R2 III rs10762264 RiskG A 0.48 -3.13 -4.64 to -1.62 -eQTL0.327 GWA6.946 3.4654eQTL 3.75E-12 0.906 III rs12241136 T A 0.10 -2.77 -3.72 to -1.81 0.057 3.639 -0.0459 2.739E-4 0.001
VI rs78983061 C A 0.06 2.21 0.72 to 3.70 0.061 0.496 0.01597 0.6198 0.064
VI rs7089277 G T 0.07 8.59 6.07 to 11.10 0.040 3.942 -0.0701 8.07E-05 0.150 VI rs4746822 C T 0.49 -6.7 -9.10 to -4.29 -0.322 7.242 3.3899 4.41E-13 1.000
VII rs4746824 C A 0.22 1.18 0.70 to 1.66 -0.195 2.792 1.0366 0.005238 0.180 VII rs75405157 T C 0.06 1.55 1.02 to 2.09 0.061 0.481 0.01399 0.6306 0.004
VII rs2394529 G C 0.5 -1.41 -2.11 to -0.69 -0.308 7.043 3.0703 1.88E-12 0.954 VIII rs9645501 G A 0.34 -2.08 -2.81 to -1.33 -0.287 4.449 2.6947 8.61E-06 0.559
VIII rs147449838 G A <.01 -1.23 -1.91 to -0.54 * * * * < 0.001
VIII rs200216341 G A <.01 -1.31 -2.00 to -0.63 * * * * < 0.001 IX rs1983128 G A <.01 -4.45 -5.94 to -2.96 -0.168 1.180 0.55676 0.2378 0.036 X rs5030945 T C 0.45 -28.14 -37.05 to -20.14 -0.011 2.359 -0.22229 0.01831 0.077
X rs874557 A G 0.45 -31.58 -44.26 to -18.83 -0.001 2.357 -0.22318 0.01843 0.077
Notes: * indicates parameters and p-values that were not estimated. All β’s are relative to the risk allele. Bolded values indicate β estimates that are significantly different from 0 for Luciferase reporter assays (t-test, Bonferroni adjusted p < 0.05, n > 12), eQTL ([log10(Bayes Factor) > 2.5], n = 532) and GWA (F-test, p < 1 x 10-8 , n = 4,437). R2 values are relative to rs4746822. In agreement with other studies, we found that the effect of a single variant on enhancer activity is generally < 2 fold179-181. We next determined if the estimated effects of individual variants within an element behaved cumulatively. For each of the six elements containing regulatory variants, we quantified the expected luciferase values for each haplotype by adding the coefficients based on each variant within the haplotype
36
and plotted those against the observed luciferase values. In all six elements, predicted luciferase values were positively and significantly correlated with observed luciferase values (Pearson r2 > 0.25, p < 0.0001, Appendix A, Figure 20). Although we observe cumulative effects, we cannot dismiss the possibility of more complex interactions.
The results from the allele-specific reporter assays were positively validated in the liver eQTL study. For 10 out of 12 variants present in the eQTL analysis, the effect observed in our allele-specific reporter assays was in the same direction as predicted by the eQTL association (p = 0.02, binomial test). Among the validated regulatory variants were four genome-wide significant eQTLs (Figure 5D, Table 1). The observed effects of those four variants in our reporter assays were not specific to HepG2 cells. Specifically, in seven of the eight cases in which one of the variants significantly altered regulatory element activity in a different cell type, the direction of the effect was consistent with that observed in HepG2 cells (Appendix A, Table 8). Together, these results indicate that rs10762264, rs4746822, rs2394529, and rs9645501 are regulatory variants in four separate enhancers that contribute to HKDC1 expression in human liver.
2.4.2 The identified regulatory variants have coordinated effects
In order for the regulatory variants identified to collectively contribute to maternal glycemia, we hypothesized that there would be coordination between allele- specific regulatory element activity and maternal 2 hr glucose levels. Supporting our hypothesis, all four variants that were significant eQTLs for HKDC1 in liver were
37
associated with maternal 2 hr glucose levels with three reaching genome wide significance in the imputed GWA data (Table 1). All four alleles that were associated with increased 2 hr glucose also had decreased luciferase expression in the reporter assays and decreased HKDC1 expression in the eQTL analysis (Figure 5D, Table 1). We expanded the analysis to include 12 genome-wide significant SNPs associated with 2 hr glucose and found that each of the 12 SNPs associated with increased glucose also associated with decreased HKDC1 expression (p = 0.0002, binomial test). We further expanded the analysis to include all 178 tested SNPs within the 30 kb locus and found the risk allele to decrease HKDC1 expression in 131 cases (p = 1.14 x 10-10). Together, those results support a model in which multiple genetically linked regulatory variants have a coordinated effect of reducing HKDC1 expression in women with higher gestational glucose levels. Exceptions to the coordination were limited to variants that were not significantly associated with 2 hr plasma glucose levels or HKDC1 expression and that were not in strong LD with the lead GWA variant. For rs7089277, the minor allele frequency is low (7%) and therefore the variant may have limited effects in the population, and there is only nominal association with 2 hr glucose (p = 8.02 x 10-5). The
2 SNPs in region X have large luciferase β’s, but were not significantly associated with 2 hr glucose (p = 0.0183 and 0.0184), were not in LD with rs4746822 (r2 = 0.077), and did not significantly associate with HKDC1 expression. Furthermore, reporter assays in three additional cell types found cell-dependent effects for the variants in region X (Appendix
38
A, Table 9). Together, these results indicate that there are strongly coordinated regulatory effects across the genomic region associated with 2 hr plasma glucose levels, and that exceptions to that coordination likely do not contribute to the expression of
HKDC1.
2.4.3 HKDC1 is a novel human hexokinase gene
Having demonstrated that alleles associated with higher maternal 2 hr glucose levels decrease HKDC1 expression, we next sought to understand whether HKDC1 has hexokinase activity that may explain its contribution to glucose homeostasis.
Phosphorylation of glucose by hexokinase is the first step in glucose metabolism.
Screens for hexokinase activity in rat cells have identified four distinct hexokinases using electrophoresis and chromatography. Those genes have been mapped, and are known as HK1, HK2, HK3, and glucokinase (GCK)182-184. Reduced hexokinase activity has previously been associated with metabolic phenotypes including diabetes185; 186.
To determine if HKDC1 contributes to cellular hexokinase activity, we first used siRNA-mediated knockdown to model the genetically reduced levels of HKDC1 expression present in women with higher 2 hr glucose concentrations, and measured the effect of that reduction on cellular hexokinase activity. Targeting HKDC1 with two different siRNAs individually and together in HepG2 cells, we reduced mRNA expression by 35–60%. Reduced HKDC1 expression resulted in a dose-dependent decrease in cellular hexokinase activity (Figure 6A). The siRNAs were specific and did
39
not alter expression of the HK1, HK2, or GCK (Figure 6B). HK3 expression was not detectable in HepG2 cells, as expected176. The magnitude of reduction in hexokinase activity indicates that about half of the hexokinase activity in HepG2 cells is due to
HKDC1. The result agrees with RNA-seq data showing that half of the hexokinase mRNA expression in HepG2 cells is HKDC1 (Appendix A, Table 10). Providing further evidence that HKDC1 contributes to cellular hexokinase activity, we also found that overexpression of HKDC1 mRNA by transient transfection of an HKDC1 expression plasmid increased cellular hexokinase activity (Figures 6C and 6D).
40
Figure 6: HKDC1 is a hexokinase. (A) Two different siRNAs were used to knockdown HKDC1 in HepG2 cells. Quantification of hexokinase (HK) activity from whole cell lysates shows a dose-dependent decrease in HK activity with reduced HKDC1 expression (n = 4). (B) siRNAs are specific to HKDC1 and do not impact the expression of the other human hexokinase genes that are expression in HepG2 cells (n = 4). (C,D) Transient overexpression of HKDC1 increases total hexokinase activity in HepG2 cells compared to controls which were transfected with a plasmid expression a truncated HKDC1 (n = 2). (E,F) Adenoviral-mediated overexpression of HKDC1 overexpression in INS-1 cells increased the amount of HKDC1 protein and cellular HK activity across a range of 0-50 mM glucose shown in f. The level of hexokinase activity was determined by dividing the optical density at 490 nm (OD490) at each glucose concentration by the OD490 at 50 mM glucose in all 3 transduction conditions, respectively (n = 3). (G) HKDC1 and HK1 protein was expressed in bacterial cells and isolated. Purity of the isolated protein was demonstrated with Coomassie-blue staining.
41
(H) Hexokinase assays performed on the purified protein demonstrate that both HKDC1 and HK1 have hexokinase activity. Specific activity was defined as micromoles of NADPH generated per hour per microgram of protein (n = 2). All error bars show s.d37.
To demonstrate that the activity of HKDC1 was not specific to HepG2 cells, we transduced the rat pancreatic cell line, INS-1, with an adenovirus that expressed
HKDC1 from a human cytomegalovirus promoter, and measured hexokinase activity in the cell lysates at glucose concentrations ranging from 0-50 mM172. The predominant hexokinase in INS-1 cells is GCK, and the cells have little or no detectable low Km hexokinase activity172. Cells transduced with the HKDC1 adenovirus had substantially increased HKDC1 protein (Figure 6E, Appendix A, Figure 21), and increased hexokinase activity across the concentration range (Figure 6F, Appendix A, Figure 22).
Moreover, the shift in the dose-response curve suggests that HKDC1 has a lower Km than GCK. Adenoviral-mediated HKDC1 overexpression did not alter the expression of
HK2, HK3, or GCK and decreased HK1, demonstrating that the virus specifically overexpressed HKDC1 (Appendix A, Figure 23). Transduction also did not result in decreased cell density (Appendix A, Figure 24). We repeated the experiment with independently purified virus and independently grown INS-1 cells, with similar results
(Appendix A, Figure 25). Together, these results demonstrate that HKDC1 contributes to cellular hexokinase activity either through direct hexokinase activity or through modulating the activity of the other hexokinases.
42
Based on the extent of nucleotide and amino acid similarity between HKDC1 and members of the hexokinase family (Appendix A, Table 11 and 12), we hypothesized that the effects of HKDC1 expression on cellular hexokinase activity are in part the result of the direct enzymatic activity of HKDC1. To test that hypothesis, we purified HKDC1 and compared its specific activity to that of purified HK1. Protein purity was confirmed via a Coomassie blue stain (Figure 6G, Appendix A, Figure 21). Results of the assays indicate that HKDC1 protein alone has hexokinase activity, with 20% of the specific activity of HK1 under the same conditions (Figure 6H). Because our results show
HKDC1 hexokinase activity in vitro and in vivo, we propose renaming the HKDC1 gene to HK5.
2.5 Discussion
We have shown that regulatory variation associated with gestational glucose metabolism alters expression of a novel human hexokinase. This result adds to the growing empirical evidence that regulatory variants contribute to a variety of common complex human phenotypes96; 187; 188. Moreover, our results provide empirical evidence that regulatory variants spanning multiple enhancers have a coordinated allelic effect on
HKDC1 expression. A recent analysis suggests that such coordinated effects may be a common mechanism by which regulatory variants influence gene expression187. Such coordinated disruption of regulatory haplotypes may also explain how modest effects of individual regulatory variants can together have a sufficiently strong effect so as to be
43
detectable in a genome-wide genetic analysis179. The burden of multiple genetic variants disrupting regulatory haplotypes may therefore help explain the overabundance of non- coding genetic variants in GWAS. Notably, however, independent effects were not observed in our analysis of the liver eQTL data. This negative result may be explained by differences in effect size, limited power between closely linked variants, and tissue- specific effects (Appendix A, Figure 26). Together, we take the results presented here to be consistent with a model of coordinated regulatory variation, and we emphasize the need for additional investigation. In part, challenges of strong association between variants and heterogeneous effect sizes may be overcome with high-throughput empirical investigation of allele-specific regulatory activity in large populations98; 179.
Importantly, the plasmid-based reporter assays used to detect regulatory variants here are likely biased towards detecting regulatory elements that act independent of genome context. Additional elements may be active when in the native genomic context, where interactions between from multiple clustered regulatory elements contribute to effects on nearby gene regulation. Similarly, determining the direct effects variants detected here on endogenous gene expression remains a challenge.
Addressing that possibility will require additional studies that include genomic context, potentially through direct modification of the genome via genome editing189; 190.
Studying regulatory effects in the locus associated with maternal glycemia also led us to the discovery of a novel human hexokinase that appears to have important
44
metabolic effects during pregnancy. Previous screens to identify vertebrate hexokinases have identified HK1, HK2, HK3, and GCK, but did not identify HKDC1191; 192. One possible reason why HKDC1 was missed previously is that a high degree of structural similarity between HKDC1 and HK1 may have obscured separation in chromatography and electrophoresis. We also found that purified HKDC1 has reduced hexokinase activity when compared to HK1 in our in vitro assays. One possibility is that additional co-factors could be required for full HKDC1 activity in vitro, but that those factors are lost during the purification process. Such diminished hexokinase activity may have prevented earlier detection of HKDC1 as a hexokinase by less sensitive methods.
The tissues that are most relevant for HKDC1’s role in meeting the metabolic demands of pregnancy are not yet known, nor is it known how HKDC1 is regulated in response to pregnancy hormones. We expect that future evaluation of these questions will provide new insights into the metabolic changes that occur during pregnancy. More broadly, the results from this study demonstrate the value of identifying and pursuing the targets of noncoding phenotype-associated genetic variants for revealing novel mechanisms of human disease84.
45
Chapter 3. Massively parallel quantification of the regulatory effects of non-coding genetic variation in a human cohort
This research chapter is based on a research article published by Christopher Vockley*,
Cong Guo*, and William Majoros* et al. in the journal Genome Research in 2015 (*co-first authors)
3.1 Overview
We report a novel high-throughput method to empirically quantify individual- specific regulatory element activity at the population scale. The approach combines targeted DNA capture with a high-throughput reporter gene expression assay. As demonstration, we measured the activity of more than 100 putative regulatory elements from 95 individuals in a single experiment. We found that, in agreement with previous reports, most genetic variants have weak effects on distal regulatory element activity.
Because haplotypes are typically maintained within but not between assayed regulatory elements, the approach can be used to identify causal regulatory haplotypes that likely contribute to human phenotypes. Finally, we demonstrate the utility of the method to functionally fine map causal regulatory variants in regions of high linkage disequilibrium identified by eQTL analyses.
46
3.2 Introduction
There are now several examples of noncoding genetic variants that alter the activity of regulatory elements and contribute substantially to complex traits and human diseases31; 33; 37; 72; 187; 193. Such examples are likely representative of a larger trend that genetic variations in regulatory elements are a major contributor to complex phenotypes and disease72; 194. Genetic effects on gene regulation are pervasive, as demonstrated by association studies revealing eQTL for the majority of human genes195-197. Recent studies have further demonstrated that genetic variants associated with DNase I hypersensitivity, a strong predictor of the presence of a regulatory element, explain a substantial proportion of eQTLs75, and that individuals who are heterozygous in those elements likely have heritable allele-specific open chromatin and transcription factor binding198-200. While there is now much evidence supporting the contributions of regulatory variation to human phenotypes, systematically identifying the specific variants and regulatory elements that contribute to phenotype remains a major challenge.
One of the major reasons that challenge remains is that patterns of recombination across the genome limit the resolution of genetic association studies and prevent the identification of specific causal variants. That limitation motivates the development of complementary empirical approaches to assay the consequences of non-coding genetic variation on regulatory element activity31; 35-37. In a reporter gene expression assay, for
47
example, a gene regulatory element is cloned into a plasmid where the element can control the expression of a fluorescent or chemiluminescent protein. The plasmid is then transfected or infected into cells, and the activity of the regulatory element is estimated by measuring the expression of the reporter gene. Several examples have now shown that reporter assays are a valuable tool to compare the function of genetically different versions of the same regulatory element and to identify non-coding variants that explain genetic associations with gene expression and phenotypes36; 37. Recent advances have dramatically increased the throughput of reporter assays by embedding molecular barcodes within the reporter gene that can later be observed with DNA sequencing97-100, and the regulatory activity of more than one million unique DNA fragments can now be assayed in a single experiment using such massively parallel reporter assays101.
Here, we have developed a novel high-throughput approach to efficiently measure the activity of regulatory elements captured from the genomes of a human study population. Previous approaches to identify genetic effects on regulatory element activity have used DNA synthesis and random mutagenesis to generate mutations in select regulatory elements97; 99; 100. By instead assaying putative regulatory elements captured from donor genomes, the strategy presented here allows for high-throughput empirical measurement of the effects of regulatory variants specific to the study population. Moreover, because haplotypes are maintained within each regulatory element, empirical measurement of the combined effects of all common, rare, and
48
personal variants within a regulatory element are possible. The result is individual- specific measurements of regulatory element activity across the study population.
Because candidate regulatory elements are assayed independently of each other, the approach is an effective strategy to identify causal mutations within large regions of statistical association between genotype and phenotype. Together, these results demonstrate that population-scale functional reporter assays are a valuable strategy for identifying specific causal genetic variants and haplotypes within genomic loci previously associated with phenotype.
3.3 Methods
3.3.1 TruSeq Custom Amplicon Sequencing
We defined a target region as the region containing all variants in LD (D’ > 0.05) with the lead SNP previously reported to be associated with fetal adiposity201. All annotated exons and all sites with evidence of putative enhancer activity as determined by the presence of DHS in two or more cell lines studied by the ENCODE Project
Consortium 202 were selected for capture. Captured sites included 10 bp of flanking DNA to ensure that the entire putative regulatory site was included in the study. Lists of annotated DHS from the ENCODE Project Consortium were downloaded as BED files from http://genome.ucsc.edu/ENCODE/downloads, and the union of overlapping DHS sites was obtained using the "merge" command in BEDTools 203. TruSeq custom amplicon probes targeting the regions as well as the exons of CCNL1, LINC00880,
49
LINC00881, and the five exons of VEPH1 residing within the LD block were designed using the Illumina Design Studio. The probes were designed to not overlap any known
SNPs and capture an additional 25 bp flanking each DHS site. The final design consisted of 174 amplicons with lengths ranging from 398 bp to 450 bp (mean length of 409 bp and a median length of 402 bp) capturing a total of ~60 kb of DNA. We designed the amplicons to be less than 450 bp to ensure that paired-end 250 bp sequencing would cover the entire length of the fragment. Library construction was conducted via the standard protocol provided by Illumina using 250 ng of genomic DNA per reaction. The libraries were pooled and sequenced using paired-end 250 bp reads on an Illumina
MiSeq instrument.
3.3.2 Variant Calling and Phasing
Sequencing reads were demultiplexed and aligned to the target regions using the standard Illumina Custom Amplicon Workflow protocol. Reads were first aligned to the downstream locus-specific and upstream locus-specific oligonucleotide primers used to amplify the targeted regions. Then, the alignment was performed using a banded Smith-
Waterman alignment. Variant calling was performed using tools from the Genome
Analysis Toolkit (GATK) version 3.2-2, according to GATK Best Practices recommendations204-206. Per September 2014 guidelines for small targeted experiments, this workflow included using HaplotypeCaller to call variants in target regions individually per subject, followed by joint genotyping using GenotypeGVCFs to
50
produce a multi-sample VCF. Default settings were used for both tools. After variant calling, the following annotations and thresholds were used to remove low confidence
SNPs, based on GATK recommendations for hard filtering: QD < 2.0; MQ < 40.0; FS >
60.0; MQRankSum < -12.5; ReadPosRankSum < -8.0; QUAL < 100.0. Similarly, the following filters were applied to remove low confidence indels: QD < 2.0; FS > 200.0;
ReadPosRankSum < -20.0; InbreedingCoeff < -0.8; QUAL < 100.0. After hard-filtering, haplotypes were estimated with SHAPEIT2 software 207-209 using the “Read Aware
Phasing” algorithm 210. Per SHAPEIT2 documentation, linkage disequilibrium patterns necessary for haplotype inference can be adequately captured using MCMC sampling in studies with at least 100 subjects, so reference panels were not incorporated and default algorithm parameters were used.
3.3.3 Reporter Input Library Construction
PCR amplicons from Illumina custom capture libraries from 95 individuals were pooled in equal volume. The resulting pools were then PCR amplified to add 15 bp of sequence matching the STARR-seq backbone using primers TS2SSF and TS2SSpatientR using Q5 polymerase with GC buffer (New England Biolabs) using the following cycling conditions: 98 °C for 15 s and cycles of (98 °C for 10 s, 63 °C for 30s and 72 °C for 3 min).
The resulting products were purified using Solid Phase Reverse Immobilization (SPRI) beads at a 1.8x SPRI:reaction ratio.
51
The STARR-seq screening vector was digested overnight with SalI and AgeI and linearized backbone was purified with the Wizard SV Gel and PCR Clean-Up kit
(Promega). 100 ng of backbone and 23 ng pooled insert were cloned in two 20 μl Gibson assembly reactions. The reactions were purified using SPRI beads and eluted in 5 μl ddH20 and then transformed into Stellar chemically competent cells per manufacturer protocol. Transformations were recovered for 1 h in SOC medium while shaking (225 rpm, 37 °C) and then grown for 14 h in 250 mL of Luria Broth while shaking (225 rpm,
37 °C). The resulting reporter input libraries were then purified using the Promega Pure
Yield Maxiprep kit.
To assess variant diversity in the population STARR-seq input libraries, the fragments inserted into each were sequenced on an Illumina MiSeq. 10 ng of each input library were PCR amplified using indexed custom sequencing primers and Q5 polymerase in GC buffer (New England Biolabs). The following thermal cycling protocol was used: 98 °C for 30 s, followed by 10 cycles of (98 °C for 10 s, 65 °C for 30 s, 72 °C for
2 min), with a final extension at 72 °C for 7 min. The reporter input pool PCR product was purified using SPRI beads (1.8x SPRI:DNA ratio) and sequenced on an Illumina
MiSeq Instrument using 250 bp paired-end reads. Primer sequences are available in
Appendix B, Table 18.
52
3.3.4 Reporter Output Library Construction
Population STARR-seq input libraries were combined in equimolar pools and transfected into T-150 flasks of HepG2 cells with Fugene (Promega) at a 5.5:1 ratio of
Fugene:DNA. Eight replicate transfections were performed. Forty-eight hours after transfection, RNA was harvested as follows.
Cells were rinsed with PBS pH 7.4 and incubated for 3 min at 37 °C with DNase I
(5 mg DNase I in 1 ml of buffer containing 10 mM Tris-HCl pH 7.5, 150 mM NaCl and 1 mM MgCl in DEPC treated water diluted to a total volume of 24 ml in PBS). Cells were rinsed again with PBS and then dissociated with Trypsin-EDTA 0.25% (Life
Technologies). Trypsin was neutralized with HepG2 tissue culture medium and cells were pelleted via centrifugation. Cell pellets were rinsed once with PBS and then lysed in 2 ml of RLT buffer (Qiagen) with 2-mercaptoethanol (Sigma).
Total RNA was prepared using Qiagen RNeasy Midi kit including the on-column
DNase I digestion step. Poly-A RNA was isolated from 70 μg of total RNA by double selecting with Dynabead Oligo-dT25 beads (Life Technologies). The RNA was then treated with turboDNAse (4 U) for 30 min at 37 °C (Life Technologies). DNase treated poly-A RNA was purified using the RNeasy Mini kit.
cDNA was synthesized using the STARR-seq gene-specific primer using
Superscript III (Life Technologies). Reaction volumes were scaled to 50 μl. Reactions were incubated for 2.5 h at 55 °C and inactivated by incubating at 70 °C for 15 min.
53
Following synthesis, cDNA was treated with RNaseA (Sigma) at 37 °C for 30 min. cDNA was purified with SPRI beads at a 1.5:1 bead:cDNA ratio (by volume).
The cDNA was then amplified using a two stage PCR with a protocol similar to the published STARR-seq protocol101. The cDNA sample from each replicate was used as input into first round reporter specific PCR reactions using primers “reporter specific primer1” and “reporter specific primer2”, and Q5 high-fidelity polymerase (New
England Biolabs) with GC buffer (denaturing at 98 °C for 45 s, amplification with 15 cycles of 98 °C for 15 s, 65 °C for 30 s, and 72 °C for 70 s; final extension at 72 °C for 7 min). Samples were then purified using SPRI beads at 1.5x ratio of bead:PCR product and eluted in 15 μl nuclease free water. The resulting products were used as template for a second round of PCR, which used a standard Illumina TruSeq indexing primer on the p5 end of the library and custom indexing primers (Appendix B, Table 18) to barcode the samples for multiplexing prior to sequencing (Illumina). Final sequencing libraries were purified with SPRI beads at a 1.5x SPRI:PCR reaction ratio.
3.3.5 Identifying Regulatory Variants in Population STARR-seq
Haplotype sequences were imputed using the phased VCF file by inserting phased variants into reference sequences from the hg19 genome assembly. Sequencing reads were aligned to these haplotypes using Bowtie2211 with strict match parameters
(mismatch, gap open, and gap extend penalties all set to 100) to ensure exact matching to individual haplotypes. Read counts at each SNP were tallied using SAMtools mpileup
54
212. Replicates were pooled to increase statistical power. SNPs having fewer than two reads of either input DNA or pooled RNA were discarded from further analysis. Fisher’s exact test was used to detect significant differences in minor allele frequency between input DNA and output RNA; a pseudocount of 1 was added to each table entry in
Fisher’s test. Two-tailed p-values were adjusted to control the false discovery rate (FDR) to less than 5% via procedure p.adjust() in the standard R package “stats”, which implements the Benjamini-Hochberg procedure213. Of 283 SNPs tested, 36 were found significant at an FDR-adjusted level of 0.05. SNP effect sizes for each allele were computed as the ratio of normalized read counts between variants:
(RNA0/DNA0)/(RNA1/DNA1) for DNA and pooled RNA read counts for alleles 0 and 1.
Haplotype effect sizes were computed as normalized ratios for each haplotype versus all pooled haplotypes at a locus:
(RNAhaplotype/DNAhaplotype)/(RNApooled/DNApooled)
Significance was assessed via Fisher's exact test as above.
3.3.6 Luciferase Validation Assays
Selected regions were amplified from the genomic DNA from individuals who were heterozygous for regulatory variants identified via the population STARR-seq assay. Primer sequences are available in Appendix B, Table 19. The amplified regions were then cloned into a modified pGL4.13 luciferase expression vector containing a
Supercore1 promoter as described101. The construct was then transformed into TOP-10
55
competent cells (Life Technologies) and plated onto LB agar plates with ampicillin and incubated overnight at 37°C. In order to capture both haplotypes from subjects who were heterozygous in those regions, multiple colonies were selected and grown individually in LB media overnight. Plasmids were extracted using the PureYield
Plasmid Miniprep System (Promega). Constructs were sequenced using Sanger sequencing and variants were confirmed in dbSNP31. HepG2 cells were plated into white flat-bottom 96-well plates at a density of 25,000 cells/well. After 48 hr, 100 ng of plasmid/well (1:10 Renilla:firefly luciferase ratio) was transfected with Fugene HD
(Promega) at a 5.5:1 Fugene:DNA ratio. 12 biological replicates for each construct were transfected. After 24 hr, firefly luciferase and Renilla luciferase signal were quantified using the Dual-glo Luciferase Assay (Promega) using a Victor3 1420 plate reader
(PerkinElmer). Normalized luciferase signal was calculated by dividing the firefly luciferase signal by the Renilla luciferase signal. Statistical significance between the normalized luciferase signals for each allele was determined using a Student’s t-test.
3.3.7 GEUVADIS eQTL Analysis
Expression-QTLs and gene expression measurements were obtained from the
GEUVADIS project89. The expression measurements used in this manuscript were from
462 measurements that passed GEUVADIS quality control, and that had been PEER- factor normalized214 and transformed to a standard normal distribution 89. Associations
56
between quantile-normalized gene expression levels and genotype were calculated in R via the lm() function.
3.3.8 Allele-specific H3K27ac Analysis
Allele-specific analysis of H3K27ac ChIP-seq reads was completed by using
Bowtie211 to read to both possible alleles of as well as flanking regions for rs73170828 and rs62274098. Reads were required to align with no mismatches (bowtie parameter “-v 0”), and any reads that aligned equally well to both possible alleles were discarded (bowtie parameter “-m 1”). The approach follows a previously published method that was shown to eliminate alignment biases towards the reference allele199. To test for allele- specific H3K27ac, the number of unique reads aligning to each allele was tabulated, and the statistical tests described were performed using R.
3.3.9 Data Visualization
Visualization for rs4266144 case study analysis was completed on the UCSC
Genome Browser using the GRCh37/h19 release of the human genome175.
3.3.10 Data Access
Raw and aligned sequencing data from the input and output STARR-seq libraries have been submitted to the NCBI Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) under the accession number GSE68331.
57
3.4 Results
3.4.1 Population-scale reporter assay approach
We designed an empirical strategy to measure the activity of specific candidate regulatory elements across a population of individuals (Figure 7A). The strategy is based on the STARR-seq assay101. Briefly, in STARR-seq, candidate regulatory elements are cloned into the 3’ UTR of a reporter gene. The resulting plasmid pool is then transfected into host cells where the cloned elements can regulate expression of the reporter gene in which they are embedded. High-throughput sequencing of the 3’ UTR of the expressed reporter gene mRNA can then be used to estimate the regulatory activity of each element.
To leverage the STARR-seq approach to measure the activity of candidate regulatory elements across a population of individuals, we first generate a targeted sequencing library of regulatory elements from donor genomes using multiplex PCR. In a subsequent PCR reaction, we then modify the resulting fragment libraries such that the sequence of the terminal 15 bp at each end of each fragment matches the ends of the cloning site in the STARR-seq backbone. We then clone the capture regulatory elements into the STARR-seq backbone using a homology-based cloning strategy, and expand the resulting input library in E. coli. To assay the activity of each captured fragment, we transfect the input library into a human liver carcinoma cell line, HepG2, and use 250 bp paired-end sequencing to observe the abundance of each allele of each element in the
58
input pool of transfected DNA and in the expressed reporter gene mRNA. Using an allele-specific analysis strategy, we then estimate the effect of each allele on regulatory element activity.
3.4.2 Targeted sequencing of candidate regulatory elements from a GWAS population
As demonstration of the above approach, we focused on candidate regulatory elements from a 250 kb region on 3q25 that we previously found to be associated with measures of adiposity at birth201. We selected the regions to assay based on evidence from the ENCODE Project Consortium that suggests potential regulatory activity202.
Specifically, we aggregated open chromatin data from 40 different cell types relevant to metabolism, which yielded an initial set of 128 open chromatin sites. We further prioritized those sites by selecting DHS that were present in at least two or more cell lines, resulting in a total 104 DHS (Figure 7B). We designed 174 PCR amplicons to amplify from the 104 candidate regulatory elements. The amplicons had an average length of 409 bp. We then used multiplex PCR to amplify those elements from 95 individuals at the extremes of adiposity in the genetic association cohort201.
To quantify the genetic variation in the captured elements, we sequenced the regions using paired end 250 bp sequencing. That read length was sufficient to observe the entire sequence of each amplicon. Sequencing was completed to a median depth of
1500x (Appendix B, Figure 28), resulting in the identification of 321 genetic variants in the captured elements. Twenty-three percent of the variants identified were specific to 59
the study population as determined by their absence from dbSNP and the 1000 Genomes
Project database170; 215. The ratio of transitions to transversions was similar between the captured variants and those found in the 1000 Genomes Project (Appendix B, Table 16), suggesting that the novel variants were unlikely due to systematic sequencing errors.
We identified a substantially greater fraction of rare and personal variants in our targeted sequencing, likely due to increased sequencing depth that supported more highly powered variant calling (Appendix B, Figure 29). The preponderance of study- specific variants emphasizes the importance of assaying regulatory elements captured from the genomes of the study population rather than from a separate cohort.
60
Figure 7: Identification of regulatory variants using population-scale STARR-seq assays. (A) Schematic of population STARR-seq assay design. (B) Candidate regulatory sites were sequenced in 95 members of the HAPO study patient cohort using Custom Amplicon sequencing. The targeted regions overlap open chromatin (DNase I HS) in multiple cell types as described in the methods. (C) Population STARR-seq is highly reproducible. Rep1-7 are biological replicates generated from independent transfections. The X- and Y- axes represent element activity (output RNA reads / input DNA reads). In each case, Spearman's ρ is greater than 0.90. (D) Plotted is a comparison of the allele
61
frequency of each SNP in the cohort DNA to the allele frequency of each SNP in the resulting reporter library. Allele frequencies of the cohort DNA used are shown on the X-axis; and the allele frequency in the resulting reporter library are on the Y-axis. The allele frequencies are highly correlated, as evaluated by a Pearson correlation (r2 = 0.94, p < 1 x 10-5). (E) Log2(effect sizes) for non-significant (pink) and significant (FDR < 0.05, blue) variants. The effect sizes are small and range between 0.25 - 3.96 fold-change. (F) Firefly luciferase assay validations for population STARR-seq. In all cases, the higher expressing allele in our high-throughput reporter assay, shown in green, also had higher luciferase expression216.
3.4.3 Quantifying the effects of non-coding variation in a GWAS population
To quantify the activity of the captured candidate regulatory elements, we cloned the captured amplicons into the 3’ UTR of the STARR-seq reporter gene 101 to generate an input plasmid library. The input library covered 99% of the targeted sequence and included both alleles of 88% of the variants observed in targeted sequencing of the region at a median coverage of ~2200x (Appendix B, Table 17, Figure
30). We then performed seven independent transfections of the input library into HepG2 cells, and used targeted high-throughput sequencing of the expressed reporter gene transcripts to measure the allele-specific regulatory activity for each amplicon. The sequencing generated a median coverage of the target amplicons of ~13,000x (Appendix
B, Figure 31), and assayed both alleles of 283 of the 321 SNPs detected in the input library. Of the assayed SNPs, 83 (29%) were rare, defined as a minor allele frequency <
1%. We observed a similar fraction of rare SNPs in the input library (32%), suggesting that there was minimal bias against rare variants in the assays.
62
There was strong correlation between the allele ratios in each pair of output libraries (Spearman’s ρ between 0.90 and 0.97; Figure 7C), demonstrating reproducibility of the assay. There was also strong correlation between the allele ratios in the input plasmid pool versus the allele ratios in each of the output libraries (Spearman's ρ between 0.80 and 0.88, Appendix B, Figure 32), demonstrating that variants had small effects on regulatory activity overall. Cloning the captured candidate regulatory elements into the STARR-seq backbone did not introduce biases in the allele frequency in the assay as demonstrated by a strong correlation between the allele ratios in the plasmid DNA library and the allele ratios in the sequencing of the initial multiplex PCR products (r2 = 0.94, two-sided p < 0.0001; Figure 7D). We therefore concluded that the resulting assay libraries were representative of the genetic diversity in the population.
When the allele frequencies in the input plasmid DNA library were compared to the allele frequencies in the variants called in the 95 individuals, we observed enrichment of rare minor alleles in the input plasmid DNA library (Appendix B, Figure 33). Because that bias was specific to the comparison with called variants and was not observed when comparing to the raw sequencing reads, the bias was likely due underestimation of rare allele frequencies by conservative calling of rare variants215.
To identify individual variants that have a statistically significant effect on regulatory activity after taking into account differences in read depth, we pooled reads from the replicate output libraries and compared relative variant abundance to the input
63
library using Fisher’s exact test. We identified 27 common and nine rare regulatory variants with a false discovery rate (FDR) < 5%. The identified variants had fold changes in regulatory activity ranging from 0.25 - 3.96, consistent with previous observations using saturation mutagenesis of enhancers (Figure 7E)179. To empirically validate that the results were not due to the candidate regulatory elements' location in the 3' UTR of the reporter gene, we used a standard luciferase reporter assay in which the candidate regulatory element is located upstream of the promoter. In all cases, the allele with greater regulatory activity in the STARR-seq assay also had increased luciferase expression (Figure 6F). That positive validation indicates that the observed effects were not specific to the location of the candidate regulatory element relative to the reporter gene.
3.4.4 Quantifying the effects of non-coding variation in a GWAS population
We next evaluated whether regulatory variants were enriched in the most active enhancers, or could instead be due to noise in low-activity or silent candidate regulatory elements. We defined an enhancer activity score as the proportion of the total reads contributed by a fragment in the targeted RNA-seq output library divided by the proportion of the total reads contributed by that fragment in the input DNA plasmid library. The fragments that contained regulatory variants had higher-ranking enhancer activity scores than those that lacked regulatory variants (Figure 8A; U-test, p < 10-4) consistent with regulatory variants being located in the most active candidate regulatory 64
elements. We also asked whether there was evidence that rare alleles were more likely to have a stronger effect on regulatory activity, and did not find a statistically significant association between effect size and allele frequency (Spearman ρ = -0.18, p = 0.28,
Appendix B, Figure 34).
3.4.5 Effects of haplotypes on regulatory element activity
For 98 of the amplicons, there was more than one polymorphic site (Figure 8B), allowing us to ask whether multiple variants act independently to alter regulatory element activity at the haplotype level. To investigate that possibility, we generated phased haplotype sequences based on the targeted sequencing data, and used sequence alignment to assign sequencing reads from the expressed reporter library to each haplotype. That analysis allowed us to estimate the relative expression of each of the
>450 distinct haplotypes assayed, and revealed 24 haplotypes across 16 amplicons that significantly altered regulatory element activity (adjusted p < 0.05, Fisher's exact test).
We then evaluated the extent to which the independent contributions of the estimated effects of each SNP in a haplotype predicted the observed activity of the entire haplotype (Appendix B, Figure 35). The correlation between the effects predicted by individual SNPs and the effects of the haplotype (r = 0.54, p = 0.007) supports an overall consistency between SNP effects and their combination into haplotype effects. However, there was substantial residual variation that may be due to either experimental noise or synergistic effects between variants within haplotypes.
65
3.4.6 Fine mapping genetic associations with phenotypes
One of the major goals of functionally evaluating regulatory variants is to determine genetic effects on regulatory element activity that may explain genetic associations with phenotypes. To demonstrate that our strategy can support such fine mapping, we investigated a set of SNPs associated with the expression of a long noncoding RNA LINC00881 in the region. Specifically, the GEUVADIS project 89 identified a cluster of nine eQTLs associated with the expression of LINC00881 in lymphoblastoid cell lines (LCLs, Appendix B, Figure 36). The variants associated with
LINC00881 span ~12 kb of the genome. The statistical significance of the association with
LINC00881 was similar across all nine variants, likely due to high linkage disequilibrium across the region (Figure 7C). Four of the nine eQTLs were also assayed in the 95 individuals with our population scale reporter assays. Only one variant, rs73170828, located 242 bp upstream of the annotated LINC00881 transcription start site, significantly altered reporter gene expression (Figure8, FDR = 0.02). In the eQTL analysis and in our population scale reporter assays, the reference allele of rs73170828 was associated with increased gene expression and increased regulatory activity, respectively. Together, these results suggest that the promoter-proximal variant rs73170828 is a causal variant that regulates the transcription of LINC00881 and explains the association of the other eQTLs in the region. As independent support of the regulatory function of rs73170828, we searched for evidence of allele-specific histone 3
66
lysine 27 acetylation (H3K27ac), a histone modification associated with active gene regulation217. In ChIP-seq experiments performed on LCLs derived from five individuals heterozygous for rs73170828218, there was substantially higher H3K27ac on the reference allele across the LCLs (p = 0.058, paired Wilcoxon test). Furthermore, there was an overall significant increase in the number of reads aligning to the reference allele when compared to a null model in which the same proportion of reads align to each allele
(binomial p = 0.004). Those results are concordant with increased regulatory activity of the reference allele in our reporter assays and increased LINC00881 expression. The second closest assayed variant, rs62274098, did not have significant allele-specific
H3K27ac (binomial p = 0.92), suggesting again that rs73170828 and not neighboring variants mechanistically contributes to the expression of LINC00881 (Figure 8E).
Together, these results show that our novel approach for quantifying the effects of non- coding variation on gene regulation within cohorts reveals likely mechanisms underlying genotype-phenotype associations.
67
Figure 8: Comprehensive measurement of haplotype-specific regulatory element activity provides mechanistic insights into gene regulation (A) Distribution of enhancer activity scores for fragments containing regulatory variants (red) and fragments containing non-regulatory variants (blue) (B) Histogram of number of SNPs per assayed element. (C) Manhattan plot of eQTLs for the long non-coding RNA LINC00881. Blue dots indicate -log10(p-value) of LINC00881 eQTL from the GEUVADIS database (left Y- axis); red bars indicate -log10(FDR) for variants that alter regulatory activity in the population STARR-seq assay (right Y-axis). Red dotted line indicates a FDR = 1.0. (D) Association between normalized expression of long noncoding gene LINC00881 in LCLs as measured by the GEUVADIS project (Y-axis) and the measured effect size in population STARR-seq assay (X-axis) for SNP rs73170828 (r2 = 0.07, p = 7.6 x 10-9). (E) Allele-specific H3K27ac analysis of variants rs62274098 and rs73170828, both eQTLs proximal to and 5' of LINC00881; read counts (Y-axis) differed substantially between alleles for rs73170828 (Wilcoxon p=0.058, binomial p=0.004) but not for rs62274098 (Wilcoxon p=0.9; binomial p=0.92)216.
3.5 Discussion
In this work, we developed a novel high-throughput empirical approach to measure the regulatory effects of noncoding human genetic variation directly from the
DNA of individuals from a population-based study cohort. The ability to assay directly 68
from cohort DNA samples is an important distinction from previous high-throughput reporter assays because it allows investigation of variants and haplotypes that are not present in existing databases of human genetic variation. As rare variants are typically not observed frequently enough to support a statistical association, rare-variant burden tests instead collapse or aggregate variants and correlate the overall burden of those variants with phenotypes219; 220. While burden testing within the coding regions of the genome can leverage predicted effects on the resulting protein166; 221, modeling regulatory element activity based on sequence alone remains a major challenge. Measuring regulatory activity directly from cohort DNA provides a possible empirical solution that allows the regulatory machinery of the cell to determine the cumulative effects of all regulatory variation in the element tested, and allows for inference about the activity of that regulatory element that would not be possible otherwise.
The possibility for empirically-based association between regulatory function and phenotype is especially needed in light of recent studies suggesting that coordination of regulatory effects between alleles may explain how weak effects of individual noncoding variants contribute to overall phenotypes31; 37; 187. As we have shown, assaying regulatory elements outside of the context of genetic linkage enables identification of individual regulatory elements that contribute to observed associations with gene expression. Importantly, however, genetic linkage is maintained within each individual regulatory element tested. That feature allows for measuring the effects of
69
regulatory element haplotypes on element activity without confounding effects of a nearby regulatory element. For those reasons, the approach described here has the ability to both resolve independent effects in multiple regulatory elements while also maintaining local epistatic interactions between variants within an individual element.
Measuring haplotype-scale effects in larger populations will also be important to establish the distribution of natural functional variation in regulatory elements, and may provide insights into the role of gene regulation in a wide variety of biological processes.
For example, one of the most significant regulatory variants in our study, the common
SNP rs4266144 (minor allele frequency = 0.40), had a 1.34-fold effect on the activity of the regulatory element in which it is located. The variant overlaps a binding site for the transcription factor TEAD4 in the HepG2 cell line that we used in this study202. The C allele more closely matches the TEAD4 consensus motif and also had increased regulatory activity (Fig. 7F, left-most plot; Figure. 9). The higher-activity C allele is also human-specific, while the ancestral G allele is conserved across non-human members of the Hominidae clade, and it is possible that recent evolution has altered the regulatory activity of that site by changing the TEAD4 recognition sequence222. Understanding if transcription factor binding site disruption is a common basis for regulatory variation will require expanding the catalog of known effects of genetic variation on regulatory activity across human populations. Doing so is readily possible because the approach
70
demonstrated here only requires genomic DNA as opposed to more difficult to obtain samples of live cells or tissues.
Figure 9: SNP rs4266144 resides within a TEAD4 ChIP-seq binding site as assayed in HepG2 cells. The C>G variant is located in a largely invariant region of the TEAD4 canonical consensus binding motif. The binding site is located within a region that is enriched for H3K27ac and p300 occupancy. Concordantly, ChromHMM segmentation analysis scores the locus as a putative weak enhancer223. Multispecies conservation analysis suggests that this motif resides within a region that is conserved between the great apes216.
For any complex disease, multiple types of cells are likely relevant to an observed phenotype. Additionally, the causal regulatory elements may only be active under certain environmental conditions, or an interaction with the environment may amplify the effect. Transient reporter assays have been shown to recapitulate cell type- 71
and environment- specific gene regulation106; 224; 225. Because the input plasmid libraries generated in this study are a renewable resource that can be readily expanded in E. coli, the same captured regulatory elements can be assayed in numerous cell models and environmental contexts. Doing so may have particular benefit for identifying the specific cells or environments that are more relevant to a given genetic association signal.
There are both advantages and disadvantages intrinsic to the architecture of the
STARR-seq assay platform. Among the advantages is the potential to characterize dual functioning enhancer-promoters 101. We detected regulatory variants within TSS- proximal regions of two of the three genes located within our test locus, suggesting that the elements that contain these variants serve as dual function enhancer-promoters. The approach is limited by the observation that enhancers often have promoter-specific activity in transient transfection assays, indicating that alternative promoters may be required in some cases226. Addressing those shortcomings will further increase the ability to assign regulatory causes to genetic associations.
Taken together, the approach demonstrated here enables measurement of the functional variation in regulatory activity across human populations, and provides a novel and general path forward to identify disease-related perturbations in regulatory mechanisms after the completion of a genome-wide association study.
72
Chapter 5: Regulatory variants associated with fetal adiposity regulate adipogenesis
5.1 Overview
Babies born with high or low body fat at birth are at risk for developing metabolic diseases such as T2D and obesity later in life. Although both the intrauterine environment and fetal genetics impact fetal development, little is known about the genetic mechanisms which influence fetal growth and fat accretion. Here, we use a high throughput reporter assay to measure the regulatory impacts of variants directly from a patient population. We report that haplotypes previously associated with fetal adiposity increase regulatory activity and increase the expression of VEPH1. Together, these results suggest a novel mechanism of fetal adiposity in which the effects of genetic variants in multiple regulatory elements control the expression of a gene involved in adipogenesis.
5.2 Introduction
Although maternal fuels have a strong impact on fetal growth, the genetics of the fetus also impact its birth traits. Twin, intergenerational, and family studies have estimated the heritability of birth weight to be as high as 70%139-147. Models which consider birth weight as dichotomous give similar estimates of heritability as those which consider it a continuous trait 143. This observation suggests that the contribution of
73
genes to variation in birth weight is similar at the extremes of birth weight and across the normal distribution. A child’s birth weight is a combination of both lean body mass and fat mass, but differences in fat mass account for roughly 50% of variance in birth weight227. Most adipose tissue in newborns is in the form of subcutaneous fat, which is most susceptible to change due to altered fetal growth228; 229. Humans are born with 10-
15% body fat, which is significantly higher than the 1-4% found in the offspring of other primates and mammals159. Body fat in human newborns is primarily white adipose tissue and likely serves as an energy source to support growth of the large human newborn brain during the early post-natal period159. Given this important role, it has been hypothesized that increased body fat at birth is an important evolutionary adaptation to support human brain growth and development159. However, as previously mentioned, variation in newborn fat mass also impacts birth weight and chronic disease risk.
To define genetic contributions to maternal glucose levels during pregnancy and measures of offspring size and adiposity at birth, we performed genome wide mapping using DNA from 4,167 Thai (Bangkok), Afro-Caribbean (Barbados), Northern European ancestry (Belfast, Toronto, Brisbane, and Newcastle), and Mexican-American
(Bellflower, CA) mothers and their respective newborns collected during the HAPO
Study. In babies, rs17451107 at at chr3q25.31, located directly upstream of two lncRNAs
(LINC00880 and LINC00881) showed strong association (p = 4.29e-16) with newborn
74
sum of skinfolds and percent fat mass (p = 5.28e-08)151. However, neither the associated
SNP nor SNPs in LD were located in coding regions of the genome. We hypothesize that the causal SNP(s) could disrupt the activity of regulatory elements, resulting in in altered downstream gene expression.
5.3 Methods
5.3.1 Custom Amplicon Design and Capture
Custom amplicon design and capture were performed as described in Vockley,
Guo, & Majoros et al. 2015216 with the following difference: The number of individuals was increased from 95 to 760.
5.3.2 Variant Calling and Phasing
Variant calling and phasing was performed as described in Vockley, Guo, &
Majoros et al 2015216 with the following difference: The number of individuals was increased from 95 to 760.
5.3.3 Adipocyte RNA-seq Time course
Primary white pre-adipocytes (PromoCell) were seeded at 100,000 cells/well into
6-well plates and allowed to grow to 100 percent confluence (Day 0). The media was changed to Adipocyte Differentiation Media (PromoCell). After 72 hr, the media was changed to Adipocyte Nutrition Medium (PromoCell). RNA was isolated via RNeasy
RNA prep kit (Qiagen) in quadruplicate. The chosen time points were Day 0, 1, 6, 9, 12,
15, and 21. For each time point, oil red o staining was conducted in triplicate as directed 75
by Lonza
(http://bio.lonza.com/uploads/tx_mwaxmarketingmaterial/Lonza_ManualsProductInstr uctions_Oil_Red_O_Stain_for_In_Vitro_Adipogenesis.pdf) and quantified on the
Glomax Discover System (Promega) at 492 nm. RNA-seq libraries were constructed using the TruSeq Stranded mRNA Library Prep Kit (Illumina) per manufacturer’s protocol. Libraries were sequenced on an Illumina HiSeq using the 50 bp SR kit.
After stripping any overrepresented, contaminating sequences found using
FastQC, raw RNA-seq reads were mapped to hg19 using STAR aligner v.2.4.1a230. RNA- seq read counts were quantified in gene body exons in GENCODE v.19 annotation231 using featureCounts v.1.4.6-p4232 where both ends of each read pair were required to map to the same gene to be counted. We tested for differentially expressed genes (DEGs) using the negative binomial model implemented in edgeR233 after normalization by trimmed mean of M-values234 (TMM) and estimation of common, trended, and tagwise dispersion. We annotated genes with gene ontology (GO) terms235 using
BioMart236 and mapped GO terms to GO slim terms. We tested for functional enrichment of GO slim terms among the set of DEGs using the gene set analysis R package piano237 with Stouffer's method and 4,000 permutations to compute p-values
5.3.4 Statistical Methods for Association
Because study subjects were chosen only from newborns with extreme size measurements, sum of skin folds was not analyzed as a continuous variable and instead
76
was dichotomized into ‘high’ and ‘low’ categories based on the sampling approach.
Using dichotomous sum of skin folds as the outcome, genetic association analyses were performed for each ancestry cohort using logistic regression with SNPTEST (version
2.5), an additive genotype variable and covariates under three models164. Model 1 adjusted for field center, the first 2 principal components of ancestry, newborn sex, gestational age at delivery, parity, and maternal age at oral glucose tolerance test
(OGTT). Model 2 adjusted for Model 1 covariates plus maternal BMI, height, and mean arterial pressure at OGTT. Model 3 adjusted for Model 2 covariates plus maternal fasting glucose and fasting C-peptide at OGTT. Cohort specific associations of haplotype activity scores with high vs. low sum of skin folds were performed using logistic regression and the same three sets of model covariates using R statistical software
(version 3.2.2).
5.3.5 POP-STARR
Population STARR-seq libraries and haplotype effect size calculations were conducted as previously published by Vockley, Guo, & Majoros et al. 2015216 with the following differences: The custom amplicon libraries were combined into 8 pools (95 individuals per pool) in equimolar ratios. These pools were then amplified and cloned into the STARR-seq backbone. Each pool was transformed into Stellar chemically competent cells per manufacturer protocol. Transformations were recovered for 1 h in
SOC medium while shaking (225 rpm at 37 °C) and then incubated for 16 h in 250 mL of
77
LB while shaking (225 rpm at 37 °C). The resulting plasmid reporter input libraries were isolated using a MaxiPrep Kit (Promega). The 8 purified libraries were pooled in equimolar ratios to create a single plasmid input library. The libraries were electroporated (Biorad Gene Pulser Xcell) into primary white preadipocytes (PromoCell) using the following conditions: 4 million cells in 200uL of OptiMEM, 5 ug of DNA
Exponential protocol: 170 volts, 950 uF, 2 uM, inf capacitance. 10 electroporations were conducted and each electroporation was plated into a T-75 flask in pre-adipocyte growth medium (PromoCell). After 24 hr, the media was changed to adipocyte differentiation medium (PromoCell) in 5 of the plates, and pre-adipocyte growth medium in the other
5. Total RNA was harvested 48hr later using RNeasy RNA prep kit (Qiagen). Primer sequences for library construction are included in Appendix B, Table 18.
5.4 Results
To fine map putative regulatory elements, we designed Illumina Truseq Custom amplicon probes targeting all DHS within the 250 kb LD block associated with fetal adiposity. These probes were used to capture DHS from the DNA of 760 babies at the extreme tails of fetal adiposity (10th and 90th percentile) across four ancestries (Afro-
Caribbean, European, Thai, and Hispanic). In total, we captured 174 amplicons targeting
104 enhancers (Appendix D, Figure 47). We called a total of 216 common (MAF>0.01),
283 rare (MAF<0.01), and 444 private variants. We performed a logistic test for association with sum of skinfolds using the same models described in Urbanek et al.
78
2013201. In all three models, the associations replicated solely in the Thai population
(Figure 10A, Appendix C, Figures 37-39). To check if this was due to an issue with our sequencing or variant calling, we subsetted our previous genotyping data to the same
760 individuals and tested for association using the same models. Similarly, we only identified significant signal in the Thai population (Appendix C, Figures 40-42). Reasons for this observation could include, lack of power due to smaller sample sizes, larger effects in the Thai population, or regressing sum of skinfolds as a dichotomous rather than a continuous trait.
To assay the regulatory potential of variants at 3q25, we created a POP-STARR library using the captured DNA as described in Vockley, Guo, and Majoros et al216. The libraries were representative of the initial study population, capturing ~95% of haplotype diversity (Appendix C, Table 20). Because the locus had been associated with adiposity, we hypothesized that regulatory variants could be affecting processes in adipose tissue, primarily during adipogenesis. To investigate if gene expression changes occur at 3q25 during adipogenesis, we differentiated primary white preadipocytes into fully mature adipocytes over 21 days. RNA-seq was used to quantify changes in expression, and Oil Red O staining was used to quantify lipid content across seven time points. Lipid content within the cells increased ~40-fold over 21 days, signifying successful adipogenesis (Appendix C, Figure 43). We observed the largest number of gene expression changes within the first 48 hr of differentiation (Figure 10B), including
79
the up-regulation of canonical adipogenic genes such as CEBPA, FOXO1, LEP, and
ADIPOQ, and down-regulation of cell cycle genes such as CDK1, CDK2, and CENPE
(Appendix C, Figures 44 and 45). Genes CCNL1 and VEPH1 at the associated locus also exhibited altered expression (Appendix C, Figure 46), suggesting that they may be directly or indirectly involved in adipogenic pathways. In particular, VEPH1 is a strong candidate because it has recently been shown to inhibit TGF- β signaling, a potent inhibitor of adipocyte differentiation238; 239.
The reporter constructs were then electroporated into preadipocytes and differentiation was initiated in half of the plates after 24 hr. After 48 hr, the RNA was harvested and reporter specific libraries were constructed, sequenced, and analyzed as previously described216 (Figure 10C). A total of 817 SNPs and 1090 haplotypes were assayed in preadipocytes, and 797 SNPs and 1041 haplotypes in adipocytes. We identified 111 regulatory variants which were shared between pre-adipocytes and adipocytes (Figure 1D).
80
Figure 10: 3q25 fine mapping and POP-STARR in adipocytes. (A) SNP associations with sum of skinfolds in 760 individuals from the 10th and 90th percentiles of adiposity after fine-mapping in the Thai population. (B) expression time-course results for adipocyte differentiation over 21 days. (C) schematic of experimental design of POP- STARR in primary pre-adipocytes. (D) number of functional variants discovered.
Next, we tested if phenotype could be predicted directly by regulatory element activity. Amplicon activity scores for each individual were calculated by averaging the haplotype effect sizes for each pair of haplotypes present in an individual. We found the regulatory activity of three amplicons to be significantly associated with fetal adiposity in the Thai population (Figure 11A-B, Table 2).
81
Figure 11: The activity of regulatory elements is directly associated with sum of skinfolds. (A) association of amplicon acivity scores with sum of skinfolds in preadipocytes and adipocytes. (B) associated amplicons that contain functional GWAS SNPs.
These amplicons contained SNPs which also showed strong association in Thai cohort
(Table 2). Although SNPs rs17451107, rs10049088, and rs10049090 were also associated with the phenotype, the activity of the element that they resided in was not. Elements II and III were negatively associated with sum of skinfolds and the risk alleles decreased expression. Element I was positively associated with sum of skinfolds, and the risk alleles increased expression (Table 2). We observed weaker associations between amplicon activity and adiposity when the experiment was repeated in adipocytes
(Figure 11A). These results suggest that sum of skinfolds is more strongly associated with differentiation potential rather than fat accretion during maturation.
82
Table 2: Results for associated SNPs and regulatory elements.
Non- POP- POP- Element Effect Effect GWAS STARR Association STARR Element Number SNP id Allele Allele Beta Beta P-value P-value P-value I rs56406311 T C -0.95 0.96 1.54E-04 6.29E-01 3.11E-04 I rs9817452 T G -0.95 1.07 1.54E-04 3.78E-04 3.11E-04 I rs13322435 G A -0.85 0.82 4.92E-04 1.01E-38 3.11E-04 I rs9854955 G A -0.85 0.82 4.92E-04 3.08E-36 3.11E-04 NA rs17451107 C T -0.96 1.02 1.18E-04 9.00E-01 3.95E-01 NA rs10049088 T C -1.02 1.08 5.20E-05 2.41E-01 3.95E-01 NA rs10049090 A G -0.93 0.91 1.45E-04 2.29E-03 3.95E-01 II rs11712937 T C -0.89 1.41 5.27E-04 4.49E-113 7.26E-04 III rs7617389 C T -0.97 1.15 1.42E-04 9.06E-03 1.94E-04
Based on our findings, we hypothesize that risk alleles alter VEPH1 expression, a known inhibitor of the TGF- β and insulin/PI3K signaling pathways239; 240. TGF- β is a strong inhibitor of adipogensis in vitro and in vivo238; 241; 242. Melted, the Drosophila ortholog of VEPH1, mutants have 40% less body fat than wildtype240. Although this evidence supports our results and hypothesis, we stress the need for additional investigation regarding how these regulatory haplotypes may directly impact adipocyte differentiation.
83
Chapter 6: Transversions have larger regulatory effects than transitions
6.1 Overview
Transversions (Tv's) are more likely to alter the amino acid sequence of proteins than transitions (Ts's), and local deviations in the Ts:Tv ratio are indicative of evolutionary selection on genes. Whether the two different types of mutations have different effects in non-protein-coding sequences remains unknown. Here, we provide multiple lines of evidence demonstrating that Tv’s have larger impacts on regulatory
DNA including analyses of TF binding motifs, allele-specific TF binding, and genome- wide Tv density within accessible chromatin. Using massively parallel population-scale reporter assays, we also provide empirical evidence that Tv's have larger effects than
Ts's on the activity of human gene regulatory elements. Understanding the features of functional non-coding variation will be valuable for revealing the genetic underpinnings of complex traits and diseases.
6.2 Introduction
Genetic variation in noncoding regions of the genome contributes heavily to the heritability of many complex human traits and diseases194. Phenotype-associated variants are especially enriched in genomic regions that also have evidence of transcriptional regulatory activity83; 243. A likely scenario is that those genetic variants
84
alter the affinity of TFs to the genome, leading to changes in the activity of regulatory elements and the expression of target genes37; 96; 244. Predicting changes in regulatory element activity from DNA sequence alone remains a substantial challenge. There is therefore a need to identify additional indicators of which non-coding genetic variants have regulatory effects. It is well known that Ts’s are enriched over Tv’s in protein- coding regions of the human genome. That feature is a foundational principle for studies of the molecular basis for evolution245-247. In contrast, non-coding regions are not known to have a strong transitional bias. TF’s bind DNA based on both sequence and shape248.
We therefore hypothesized that, because Tv’s more dramatically alter local DNA structure, they would also be more likely to alter TF binding and subsequent regulatory activity.
6.3 Methods
6.3.1 Predicted Effects of Mutations on TF Binding
The set of all non-redundant TF binding position frequency matrices (PFMs) were retrieved from the JASPAR database249. For each PFM, a pseudocount of 0.1 was added to every element, and the PFM was converted to a position specific scoring matrix
(PSSM). The most likely (i.e. consensus) binding sequence was determined for each
PSSM. We defined the PSSM score for a given DNA sequence as the sum of the corresponding positions in the PSSM. Then, for each position in each consensus
85
sequence, we calculated the PSSM score of having every possible nucleotide at that position and, subsequently, the change in PSSM score when mutating any nucleotide to any other nucleotide at that position. The final values along with covariates such as the
JASPAR motif ID and the position in the motif data were output as a table that was used for statistical analysis. PSSM generation and mutation scoring was performed using
BioPython libraries, and statistical analysis was performed in R.
6.3.2 Effects of Ts’s and Tv’s in Patwardhan et al. Dataset
Data from saturation mutagenesis of three regulatory elements were collected 179 and reformatted to give the effect of every possible mutation at every position assayed.
Effects from replicate experiments were averaged. A series of linear regression models was then used to evaluate the effect of Ts’s and Tv’s on regulatory element activity while accounting for differences in regulatory element activity between elements and location of the mutation within each element. The specific models used along with coefficients and test statistics are provided in Supplementary Table 1. All analysis was performed using R.
6.3.3 Allele Specific Binding Analysis
We analyzed two publicly available allele-specific binding datasets, one based on the binding of multiple TFs (cFos, cMyc, CTCF, JunD, Max, Pol_II, and Pol_III) to the diploid personal genome sequence of NA12878250, the other based on the binding of
CTCF to SNPs discovered through ChIP-seq in 6 different LCLs251. We computed the Tv
86
frequency in allele-specific variants and in all variants tested and compared the two frequencies by transforming the assumed binomial distribution to a standard normal and performing a two-tailed Z-test. Because the number of allele-specific binding variants was small, especially in the case of Ni et al. 2012251, we pooled allele-specific variants across TFs or across cell lines, making sure to collapse redundant variants. Only summary statistics of numbers of SNPs tested and Ts/Tv ratios were reported by Ni et al. 2012251 for all SNPs tested for each cell line, which we used to compute the mean Tv frequency across cell lines. We were ignorant of the overlap of all tested SNPs across cell lines and for simplicity used the mean number of SNPs tested as the null model sample size for that dataset.
6.3.4 Genome-wide Depletion of Tv’s in DHS’s
All sites with evidence of putative enhancer activity as determined by the union of DHS’s of all cell lines studied by the ENCODE Project Consortium243. BED files containing DHS coordinates were downloaded from the ENCODE Project. We removed any DHS which overlapped with protein coding exons. Coordinates for all protein- coding exons were downloaded from the UCSC Genome Browser175. VCF files for 2500 individuals for each chromosome were obtained from the 1000 Genomes Database32.
BED file manipulations were performed using the BEDtools203 and VCFtools252 were used to calculate Ts:Tv ratios. For the Ts:Tv-gene proximity analysis, we defined Tv density per element as . We defined
87
Ts density in a similar manner: .
Elements which contained 0 SNPs were excluded from the analysis. Tv/Ts dense and
Tv/Ts sparse elements were defined as elements with the top and bottom 10% of Ts/Tv density respectively. The center of DHS’s were defined as the middle 1/3rd of the peak.
Statistical analysis and plots were generated in R.
6.3.5 Custom Amplicon Design and Capture
Custom amplicon design and capture were performed as described in Vockley,
Guo, & Majoros et al. 2015216 with the following difference: The number of individuals was increased from 95 to 760.
6.3.6 Variant Calling and Phasing
Variant calling and phasing was performed as described in Vockley, Guo, &
Majoros et al. 2015216 with the following difference: The number of individuals was increased from 95 to 760.
6.3.7 POP-STARR-seq
Population STARR-seq libraries and haplotype effect size calculations were conducted as previously published by Vockley, Guo, & Majoros et al. 2015216 with the following differences: The custom amplicon libraries were combined into 8 pools (95 individuals per pool) in equimolar ratios. These pools were then amplified and cloned into the STARR-seq backbone. Each pool was transformed into Stellar chemically
88
competent cells per manufacturer protocol. Transformations were recovered for 1 h in
SOC medium while shaking (225 rpm at 37 °C) and then incubated for 16 h in 250 mL of
LB while shaking (225 rpm at 37 °C). The resulting plasmid reporter input libraries were isolated using a MaxiPrep Kit (Promega). The 8 purified libraries were then pooled in equimolar ratios to create a single plasmid input library. This library was then transfected into T-175 flasks containing HepG2 cells at ~70% confluency with Fugene
HD (Promega) at a 5.5:1 ratio of Fugene:DNA. In total, 3 replicate transfections were performed. RNA was harvested after ~48 hrs. Primer sequences for library construction are included in Appendix D, Table 22.
6.3.8 Comparing effects of Ts’s and Tv’s on Regulatory Element Activity
To determine the number of Ts’s and Tv’s between haplotypes, we grouped haplotypes by amplicon. This ensured that each haplotype was compared to only those with the exact same length and start/stop coordinates. For each amplicon, we designated one haplotype at random as the “reference haplotype”. For each group of haplotypes, we counted the number of Ts’s and Tv’s that differed between each haplotype within the group and the reference haplotype. The change in effect magnitudes between the haplotypes in each amplicon group were calculated as follows:
| | ||
Amplicon groups which did not contain at least one haplotype with an effect size p-value < 0.05 were excluded from the analysis. Linear regressions were performed 89
using the lm() function in R. When performing regressions we included amplicon number as a variable.
6.3.9 Web Resources
ENCODE Project, https://genome.ucsc.edu/ENCODE/
1000 Genomes Database, http://browser.1000genomes.org/index.html
Gene Expression Omnibus (GEO), http://www.ncbi.nlm.nih.gov/geo/
UCSC Genome Browser, http://genome.ucsc.edu
JASPAR, http://jaspar.genereg.net/
Analysis for JASPAR dataset, https://github.com/ReddyLab/TransversionsInRegElements
Analysis of Patwardhan et al, https://github.com/ReddyLab/TransversionsInRegElements
VCFtools, https://vcftools.github.io/man_latest.html
BEDtools, http://bedtools.readthedocs.org/en/latest/
GEO Accession code: GSE77743
6.4 Results
We first evaluated whether Tv’s are expected to have greater effects on TF binding than Ts’s. To do so, we calculated the change in the PWM score of every possible single nucleotide mutation in every TF binding motif in the JASPAR database249. The center of the TF binding motif is typically more specific than either edge
90
of the motif and, similarly, mutations near the center of the motif typically had greater impacts on the PWM score. Across all motifs, Tv’s had a significantly greater effect on
TF binding score both in the center of the motif and in the flanking regions (Figure 12A).
The effect was most pronounced at motif positions with moderate information content, suggesting that degeneracy in TF binding motifs more often accommodate Ts’s than Tv’s
(Figure 12B).
We next investigated whether the effects predicted by motif analysis also occurs in cells. We analyzed publicly available allele-specific ChIP-seq data for seven TFs in the fully-sequenced diploid lymphoblastoid cell line (LCL) GM12878250, and for CTCF across six LCLs251. In both studies, SNPs with evidence of allele-specific TF binding were subtly but significantly enriched for Tv’s when compared to the set of SNPs tested (35.3% vs
32.2% for TFs in GM12878 cells, 35% vs 33% for CTCF in LCLs; Z test p = 5.1 x- 10-4, 2.7 x
10-3, respectively, Figure 12C).
As an alternative approach to evaluate whether Tv’s have greater regulatory effects than
Ts’s, we investigated whether there is evidence for depletion of Tv’s within regulatory elements. We defined putative regulatory elements as non-exonic open chromatin regions marked by DHS’s from the ENCODE project65; 243. We then calculated the Ts:Tv ratio for each DHS, the flanking 150 bp, and the rest of the non-coding genome. The
Ts:Tv ratio within DHS’s, 2.26, was larger than that in flanking regions and non-coding genome (2.18 and 2.00, respectively; Figure 12D). DHSs in the top 10% of Tv density
91
were also a median of 6 kb farther from genes than DHS’s in the bottom 10% (t test, p =
5.9 x 10-12; Figure 1D).
Figure 12: Tv’s are depleted at TF binding sites. (A,B) Changes to PWM scores for JASPAR TFs caused by Ts’s and Tv’s. Black squares are changes >1.5x above the interquartile range. P-values for parameter estimates were calculated using a t test. (C) The percentage of Tv’s in allele-specific CTCF across six LCL lines (left), and for allele- specific binding across seven TFs (right). Error bars show the s.e.m. (D) Genome-wide Ts:Tv ratios within non-exonic DHS’s, flanking regions, and remaining non-coding genome. (E,F) Distribution of proximities between (E) nearest gene and Tv rich and sparse elements, and (F) Ts rich and Ts sparse elements.
92
In contrast, Ts dense sites were only a median distance of 400 bp farther than Ts sparse sites (t test, p = 0.002; Figure 12E). These results suggest that Tv’s have larger effects on TF binding, resulting in their depletion within regulatory elements, especially close to gene transcription start sites.
Next, we tested to see if there was a measurable difference between Ts’s and Tv’s on regulatory element activity. We focused our analysis on variants within 104 DHS’s at
3q25, a locus we previously identified to be associated with fetal adiposity201 (Appendix
D, Figure 47). We observed an even greater Ts:Tv ratio within the center of one-third of
DHS’s at this locus compared to the remaining DHS and flanking regions (Figure 13A).
To measure the regulatory activity of diverse haplotypes of the 104 DHSs, we used a population-scale STARR-seq (POP-STARR) reporter assay216. Briefly, we first captured the 104 DHSs from the genomes of 760 donors via multiplex PCR and called variants via
GATK Best Practices recommendations204-206 . The libraries of captured elements were then pooled, cloned into the STARR-seq backbone101, and transfected into the liver carcinoma cell line HepG2. After two days, RNA was isolated and the abundance of the expressed reporter genes was quantified using high-throughput sequencing. Haplotype- specific regulatory activity was measured by comparing the relative abundance of each haplotype in the expressed reporter genes to that in the input plasmid library.
Significance was assessed using Fisher’s exact test (Figure 13B). In total, we assayed 1153
93
unique haplotypes comprised of 942 variants. Of those variants, 634 were Ts’s and 308 were Tv’s.
To test if Tv’s more dramatically alter the activity of regulatory elements, we first classified haplotypes by whether they contained a Tv or a Ts relative to a reference haplotype. We then used a multiple linear regression model to test if the presence or absence of a Tv or Ts correlated with changes in regulatory activity between haplotypes.
The presence of a Tv was correlated with greater changes in regulatory activity (t test, β
= 0.09 ± 0.033 s.e.m., p = 0.006), while the presence a Ts was not (t test, β = 0.007 ± 0.036 s.e.m., p = 0.86) (Figure 13C). Next, we expanded the model to account for the total number of Ts’s and Tv’s between haplotypes. The total number of Tv’s was significantly correlated with the magnitude of changes in regulatory activity (t test, p = 0.001) whereas the total number of Ts’s was not (t test, p = 0.054). Furthermore, the effect of additional Tv’s on the magnitude of changes in regulatory element activity was double that of additional Ts’s (β = 0.12 ± 0.035 s.e.m vs 0.06 ± 0.03 s.e.m.) (Figure 13D). When the same analysis was limited to haplotypes that overlapped the middle third of DHS’s, the effect of Tv’s was substantially larger (β = 0.07 ± 0.031 s.e.m.), the effect of Ts’s was unchanged (β = 0.015 ± 0.025 s.e.m.), and the ratio of the effect sizes increased to 4.6-fold
(Figure 13E). We performed a similar analysis on a study that used saturation mutagenesis to evaluate the effect of every possible mutation on the activity of three enhancers, with much the same result (Appendix D, Table 21)179. Together, these results
94
provide empirical evidence that Tv’s have larger impacts on regulatory element activity
than Ts’s.
line. P number of Ts/Tv differences between haplotypes which overlap DHS centers. The red line is the r values were calculated a using t test. Correlation(E) between change in haplotype effect magnitude the and magnitude and the number of Ts/Tv differences betwee above the upper quartile or the below lower quartile. (D) Correlation between change in haplotype effect to the pr regions. schematic(B) of POP
-
values were calculated using a t test.
Figure
esence of a Ts or Tv within a haplotype. Black squares are effects of1.5x the interquartile range
13
: Tv’
s have gre
-
STARR experimental design. (C) Changes in haplotype effect magnitudes due
ater ater regulatory effects than Ts’
n n haplotypes. The red line is the regression line. P
s.
(A) Ts/Tv within DHS and 150 bp flanking
egression
-
95
6.5 Discussion
Understanding the features that predict which non-coding variants alter regulatory activity will be valuable for revealing the underlying genetic mechanisms governing complex traits and diseases. As a step towards that goal, we have shown that there are functional differences in the effects of Ts’s and Tv’s in non-coding DNA. Our results show that Tv’s are more likely to disrupt TF binding and have larger effects on regulatory element activity than Ts’s. Evolutionary pressure to maintain regulatory element activity may therefore explain our observations that Tv’s are depleted in the center of DHS’s, particularly near genes. Several possible mechanisms may explain the stronger effects of Tv’s. TFs may recognize the purine or pyrimidine structure rather than the specific nucleotide. Alternatively, Tv’s may disproportionately alter the DNA backbone, impacting the binding of TFs that recognize backbone shape. Understanding those principles of TF recognition may further inform whether specific classes of TFs are particularly impacted by Tv’s.
96
Chapter 7: Conclusions and Future Outlook
Although thousands of genetic associations have been identified for hundreds of traits and diseases, only a handful have been directly linked to disease mechanisms. In this work, we followed-up previously conducted GWAS and identified potential mechanisms for maternal hyperglycemia and fetal adiposity. We also developed a novel population scale reporter assay to measure the effects of non-coding genetic variation directly from patient genomes. The assay allowed us to discover a property of the genetic variants that have the greatest effects on regulatory element activity, namely that
Tv’s have larger regulatory effects than Ts’s. Collectively, our findings highlight the importance of GWAS follow-up and the power of POP-STARR.
One of the major findings published in Guo et al. 2015 is the characterization of the 5th human hexokinase, HKDC137. We propose that individuals with risk alleles have decreased enhancer activity near HKDC1, resulting in decreased HKDC1 expression leading to compromised glucose metabolism in the liver. Our proposed model is consistent with previous studies evidencing that mutations in HKs can result in metabolic disorders253-255. Currently, we can only speculate as to why HKDC1 is particularly important for glucose homeostasis during the gravid state. Potential reasons include maternal hormonal changes, altered metabolic load, and signaling between fetus and mother; and further investigation is needed.
97
The discovery of HKDC1 has potential implications beyond gestational hyperglycemia as well. In many types of cancers, HKs are drastically upregulated to keep-up with the increased metabolic requirements of cancer cells256. HKs have also been observed to bind the mitochondrial membrane in times of stress, thereby preventing apoptotic signaling molecules to reach the nucleus257; 258. Interference with apoptotic pathways can greatly increase the resilience of cancer cells against drugs. For these reasons, HKs themselves have been viewed as a potential therapeutic targets. A previous analysis of gene expression profiles in cancers revealed that out of the top 20 cancer genes, HKDC1 was the only one which has never been targeted in a drug trial259.
Since HKDC1 is the primary HK that is overexpressed in lung, breast, and liver cancers, it could potentially be a promising target. Moreover, HKDC1 expression is low to undetectable in most tissues, and since it has only been associated with maternal glycaemia, its importance may be limited to a handful of cell-types under specific conditions.
We will continue to build on our initial findings from the Guo et al. paper using
CRISPR/Cas9 technology. Although CRISPR/Cas9 is best known for its uses in genome editing, it can also be modified to activate or silence enhancers through epigenetic modifications260; 261. Inactivated dead-Cas9 (dCas9) is fused to either an activator (P300) or a repressor (KRAB) and transfected into the cell in place of unmodified Cas9. The fusion protein binds to DNA without cutting while the active domain recruits epigenetic
98
modifying factors. As a next step, I plan to fine-map each enhancer by introducing various combinations of guides targeting each element. I also plan to activate/deactivate pairs of enhancers to identify combinatoric effects between regulatory elements. Future studies for this locus also involve utilizing CRISPR/Cas9 to introduce regulatory variants into the locus.
The related phenotype, fetal adiposity, also demands additional experimentation to develop a clearer picture of the underlying mechanisms. We currently hypothesize that regulatory variants within risk haplotypes elevate expression of VEPH1, resulting in increased adipocyte differentiation. To validate this model, we will utilize chromatin conformation assays to demonstrate that the associated enhancers form loops with the
VEPH1 promoter. Once these interactions have been established, we will test if deleting or blocking elements using CRISPR/Cas9 alters the endogenous expression of VEPH1 in adipocytes. The results from these experiments may strengthen the hypothesis that the enhancers act specifically on VEPH1 and not nearby genes. Functional assays involving
VEPH1 knockdown/overexpression and their impacts on adipogenesis will also be required for model validation. We plan to over-express VEPH1 via lentivirus, and quantifying changes in differentiation efficiency and lipid accumulation rate during maturation. Since VEPH1 is also involved in insulin signaling, conducting a similar experiment while modulating insulin levels may also prove informative.
99
Although we have strong evidence suggesting that fetal adiposity is at least, in part, caused by genetic drivers at 3q25, we cannot discount maternal genetic or hormonal contributions. Since the uterine environment has a strong influence on fetal growth and development, we must also consider hormonal signaling between mother and baby. Placental hormones such as those in the prolactin family have been shown to drive fetal growth pathways during development262-265. Given that genetic variants can affect hormone response in vivo266, we cannot discount the same possibility occurring between maternal hormones and the fetal genome. Additional experiments measuring the regulatory properties of SNPs in the context of hormone response may implicate new pathways in fetal fat accretion.
With the development of POP-STARR, we are now able to assay hundreds of regulatory variants directly from the genomes of a patient population. We have successfully performed POP-STARR in 760 patients across 174 regulatory elements in multiple cell models. Expanding POP-STARR to multiple or even all GWAS loci is the next step. To assay SNPs in all GWAS loci, a dramatic scale-up of POP-STARR is required. Our previous POP-STARR experiments used material from TruSeq Custom
Amplicon libraries as candidate enhancers. Although this method is effective for targeted capture of small regions, it is impractical for ascertaining large genomic regions over a megabase. Alternative capture strategies such as Agilent SureSelect will be more effective for capturing multiple GWAS loci. One of the major strengths of POP-STARR is
100
that it can be easily adapted to nearly any capture platform. Therefore, we can readily integrate libraries from previous re-sequencing studies into POP-STARR and assay for functional variation.
Generating POP-STARR libraries from pooled DNA samples raises another issue: rare and private variants become diluted after pooling, comprising only a small proportion of the final library. Low frequency alleles which disrupt enhancer activity are even further depleted in the RNA isolated from cells post-transfection. Moreover, PCR biases introduced during amplification may alter the ratios of rare variants, resulting in skewed downstream effect size calculations. Although sequencing deeper would improve rare variant detection, it would not alleviate biases introduced during library preparation. Sequencing deeper is also impractical for highly diverse libraries that we are currently generating. One solution we’ve used is to divide the patient DNA samples into smaller pools prior to library preparation. The decrease in the number of individuals per pool results in higher relative frequencies for rare and private variants.
For large numbers of samples, the amount of time spent on preparing libraries can quickly increase if split. Although there exists many challenges with assaying rare variants, many common phenotypes are presumably influenced by common genetic variation. It can be argued that common polymorphisms are more actionable regarding future screens and therapeutic studies, because they are present in a larger proportion of the population and are therefore easier to detect.
101
The challenges discussed highlight the importance of identifying key features of regulatory variation and utilizing those features to improve variant effect prediction.
Genomic features such as DHS, H3K4me1, and H3K27ac have already greatly informed enhancer prediction across the genome. Although these features help establish regions where regulatory variants may be enriched, they are not features of SNPs themselves.
Substitution mutations are divided into two categories: transitions and transversions.
Using our previously developed POP-STARR assay, we provided empirical evidence that Tv’s cause larger changes in regulatory activity than Ts’s. There are several potential mechanisms driving this observation. TFs may actually recognize weather the nucleotide is a pyrimidine or purine over exact base identity. Alternatively, Tv’s could cause larger changes in the shape of the DNA backbone, resulting in decreased affinity of structure dependent TFs. Several groups have shown that TF binding is based on both sequence and structure248; 267-271. The degree that a TF is affected by either of these properties is dependent on the family it resides in. For example, both sequence and structure independently affect Hox-DNA binding interactions, while E-box TF binding is more dependent on DNA shape248; 272. Grouping DHS based on Tv and Ts density may help determine what classes of TFs are present at those sites. This, in conjunction with
TF binding motifs, may allow researchers to narrow the field of TF candidates at a given site prior to performing wet-lab experiments.
102
In summary, we have demonstrated that non-coding genetic variation plays an important role in regulating genes involved in maternal glycaemia and fetal adiposity.
We also developed a novel high throughput reporter assay to measure the effects of genetic variation on gene expression, resulting in the identification of a fundamental feature of regulatory variation. More broadly, we highlight the importance and value of following-up GWAS with functional studies. For many complex traits, understanding the impacts non-coding variation will elucidate new biological mechanisms. By understanding these mechanisms, we will not only learn more about the genetics of gene regulation, but we will also create new paths toward improving human health.
103
Appendix A: Identification of non-coding regulatory variation associated with maternal glycaemia
104
Figure 14: Loci associated with 2 hr glucose during pregnancy imputed to HAPMAP (A) and 1000 Genomes (B). Peak of association is in the first intron of HKDC1. Black bars delineate a 30kb block with the strongest association (F-test, p < 1 x10-5, n = 1,367) and LD (r2 > 0.3).
Figure 15: Significant HKDC1 eQTLs [log10(Bayes Factor) > 2.5] and GWA SNPs (F-test, p < 1 x 10-8 ) in the maternal 2 hr glucose level associated locus. An enrichment
105
of open chromatin is located in a 30kb block between the 1st and 5th exons of HKDC1, flanked by two regulatory “deserts” on either side. Open chromatin for each cell line is denoted by DNaseI hypersensitivity (ENCODE). Putative enhancer marks are marked by H3KMe1 and H3K27AC. Black bars delineate the same 30 kb block in Supplementary Figure 1.
Figure 16: eQTL analysis in primary liver for all genes within 500 kb of HKDC1. The red line represents the lead GWAS SNP rs4746822.
106
Figure 17: Enhancer strength of selected regulatory elements. Firefly luciferase intensity was normalized by dividing by the Renilla luciferase intensity. Enhancer strength was determined by dividing the normalized luciferase intensity of each construct by the normalized intensity of the empty vector. Error bars show s.d (n = 8 to 19).
Figure 18: Enhancer strength vs DHS peak width. Spearman ρ =0.5 ,p = 0.117 (n = 8 to 19) . Error bars show s.d.
107
Figure 19: Experimental design for luciferase reporter assays. Multiple haplotypes of each regulatory element were cloned upstream of the promoter and site directed mutagenesis was used to segregate alleles which do not segregate naturally in the population. A linear regression model was used to determine the effect of each SNP on luciferase expression. The bottom and top boxes are the first and third quartiles, and the band inside the box is the median. The ends of the whiskers represent the lowest and highest data points within 1.5 interquartile range of the lower and upper quartiles. Circles represent outliers defined as 1.5 times the interquartile range above the upper quartile or below the lower quartile.
108
Figure 20: Plots of predicted luciferase values versus observed luciferase values. In a-f, predicted luciferase values are positively and significantly associated with observed luciferase values, suggesting that the effects of individual variants may combine additively within haplotypes. The blue line is y = x and the black line is the regression line. Error bars show s.d.
109
Figure 21: Full blot and gel images. (A) Coomassie stain for HKDC1 and HK1. The numbers representing the following: 1:Preinduction, 2:Induction, 3:Clarified Lysate, 4:Column Flow through, 5:Fraction 1, 6:Fraction 2, 7:Fraction 3, 8:Fraction 4, 9:Fraction 5. Full western blot images are shown for INS-1 cells induced with GFP and HKDC1 adenovirus using an HKDC1 (B) and anti-β Actin antibody (C).
110
0 .1 0 G F P (N e g a tiv e C o n tro l)
0 .0 8 H K 1 (P o s itiv e C o n tro l) H K D C 1
0 0 .0 6
9
4 D
O 0 .0 4
0 .0 2
0 .0 0 -2 -1 0 1 2 lo g 1 0 (g lu c o s e ) m M
Figure 22: Un-normalized HKDC1 virus transduction results. HKDC1 overexpression in INS-1 cells via adenovirus shows increased HK activity between a range of 0-50mM glucose. Error bars show s.d.
Figure 23: Expression of other HK mRNAs in INS-1 cells after either GFP or HKDC1 adenovirus transduction. Expression was quantified via qPCR and expression was normalized using the ΔΔ CT method (n = 3). Error bars show s.d.
111
Figure 24: Cell number is consistent between groups of INS-1 cells treated with adenovirus. Cell number was quantified using the Cell-Titer Glo assay (Promega) (n = 3). Error bars show s.d.
Figure 25: Replicate of HKDC1 activity dose response curve. This experiment is a duplicate experiment represented in Supplementary Figure 4 (n = 3). Error bars show s.d.
112
Figure 26: Power analysis to detect independent additive effects of regulatory variants. The beta of SNP1 (rs10762264) = 0.48 and the MAF = 0.4. R2 values between the 4 SNPs range from 0.8-0.99.
113
Figure 27: Standard curve for specific activity versus fluorescence (n = 3).
Table 3: Putative regulatory element chromatin marks
Region Coordinates DHS DNaseI HS H3Kme1 H3K27Ac Width (bp) I chr10:70973319- 757 HeLa, K562, HepG2, K562 K562 70974076 HRPEpiC II chr10:70975656- 360 HUVEC, HeLa, k562, HUVEC, HUVEC, 70976016 HMVEC, HRPE K562, NHEK, NHEK, K562 NHLF III chr10:70976807- 1020 HUVEC, HeLa, K562, HUVEC, HSMM, 70977827 HMVEC, HRPE, A549, K562, HUVEC, Stellate, Urothel, NHEK, NHEK, Myometr, Medullo, NHLF NHLF HMEC, Osteoblasts, PanIsletD, HPDE6, FibroP IV chr10:70979612- 939 HepG2, HRPE, A549, K562 H1-hESC 70980551 K562 V chr10:70981067- 223 HepG2, A549 K562, GM12878, 70981290 NHEK H1-hESC, NHEK VI chr10:70982000- 955 HUVEC, HeLa, K562, GM12878, GM12878, 70982955 HepG2, HMVEC, H1-hESC, H1-hESC,
114
HRPE, A549, Stellate, HSMM, HSMM, Urothel, Myometr, HUVEC, HUVEC, Medullo, HMEC, K562, K562, HMEC, Osteoblast, NHEK, NHEK PanIsletD, HPDE6, NHLF FibroP VII chr10:70984649- 916 HUVEC, HeLa, GM12878, GM12878, 70985565 HepG2, HMVEC, HSMM, HUVEC, HRPE, Medullo, HUVEC, NHEK HMEC, HPDE6, K562, FibroP NHEK VIII chr10:70986715- 398 HepG2, Medullo 70987113 IX chr10:70988887- 1407 HUVEC, K562, GM12878, GM12878, 70990294 HepG2, HMVEC, H1-hESC, K562 HRPE, A549, Stellate, HSMM, Urothel, Medullo, HUVEC, HMEC, Osteoblast, K562, PanIslet, FibroP NHEK, NHLF X chr10:70991933- 698 HUVEC, H1-hESC, HSMM, 70992631 HeLa,HepG2, HSMM, NHEK, HMVEC, HRPE, A549, HUVEC, NHLF Stellate, Urothel, NHEK, Myometr, Medullo, NHLF HMEC, HMEC, Osteoblast, PanIsletD, HPDE6, FibroP XI chr10:70997194- 879 HUVEC, HeLa, K562, GM12878, 70998073 HMVEC, HRPE, A549, H1-hESC, Stellate, Urothel, HSMM, Myometr, Medullo, HUVEC, HMEC, Osteoblasts, K562, PanIsletD, HPDE6, NHEK, FibroP NHLF
Table 4: Haplotype frequencies across the regulatory elements
Region Coordinates SNPs Common Rare Total (common) Haplotypes Haplotypes Haplotypes (>1%) (<1%) I chr10:70973319- 9(4) 5 6 11 70974076 115
II chr10: 70975656- 4(2) 2 3 5 70976016 III chr10:70976807- 11(8) 5 6 11 70977827 IV chr10:70979612- 13(2) 3 12 15 70980551 V chr10:70981067- 2(1) 2 1 3 70981290 VI chr10:70982000- 21(9) 8 19 27 70982955 VII chr10:70984649- 15(4) 5 14 19 70985565 VIII chr10:70986715- 7(4) 4 4 8 70987113 IX chr10:70988887- 26(12) 13 55 68 70990294 X chr10:70991933- 15(7) 6 9 15 70992631 XI chr10:70997194- 13(7) 7 14 21 70998073 Total 136(60) 60 143 203
Table 5: 1000 Genomes individual IDs and ancestries
Catalog ID Ancestry Sex
NA19399 LUHYA IN WEBUYE, KENYA Female
NA19428 LUHYA IN WEBUYE, KENYA Male
NA18557 YORUBA IN IBADAN, NIGERIA Male
NA19007 JAPANESE IN TOKYO, JAPAN Male
HG01133 COLOMBIAN IN MEDELLIN, Male
COLOMBIA
HG00346 FINNISH IN FINLAND Female
116
NA19473 LUHYA IN WEBUYE, KENYA Female
NA18861 YORUBA IN IBADAN, NIGERIA Female
NA19346 LUHYA IN WEBUYE, KENYA Male
NA19457 LUHYA IN WEBUYE, KENYA Female
HG01437 COLOMBIAN IN MEDELLIN, Male
COLOMBIA
NA19438 LUHYA IN WEBUYE, KENYA Female
HG00189 FINNISH IN FINLAND Male
NA19150 YORUBA IN IBADAN, NIGERIA Male
HG01626 IBERIAN POPULATIONS IN SPAIN Female
NA19445 LUHYA IN WEBUYE, KENYA Female
HG01079 PUERTO RICAN IN PUERTO RICO Male
GM19707 AFRICAN ANCESTRY IN Female
SOUTHWEST USA
GM12144 CEPH/UTAH Male
Table 6: Pre- and post-mutagenesis rare allele frequencies
Pre- Post- SNPid mutagenesis mutagenesis rs7089312 0.125 0.2857 rs5030941 0.125 0.2857 rs2394529 0.1667 0.2727
117
rs141651118 0.2 0.3 rs147449838 0.2 0.4 rs55755107 0.1667 0.4286 rs4072135 0.1667 0.35714 rs11813186 0.1667 0.21429 rs5030945 0.125 0.38889 rs144643300 0.125 0.16667 rs12246517 0.25 0.5 rs4746829 0.25 0.5
Table 7: Table of significant regulatory variants
Allele Allele Region SNP A B MAF β Luciferase P-Value III rs10762264 G A 0.48 -3.13 5.05E-05 III rs12241136 A T 0.1 2.77 4.14E-08 VI rs78983061 C A 0.06 2.21 0.003 VI rs7089277 T G 0.07 -8.59 8.90E-11 VI rs4746822 C T 0.49 -6.7 8.00E-08 VII rs4746824 C A 0.22 1.18 -2.00E-06 VII rs75405157 T C 0.06 1.55 3.08E-08 VII rs2394529 G C 0.5 -1.41 1.06E-04 VIII rs9645501 G A 0.34 -2.08 9.04E-08 VIII rs147449838 G A <.01 -1.23 4.35E-04 VIII rs200216341 G A <.01 -1.31 1.71E-04 IX rs1983128 G A <.01 -4.45 9.49E-09 X rs5030945 T C 0.45 -28.14 2.19E-10 X rs874557 A G 0.45 -31.58 1.54E-06
Table 8: Concordant SNP effects in four different cell lines
SNP Allele Allele P-value β Luc β Luc β Luc β Luc A B A549 K562 Fibroblast HepG2
rs10762264 G A 5.05E-05 -2.368 N.E. -8.9581 -3.13 rs4746822 C T 8.00E-08 -2.724 N.E. -3.86 -6.7 118
rs2394529 G C 1.06E-04 N.E. N.E. 3.137 -1.41 rs9645501 G A 9.04E-08 -29.07 -115.4 -15.29 -2.08
Table 9: Discordant SNP effects in four different cell lines
SNP Allele Allele β Luc A549 β Luc K562 β Luc β Luc A B Fibroblast HepG2 rs5030945 T C 5.04 66.89 -3.13 -28.14 rs874557 A G 28.37 62.46 -2.3 -31.58
Table 10: RPKM for primary hepatocytes and HepG2 cells
HepG2 Hepatocytes (RPKM) (RPKM) HK1 6.5 0.7 HK2 1.3 27.2 HK3 6.6 0 GCK 1 0.1 HKDC1 1.2 28.3
Table 11: Amino acid percent identity matrix
GCK HK3 HKDC1 HK1 HK2 GCK 100 52.41 51.52 53.13 54.64 HK3 52.41 100 52.97 53.23 55.93 HKDC1 51.52 52.97 100 70.8 67.79 HK1 53.13 53.23 70.8 100 72.71 HK2 54.64 55.93 67.79 72.71 100
Table 12: DNA percent identity matrix
GCK HK3 HK1 HKDC1 HK2 GCK 100 53.18 50.35 48.77 49.46 HK3 53.18 100 57.31 57.86 60.38 HK1 50.35 57.31 100 63.44 63.09
119
HKDC1 48.77 57.86 63.44 100 64.12 HK2 49.46 60.38 63.09 64.12 100
Table 13: Primer sequences for amplifying regulatory elements
Region Forward Reverse I CGGTACCTGAGCTCGAAGGC TATCCTCGAGGCTAGTGG CACAGGTTTTTAGATCTCCTT TCCTGGCGCATCTTGTA II CGGTACCTGAGCTCGTCC TATCCTCGAGGCTAGGGAA TGAGCATTCCTTGTCTTCG CAGTTGGGAATTTTATGGAAA III CGGTACCTGAGCTCGCC TATCCTCGAGGCTAGCCTAA AGATGGGTGATACGCTTT TTCCCCCACTAGTTGATT IV CGGTACCTGAGCTCGAATG TATCCTCGAGGCTAGTGGC GAAGAATCTGCCCCAACA CTTTCCGAGCAAACAT V CGGTACCTGAGCTCGTTGT TATCCTCGAGGCTAGGACC CACTTTGCTCAGGGAACTTG TTGGCTAAGTCCTCCTGCT VI CGGTACCTGAGCTCGAGA TATCCTCGAGGCTAGGCC GGAAGTGTGGCCCCTTACA ATGAAAAATACACACTGAAAACC VII CGGTACCTGAGCTCGCCC TATCCTCGAGGCTAGTCCC TTAGTGCCTGGGACGTG CAGGTGAGAGGTGAGG VIII CGGTACCTGAGCTCGT TATCCTCGAGGCTAGGAATG CTGCAGCCCTCTCACCTCA GCCCTGACGAAGGTG IX CGGTACCTGAGCTCGTCC TATCCTCGAGGCTAGCCC CATGTCAGGGTCCCAGT TCCATGAACTGCCTTGG X CGGTACCTGAGCTCGTC TATCCTCGAGGCTAGGAA CTCAGATTCTGCCCTTCAGA TGGCCCTGACGAAGGTG XI CGGTACCTGAGCTCGTCCCAC TATCCTCGAGGCTAGCATG CACTAGAATTGTGGGTTT GTTTGCCAGGTCCACA
Table 14: Primer sequences for site directed mutagenesis
SNP ID Forward Reverse kg0002 CTTGTCTTCGGTTCA TTTTACAGGTTTATTGT CAATAAACCTGTAAAA GAACCGAAGACAAG rs5030937 TACCAGCAGGTCA TCATAACATAAATCAGT CACTGATTTATGTTATGA GTGACCTGCTGGTA rs5030938 TTTATGTTATGACGA TAAGTCCAAAGTTAAG CTTAACTTTGGACTTA TCGTCATAACATAAA rs9645501 ACCTTCTCAGCCCTC GAAAGCAGAATGGAATG 120
ATTCCATTCTGCTTTC AGGGCTGAGAAGGT rs147449838 CACATGCGGCTCTCCAA CCAAAAGGGTGTCATTGG TGACACCCTTTTGG AGAGCCGCATGTG rs200216341 AGGCGGTTCCGGGCTA GGCCCTTCTCCATCTTA AGATGGAGAAGGGCC GCCCGGAACCGCCT kg0001 TGGCTGCTCCTCGCCA GGAAGACAGGATGTGT CACATCCTGTCTTCC GGCGAGGAGCAGCCA rs5030945 CCTTTATCCGAGTTTT TGCTCCCAGCCTGGGAA CCCAGGCTGGGAGCA AACTCGGATAAAGG rs5030946 CCAGGCTGGGAGCACA TGGGAAGAGAGAGCTT AGCTCTCTCTTCCCA GTGCTCCCAGCCTGG rs144643300 ACCGCAAGGGCTGTGT AGAAGGCAAATGTGAA TCACATTTGCCTTCT CACAGCCCTTGCGGT rs4746828 GTGCTCACATTTGCCT CATGTCAACTGGAGAAG TCTCCAGTTGACATG GCAAATGTGAGCAC rs12241136 AAAATCCAACTACTTT TAGGTTTAAATCTTAAAA TAAGATTTAAACCTA GTAGTTGGATTTT rs10998649 GGCAAGGCTGGTCTCGAACTCCTGA GGCAGATTGCCTGAGGTC CCTCAGGCAATCTGCC AGGAGTTCGAGACCAGCCTTGCC rs7914256 GGCAAGGCTGGTCTCTAACTCCTGAT GGCAGATTGCCTGAGATC CTCAGGCAATCTGCC AGGAGTTAGAGACCAGCCTTGCC
Table 15: Primer sequences for qPCR
Forward Reverse Bactin GTGGCCATCTCTTGCTGCAAG GGGAAATCGTGCGTGACATTAAG HKDC1 GGTCAGGATGCTGCCCACCT CCCAAGATCCAGGGCGAGAA HK1 TGAAGTCGGCCTGATCATCG TCCTCCCCTCGTCTCCTTCC HK2 GGGTCCTGCTGGTCCGTGTT TCCTGCGGGATGGCGTAGAT HK3 GAGGAGACCCTGGCCCCATT CCTTCCGCATCTGTGCCTGA GCK TGGATGTGGTGGCAATGGTG GATCATGCCGACCTCGCACT ratHK1 TTAACCCGCTTGGGAGTGGA GGCTGATCGGAAGGAGACGA ratHK2 AGCGACTTCGCTCCACCATC GGAGACGCTTGGCAAAATGG ratHK3 CTCTTCCAGGATGCGCCTGT TCCCCTCTGTGGATGGTGGT ratGCK GGCACTGCCGAGATGCTCTT GAAGCCCAGGGGCAGTTTCT ratBactin CACTGCCGCATCCTCTTCCT GGAACCGCTCATTGCCGATA
121
Appendix B: Massively parallel quantification of the regulatory effects of non-coding genetic variation in a human cohort
Figure 28: Distribution of TruSeq Custom Amplicon sequencing coverage for 95 individuals. For each individual, the read depth was determined by calculating the median coverage per amplicon for that specific individual. The median read depth for an individual in the cohort is 1500x.
122
Figure 29: Distribution of allele frequencies in the 1000 Genomes Project and our TruSeq Custom Amplicon Sequencing for 95 individuals. The high coverage permitted confidently calling a higher number of private variants per individual.
123
Figure 30: Distribution of median coverage per amplicon of STARR-seq DNA plasmid input library sequencing. The Y-axis represents the number of amplicons and the X-axis represents the median depth per fragment. The median number of times an amplicon was sequenced was 2200 times.
124
Figure 31: Distribution of median coverage per amplicon of the RNA-seq output library sequencing. The Y-axis represents the number of amplicons and the X-axis represents the median depth per fragment. The median number of times an amplicon was sequenced was 13,000 times.
125
Figure 32: Allele ratio in the DNA plasmid library (X-axis) versus allele ratio in RNA-seq output libraries (Y-axis) for each replicate. Allele ratio is defined as (number of reads containing Allele0) / (number of reads containing Allele1). Allele0 is the reference allele and Allele1 is the alternate allele defined by the VCF file. Generally, the alternative allele has lower frequency, although this is not always the case.
126
Figure 33: Plotted is a comparison of the allele frequency of each SNP in the cohort DNA determined by variant calling to the allele frequency of each SNP in the resulting reporter library. Allele frequencies of the cohort DNA used are shown on the X-axis; and the allele frequency in the resulting reporter library are on the Y-axis.
Figure 34: Correlation between minor allele frequency (MAF: X-axis) and variant effect size (Y-axis) for functional variants identified in our population STARR-seq assay (Spearman ρ = -0.18, p = 0.28).
127
Figure 35: Correlation between SNP effect sizes (X-axis: log of product of effect sizes of SNPs on haplotype) and log of observed haplotype effects (Y-axis) for putative regulatory haplotypes containing more than one SNP (r = 0.54, p = 0.007). Observed haplotype effect sizes were computed as normalized ratios for each haplotype versus all pooled haplotypes at a locus: (RNAhaplotype/DNAhaplotype)/(RNApooled/DNApooled). Solid line: regression line (slope=0.8, intercept=-0.019); dotted line: 1:1 diagonal.
128
Figure 36: Pearson correlation coefficients for five genes (LINC00881:ENSG00000241135.1, LINC00880:ENSG00000243629.1, CCNL1:ENSG00000163660.7, TIPARP:ENSG00000163659.8, LEKR1:ENSG00000197980.6) and 67 proximal SNPs. Blue points correspond to eQTLs for LINC00881 as defined by the GEUVADIS consortium.
Table 16: Transition:Transversion ratios in 1000 Genomes and Custom Amplicon Sequencing
1000 genomes Custom Amplicon Sequencing
Exons 2.71 2.83
DHS Peaks 2.36 2.31
DHS Peak middle 2.65 2.63
129
DHS Peak edges 2.25 2.18
Non DHS 1.61 1.97 Intergenic
Overall 2.02 2.17
Table 17: Proportion of assayed variation in Population STARR-seq
Number of Number of Variants Fragments Called Sequenced
Custom Amplicon Assay 174 321
Population STARR-seq 173 283
Percent 99.42528736 88.16199377
Table 18: STARR-seq Primers
TAGAGCATGCACCGGACACTCTTTCCCTACACGACGCTC TS2SSF: TTCCGATCT
TS2SSpatient GGCCGAATTCGTCGATCGCGAGTTAATGCAACGATCGTC R: GAAATTCGC
PPRead2 TCGCGAGTTAATGCAACGATCGTCGAAATTCGC
PPBCread GCGAATTTCGACGATCGTTGCATTAACTCGCGA
CAAGCAGAAGACGGCATACGAGATCGTGATTCGCGAGT PPBC1 TAATGCAACGATCGTCGAAATTCG*C
CAAGCAGAAGACGGCATACGAGATACATCGTCGCGAGT PPBC2 TAATGCAACGATCGTCGAAATTCG*C
CAAGCAGAAGACGGCATACGAGATGCCTAATCGCGAGT PPBC3 TAATGCAACGATCGTCGAAATTCG*C
PPBC4 CAAGCAGAAGACGGCATACGAGATTGGTCATCGCGAGT 130
TAATGCAACGATCGTCGAAATTCG*C
CAAGCAGAAGACGGCATACGAGATCACTGTTCGCGAGT PPBC5 TAATGCAACGATCGTCGAAATTCG*C
CAAGCAGAAGACGGCATACGAGATATTGGCTCGCGAGT PPBC6 TAATGCAACGATCGTCGAAATTCG*C
CAAGCAGAAGACGGCATACGAGATGATCTGTCGCGAGT PPBC7 TAATGCAACGATCGTCGAAATTCG*C
CAAGCAGAAGACGGCATACGAGATTCAAGTTCGCGAGT PPBC8 TAATGCAACGATCGTCGAAATTCG*C
CAAGCAGAAGACGGCATACGAGATCTGATCTCGCGAGT PPBC9 TAATGCAACGATCGTCGAAATTCG*C
*= phosphorothioate bond.
Table 19: Luciferase Validation Primers
CTGGCCTAACTGGCCGGTACCCCAGCCTGTGTGGATGTT chr3 156800768 F GC
CTGGCCTAACTGGCCGGTACCGGGGAAGATCAGGGGAT chr3 156806431 F GAA
CTGGCCTAACTGGCCGGTACCAGTTCGTTTTCCGGGGGT chr3 156812738 F GA
CTGGCCTAACTGGCCGGTACCTGACAGCCCCCTCTAGTG chr3 156852592 F CAG
CTGGCCTAACTGGCCGGTACCCGGCAGCAGTAGCTGTCG chr3 156878129 F AA
CTGGCCTAACTGGCCGGTACCTTCTGTAGATGATTGAAA chr3 156898104 F TATTTTGGA chr3 156800768 R TACCCTAGGGAGATCTCCCTTGTCCCCAGGAAGCTC
131
chr3 156806431 R TACCCTAGGGAGATCTCTCTTCCCGCTCGCAGCA chr3 156812738 TACCCTAGGGAGATCTTGAGGGAGCTGTCTTCAGTTCAG R A chr3 156852592 R TACCCTAGGGAGATCTGCATCAGTTGAGCTGAGGGACA chr3 156878129 R TACCCTAGGGAGATCTCCGCCACTTCCCTTGGTACA chr3 156898104 R TACCCTAGGGAGATCTCTTCATGGAGAGGTGGAGGA
132
Appendix C: Regulatory variants associated with fetal adiposity regulate adipogenesis
Figure 37: Association with sum of skinfolds using variant call data from the custom capture sequencing using model 1 as described in Urbanek et al201.
133
Figure 38: Association with sum of skinfolds using variant call data from the custom capture sequencing using model 2 as described in Urbanek et al201.
134
Figure 39: Association with sum of skinfolds using variant call data from the custom capture sequencing using model 3 as described in Urbanek et al201.
135
Figure 40: Association with sum of skinfolds after subsetting the original GWAS data to 760 individuals using model 1 as described in Urbanek et al201.
136
Figure 41: Association with sum of skinfolds after subsetting the original GWAS data to 760 individuals using model 2 as described in Urbanek et al201.
137
Figure 42: Association with sum of skinfolds after subsetting the original GWAS data to 760 individuals using model 3 as described in Urbanek et al201.
138
Figure 43: Quantification of oil red o staining for adipocyte differentiation during 21 days. N = 3 for each time point.
Figure 44: log2 fold changes in gene expression for adipogenic markers over 21 days. N = 4 for each time point.
139
Figure 45: log2 fold changes in gene expression for cell cycle genes over 21 days. N = 4 for each time point.
Figure 46: log2 fold changes in gene expression for genes at 3q25 over 21 days. N = 4 for each time point.
140
Table 20: Proportion of assayed haplotypes
Plate Ancestry Existing Assayed Percent Haplotypes Haplotypes Captured 1 Hispanic 495 454 91.72 2 Hispanic + White 451 436 96.67 3 White 430 419 97.44 4 Black + White 589 552 93.72 5 Black 571 545 95.45 6 Asian + Black 534 512 95.88 7 Asian 411 399 97.08 8 Asian + White + 439 420 95.67 Hispanic
141
Appendix D: Transversions have larger regulatory effects than transitions
Figure 47: Amplicons targeting DHS and active histone markers in multiple cell lines. In total, 104 DHS were captured using 174 amplicons. Amplicons were tiled across target regions and also captured at least 50 bp upstream and downstream of each DHS. Amplicon are ~400-425 bp in length.
Table 21: Effects of Tv’s on regulatory element activity in Patwardhan et al dataset
Model β se t Pr(>t) effect ~ tstv 0.015 0.007 2.069 0.019 effect ~ tstv * enhancer 0.031 0.014 2.185 0.014 effect ~ tstv * enhancer * distance_from_element_center 0.071 0.027 2.616 0.004
Table 22: Population STARR-seq Primer Sequences
TS2SSF: TAGAGCATGCACCGGACACTCTTTCCCTACACGACGCTCTTCCGATCT TS2SSCIDRR: GGCCGAATTCGTCGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CIDRread2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT SSRT CAAACTCATCAATGTATCTTATCATG SS-spliced F GGGCCAGCTGTTGGGGTGTCCAC SS-spliced R CTTATCATGTCTGCTCGAAGC CIDRBCread AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC CIDRBC1 CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CIDRBC2 CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
142
CIDRBC3 CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CIDRBC4 CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CIDRBC5 CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CIDRBC6 CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CIDRBC7 CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CIDRBC8 CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CIDRBC9 CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CIDRBC10 CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CIDRBC11 CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
143
References
1. Bruder, C.E.G., Piotrowski, A., Gijsbers, A.A.C.J., Andersson, R., Erickson, S., de Stahl, T.D., Menzel, U., Sandgren, J., von Tell, D., Poplawski, A., et al. (2008). Phenotypically concordant and discordant monozygotic twins display different DNA copy-number-variation profiles. American journal of human genetics 82, 763-771.
2. Venter, J.C. (2001). The sequence of the human genome (vol 292, pg 1304, 2001). Science 292, 1838-1838.
3. International Human Genome Sequencing, C. (2004). Finishing the euchromatic sequence of the human genome. Nature 431, 931-945.
4. Lander, E.S., Linton, L.M., Birren, B., Nusbaum, C., Zody, M.C., Baldwin, J., Devon, K., Dewar, K., Doyle, M., FitzHugh, W., et al. (2001). Initial sequencing and analysis of the human genome. Nature 409, 860-921.
5. International HapMap, C., Altshuler, D.M., Gibbs, R.A., Peltonen, L., Altshuler, D.M., Gibbs, R.A., Peltonen, L., Dermitzakis, E., Schaffner, S.F., Yu, F., et al. (2010). Integrating common and rare genetic variation in diverse human populations. Nature 467, 52-58.
6. International HapMap, C., Frazer, K.A., Ballinger, D.G., Cox, D.R., Hinds, D.A., Stuve, L.L., Gibbs, R.A., Belmont, J.W., Boudreau, A., Hardenbol, P., et al. (2007). A second generation human haplotype map of over 3.1 million SNPs. Nature 449, 851-861.
7. Montpetit, A., and Chagnon, F. (2006). [The Haplotype Map of the human genome: a revolution in the genetics of complex diseases]. Medecine sciences : M/S 22, 1061- 1067.
8. International HapMap, C. (2005). A haplotype map of the human genome. Nature 437, 1299-1320.
9. Barzel, A., and Kupiec, M. (2008). Finding a match: how do homologous sequences get together for recombination? Nat Rev Genet 9, 27-37.
144
10. Sung, P., and Klein, H. (2006). Mechanism of homologous recombination: mediators and helicases take on regulatory functions. Nature reviews Molecular cell biology 7, 739-750.
11. Provine, W.B. (1991). Alfred Henry Sturtevant and crosses between Drosophila melanogaster and Drosophila simulans. Genetics 129, 1-5.
12. Altshuler, D.M., Durbin, R.M., Abecasis, G.R., Bentley, D.R., Chakravarti, A., Clark, A.G., Donnelly, P., Eichler, E.E., Flicek, P., Gabriel, S.B., et al. (2012). An integrated map of genetic variation from 1,092 human genomes. Nature 491, 56- 65.
13. Sherry, S.T., Ward, M.H., Kholodov, M., Baker, J., Phan, L., Smigielski, E.M., and Sirotkin, K. (2001). dbSNP: the NCBI database of genetic variation. Nucleic acids research 29, 308-311.
14. Sachidanandam, R., Weissman, D., Schmidt, S.C., Kakol, J.M., Stein, L.D., Marth, G., Sherry, S., Mullikin, J.C., Mortimore, B.J., Willey, D.L., et al. (2001). A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms. Nature 409, 928-933.
15. Schneider, J.A., Pungliya, M.S., Choi, J.Y., Jiang, R.H., Sun, X.J., Salisbury, B.A., and Stephens, J.C. (2003). DNA variability of human genes. Mech Ageing Dev 124, 17-25.
16. Fischer, A., Wiebe, V., Paabo, S., and Przeworski, M. (2004). Evidence for a complex demographic history of chimpanzees. Molecular biology and evolution 21, 799- 808.
17. Li, W.H., and Sadler, L.A. (1991). Low Nucleotide Diversity in Man. Genetics 129, 513-523.
18. Harpending, H.C., Batzer, M.A., Gurven, M., Jorde, L.B., Rogers, A.R., and Sherry, S.T. (1998). Genetic traces of ancient demography. Proceedings of the National Academy of Sciences of the United States of America 95, 1961-1967.
19. DeGiorgio, M., Jakobsson, M., and Rosenberg, N.A. (2009). Explaining worldwide patterns of human genetic variation using a coalescent-based serial founder model of migration outward from Africa. Proceedings of the National Academy of Sciences of the United States of America 106, 16057-16062.
145
20. Tishkoff, S.A., and Verrelli, B.C. (2003). Patterns of human genetic diversity: Implications for human evolutionary history and disease. Annu Rev Genom Hum G 4, 293-340.
21. Rosenberg, N.A., Pritchard, J.K., Weber, J.L., Cann, H.M., Kidd, K.K., Zhivotovsky, L.A., and Feldman, M.W. (2002). Genetic structure of human populations. Science 298, 2381-2385.
22. Xue, F.H., Wang, Y., Xu, S.H., Zhang, F., Wen, B., Wu, X.S., Lu, M., Deka, R., Qian, J., and Jin, L. (2008). A spatial analysis of genetic structure of human populations in China reveals distinct difference between maternal and paternal lineages. Eur J Hum Genet 16, 705-717.
23. McComb, J., Crawford, M.H., Leonard, W.R., Schanfield, M.S., and Osipova, L. (1996). Applications of DNA fingerprints for the study of genetic structure of human populations. Stadler Gen, 31-46.
24. Amberger, J.S., Bocchini, C.A., Schiettecatte, F., Scott, A.F., and Hamosh, A. (2015). OMIM.org: Online Mendelian Inheritance in Man (OMIM (R)), an online catalog of human genes and genetic disorders. Nucleic acids research 43, D789-D798.
25. McKusick, V.A. (2007). Mendelian inheritance in man and its online version, OMIM. American journal of human genetics 80, 588-604.
26. Hindorff, L.A., Sethupathy, P., Junkins, H.A., Ramos, E.M., Mehta, J.P., Collins, F.S., and Manolio, T.A. (2009). Potential etiologic and functional implications of genome-wide association loci for human diseases and traits. Proceedings of the National Academy of Sciences of the United States of America 106, 9362-9367.
27. Stranger, B.E., Stahl, E.A., and Raj, T. (2011). Progress and promise of genome-wide association studies for human complex trait genetics. Genetics 187, 367-383.
28. Ozaki, K., Ohnishi, Y., Iida, A., Sekine, A., Yamada, R., Tsunoda, T., Sato, H., Sato, H., Hori, M., Nakamura, Y., et al. (2002). Functional SNPs in the lymphotoxin- alpha gene that are associated with susceptibility to myocardial infarction. Nature genetics 32, 650-654.
29. Welter, D., MacArthur, J., Morales, J., Burdett, T., Hall, P., Junkins, H., Klemm, A., Flicek, P., Manolio, T., Hindorff, L., et al. (2014). The NHGRI GWAS Catalog, a curated resource of SNP-trait associations. Nucleic acids research 42, D1001-1006.
146
30. Hindorff LA, M.J.E.B.I., Morales J (European Bioinformatics Institute), Junkins HA, Hall PN, Klemm AK, and Manolio TA. A Catalog of Published Genome-Wide Association Studies. In. (
31. Stadhouders, R., Aktuna, S., Thongjuea, S., Aghajanirefah, A., Pourfarzad, F., van Ijcken, W., Lenhard, B., Rooks, H., Best, S., Menzel, S., et al. (2014). HBS1L-MYB intergenic variants modulate fetal hemoglobin via long-range MYB enhancers. The Journal of clinical investigation 124, 1699-1710.
32. Genomes Project, C., Abecasis, G.R., Auton, A., Brooks, L.D., DePristo, M.A., Durbin, R.M., Handsaker, R.E., Kang, H.M., Marth, G.T., and McVean, G.A. (2012). An integrated map of genetic variation from 1,092 human genomes. Nature 491, 56- 65.
33. Nicolae, D.L., Gamazon, E., Zhang, W., Duan, S., Dolan, M.E., and Cox, N.J. (2010). Trait-associated SNPs are more likely to be eQTLs: annotation to enhance discovery from GWAS. PLoS genetics 6, e1000888.
34. Carroll, S.B. (2005). Evolution at two levels: On genes and form. PLoS biology 3, 1159-1166.
35. Feng, Q., Vickers, K.C., Anderson, M.P., Levin, M.G., Chen, W., Harrison, D.G., and Wilke, R.A. (2013). A common functional promoter variant links CNR1 gene expression to HDL cholesterol level. Nature communications 4, 1973.
36. Fogarty, M.P., Cannon, M.E., Vadlamudi, S., Gaulton, K.J., and Mohlke, K.L. (2014). Identification of a regulatory variant that binds FOXA1 and FOXA2 at the CDC123/CAMK1D type 2 diabetes GWAS locus. PLoS genetics 10, e1004633.
37. Guo, C., Ludvik, A.E., Arlotto, M.E., Hayes, M.G., Armstrong, L.L., Scholtens, D.M., Brown, C.D., Newgard, C.B., Becker, T.C., Layden, B.T., et al. (2015). Coordinated regulatory variation associated with gestational hyperglycaemia regulates expression of the novel hexokinase HKDC1. Nature communications 6, 6069.
38. Voss, T.C., and Hager, G.L. (2014). Dynamic regulation of transcriptional states by chromatin and transcription factors. Nat Rev Genet 15, 69-81.
39. Grewal, S.I., and Jia, S. (2007). Heterochromatin revisited. Nat Rev Genet 8, 35-46.
40. Djupedal, I., and Ekwall, K. (2008). Molecular biology. The paradox of silent heterochromatin. Science 320, 624-625.
147
41. Levine, M., Cattoglio, C., and Tjian, R. (2014). Looping back to leap forward: transcription enters a new era. Cell 157, 13-25.
42. Conaway, J.W. (2012). Introduction to theme "Chromatin, epigenetics, and transcription". Annual review of biochemistry 81, 61-64.
43. Hellman, A., and Chess, A. (2007). Gene body-specific methylation on the active X chromosome. Science 315, 1141-1143.
44. Forn, M., Diez-Villanueva, A., Merlos-Suarez, A., Munoz, M., Lois, S., Carrio, E., Jorda, M., Bigas, A., Batlle, E., and Peinado, M.A. (2015). Overlapping DNA methylation dynamics in mouse intestinal cell differentiation and early stages of malignant progression. PloS one 10, e0123263.
45. Adli, M., Parlak, M., Li, Y., and El-Dahr, S.S. (2015). Epigenetic States of nephron progenitors and epithelial differentiation. Journal of cellular biochemistry 116, 893-902.
46. Zentner, G.E., Tesar, P.J., and Scacheri, P.C. (2011). Epigenetic signatures distinguish multiple classes of enhancers with distinct cellular functions. Genome research 21, 1273-1283.
47. Spivakov, M., and Fisher, A.G. (2007). Epigenetic signatures of stem-cell identity. Nat Rev Genet 8, 263-271.
48. Szyf, M. (2009). Epigenetics, DNA methylation, and chromatin modifying drugs. Annual review of pharmacology and toxicology 49, 243-263.
49. Levo, M., and Segal, E. (2014). In pursuit of design principles of regulatory sequences. Nat Rev Genet 15, 453-468.
50. Alexander, R.P., Fang, G., Rozowsky, J., Snyder, M., and Gerstein, M.B. (2010). Annotating non-coding regions of the genome. Nat Rev Genet 11, 559-571.
51. Riethoven, J.J. (2010). Regulatory regions in DNA: promoters, enhancers, silencers, and insulators. Methods in molecular biology 674, 33-42.
52. Raab, J.R., and Kamakaka, R.T. (2010). Insulators and promoters: closer than we think. Nat Rev Genet 11, 439-446.
53. Smale, S.T., and Kadonaga, J.T. (2003). The RNA polymerase II core promoter. Annual review of biochemistry 72, 449-479.
148
54. Thomas, M.C., and Chiang, C.M. (2006). The general transcription machinery and general cofactors. Critical reviews in biochemistry and molecular biology 41, 105- 178.
55. Heintzman, N.D., and Ren, B. (2007). The gateway to transcription: identifying, characterizing and understanding promoters in the eukaryotic genome. Cellular and molecular life sciences : CMLS 64, 386-400.
56. Juven-Gershon, T., Hsu, J.Y., Theisen, J.W., and Kadonaga, J.T. (2008). The RNA polymerase II core promoter - the gateway to transcription. Current opinion in cell biology 20, 253-259.
57. Carninci, P., Sandelin, A., Lenhard, B., Katayama, S., Shimokawa, K., Ponjavic, J., Semple, C.A., Taylor, M.S., Engstrom, P.G., Frith, M.C., et al. (2006). Genome- wide analysis of mammalian promoter architecture and evolution. Nature genetics 38, 626-635.
58. Pennacchio, L.A., Bickmore, W., Dean, A., Nobrega, M.A., and Bejerano, G. (2013). Enhancers: five essential questions. Nat Rev Genet 14, 288-295.
59. Andersson, R., Gebhard, C., Miguel-Escalada, I., Hoof, I., Bornholdt, J., Boyd, M., Chen, Y., Zhao, X., Schmidl, C., Suzuki, T., et al. (2014). An atlas of active enhancers across human cell types and tissues. Nature 507, 455-461.
60. Ong, C.T., and Corces, V.G. (2014). CTCF: an architectural protein bridging genome topology and function. Nat Rev Genet 15, 234-246.
61. Phillips, J.E., and Corces, V.G. (2009). CTCF: master weaver of the genome. Cell 137, 1194-1211.
62. Perkel, J. (2015). Mapping Chromosome Neighborhoods. BioTechniques 58, 280-284.
63. Shlyueva, D., Stampfel, G., and Stark, A. (2014). Transcriptional enhancers: from properties to genome-wide predictions. Nat Rev Genet 15, 272-286.
64. Song, L., and Crawford, G.E. (2010). DNase-seq: a high-resolution technique for mapping active gene regulatory elements across the genome from mammalian cells. Cold Spring Harbor protocols 2010, pdb prot5384.
65. Thurman, R.E., Rynes, E., Humbert, R., Vierstra, J., Maurano, M.T., Haugen, E., Sheffield, N.C., Stergachis, A.B., Wang, H., Vernot, B., et al. (2012). The accessible chromatin landscape of the human genome. Nature 489, 75-82.
149
66. Keene, M.A., Corces, V., Lowenhaupt, K., and Elgin, S.C. (1981). DNase I hypersensitive sites in Drosophila chromatin occur at the 5' ends of regions of transcription. Proceedings of the National Academy of Sciences of the United States of America 78, 143-146.
67. Cui, K., and Zhao, K. (2012). Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods in molecular biology 833, 413-419.
68. McGhee, J.D., Wood, W.I., Dolan, M., Engel, J.D., and Felsenfeld, G. (1981). A 200 base pair region at the 5' end of the chicken adult beta-globin gene is accessible to nuclease digestion. Cell 27, 45-55.
69. Shibata, Y., Sheffield, N.C., Fedrigo, O., Babbitt, C.C., Wortham, M., Tewari, A.K., London, D., Song, L., Lee, B.K., Iyer, V.R., et al. (2012). Extensive evolutionary changes in regulatory element activity during human origins are associated with altered gene expression and positive selection. PLoS genetics 8, e1002789.
70. Dunham I, K.A., Aldred SF, Collins PJ, Davis CA, Doyle F, Epstein CB, Frietze S, Harrow J, Kaul R, Khatun J, Lajoie BR, Landt SG, Lee BK, Pauli F, Rosenbloom KR, Sabo P, Safi A, Sanyal A, Shoresh N, Simon JM, Song L, Trinklein ND, Altshuler RC, Birney E, Brown JB, Cheng C, Djebali S, Dong X, Dunham I, Ernst J, Furey TS, Gerstein M, Giardine B, Greven M, Hardison RC, Harris RS, Herrero J, Hoffman MM, Iyer S, Kelllis M, Khatun J, Kheradpour P, Kundaje A, Lassman T, Li Q, Lin X, Marinov GK, Merkel A, Mortazavi A, Parker SC, Reddy TE, Rozowsky J, Schlesinger F, Thurman RE, Wang J, Ward LD, Whitfield TW, Wilder SP, Wu W, Xi HS, Yip KY, Zhuang J, Bernstein BE, Birney E, Dunham I, Green ED, Gunter C, Snyder M, Pazin MJ, Lowdon RF, Dillon LA, Adams LB, Kelly CJ, Zhang J, Wexler JR, Green ED, Good PJ, Feingold EA, Bernstein BE, Birney E, Crawford GE, Dekker J, Elinitski L, Farnham PJ, Gerstein M, Giddings MC, Gingeras TR, Green ED, Guigo R, Hardison RC, Hubbard TJ, Kellis M, Kent WJ, Lieb JD, Margulies EH, Myers RM, Snyder M, Starnatoyannopoulos JA, Tennebaum SA, Weng Z, White KP, Wold B, Khatun J, Yu Y, Wrobel J, Risk BA, Gunawardena HP, Kuiper HC, Maier CW, Xie L, Chen X, Giddings MC, Bernstein BE, Epstein CB, Shoresh N, Ernst J, Kheradpour P, Mikkelsen TS, Gillespie S, Goren A, Ram O, Zhang X, Wang L, Issner R, Coyne MJ, Durham T, Ku M, Truong T, Ward LD, Altshuler RC, Eaton ML, Kellis M, Djebali S, Davis CA, Merkel A, Dobin A, Lassmann T, Mortazavi A, Tanzer A, Lagarde J, Lin W, Schlesinger F, Xue C, Marinov GK, Khatun J, Williams BA, Zaleski C, Rozowsky J, Roder M, Kokocinski F, Abdelhamid RF, Alioto T, Antoshechkin I, Baer MT, Batut P, Bell I, Bell K, Chakrabortty S, Chen X, Chrast J, Curado J, Derrien T, 150
Drenkow J, Dumais E, Dumais J, Duttagupta R, Fastuca M, Fejes-Toth K, Ferreira P, Foissac S, Fullwood MJ, Gao H, Gonzalez D, Gordon A, Gunawardena HP, Howald C, Jha S, Johnson R, Kapranov P, King B, Kingswood C, Li G, Luo OJ, Park E, Preall JB, Presaud K, Ribeca P, Risk BA, Robyr D, Ruan X, Sammeth M, Sandu KS, Schaeffer L, See LH, Shahab A, Skancke J, Suzuki AM, Takahashi H, Tilgner H, Trout D, Walters N, Wang H, Wrobel J, Yu Y, Hayashizaki Y, Harrow J, Gerstein M, Hubbard TJ, Reymond A, Antonarakis SE, Hannon GJ, Giddings MC, Ruan Y, Wold B, Carninci P, Guigo R, Gingeras TR, Rosenbloom KR, Sloan CA, Learned K, Malladi VS, Wong MC, Barber GP, Cline MS, Dreszer TR, Heitner SG, Karolchik D, Kent WJ, Kirkup VM, Meyer LR, Long JC, Maddren M, Raney BJ, Furey TS, Song L, Grasfeder LL, Giresi PG, Lee BK, Battenhouse A, Sheffield NC, Simon JM, Showers KA, Safi A, London D, Bhinge AA, Shestak C, Schaner MR, Kim SK, Zhang ZZ, Mieczkowski PA, Mieczkowska JO, Liu Z, McDaniell RM, Ni Y, Rashid NU, Kim MJ, Adar S, Zhang Z, Wang T, Winter D, Keefe D, Birney E, Iyer VR, Lieb JD, Crawford GE, Li G, Sandhu KS, Zheng M, Wang P, Luo OJ, Shahab A, Fullwood MJ, Ruan X, Ruan Y, Myers RM, Pauli F, Williams BA, Gertz J, Marinov GK, Reddy TE, Vielmetter J, Partridge EC, Trout D, Varley KE, Gasper C, Bansal A, Pepke S, Jain P, Amrhein H, Bowling KM, Anaya M, Cross MK, King B, Muratet MA, Antoshechkin I, Newberry KM, McCue K, Nesmith AS, Fisher-Aylor KI, Pusey B, DeSalvo G, Parker SL, Balasubramanian S, Davis NS, Meadows SK, Eggleston T, Gunter C, Newberry JS, Levy SE, Absher DM, Mortazavi A, Wong WH, Wold B, Blow MJ, Visel A, Pennachio LA, Elnitski L, Margulies EH, Parker SC, Petrykowska HM, Abyzov A, Aken B, Barrell D, Barson G, Berry A, Bignell A, Boychenko V, Bussotti G, Chrast J, Davidson C, Derrien T, Despacio-Reyes G, Diekhans M, Ezkurdia I, Frankish A, Gilbert J, Gonzalez JM, Griffiths E, Harte R, Hendrix DA, Howald C, Hunt T, Jungreis I, Kay M, Khurana E, Kokocinski F, Leng J, Lin MF, Loveland J, Lu Z, Manthravadi D, Mariotti M, Mudge J, Mukherjee G, Notredame C, Pei B, Rodriguez JM, Saunders G, Sboner A, Searle S, Sisu C, Snow C, Steward C, Tanzer A, Tapanan E, Tress ML, van Baren MJ, Walters N, Washieti S, Wilming L, Zadissa A, Zhengdong Z, Brent M, Haussler D, Kellis M, Valencia A, Gerstein M, Raymond A, Guigo R, Harrow J, Hubbard TJ, Landt SG, Frietze S, Abyzov A, Addleman N, Alexander RP, Auerbach RK, Balasubramanian S, Bettinger K, Bhardwaj N, Boyle AP, Cao AR, Cayting P, Charos A, Cheng Y, Cheng C, Eastman C, Euskirchen G, Fleming JD, Grubert F, Habegger L, Hariharan M, Harmanci A, Iyenger S, Jin VX, Karczewski KJ, Kasowski M, Lacroute P, Lam H, Larnarre-Vincent N, Leng J, Lian J, Lindahl-Allen M, Min R, Miotto B, Monahan H, Moqtaderi Z, Mu XJ, O'Geen H, Ouyang Z, Patacsil D, Pei B, Raha D, Ramirez L, Reed B, Rozowsky J, Sboner A, Shi M, Sisu C, Slifer T, Witt H, Wu L, Xu X, Yan KK, Yang X, Yip KY, Zhang Z, Struhl K, Weissman SM, Gerstein M,
151
Farnham PJ, Snyder M, Tenebaum SA, Penalva LO, Doyle F, Karmakar S, Landt SG, Bhanvadia RR, Choudhury A, Domanus M, Ma L, Moran J, Patacsil D, Slifer T, Victorsen A, Yang X, Snyder M, White KP, Auer T, Centarin L, Eichenlaub M, Gruhl F, Heerman S, Hoeckendorf B, Inoue D, Kellner T, Kirchmaier S, Mueller C, Reinhardt R, Schertel L, Schneider S, Sinn R, Wittbrodt B, Wittbrodt J, Weng Z, Whitfield TW, Wang J, Collins PJ, Aldred SF, Trinklein ND, Partridge EC, Myers RM, Dekker J, Jain G, Lajoie BR, Sanyal A, Balasundaram G, Bates DL, Byron R, Canfield TK, Diegel MJ, Dunn D, Ebersol AK, Ebersol AK, Frum T, Garg K, Gist E, Hansen RS, Boatman L, Haugen E, Humbert R, Jain G, Johnson AK, Johnson EM, Kutyavin TM, Lajoie BR, Lee K, Lotakis D, Maurano MT, Neph SJ, Neri FV, Nguyen ED, Qu H, Reynolds AP, Roach V, Rynes E, Sabo P, Sanchez ME, Sandstrom RS, Sanyal A, Shafer AO, Stergachis AB, Thomas S, Thurman RE, Vernot B, Vierstra J, Vong S, Wang H, Weaver MA, Yan Y, Zhang M, Akey JA, Bender M, Dorschner MO, Groudine M, MacCoss MJ, Navas P, Stamatoyannopoulos G, Kaul R, Dekker J, Stamatoyannopoulos JA, Dunham I, Beal K, Brazma A, Flicek P, Herrero J, Johnson N, Keefe D, Lukk M, Luscombe NM, Sobral D, Vaquerizas JM, Wilder SP, Batzoglou S, Sidow A, Hussami N, Kyriazopoulou-Panagiotopoulou S, Libbrecht MW, Schaub MA, Kundaje A, Hardison RC, Miller W, Giardine B, Harris RS, Wu W, Bickel PJ, Banfai B, Boley NP, Brown JB, Huang H, Li Q, Li JJ, Noble WS, Bilmes JA, Buske OJ, Hoffman MM, Sahu AO, Kharchenko PV, Park PJ, Baker D, Taylor J, Weng Z, Iyer S, Dong X, Greven M, Lin X, Wang J, Xi HS, Zhuang J, Gerstein M, Alexander RP, Balasubramanian S, Cheng C, Harmanci A, Lochovsky L, Min R, Mu XJ, Rozowsky J, Yan KK, Yip KY, Birney E. (2012). An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74.
71. Skipper, M., Eccleston, A., Gray, N., Heemels, T., Le Bot, N., Marte, B., and Weiss, U. (2015). Presenting the epigenome roadmap. Nature 518, 313.
72. Maurano, M.T., Humbert, R., Rynes, E., Thurman, R.E., Haugen, E., Wang, H., Reynolds, A.P., Sandstrom, R., Qu, H., Brody, J., et al. (2012). Systematic localization of common disease-associated variation in regulatory DNA. Science 337, 1190-1195.
73. Ernst, J., Kheradpour, P., Mikkelsen, T.S., Shoresh, N., Ward, L.D., Epstein, C.B., Zhang, X., Wang, L., Issner, R., Coyne, M., et al. (2011). Mapping and analysis of chromatin state dynamics in nine human cell types. Nature 473, 43-49.
74. Schaub, M.A., Boyle, A.P., Kundaje, A., Batzoglou, S., and Snyder, M. (2012). Linking disease associations with regulatory information in the human genome. Genome research 22, 1748-1759. 152
75. Degner, J.F., Pai, A.A., Pique-Regi, R., Veyrieras, J.B., Gaffney, D.J., Pickrell, J.K., De Leon, S., Michelini, K., Lewellen, N., Crawford, G.E., et al. (2012). DNase I sensitivity QTLs are a major determinant of human expression variation. Nature 482, 390-394.
76. McVicker, G., van de Geijn, B., Degner, J.F., Cain, C.E., Banovich, N.E., Raj, A., Lewellen, N., Myrthil, M., Gilad, Y., and Pritchard, J.K. (2013). Identification of genetic variants that affect histone modifications in human cells. Science 342, 747- 749.
77. Nica, A.C., and Dermitzakis, E.T. (2013). Expression quantitative trait loci: present and future. Philosophical transactions of the Royal Society of London Series B, Biological sciences 368, 20120362.
78. Stranger, B.E., Nica, A.C., Forrest, M.S., Dimas, A., Bird, C.P., Beazley, C., Ingle, C.E., Dunning, M., Flicek, P., Koller, D., et al. (2007). Population genomics of human gene expression. Nature genetics 39, 1217-1224.
79. Teslovich, T.M., Musunuru, K., Smith, A.V., Edmondson, A.C., Stylianou, I.M., Koseki, M., Pirruccello, J.P., Ripatti, S., Chasman, D.I., Willer, C.J., et al. (2010). Biological, clinical and population relevance of 95 loci for blood lipids. Nature 466, 707-713.
80. Innocenti, F., Cooper, G.M., Stanaway, I.B., Gamazon, E.R., Smith, J.D., Mirkov, S., Ramirez, J., Liu, W., Lin, Y.S., Moloney, C., et al. (2011). Identification, replication, and functional fine-mapping of expression quantitative trait loci in primary human liver tissue. PLoS genetics 7, e1002078.
81. Hernandez, D.G., Nalls, M.A., Moore, M., Chong, S., Dillman, A., Trabzuni, D., Gibbs, J.R., Ryten, M., Arepalli, S., Weale, M.E., et al. (2012). Integration of GWAS SNPs and tissue specific expression profiling reveal discrete eQTLs for human traits in blood and brain. Neurobiology of disease 47, 20-28.
82. Mells, G.F., and Hirschfield, G.M. (2015). Making the most of new genetic risk factors - genetic and epigenetic fine mapping of causal autoimmune disease variants. Clinics and research in hepatology and gastroenterology 39, 408-411.
83. Farh, K.K., Marson, A., Zhu, J., Kleinewietfeld, M., Housley, W.J., Beik, S., Shoresh, N., Whitton, H., Ryan, R.J., Shishkin, A.A., et al. (2015). Genetic and epigenetic fine mapping of causal autoimmune disease variants. Nature 518, 337-343.
153
84. Smemo, S., Tena, J.J., Kim, K.H., Gamazon, E.R., Sakabe, N.J., Gomez-Marin, C., Aneas, I., Credidio, F.L., Sobreira, D.R., Wasserman, N.F., et al. (2014). Obesity- associated variants within FTO form long-range functional connections with IRX3. Nature 507, 371-375.
85. Nica, A.C., Montgomery, S.B., Dimas, A.S., Stranger, B.E., Beazley, C., Barroso, I., and Dermitzakis, E.T. (2010). Candidate causal regulatory effects by integration of expression QTLs with complex trait genetic associations. PLoS genetics 6, e1000895.
86. Torres, J.M., Gamazon, E.R., Parra, E.J., Below, J.E., Valladares-Salgado, A., Wacher, N., Cruz, M., Hanis, C.L., and Cox, N.J. (2014). Cross-tissue and tissue-specific eQTLs: partitioning the heritability of a complex trait. American journal of human genetics 95, 521-534.
87. Zhang, W., Gamazon, E.R., Zhang, X., Konkashbaev, A., Liu, C., Szilagyi, K.L., Dolan, M.E., and Cox, N.J. (2015). SCAN database: facilitating integrative analyses of cytosine modification and expression QTL. Database : the journal of biological databases and curation 2015.
88. Gamazon, E.R., Zhang, W., Konkashbaev, A., Duan, S., Kistner, E.O., Nicolae, D.L., Dolan, M.E., and Cox, N.J. (2010). SCAN: SNP and copy number annotation. Bioinformatics 26, 259-262.
89. Lappalainen, T., Sammeth, M., Friedlander, M.R., t Hoen, P.A., Monlong, J., Rivas, M.A., Gonzalez-Porta, M., Kurbatova, N., Griebel, T., Ferreira, P.G., et al. (2013). Transcriptome and genome sequencing uncovers functional variation in humans. Nature 501, 506-511.
90. Liang, L., Morar, N., Dixon, A.L., Lathrop, G.M., Abecasis, G.R., Moffatt, M.F., and Cookson, W.O. (2013). A cross-platform analysis of 14,177 expression quantitative trait loci derived from lymphoblastoid cell lines. Genome research 23, 716-726.
91. Consortium, G.T. (2015). Human genomics. The Genotype-Tissue Expression (GTEx) pilot analysis: multitissue gene regulation in humans. Science 348, 648-660.
92. Consortium, G.T. (2013). The Genotype-Tissue Expression (GTEx) project. Nature genetics 45, 580-585.
93. Lucas, A.O. (1976). Surveillance of communicable diseases in tropical Africa. International journal of epidemiology 5, 39-43. 154
94. Carithers, L.J., Ardlie, K., Barcus, M., Branton, P.A., Britton, A., Buia, S.A., Compton, C.C., DeLuca, D.S., Peter-Demchok, J., Gelfand, E.T., et al. (2015). A Novel Approach to High-Quality Postmortem Tissue Procurement: The GTEx Project. Biopreservation and biobanking 13, 311-319.
95. Maurano, M.T., Wang, H., Kutyavin, T., and Stamatoyannopoulos, J.A. (2012). Widespread site-dependent buffering of human regulatory polymorphism. PLoS genetics 8, e1002599.
96. Musunuru, K., Strong, A., Frank-Kamenetsky, M., Lee, N.E., Ahfeldt, T., Sachs, K.V., Li, X., Li, H., Kuperwasser, N., Ruda, V.M., et al. (2010). From noncoding variant to phenotype via SORT1 at the 1p13 cholesterol locus. Nature 466, 714-719.
97. Patwardhan, R.P., Lee, C., Litvin, O., Young, D.L., Pe'er, D., and Shendure, J. (2009). High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis. Nature biotechnology 27, 1173-1175.
98. Kwasnieski, J.C., Mogno, I., Myers, C.A., Corbo, J.C., and Cohen, B.A. (2012). Complex effects of nucleotide variants in a mammalian cis-regulatory element. Proceedings of the National Academy of Sciences of the United States of America 109, 19498-19503.
99. White, M.A., Myers, C.A., Corbo, J.C., and Cohen, B.A. (2013). Massively parallel in vivo enhancer assay reveals that highly local features determine the cis- regulatory function of ChIP-seq peaks. Proceedings of the National Academy of Sciences of the United States of America 110, 11952-11957.
100. Melnikov, A., Murugan, A., Zhang, X., Tesileanu, T., Wang, L., Rogov, P., Feizi, S., Gnirke, A., Callan, C.G., Jr., Kinney, J.B., et al. (2012). Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay. Nature biotechnology 30, 271-277.
101. Arnold, C.D., Gerlach, D., Stelzer, C., Boryn, L.M., Rath, M., and Stark, A. (2013). Genome-wide quantitative enhancer activity maps identified by STARR-seq. Science 339, 1074-1077.
102. Murtha, M., Tokcaer-Keskin, Z., Tang, Z., Strino, F., Chen, X., Wang, Y., Xi, X., Basilico, C., Brown, S., Bonneau, R., et al. (2014). FIREWACh: high-throughput functional detection of transcriptional regulatory modules in mammalian cells. Nature methods 11, 559-565.
155
103. Rathert, P., Roth, M., Neumann, T., Muerdter, F., Roe, J.S., Muhar, M., Deswal, S., Cerny-Reiterer, S., Peter, B., Jude, J., et al. (2015). Transcriptional plasticity promotes primary and acquired resistance to BET inhibition. Nature 525, 543-547.
104. Vanhille, L., Griffon, A., Maqbool, M.A., Zacarias-Cabeza, J., Dao, L.T., Fernandez, N., Ballester, B., Andrau, J.C., and Spicuglia, S. (2015). High-throughput and quantitative assessment of enhancer activity in mammals by CapStarr-seq. Nature communications 6, 6905.
105. Arnold, C.D., Gerlach, D., Spies, D., Matts, J.A., Sytnikova, Y.A., Pagani, M., Lau, N.C., and Stark, A. (2014). Quantitative genome-wide enhancer activity maps for five Drosophila species show functional enhancer conservation and turnover during cis-regulatory evolution. Nature genetics 46, 685-692.
106. Shlyueva, D., Stelzer, C., Gerlach, D., Yanez-Cuna, J.O., Rath, M., Boryn, L.M., Arnold, C.D., and Stark, A. (2014). Hormone-responsive enhancer-activity maps reveal predictive motifs, indirect repression, and targeting of closed chromatin. Mol Cell 54, 180-192.
107. Kim, J.S., Lee, H.J., and Carroll, D. (2010). Genome editing with modularly assembled zinc-finger nucleases. Nature methods 7, 91-91.
108. Maeder, M.L., Thibodeau-Beganny, S., Osiak, A., Wright, D.A., Anthony, R.M., Eichtinger, M., Jiang, T., Foley, J.E., Winfrey, R.J., Townsend, J.A., et al. (2008). Rapid "Open-Source" engineering of customized zinc-finger nucleases for highly efficient gene modification. Mol Cell 31, 294-301.
109. Joung, J.K., and Sander, J.D. (2013). INNOVATION TALENs: a widely applicable technology for targeted genome editing. Nat Rev Mol Cell Bio 14, 49-55.
110. Gaj, T., Gersbach, C.A., and Barbas, C.F. (2013). ZFN, TALEN, and CRISPR/Cas- based methods for genome engineering. Trends in biotechnology 31, 397-405.
111. Bedell, V.M., Wang, Y., Campbell, J.M., Poshusta, T.L., Starker, C.G., Krug, R.G., Tan, W.F., Penheiter, S.G., Ma, A.C., Leung, A.Y.H., et al. (2012). In vivo genome editing using a high-efficiency TALEN system. Nature 491, 114-U133.
112. Zu, Y., Tong, X.J., Wang, Z.X., Liu, D., Pan, R.C., Li, Z., Hu, Y.Y., Luo, Z., Huang, P., Wu, Q., et al. (2013). TALEN-mediated precise genome modification by homologous recombination in zebrafish. Nature methods 10, 329-+.
156
113. Morton, J., Davis, M.W., Jorgensen, E.M., and Carroll, D. (2006). Induction and repair of zinc-finger nuclease-targeted double-strand breaks in Caenorhabditis elegans somatic cells. Proceedings of the National Academy of Sciences of the United States of America 103, 16370-16375.
114. Hwang, W.Y., Fu, Y.F., Reyon, D., Maeder, M.L., Kaini, P., Sander, J.D., Joung, J.K., Peterson, R.T., and Yeh, J.R.J. (2013). Heritable and Precise Zebrafish Genome Editing Using a CRISPR-Cas System. PloS one 8.
115. Lo, T.W., Pickle, C.S., Lin, S., Ralston, E.J., Gurling, M., Schartner, C.M., Bian, Q., Doudna, J.A., and Meyer, B.J. (2013). Precise and Heritable Genome Editing in Evolutionarily Diverse Nematodes Using TALENs and CRISPR/Cas9 to Engineer Insertions and Deletions. Genetics 195, 331-+.
116. Liu, P.P., Long, L.J., Xiong, K., Yu, B., Chang, N.N., Xiong, J.W., Zhu, Z.Y., and Liu, D. (2014). Heritable/conditional genome editing in C. elegans using a CRISPR- Cas9 feeding system. Cell Res 24, 886-889.
117. Friedland, A.E., Tzur, Y.B., Esvelt, K.M., Colaiacovo, M.P., Church, G.M., and Calarco, J.A. (2013). Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nature methods 10, 741-+.
118. Regales, L., Giraldo, P., Garcia-DIaz, A., Lavado, A., and Montoliu, L. (2003). Identification and functional validation of a 5 ' upstream regulatory sequence in the human tyrosinase gene homologous to the locus control region of the mouse tyrosinase gene. Pigm Cell Res 16, 685-692.
119. Musunuru, K. (2013). Genome editing of human pluripotent stem cells to generate human cellular disease models. Dis Model Mech 6, 896-904.
120. Hou, Z.G., Zhang, Y., Propson, N.E., Howden, S.E., Chu, L.F., Sontheimer, E.J., and Thomson, J.A. (2013). Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proceedings of the National Academy of Sciences of the United States of America 110, 15644-15649.
121. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier, E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821.
122. Kim, Y., Kweon, J., and Kim, J.S. (2013). TALENs and ZFNs are associated with different mutation signatures. Nature methods 10, 185.
157
123. Lee, H.J., Kim, E., and Kim, J.S. (2010). Targeted chromosomal deletions in human cells using zinc finger nucleases. Genome research 20, 81-89.
124. Urnov, F.D., Miller, J.C., Lee, Y.L., Beausejour, C.M., Rock, J.M., Augustus, S., Jamieson, A.C., Porteus, M.H., Gregory, P.D., and Holmes, M.C. (2005). Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature 435, 646-651.
125. Barker, D.J., Winter, P.D., Osmond, C., Margetts, B., and Simmonds, S.J. (1989). Weight in infancy and death from ischaemic heart disease [see comments]. Lancet 2, 577-580.
126. Curhan, G.C., Willett, W.C., Rimm, E.B., Spiegelman, D., Ascherio, A.L., and Stampfer, M.J. (1996). Birth weight and adult hypertension, diabetes mellitus, and obesity in US men. Circulation 94, 3246-3250.
127. Decsi, T., Erhardt, E., Markus, A., Burus, I., and Molnar, D. (1999). Plasma lipids, phospholipid fatty acids and indices of glycaemia in 10- year-old children born as small-for-gestational-age or preterm infants [see comments]. Acta Paediatr 88, 500-504.
128. Hales, C.N., Barker, D.J., Clark, P.M., Cox, L.J., Fall, C., Osmond, C., and Winter, P.D. (1991). Fetal and infant growth and impaired glucose tolerance at age 64. BMJ 303, 1019-1022.
129. Leon, D.A., Lithell, H.O., Vagero, D., Koupilova, I., Mohsen, R., Berglund, L., Lithell, U.B., and McKeigue, P.M. (1998). Reduced fetal growth rate and increased risk of death from ischaemic heart disease: cohort study of 15 000 Swedish men and women born 1915- 29 [see comments]. Bmj 317, 241-245.
130. McCance, D.R., Pettitt, D.J., Hanson, R.L., Jacobsson, L.T., Knowler, W.C., and Bennett, P.H. (1994). Birth weight and non-insulin dependent diabetes: thrifty genotype, thrifty phenotype, or surviving small baby genotype? Bmj 308, 942- 945.
131. Valdez, R., Athens, M.A., Thompson, G.H., Bradshaw, B.S., and Stern, M.P. (1994). Birthweight and adult health outcomes in a biethnic population in the USA. Diabetologia 37, 624-631.
132. Rich-Edwards, J.W., Colditz, G.A., Stampfer, M.J., Willett, W.C., Gillman, M.W., Hennekens, C.H., Speizer, F.E., and Manson, J.E. (1999). Birthweight and the risk
158
for type 2 diabetes mellitus in adult women. Annals of internal medicine 130, 278-284.
133. Catalano, P.M., and Hauguel-De Mouzon, S. (2011). Is it time to revisit the Pedersen hypothesis in the face of the obesity epidemic? Am J Obstet Gynecol 204, 479-487.
134. Dabelea, D., and Crume, T. (2011). Maternal environment and the transgenerational cycle of obesity and diabetes. Diabetes 60, 1849-1855.
135. Dabelea, D., Pettitt, D.J., Hanson, R.L., Imperatore, G., Bennett, P.H., and Knowler, W.C. (1999). Birth weight, type 2 diabetes, and insulin resistance in Pima Indian children and young adults. Diabetes care 22, 944-950.
136. Harder, T., Rodekamp, E., Schellong, K., Dudenhausen, J.W., and Plagemann, A. (2007). Birth weight and subsequent risk of type 2 diabetes: a meta-analysis. Am J Epidemiol 165, 849-857.
137. Wei, J.N., Li, H.Y., Sung, F.C., Lin, C.C., Chiang, C.C., Li, C.Y., and Chuang, L.M. (2007). Birth weight correlates differently with cardiovascular risk factors in youth. Obesity (Silver Spring) 15, 1609-1616.
138. Whincup, P.H., Kaye, S.J., Owen, C.G., Huxley, R., Cook, D.G., Anazawa, S., Barrett- Connor, E., Bhargava, S.K., Birgisdottir, B.E., Carlsson, S., et al. (2008). Birth weight and risk of type 2 diabetes: a systematic review. JAMA 300, 2886-2897.
139. Gardosi, J., Figueras, F., Clausson, B., and Francis, A. (2011). The customised growth potential: an international research tool to study the epidemiology of fetal growth. Paediatric and perinatal epidemiology 25, 2-10.
140. Gardosi, J., Clausson, B., and Francis, A. (2009). The value of customised centiles in assessing perinatal mortality risk associated with parity and maternal size. BJOG 116, 1356-1363.
141. Gardosi, J., Clausson, B., and Francis, A. (2007). The use of customised versus population-based birthweight standards in predicting perinatal mortality. BJOG 114, 1301-1302; author reply 1303.
142. Cnattingius, S., Signorello, L.B., Anneren, G., Clausson, B., Ekbom, A., Ljunger, E., Blot, W.J., McLaughlin, J.K., Petersson, G., Rane, A., et al. (2000). Caffeine intake and the risk of first-trimester spontaneous abortion. N Engl J Med 343, 1839-1845.
159
143. Clausson, B., Lichtenstein, P., and Cnattingius, S. (2000). Genetic influence on birthweight and gestational length determined by studies in offspring of twins. BJOG 107, 375-381.
144. Clausson, B., Granath, F., Ekbom, A., Lundgren, S., Nordmark, A., Signorello, L.B., and Cnattingius, S. (2002). Effect of caffeine exposure during pregnancy on birth weight and gestational age. Am J Epidemiol 155, 429-436.
145. Clausson, B., Gardosi, J., Francis, A., and Cnattingius, S. (2001). Perinatal outcome in SGA births defined by customised versus population-based birthweight standards. BJOG 108, 830-834.
146. Clausson, B., Cnattingius, S., and Axelsson, O. (1999). Outcomes of post-term births: the role of fetal growth restriction and malformations. Obstet Gynecol 94, 758- 762.
147. Clausson, B., Cnattingius, S., and Axelsson, O. (1998). Preterm and term births of small for gestational age infants: a population-based study of risk factors among nulliparous women. British journal of obstetrics and gynaecology 105, 1011-1017.
148. Catalano, P.M., McIntyre, H.D., Cruickshank, J.K., McCance, D.R., Dyer, A.R., Metzger, B.E., Lowe, L.P., Trimble, E.R., Coustan, D.R., Hadden, D.R., et al. (2012). The hyperglycemia and adverse pregnancy outcome study: associations of GDM and obesity with pregnancy outcomes. Diabetes care 35, 780-786.
149. Group, H.S.C.R., Metzger, B.E., Lowe, L.P., Dyer, A.R., Trimble, E.R., Chaovarindr, U., Coustan, D.R., Hadden, D.R., McCance, D.R., Hod, M., et al. (2008). Hyperglycemia and adverse pregnancy outcomes. The New England journal of medicine 358, 1991-2002.
150. Herrera, E., Amusquivar, E., Lopez-Soldado, I., and Ortega, H. (2006). Maternal lipid metabolism and placental lipid transfer. Horm Res 65 Suppl 3, 59-64.
151. Urbanek, M., Hayes, M.G., Armstrong, L.L., Morrison, J., Lowe, L.P., Badon, S.E., Scheftner, D., Pluzhnikov, A., Levine, D., Laurie, C.C., et al. (2013). The chromosome 3q25 genomic region is associated with measures of adiposity in newborns in a multi-ethnic genome-wide association study. Human molecular genetics.
152. M. Geoffrey Hayes, M.U., 1 Marie-France Hivert,2,3 Loren L. Armstrong,1, Jean Morrison, C.G., 5 Lynn P. Lowe,6 Douglas A. Scheftner,1 Anna Pluzhnikov,4, David M. Levine, C.P.M., 7 Christine M. Ackerman,1 Luigi Bouchard,8,9 Diane 160
Brisson,9, Brian T. Layden, D.M., 10 Kimberly F. Doheny,11 Marysa V. Leya,1 Rachel N. Lown-Hecht,1, Alan R. Dyer, B.E.M., 1 Timothy E. Reddy,5,12 Nancy J. Cox,4 and William L. Lowe Jr.,1, and Group, f.t.H.S.C.R. ( 2013). Identification of HKDC1 and BACE2 as Genes Influencing Glycemic Traits During Pregnancy Through Genome-Wide Association Studies. DIABETES VOL. 62.
153. (2002). The Hyperglycemia and Adverse Pregnancy Outcome (HAPO) Study. Int J Gynaecol Obstet 78, 69-77.
154. Chawla, R., McCance, D.R., McKenna, S., Young, I.S., Patterson, C.C., Rangarajan, J., Reisetter, A.C., Armstrong, L.L., Lowe, L.P., Metzger, B.E., et al. (2014). The chromosome 3q25 locus associated with fetal adiposity is not associated with childhood adiposity. Nutrition & diabetes 4, e138.
155. Andersson, E.A., Harder, M.N., Pilgaard, K., Pisinger, C., Stancakova, A., Kuusisto, J., Grarup, N., Faerch, K., Poulsen, P., Witte, D.R., et al. (2011). The birth weight lowering C-allele of rs900400 near LEKR1 and CCNL1 associates with elevated insulin release following an oral glucose challenge. PloS one 6, e27096.
156. Ryckman, K.K., Feenstra, B., Shaffer, J.R., Bream, E.N., Geller, F., Feingold, E., Weeks, D.E., Gadow, E., Cosentino, V., Saleme, C., et al. (2012). Replication of a genome-wide association study of birth weight in preterm neonates. The Journal of pediatrics 160, 19-24 e14.
157. Mook-Kanamori, D.O., Marsh, J.A., Warrington, N.M., Taal, H.R., Newnham, J.P., Beilin, L.J., Lye, S.J., Palmer, L.J., Hofman, A., Steegers, E.A., et al. (2011). Variants near CCNL1/LEKR1 and in ADCY5 and fetal growth characteristics in different trimesters. The Journal of clinical endocrinology and metabolism 96, E810-815.
158. Freathy, R.M., Mook-Kanamori, D.O., Sovio, U., Prokopenko, I., Timpson, N.J., Berry, D.J., Warrington, N.M., Widen, E., Hottenga, J.J., Kaakinen, M., et al. (2010). Variants in ADCY5 and near CCNL1 are associated with fetal growth and birth weight. Nature genetics 42, 430-435.
159. Kuzawa, C.W. (1998). Adipose tissue in human infancy and childhood: an evolutionary perspective. Am J Phys Anthropol Suppl 27, 177-209.
160. Cunnane, S.C., and Crawford, M.A. (2003). Survival of the fattest: fat babies were the key to evolution of the large human brain. Comparative biochemistry and physiology Part A, Molecular & integrative physiology 136, 17-26.
161
161. Lain, K.Y., and Catalano, P.M. (2007). Metabolic changes in pregnancy. Clinical obstetrics and gynecology 50, 938-948.
162. Metzger, B.E. (2007). Long-term outcomes in mothers diagnosed with gestational diabetes mellitus and their offspring. Clinical obstetrics and gynecology 50, 972- 979.
163. (1989). Weight in infancy and death from ischaemic heart disease. Lancet 2, 1335.
164. Hayes, M.G., Urbanek, M., Hivert, M.F., Armstrong, L.L., Morrison, J., Guo, C., Lowe, L.P., Scheftner, D.A., Pluzhnikov, A., Levine, D.M., et al. (2013). Identification of HKDC1 and BACE2 as genes influencing glycemic traits during pregnancy through genome-wide association studies. Diabetes 62, 3282-3291.
165. Scott, R.A., Lagou, V., Welch, R.P., Wheeler, E., Montasser, M.E., Luan, J., Magi, R., Strawbridge, R.J., Rehnberg, E., Gustafsson, S., et al. (2012). Large-scale association analyses identify new loci influencing glycemic traits and provide insight into the underlying biological pathways. Nature genetics 44, 991-1005.
166. Choi, Y., Sims, G.E., Murphy, S., Miller, J.R., and Chan, A.P. (2012). Predicting the functional effect of amino acid substitutions and indels. PloS one 7, e46688.
167. Ng, P.C., and Henikoff, S. (2001). Predicting deleterious amino acid substitutions. Genome research 11, 863-874.
168. Uhlen, M., Oksvold, P., Fagerberg, L., Lundberg, E., Jonasson, K., Forsberg, M., Zwahlen, M., Kampf, C., Wester, K., Hober, S., et al. (2010). Towards a knowledge-based Human Protein Atlas. Nature biotechnology 28, 1248-1250.
169. Irwin, D.M., and Tan, H. (2008). Molecular evolution of the vertebrate hexokinase gene family: Identification of a conserved fifth vertebrate hexokinase gene. Comparative biochemistry and physiology Part D, Genomics & proteomics 3, 96- 107.
170. Sherry, S.T., Ward, M.H., Kholodov, M., Baker, J., Phan, L., Smigielski, E.M., and Sirotkin, K. (2001). dbSNP: the NCBI database of genetic variation. Nucleic acids research 29, 308-311.
171. He, T.C., Zhou, S., da Costa, L.T., Yu, J., Kinzler, K.W., and Vogelstein, B. (1998). A simplified system for generating recombinant adenoviruses. Proceedings of the National Academy of Sciences of the United States of America 95, 2509-2514.
162
172. Becker, T.C., BeltrandelRio, H., Noel, R.J., Johnson, J.H., and Newgard, C.B. (1994). Overexpression of hexokinase I in isolated islets of Langerhans via recombinant adenovirus. Enhancement of glucose metabolism and insulin secretion at basal but not stimulatory glucose levels. The Journal of biological chemistry 269, 21234-21238.
173. Hohmeier, H.E., Mulder, H., Chen, G., Henkel-Rieger, R., Prentki, M., and Newgard, C.B. (2000). Isolation of INS-1-derived cell lines with robust ATP- sensitive K+ channel-dependent and -independent glucose-stimulated insulin secretion. Diabetes 49, 424-430.
174. Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., Lopez, R., McWilliam, H., Remmert, M., Soding, J., et al. (2011). Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Molecular systems biology 7, 539.
175. Kent, W.J., Sugnet, C.W., Furey, T.S., Roskin, K.M., Pringle, T.H., Zahler, A.M., and Haussler, D. (2002). The human genome browser at UCSC. Genome research 12, 996-1006.
176. Consortium, E.P., Bernstein, B.E., Birney, E., Dunham, I., Green, E.D., Gunter, C., and Snyder, M. (2012). An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74.
177. Bernstein, B.E., Stamatoyannopoulos, J.A., Costello, J.F., Ren, B., Milosavljevic, A., Meissner, A., Kellis, M., Marra, M.A., Beaudet, A.L., Ecker, J.R., et al. (2010). The NIH Roadmap Epigenomics Mapping Consortium. Nature biotechnology 28, 1045-1048.
178. Montgomery, S.B., Sammeth, M., Gutierrez-Arcelus, M., Lach, R.P., Ingle, C., Nisbett, J., Guigo, R., and Dermitzakis, E.T. (2010). Transcriptome genetics using second generation sequencing in a Caucasian population. Nature 464, 773-777.
179. Patwardhan, R.P., Hiatt, J.B., Witten, D.M., Kim, M.J., Smith, R.P., May, D., Lee, C., Andrie, J.M., Lee, S.I., Cooper, G.M., et al. (2012). Massively parallel functional dissection of mammalian enhancers in vivo. Nature biotechnology 30, 265-270.
180. van den Boogaard, M., Smemo, S., Burnicka-Turek, O., Arnolds, D.E., van de Werken, H.J., Klous, P., McKean, D., Muehlschlegel, J.D., Moosmann, J., Toka, O., et al. (2014). A common genetic variant within SCN10A modulates cardiac SCN5A expression. The Journal of clinical investigation 124, 1844-1852.
163
181. Xu, Z., Pei, L., Zhang, F., Hu, X., Gui, Y., Wang, L., and Wu, B. (2013). A functional variant in IL12B promoter modulates its expression and associates with increased risk of allergic asthma. Genes and immunity 14, 238-243.
182. Gonzalez, C., Ureta, T., Sanchez, R., and Niemeyer, H. (1964). Multiple molecular forms of ATP:hexose 6-phosphotransferase from rat liver. Biochemical and biophysical research communications 16, 347-352.
183. Katzen, H.M., and Schimke, R.T. (1965). Multiple forms of hexokinase in the rat: tissue distribution, age dependency, and properties. Proceedings of the National Academy of Sciences of the United States of America 54, 1218-1225.
184. Heredia, V.V., Thomson, J., Nettleton, D., and Sun, S. (2006). Glucose-induced conformational changes in glucokinase mediate allosteric regulation: transient kinetic analysis. Biochemistry 45, 7553-7562.
185. Fendler, W., Malachowska, B., Baranowska-Jazwiecka, A., Borowiec, M., Wyka, K., Malecki, M.T., Jarosz-Chobot, P., Mysliwiec, M., Mlynarski, W., and The PolPeDiab Study, G. (2014). Population-based estimates for double diabetes amongst people with glucokinase monogenic diabetes, GCK-MODY. Diabetic medicine : a journal of the British Diabetic Association.
186. Faletra, F., Athanasakis, E., Morgan, A., Biarnes, X., Fornasier, F., Parini, R., Furlan, F., Boiani, A., Maiorana, A., Dionisi-Vici, C., et al. (2013). Congenital hyperinsulinism: clinical and molecular analysis of a large Italian cohort. Gene 521, 160-165.
187. Corradin, O., Saiakhova, A., Akhtar-Zaidi, B., Myeroff, L., Willis, J., Cowper-Sal lari, R., Lupien, M., Markowitz, S., and Scacheri, P.C. (2014). Combinatorial effects of multiple enhancer variants in linkage disequilibrium dictate levels of gene expression to confer susceptibility to common traits. Genome research 24, 1-13.
188. Huang, Q., Whitington, T., Gao, P., Lindberg, J.F., Yang, Y., Sun, J., Vaisanen, M.R., Szulkin, R., Annala, M., Yan, J., et al. (2014). A prostate cancer susceptibility allele at 6q22 increases RFX6 expression by modulating HOXB13 chromatin binding. Nature genetics 46, 126-135.
189. Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., et al. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823.
164
190. Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., and Church, G.M. (2013). RNA-guided human genome engineering via Cas9. Science 339, 823-826.
191. Cardenas, M.L., Cornish-Bowden, A., and Ureta, T. (1998). Evolution and regulatory role of the hexokinases. Biochimica et biophysica acta 1401, 242-264.
192. Wilson, J.E. (1995). Hexokinases. Reviews of physiology, biochemistry and pharmacology 126, 65-198.
193. Olansky, L., Welling, C., Giddings, S., Adler, S., Bourey, R., Dowse, G., Serjeantson, S., Zimmet, P., and Permutt, M.A. (1992). A variant insulin promoter in non- insulin-dependent diabetes mellitus. The Journal of clinical investigation 89, 1596-1602.
194. Gusev, A., Lee, S.H., Trynka, G., Finucane, H., Vilhjalmsson, B.J., Xu, H., Zang, C., Ripke, S., Bulik-Sullivan, B., Stahl, E., et al. (2014). Partitioning heritability of regulatory and cell-type-specific variants across 11 common diseases. American journal of human genetics 95, 535-552.
195. Cantor, R.M., Lange, K., and Sinsheimer, J.S. (2010). Prioritizing GWAS results: A review of statistical methods and recommendations for their application. American journal of human genetics 86, 6-22.
196. Stranger, B.E., and Raj, T. (2013). Genetics of human gene expression. Current opinion in genetics & development 23, 627-634.
197. Battle, A., Mostafavi, S., Zhu, X., Potash, J.B., Weissman, M.M., McCormick, C., Haudenschild, C.D., Beckman, K.B., Shi, J., Mei, R., et al. (2014). Characterizing the genetic basis of transcriptome diversity through RNA-sequencing of 922 individuals. Genome research 24, 14-24.
198. Birney, E., Lieb, J.D., Furey, T.S., Crawford, G.E., and Iyer, V.R. (2010). Allele- specific and heritable chromatin signatures in humans. Human molecular genetics 19, R204-209.
199. Reddy, T.E., Gertz, J., Pauli, F., Kucera, K.S., Varley, K.E., Newberry, K.M., Marinov, G.K., Mortazavi, A., Williams, B.A., Song, L., et al. (2012). Effects of sequence variation on differential allelic transcription factor occupancy and gene expression. Genome research 22, 860-869.
165
200. McDaniell, R., Lee, B.K., Song, L., Liu, Z., Boyle, A.P., Erdos, M.R., Scott, L.J., Morken, M.A., Kucera, K.S., Battenhouse, A., et al. (2010). Heritable individual- specific and allele-specific chromatin signatures in humans. Science 328, 235-239.
201. Urbanek, M., Hayes, M.G., Armstrong, L.L., Morrison, J., Lowe, L.P., Badon, S.E., Scheftner, D., Pluzhnikov, A., Levine, D., Laurie, C.C., et al. (2013). The chromosome 3q25 genomic region is associated with measures of adiposity in newborns in a multi-ethnic genome-wide association study. Human molecular genetics 22, 3583-3596.
202. Consortium, T.E.P. (2012). An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74.
203. Quinlan, A.R., and Hall, I.M. (2010). BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-842.
204. McKenna, A., Hanna, M., Banks, E., Sivachenko, A., Cibulskis, K., Kernytsky, A., Garimella, K., Altshuler, D., Gabriel, S., Daly, M., et al. (2010). The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome research 20, 1297-1303.
205. DePristo, M.A., Banks, E., Poplin, R., Garimella, K.V., Maguire, J.R., Hartl, C., Philippakis, A.A., del Angel, G., Rivas, M.A., Hanna, M., et al. (2011). A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nature genetics 43, 491-498.
206. Van der Auwera, G.A., Carneiro, M.O., Hartl, C., Poplin, R., Del Angel, G., Levy- Moonshine, A., Jordan, T., Shakir, K., Roazen, D., Thibault, J., et al. (2013). From FastQ data to high confidence variant calls: the Genome Analysis Toolkit best practices pipeline. Current protocols in bioinformatics / editoral board, Andreas D Baxevanis [et al] 11, 11 10 11-11 10 33.
207. Delaneau, O., Marchini, J., and Zagury, J.F. (2012). A linear complexity phasing method for thousands of genomes. Nature methods 9, 179-181.
208. O'Connell, J., Gurdasani, D., Delaneau, O., Pirastu, N., Ulivi, S., Cocca, M., Traglia, M., Huang, J., Huffman, J.E., Rudan, I., et al. (2014). A general approach for haplotype phasing across the full spectrum of relatedness. PLoS genetics 10, e1004234.
209. Delaneau, O., Zagury, J.F., and Marchini, J. (2013). Improved whole-chromosome phasing for disease and population genetic studies. Nature methods 10, 5-6. 166
210. Delaneau, O., Howie, B., Cox, A.J., Zagury, J.F., and Marchini, J. (2013). Haplotype estimation using sequencing reads. American journal of human genetics 93, 687- 696.
211. Langmead, B., and Salzberg, S.L. (2012). Fast gapped-read alignment with Bowtie 2. Nature methods 9, 357-359.
212. Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R., and Genome Project Data Processing, S. (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-2079.
213. Benjamini, Y., and Hochberg, Y. (1995). Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society Series B (Methodological), 289-300.
214. Stegle, O., Parts, L., Durbin, R., and Winn, J. (2010). A Bayesian framework to account for complex non-genetic factors in gene expression levels greatly increases power in eQTL studies. PLoS computational biology 6, e1000770.
215. Consortium, T.G.P., Abecasis, G.R., Auton, A., Brooks, L.D., DePristo, M.A., Durbin, R.M., Handsaker, R.E., Kang, H.M., Marth, G.T., and McVean, G.A. (2012). An integrated map of genetic variation from 1,092 human genomes. Nature 491, 56- 65.
216. Vockley, C.M., Guo, C., Majoros, W.H., Nodzenski, M., Scholtens, D.M., Hayes, M.G., Lowe, W.L., Jr., and Reddy, T.E. (2015). Massively parallel quantification of the regulatory effects of noncoding genetic variation in a human cohort. Genome research 25, 1206-1214.
217. Creyghton, M.P., Cheng, A.W., Welstead, G.G., Kooistra, T., Carey, B.W., Steine, E.J., Hanna, J., Lodato, M.A., Frampton, G.M., Sharp, P.A., et al. (2010). Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proceedings of the National Academy of Sciences of the United States of America 107, 21931-21936.
218. Kilpinen, H., Waszak, S.M., Gschwind, A.R., Raghav, S.K., Witwicki, R.M., Orioli, A., Migliavacca, E., Wiederkehr, M., Gutierrez-Arcelus, M., Panousis, N.I., et al. (2013). Coordinated effects of sequence variation on DNA binding, chromatin structure, and transcription. Science 342, 744-747.
167
219. Li, B., and Leal, S.M. (2008). Methods for detecting associations with rare variants for common diseases: application to analysis of sequence data. American journal of human genetics 83, 311-321.
220. Zawistowski, M., Gopalakrishnan, S., Ding, J., Li, Y., Grimm, S., and Zollner, S. (2010). Extending rare-variant testing strategies: analysis of noncoding sequence and imputed genotypes. American journal of human genetics 87, 604-617.
221. Hu, H., Huff, C.D., Moore, B., Flygare, S., Reese, M.G., and Yandell, M. (2013). VAAST 2.0: improved variant classification and disease-gene identification using a conservation-controlled amino acid substitution matrix. Genetic epidemiology 37, 622-634.
222. Blanchette, M., Kent, W.J., Riemer, C., Elnitski, L., Smit, A.F., Roskin, K.M., Baertsch, R., Rosenbloom, K., Clawson, H., Green, E.D., et al. (2004). Aligning multiple genomic sequences with the threaded blockset aligner. Genome research 14, 708- 715.
223. Ernst, J., and Kellis, M. (2012). ChromHMM: automating chromatin-state discovery and characterization. Nature methods 9, 215-216.
224. Gisselbrecht, S.S., Barrera, L.A., Porsch, M., Aboukhalil, A., Estep, P.W., 3rd, Vedenko, A., Palagi, A., Kim, Y., Zhu, X., Busser, B.W., et al. (2013). Highly parallel assays of tissue-specific enhancers in whole Drosophila embryos. Nature methods 10, 774-780.
225. Pennacchio, L.A., Ahituv, N., Moses, A.M., Prabhakar, S., Nobrega, M.A., Shoukry, M., Minovitsky, S., Dubchak, I., Holt, A., Lewis, K.D., et al. (2006). In vivo enhancer analysis of human conserved non-coding sequences. Nature 444, 499- 502.
226. Zabidi, M.A., Arnold, C.D., Schernhuber, K., Pagani, M., Rath, M., Frank, O., and Stark, A. (2015). Enhancer-core-promoter specificity separates developmental and housekeeping gene regulation. Nature 518, 556-559.
227. Catalano, P.M., Tyzbir, E.D., Allen, S.R., McBean, J.H., and McAuliffe, T.L. (1992). Evaluation of fetal growth by estimation of neonatal body composition. Obstet Gynecol 79, 46-50.
228. Harrington, T.A., Thomas, E.L., Frost, G., Modi, N., and Bell, J.D. (2004). Distribution of adipose tissue in the newborn. Pediatr Res 55, 437-441.
168
229. Poulos, S.P., Hausman, D.B., and Hausman, G.J. (2010). The development and endocrine functions of adipose tissue. Mol Cell Endocrinol 323, 20-34.
230. Dobin, A., Davis, C.A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., and Gingeras, T.R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21.
231. Harrow, J., Frankish, A., Gonzalez, J.M., Tapanari, E., Diekhans, M., Kokocinski, F., Aken, B.L., Barrell, D., Zadissa, A., Searle, S., et al. (2012). GENCODE: the reference human genome annotation for The ENCODE Project. Genome research 22, 1760-1774.
232. Liao, Y., Smyth, G.K., and Shi, W. (2014). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930.
233. Robinson, M.D., McCarthy, D.J., and Smyth, G.K. (2010). edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139-140.
234. Robinson, M.D., and Oshlack, A. (2010). A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol 11, R25.
235. Ashburner, M., Ball, C.A., Blake, J.A., Botstein, D., Butler, H., Cherry, J.M., Davis, A.P., Dolinski, K., Dwight, S.S., Eppig, J.T., et al. (2000). Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nature genetics 25, 25-29.
236. Smedley, D., Haider, S., Durinck, S., Pandini, L., Provero, P., Allen, J., Arnaiz, O., Awedh, M.H., Baldock, R., Barbiera, G., et al. (2015). The BioMart community portal: an innovative alternative to large, centralized data repositories. Nucleic acids research 43, W589-598.
237. Varemo, L., Nielsen, J., and Nookaew, I. (2013). Enriching the gene set analysis of genome-wide data by incorporating directionality of gene expression and combining statistical hypotheses and methods. Nucleic acids research 41, 4378- 4391.
238. Choy, L., and Derynck, R. (2003). Transforming growth factor-beta inhibits adipocyte differentiation by Smad3 interacting with CCAAT/enhancer-binding protein (C/EBP) and repressing C/EBP transactivation function. The Journal of biological chemistry 278, 9609-9619. 169
239. Shathasivam, P., Kollara, A., Ringuette, M.J., Virtanen, C., Wrana, J.L., and Brown, T.J. (2015). Human ortholog of Drosophila Melted impedes SMAD2 release from TGF-beta receptor I to inhibit TGF-beta signaling. Proceedings of the National Academy of Sciences of the United States of America 112, E3000-3009.
240. Teleman, A.A., Chen, Y.W., and Cohen, S.M. (2005). Drosophila Melted modulates FOXO and TOR activity. Developmental cell 9, 271-281.
241. Tsurutani, Y., Fujimoto, M., Takemoto, M., Irisuna, H., Koshizaka, M., Onishi, S., Ishikawa, T., Mezawa, M., He, P., Honjo, S., et al. (2011). The roles of transforming growth factor-beta and Smad3 signaling in adipocyte differentiation and obesity. Biochemical and biophysical research communications 407, 68-73.
242. Yadav, H., and Rane, S.G. (2012). TGF-beta/Smad3 Signaling Regulates Brown Adipocyte Induction in White Adipose Tissue. Frontiers in endocrinology 3, 35.
243. Consortium, E.P. (2012). An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74.
244. Roman, T.S., Marvelle, A.F., Fogarty, M.P., Vadlamudi, S., Gonzalez, A.J., Buchkovich, M.L., Huyghe, J.R., Fuchsberger, C., Jackson, A.U., Wu, Y., et al. (2015). Multiple Hepatic Regulatory Variants at the GALNT2 GWAS Locus Associated with High-Density Lipoprotein Cholesterol. American journal of human genetics 97, 801-815.
245. Cargill, M., Altshuler, D., Ireland, J., Sklar, P., Ardlie, K., Patil, N., Shaw, N., Lane, C.R., Lim, E.P., Kalyanaraman, N., et al. (1999). Characterization of single- nucleotide polymorphisms in coding regions of human genes. Nature genetics 22, 231-238.
246. Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of molecular evolution 16, 111-120.
247. Li, W.H., Wu, C.I., and Luo, C.C. (1985). A new method for estimating synonymous and nonsynonymous rates of nucleotide substitution considering the relative likelihood of nucleotide and codon changes. Molecular biology and evolution 2, 150-174.
170
248. Abe, N., Dror, I., Yang, L., Slattery, M., Zhou, T., Bussemaker, H.J., Rohs, R., and Mann, R.S. (2015). Deconvolving the recognition of DNA shape from sequence. Cell 161, 307-318.
249. Mathelier, A., Fornes, O., Arenillas, D.J., Chen, C.Y., Denay, G., Lee, J., Shi, W., Shyr, C., Tan, G., Worsley-Hunt, R., et al. (2015). JASPAR 2016: a major expansion and update of the open-access database of transcription factor binding profiles. Nucleic acids research.
250. Rozowsky, J., Abyzov, A., Wang, J., Alves, P., Raha, D., Harmanci, A., Leng, J., Bjornson, R., Kong, Y., Kitabayashi, N., et al. (2011). AlleleSeq: analysis of allele- specific expression and binding in a network framework. Molecular systems biology 7, 522.
251. Ni, Y., Hall, A.W., Battenhouse, A., and Iyer, V.R. (2012). Simultaneous SNP identification and assessment of allele-specific bias from ChIP-seq data. BMC genetics 13, 46.
252. Danecek, P., Auton, A., Abecasis, G., Albers, C.A., Banks, E., DePristo, M.A., Handsaker, R.E., Lunter, G., Marth, G.T., Sherry, S.T., et al. (2011). The variant call format and VCFtools. Bioinformatics 27, 2156-2158.
253. An, P., Miljkovic, I., Thyagarajan, B., Kraja, A.T., Daw, E.W., Pankow, J.S., Selvin, E., Kao, W.H., Maruthur, N.M., Nalls, M.A., et al. (2014). Genome-wide association study identifies common loci influencing circulating glycated hemoglobin (HbA1c) levels in non-diabetic subjects: the Long Life Family Study (LLFS). Metabolism: clinical and experimental 63, 461-468.
254. Pinney, S.E., Ganapathy, K., Bradfield, J., Stokes, D., Sasson, A., Mackiewicz, K., Boodhansingh, K., Hughes, N., Becker, S., Givler, S., et al. (2013). Dominant form of congenital hyperinsulinism maps to HK1 region on 10q. Hormone research in paediatrics 80, 18-27.
255. Cuesta-Munoz, A.L., Huopio, H., Otonkoski, T., Gomez-Zumaquero, J.M., Nanto- Salonen, K., Rahier, J., Lopez-Enriquez, S., Garcia-Gimeno, M.A., Sanz, P., Soriguer, F.C., et al. (2004). Severe persistent hyperinsulinemic hypoglycemia due to a de novo glucokinase mutation. Diabetes 53, 2164-2168.
256. Smith, T.A. (2000). Mammalian hexokinases and their abnormal expression in cancer. British journal of biomedical science 57, 170-178.
171
257. Chen, Z., Zhang, H., Lu, W., and Huang, P. (2009). Role of mitochondria-associated hexokinase II in cancer cell death induced by 3-bromopyruvate. Biochimica et biophysica acta 1787, 553-560.
258. Mathupala, S.P., Ko, Y.H., and Pedersen, P.L. (2006). Hexokinase II: cancer's double- edged sword acting as both facilitator and gatekeeper of malignancy when bound to mitochondria. Oncogene 25, 4777-4786.
259. Li, G.H., and Huang, J.F. (2014). Inferring therapeutic targets from heterogeneous data: HKDC1 is a novel potential therapeutic target for cancer. Bioinformatics 30, 748-752.
260. Hilton, I.B., D'Ippolito, A.M., Vockley, C.M., Thakore, P.I., Crawford, G.E., Reddy, T.E., and Gersbach, C.A. (2015). Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nature biotechnology 33, 510-517.
261. Thakore, P.I., D'Ippolito, A.M., Song, L., Safi, A., Shivakumar, N.K., Kabadi, A.M., Reddy, T.E., Crawford, G.E., and Gersbach, C.A. (2015). Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nature methods 12, 1143-1149.
262. Freemark, M. (2010). Placental hormones and the control of fetal growth. The Journal of clinical endocrinology and metabolism 95, 2054-2057.
263. Newbern, D., and Freemark, M. (2011). Placental hormones and the control of maternal metabolism and fetal growth. Current opinion in endocrinology, diabetes, and obesity 18, 409-416.
264. Mannik, J., Vaas, P., Rull, K., Teesalu, P., and Laan, M. (2012). Differential placental expression profile of human Growth Hormone/Chorionic Somatomammotropin genes in pregnancies with pre-eclampsia and gestational diabetes mellitus. Molecular and cellular endocrinology 355, 180-187.
265. Mannik, J., Vaas, P., Rull, K., Teesalu, P., Rebane, T., and Laan, M. (2010). Differential expression profile of growth hormone/chorionic somatomammotropin genes in placenta of small- and large-for-gestational-age newborns. The Journal of clinical endocrinology and metabolism 95, 2433-2442.
266. Soccio, R.E., Chen, E.R., Rajapurkar, S.R., Safabakhsh, P., Marinis, J.M., Dispirito, J.R., Emmett, M.J., Briggs, E.R., Fang, B., Everett, L.J., et al. (2015). Genetic
172
Variation Determines PPARgamma Function and Anti-diabetic Drug Response In Vivo. Cell 162, 33-44.
267. Liu, Z., Guo, J.T., Li, T., and Xu, Y. (2008). Structure-based prediction of transcription factor binding sites using a protein-DNA docking approach. Proteins 72, 1114-1124.
268. Seeman, N.C., Rosenberg, J.M., and Rich, A. (1976). Sequence-specific recognition of double helical nucleic acids by proteins. Proceedings of the National Academy of Sciences of the United States of America 73, 804-808.
269. Rohs, R., West, S.M., Liu, P., and Honig, B. (2009). Nuance in the double-helix and its role in protein-DNA recognition. Current opinion in structural biology 19, 171-177.
270. Rohs, R., West, S.M., Sosinsky, A., Liu, P., Mann, R.S., and Honig, B. (2009). The role of DNA shape in protein-DNA recognition. Nature 461, 1248-1253.
271. Joshi, R., Passner, J.M., Rohs, R., Jain, R., Sosinsky, A., Crickmore, M.A., Jacob, V., Aggarwal, A.K., Honig, B., and Mann, R.S. (2007). Functional specificity of a Hox protein mediated by the recognition of minor groove structure. Cell 131, 530-543.
272. Gordan, R., Shen, N., Dror, I., Zhou, T., Horton, J., Rohs, R., and Bulyk, M.L. (2013). Genomic regions flanking E-box binding sites influence DNA binding specificity of bHLH transcription factors through DNA shape. Cell reports 3, 1093-1104.
173
Biography
Cong “Karl” Guo was born in Xi’an, China in 1988 and immigrated to the United
States in 1991. He attended the Georgia Institute of Technology from 2007-2011 where he earned his B.S. in Biomedical Engineering with honors. As an undergraduate, he received the HOPE Scholarship, President’s Undergraduate Research Award, and
National Cancer Institute ICBP Summer Cancer Fellowship. Karl then entered graduate school at Duke University in the University Program in Genetics and Genomics, where he was mentored by Dr. Timothy Reddy. Karl authored and co-authored several scientific articles while at Duke, including “Coordinated Regulatory Variation
Associated with Gestational Hyperglycemia Regulates Expression of the Novel
Hexokinase HKDC1”, “Massively parallel quantification of the regulatory effects of genetic variation in a human cohort”, and “Transversions have larger regulatory impacts than transitions”. During his Ph.D. Karl received the Ruth L. Kirschstein
National Research Service Award from the NICHD and co-founded Duke Outreach in
Genetics and Genomics.
174