Canadian Journal of Physiology and Pharmacology
Heat shock protein 27 and 70 contribute to the protection of Schisandrin B against D-galactosamine-induced liver injury in mice
Journal: Canadian Journal of Physiology and Pharmacology
Manuscript ID cjpp-2015-0419.R1
Manuscript Type: Article
Date Submitted by the Author: 22-Sep-2015
Complete List of Authors: Gao, Zhiying; Qiqihar Medical University Zhang, Jishun;Draft Beijing Chaoyang Hospital, Capital Medical University Li, Libo; Qiqihar Medical University, Department of Pharmacology Shen, Longqing; Qiqihar Medical University Li, Qingyi; Qiqihar Medical University Zou, Yu; Qiqihar Medical University Du, Xiaohui; Qiqihar Medical University Zhao, Zhibo; Qiqihar Medical University
Schisandrin B, Heat shock proteins, D-galactosamine, Liver injury, Keyword: Quercetin
https://mc06.manuscriptcentral.com/cjpp-pubs Page 1 of 27 Canadian Journal of Physiology and Pharmacology
1
Heat shock protein 27 and 70 contribute to the protection of Schisandrin B
against D-galactosamine-induced liver injury in mice
Zhiying Gao 1, Jishun Zhang 2, Libo Li 3* , Longqing Shen 4, Qingyi Li 3, Yu Zou 3,
Xiaohui Du 3, Zhibo Zhao 4
1Polygenic Disease Institute, Qiqihar Medical University, 333 Bukui Street,
Jianhua District, Qiqihar 161006, China.
2Department of Gastroenterology and Hepatology, Beijing Chaoyang Hospital, Capital Medical University, Draft 5 Jingyuan Road, Shijingshan District, Beijing 100043, China.
3Department of Pharmacology, Qiqihar Medical University, 333 Bukui Street,
Jianhua District, Qiqihar 161006, China.
4School of Basic Medicine, Qiqihar Medical University, 333 Bukui Street, Jianhua
District, Qiqihar 161006, China.
*Corresponding author
Libo Li, Department of Pharmacology, Qiqihar Medical University, 333 Bukui
Street, Jianhua District, Qiqihar 161006, China.
Tel: +86 452 2663159; Fax: +86 452 2663722; E mail: [email protected]
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 2 of 27
2
Abstract: Schisandrin B is a hepatoprotective component isolated from a traditional Chinese herb Schisandra chinensis (Turcz.) Baill. This study determined the effect of Schisandrin B on D galactosamine induced liver injury and the role of Heat shock protein 27 and 70 against liver injury in mice. Acute liver injury was induced by intraperitoneal injection of D galactosamine to mice, and Schisandrin B was given orally. The protein and gene expression of Heat shock protein 27 and 70 were detected by Western blot and real time quantitative polymerase chain reaction respectively. Liver tissues were subjected to histological evaluation, and activities of alanine aminotransferase and aspartate aminotransferase inDraft the serum were measured. Pretreatment of
Schisandrin B significantly attenuated D galactosamine induced liver injury in mice. This result was evidenced by improved alteration of histopathological hepatic necrosis and reduced alanine aminotransferase and aspartate aminotransferase activities in the serum. The hepatoprotective effect was accompanied with overexpression of Heat shock protein 27 and 70 both at the protein and mRNA levels. However, the aforementioned actions of Schisandrin B were all markedly suppressed by the Heat shock protein inhibitor Quercetin.
Heat shock protein 27 and 70 were involved in the protective effect of
Schisandrin B against D galactosamine induced liver injury in mice.
Key words
Schisandrin B; Heat shock proteins; induction; protection; D galactosamine;
https://mc06.manuscriptcentral.com/cjpp-pubs Page 3 of 27 Canadian Journal of Physiology and Pharmacology
3
Liver injury; mice; Quercetin
Introduction
Hepatitis has high incidence and mortality worldwide and remains a major public
health threat. This disorder is caused by various agents, such as alcohol, viruses,
environmental toxins, and drugs (Hwang et al. 2005). Liver injury is a basic
pathogenesis of various forms of hepatitis. Long term presence of liver injury
leads to liver fibrosis, cirrhosis, and even hepatic carcinoma (Zou et al. 2006).
Therefore, rectifying liver injury is an important strategy to cure hepatitis clinically.
D galactosamine (D Gal) challengedDraft mice is a well established animal model to
investigate acute hepatic injury, which resembles clinical viral hepatitis both in
morphology and function (Decker and Keppler 1972; Keppler et al. 1968). Thus,
this model is widely used to evaluate hepatoprotective activity (Myagmar et al.
2004; Visen et al. 1998).
Schisandrin B (Fig. 1) is an active dibenzocyclooctadiene lignan component
that is isolated from the fruit of a well known Chinese herb Schisandra chinensis
(Turcz.) Baill., and is particularly effective in viral and chemical induced hepatitis
(Chan 2012; Liu 1989). SchB possesses a significant hepatoprotective effect
against injuries caused by chemicals, such as carbon tetrachloride (CCl 4) (Chiu
et al. 2007; Ip et al. 1995) and ethanol (Lam et al. 2010) induced hepatotoxicity,
as well as injuries caused by drugs, such as tacrine (Pan et al. 2002) and
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 4 of 27
4
menadione (Ip et al. 2000) induced liver damage in animals. SchB also has beneficial effects on TNF alpha induced hepatic apoptosis in mice (Ip et al. 2001) and on oxidative injury or lipoperoxidative damage in vitro (Chiu and Ko 2006;
Zhang et al. 1992).
Heat shock proteins (HSPs) are a highly conserved family of proteins that facilitate proper folding or clearance of damaged proteins in the cytoplasm (Hartl
1996; Jäättelä 1999). HSPs are molecular chaperones that are essential in maintaining cellular homeostasis during normal cell growth and stressful conditions (Fink 1999; Hartl 1996). Among the HSPs, inducible HSP27 and
HSP70 have mostly been investigatedDraft for their ability to protect cells and tissues from damage caused by pathological agents (Jäättelä 1999; Kültz 2005) including liver injury (Fujimori et al. 1997; Fujisawa et al. 2013; Mikami et al.
2004). Hepatic HSP27 and HSP70 have been recently reported to be involved in protecting against D Gal induced hepatocyte apoptosis (Bao and Liu 2010a,
2010 b). HSPs also play a role in the hepatoprotective mechanism of SchB.
Previous studies report that SchB protects against CCl 4 hepatotoxicity (Tang et al. 2003) and TNF α triggered hepatic apoptosis (Ip et al. 2001) in mice or rats through an HSP inducing effect.
Our recent study has demonstrated that pretreatment with SchB significantly increases HSP27 and HSP70 expression at both the protein and gene levels in normal mice (Li et al. 2014). Furthermore, the hepatoprotection of SchB against
https://mc06.manuscriptcentral.com/cjpp-pubs Page 5 of 27 Canadian Journal of Physiology and Pharmacology
5
acetaminophen hepatotoxicity induced liver injury is also attributed to its
induction of hepatic HSP27 and HSP70 (Li et al. 2014). In the present study, we
used a D Gal induced liver injury mouse model to determine whether the
hepatoprotective effect of SchB is a result of the induction of hepatic HSPs.
Materials and methods
Chemicals and reagents
SchB was purchased from Push BioTechnology Co. Ltd. (Chengdu, China).
D Gal and Quercetin (Que) withDraft a purity of more than 98% by HPLC were
obtained from Sigma Aldrich (St. Louis, MO, USA). SchB and Que were
separately suspended in 0.5% [w/v] sodium carboxymethyl cellulose for oral
administration. D Gal was dissolved in physiological saline for injection. All other
chemicals and reagents used were of analytical grade.
Animals and treatment
Male ICR mice (18 g to 22 g) were obtained from the National Laboratory Animal
Center (Changchun, China). The animals were initially acclimated for 5 days and
maintained in a 12 h light/dark cycle of 22 °C to 24 °C and a relative humidity of
50%. Food and water were given ad libitum. The animal care and experimental
protocols were approved by Guide for the Care and Use of Laboratory Animals
(1996, published by National Academy Press, 2101 Constitution Ave. NW,
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 6 of 27
6
Washington, DC 20055, USA) and the Animal Care and Ethical Committee of
Qiqihar Medical University, China (Ethics no. 2011 2004 09).
Mice were randomly divided into six groups ( n=12) as follows: Control, D Gal,
D Gal + Que, SchB + D Gal, SchB + D Gal + Que, and Que . SchB was administered intragastrically at a dose of 200 mg/kg three times in 1 day, with an interval of 8 h. Que was given orally to mice at a dose of 200 mg/kg combined with SchB. D Gal was intraperitoneally injected once at a dosage of 800 mg/kg
12 h before the last administration of SchB . The control mice were given equal volume of vehicles. Mice were sacrificed by decapitation 4 h after the last dose of SchB . Blood samples were thenDraft harvested to determine aminotransferase activities. Liver tissues were used for subsequent analyses.
Western blot analysis
A total of 30 g of sample proteins extracted from liver tissue was separated by sodium dodecylsulfate–polyacrylamide gel electrophoresis (SDS PAGE) in a
12% polyacrylamide gel and then transferred to a polyvinylidene difluoride membrane (Pall Corp., Port Washington, NY, USA). The membranes were blocked with 5% (w/v) skim milk in Tris buffered saline with Tween 20 (TBST) for
1 h at room temperature and then probed with primary antibodies at 4 °C overnight. The antibodies were rabbit anti HSP27 (Cell Signaling, MA, USA), mouse anti HSP70 and mouse anti β actin (internal control) (Santa Cruz
Biotechnology, Santa Cruz, CA, USA). The following day, blots were incubated
https://mc06.manuscriptcentral.com/cjpp-pubs Page 7 of 27 Canadian Journal of Physiology and Pharmacology
7
with horseradish peroxidase conjugated secondary antibodies in TBST for 2 h at
room temperature. The protein bands were visualized using an enhanced
chemiluminescence plus kit (Beijing Applygen Technologies, Inc., Beijing, China)
and analyzed using Gel Pro Analyzer 4.0 software (Media Cybernetics, Rockville,
MD, USA). Each experiment was carried out in triplicate.
Real-time quantitative PCR (qPCR) assay
Total RNA isolated from the liver tissue was used to synthesize the
complementary DNA with an ExScript RT kit . Messenger RNA (mRNA) levels
were measured by real time qPCR using SYBR Premix Ex Taq in an ABI 7300
real time qPCR system (AppliedDraft Biosystems, Foster City, CA, USA). The kits
and primers were obtained from Takara Biotechnology of China (Dalian, China).
β actin primers were used as the internal control. The following primer
sequences were employed: HSP27 sense primer,
5′ GTCCCTGGACGTCAACCACT 3′, and HSP27 anti sense primer,
5′ GAGATGTAGCCATGTTCGTCCT 3′; HSP70 sense primer,
5′ CAGAGGCCAGGGCTGGATTA 3′, and HSP70 anti sense primer,
5′ ACACATGCTGGTGCTGTCACTTC 3′; β actin sense primer,
5′ CATCCGTAAAGACCTCTATGCCAAC 3′, and β actin anti sense primer,
5′ ATGGAGCCACCGAT CCACA 3′. The thermal cycling parameters were as
follows: 1 cycle of 95 °C for 30 s, 40 cycles of 5 s at 95 °C, and 31 s at 60 °C.
Threshold cycle (Ct) data were collected using Sequence Detection Software
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 8 of 27
8
version 1.2.3 (Applied Biosystems). Relative quantification of gene expression was analyzed by the 2 −∆∆ Ct method. Ct values of the HSP genes were normalized to the Ct values of β actin to obtain delta Ct (∆Ct). Fold change in
HSP genes relative to the β actin internal control was determined by the
−∆∆Ct following equation: Fold change = 2 , where ∆∆Ct = (Ct HSP gene − Ct β actin ) −
(Ct control − Ct β actin). Each experiment was conducted in triplicate.
Determination of the aminotransferase activities
The activities of alanine aminotransferase (ALT) and aspartate aminotransferase
(AST) in serum were measured using an assay kit (Beijing BHKT Clinical
Reagent Co. Ltd., Beijing, China)Draft according to the manufacturer’s instructions.
Histopathological analysis
The paraffin method was used to analyze hepatic histology. In brief, the fresh right lobe of the mouse livers was immediately fixed in 10% formalin. The tissue was then dehydrated with different grades of ethanol, embedded in paraffin, and cut into 5 m sections. The paraffin was removed with xylene and ethanol, and the slide was stained with hematoxylin and eosin. Morphological evaluation was performed under a light microscope equipped with the Nikon D600 digital camera and then analyzed by Image Pro Plus 7.0 software (Media Cybernetics).
The pathological investigator was blinded to the treatments in the experiment.
Statistical analysis
All data were expressed as mean ± standard deviation (SD). SPSS 13.0
https://mc06.manuscriptcentral.com/cjpp-pubs Page 9 of 27 Canadian Journal of Physiology and Pharmacology
9
software (SPSS Inc., Chicago, IL, USA) was used for statistical analysis.
Intergroup differences were detected using one way ANOVA, followed by
Dunnett’s test. P values <0.05 were considered statistically significant.
Results
SchB increased the expression of hepatic HSP27 and HSP70 proteins in
D-Gal-challenged mice
Western blot analysis showed that the hepatic HSP27 and HSP70 proteins in
D Gal challenged mice markedlyDraft increased compared with the normal control
group. Oral administration of SchB at 200 mg/kg increased the expression of
hepatic HSP27 and HSP70 proteins in mice more significantly, by approximately
4.9 and 3.8 fold, respectively. This result indicates that SchB exerted more
potent inducing effect on HSP27 than HSP70. However, Que inhibited the
inducing effect of SchB and D Gal both on HSP27 and HSP70. Compared with
the normal control group, Que itself exhibited no noticeable effect on the
expression of HSP27 and HSP70 proteins (Fig. 2).
SchB increased the expression of hepatic HSP27 and HSP70 mRNAs in
D-Gal-challenged mice
Real time qPCR analysis showed that hepatic HSP27 and HSP70 mRNAs in
D Gal treated mice markedly increased. SchB at 200 mg/kg upregulated the
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 10 of 27
10
expression of hepatic HSP27 and HSP70 mRNAs by approximately 6.1 and
5.3 fold, respectively, indicating that the gene level results were in accordance with HSP27 and HSP70 proteins. Increased levels of HSP27 and HSP70 mRNAs induced by SchB (200 mg/kg) were also markedly suppressed by Que
(200 mg/kg) treatment. Combined with the same observation in the protein expression, these results suggest Que is a feasible inhibitory tool in this study
(Fig. 3).
SchB-induced hepatic HSP27 and HSP70 attenuated hepatoxicity in mice treated with D-Gal
Biochemical assay showed thatDraft the serum activities of ALT and AST in
D GAL treated mice were significantly greater than those in the control group.
Oral administration with SchB (200 mg/kg) before D GAL injection in mice significantly suppressed the serum activities of ALT and AST by 60.30% and
55.61%, respectively, showing the hepatoprotective effect of SchB. However, the activities of ALT and AST relapsed when Que was co administered with SchB, without difference compared with the D GAL treated mice. By contrast, Que neither increased the serum activities of ALT and AST nor affected the increase of such activities induced by D GAL treatment (Fig. 4).
Protective effect of hepatic HSP27 and HSP70 induced by SchB against
D-Gal-induced liver injury in histology in mice
The histological assay demonstrated the normal hepatic lobular architecture and
https://mc06.manuscriptcentral.com/cjpp-pubs Page 11 of 27 Canadian Journal of Physiology and Pharmacology
11
cell structure of mice liver in the control group. Injection of D GAL resulted in
significant morphological changes in liver histology. These changes included
disseminated hepatocyte necrosis, congestion, ballooning, and destruction
around the central vein, as well as immigration of inflammatory cells, which were
markedly attenuated by SchB pretreatment in mice. However, the
hepatoprotective effect of SchB was suppressed by Que (200 mg/kg) treatment,
as indicated by heavier aggravated lesions compared with the SchB + D Gal
group. Que per se exhibited neither protective nor injurious effect in mice (Fig.
5).
Draft
Discussion
We investigated a possible molecular mechanism of the hepatoprotective effect
of SchB in a mouse model with D Gal induced acute liver injury. SchB
attenuated D Gal induced hepatic injury by overexpression of HSP27 and
HSP70 in mice.
D Gal induced acute liver injury is a widely used animal model that closely
resembles human viral hepatitis (Decker and Keppler 1972; Keppler et al. 1968).
Injection with D Gal decreases uracil nucleotides in the liver, markedly depleting
hepatic UDP glucuronic acid. D Gal inhibits hepatic glucuronidation, disrupting
the synthesis of essential uridylate nucleotides. Reduction of these nucleotides
eventually impairs protein and glycoprotein synthesis, causing progressive
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 12 of 27
12
damage of cellular membranes. This leads to changes in membrane permeability and ultimately enzyme leakage from the cells (Abdul Hussain et al.
1991; Keppler et al. 1970). In this study, we used D Gal induced acute liver injury model to investigate the actions and mechanisms of SchB. Pretreatment with SchB protected the liver against D Gal induced hepatotoxicity in mice, as demonstrated by the amelioration of histopathological hepatic necrosis and the reduction in ALT and AST activities.
HSP27 and HSP70 are multidimensional proteins that are implicated in a range of diseases; thus, they serve as disease biomarkers and may be a potential drug target (Evans etDraft al. 2010; Vidyasagar et al. 2012). Also, HSP70 has been reported to be a chaperone involved in inflammation, endoplasmic reticulum stress and apoptosis at liver level (Tarantino et al. 2012). Because
HSPs have a cytoprotective effect on tissue injury, we hypothesized that the hepatoprotective effect of SchB is due to the induction of hepatic HSPs. Our previous study confirmed that SchB induces the expression of HSP27 and
HSP70 in mice. Hepatic HSP27 and HSP70 production were enhanced following
SchB administration. HSP27 and HSP70 mRNA and protein expression increased in a time and dose dependent manner. Moreover, the pattern of protein expression paralleled mRNA levels, suggesting that the induction of hepatic HSP27 and HSP70 by SchB is through the upregulation of HSP gene transcription (Li et al. 2014). The present study demonstrated that SchB
https://mc06.manuscriptcentral.com/cjpp-pubs Page 13 of 27 Canadian Journal of Physiology and Pharmacology
13
significantly induced both mRNA levels and protein expression of HSP27 and
HSP70 in D Gal treated mice compared with D Gal alone challenged mice,
which showed higher HSP27 and HSP70 expression than the normal control
group.
To investigate whether the upregulation of HSP27 and HSP70 by SchB is
responsible for its hepatoprotective action against D Gal induced liver injury, we
used Que, an inhibitor of HSP biosynthesis (Gonzalez et al. 2009; Hosokawa et
al. 1990; Nagai et al. 1995). The results showed that Que significantly
suppressed the induction of hepatic HSP27 and HSP70 by SchB, but Que itself
did not affect the expression ofDraft hepatic HSP27 and HSP70 in the normal control
or D Gal injected mice. In the SchB (200 mg/kg) pretreated mice, compared with
D Gal treated mice, reduced ALT and AST activities and decreased extent of
hepatic necrosis were observed. This finding suggests that SchB has a
protective effect on D Gal induced liver injury. Simultaneous administration of
Que (200 mg/kg) and SchB (200 mg/kg) in D Gal treated mice attenuated the
protective effect of SchB on ALT and AST activities and hepatic necrosis, but
Que itself exhibited neither hepatoprotective nor injurious effect on mice. Our
results demonstrated that Que treatment markedly suppressed the
hepatoprotective effect of SchB, suggesting that the increased HSP27 and
HSP70 expression following SchB treatment contributed to mitigate the extent of
D Gal induced liver injury.
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 14 of 27
14
In summary, we found that oral administration of SchB markedly alleviated
D Gal induced liver injury in mice, as demonstrated by the reduction in ALT and
AST activities and decreased hepatic necrosis, accompanied by the overexpression of HSP27 and HSP70 in the mouse liver. However, the hepatoprotective effects of SchB were significantly attenuated by Que, an inhibitor of HSP biosynthesis. Our findings revealed that SchB administration provide a significant hepatoprotective effect against D Gal induced liver injury in mice, and HSP27 and HSP70 contribute to the protection of SchB.
Because HSPs occur and function endogenously, the upregulation of HSP function by pharmacological approachDraft may provide a potential prophylactic or therapeutic drug target for treatment of liver diseases (Latchman. 1998), such as inducing HSP expression in the treatment of liver injury. Therefore, SchB, with its
HSP inducing capability, might be a potential candidate compound for hepatitis or other hepatic diseases in the future.
Acknowledgements
This work was supported by the Scientific Research Fund of Heilongjiang
Province Education Department of China [grant number: 1155G68]. We also thank the Basic Medical Research Section and Molecular Biological Experiment
Center of Qiqihar Medical University for their help.
Conflict of interest
We declare no conflict of interest.
https://mc06.manuscriptcentral.com/cjpp-pubs Page 15 of 27 Canadian Journal of Physiology and Pharmacology
15
References
Abdul Hussain, S. K., and Mehendale, H. M. 1991. Studies on the
age dependent effects of galactosamine in primary rat hepatocyte cultures.
Toxicol. Appl. Pharmacol. 107(3): 504 513. PMID: 2000637.
Bao, X. Q., and Liu, G. T. 2010 a. Bicyclol protects HepG2 cells against
D galactosamine induced apoptosis through inducing heat shock protein 27 and
mitochondria associated pathway. Acta Pharmacol. Sin. 31(2): 219 226. doi:
10.1038/aps.2009.194. PMID: 20139905.
Bao, X. Q., and Liu, G. T. 2010 b. Involvement of HSP70 in the protection of
bicyclol on apoptosis of HepG2Draft cells intoxicated by d galactosamine. J. Asian
Nat. Prod. Res. 12(4): 313 323. doi: 10.1080/10286021003769924. PMID:
20419542.
Chan, S. W. 2012. Panax ginseng, Rhodiola rosea and Schisandra chinensis. Int.
J. Food Sci. Nutr. 63 Suppl 1: 75 81. doi: 10.3109/09637486.2011.627840.
PMID: 22039930.
Chiu, P. Y., and Ko, K. M. 2006. Schisandrin B induced increase in cellular
glutathione level and protection against oxidant injury are mediated by the
enhancement of glutathione synthesis and regeneration in AML12 and H9c2
cells. Biofactors, 26(4): 221 230. PMID: 17119269.
Chiu, P. Y., Leung, H. Y., Siu, A. H., Poon, M. K., and Ko, K. M. 2007.
Schisandrin B decreases the sensitivity of mitochondria to calcium ion induced
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 16 of 27
16
permeability transition and protects against carbon tetrachloride toxicity in mouse livers. Biol. Pharm. Bull. 30(6): 1108 1112. PMID: 17541162.
Decker, K., and Keppler, D. 1972. Galactosamine induced liver injury. Prog. Liver
Dis. 4: 183 199. PMID: 4631501.
Evans, C. G., Chang, L., and Gestwicki, J. E. 2010. Heat shock protein 70
(hsp70) as an emerging drug target. J. Med. Chem. 53(12): 4585 4602. doi:
10.1021/jm100054f. PMID: 20334364.
Fink, A. L. 1999. Chaperone mediated protein folding. Physiol. Rev. 79(2):
425 449. PMID: 10221986.
Fujimori, S., Otaka, M., Otani,Draft S., Jin, M., Okuyama, A., Itoh, S., et al. 1997.
Induction of a 72 kDa heat shock protein and cytoprotection against thioacetamide induced liver injury in rats. Dig. Dis. Sci. 42(9): 1987 1994. PMID:
9331166.
Fujisawa, K., Yabuuchi, C., Izawa, T., Kuwamura, M., Takasu, N., Torii, M., et al.
2013. Expression patterns of heat shock protein 25 in carbon tetrachloride induced rat liver injury. Exp. Toxicol. Pathol. 65(5): 469 476. doi:
10.1016/j.etp.2012.02.001. PMID: 22417648.
Gonzalez, O., Fontanes, V., Raychaudhuri, S., Loo, R., Loo, J., Arumugaswami,
V., et al. 2009. The heat shock protein inhibitor Quercetin attenuates hepatitis C virus production. Hepatology, 50(6): 1756 1764. doi: 10.1002/hep.23232. PMID:
19839005.
https://mc06.manuscriptcentral.com/cjpp-pubs Page 17 of 27 Canadian Journal of Physiology and Pharmacology
17
Hartl, F. U. 1996. Molecular chaperones in cellular protein folding. Nature,
381(6583): 571 579. doi: 10.1038/381571a0. PMID: 8637592.
Hosokawa, N., Hirayoshi, K., Nakai, A., Hosokawa, Y., Marui, N., Yoshida, M., et
al. 1990. Flavonoids inhibit the expression of heat shock proteins. Cell Struct.
Funct. 15(6): 393 401. PMID: 2085852.
Hwang, J. M., Tseng, T. H., Tsai, Y. Y., Lee, H. J., Chou, F. P., Wang, C. J., et al.
2005. Protective effects of baicalein on tert butyl hydroperoxide induced hepatic
toxicity in rat hepatocytes. J. Biomed. Sci. 12(2): 389 397. doi:
10.1007/s11373 005 1572 8. PMID: 15917992.
Ip, S. P., Poon, M. K., Wu, S. S.,Draft Che, C. T., Ng, K. H., Kong, Y. C., et al. 1995.
Effect of schisandrin B on hepatic glutathione antioxidant system in mice:
protection against carbon tetrachloride toxicity. Planta Med. 61(5): 398 401. doi:
10.1055/s 2006 958123. PMID: 7480197.
Ip, S. P., Yiu, H. Y., and Ko, K. M. 2000. Schisandrin B protects against
menadione induced hepatotoxicity by enhancing DT diaphorase activity. Mol.
Cell. Biochem. 208(1 2): 151 155. PMID: 10939639.
Ip, S. P., Che, C. T., Kong, Y. C., and Ko, K. M. 2001. Effects of schisandrin B
pretreatment on tumor necrosis factor alpha induced apoptosis and Hsp70
expression in mouse liver. Cell Stress Chaperones, 6(1): 44 48. PMID:
11525242.
Jäättelä, M. 1999. Heat shock proteins as cellular lifeguards. Ann. Med. 31(4):
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 18 of 27
18
261 271. PMID: 10480757.
Keppler, D., Lesch, R., Reutter, W., and Decker, K. 1968. Experimental hepatitis induced by D galactosamine. Exp. Mol. Pathol. 9(2): 279 290. PMID: 4952077.
Keppler, D. O., Rudigier, J. F., Bischoff, E., and Decker, K. F. 1970. The trapping of uridine phosphates by D galactosamine. D glucosamine, and
2 deoxy D galactose. A study on the mechanism of galactosamine hepatitis. Eur.
J. Biochem. 17(2): 246 253. PMID: 5500393.
Kültz, D. 2005. Molecular and evolutionary basis of the cellular stress response.
Annu. Rev. Physiol. 67: 225 257. doi:
10.1146/annurev.physiol.67.040403.103635.Draft PMID: 15709958.
Lam, P. Y., Chiu, P. Y., Leung, H. Y., Chen, N., Leong, P. K., and Ko, K. M. 2010.
Schisandrin B co treatment ameliorates the impairment on mitochondrial antioxidant status in various tissues of long term ethanol treated rats. Fitoterapia,
81(8): 1239 1245. doi: 10.1016/j.fitote.2010.08.010. PMID: 20800090.
Latchman, D. S. 1998. Heat shock proteins: protective effect and potential therapeutic use (review). Int. J. Mol. Med. 2(4): 375 381. PMID: 9857220.
Li, L., Zhang, T., Zhou, L., Zhou, L., Xing, G., Chen, Y., et al. 2014. Schisandrin B attenuates acetaminophen induced hepatic injury through heat shock protein 27 and 70 in mice. J. Gastroenterol. Hepatol. 29(3): 640 647. doi:
10.1111/jgh.12425. PMID: 24219791.
Liu, G. T. 1989. Pharmacological actions and clinical use of fructus schizandrae.
https://mc06.manuscriptcentral.com/cjpp-pubs Page 19 of 27 Canadian Journal of Physiology and Pharmacology
19
Chin. Med. J (Engl). 102(10): 740 749.PMID: 2517053.
Mikami, K., Otaka, M., Goto, T., Miura, K., Ohshima, S., Yoneyama, K., et al.
2004. Induction of a 72 kDa heat shock protein and protection against
lipopolysaccharide induced liver injury in cirrhotic rats. J. Gastroenterol. Hepatol.
19(8): 884 890. doi: 10.1111/j.1440 1746.2004.03401.x. PMID: 15242491.
Myagmar, B. E., Shinno, E., Ichiba, T., and Aniya, Y. 2004. Antioxidant activity of
medicinal herb Rhodococcum vitis idaea on galactosamine induced liver injury
in rats. Phytomedicine, 11(5): 416 423. doi: 10.1016/j.phymed.2003.04.003.
PMID: 15330497.
Nagai, N., Nakai, A., and Nagata,Draft K. 1995. Quercetin suppresses heat shock
response by down regulation of HSF1. Biochem. Biophys. Res. Commun. 208(3):
1099 1105. doi: 10.1006/bbrc.1995.1447. PMID: 7702609.
Pan, S. Y., Han, Y. F., Carlier, P. R., Pang, Y. P., Mak, D. H., Lam, B. Y., et al.
2002. Schisandrin B protects against tacrine and bis(7) tacrine induced
hepatotoxicity and enhances cognitive function in mice. Planta Med. 68(3):
217 220. doi: 10.1055/s 2002 23145. PMID: 11914957.
Tang, M. H., Chiu, P. Y., and Ko, K. M. 2003. Hepatoprotective action of
schisandrin B against carbon tetrachloride toxicity was mediated by both
enhancement of mitochondrial glutathione status and induction of heat shock
proteins in mice. Biofactors, 19(1 2): 33 42. PMID: 14757975.
Tarantino, G., Finelli, C., Colao, A., Capone, D., Tarantino, M., Grimaldi, E., et al.
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 20 of 27
20
2012. Are hepatic steatosis and carotid intima media thickness associated in obese patients with normal or slightly elevated gamma glutamyl transferase? J.
Transl. Med. 10:50. doi: 10.1186/1479 5876 10 50. PMID: 22424154.
Vidyasagar, A., Wilson, N. A., and Djamali, A. 2012. Heat shock protein 27
(HSP27): biomarker of disease and therapeutic target. Fibrogenesis Tissue
Repair, 5(1): 7. doi: 10.1186/1755 1536 5 7. PMID: 22564335.
Visen, P. K., Saraswat, B., and Dhawan, B. N. 1998. Curative effect of picroliv on primary cultured rat hepatocytes against different hepatotoxins: an in vitro study.
J. Pharmacol. Toxicol. Methods, 40(3): 173 179. PMID: 10334634.
Zhang, T. M., Wang, B. E., andDraft Liu, G. T. 1992. Effect of schisandrin B on lipoperoxidative damage to plasma membrane of rat liver in vitro. Zhongguo Yao
Li Xue Bao, 13(3): 255 258. PMID: 1442110.
Zou, Y., Yang, Y., Li, J., Li, W., and Wu, Q. 2006. Prevention of hepatic injury by a traditional Chinese formulation, BJ JN, in mice treated with
Bacille Calmette Guerin and lipopolysaccharide. J. Ethnopharmacol. 107(3):
442 448. doi: 10.1016/j.jep. 2006.04.006. PMID: 16697540.
https://mc06.manuscriptcentral.com/cjpp-pubs Page 21 of 27 Canadian Journal of Physiology and Pharmacology
21
Figure captions:
Fig. 1 Chemical Structure of Schisandrin B
Fig. 2 Schisandrin B (SchB) increased protein expression of hepatic Heat shock
protein (HSP) 27 and HSP70 in D galactosamine (D Gal) challenged mice. Mice
were orally given SchB (200 mg/kg) three times in 24 h or co treated with
Quercetin (Que) (200 mg/kg), and D Gal (800 mg/kg) was intraperitoneally
injected once 12 h before the last administration of SchB. The control animals
were given the equal volume (20 mL/kg) of vehicles only. Liver tissue samples
were harvested at 4 h after the last dose of SchB, whole liver proteins were extracted, and the protein expressionDraft of hepatic HSP27 and HSP70 was detected by Western blot analysis. (a) Representative Western blot analysis of
HSP27 and HSP70 protein from each group. (b) Levels of hepatic HSP27 and
HSP70 proteins. Protein levels were expressed as mean ± Standard Deviation
(SD) (n=5) in each column. The lanes were normalized to the levels of β actin. * P
<0.05, ** P <0.01 compared with corresponding control group; # P <0.05
compared with corresponding D Gal group; && P < 0.01 compared with
corresponding SchB+D Gal group. Similar results were obtained with three
replications.
Fig. 3 Schisandrin B (SchB) increased expression of hepatic Heat shock protein
(HSP) 27 and HSP70 mRNA in D galactosamine (D Gal) challenged mice.
Animal treatment was as described as in Fig. 2. After mice sacrificed, total RNA
was isolated from liver tissue samples using RNAiso reagent and then
subsequently used for cDNA synthesis. The 2 ∆∆ Ct analyses of quantitative
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 22 of 27
22
polymerase chain reaction (qPCR) of HSP27 and HSP70 were obtained from 5 mice per group. Data were expressed as mean ± Standard Deviation (SD). ** P <
0.01 compared with the corresponding vehicle treated mice; ## P <0.01, compared with corresponding D Gal group; & P < 0.05 compared with corresponding SchB + D Gal group. Similar results were obtained with three replications. Que, Quercetin.
Fig. 4 Schisandrin B (SchB) induced hepatic Heat shock protein (HSP) 27 and
HSP70 attenuated hepatoxicity in mice treated with D galactosamine (D Gal).
Mice were treated as described as in Fig. 2. Blood samples were harvested and then serum was separated forDraft determination of (a) ALT and (b) AST activities according to the manufacturer’s instruction. Data were expressed as mean ± Standard Deviation (SD) (n=12). ** P < 0.01 compared with the corresponding control group; ## P <0.01, compared with corresponding D Gal group; && P < 0.01 compared with corresponding SchB + D Gal group. Que,
Quercetin; ALT, alanine aminotransferase; AST, aspartate aminotransferase.
Fig. 5 Protective effect of hepatic Heat shock protein (HSP) 27 and HSP70 induced by Schisandrin B (SchB) against D galactosamine (D Gal) induced liver injury in histology in mice. Mice were treated as described as in Fig. 2. Liver sections were stained with hematoxylin eosin for morphological evaluation
(magnification: 100 ×)
https://mc06.manuscriptcentral.com/cjpp-pubs Page 23 of 27 Canadian Journal of Physiology and Pharmacology
Draft
81x70mm (300 x 300 DPI)
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 24 of 27
Draft
182x196mm (300 x 300 DPI)
https://mc06.manuscriptcentral.com/cjpp-pubs Page 25 of 27 Canadian Journal of Physiology and Pharmacology
Draft
86x71mm (300 x 300 DPI)
https://mc06.manuscriptcentral.com/cjpp-pubs Canadian Journal of Physiology and Pharmacology Page 26 of 27
Draft
153x236mm (300 x 300 DPI)
https://mc06.manuscriptcentral.com/cjpp-pubs Page 27 of 27 Canadian Journal of Physiology and Pharmacology
Draft
110x67mm (300 x 300 DPI)
https://mc06.manuscriptcentral.com/cjpp-pubs