Analysis of Plant Dehydrin Promoters

Analysis of plant dehydrin promoters

Yevgen Zolotarov

Department of Plant Science McGill University, Montreal, Quebec, Canada

May, 2014

A thesis submitted to McGill University in partial fulfillment of the requirements of the degree of Master of Science

Abstract Transcriptional regulation is an important mechanism of gene expression modulation. The two studies presented here looked at transcriptional control of dehydrin genes. In the first study, promoters of KS dehydrin orthologues from an arctic and temperate Oxytropis species were compared. A region in the promoter from the temperate species was identified to be responsible for the repression of expression of a reporter gene under the promoter’s control. In the second study, using de novo motif discovery, promoters of five subclasses of dehydrins were analyzed. It was shown that each subclass contains overrepresented motifs in their promoters, which could help explain dehydrins’ expression patterns in response to various environmental stresses.

Résumé La régulation transcriptionnelle est un mécanisme important de la modulation de l'expression génique. Les deux études présentées ici ont examiné le contrôle transcriptionnel de gènes de type déhydrine. Dans la première étude, les promoteurs de deux orthologues de déhydrine KS des espèces arctique et tempérée du genre Oxytropis ont été comparés. Une région dans le promoteur de l'espèce tempérée a été identifiée comme étant responsable de la répression d'expression d'un gène rapporteur sous le contrôle du promoteur. Dans la deuxième étude, à l'aide de la découverte de motifs de novo, les promoteurs des cinq sous-classes de déhydrines ont été analysés. Il a été démontré que chaque sous-classe contient des motifs surreprésentés dans leurs promoteurs, ce qui pourrait aider à expliquer les profils d'expression de déhydrines en réponse aux divers stress environnementaux.

iii

Acknowledgements I would like to thank Dr. Martina Strömvik for her indispensable guidance, support and patience. I would also like to thank members of my research advisory committee, Dr. Jean-Benoit Charron and Dr. Reza Salavati, for their advice. This project wouldn't have been possible without Annie Archambault, who paved the way for my Master's research project. I am also thankful to Annie for preparing Oxytropis arctobia and Oxytropis splendens GenomeWalker libraries.

Table of contents

Abstract ...... ii Résumé ...... iii Acknowledgements ...... iv Table of contents...... v List of tables ...... vii List of figures ...... viii List of abbreviations ...... ix Thesis format ...... x Contributions of authors ...... xi 1. Introduction ...... 1 1.1 General introduction ...... 1 1.2 Hypotheses ...... 2 1.3 Objectives...... 2 2. Literature Review ...... 4 2.1 Gene expression regulation in plants under osmotic stresses ...... 4 2.2 Cold acclimation ...... 4 2.2.1 Introduction ...... 4 2.2.2 Transcription factors involved in cold acclimation ...... 6 2.2.3 Dehydrins and osmoprotectants ...... 10 2.3 Modulation of plant gene expression ...... 11 2.3.1 Promoters ...... 11 2.3.2 3′ UTR ...... 12 2.4 Gene regulation in Arctic plant species ...... 13 2.5 De novo motif discovery ...... 15 2.6 Published plant genomes ...... 15 Preface to chapter 3 ...... 17 3. In planta and in silico analysis of Oxytropis splendens and Oxytropis arctobia KS dehydrin promoters ...... 18 3.1 Introduction ...... 18 3.2 Materials & methods ...... 19 3.2.1 Isolation of KS dehydrin promoter and 3′ UTR regions from O. arctobia and O. splendens ...... 19 3.2.2 Sequencing ...... 20 3.2.3 Construction of KS dehydrin promoter::gusA fusion vectors ...... 21 3.2.4 Transformation of Arabidopsis thaliana by floral dip method ...... 27 3.2.5 Sequence analysis ...... 28 3.2.6 Stress tests and ABA treatment ...... 28 3.3 Results ...... 30 3.3.1 KS dehydrin proximal promoters and 3′ UTR from O. arctobia and O. splendens show high identity ...... 30

3.3.2 Multiple motifs linked with response to osmotic stresses is found in Oxytropis KS dehydrin promoters ...... 31 3.3.3 KS dehydrin promoter from the arctic species drives constitutive reporter gene expression in Arabidopsis ...... 36 3.4 Discussion ...... 39 3.4.1 KS dehydrin proximal promoters and 3′ UTR from O. arctobia and O. splendens show high identity ...... 39 3.4.2 Multiple motifs linked with response to osmotic stresses are found in Oxytropis KS dehydrin promoters ...... 39 3.4.3 KS dehydrin promoter from the arctic species drives constitutive reporter gene expression in Arabidopsis ...... 43 Preface to chapter 4 ...... 44 4. De novo regulatory motif discovery identifies significant motifs in promoters of five classes of plant dehydrin genes ...... 45 4.1 Abstract ...... 45 4.2 Background ...... 45 4.3 Results and Discussion ...... 48 4.3.1 Promoters of KS dehydrins have one conserved GATA motif ...... 48 4.3.2 Motifs discovered in promoters of Kn dehydrins suggest guard-cell and seed specific gene regulation ...... 52 4.3.3 SKn dehydrins contain multiple cold/dehydration, abscisic acid and light regulated response elements ...... 54 4.3.4 YnSKn dehydrins promoters contain multiple ABREs, light REs and a CRT ...... 58 4.3.5: YnKn dehydrins promoters contain ABREs and light REs ...... 60 4.3.6 Acidic and basic dehydrins contain similar motifs ...... 60 4.3.7 Conclusions ...... 64 4.4 Methods ...... 65 4.4.1 Plant genomes used in the computational analyses ...... 65 4.4.2 Identification of dehydrin genes ...... 66 4.4.3 De novo motif discovery ...... 67 4.5 Acknowledgements ...... 67 5. Conclusions and future research directions ...... 68 Appendix I ...... 69 Appendix II ...... 70 Appendix III ...... 71 Appendix IV ...... 72 Appendix V ...... 73 Appendix VI ...... 74 Appendix VII ...... 77 List of references ...... 78

List of tables Table 3.1: Cloning and sequencing primers used to isolate promoter and 3′ UTR region of KS dehydrin from O. arctobia and O.splendens...... 22 Table 3.2a: Sequence identity (%) of isolated KS dehydrin promoter regions...... 31 Table 3.2b: Sequence identity (%) of isolated KS dehydrin 3′ UTR...... 31 Table 3.3 Occurrence and function of CREs in Oxytropis KS dehydrin 1000 bp promoters...... 32 Table 4.1: Number of analyzed dehydrin promoters per species...... 48 Table 4.2a: Selected de novo motifs found in KS dehydrin promoters and their putative function identified through PLACE database...... 51

Table 4.2b: Selected de novo motifs found in Kn dehydrin promoters and their putative function identified through PLACE database...... 54

Table 4.2c: Selected de novo motifs found in SKn dehydrin promoters and their putative function identified through PLACE database...... 57

Table 4.2d: Selected de novo motifs found in YnSKn dehydrin promoters and their putative function identified through PLACE database...... 60

Table 4.2e: Selected de novo motifs found in YnKn dehydrin promoters and their putative function identified through PLACE database...... 62 Table 4.3a: Selected de novo motifs found in acidic dehydrin promoters and their putative function identified through PLACE database...... 63 Table 4.3b: Selected de novo motifs found in basic dehydrin promoters and their putative function identified through PLACE database...... 64 Supplementary Table 1: List of bacterial clones carrying vectors used in the experiments...... 75 Supplementary Table 2. Number of transgenic lines showing GUS expression...... 78

vii

List of figures Figure 3.1: Alignment of 1000 bp of O. arctobia (OA) and O. splendens (OS) KS dehydrin promoters with putative motif locations indicated...... 35 Figure 3.2: Comparative representation of promoters used in constructs...... 36 Figure 3.3: Arabidopsis rosette leaves showing GUS reporter gene expression under the control of different lengths of Oxytropis KS dehydrin promoters...... 37

viii

List of abbreviations ABA Abscisic acid ABRE Abscisic acid response element AP1 Outer adaptor primer AP2 Nested adaptor primer CRE Cis-regulatory element (or cis-acting regulatory element) DNA Deoxyribonucleic acid GSP1 Outer gene-specific primer GSP2 Nested gene-specific primer GUS Glucuronidase LB Lysogeny broth mRNA Messenger RNA PCR Polymerase chain reaction PFM Position frequency matrix PLACE Plant cis-acting regulatory DNA elements (database) PWM Position weight matrix RE Response element RNA Ribonucleic acid rpm Revolutions per minute TF Transcription factor TSS Transcription start site UTR Untranslated region

Thesis format This thesis is presented in manuscript-based format. Two manuscripts are included as chapters. Chapter 3, entitled "In planta and in silico analysis of Oxytropis arctobia and Oxytropis splendens KS dehydrin promoters", will be submitted for publication in 2014. Chapter 4, entitled "De novo regulatory motif discovery identifies significant motifs in promoters of five classes of plant dehydrin genes", was submitted to Plant Molecular Biology in January 2014, and is under revision for re-submission to Plant Molecular Biology. The two manuscripts have been reformatted for thesis consistency.

Contributions of authors Chapter 3 is co-authored by Y. Zolotarov, A. Archambault and M. Strömvik. M. Strömvik designed the project, A. Archambault created Oxytropis arctobia and Oxytropis splendens GenomeWalker libraries, Y. Zolotarov performed the experiments and wrote the initial manuscript. All authors have participated in writing the final version of the manuscript.

Chapter 4 is co-authored by Y. Zolotarov and M. Strömvik. M. Strömvik conceived the idea and Y. Zolotarov developed the study, performed the analyses, and wrote the initial manuscript. Y. Zolotarov and M. Strömvik interpreted the data and wrote the final version of the manuscript.

1. Introduction 1.1 General introduction Cold acclimation is a process through which plants acquire the ability to tolerate freezing temperatures after exposure to low non-freezing temperatures. It is a complex process, still largely unknown, that involves gene regulatory changes in a large portion of the genome. During the onset of cold, plants have to adjust to decreased water availability and lower amount of sunlight. Arctic plants on the other hand, have to be prepared for freezing temperatures at all times, and so are adapted to severe environmental conditions. Two closely related Oxytropis species (Fabaceae), one residing in the arctic and the other native to temperate climate zones, were previously shown to regulate at least one gene differently from each other when grown in temperate and arctic conditions. This gene, a cold-regulated KS dehydrin, is constitutively expressed in the arctic O. arctobia species whereas in the temperate O. splendens, it is significantly upregulated only after exposure to cold (Archambault and Strömvik, 2011a).

There are several levels of gene expression modulation, with transcriptional control being the most prevalent (Mahadevappa and Warrington, 2002). Transcriptional control is carried out through the combined activity of numerous transcription factors that recognize cis-regulatory elements located in the promoter, upstream of the transcription start site, and either activate or repress the transcription of a gene.

To elucidate the molecular mechanism behind the difference in gene regulation between the two species, promoters of KS dehydrins were isolated, sequenced and transformed into Arabidopsis thaliana in a construct with the GUS reporter gene. In addition, to understand the transcriptional modulation of different classes of dehydrin, de novo motif discovery in promoters of dehydrins from 40 species was performed.

1.2 Hypotheses 1. Differences in putative cis-regulatory elements in the promoters of KS dehydrin genes from temperate and arctic Oxytropis species can help explain the different KS dehydrin gene regulation in the two species. 2. Reporter gene expression driven by the promoters of orthologous KS dehydrin genes from the temperate and arctic Oxytropis species will exhibit different patterns of expression in transgenic A. thaliana. 3. Partial O. arctobia and O. splendens promoters (<1000 bp) with and without putative CREs identified in hypothesis 1 will drive differential gene expression in A. thaliana

4. De novo motif discovery in promoters of different types (Kn, KS, SKn, YnKn,

YnSKn) of plant dehydrins will reveal motifs responsible for specific expression of these dehydrins induced by ABA, cold and drought.

1.3 Objectives Objective 1: Isolation and sequence analysis of coding sequences and promoters of KS dehydrin orthologues from Oxytropis arctobia and Oxytropis splendens involved in cold acclimation  Isolate and sequence more than 1 Kb promoter region located upstream of the start codon of Oxytropis arctobia and Oxytropis splendens KS dehydrin gene  Isolate and sequence the 3′ UTR region of the Oxytropis arctobia and Oxytropis splendens KS dehydrin gene  Identify putative cis-regulatory elements in the isolated promoters and compare their number and positioning.

Objective 2: Transformation of Arabidopsis thaliana with constructs containing KS dehydrin promoters  Transform A. thaliana with GUS reporter gene constructs containing 1000 bp, 520 bp and 467 bp of the promoters of orthologous KS dehydrin genes  Assess GUS expression in the T2 plants exposed to different environmental stresses

Objective 3: De novo motif discovery in promoters of plant dehydrin  Identify plant dehydrins in published genomes using K-segment Position Frequency Matrices (PFMs)  Group dehydrins by type using K-segment and Y-segment PFMs and S-segment occurrence  Obtain promoters of grouped dehydrins  Perform de novo motif discovery on grouped promoters  Analyze significant motifs using STAMP web server and PLACE database

2. Literature Review 2.1 Gene expression regulation in plants under osmotic stresses Environmental stresses, such as drought, high salinity and freezing temperatures, reduce water potential and cause osmotic stress in plants. Even though initially these stresses seem to be quite different, their physiological effect on plant cells is similar in that the water availability decreases. Gene expression is accordingly adjusted to cope with lack of water within the cells. There is some overlap in transcriptomic changes in response to osmotic stresses. For example, in Arabidopsis, after 3 hours exposure to either drought, high salinity or cold, 3% of the genes with significant change in transcription are shared in response to all three osmotic stresses (Kreps et al., 2002). Another study found that 22 genes are shared in response to osmotic stresses, which represented 4.6% of all significantly up- or down-regulated genes (Seki et al., 2002). Many more genes were shared between high salinity and drought, than between cold exposure and two other osmotic stresses. Around 11% of all stress-inducible genes were transcription factors (Seki et al., 2002). Promoter analysis of the 22 shared genes indicated that most of them contained a C-repeat (CCGAC) core CRE and an abscisic acid response element (PyACGTG(T/G)C) (Seki et al., 2002). The presence of these CREs is expected, since transcription in response to osmotic stresses can be modulated in either an ABA-dependent or independent manner (Shinozaki and Yamaguchi-Shinozaki, 2000; Agarwal and Jha, 2010).

2.2 Cold acclimation 2.2.1 Introduction Cold acclimation is a process through which plants acquire the ability to tolerate freezing temperatures after an exposure to low non-freezing temperatures (Chinnusamy et al., 2007). It is a complex process that involves regulatory changes in a large portion of the genome. During the onset of cold, plants have to adjust to decreased water availability and lower amount of sunlight. Temperature decrease causes changes in

protein conformation, decrease in cellular membrane fluidity, and it inhibits metabolic reactions. The early sequence of events that allow plants to acclimate to cold begins with membrane rigidification, followed by disruption of actin filaments and that results in the release of calcium ions from apoplast (Örvar et al., 2000). Membrane rigidification is the first step that results in the activation of cold responsive genes. Treatment with dimethyl sulfoxide, a membrane rigidifier, at 25 °C, caused an increase of a reporter gene expression driven by a cold-inducible gene promoter BN115 in Brassica napus (Sangwan et al., 2001). Membrane rigidification, and rearrangement of microtubules and actin filaments activates mechanosensitive Ca2+ channels in alfalfa and B. napus, which results in an influx of calcium ions into cytosol from cell wall and internal stores (Örvar et al., 2000; Sangwan et al., 2001). Calcium is a ubiquitous secondary messenger and the increase of its cytosolic concentration in response to environmental stresses affects the activity of numerous proteins. Calmodulin (CaM), calcium-dependent protein kinases and calcineurin-like proteins are some of the examples of Ca2+-dependent proteins that transduce various stress signals from calcium to other proteins that modulate gene expression. It has been shown that in Arabidopsis thaliana, the promoters of Ca2+-responsive genes contain two motifs that match abscisic acid related cis element (ABRE) and ABRE coupling element (ABRE-CE) (Kaplan et al., 2006). In A. thaliana, 75% of metabolites screened have increased in response to low temperature, some as much as 25-fold (Cook et al., 2004). The metabolites that increased in content included amines, carbohydrates and organic acids (Cook et al., 2004). Many of these metabolites can act as osmoprotectants, and some, such as proline, can act as signals for modulation of gene expression (Chinnusamy et al., 2007). In Arabidopsis, from 4% (Lee et al., 2005) to 20% (Hannah et al., 2005) of genes are considered to be cold-regulated. With that many genes involved in the cold response, the transcriptional regulation is very complex and numerous transcription factors are involved in the modulation of gene expression (Lee et al., 2005).

2.2.2 Transcription factors involved in cold acclimation 2.2.2.1 CBFs C-repeat binding factors (CBFs) are considered the key transcription factors in the modulation of the expression of genes in plants under osmotic stress. CBFs are also known as dehydration response element binding (DREB) factors. There are four known CBF transcription factors in Arabidopsis. CBF1, CBF2 and CBF3 are involved in low temperature-dependent response pathway (Novillo et al., 2004), whereas CBF4 is involved in abscisic acid (ABA) response pathway and drought tolerance but not in cold acclimation (Haake et al., 2002). CBF1, CBF2 and CBF3 are located on chromosome IV in Arabidopsis and they are organized in tandem. Their high sequence similarity and the location in the genome indicate that they are paralogues of an original gene, and have evolved through duplication and divergence (Medina et al., 1999). CBFs belong to the APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) family of transcription factors, and they recognize a C-repeat (CRT) motif (CCGAC core) in the promoters of cold responsive (COR) genes (Knight et al., 2004; Lee et al., 2005). CBFs contain one AP2 DNA-binding domain and they have two signature segments – PKKP/RAGRxKFxETRHP (abbreviated PKKPAGR) and DSAWR, flanking the AP2 domain. These signature motifs are highly conserved in other plant species. PKKPAGR is required for the induction of COR genes and its deletion greatly impairs CBF1 binding to the CRT cis-regulatory element (Canella et al., 2010). Genes that belong to the CBF regulon include transcription factors (e.g. RAP2.1 and RAP2.6), sugar transporters, water channel proteins, galactinol synthase (Fowler and Thomashow, 2002), dehydrins and other late embryogenesis abundant (LEA) proteins, protease inhibitors and proteins involved in metabolism (Maruyama et al., 2004). Two transcription factors that repress the trans-activation of genes, SZT and CZF2 (At5g04340), are also upregulated in response to CBF3 overexpression (Maruyama et al., 2004). It has been shown that SZT overexpression causes downregulation of genes involved in photosynthesis and carbohydrate metabolism. This suggests that SZT is involved in growth retardation in response to stress (Maruyama et al., 2004). In Arabidopsis plants exposed to cold, 75% of all screened metabolites have

increased in concentration and, out of those, 79% were also increased in plants overexpressing CBF3 (Cook et al., 2004) indicating that the CBF pathway plays a significant role in cold acclimation. Interestingly, it has been shown that despite their sequence similarity, CBF2 differs in its effect from CBF1 and CBF3 (Novillo et al., 2004). Mutant cbf2 Arabidopsis plants exhibited better freezing tolerance than wild-type plants. In addition, the levels of CBF1 and CBF3, as well as the levels of downstream COR genes, were higher in the cbf2 mutant than in wild-type plants. Temporal regulation of CBF1 and CBF3 differs from that of CBF2: in the two first paralogues, expression levels peak at around one hour after exposure to cold. In the last paralogue, expression levels peak at around three hours after cold exposure. These results indicate that CBF2 acts as a negative regulator of CBF1 and CBF3, providing tight control of the expression of downstream genes and the transcription factors themselves (Novillo et al., 2004; Medina et al., 2011). Ectopic expression of CBF1 in Arabidopsis promoted the expression of COR genes even at warm temperatures, which was enough to induce cold acclimation (Stockinger et al., 1997; Liu et al., 1998). In transgenic tomatoes, which are not capable of cold acclimation, expressing Arabidopsis CBF1, plant survival after exposure to cold increased fivefold (Singh et al., 2011). Other transgenic plants expressing Arabidopsis CBFs, such as rice (Ito et al., 2006), Brassica napus (Jaglo et al., 2001), wheat (Pellegrineschi et al., 2004) and tobacco (Kasuga et al., 2004), exhibited improved cold tolerance when compared to non-transgenic controls. CBF cold response pathway is highly conserved in plants both capable (e.g.: barley, B. napus, oat, rye, winter wheat) and incapable (e.g.: cotton, maize, rice, soybean, tomato) of cold acclimation (Jaglo et al., 2001; Chinnusamy et al., 2007). Higher freezing tolerance was observed in transgenic plants overexpressing CBFs from other species, such as Arabidopsis transformed with maize (Qin et al., 2004) or rice CBF (Ito et al., 2006); rice transformed with barley CBF (Oh et al., 2007); China rose transformed with Medicago truncatula CBF (Chen et al., 2010); alfalfa transferred with soybean CBF (Jin et al., 2010) and many others (Kitashiba et al., 2004; Oh et al., 2005; Pino et al., 2007; Takumi et al., 2008; Wisniewski et al., 2011; Zhou et al., 2011). These

results reinforce the idea that CBF pathway is evolutionary conserved and that CBF DNA-binding domain recognizes a very similar cis-regulatory element and regulates the expression of COR genes in different species, ranging from monocots to dicots. The expression of CBFs in response to cold is gated by the circadian clock (Fowler et al., 2005). The accumulation of CBF1-3 transcripts after cold exposure, is greater in the early morning than it is in the early evening. It seems that this regulation occurs at the transcriptional level and the CREs responsible for it are located in the same region where ICE1 binding sites are located. The circadian gated control of CBF expression seems to be, at least partially, separate from the ICE1 regulated control. Since constitutive overexpression of CBF results in stunted growth, it makes sense that CBF and its regulon is under a very tight control (Fowler et al., 2005).

2.2.2.2 ICE1 ICE1 (Inducer of CBF Expression 1) is a nuclear-localized MYC-like basic helix-loop- helix transcription activator that regulates CBF3 expression (Chinnusamy et al., 2003). ICE1 is constitutively expressed, which allows CBF transcripts to start appearing 15 minutes after exposure to cold (Gilmour et al., 1998). Two sequences within the promoter of CBFs were recognized as being necessary for ICE1-driven expression of CBF in response to cold, they were designated ICEr1 and ICEr2. ICEr1 contains a consensus recognition site (CANNTG) for MYC transcription factors (Zarka et al., 2003). Ice1 Arabidopsis mutants, have a markedly lower survival rates after cold exposure than do wild-type plants (Chinnusamy et al., 2003). It can be explained by the fact that in these mutants, the levels of CBF3 and its regulon genes (e.g.: COR15A, COR47A, RD29A) in significantly lower than in WT plants. There are five putative MYC CREs in the promoter of CBF3, whereas the promoters of CBF1 and CBF2 contain only one such CRE. This could explain why the expression pattern of CBF1 and CBF2 differs from CBF3 in ice1 mutants. There is a slight reduction of CBF1 and CBF2 expression in ice1 mutants after cold exposure, however the transcript levels are higher after 6 hours of cold exposure in mutants than in WT plants (Chinnusamy et al., 2003). Since ICE1 is expressed constitutively, there must be a type of regulation, other than transcriptional, affecting ICE1, to regulate its activity. It has been shown that

HOS1, a RING E3 ligase, ubiquitinates ICE1, thereby targeting it for degradation (Dong et al., 2006). HOS1 C-terminus has shown a very strong interaction with ICE1. Interestingly, cold exposure also causes the degradation of ICE1 mediated by HOS1, indicating that ICE1 upregulation of CBFs is transient. Thus, HOS1 is a negative regulator of CBF3 and its regulon (Dong et al., 2006). Low temperature induces the activation of ICE1 through its sumoylation by SIZ1, a SUMO E3 ligase (Miura et al., 2007). In siz1 Arabidopsis mutants, the levels of CBF3 and its regulon are significantly lower than in WT plants. It is not entirely understood how ICE1 is activated by SIZ1, but it is thought that SUMO conjugation to ICE1 prevents HOS1 ubiquitination, and thus, the degradation of ICE1 (Miura et al., 2007). SIZ1-HOS1 system appears to fine-tune the expression of CBF3 and its downstream genes through post-translational modification of ICE1 (Thomashow, 2010).

2.2.2.3 MYB15 and ZAT12 – negative regulators of CBF expression MYB15 is a nuclear-localized negative regulator of CBF expression from the R2R3-MYB family of proteins. It has been shown that in Arabidopsis plants overexpressing MYB15, levels of CBFs are lowered (Agarwal et al., 2006). MYB15 represses CBF expression by binding type II (G(G/T)T(A/T)GTT(A/G)) and type IIG (G(G/T)T(A/T)GGT(A/G)) Myb recognition sequences in the promoters of CBF1-3. ICE1 interacts with MYB15 and represses its expression. Mutants overexpressing or underexpressing MYB15 had no effect on the levels of CBF downstream genes COR15A and RD29A, suggesting that there are other transcription factors that regulate the expression of these genes (Agarwal et al., 2006). ZAT12 regulon contains 9 cold-induced and 15 cold-repressed genes (Vogel et al., 2004). Out of 25 genes that increased more than 15-fold in response to cold exposure, 19 are induced by CBF2 and 2 are induced by ZAT12. ZAT12, however, downregulates the expression of CBF2 (Vogel et al., 2004). ZAT12 and CBF2 have similar expression profiles. A proximal promoter region of ZAT12 and CBF2 that was shown to be enough to confer cold-induced expression contains seven conserved motifs in both genes. ZAT12, CBF1 and CBF2 contain a CG-1 element (vCGCGb) that is recognized by calmodulin binding transcription activator (CAMTA) family of

transcription factors. It was shown that CAMTA bind CG-1 element of CBF2 and that in camta3 mutants, the cold-induced expression level of CBF2 is decreased by 50% (Doherty et al., 2009).

2.2.3 Dehydrins and osmoprotectants Low temperatures reduce membrane fluidity and decrease the water movement into a plant. Freezing temperatures cause ice formation, which reduces water potential. Plants express dehydration proteins, or dehydrins, in response to such stresses to protect their cells. Other types of stresses that decrease water availability, such as drought and increased salinity, also induce dehydrin expression. Abscisic acid, an important phytohormone, also induces dehydrin expression (Choi et al., 1999; Allagulova et al., 2003). Dehydrins are important for growth and survival of perennial plants, since they allow these plants to tolerate drastic changes in the environmental conditions (Hughes and Graether, 2010; Vornam et al., 2011). Dehydrins are thought to be involved in membrane stabilization and can act as protein cryoprotectants (Allagulova et al., 2003; Hughes and Graether, 2010). Dehydrins are found in the nucleus, where they are suspected to be involved in stabilization of transcription machinery. Dehydrins have been shown to be associated with cellular and intracellular membranes (Allagulova et al., 2003). Dehydrins belong to group 2 of the late embyogenesis abundant (LEA) proteins and have been found in higher and lower plants, algae, yeast and cyanobacteria (Garay-Arroyo et al., 2000; Rorat, 2006). Dehydrins contain a large number of charged and polar amino acids and usually lack cystein and tryptophan (Choi et al., 1999). However, all dehydrins have a conserved amphipathic α-helix, formed by a lysine-rich 15 amino acid segment (consensus sequence: EKKGIMDKIKEKLPG), called K- segment. Additionally, serine-rich S-segment, Y-segment with a consensus sequence (T/V)DEYGNP and less conserved regions, rich in polar amino acid, Φ-segments, are found in many dehydrins (Close, 1996; Close, 1997). The number and position of these segments is used to categorize dehydrins into different classes. Dehydrins are expressed in response to different cues based on their class (Rorat, 2006). For

example, low temperature induced dehydrins can have following structure: Kn, SKn and

KS, however YnSKn dehydrins are not induced by cold (Allagulova et al., 2003). Different dehydrin expression patterns are observed in response to various environmental stimuli, which can be explained by the presence of numerous stress- related cis-regulatory elements found in dehydrin promoters (Choi et al., 1999; Shekhawat et al., 2011) Cold stress induces the accumulation of numerous osmoprotectants that are small, electrically neutral molecules that stabilize proteins and membranes and protect them from detrimental effects of high concentration of ions (Rontein et al., 2002). Well- known osmoprotectants, such as proline, glutamate, trehalose, sorbitol, glucose, glycerol, galactinol, maltose and sucrose, have increased in concentration in Arabidopsis after cold exposure (Kaplan et al., 2004). Sugars, such as sucrose and trehalose, can replace water molecules on the surface of a protein and can thus conserve its conformation. This allows cells to restore their function after rehydration (Hoekstra et al., 2001). Proline is accumulated in plants and many other organisms in response to dehydration, it can create a shell of water around proteins during dehydration (Chen et al., 2009).

2.3 Modulation of plant gene expression 2.3.1 Promoters Plant genomes contain many thousands of genes. Some of these genes are expressed constitutively in most cells, they are known as housekeeping genes. Others need to be expressed at precise moments in response to different environmental or developmental cues. Gene expression can be controlled at any level of transcription and translation. Transcriptional control is, however, the prevalent regulatory mechanism of gene expression (Mahadevappa and Warrington, 2002). Transcription factors mediate gene regulation through interaction with short stretches of DNA (cis-regulatory elements) that are usually found, in eukaryotes, within 100-400 base pairs (bp) upstream of the transcription start site (TSS). This upstream region is known as the proximal promoter (Smale, 2005) (Sablowski, 2007). Distal regions of promoters, thousand or more bp

upstream of TSS, can also contain transcription factor binding sites (Shahmuradov et al., 2003). About 30-50% of gene promoters contain a TATA-box, one of the most common DNA elements found in core promoters. A TATA-box is located 25 to 30 bp upstream of the TSS. The TATA-box is bound by a component of TFIID complex that recruits RNA polymerase II and in some cases, this is enough to drive transcription (Shahmuradov, 2005). Most TATA-box-containing and TATA-less genes require transcription factor (TF) binding to cis-regulatory elements located in their promoters. TFs recruit the basal transcriptional complex to activate transcription. Cis-regulatory elements located in promoters can also act as targets of transcription repressors. For example, AtERF3 from Arabidopsis thaliana (Fujimoto et al., 2000) and Dof2 from maize (Yanagisawa and Sheen, 1998) participate in passive repression by competing for the same CRE as related transcription activators, AtERF1 and Dof1, respectively. Methylation of the promoter region is known to silence gene expression in plants (Sørensen et al., 1996; Mette et al., 2000). In both mammals and plants, cytosine residues in CG dinucleotides are methylated. However, in plants, methylation can occur at cytosines in CNG and, less frequently, in CNN trinucleotides (Gehring and Henikoff, 2007). The presence of 5 to 10 bp CREs in gene promoters is responsible for the differential expression of genes, which affects the functions and properties of a cell. Several databases containing plant-specific cis-regulatory elements exist: PLACE (Higo, 1999), PlantCARE (Lescot et al., 2002) and RegSite (http://linux1.softberry.com/berry.phtml?topic=regsite). These databases can be used to find putative motifs in promoter sequences that may be responsible for differential expression of related genes.

2.3.2 3′ UTR The 3′ untranslated region (UTR) is the part of the gene located downstream of the stop codon that gets transcribed but does not get translated. The average length of 3′ UTR in plants is 240 nt (Bailey-Serres, 1999). Specific elements, such as DST, found in the 3′ UTR of higher plants' SAUR transcripts, are very strong determinants of mRNA

instability (Abler and Green, 1996). The presence of an AUUUA element in the 3′ UTR of reporter genes in stably transformed tobacco caused rapid degradation of their transcripts (Abler and Green, 1996). Trans-acting factors, such as common bean PRP- BP, specifically bind to a sequence found in 3′ UTR of transcripts and lead to their degradation (Zhang and Mehdy, 1994). In rice, 3′ UTR of α-amylase participates in sugar-dependent mRNA degradation (Chan and Yu, 1998). Another type of control of mRNA stability is a riboswitch. A thiamine pyrophosphate (TPP) sensing riboswitch was found in the 3′ UTR of THIC gene in all examined plants species. The presence of this riboswitch has an effect on 3′ end processing that directly affects mRNA accumulation and expression (Wachter et al., 2007).

2.4 Gene regulation in Arctic plant species Arctic plants are often subjected to harsh weather conditions and extreme temperature fluctuations. Roots and aerial parts of arctic plants are often exposed to significantly different temperatures, with soil temperatures at or below freezing, and aboveground temperatures being 20 or more degrees higher (Mølgaard, 1982). To be able to better withstand the elements, arctic plants have adapted to their environments, often through increased ploidy level (Brochmann et al., 2004; Brysting et al., 2011). However, there is a dearth of information on regulation of gene expression in the arctic plants. Recently, it has been shown that in two arctic Oxytropis species, a cold dehydrin gene is constitutively transcribed, whereas in closely related temperate species, the transcription is turned on in response to cold exposure (Archambault and Strömvik, 2011a). Similarly, another type of gene which is known to be expressed in response to cold, an antifreeze gene, has been shown to be constitutively expressed in an antarctic grass Deschampsia antarctica (Bravo and Griffith, 2005), with levels of ice recrystallization inhibition transcripts rapidly increasing after cold exposure (Chew et al., 2012). Additionally, D. antarctica accumulates very high levels of sucrose, a known osmoprotectant, in leaves, due to indirect light upregulation of sucrose phosphate synthase activity during long day conditions (Zúñiga-Feest et al., 2005). Transcriptome sequencing of subnival alpine plant Chorispora bungeana (Brassicaceae) has revealed significant differences in gene expression with Arabidopsis. Chilling-treated C.

bungeana seedlings did not exhibit the enrichment of cold acclimation genes that was seen in A. thaliana. Additionally, CBF paralogues were not upregulated, as opposed to the CBF upregulation in A. thaliana. However, genes related to protein phosphorylation and auto-ubiquitination were enriched in freezing resistant C. bungeana, which could allow for a rapid modification of proteins involved in cold tolerance during the onset of low temperatures (Zhao et al., 2012). ABA is linked with stomatal closure, which prevents water loss (Desikan et al., 2004). In two arctic sedges, Eriophorum vaginatum and Carex bigelowii, ABA concentration was significantly lower in roots in plants exposed to 0 °C than in those exposed to 15 °C. However, leaf ABA levels were only affected in C. bigelowii and not in E. vaginatum (Starr et al., 2004). Thellungiella salsuginea, a species closely related to Arabidopsis thaliana, that grows in sub-arctic Canada, has become a model organism to study stress tolerance in plants (Amtmann, 2009). T. salsuginea can tolerate freezing temperatures throughout its life cycle without the need to cold acclimate through prior exposure to cold (Griffith et al., 2007). Similarly to A. thaliana, CBF1 transcription factor and several cold responsive genes (COR47 and COR15a) are expressed in T. salsuginea in response to cold exposure. No anti-freeze proteins were detected and it is thought that T. salsuginea tolerates freezing temperatures through supercooling (Griffith et al., 2007). ESTs from cold-, drought- and salinity-stressed Thellungiella plants showed little overlap, indicating that the stress response is specific. Additionally, stress response genes that have no homologues in Arabidopsis were discovered (Wong et al., 2005). COR15 paralogues, in highly cold-tolerant Draba lineage from Brassicaceae family, exhibit heterogenic evolution, which indicates functional divergence, that might have helped Draba species to colonize alpine and arctic regions after cooling Quaternary stages (Zhou et al., 2009). The general theme that arises from these studies is that arctic plants are prepared for stress through constitutive expression of specialized genes. However, more studies are required to elucidate the regulation of gene expression in arctic plants.

2.5 De novo motif discovery Transcriptional co-regulation of genes entails the presence of similar cis-regulatory elements (motifs) in the promoters of these genes. For example, a large proportion of cold responsive genes contains a CRT, that is recognized by CBF transcription factors (Zhou et al., 2011). De novo motif discovery allows finding motifs that are overrepresented in a co-regulated group of promoters. The logic behind motif discovery is that if a motif is found in a group of promoters of co-regulated genes with a significantly higher frequency than in the rest of promoters, than there is a high probability that this motif has some biological significance. There are numerous ways of representing motifs, the most popular being sequence logo (Schneider and Stephens, 1990), in which stacked nucleotides are represented with different height, based on their frequency at that specific position. WebLogo is a website that allows to represent motifs in the sequence logo format based on their position weight matrices (PWM) (Crooks et al., 2004). A plethora of de novo motif discovery tools have been created. Some of the most popular ones are Weeder (Pavesi et al., 2004), MEME (Bailey et al., 2009), AlignACE (Roth et al., 1998) and BioProspector (Liu et al., 2001). Since these tools use different models of motif discovery, some stochastic, others deterministic, there is a high probability that different motifs will be discovered by different programs. To improve motif discovery results and to minimize the likelihood of missing an important motif it is recommended to use several different tools (MacIsaac and Fraenkel, 2006). To improve the performance and to decrease the probability of finding false-positives, small number of short promoter sequences is recommended. It has been found that increasing the number of promoters does not improve motif discovery performance after a certain threshold (Hu et al., 2005).

2.6 Published plant genomes Recent advances in high-throughput sequencing technologies have allowed to sequence whole genomes much faster and cheaper than before. Multiple plant genomes have been published with new genome sequences appearing with increased frequency. Many plant genome consortia make their annotated genome data available

online through Phytozome (Goodstein et al., 2012) (http://phytozome.net). The genomes that are not found on Phytozome usually can be downloaded through FTP. BioMart database (Smedley et al., 2009), integrated into Phytozome, allows to download genomic data for each of the species, with annotations available from gene ontology (GO), PFAM, KEGG, SMART and KOG databases.

Preface to chapter 3 To study cold acclimation in a temperate Oxytropis species, the transcriptional control of a KS dehydrin gene was compared to its orthologue in an arctic Oxytropis species. The promoters of KS dehydrins were isolated, sequenced and analysed for the presence of putative cis-regulatory elements. Different lengths of the promoters were used to drive reporter gene expression in Arabidopsis and differences in the expression pattern were observed. A region of the promoter from the temperate species was identified that contains a putative repression element, blocking the expression in Arabidopsis.

3. In planta and in silico analysis of Oxytropis splendens and Oxytropis arctobia KS dehydrin promoters

3.1 Introduction Plants are unable to move from their environments easily and therefore they have to be able to withstand various weather conditions such as droughts, low and freezing temperatures and heat. This is true especially for Arctic plants, where the weather can change abruptly and the temperature fluctuations within a single day can be drastic. Plants are able to survive these conditions by adjusting their gene expression profiles. For example, temperate plant species can withstand cold winters after a period of exposure to low non-freezing temperatures, in a process called cold acclimation (Chinnusamy et al., 2007). During this process, gene expression is adjusted in a way that allows enzymes and membranes to preserve their shape (Cook et al., 2004; Chinnusamy et al., 2007; Hughes and Graether, 2010). This is accomplished by increasing the content of metabolites known as osmoprotectants and by upregulating dehydrin expression. Dehydrins are intrinsically unstructured proteins that have a conserved sequence of 15 amino acids, known as K-segment (Close, 1997). They are expressed in response to osmotic stresses, such as drought, high salinity, cold and in response to abscisic acid treatment (Allagulova et al., 2003). Dehydrins have been shown to acts as cryoprotectants by preserving enzyme function and preventing interactions between partially denatured proteins (Hughes and Graether, 2010). In addition, dehydrins play a role of membrane stabilization during osmotic stresses (Rahman et al., 2010; Eriksson et al., 2011). In contrast with temperate plants, arctic plants have to be constantly prepared to withstand rapid changes in their environments. For example Eutrema salsugineum (previously known as Thellungiella salsuginea), a Brassicaceae growing in sub-arctic Canada, does not need to undergo cold acclimation to be able to survive freezing temperatures (Griffith et al., 2007). In Deschampsia antarctica, an antarctic Poaceae species, an antifreeze gene is expressed constitutively (Bravo and Griffith, 2005). Similarly, in an arctic Fabaceae species, Oxytropis arctobia, a KS dehydrin is expressed

constitutively, in contrast with the temperate Oxytropis splendens, in which the orthologous KS dehydrin is expressed after cold exposure (Archambault and Strömvik, 2011a). In this study, we set out to elucidate the mechanism behind the different patterns of KS dehydrin expression in the temperate and arctic Oxytropis species. The promoters of KS dehydrins were isolated and sequenced. Multiple motifs linked to osmotic stress response, seed-specific expression and light-dependent transcription regulation were detected in both promoters. GUS reporter gene activity driven by different lengths of the KS dehydrin promoters was observed in transgenic Arabidopsis.

3.2 Materials & methods 3.2.1 Isolation of KS dehydrin promoter and 3′ UTR regions from O. arctobia and O. splendens GenomeWalker™ DNA libraries (Clontech Universal GenomeWalker Kit, Cat. No. 638904) for O. arctobia and O. splendens were prepared by digesting genomic DNA with the following blunt-end restriction enzymes at 37 ℃, overnight (30 ℃ for SmaI): DraI (library DL1), SmaI (DL2), EcoRV (DL3), PvuII (DL4) and StuI (DL5). Digested genomic DNA was purified using chloroform extraction and ethanol precipitated. Adaptors were ligated to digested genomic fragments overnight, at 16 ℃. To amplify the promoter and 3′ UTR of KS dehydrin from O. arctobia and O. splendens, five GenomeWalker™ DNA libraries from each species were used as template in separate primary PCR, which was then diluted 50× and used as a template in secondary PCR, using Advantage™ 2 Polymerase (Clontech, Cat. No. 639207), to amplify the product. An adaptor primer (AP1) and a gene specific prmer (GSP1) were used in the primary PCR and a nested adaptor primer (AP2) and gene specific primer (GSP2) were used in the secondary PCR (Table 3.1). Primers were designed by hand and their properties (such as GC%, melting temperature and self-complementarity) were assessed using OligoCalc (http://www.basic.northwestern.edu/biotools/oligocalc.html) (Kibbe, 2007). The following PCR thermocycler programs were used for primary and secondary (in parentheses) PCR: 7 (5) cycles: 94 °C for 25 seconds, 72 °C for 3 minutes; 32 (20) cycles: 94 °C for

25 seconds, 67 °C for 3 minutes; 1 cycle: 67 °C for 7 minutes; 4 °C until the products were removed from the thermocycler. Initially, secondary PCR was run to identify libraries containing putative products of interest. Once the library containing prospective amplicons was selected, another secondary PCR, using diluted primary PCR products as template, was run in 4 PCR tubes with total reaction volume of 50 µl. PCR products were excised from ethidium bromide stained 0.9% agarose (Bio Basic, Cat. No. D0012) gel after electrophoresis by illuminating the gel with UV light and purified using QIAquick® Gel Extraction Kit (QIAGEN, Cat. No. 28706). The spectrophotometer (Ultrospec 2100 pro) was used to assess the yield and quality of purified PCR products. Purified PCR products were cloned into either pCR™2.1-TOPO® (Invitrogen, Cat. No. 450641) or pGEM®-T Easy (Promega, Cat. No. A1360) vectors, transformed into chemically competent Escherichia coli TOP10 cells (Invitrogen, Cat. No. C4040-10) using the heat shock method (Van Die et al., 1983), and were subjected to a blue-white screen on LB (Fisher, Cat. No. BP1427-500) + 50 μg/ml ampicillin (Fisher, BP1760-5) solid selection medium. Selected white colonies were cultured in LB + ampicillin overnight and the presence of a desired insert was verified by culture PCR using AP2 and GSP2 primers; EconoTaq™ DNA Polymerase (Lucigen, Cat. No. 30031-1) was used to amplify the products. There were difficulties with cloning larger inserts into pCR2.1-TOPO vector, therefore the vector cloning system was changed to pGEM-T Easy. Plasmids were purified for sequencing and subcloning using QIAprep® Spin Miniprep Kit (QIAGEN, Cat. No. 27104).

3.2.2 Sequencing Purified plasmids were submitted for sequencing at the McGill University and Génome Québec Innovation Centre (http://www.gqinnovationcenter.com). Sequences were edited using Geneious Pro 6.1.7 (Biomatters Ltd., http://www.geneious.com/). Low quality ends were trimmed, adaptor and vector sequences were removed and contiguous sequences were assembled by hand.

3.2.3 Construction of KS dehydrin promoter::gusA fusion vectors Fragments of 1000 bp, 520 bp and 467 bp (O. splendens only) of KS dehydrin promoter (in addition to the start codon) from O. arctobia and O. splendens were amplified from isolated clones using primers containing overhangs with EcoRI and SalI (Table 3.1). NEBcutter (Vincze et al., 2003) was used to identify restriction enzyme cut sites. Additional nucleotides were added to the ends of the primers to improve cleavage efficiency (http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cleavage_olignucl eotides.asp). The pCAMBIA-1391Xa (CAMBIA, Canberra, Australia; GenBank accession no.: AF234309) binary vector and amplified products were digested with EcoRI (Invitrogen, Cat. No. 15202-013) and SalI (invitrogen, Cat. No. 15217-011), and then ligated using T4 DNA ligase (Fermentas, Cat. No. EL0014). Constructs were first transformed into chemically competent E. coli TOP10 strain using the heat shock method (Van Die et al., 1983). Transformants were screened on LB agar with 50 µg/ml kanamycin. Positive transformants were incubated in 5 ml of LB + 50 µg/ml kanamycin at 37 °C, overnight, and then confirmed by culture PCR using a forward promoter specific primer and Gus_A_5R reverse primer, specific to gusA coding region (Table 3.1). Plasmids were extracted using QIAprep Spin Miniprep Kit (QIAgen, Cat. No. 27104). Eluted plasmids were transformed into Agrobacterium tumefaciens GV3101 strain using the freeze thaw method (Holsters et al., 1978; Weigel and Glazebrook, 2006). Transformants were screened on LB agar with 50 µg/ml kanamycin (Calbiochem, Cat. No. 5880) and then confirmed by culture PCR using a forward promoter specific primer and Gus_A_5R reverse primer, specific to gusA coding region (Table 3.1). Sequencing was used to confirm the proper orientation and in-frame position of the insert.

Table 3.1: Cloning and sequencing primers used to isolate promoter and 3′ UTR region of KS dehydrin from O. arctobia and O. splendens.

Location Location # of (relative to (relative to Sequence Primer name Sequence (5′ - 3′)* Region GC% Comments nt start of start name sequence) codon)

GTAATACGACTCACTAT Genome Used as outer primer in cloning of AP1 AGGGC 22 N/A N/A N/A Walker 45 Oxytropis KS dehydrin promoter adaptor and 3′ UTR regions

ACTATAGGGCACGCGTG Genome Used as nested primer in cloning AP2 GT 19 N/A N/A N/A Walker 58 of Oxytropis KS dehydrin adaptor promoter and 3′ UTR regions

2976 → Sequencing primer, supplied by M13F GTAAAACGACGGCCAGT 17 N/A pGEM-T Easy Vector 53 2993 Génome Québec GGAAACAGCTATGACCA Sequencing primer, supplied by M13R 19 172 ← 190 N/A pGEM-T Easy Vector 47 TG Génome Québec TATTTAGGTGACACTAT Sequencing primer, supplied by SP6 19 141 ← 159 N/A pGEM-T Easy Vector 32 AG Génome Québec TAATACGACTCACTATA Sequencing primer, supplied by T7 20 2999 → 3 N/A pGEM-T Easy Vector 40 GGG Génome Québec

GGTCTCATCATGCTCCT Used as GSP1 in primary PCR for arct_cold47_2R GCAACT 23 556 ← 578 490 ← 512 arctic_contig47 3′ UTR 52 cloning of Oxytropis KS dehydrin promoters Used as GSP2 in secondary PCR TGCTGCTGCTATCATGA arct_cold47_8R CCATGC 23 495 ← 517 429 ← 451 arctic_contig47 CDS 52 for cloning of Oxytropis KS dehydrin promoters

Table 3.1 continued Used for primer walking of TGACTAATTAGCGTCCG -581 → COLD47_OA04 and sequencing of arct_cold47_9F 20 590 → 609 COLD47OA_04 promoter 50 TCC -562 1 Kb KS dehydrin promoter insert in pCAMBIA-1391Xa CCTATGTGAAGGGTTTC 1195 ← Used for primer walking of arct_cold47_10R 20 25 ← 44 COLD47OA_04 CDS 50 ACC 1214 COLD47OA_04, COLD47OS_06 CCTCAATACCTTCTAAC -1929 → Used for primer walking of arct_cold47_11F 23 520 → 542 COLD47OS_06 promoter 48 ACTCCC -1907 COLD47OS_06 2551 ← Erroneous primer, not used, ACCATAGTGCTCTCCTT 2571, 103 ← 123, arct_cold47_12R 21 COLD47OS_06 coding 48 annealing site present twice in TGTG 2578 130 ← 150 COLD47OS_06 ←2598 ATTGGGCTTGGGCTCTT 1181 -1268 → Used for primer walking of arct_cold47_13F 21 COLD47OS_06 promoter 57 TGGG →1201 -1248 COLD47OS_06 CAAACTCTAGAAGCAAG 1659 ← -790 ← Used for primer walking of arct_cold47_14R 20 COLD47OS_06 promoter 45 TCC 1678 -771 COLD47OS_06 TACATGACAGACCTGGG -1557 → Used for primer walking of arct_cold47_15F 20 709 → 728 COLD47OA_07 promoter 55 TCC -1538 COLD47OA_07 TTCATTTCTACCACTGC 1588 ← -678 ← Used for primer walking of arct_cold47_16R 20 COLD47OA_07 promoter 45 TCC 1607 -659 COLD47OA_07 Used to amplify a paralogue of O. arctobia dehydrin by incorporating TCCTATGTGAAGGGTTT arct_cold47_17R CACCAG 23 620 ← 642 23 ← 45 COLD47OA_01 CDS 48 a SNP in the primer. Was not succesful, amplified the same locus Used as GSP1 in primary PCR for ACACAAACCCCGTGCCT -297 ← arct_cold47_18R 20 233 ← 253 COLD47OA_01 promoter 60 cloning of Oxytropis KS dehydrin ACG -277 promoters, unsuccessfully Used as GSP2 in secondary PCR GATTTTAAGGAACAGTG for cloning of Oxytropis KS arct_cold47_19R 20 300 ← 320 -364 ← -344 COLD47OA_01 promoter 40 TGC dehydrin promoters, unsuccessfully

Table 3.1 continued AACCCTTCACATAGGAG Used as GSP1 in primary PCR for arct_cold47_21F GCC 20 96 → 115 30 → 49 arctic_contig47 coding 55 cloning of Oxytropis KS dehydrin 3′ UTR CACAAAGTAGAAAGCCA Used as GSP2 in secondary PCR 133 → 152 67 → 86 arct_cold47_22F TGG 20 arctic_contig47 coding 45 for cloning of Oxytropis KS dehydrin 3′ UTR GATTATGATGAGTTATG Used for primer walking of 3′ UTR arct_cold47_23F 27 549 → 575 N/A OA_3UTR_38 3′ UTR 30 AAATTTGGTG O. arctobia inserts (34, 38 & 40) GTGTTGAATAAATTATT 1945 ← Used for primer walking of 3′ UTR arct_cold47_24R 30 N/A OA_3UTR_38 3′ UTR 23 AAGTAGTTGAATG 1974 O. arctobia inserts (34, 38 & 40) Used to amplify 1000 bp of CTGCTATCCGGATGGCA 2003 ← promoter and 3′ UTR for O. arct_cold47_25R 19 N/A OA_3UTR_38 3′ UTR 53 AA 2021 arctobia and O. splendens, from genomic DNA. Was not successful Used to amplify 1000 bp of GGGGGTGTTGAATATGA 1136 ← promoter and 3′ UTR for O. arct_cold47_26R 24 N/A OA_3UTR_38 3′ UTR 42 AAACCAT 1159 arctobia and O. splendens, from genomic DNA. Was not successful Used to amplify part of the CACATCCCGTTATGATA promoter and CDS of O. arctobia arct_cold47_27F 22 35 → 56 -563 →-524 COLD47OA_01 promoter 45 CAACC dehydrin from genomic DNA. Was not successful Used to screen E. coli and GATCCAGACTGAATGCC pCAMBIA- Gus_A_5R 22 61 → 82 N/A gusA gene 55 Agrobacterium transformants by CACAG 1391Xa culture PCR Used to screen E. coli and TCCACCATGTTGGGCCC 10576 → pCAMBIA- upstream of pCAMBIA_YZ_1F 18 N/A 67 Agrobacterium transformants by G 10593 1391Xa polylinker culture PCR used to clone 1000 bp of O. TAAGTCGACTGGAGCGT -1000 → - arctobia dehydrin promoter into COLD47OA_04_1F 30 171 → 191 COLD47OA_04 promoter 53 GGATCATGTGGTG 980 pCAMBIA-1391Xa. Added SalI cut site

Table 3.1 continued used to clone 1000 bp of O. TAAGTCGACGGCGTTTC 1449 → -1000 → - splendens dehydrin promoter into COLD47OS_06_1F 29 COLD47OS_06 promoter 55 TGTAGCTTGGGG 1468 981 pCAMBIA-1391Xa. Added SalI cut site used to clone 1000 bp of O. TGCGCGAATTCCATATT 1149 ← arctobia dehydrin promoter into COLD47OA_04_2R GTTGATTGGTTTTTCCT 36 -25 ← 3 COLD47OA_04 promoter 39 TG 1173 pCAMBIA-1391Xa. Added EcoRI cut site used to clone 1000 bp of O. TGCGCGAATTCCATATT splendens dehydrin promoter into 2451 ← COLD47OS_06_2R GTTGATTGGTTTTTGCT 36 -25 ← 3 COLD47OS_06 promoter 39 pCAMBIA-1391Xa. Added EcoRI 2427 TG cut site, the difference with COLD47OA_04_1F is italisized used to clone 2000 bp of O. GGGGTCGACGGGAGAGA -2001 → arctobia dehydrin promoter into COLD47OA_07_1F 32 265 → 287 COLD47OA_07 promoter 66 CCGAGGCTCTCCAAA -1979 pCAMBIA-1391Xa. Added SalI cut site used to amplify 500 bp of O. TAAGTCGACCGCTGGAT 1765 → COLD47OA_07_2F 29 -500 → -480 COLD47OA_07 promoter 55 arctobia dehydrin promoter, TGGGCCAAAACC 1784 unsuccessfully. Added SalI cut site used to amplify and clone 519 bp TAAGTCGACAGCGTCCG 1746 → COLD47OA_07_3F 29 -519 → -499 COLD47OA_07 promoter 55 of O. arctobia dehydrin promoter. TCTATCCCCAAC 1765 Added SalI cut site

used to clone 2000 bp of O. splendens dehydrin promoter into CAGAAGCTTGACGCACG -2001 → - COLD47OS_06_3F 29 449 → 468 COLD47OS_06 promoter 48 pCAMBIA-1391Xa. Added HindIII TCATACTCATAC 1981 cut site, the difference with COLD47OA_04_1F is italisized

Table 3.1 continued used to clone 2000 bp of O. TACGGATCCCATATTGT 2451 ← splendens dehydrin promoter into COLD47OS_06_4R 34 -25 ← 3 COLD47OS_06 promoter 38 TGATTGGTTTTTGCTTG 2427 pCAMBIA-1391Xa. Added BamHI cut site used to amplify 500 bp of O. TAAGTCGACCGCTGGAT 1949 → splendens dehydrin promoter, COLD47OS_06_5F 29 -500 → -480 COLD47OS_06 promoter 59 TGGGCCTAACCC 1968 unsuccessfully. Added SalI cut site used to amplify and clone 467 bp TAAGTCGACTTTTGGCC 1982 → COLD47OS_06_6F 29 -467 → -447 COLD47OS_06 promoter 48 of O. splendens dehydrin CAGTCCGAAACA 2001 promoter. Added SalI cut site used to amplify and clone 520 bp TAAGTCGACGGCAGTTG 1929 → COLD47OS_06_7F 29 -520 → -500 COLD47OS_06 promoter 52 of O. splendens dehydrin GGTCATTTCCAG 1948 promoter. Added SalI cut site Used to amplify 6 'gene GCCGGGTCGACGGATTG OS_502_SEF3 fragments', together with OS_GF_1F 18 1 → 18 -513 → -495 promoter 72 G a_La_REs COLD47OS_06_2R. Added SalI cut site *Restriction endonuclease cut sites are underlined and additional nucleotides added for efficiency are in bold.

3.2.4 Transformation of Arabidopsis thaliana by floral dip method Agrobacterium transformants containing pCAMBIA-1391Xa constructs with different lengths of O. splendens and O. arctobia KS dehydrin promoter sequences were used to transform A. thaliana (ecotype Columbia) using the floral dip method (Clough and Bent, 1998; Zhang et al., 2006). A. thaliana seeds were sown in pots with PRO-MIX® (Premier Tech Horticulture) covered with window mesh, and were placed in a 4 °C dark walk-in chamber for 2 days. A single Agrobacterium transformant colony was used to inoculate 10 ml LB + kanamycin (50 µg/ml) which was incubated at 28 °C in a shaker spinning at 200 rpm. The 2 day old culture was used to inoculate 150 ml of LB + kanamycin (50 µg/ml) which was grown in the same conditions, overnight. The culture was divided among three centrifuge bottles which were centrifuged at 5500 rpm for 15 minutes at 20 °C. The supernatant was discarded, and the pinkish Agrobacterium pellet was resuspended in 5% sucrose solution by pipetting, and diluted in 500 ml of the sucrose solution with 0.05% (250 µl) Silwet L-77 (Lehle Seeds, Cat. No. VIS-01) added. Arabidopsis inflorescences were dipped in the transformation buffer for 30 seconds with mild agitation. The pots were placed on the side and were covered overnight to preserve humidity. After numerous siliques started to form, the watering regimen decreased to allow the siliques to dry out. Plants were cut off and seeds were collected from dry siliques. To select positive transformants, 0.060g of seeds were sterilized in 100% isopropanol for 60 seconds with mild agitation, then transferred into 50% bleach solution with 0.1% Tween 20 (Sigma, Cat. No. P9416) for 5 minutes, while vigorously inverting the tube. Bleach solution was discarded and the seeds were washed with sterile water three times. Three milliliters of sterile 0.1% agarose solution was added to the seeds and half of the volume was spread on a 15 cm Petri plate containing selection medium. This was prepared by mixing 1/2× (1.1 g) Murashige and Skoog basal medium with Gamborg's vitamins (Sigma, Cat. No. M0404), 0.8% (4 g) agar (Sigma, Cat. No. A1296) in 500 ml of water, the pH of the solution was adjusted to 5.7 with a few drops of 1N NaOH. The medium was autoclaved and 25 µg/ml (0.0125 g) of hygromycin B (Sigma, Cat. No. H9773) was added through a 0.20 µm filter, once the temperature of the medium reached 55 °C. The plates were sealed with surgical tape to allow sufficient gas

exchange, vernalized in 4˚C for two days, then placed in the walk-in growth chamber and grown as described above. After 18 days, positive transformants were easily distinguished from untransformed plants by the presence of true leaves and long roots that penetrated into the selection medium, whereas untransformed plants had only cotyledons and very short roots, 1-3 mm in length. Positive transformants were carefully removed from the selection medium by gently lifting them up with tweezers, paying close attention to prevent any damage to the roots. Seedlings were transplanted into individual pots with PRO-MIX®, watered sufficiently and were covered to preserve humidity. The presence of constructs was confirmed by extracting genomic DNA from T2 plants using DNeasy Plant Mini Kit (QIAgen, Cat. No. 69104), followed by PCR with promoter-specific forward primer and gusA-specific reverse primer, Gus_A_5R (Table 3.1).

3.2.5 Sequence analysis Promoter sequences were analyzed using PLACE (http://www.dna.affrc.go.jp/PLACE/signalscan.html) (Higo, 1999). Sequence alignments were constructed in Geneious using Clustal W 2.1 (Larkin et al., 2007). To find motifs in the region of O. splendens KS dehydrin promoter between -467 and -520, the region (GGCAGTTGGGTCATTTCCAGCGCTGGATTGGGCCTAACCCAAGTCTTGTGGAG) was broken down into hexamers and their reverse complements, and published literature was searched using these hexamers. Location of the TATA-box and the transcription start site was predicted using TSSP (SoftBerry, http://www.softberry.com).

3.2.6 Stress tests and ABA treatment All tests were performed with transgenic Arabidopsis plants carrying O. arctobia and O. splendens KS dehydrin promoter::gusA reporter gene construct. Histochemical GUS assay was performed using the protocol described in Cervera, 2004. Control plants and treatment plants, except cold stress, were grown in a chamber with 150 µmol/m2/s light intensity, 16 hours of daylight, 22/18 °C day/night temperature.

Acute cold stress test was performed by exposing mature plants to 4 °C for 6 hours in a cold chamber and then immediately submerging excised rosette leaves into the GUS assay buffer. Chronic cold stress was performed by plating Arabidopsis seeds on hygromycin selection medium and then growing them at 10 °C with 20 hours of daylight and 100 µmol/m2/s light intensity. Seedlings were subjected to the GUS assay after two rosette leaves were greater than 1 mm in length (stage 1.02 (Boyes et al., 2001)). High salinity stress was performed by spraying mature plants with 250 mM NaCl solution, until run-off. Four hours after treatments rosette leaves were excised and subjected to the GUS assay. Abscisic acid solution (100 µM) was sprayed until run-off on mature plants. Four hours after treatments rosette leaves were excised and subjected to the GUS assay. Dehydration stress was performed by not watering the plants for 5 days.

3.3 Results 3.3.1 KS dehydrin proximal promoters and 3′ UTR from O. arctobia and O. splendens show high identity Cis-regulatory elements are important for the transcriptional control of gene expression; they are usually located in the proixamal promoter region. To investigate potentially crucial sequence differences in the promoters of ortholgous genes from an arctic and a temperate plant, 5′ upstream and 3′ UTR sequences were isolated from O. arctobia and O. splendens. Since the coding sequence of KS dehydrin from Oxytropis species was known (GenBank Acc: GW696883) (Archambault and Strömvik, 2011a) it was possible to design gene specific primers used in conjunction with adaptor primers to amplify upstream promoter regions and downstream 3′ UTR from O. arctobia and O. splendens GenomeWalker libraries (Table 3.1). For O. arctobia promoters, two bands were extracted from DL3: 1048 bp with 597 bp of promoter (COLD47OA_01) and 1621 bp with 1170 bp of promoter (COLD47OA_04); in addition one band was extracted from DL1: 2715 bp with 2264 bp of promoter (COLD47OA_07). For O. splendens promoters, two bands were extracted from DL5: 1299 bp with 848 bp of promoter (COLD47OS_03) and 2899 bp with 2488 bp of promoter (COLD47OS_06). The promoter sequences were investigated for overall similarity by aligning them using ClustalW 2 (Table 3.2a). COLD47OA_04 and COLD47OA_07 have 99.2% identity, COLD47OS_03 and COLD47OS_06 have 98% identity in the overlapping regions The alignment of the KS dehydrin partial coding sequences, from the same fragments, shows 99.6% or higher identity within species and 98.9% or higher between species. Since regulatory elements are also known to be present in the 3′ UTR regions, these were isolated from the same genes. For the O. arctobia dehydrin downstream region, containing the 3′ UTR, two bands were extracted from DL1: 1951 bp with 1552 bp of downstream region (OA_3UTR_34) and 2081 bp with 1682 bp downstream region (OA_3UTR_38). For the O. splendens dehydrin, two bands were extracted from DL1 and three distinct clones were obtained: 823 bp with 424 bp downstream region (OS_3UTR_04), 1239 bp with 840 bp downstream region (OS_3UTR_10) and 1175 bp

with 776 bp downstream region (OS_3UTR_11). The sequence identity between the isolated KS dehydrin downstream regions from both species is also relatively high (Table 3.2b.)

Table 3.2a: Sequence identity (%) of isolated KS dehydrin promoter regions

Sequence name COLD47OA_01 COLD47OA_04 COLD47OA_07 COLD47OS_06 COLD47OA_04 66.2 – – – COLD47OA_07 66.0 99.2 – – COLD47OS_06 63.8 67.4 67.1 – COLD47OS_03 62.8 73.5 73.4 98.0

Table 3.2b: Sequence identity (%) of isolated KS dehydrin 3′ UTR

Sequence name OA_3UTR_34 OA_3UTR_38 OS_3UTR_04 OS_3UTR_10 OA_3UTR_38 92.5 – – – OS_3UTR_04 67.5 67.3 – – OS_3UTR_10 86.4 83.2 68.4 – OS_3UTR_11 74.8 71.4 72.3 82.2

3.3.2 Multiple motifs linked with response to osmotic stresses is found in Oxytropis KS dehydrin promoters To identify the difference in putative regulatory elements in the promoters of O. arctobia and O. splendens KS dehydrins, 1000 bp of each promoter was analyzed using the Plant cis-acting regulatory DNA elements database (PLACE) (Higo, 1999) (Table 3.3). Alignment of 1000 bp of the promoter sequences of O. arctobia and O. splendens KS dehydrins indicates that they share 66.2% identity. The promoter regions 520 bp directly upstream of the start codon share a 92.8% identity, whereas the regions from -520 to - 1000 bp have a much lower identity of 40.9%. Cis-regulatory element analysis (Figure 3.1, Table 3.3) shows that both KS dehydrin promoters contain various motifs associated with ABA- and osmotic stress- induced transcription (DPBFCOREDCDC3, MYB1AT, ABRERATCAL, ABRELATERD1, SEF4MOTIFGM7S, MYBCORE, MYB2CONSENSUSAT, MYCCONSENSUSAT), cold- induced transcription (LTRE1HVBLT49, LTRECOREATCOR15, DRECRTCOREAT, MYCCONSENSUSAT), light-induced transcription modulation (REALPHALGLHCB21, TBOXATGAPB, IBOXCORE, BOXCPSAS1), seed-specific transcription

(DPBFCOREDCDC3, RYREPEATGMGY2, SEF3MOTIFGM, SEF4MOTIFGM7S, CANBNNAPA, ACGTCBOX) and pathogen-induced transcription (GT1GMSCAM4, ELRECOREPCRP1, GCCCORE). The differences in motifs and their position between the two promoters could be responsible for the differences in the transcription pattern.

Table 3.3: Occurrence and function of CREs in Oxytropis KS dehydrin 1000 bp promoters Location CRE name Sequence Function1 Promoter2 Position Oa -197 – -193 ABRELATERD1 ACGTG ABA Os -197 – -193 Oa -187 – -181 ABRERATCAL MACGYGB ABA Os -187 – -181 ACGTCBOX GACGTC Os -929 – -924 Seed BOXCPSAS1 CTCCCAC Os -856 – -850 Light, repression CANBNNAPA CNAACAC Oa -708 – -702 Seed CMSRE1IBSPOA TGGACGG Oa -565 – -559 Sugar -24 – -18 Oa -474 – -468 DPBFCOREDCDC3 ACACNNG -872 – -866 Seed, ABA -24 – -18 Os -891 – -884 DRECRTCOREAT RCCGAC Oa -618 – -613 Cold, drought -434 – -429 ELRECOREPCRP1 TTGACC Oa Pathogen -593 – -588 GCCCORE GCCGCC Os -522 – -517 Pathogen -17 – -12 Oa GT1GMSCAM4 GAAAAA -226 – -221 Pathogen, salt Os -226 – -221 -146 – -142 -296 – -292 Oa -327 – -323 IBOXCORE GATAA -911 – -907 Light -146 – -142 Os -331 – -327 -390 – -386 LTRE1HVBLT49 CCGAAA Os -454 – -449 Cold Oa -557 – -553 LTRECOREATCOR15 CCGAC Cold, drought, ABA Os -574 – -571 1Function indicates that the CRE plays a role in either gene modulation due to listed stimuli or in expression in specific tissues (seed) 2Oa – Oxytropis arctobia, Os – Oxytropis splendens

Table 3.3 continued. Location CRE name Sequence Function Promoter Position

-14 – -9 -37 – -32 -49 – -44 Oa -253 – -248 -894 – -889 ABA, osmotic stress, MYB1AT WAACCA -982 – -977 seed -14 – -9 -37 – -32 Os -49 – -44 -257 – -252 ABA, osmotic stress, MYB2CONSENSUSAT YAACKG Os -548 – -543 seed -517 – -512 -548 – -543 MYBCORE CNGTTR Os Osmotic stress -566 – -561 -683 – -678 -474 – -469 -871 – -866 Oa -922 – -917 ABA, osmotic stress, MYCCONSENSUSAT CANNTG -982 – -977 cold, seed -517 – -512 Os -868 – -863 PHDGM (Not in PLACE) GTCGAC Os -472 – -467 Repression Oa -266 – -261 -270 – -265 PREATPRODH ACTCAT Osmotic stress Os -881 – -876 -913 – -908 -13 – -8 Oa -36 – -31 REALPHALGLHCB21 AACCAA Light -13 – -8 Os -36 – -31 Oa -305 – -299 RYREPEATGMGY2 CATGCAT Seed Os -309 – -303 -82 – -75 Oa S1FSORPL21 ATGGTATT -753 – -746 Repression Os -82 – -75 SEF3MOTIFGM AACCCA Os -484 – -479 Seed Oa -313 – -307 SEF4MOTIFGM7S RTTTTTR -17 – -11 Seed Os -317 – -311 -119 – -114 TBOXATGAPB ACTTTG Os -646 – -641 Light -796 – -791

Figure 3.1: Alignment of 1000 bp of O. arctobia (OA) and O. splendens (OS) KS dehydrin promoters with putative motif locations indicated. The translational start codon is marked at the borrom right of the alignment.

3.3.3 KS dehydrin promoter from the arctic species drives constitutive reporter gene expression in Arabidopsis To observe the effect that the two promoters have on reporter gene expression and how they affect the expression after stress exposure, Arabidopsis was transformed with constructs containing 1000 bp of each promoter (Figure 3.2, Oa_1000 and Os_1000). A TATA-box was found in the promoters from both species observed. A transcription start site was predicted at 24 bp downstream of the TATA-box.

Figure 3.2: Comparative representation of promoters used in constructs. All promoters have the same location of TATA-box and TSS. Start codon is indicated on the right. Species code: Oa – O. arctobia, Os – O. splendens. Length in base pairs in included in the name after species code.

Rosette leaves of transgenic Arabidopsis plants grown in temperate conditions showed GUS reporter gene expression pattern similar to that observed in Oxytropis species (Figure 3.3, Supplementary Table 2). When 1000 bp of O. arctobia KS dehydrin promoter was used to drive GUS reporter gene expression, the pattern was constitutive in 21 out of 24 transgenic lines (Figure 3.3 A). In two of those lines, hydathode-specific expression was observed. When 1000 bp of O. splendens KS dehydrin promoter was used, there were no signs of GUS expression in 24 out of 43 lines (Figure 3.3 B); in 19 out of 43 Arabidospis transgenic lines GUS activity in hydathodes was observed in hydathodes (Figure 3.3 C, hydathode-specific expression visible in the inset).

Figure 3.3: Arabidopsis rosette leaves showing GUS reporter gene expression under the control of different lengths of Oxytropis KS dehydrin promoters. Bar = 1mm.

When transgenic Arabidopsis plants were subjected to cold, high salinity, dehydration and ABA treatment, no changes in the pattern of reporter gene expression were observed in the rosette leaves. To test if there is a possible repression cis-regulatory element found in the O. splendens KS dehydrin promoter, the region of high similarity with O. arctobia promoter (-1 to -520) and the region (-1 to -467) that did not include the PHDGM CRE (a putative repressor element) were used to drive GUS reporter gene expression (Figure 3.2 Oa_520, Os_520 and Os_467). When 520 bp were included, no changes in expression pattern in the rosette leveas were observed for either promoter (Figure 3.3 D and E). When 467 bp of O. splendens KS dehydrin promoter was used, the expression became constitutive (Figure 3.3 F). This indicates that in the region between -468 to -520, there may be a repressor CRE that blocks the expression in Arabidopsis.

3.4 Discussion 3.4.1 KS dehydrin proximal promoters and 3′ UTR from O. arctobia and O. splendens show high identity The identity of the coding region of all isolated KS dehydrin coding sequences was very high. The promoter region of COLD47OA_01 when compared with the other two sequences isolated from O. arctobia (04 and 07) is significantly lower than the identity between these sequences. While the conceptual distinction between paralogues and alleles is clear, it would be difficult to say whether the extracted sequences represent the same locus based on sequence identity alone. There are cases within the plant kingdom where an identity of 40% was observed between allelic variants (Xue et al., 1996) or a 99.5% identity between paralogues (Emrich et al., 2006).

3.4.2 Multiple motifs linked with response to osmotic stresses are found in Oxytropis KS dehydrin promoters Due to high identity in the proximal promoter sequence, multiple putative cis-regulatory elements are present in both KS dehydrin promoters (Figure 3.1, Table 3.3). Within 100 bp upstream of the start codon there is a REALPHALGLHCB21 motif (REα, AACCAA) in both promoters, present in two proximal copies. It has been suggested to be a binding site of a repressor modulating transcription of genes regulated by phytochrome, in darkness, in Fabaceae Lemna gibba (Degenhardt and Tobin, 1996). Both promoters contain three copies of MYB1AT motif (WAACCA). This motif has been shown to be involved in abscisic acid dependent activation of dehydration-responsive gene rd22 in Arabidopsis (Abe et al., 2003). MYB1AT overlaps with the two occurrences of REα motif (AAACCAA MYB1AT is underlined, REα is in italic), which could play a role in modulation of KS dehydrin expression in response to osmotic stresses and light exposure. DPBFCOREDCDC3 motif (ACACNNG), found in both promoters, was implicated in embryo-specific and ABA induced gene expression in carrot (Kim et al., 1997). Due to a difference in one nucleotide between the two promoters, GT1GMSCAM4 motif (GAAAAA) is found in O. arctobia but SEF4MOTIFGM7S motif (RTTTTTR, in reverse orientation) appears in the corresponding site of O. splendens

promoter. GT1GMSCAM4 is found in the promoter of soybean SCaM-4 gene, which is rapidly induced after pathogen exposure and NaCl treatment. GT-1-like transcription factor in both Arabidopsis and soybean, interacts with GT1GMSCAM4 motif in SCaM-4 promoter (Park et al., 2004). SCaM-4 is an isoform of calmodulin, which is a mediator of Ca2+ signals. Calcium cytosol concentration increases in plants in response to drought, salinity and cold (Knight et al., 1997; Shinozaki and Yamaguchi-Shinozaki, 2000), therefore GT1GMSCAM4 motif could be involved in gene transcriptional upregulation in response to osmotic stresses. SEF4MOTIFGM7S motif found in the O. splendens promoter has been shown to be involved in regulation of soybean β-conglycinin expressed in developing seeds and in response to ABA (Lessard et al., 1991). S1FSORPL21 motif (ATGGTATT) found in both promoters, might be involved in downregulation of the RPL21 gene in spinach (Lagrange et al., 1997). TBOXATGAPB motif (ACTTTG) located at -114 to -119 and twice more in the -641 to -796 region, in the O. splendens promoter. It is involved in light-induced upregulation of GAPB gene in Arabidopsis (Chan et al., 2001). IBOXCORE motif (GATAA) is found at -142 to -146 and at several other locations further upstream, in both promoters, and this motif is involved in light-regulated transcription (Terzaghi and Cashmore, 1995). Two abscisic acid response elements are located in close succession in both promoters, ABRERATCAL (MACGYGB, -181 to -187) and ABRELATERD1 (ACGTG, -193 to -197). ABRERATCAL was found in the promoters of Ca2+ responsive genes in Arabidopsis (Kaplan et al., 2006). ABRERATCAL is an ABRE that is necessary for dehydration and etiolation-induced transcription of luciferase reporter gene in Arabidopsis, this element was identified in early responsive to dehydration 1 gene (erd1) (Simpson et al., 2003).Both promoters contain a proline response element PREATPRODH (ACTCAT), which is necessary for proline (an osmoprotectant) and hypoosmolarity-induced transcription by the promoter of proline dehydrogenase in Arabidopsis (Satoh et al., 2002). RYREPEATGMGY2 (CATGCAT) is found in both promoters, it was identified as a motif important for the expression of seed proteins in Phaseolus vulgaris and Glycine max. It is adjacent to SEF4MOTIFGM7S, that was also identified in soybean and their

occurrence in close proximity could be important for seed specific expression of KS dehydrins in O. splendens and O. arctobia. The region from -429 to -484 in the O. arctobia promoter, and the corresponding region from from -435 to -485 in the O. splendens promoter has a high identity, however it contains several nucleotide differences that are responsible for variation between putative motifs in the two promoters. Two copies of ELRECOREPCRP1 (TTGACC) are found in O. arctobia promoter, one of them is within a region of high identity with O. splendens, however a change of two nucleotides resulted in the presence of this motif in the former species, but not the latter. This motif, also called a W-box, is necessary for pathogen-induced expression of certain genes in Arabidopsis and parsley (Petroselinum crispum) (Rushton et al., 1996; Laloi et al., 2004). At -449 to -454, due to a difference in one nucleotide, there is a LTRE1HVBLT49 motif (CCGAAA) in the O. splendens promoter, but not in that of O. arctobia. This motif was found to be responsible for cold-induced expression of blt4.9 gene in barley (Hordeum vulgare) (Dunn et al., 1998). A repressive element PHDGM (GTGGAG), can be bound by soybean Alfin1-type PHD finger proteins, is located at -467 to -472 in the O. splendens promoter, but not in the O. arctobia one, due to a difference in one nucleotide (Wei et al., 2009). These proteins respond differentially to osmotic stresses and have been shown improve salt tolerance in transgenic Arabidopsis, transformed with GmPHD2 (Wei et al., 2009). Further upstream in the O. splendens promoter, there is a SEF3MOTIFGM motif (AACCCA), also found in soybean, where it is responsible for α′ subunit of β-conglycinin gene expression in seed and in response to ABA (Lessard et al., 1991). The O. splendens promoter contains two motifs (SEF3MOTIFGM and SEF4MOTIFGM7S) that were found in the promoters of both the α′ and β subunits of soybean β-conglycinin gene. In the O. arctobia promoter, at -469 to -474, there is a MYCCONSENSUSAT motif (CANNTG), that overlaps with DPBFCOREDCDC3. This motif has been shown to be involved in response to osmotic stresses in Arabidopsis (Abe et al., 2003). Additionally, this motif is found in the promoter of CBF3 and is recognized by cold- activated ICE1 (Chinnusamy et al., 2004). ICE1 is necessary to activate CBF3 expression, which in turn is necessary to upregulate the expression in a wide range of

genes involved in cold response. A MYC motif is found further upstream in both promoters: there are 4 occurrences in the O. arctobia promoter and 2 in the O. splendens promoter. The region upstream of -485 in both promoters is highly dissimilar. The O. arctobia promoter contains LTRECOREATCOR15 (CCGAC) (Baker et al., 1994) and DRECRTCOREAT (RCCGAC) (Qin et al., 2004), which are bound by CBF in response to cold exposure. CMSRE1IBSPOA (TGGACGG), a sucrose response element identified in sweet potato, is found at -559 to -565. Sucrose concentration increases in Arabidopsis and other plants in response to cold stress (Kaplan et al., 2004) and therefore it is possible that not only does it play the usual role of an osmoprotectant, but also a role of an inducer of transcription of genes involved in cold response. At -702 to - 708 there is a CANBNNAPA motif (CNAACAC), an element found in rapeseed (Brassica napus) napin gene promoter that confers seeds-specific expression (Ellerström et al., 1996). The O. splendens dehydrin promoter region with high dissimilarity to the O. arctobia promoter contains four MYBCORE motifs (CNGTTR), which is linked to osmotic stress response in Arabidopsis (Urao et al., 1993), one of occurrences of that motif overlaps with another motif related to dehydration-responsive gene expression - MYB2CONSENSUSAT motif (YAACKG) (Abe et al., 2003). A GCCCORE motif (GCCGCC) is found at -517 to -522. This motif conferred a jasmonate-responsive expression of a defensin gene in Arabidopsis, which is usually expressed after pathogen infection, as part of the defensive response (Brown et al., 2003). A copy of LTRECOREATCOR15 is found at -571 to -574, which could confer cold-responsiveness (Baker et al., 1994). BOXCPSAS1 motif (CTCCCAC) is found at -850 to - 856, it is involved in light-activated repression of AS1 gene in pea (Pisum sativum). Additionally nuclear factors from Arabidopsis have been shown to bind this motif (Ngai et al., 1997). ACGTCBOX motif (GACGTC) is found at -924 to -929, it was shown to be involved in seed-specific gene expression in rice (Oryza sativa) (Izawa et al., 1994). Additionally, ACGTCBOX motif is recognized by bZIP proteins, which are involved in responses to biotic and abiotic stimuli, with drought, high salinity and cold being among them (Wei et al., 2012).

3.4.3 KS dehydrin promoter from the arctic species drives constitutive reporter gene expression in Arabidopsis Constitutive GUS expression was observed in transgenic Arabidopsis under the control of O. arctobia 1000 bp and 520 bp of KS dehydrin promoter. This indicates that the cis-regulatory elements necessary for constituve expression are located within the proximal promoter region. There were no differences between 1000 bp and 520 bp O. splendens KS dehydrin promoter-driven GUS expression patterns. Nor did stress exposure cause upregulation of GUS expression, as was expected, based on the results seen in the native species. Since a heterologous system was used to study the effect of gene upstream region on expression, it is possible that functional cis-regulatory elements from O. splendens are not recognized by transcription factors or have a different effect on gene expression in Arabidopsis. When 467 bp of the promoter from O. splendens was used, constitutive expression was observed similar to the case with the O. arctobia promoter. This indicates that the differences between the two promoters downstream of the PHDGM motif (Figure 3.1) do not affect gene expression in the heterologous system. The region between -520 and -467 bp in the O. splendens promoter must contain a repression element that block the expression in Arabidopsis, regardless of stress exposure. It is possible that in temperate conditions, that region plays a role in the repression of KS dehydrin expression in O. splendens. Since the repression is relieved after cold exposure (Archambault and Strömvik, 2011a), the possible transcriptional repressor could respond to cold stress in a different manner in the native system than it does in the heterologous one.

Preface to chapter 4 As was shown in Chapter 3, multiple CREs were found in both KS dehydrin promoters. To be able to better understand transcription control of their expression, de novo motif discovery in KS dehydrins, as well as 4 other sub-classes was performed. Conserved motifs in all five dehydrin sub-classes were identified, that could be linked to their function and expression profiles.

4. De novo regulatory motif discovery identifies significant motifs in promoters of five classes of plant dehydrin genes

4.1 Abstract Plants accumulate dehydrins in response to osmotic stresses. Dehydrins are divided into five different classes, which are thought to be regulated in different manners. To understand the transcriptional regulation of the five dehydrin classes, de novo motif discovery was performed on 235 dehydrin promoters from a total of 40 plant genomes.

Overrepresented motifs were identified in the promoters of five dehydrin classes. Kn dehydrin promoters contain motifs linked with seed-specific expression. KS dehydrin promoters contain a motif with a GATA core. SKn and YnSKn dehydrin promoters contain motifs that match elements connected with cold/dehydration, abscisic acid and light response. YnKn dehydrin promoters contain motifs that match abscisic acid and light response elements, but not cold/dehydration response elements. Conserved promoter motifs are present in the dehydrin classes and across different plant lineages, indicating that dehydrin gene regulation is likely also conserved.

4.2 Background Plants have developed specific mechanisms that allow them to prepare for and survive drastic changes in their environment. One of the better-studied mechanisms is cold acclimation, which allows plants to develop freezing tolerance (Hannah et al., 2005; Maruyama et al., 2009). During exposure to low non-freezing temperatures gene expression is modulated and numerous solutes, known as osmoprotectants, and protective proteins are accumulated in plant tissues. Dehydrins or dehydration proteins, (DHN), are often found among those protective proteins and they are ubiquitous in transcriptomes of plants under osmotic stress, such as cold, drought and high salinity (Choi et al., 1999; Allagulova et al., 2003; Hundertmark and Hincha, 2008; Archambault and Strömvik, 2011a; Yamasaki et al., 2013). Dehydrins belong to group II LEA (late embryogenesis abundant) proteins, which are found only in plants. All dehydrins contain

a 15 amino acid K-segment, rich in lysine residues, represented by EKKGIMDKIKEKLPG conserved sequence (Close, 1996). The K-segment forms an amphipathic α-helix that allows dehydrins to stabilize plant membranes and proteins during dehydration stresses (Rorat, 2006; Koag et al., 2009; Drira et al., 2012; Rahman et al., 2013). In addition to the K-segment, dehydrins can contain a Y-segment (T/VDEYGNP) and an S-segment (3+ serines) (Close, 1997). The S-segment is thought to be involved in ion binding and dehydrin phosphorylation, which induces a conformational change in dehydrins (Kovacs et al., 2008; Rahman et al., 2011). Currently, the function of the Y-segment is unknown. The dehydrins are categorized into

5 subclasses (Kn, KS, SKn, YnKn and YnSKn) based on the presence and location of the 3 conserved segments (Close, 1997). Members of each subclass are expressed in response to a different set of stimuli. However, there is no clear link between subclass types and expression triggers (Eriksson and Harryson, 2011). Stress response in plants can be regulated in an abscisic acid (ABA) dependent and/or independent manner (Agarwal and Jha, 2010). Multiple transcription factors, such as C-repeat binding factor/dehydration responsive element binding protein (CBF/DREB) and ABA response element binding protein (AREB), participate in water stress response, by binding to cis-regulatory elements in the promoters of their respective regulons. The CBF1-3 are transcription factors that participate in ABA independent cold and dehydration induced gene expression (Sakuma et al., 2002) and they bind a C-repeat (CRT) cis-regulatory element core (CCGAC). Members of the CBF regulon include well-studied A. thaliana genes, such as LTI78/COR78 (Knight et al.,

1997), COR15A and COR47 (an SKn dehydrin) (Thomashow et al., 2001). However, not all members of the CBF regulon have the CRT cis-regulatory element in their promoters (Fowler and Thomashow, 2002), hence there are yet undiscovered motifs that are involved in cold and drought response. Numerous transcription factors participate in the ABA dependent stress response and they bind several cis-regulatory elements with a TACGTG core (Higo, 1999). Many members of the CBF regulon are also upregulated in response to drought and ABA exposure, demonstrating a cross-talk between stress- induced pathways (Chinnusamy et al., 2004). For example, in barley (Hordeum vulgare

L.), a Kn dehydrin is strongly upregulated in response to cold, dehydration and ABA, and

its promoter contains CRT and ABREs cis-regulatory elements, whereas a barley SKn dehydrin, whose promoter contains multiple CRTs and no ABREs is only weakly upregulated in response to ABA, but shows a significant upregulation in response to cold (Choi et al., 1999). The expression of CBFs, and, in turn, their regulons, is modulated by photoperiod through phytochrome B and phytochrome-interacting factors (Kim et al., 2002; Lee and Thomashow, 2012). In this study, we tested whether the different classes of dehydrin genes, house specific and conserved cis-regulatory elements in their promoters, which could contribute to gene characterization. De novo motif discovery, a computational approach to identify statistically overrepresented sequences, motifs, within a promoter sequence, was used to scan a total of 235 dehydrin promoters. For each of the five dehydrin classes, statistically significant motifs were identified, and matched to experimentally validated cis-regulatory elements known from literature. Motifs linked to ABA-dependent and ABA-independent stress response pathways were detected in the promoters of dehydrin genes from various, distant plant lineages, which indicates that the stress response pathways regulating dehydrin expression are evolutionary conserved.

4.3 Results and Discussion 4.3.1 Promoters of KS dehydrins have one conserved GATA motif In total, 34 KS dehydrin promoters were included in the de novo motif discovery (Table 4.1). Table 4.1: Number of analyzed dehydrin promoters per species

Species Kn KS SKn YnKn YnSKn Total Aquilegia coerulea 1 1 2 1 1 6 Arabidopsis lyrata 1 0 5 1 2 9 Arabidopsis thaliana 1 1 4 1 3 10 Brachypodium distachyon 0 1 4 0 5 10 Brassica rapa 0 1 6 1 4 12 Cajanus cajan 0 1 2 1 1 5 Capsella rubella 1 1 4 0 3 9 Carica papaya 0 1 1 0 2 4 Cicer arietinum 0 2 1 1 1 5 Citrus clementina 1 0 1 0 2 4 Citrus sinensis 0 1 2 0 3 6 Cucumis sativus 0 1 1 0 2 4 Eucalyptus grandis 1 0 1 0 3 5 Fragaria vesca 0 0 1 0 5 6 Glycine max 0 4 1 2 2 9 Gossypuim raimondii 1 0 3 1 2 7 Linum usitatissimum 0 1 6 2 2 11 Lotus japonicus 0 0 2 1 1 4 Malus domestica 0 0 2 2 5 9 Manihot esculenta 0 2 1 0 2 5 Medicago truncatula 0 1 1 0 1 3 Mimulus guttatus 0 1 0 0 2 3 Oryza sativa 0 1 1 0 5 7 Panicum virgatum 0 1 3 0 5 9 Phaseolus vulgaris 0 2 1 1 1 5 Phoenix dactylifera 2 1 2 0 1 6 Physcomitrella patens 2 0 0 0 0 2 Populus trichocarpa 4 0 1 0 1 6 Prunus persica 0 0 2 2 2 6 Ricinus communis 0 1 1 0 3 5 Setaria italica 0 0 2 0 4 6 Solanum lycopersicum 0 0 1 0 4 5 Solanum tuberosum 0 1 1 0 3 5 Sorghum bicolor 0 1 1 0 2 4 Thellungiella halophila 0 1 3 0 3 7 Theobroma cacao 1 1 1 0 2 5 Vitis vinifera 0 0 0 0 2 2 Zea mays 0 2 2 0 3 7 Oxytropis splendens* – 1 – – – – Oxytropis arctobia* – 1 – – – – Total 16 34 73 17 95 235 * Only one promoter was obtained per species, using genome walking. Using the de novo motif discovery tool Seeder (Fauteux et al., 2008; Fauteux and Strömvik, 2009), only one putative conserved regulatory motif was discovered (Motif 1,

Table 4.2a). This motif was not discovered with MEME (Bailey et al., 2009) and Weeder (Pavesi et al., 2001) tools, however, the Seeder Q-value is 4.1×10-5, which indicates a highly significant hit. The KS dehydrins are known to be expressed in response to cold and dehydration, as well as being constitutively expressed (Rorat et al., 2003; Tommasini et al., 2008; Hara et al., 2011; Archambault and Strömvik, 2011a). Although the single identified overrepresented motif in KS dehydrin promoters does not directly match any typical cold or dehydration-related cis-regulatory elements in the PLACE database (Higo, 1999), it does match two motifs involved in light regulation and one involved in sugar regulation (Table 4.2a): IBOXCORENT (I-box core) (Martínez- Hernández et al., 2002), REBETALGLHCB21 (Degenhardt and Tobin, 1996) and SREATMSD (Tatematsu et al., 2005). These three experimentally validated motifs share four nucleotides (GATA). One of these motifs, the I-box (GATAAGR) can form a light-responsive conserved DNA modular array (CMA) together with a G-box (CACGTGGC) when located in close proximity to one another. In transgenic Arabidopsis and tobacco (Nicotiana tabacum) plants, the presence of this CMA in a promoter, drives GUS reporter gene expression when exposed to light. Interestingly, this expression seems to be mediated by phytochrome and cryptochrome photoreceptors (Martínez-Hernández et al., 2002). Another of the motifs matching the motif discovered in the KS dehydrin promoters, the REBETALGLHCB21, also called REβ (CGGATA), was first identified in gibbous duckweed (Lemna gibba) (Degenhardt and Tobin, 1996). It is involved in phytochrome- mediated repression of promoter activity in darkness, when located in close proximity with REα (AACCAA). Although, REα was not identified as a significantly overrepresented motif, it is found in 21 out of 34 KS dehydrin promoters. The GATA part of the REβ was shown to be absolutely necessary for darkness-induced repression (Degenhardt and Tobin, 1996). Furthermore, in Arabidopsis, C-repeat (CCGAC, CRT) - linked cold and dehydration induced gene expression is mediated by phytochrome (Kim et al., 2002). While CRT was not found to be significantly overrepresented within the set of KS dehydrin promoters, it is noteworthy that 15 out of 34 KS dehydrin promoters contain one or more copies of CRT or its reverse complement.

The motif discovered in the KS dehydrin promoters also matched a sugar- repressive element, SREATMSD (TTATCC, SRE), shown to be involved in sugar mediated gene repression in Arabidopsis (Tatematsu et al., 2005). Sugars are known osmoprotectants that are produced by plants in response to cold (Kaplan et al., 2004). One of the suggested roles of dehydrins is in the stabilization of protein conformation. Sugars, such as sucrose and trehalose, can replace water molecules on the surface of a protein and can thus conserve its conformation. This allows cells to restore their function after rehydration (Hoekstra et al., 2001).

Table 4.2a: Selected de novo motifs found in KS dehydrin promoters and their putative function identified through PLACE database Motif De novo motif Match in PLACE5 number/ Occurrence3/ Motif logo2 Sequence Name6 Function Software1 Significance4

2.0 GATAAGR IBOXCORENT Found in light-responsive conserved

s t

i 1.0 (2.4446e-08) DNA modular arrays b 0.0 GAGGA GATA 34/34 Sugar-repressive element (SRE) found 1 T SREATMSD 2.0 TTATCC in genes down-regulated after main

Seeder s

t (5.4972e-08)

i 1.0 4.1e-05 stem decapitation b 0.0 TACTACTCCT REBETALGLHCB21 1 2 3 4 5 6 CGGATA Required for phytochrome regulation (2.0957e-06) 1Number of the motif and the de novo discovery software that was used to locate that motif 2Motif logo representing the occurrence of a specific nucleotide at a respective position, top logo represents forward sequence and bottom logo represents its reverse complement. The x-axis represents the position of a nucleotide and the y-axis represent the amount of information in bits. 3Occurrence is the number of promoters containing a de novo motif out of the total number of promoters analyzed for a specific dehydrin class 4Siginificance of the motif, E-value calculated by MEME, Q-value calculated by Seeder, for Weeder no significance is calculated 5PLACE matches were identified using STAMP, only significant matches with E-value < 0.05 are presented 6E-value of the match with PLACE motif is indicated in the parenthesis below the PLACE ID for the motif

4.3.2 Motifs discovered in promoters of Kn dehydrins suggest guard-cell and seed specific gene regulation

A total of 16 Kn dehydrin promoters were included in the de novo regulatory motif discovery analysis (Table 4.1). The Kn dehydrins are expressed in response to high salinity, abscisic acid (ABA), cold and dehydration (Choi et al., 1999; Ohno et al., 2003; Hundertmark and Hincha, 2008; Šunderlíková et al., 2009). A total of three putative regulatory motifs were identified in this set of promoters (Table 4.2b) - two were discovered using Weeder (Motif 2: CTAAAGGC/GCCTTTAG; and Motif 3: TGACTGCATC/GATGCAGTCA) and one using Seeder (Motif 4: ACACGT/ACGTGT). Motif 2 (CTAAAGGC) has a significant match to the TAAAGSTKST1 (TAAAG) motif in the PLACE database. This motif is linked with guard-cell specific gene activation in potato (Solanum tuberosum) (Plesch et al., 2001). In addition to motif 2, all Kn dehydrin promoters included motif 4 (ACACGT/ACGTGT), detected by Seeder, which matches ABRELATERD1 motif (ACGTG) (Simpson et al., 2003) and GADOWNAT (ACGTGTC) (Nakashima et al., 2006), two ABREs involved in ABA response. During dehydration, ABA induces closing of stomata to prevent water loss (Schroeder et al., 2001) and it is possible that the ABRE (motif 4) together with motif 2 drives guard-cell specific Kn dehydrin expression during water stress that could prevent further water loss through stabilization of proteins participating in ABA signaling pathway. Motif 3 matches two motifs in PLACE - WBOXHVISO1 (TGACT) (Sun et al., 2003) and RYREPEATBNNAPA (CATGCA/TGACTG) (Ezcurra et al., 2000), which are very similar to each other. The WBOXHVISO1 is bound by the transcription factor SUSIBA2 in the barley iso1 (encoding isoamylase1) promoter, and together they regulate gene expression in seed endosperm (Sun et al., 2003). The RYREPEATBNNAPA (RY-repeat) activates napin napA in Brassica napus, through the activity of the ABI3 transcription factor's B3 domain. This part of the complex is ABA- independent, however the ABI3 B2 domain mediates the expression through an ABRE in the napin promoter (Ezcurra et al., 2000). Both the RY-repeat and a B-box that contains an ABRE-like sequence are required for seed-specific expression in B. napus

(Ezcurra et al., 1999). Since seeds undergo a process of dehydration, Kn dehydrins might play a role in preservation of protein function in dry seeds.

Table 4.2b: Selected de novo motifs found in Kn dehydrin promoters and their putative function identified through PLACE database Motif De novo motif Match in PLACE5 number/ Occurrence3/ Motif logo2 Sequence Name6 Function Software1 Significance4

2.0

s t i 1.0

b C AA

CG CTG GA T 2 0.0 TAAA TAAAGSTKST1 2.0 10/16 TAAAG Guard cell-specific gene expression

Weeder s (1.7161e-06)

t i 1.0

b G TT

CG 0.0 A CTTTTCAGA 1 2 3 4 5 6 7 8

2.0

s t i 1.0 WBOXHVISO1 SUSIBA2 (sugar signaling in barley)

b TGACT GA GA T CA 3 0.0 TG CT CAT (6.4705e-06) transcription factor binds this motif 2.0 7/16

Weeder t

i 1.0 b

CA GT T CT RYREPEATBNNAPA 0.0 ATG AG CA CATGCA Seed specific expression 1 2 3 4 5 6 7 8 9 10 (7.8215e-05)

2.0

s GADOWNAT ABRE-like sequence, important for t i 1.0 ACGTGTC

b (9.5628e-10) regulation by ABA CGTACT 4 0.0 A GT 16/16 2.0 Seeder 4.1e-2*

s Found in promoter region of Brassica t i 1.0

b QARBNEXTA napus extensin gene, involved in GATACG AACGTGT 0.0 AC T (9.5628e-10) response to wounding and tensile 1 2 3 4 5 6 strength *Significant at the 5% q-value level

4.3.3 SKn dehydrins contain multiple cold/dehydration, abscisic acid and light regulated response elements

A total of 73 SKn dehydrin promoters were analyzed (Table 4.1). Seven de novo discovered putative regulatory motifs are presented in Table 4.2c. Six out of these motifs were discovered using MEME and one using Seeder. The SKn dehydrins are known to be expressed in response to cold, ABA, dehydration and salt (Choi et al., 1999; Hundertmark and Hincha, 2008; Kovacs et al., 2008; Deng et al., 2013). Four out of seven motifs (motifs 5-8) have matches in PLACE that are known abscisic acid response elements (ABREs). Motif 5 (ACACGTGTC) matches ABREs from wheat (Triticum aestivum) (Busk and Pagès, 1998) and canola (Brassica napus) (Ezcurra et al., 1999). Motif 6 (CCGACGCGGC) matches ABREs from maize (Busk and Pagès, 1997), rice (Ono et al., 1996), Arabidopsis, soybean and tobacco (Salinas et al., 1992; Kim et al., 2001). Motif 7 (TCCGCGTTG) matches an ABRE from maize (Busk and Pagès, 1997). Motif 8 (CACCGACC) and motif 9 (AGGTCGGT) matches low temperature response elements found in numerous species. This motif is known as C- repeat (CRT, consensus sequence: RCCGAC) (Qin et al., 2004; Skinner et al., 2005; Suzuki et al., 2005). In addition, motifs 5, 6 and 10 match PLACE motifs involved in light-induced gene regulation. Motif 5 matches an element from tomato and Arabidopsis light- regulated genes (Giuliano et al., 1988; Donald and Cashmore, 1990). Motif 6 matches an element from parsley involved in light responsiveness (Weisshaar et al., 1991). Motif 10 (CTGGGACCC) matches an element from pea involved in light-induced repression (Ngai et al., 1997).

The presence of these significantly overrepresented motifs indicates that the SKn dehydrins are regulated at the transcriptional level and their expression is modulated in response to cold and ABA. SKn dehydrins should also be expressed in response to drought, since CRT, which is also called dehydration responsive element (Stockinger et al., 1997), is found in their promoters. The circadian clock controls cold induction of C- repeat binding factors (CBFs), which in turn bind CRT/DRE elements (Fowler et al., 2005). Phytochrome and cryptochrome genes are also regulated by a circadian clock in Arabidopsis (Tóth et al., 2001). COR27, a cold-induced gene, is regulated by circadian

clock related evening elements (EE) (Mikkelsen and Thomashow, 2009). In addition to EE, the COR27 promoter also contained multiple ABREs and G-boxes, to which motifs 5 and 6 also match. The core EE (AATATCT) (Rawat et al., 2005) is found in 18 out of

73 SKn gene promoters analyzed. Motifs involved in light-induced regulation of gene expression found in the promoters of SKn genes could participate in modulation of these genes by the circadian clock. It has been shown previously, using bioinformatics methods, that the promoters of cold-regulated genes contain CRTs and ABREs (Kreps et al., 2003; Suzuki et al., 2005) and our data also support those findings. Motif 10 matches an auxin response element found in soybean SAUR15A promoter (Xu et al., 1997). It has been shown previously that numerous genes related to auxin response in Arabidopsis are modulated in response to cold, such as auxin response factor ARF7 or the PINOID-binding protein 1 that is involved in hormone signaling and stress response (Lee et al., 2005).

Table 4.2c: Selected de novo motifs found in SKn dehydrin promoters and their putative function identified through PLACE database Motif De novo motif Match in PLACE5 number/ Occurrence3/ Motif logo2 Sequence Name6 Function Software1 Significance4 ABRETAEM GGACACGTGGC ABRE found in wheat (3.9106e-12) Bound by HY5, HY5AT involved in light 2.0 TGACACGTGGCA

s (1.3382e-11) regulation of t i 1.0 b A G T transcriptional activity A CCA TT G 5 0.0 AC TG C 37/73 Recognized by G-box 2.0 SGBFGMGMAUX28

MEME 3.1e-22 TCCACGTGTC binding factors in

s t i 1.0 (6.9644e-13) b A C T soybean T C AA TG 0.0 G CA GTG Sequence found in 1 2 3 4 5 6 7 8 9 GBOXLERBCS MCACGTGGC promoters of light- (1.0495e-11) regulated genes CGCCACGTGTCC ABREBNNAPA ABRE found in (5.9217e-11) Brassica napus ABRE, ABA and

2.0 CCCACGTGGC ABREAZMRAB28 water-stress

s t i 1.0 (1.0279e-10) responses. Binding

b C GA GCG C A CG T G G A C C G site of CBF2. 6 0.0 C C 52/73 2.0 GCCGCGTGGC ABREMOTIFIIIOSRAB16B ABRE Motif III found

MEME s 1.8e-90 t i 1.0 (3.7519e-09) in rice

b G CGC TC G C C A CG T G G T C Required for light- 0.0 G G CPRFPCCHS 1 2 3 4 5 6 7 8 9 10 CCACGTGGCC induced transcription (1.6178e-07) activation in parsley 2.0 ABREBZMRAB28

s TCCACGTCTC ABRE found in maize t i 1.0 (3.0350e-05)

b TC TG GG A

CTT A A GC GCTGT C 7 0.0 C T 73/73 DRE/CRT found in 2.0

Seeder s 2.3e-7 ABREMOTIFIIIOSRAB16B gene expressed in t i 1.0 GCCGCGTGGC

b CA GA (8.0878e-06) response to cold and A CC

T AAG C T GG ACAGTCG 0.0 dehydration 1 2 3 4 5 6 7 8 9

Table 4.2c continued. Motif De novo motif Match in PLACE5 number/ Occurrence3/ Motif logo2 Sequence Name6 Function Software1 Significance4 DRE/CRT found in genes

2.0 DRECRTCOREAT s

t RCCGAC expressed in response to cold i 1.0 (3.9135e-08) b C A C GA T AG A and dehydration 8 0.0 CCG C 59/73 2.0 ACIPVPAL2 Required for vascular specific

MEME 4.3e-38 CCCACCTACC

s t i 1.0 (4.8566e-06) expression

b G T G A TC 0.0 TG CGGCT LTREATLTI78 ACCGACA LTRE 1 2 3 4 5 6 7 8 (8.3569e-08)

2.0

s LTREATLTI78 t

i 1.0 ACCGACA LTRE b G (1.4795e-07) TAC C T A G CA T 9 0.0 GT GG 73/73 2.0

Seeder s 5.6e-33 Response to drought, low t i 1.0 DREDR1ATRD29AB

b TACCGACAT temperature and high salinity. C G GA

T A T A TG C (1.4999e-07) 0.0 CC AC Bound by CBF1 in Arabidopsis. 1 2 3 4 5 6 7 8

2.0

s GGTCCCATGMSAUR t i 1.0 GGTCCCAT Auxin RE found in soybean b CTG (1.4573e-07) C GA C GCT A 10 0.0 GG C C 34/73 2.0

MEME s 5.3e-15 t i 1.0 BOXCPSAS1 Involved in light-induced b CAG G G CT CTCCCAC 0.0 GTG CCAGC (5.1931e-04) repression 1 2 3 4 5 6 7 8 9

4.3.4 YnSKn dehydrins promoters contain multiple ABREs, light REs and a CRT

YnSKn dehydrins represent the largest subclass out of the five dehydrin classes analyzed. A total of 95 YnSKn gene promoters were analyzed (Table 4.1). The YnSKn dehydrins are expressed in response to ABA, dehydration and high salinity (Choi et al., 1999; Hundertmark and Hincha, 2008; Šunderlíková et al., 2009). The three motifs presented in Table 4.2d (Motifs 11-13) match numerous elements in the PLACE database and each was discovered using a different de novo motif discovery application. Motif 11 (GGACACGTGT) is very similar to Motif 5 (GACACGTGT), found in the SKn dehydrin promoters and they both match several of the same motifs in PLACE database, namely ABREs, G-box and light response elements. Motif 12 (CTACCGTGGC) also matches ABREs, G-box and light RE, in addition to an auxin regulatory element. Motif 13 (CACCGAC) is almost identical to Motif 8 (CACCGACC) discovered in the SKn dehydrin promoters, which matches CRT/DRE necessary for CBF mediated cold and dehydration response (Stockinger et al., 1997). Overall, motifs found

YnSKn dehydrin promoters are very similar to those found in SKn dehydrin promoters indicating that they possibly have as similar function, and that these two classes may have diverged more recently than the other classes. While the function of the Y- segment in the gene products of YnSKn and YnSKn dehydrins is not known, it shows similarity to the nucleotide binding domain of plant chaperones (Shih et al., 2008). The gene products of the other dehydrin classes do not have any such domains. In addition, there are evolutive constraints on the Y-segment in a dehydrin from arctic Oxytropis species compared with temperate species (Archambault and Strömvik, 2011b), suggesting that the Y-segment might carry an important function that differentiates

YnSKn from SKn dehydrins. Some of the published data shows that YnSKn dehydrins are not expressed in response to cold (Choi et al., 1999; Hundertmark and Hincha, 2008), however, there is evidence that after a period of acclimation they do accumulate in Red- Osier Dogwood (Cornus sericea L.) (Sarnighausen et al., 2004) and apple trees

(Garcia-Bañuelos et al., 2009). It is possible that cold-induced YnSKn dehydrin expression was not detected in some data sets due to a limited time of exposure to low temperature.

Table 4.2d: Selected de novo motifs found in YnSKn dehydrin promoters and their putative function identified through PLACE database Motif De novo motif Match in PLACE5 number/ Occurrence3/ Motif logo2 Sequence Name6 Function Software1 Significance4 ABRETAEM GGACACGTGGC ABRE found in wheat (2.5302e-13) 2.0

s SGBFGMGMAUX28 Recognized by G-box t i 1.0 TCCACGTGTC

b G (2.5475e-10) binding factors in soybean TA

T A GG T G GAC CGA GAT 11 0.0 A T 2.0 56/95 Coupling element 3 found CE3OSOSEM Weeder s AACGCGTGTC

t in rice, required for ABA i 1.0 (4.1693e-09) b C AA

T C induced expression C A C T T T C 0.0 ACACGTGT Required for light-induced 1 2 3 4 5 6 7 8 9 10 CPRFPCCHS CCACGTGGCC transcription activation in (5.6401e-09) parsley AUXRETGA2GMGH3 GCCACGTCA Auxin RE found in soybean (6.2831e-10) Box II/ G box, essential for

2.0 BOXIIPCCHS s

t ACGTGGC light regulation, found in i 1.0 (2.9764e-08) b AC A G T CG TA CT CG parsley 12 0.0 T CG G C 24/95 2.0 ABRE2HVA1 ABRE2 found in barley CCTACGTGGCGG MEME s 2.4e-08

t (1.4834e-06) HVA1 gene i 1.0

b GT A C T CG GA TA CG ABREATCONSENSUS 0.0 G C CG A YACGTGGC ABRE found in Arabidopsis 1 2 3 4 5 6 7 8 9 10 (5.2476e-07)

LRENPCABE ACGTGGCA Positive light RE in tobacco (5.2476e-07) 2.0 DRE/CRT found in gene

s DRECRTCOREAT t i 1.0 RCCGAC expressed in response to

b A (1.0081e-08) CTA C A A T GG GA 13 0.0 CC C 95/95 cold and dehydration 2.0

Seeder s 6.1e-09 t i 1.0 CBFHV CRT found in barley b T TGA G T A T CT CC RYCGAC 0.0 G GG (4.9155e-07) (Hordeum vulgare) 1 2 3 4 5 6 7

4.3.5: YnKn dehydrins promoters contain ABREs and light REs

YnKn dehydrins represent the smallest subgroup, with only 17 members found in 38 plant genomes (Table 4.1). YnKn dehydrins are known to be expressed in response to cold (Welling et al., 2004; Wisniewski et al., 2006), and two motifs were detected in their promoters (Table 4.2e). One was identified using MEME and the other using Seeder. Both motifs match several ABREs and light REs in the PLACE database. Motif 14 (ACACGTGTC) is very similar to the reverse complement of Motif 11 (ACACGTGTCC) identified in YnSKn dehydrins and it largely matches the same motifs in PLACE. Motif 15

(CGTACGTGGCA) is similar to Motif 12 (CTACCGTGGC) found in YnSKn dehydrin. The lack of CRTs in the promoters of YnKn dehydrins suggests that they might be expressed in response to cold in ABA-dependent manner, not linked with the CBF transcription factors (Agarwal and Jha, 2010).

4.3.6 Acidic and basic dehydrins contain similar motifs In addition to the classification based on the presence of conserved segments, dehydrin proteins can be divided into acidic (pH < 7.0) and basic (pH > 7.0). It was shown that in Thellugiella salsuginea a basic dehydrin stabilized lipid monolayer at room temperature whereas an acidic dehydrin did so at 4 °C (Rahman et al., 2013). Basic dehydrins have been shown to accumulate in response to dehydration and have a weaker response to cold stress than does acidic dehydrins (Shen et al., 2004; Du et al., 2011). In the present study, the 235 dehydrins were also divided into basic and acidic categories, and de novo motif discovery was performed as above. The results show that both basic and acidic dehydrins contain motifs that match known ABREs, CRT/DRE, and light-related REs (Table 4.3a and b). Motif 16 (Table 4.3a) found in acidic dehydrins shows an overlap with motif 18 (Table 4.3b) and both of them match the same cis-regulatory elements in PLACE. This is also the case with motifs 17 and 19, which both match CRT/DRE cis-regulatory elements involved in ABA-independent stress response. Since similar motifs are found in the promoters of both dehydrin classes, it is possible that the differential regulation of expression of these two groups is post-transcriptional.

Table 4.2e: Selected de novo motifs found in YnKn dehydrin promoters and their putative function identified through PLACE database Motif De novo motif Match in PLACE5 number/ Occurrence3/ Motif logo2 Sequence Name6 Function Software1 Significance4 ABRETAEM GGACACGTGGC ABRE found in wheat (1.6311e-10) ABREBNNAPA CGCCACGTGTCC ABRE found in rapeseed (4.9253e-10) 2.0 ABRE2HVA22 ABRE2 found in barley

s CGCACGTGTC t i 1.0 (2.1456e-12) HVA22 gene

b A CT GG GC T 0.0 ACGTGGC Recognized by G-box 14 17/17 SGBFGMGMAUX28 MEME 2.0 6.5e-54 TCCACGTGTC binding factors in s

t (3.4762e-11) i 1.0 soybean

b T GA A GC C 0.0 GCCACGT C Coupling element 3 found CE3OSOSEM 1 2 3 4 5 6 7 8 9 AACGCGTGTC in rice, required for ABA (3.8287e-09) induced expression Bound by HY5, involved HY5AT TGACACGTGGCA in light regulation of (4.9253e-10) transcriptional activity GCCACGTACA ABRE3HVA22 ABRE3 found in barley (6.1118e-13) HVA22 gene ACGTGGCA LRENPCABE Positive light RE in

2.0 (2.8786e-12) tobacco

s t i 1.0 A2 of ABA response b CGT C GA T T AT C T ATA CGA CG ABREA2HVA1 15 0.0 C TGG 17/17 GCCACGTAGG complex in barley HVA1 2.0 (4.5353e-10)

Seeder 3.4e-3 gene

s t i 1.0

b G ABADESI1 ABRE and desiccation AA TA G CC A C G T TCG AT A 0.0 GCCA GT RTACGTGGCR 1 2 3 4 5 6 7 8 9 10 11 (1.9560e-11) response in rice ABREMOTIFIIIOSRAB1 ABRE Motif III found in GCCGCGTGGC 6B rice (2.7770e-11)

Table 4.3a: Selected de novo motifs found in acidic dehydrin promoters and their putative function identified through PLACE database Motif De novo motif Match in PLACE5 number/ Occurrence3/ Motif logo2 Sequence Name6 Function Software1 Significance4 ABRETAEM GGACACGTGGC ABRE found in wheat (4.1356e-12)

2.0 Bound by HY5, involved in s

t HY5AT i 1.0 TGACACGTGGCA light regulation of b A T C G T C GC GGA C (1.4126e-11) 16 0.0 CG G C 86/140 transcriptional activity MEME 2.0 3.7e-101

s SGBFGMGMAUX28 Recognized by G-box

t TCCACGTGTC i 1.0

b A T (7.3841e-13) binding factors in soybean C G

G A GC G CTC 0.0 G C CG Sequence found in 1 2 3 4 5 6 7 8 9 GBOXLERBCS MCACGTGGC promoters of light-regulated (2.2600e-11) genes

2.0 DRE2COREZMRAB17 s

t ACCGAC i 1.0 DRE found in maize

b (1.5210e-08) A G G T T A T GTG C G A T CG CTA 17 0.0 G G 140/140 2.0 DRE/CRT found in gene

Seeder s 1.3e-24 t i 1.0 DREDR1ATRD29AB expressed in response to

b GCCGCGTGGC C T A C T A A G CCA A T C 0.0 TGACCG C (8.5593e-08) cold and dehydration in 1 2 3 4 5 6 7 8 9 Arabidopsis 1Number of the motif and the de novo discovery software that was used to locate that motif 2Motif logo representing the occurrence of a specific nucleotide at a respective position, top logo represents forward sequence and bottom logo represents its reverse complement. The x-axis represents the position of a nucleotide and the y-axis represent the amount of information in bits. 3Occurrence is the number of promoters containing a de novo motif out of the total number of promoters analyzed for a specific dehydrin class 4Siginificance of the motif, E-value calculated by MEME, Q-value calculated by Seeder, for Weeder no significance is calculated 5PLACE matches were identified using STAMP, only significant matches with E-value < 0.05 are presented 6E-value of the match with PLACE motif is indicated in the parenthesis below the PLACE ID for the motif

Table 4.3b: Selected de novo motifs found in basic dehydrin promoters and their putative function identified through PLACE database Motif De novo motif Match in PLACE5 number/ Occurrence3/ Motif logo2 Sequence Name6 Function Software1 Significance4 ABRETAEM 2.0 GGACACGTGGC ABRE found in wheat

s (1.7859e-e09) t i 1.0

b GC TCA Bound by HY5, involved in C A G C T T 18 A ACGG G HY5AT 0.0 C T 95/95 TGACACGTGGCA light regulation of Seeder 2.0 (4.9627e-09) 1.4e-27

s transcriptional activity

t i 1.0

b Sequence found in GC GT A G C T G A A C CC T GBOXLERBCS 0.0 A GTG MCACGTGGC promoters of light- 1 2 3 4 5 6 7 8 9 (1.9649e-09) regulated genes

2.0 DRE2COREZMRAB17 s

t ACCGAC i 1.0 DRE found in maize

b C (1.3837e-09) T T G A G G AT G AC ACC 19 0.0 C 95/95 2.0

Seeder 1.4e-09 DRE/CRT found in genes s

t DRECRTCOREAT i 1.0 RCCGAC expressed in response to b G A A C A C TT CC GT T (2.3775e-08) 0.0 G GG cold and dehydration 1 2 3 4 5 6 7

4.3.7 Conclusions Numerous dehydrins were identified in 38 plant genomes, many of which are not found in protein databases such as InterPro or PROSITE, or they are not annotated in Phytozome. The identified dehydrins were categorized into five subclasses based on the occurrence of conserved protein segments or into acidic and basic categories based on their isoelectric points. De novo motif discovery software was used to find statistically significant overrepresented motifs in the promoters of each group of dehydrins. These motifs were matched to known cis-regulatory elements in the PLACE database to help explain the regulation of dehydrin expression in response to different environmental stimuli. Dehydrins are expressed in response to multiple stress stimuli. Although there is overlap in expression triggers between dehydrin subclasses, there are differences in the pattern of expression. Some of the dehydrins are expressed constitutively in all tissues (Choi et al., 1999; Hundertmark and Hincha, 2008) and more specifically in seeds (Finch-Savage et al., 1994; Delahaie et al., 2013). The presence of ABREs, CRTs and light REs in the promoters of YnSKn and SKn dehydrins indicates that they could be expressed in response to dehydration and cold in both ABA-dependent and independent pathway and that this expression is modulated by light.

While YnSKn and SKn dehydrin are found in most species, often in several copies, the other three subclasses are encountered less often. It is probable that they either have specialized functions or they are expressed together with YnSKn and SKn dehydrins to increase the overall protective effect against dehydration. It is important to note that the number of discovered dehydrins is probably an underestimation due to incompleteness of genome assembly and errors inherent in sequencing. Dehydrins play an important role in the survival of plants facing various stresses. Motifs matching cis-regulatory elements linked to both ABA-dependent and independent stress response pathways, as well as light response pathways were detected in dehydrins from many different plant families. The implication of this finding is that the regulation of dehydrins is conserved in the plant lineages included in this study and that stress-linked selection pressure preserved cis-regulatory elements in the promoters of dehydrins through stabilizing selection.

4.4 Methods 4.4.1 Plant genomes used in the computational analyses Permission to use data from genomes that are not published was obtained from members of sequencing consortia, where stated. In other cases, published data was used. The following genome sequences were obtained from Phytozome (http://phytozome.net/) (Goodstein et al., 2012) using BioMart (Smedley et al., 2009): Aquilegia coerulea (permission obtained from Dr. Scott Hodges), Arabidopsis lyrata (Hu et al., 2011), Arabidopsis thaliana (The Arabidopsis Genome Initiative, 2000), Brachypodium distachyon (Vogel et al., 2010), Brassica rapa (Cheng et al., 2011; Wang et al., 2011), Carica papaya (Ming et al., 2008), Capsella rubella (Slotte et al., 2013), Citrus clementine (Haploid Clementine Genome, International Citrus Genome Consortium, 2011, http://int-citrusgenomics.org/, http://www.phytozome.net/clementine), Citrus sinensis (Sweet Orange Genome Project 2010, http://www.phytozome.net/orange), Cucumis sativus (permission obtained from Dr. Yiqun Weng), Eucalyptus grandis (Eucalyptus grandis Genome Project 2010, http://www.phytozome.net/eucalyptus), Fragaria vesca (Shulaev et al., 2010), Glycine max (Schmutz et al., 2010), Gossypuim raimondii (DOE Joint Genome Institute: Cotton D V2.0), Linum usitatissimum (Wang et al., 2012), Malus domestica (Velasco et al., 2010), Manihot esculenta (Downloaded the v.4.1 data from http://www.phytozome.net/cassava) (Prochnik et al., 2012), Medicago truncatula (Young et al., 2011), Mimulus guttatus (Mimulus Genome Project, DoE Joint Genome Institute), Oryza sativa (Kawahara et al., 2013), Panicum virgatum (Panicum virgatum v0.0, DOE- JGI, http://www.phytozome.net/panicumvirgatum), Phaseolus vulgaris (Phaseolus vulgaris v0.9, DOE-JGI and USDA-NIFA, http://www.phytozome.net/commonbean), Physcomitrella patens (Zimmer et al., 2013), Prunus persica (Verde et al., 2013), Populus trichocarpa (Populus trichocarpa v3.0, DOE-JGI, http://www.phytozome.net/poplar) (Tuskan et al., 2006), Ricinus communis (Chan et al., 2010), Setaria italica (Zhang et al., 2012), Solanum lycopersicum (Consortium, 2012), Solanum tuberosum (Consortium, 2011), Thellungiella halophila (now listed as Eutrema

salsugineum) (Yang et al., 2013), Theobroma cacao (Motamayor et al., 2013), Vitis vinifera (Jaillon et al., 2007), Zea mays (These data were produced by the Genome Sequencing Center at Washington University School of Medicine in St. Louis and can be obtained from ftp://genome.wustl.edu/pub/organism/Plants/Zea_mays_mays_cv_B73/). The following genomes were obtained from other sources: pigeonpea (Cajanus cajan) (Varshney et al., 2011) http://www.icrisat.org/gt-bt/iipg/genomedata.zip; chickpea (Cicer arietinum) (Varshney et al., 2013) http://www.icrisat.org/gt-bt/ICGGC/genomedata.zip; Lotus japonicus (Sato et al., 2008) ftp://ftp.kazusa.or.jp/pub/lotus/lotus_r2.5/; date palm (Phoenix dactylifera, Draft Sequence Version 3) (Al-Dous et al., 2011) http://qatar- weill.cornell.edu/research/datepalmGenome/download.html.

4.4.2 Identification of dehydrin genes A custom solution was used to identify all dehydrin genes found in the plant genomes described above. Amino acid sequences of several known dehydrins were obtained from NCBI GenBank (Benson et al., 2010) and sequences of their K-segment were used to populate a seed FASTA file. A Python script was written that used Biopython (Cock et al., 2009) Motif module to scan all amino acid sequence for proteins containing a sequence similar to the K-segment, based on its position frequency matrix (PFM). After each round of search new K-segment sequences were added to the original FASTA file. The Y-segment sequence file was constructed in a similar manner using identified dehydrin protein sequences. Identified dehydrins were categorized based on the occurrence of conserved segments using either their PFMs (K- and Y-segments) or a regular expression that described a simpler S-segment. All identified dehydrins were divided into five categories: Kn, KS, SKn, YnKn, YnSKn and 1000 bps upstream of the start codon were obtained from Phytozome BioMart or they were directly extracted from the genomes using custom scripts. Oxytropis arctobia and Oxytropis splendens KS dehydrin gene sequences were obtained from NCBI GenBank (accessions: AEV59613 and AEV59617, respectively (Archambault and Strömvik, 2011a)). 1000 bp of O. arctobia and O. splendens promoters were obtained by amplifying GenomeWalker libraries and sequencing PCR products (Zolotarov et. al., unpublished). Once the

dehydrins were identified, in addition to dividing them into five categories, they were also grouped based on their isoelectric point (pI) using Biopython. Dehydrins with pI less than 7.0 were considered acidic and those with pI above 7.0 were considered basic.

4.4.3 De novo motif discovery Motifs were discovered using MEME v4.9.0 (Bailey et al., 2009), Seeder v0.01 (Fauteux et al., 2008) and Weeder v1.4.2 (Pavesi et al., 2001), and using the five sets of sequences as separate input. Significant motifs were selected based on following parameters: E-value ≤ 0.05 for MEME, Q-value ≤ 0.01 for Seeder and the top 3 motifs recommended by Weeder adviser. All promoters species included in the analyses, that were available through Phytozome BioMart were used as background set (a total of 1029220 promoters). A separate parser was written to extract significant PFMs from result files produced by each program. The PFMs produced for each dehydrin class were entered into the STAMP (Mahony and Benos, 2007) website to group matrices by similarity and to identify significant (E-value ≤ 0.05) matches in PLACE (Higo, 1999). A representative member from a tree node of matrices grouped by similarity was selected and its sequence logo was generated using WebLogo 3.3 (Crooks et al., 2004).

4.5 Acknowledgements This work was supported by a grant from Natural Sciences and Engineering Research Council of Canada (NSERC) to M.V.S. and by the Centre Sève (Fonds de recherche du Québec - Nature et technologies, FRQNT).

5. Conclusions and future research directions While there is a lot of research activity geared towards the understanding of crops and temperate plant species, not enough is being done to study the arctic plants. For example, not a single arctic plant genome has been sequenced so far. This is unfortunate, since studying arctic plants could help improve our understanding of mechanisms of adaptation to environmental stresses. In the first study, promoters of KS dehydrins from an arctic and temperate Oxytropis species were compared and a region containing a putative repressor element was identified in the temperate species. In addition, multiple motifs matching known CREs linked with stress responses were identified in both promoters. It was shown that in a heterologous system, under temperate conditions, the expression pattern was similar to that found in the native species. However, when exposed to cold and other osmotic stresses, no changes in reporter gene expression under the control of O. splendens promoter were observed in Arabidopsis, whereas in the Oxytropis splendens itself, KS dehydrin expression is upregulated after cold exposure. To improve the understanding of transcriptional control of KS dehydrin linked to cold exposure, an organism belonging to Fabaceae family, closely related to Oxytropis, such as Medicago truncatula, could be used. In the second study, multiple motifs were identified in five subclasses of dehydrin genes from 40 different species. The presence of overrepresented motifs in the promoters of different dehydrin subclasses could help explain variations in their transcriptional control. These motifs were identified in silico and to confirm that they actually are important for the control of transcription, experimental validation is necessary.

Appendix I

Plasmid name: pYZ_OA_1000 Comments: 1000 bp of O. arctobia KS dehydrin promoter with the start codon were inserted between SalI and EcoRI cut site in the polylinker of pCAMBIA-1391Xa vector to drive GUS reporter gene expression.

Appendix II

Plasmid name: pYZ_OA_520 Comments: 520 bp of O. arctobia KS dehydrin promoter with the start codon were inserted between SalI and EcoRI cut site in the polylinker of pCAMBIA-1391Xa vector to drive GUS reporter gene expression.

Appendix III

Plasmid name: pYZ_OS_1000 Comments: 1000 bp of O. splendens KS dehydrin promoter with the start codon were inserted between SalI and EcoRI cut site in the polylinker of pCAMBIA-1391Xa vector to drive GUS reporter gene expression.

Appendix IV

Plasmid name: pYZ_OS_520 Comments: 520 bp of O. splendens KS dehydrin promoter with the start codon were inserted between SalI and EcoRI cut site in the polylinker of pCAMBIA-1391Xa vector to drive GUS reporter gene expression.

Appendix V

Plasmid name: pYZ_OS_467 Comments: 467 bp of O. splendens KS dehydrin promoter with the start codon were inserted between SalI and EcoRI cut site in the polylinker of pCAMBIA-1391Xa vector to drive GUS reporter gene expression. This promoter does not contain the putative repression element found in pYZ_OS 520 and pYZ_OS 1000.

Appendix VI Supplementary Table 1: List of bacterial clones carrying vectors used in the experiments Bacteria Number in Sequence Name Plasmid Insert Date strain the box Name 1084 bp Oxytropis arctobia cold dehydrin, COLD47_0A_ pCR2.1- E. coli TOP10 CDS + 633 bp promoter. Amplified using 14-Nov-11 1 COLD47OA_01 01_YZ TOPO GenomeWalker 1621 bp Oxytropis arctobia cold dehydrin, COLD47_0A_ pCR2.1- E. coli TOP10 CDS + 1170 bp promoter. Amplified using 13-Dec-11 2 COLD47OA_04 02_YZ TOPO GenomeWalker

1300 bp Oxytropis splendens cold dehydrin, COLD47_OS_ pCR2.1- E. coli TOP10 CDS + 849 bp promoter. Amplified using 14-Dec-11 3 COLD47OS_03 01_YZ TOPO GenomeWalker

2715 bp Oxytropis arctobia cold dehydrin, COLD47_0A_ pGEM-T E. coli TOP10 CDS + 2264 bp promoter. Amplified using 12-Apr-12 4 COLD47OA_07 03_YZ Easy GenomeWalker

2899 bp Oxytropis splendens cold dehydrin, COLD47_OS_ pGEM-T E. coli TOP10 CDS + 2448 bp promoter. Amplified using 12-Apr-12 5 COLD47OS_06 02_YZ Easy GenomeWalker

1000 bp of O. arctobia promoter from pCAMBIA- YZ_OA04Ec E. coli TOP10 COLD47OA_04 with the startodon, inserted 16-May-12 6 COLD47OA_04 1391Xa into SalI and EcoRI of pCAMBIA 1391-Xa

1000 bp of O. splendens promoter from pCAMBIA- COLD47OS_06 with the start codon, YZ_OS06Ec E. coli TOP10 07-Jun-12 7 COLD47OS_06 1391Xa inserted into SalI and EcoRI of pCAMBIA 1391-Xa

1000 bp of O. arctobia promoter from Agrobacterium pCAMBIA- COLD47OA_04 with the start codon, YZ_OA04At tumefaciens 22-Jun-12 8 COLD47OA_04 1391Xa inserted into SalI and EcoRI of pCAMBIA GV3101 1391-Xa

1000 bp of O. arctobia promoter from Agrobacterium pCAMBIA- COLD47OS_06 with the start codon, YZ_OS06At tumefaciens 20-Jul-12 9 COLD47OS_06 1391Xa inserted into SalI and EcoRI of pCAMBIA GV3101 1391-Xa

YZ_OS_3UTR pGEM-T Partial O. splendens dehydrin CDS and 381 E. coli TOP10 11-Sep-12 10 OS_3UTR_04 _04 Easy bp of the downstream sequence

YZ_OS_3UTR pGEM-T Partial O. splendens dehydrin CDS and 842 E. coli TOP10 11-Sep-12 11 OS_3UTR_10 _10 Easy bp of the downstream sequence

YZ_OS_3UTR pGEM-T Partial O. splendens dehydrin CDS and 776 E. coli TOP10 11-Sep-12 12 OS_3UTR_11 _11 Easy bp of the downstream sequence

YZ_OA_3UTR pGEM-T Partial O. arctobia dehydrin CDS and 1552 E. coli TOP10 11-Sep-12 13 OA_3UTR_34 _34 Easy bp of the downstream sequence

YZ_OA_3UTR pGEM-T Partial O. arctobia dehydrin CDS and 1682 E. coli TOP10 11-Sep-12 14 OA_3UTR_38 _38 Easy bp of the downstream sequence

YZ_OA_3UTR pGEM-T Partial O. arctobia dehydrin CDS and 1681 E. coli TOP10 11-Sep-12 15 OA_3UTR_40 _40 Easy bp of the downstream sequence

2000 bp of O. arctobia promoter from YZ_OA07_2K pCAMBIA- COLD47OA_07 with the start codon, E. coli TOP10 14-Nov-12 16 COLD47OA_07 _Ec 1391Xa inserted into SalI and EcoRI of pCAMBIA 1391-Xa

2000 bp of O. splendens promoter from YZ_OS06_2K pCAMBIA- COLD47OS_06 with the start codon, E. coli TOP10 15-Nov-12 17 COLD47OS_06 _Ec 1391Xa inserted into SalI and EcoRI of pCAMBIA 1391-Xa

2000 bp of O. arctobia promoter from Agrobacterium YZ_OA07_2K pCAMBIA- COLD47OA_07 with the start codon, tumefaciens 16-Nov-12 18 COLD47OA_07 _At 1391Xa inserted into SalI and EcoRI of pCAMBIA GV3101 1391-Xa

2000 bp of O. splendens promoter from Agrobacterium YZ_OS06_2K pCAMBIA- COLD47OS_06 with the start codon, tumefaciens 17-Nov-12 19 COLD47OS_06 _At 1391Xa inserted into HindIII and BamHI of GV3101 pCAMBIA 1391-Xa

pCAMBIA- pCAMBIA- pCAMBIA- E. coli TOP10 The unmodified plasmid 04-May-13 20 1391Xc 1391Xc 1391Xc

Appendix VII Supplementary Table 2: Number of transgenic lines showing GUS expression Promoter::GUS Lines observed construct GUS positive Total OA_1000 21 (87.5%) 24 OS_1000 19* (44.2%) 43 OA_520 4 (100%) 4 OS_520 0 (0%) 4 OS_467 4 (100%) 4 *In all positive cases, GUS expression was only observed in hydathodes

List of references Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15: 63–78 Abler ML, Green PJ (1996) Control of mRNA stability in higher plants. Plant Mol. Biol. 32: 63–78 Agarwal M, Hao Y, Kapoor A, Dong C-H, Fujii H, Zheng X, Zhu J-K (2006) A R2R3 Type MYB Transcription Factor Is Involved in the Cold Regulation of CBF Genes and in Acquired Freezing Tolerance. J. Biol. Chem. 281: 37636–37645 Agarwal PK, Jha B (2010) Transcription factors in plants and ABA dependent and independent abiotic stress signalling. Biol. Plant 54: 201–212 Al-Dous EK, George B, Al-Mahmoud ME, Al-Jaber MY, Wang H, Salameh YM, Al- Azwani EK, Chaluvadi S, Pontaroli AC, DeBarry J, et al (2011) De novo genome sequencing and comparative genomics of date palm (Phoenix dactylifera). Nat. Biotechnol. 29: 521–527 Allagulova CR, Gimalov FR, Shakirova FM, Vakhitov VA (2003) The Plant Dehydrins: Structure and Putative Functions. Biochemistry (Moscow) 68: 945–951 Amtmann A (2009) Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Mol. Plant 2: 3–12 Archambault A, Strömvik MV (2011a) PR-10, defensin and cold dehydrin genes are among those over expressed in Oxytropis (Fabaceae) species adapted to the arctic. Funct. Integr. Genomics 11: 497–505 Archambault A, Strömvik MV (2011b) The Y-segment of novel cold dehydrin genes is conserved and codons in the PR-10 genes are under positive selection in Oxytropis (Fabaceae) from contrasting climates. Mol. Genet. Genomics 287: 123– 142 Bailey TL, Boden M, Buske FA, Frith M, Grant CE, Clementi L, Ren J, Li WW, Noble WS (2009) MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res. 37: W202–W208

Bailey-Serres J (1999) Selective translation of cytoplasmic mRNAs in plants. Trends Plant. Sci. 4: 142–148 Baker SS, Wilhelm KS, Thomashow MF (1994) The 5′-region of Arabidopsis thaliana cor15a has cis-acting elements that confer cold-, drought- and ABA-regulated gene expression. Plant Mol. Biol. 24: 701–713 Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW (2010) GenBank. Nucleic Acids Res. 38: D46–D51 Boyes DC, Zayed AM, Ascenzi R, McCaskill AJ, Hoffman NE, Davis KR, Görlach J (2001) Growth stage-based phenotypic analysis of Arabidopsis: a model for high throughput functional genomics in plants. Plant Cell 13: 1499–1510 Bravo LA, Griffith M (2005) Characterization of antifreeze activity in Antarctic plants. J. Exp. Bot. 56: 1189–1196 Brochmann C, Brysting AK, Alsos IG, Borgen L, Grundt HH, Scheen AC, Elven R (2004) Polyploidy in arctic plants. Biol. J. Linnean Soc. 82: 521–536 Brown RL, Kazan K, McGrath KC, Maclean DJ, Manners JM (2003) A role for the GCC-box in jasmonate-mediated activation of the PDF1.2 gene of Arabidopsis. Plant Physiol. 132: 1020–1032 Brysting AK, Mathiesen C, Marcussen T (2011) Challenges in polyploid phylogenetic reconstruction: A case story from the arctic-alpine Cerastium alpinum complex. Taxon 60: 333–347 Busk P, Pagès M (1998) Regulation of abscisic acid-induced transcription. Plant Mol. Biol. 37: 425–435–435 Busk PK, Pagès M (1997) Protein binding to the abscisic acid-responsive element is independent of VIVIPAROUS1 in vivo. Plant Cell 9: 2261–2270 Canella D, Gilmour SJ, Kuhn LA, Thomashow MF (2010) DNA binding by the Arabidopsis CBF1 transcription factor requires the PKKP/RAGRxKFxETRHP signature sequence. Biochim. Biophys. Acta 1799: 454–462 Cervera M (2004) Histochemical and Fluorometric Assays for uidA (GUS) Gene Detection. In P Leandro, ed, Transgenic Plants: Methods and Protocols. Humana Press, New Jersey, pp 203–214

Chan AP, Crabtree J, Zhao Q, Lorenzi H, Orvis J, Puiu D, Melake-Berhan A, Jones KM, Redman J, Chen G, et al (2010) Draft genome sequence of the oilseed species Ricinus communis. Nat. Biotechnol. 28: 951–956 Chan CS, Guo L, Shih MC (2001) Promoter analysis of the nuclear gene encoding the chloroplast glyceraldehyde-3-phosphate dehydrogenase β subunit of Arabidopsis thaliana. Plant Mol. Biol. 46: 131–141 Chan M-T, Yu S-M (1998) The 3′ untranslated region of a rice α-amylase gene functions as a sugar-dependent mRNA stability determinant. Proc. Natl. Acad. Sci. U.S.A. 95: 6543–6547 Chen J-R, Lü J-J, Liu R, Xiong X-Y, Wang T-X, Chen S-Y, Guo L-B, Wang H-F (2010) DREB1C from Medicago truncatula enhances freezing tolerance in transgenic M. truncatula and China Rose (Rosa chinensis Jacq.). Biochemistry (Moscow) 60: 199–211 Chen M, Xu Z, Xia L, Li L, Cheng X, Dong J, Wang Q, Ma Y (2009) Cold-induced modulation and functional analyses of the DRE-binding transcription factor gene, GmDREB3, in soybean (Glycine max L.). J. Exp. Bot. 60: 121–135 Cheng F, Liu S, Wu J, Fang L, Sun S, Liu B, Li P, Hua W, Wang X (2011) BRAD, the genetics and genomics database for Brassica plants. BMC Plant Biol. 11: 136 Chew O, Lelean S, John UP, Spangenberg GC (2012) Cold acclimation induces rapid and dynamic changes in freeze tolerance mechanisms in the cryophile Deschampsia antarctica E. Desv. Plant Cell Environ. 35: 829–837 Chinnusamy V, Ohta M, Kanrar S, Lee B-H, Hong X, Agarwal M, Zhu J-K (2003) ICE1: a regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis. Genes Dev. 17: 1043–1054 Chinnusamy V, Schumaker K, Zhu J-K (2004) Molecular genetic perspectives on cross‐ talk and specificity in abiotic stress signalling in plants. J. Exp. Bot. 55: 225–236 Chinnusamy V, Zhu J, Zhu J-K (2007) Cold stress regulation of gene expression in plants. Trends Plant Sci. 12: 444–451

Choi DW, Close TJ, Zhu B (1999) The barley (Hordeum vulgare L.) dehydrin multigene family: sequences, allele types, chromosome assignments, and expression characteristics of 11 Dhn genes of cv Dicktoo. Theor. Appl. Genet. 98: 1234– 1247–1247 Close TJ (1996) Dehydrins: emergence of a biochemical role of a family of plant dehydration proteins. Physiol. Plant 97: 795–803 Close TJ (1997) Dehydrins: A commonalty in the response of plants to dehydration and low temperature. Physiol. Plant 100: 291–296 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743 Cock PJA, Antao T, Chang JT, Chapman BA, Cox CJ, Dalke A, Friedberg I, Hamelryck T, Kauff F, Wilczynski B, et al (2009) Biopython: freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics 25: 1422–1423 Consortium TPGS (2011) Genome sequence and analysis of the tuber crop potato. Nature 475: 189–195 Consortium TTG (2012) The tomato genome sequence provides insights into fleshy fruit evolution. Nature 485: 635–641 Cook D, Fowler S, Fiehn O, Thomashow MF (2004) A prominent role for the CBF cold response pathway in configuring the low-temperature metabolome of Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 101: 15243–15248 Crooks GE, Hon G, Chandonia J-M, Brenner SE (2004) WebLogo: A Sequence Logo Generator. Genome Res. 14: 1188–1190 Degenhardt J, Tobin EM (1996) A DNA binding activity for one of two closely defined phytochrome regulatory elements in an Lhcb promoter is more abundant in etiolated than in green plants. Plant Cell 8: 31–41 Delahaie J, Hundertmark M, Bove J, Leprince O, Rogniaux H, Buitink J (2013) LEA polypeptide profiling of recalcitrant and orthodox legume seeds reveals ABI3- regulated LEA protein abundance linked to desiccation tolerance. J. Exp. Bot. 64: 4559-4573

Deng Z, Pang Y, Kong W, Chen Z, Wang X, Liu X, Pi Y, Sun X, Tang K (2013) A novel ABA-dependent dehydrin ERD10 gene from Brassica napus. Mitochondr. DNA 16: 28–35 Desikan R, Cheung MK, Bright J, Henson D, Hancock JT, Neill SJ (2004) ABA, hydrogen peroxide and nitric oxide signalling in stomatal guard cells. J. Exp. Bot. 55: 205–212 Doherty CJ, Van Buskirk HA, Myers SJ, Thomashow MF (2009) Roles for Arabidopsis CAMTA transcription factors in cold-regulated gene expression and freezing tolerance. Plant Cell 21: 972–984 Donald RGK, Cashmore AR (1990) Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS-1A promoter. EMBO J. 9: 1717 Dong C-H, Agarwal M, Zhang Y, Xie Q, Zhu J-K (2006) The negative regulator of plant cold responses, HOS1, is a RING E3 ligase that mediates the ubiquitination and degradation of ICE1. Proc. Natl. Acad. Sci. U.S.A. 103: 8281–8286 Drira M, Saibi W, Brini F, Gargouri A, Masmoudi K, Hanin M (2012) The K- Segments of the Wheat Dehydrin DHN-5 are Essential for the Protection of Lactate Dehydrogenase and β-Glucosidase Activities In Vitro. Mol. Biotechnol. 54: 643–650 Du J-B, Yuan S, Chen Y-E, Sun X, Zhang Z-W, Xu F, Yuan M, Shang J, Lin H-H (2011) Comparative expression analysis of dehydrins between two barley varieties, wild barley and Tibetan hulless barley associated with different stress resistance. Acta Physiol. Plant 33: 567–574 Dunn MA, White AJ, Vural S, Hughes MA (1998) Identification of promoter elements in a low-temperature-responsive gene (blt4.9) from barley (Hordeum vulgare L.). Plant Mol. Biol. 38: 551–564 Ellerström M, Stålberg K, Ezcurra I, Rask L (1996) Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription. Plant Mol. Biol. 32: 1019–1027

Emrich SJ, Li L, Wen TJ, Yandeau-Nelson MD, Fu Y, Guo L, Chou HH, Aluru S, Ashlock DA, Schnable PS (2006) Nearly Identical Paralogs: Implications for Maize (Zea mays L.) Genome Evolution. Genetics 175: 429–439 Eriksson SK, Harryson P (2011) Dehydrins: Molecular Biology, Structure and Function. In U Lüttge, E Beck, D Bartels, eds, Ecological Studies. Springer Berlin Heidelberg, Berlin, Heidelberg, pp 289–305 Eriksson SK, Kutzer M, Procek J, Gröbner G, Harryson P (2011) Tunable Membrane Binding of the Intrinsically Disordered Dehydrin Lti30, a Cold-Induced Plant Stress Protein. Plant Cell 23: 2391–2404 Ezcurra I, Ellerström M, Wycliffe P, Stålberg K, Rask L (1999) Interaction between composite elements in the napA promoter: both the B-box ABA-responsive complex and the RY/G complex are necessary for seed-specific expression. Plant Mol. Biol. 40: 699–709 Ezcurra I, Wycliffe P, Nehlin L, Ellerström M, Rask L (2000) Transactivation of the Brassica napus napin promoter by ABI3 requires interaction of the conserved B2 and B3 domains of ABI3 with different cis-elements: B2 mediates activation through an ABRE, whereas B3 interacts with an RY/G-box. Plant J. 24: 57–66 Fauteux F, Blanchette M, Strömvik MV (2008) Seeder: discriminative seeding DNA motif discovery. Bioinformatics 24: 2303–2307 Fauteux F, Strömvik MV (2009) Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae. BMC Plant. Biol. 9: 126 Finch-Savage WE, Pramanik SK, Bewley JD (1994) The expression of dehydrin proteins in desiccation-sensitive (recalcitrant) seeds of temperate trees. Planta 193: 478–485 Fowler S, Thomashow MF (2002) Arabidopsis Transcriptome Profiling Indicates That Multiple Regulatory Pathways Are Activated during Cold Acclimation in Addition to the CBF Cold Response Pathway. Plant Cell 14: 1675–1690 Fowler SG, Cook D, Thomashow MF (2005) Low Temperature Induction of Arabidopsis CBF1, 2, and 3 Is Gated by the Circadian Clock. Plant Physiol. 137: 961–968

Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000) Arabidopsis Ethylene-Responsive Element Binding Factors Act as Transcriptional Activators or Repressors of GCC Box–Mediated Gene Expression. Plant Cell 12: 393–404 Garay-Arroyo A, Colmenero-Flores JM, Garciarrubio A, Covarrubias AA (2000) Highly hydrophilic proteins in prokaryotes and eukaryotes are common during conditions of water deficit. J. Biol. Chem. 275: 5668–5674 Garcia-Bañuelos ML, Gardea AA, Winzerling JJ, Vazquez-Moreno L (2009) Characterization of a Midwinter-Expressed Dehydrin (DHN) Gene from Apple Trees (Malus domestica). Plant Mol. Biol. Rep. 27: 476–487 Gehring M, Henikoff S (2007) DNA methylation dynamics in plant genomes. Biochim. Biophys. Acta 1769: 276–286 Gilmour SJ, Zarka DG, Stockinger EJ, Salazar MP, Houghton JM, Thomashow MF (1998) Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression. Plant J. 16: 433–442 Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik PA, Cashmore AR (1988) An evolutionarily conserved protein binding sequence upstream of a plant light- regulated gene. Proc. Natl. Acad. Sci. U.S.A. 85: 7089–7093 Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, Mitros T, Dirks W, Hellsten U, Putnam N, et al (2012) Phytozome: a comparative platform for green plant genomics. Nucleic Acids Res. 40: D1178–86 Griffith M, Timonin M, Wong ACE, Gray GR, Akhter SR, Saldanha M, Rogers MA, Weretilnyk EA, Moffatt B (2007) Thellungiella: an Arabidopsis-related model plant adapted to cold temperatures. Plant Cell Environ. 30: 529–538 Haake V, Cook D, Riechmann J, Pineda O, Thomashow MF, Zhang JZ (2002) Transcription Factor CBF4 Is a Regulator of Drought Adaptation in Arabidopsis. Plant Physiol. 130: 639–648 Hannah MA, Heyer AG, Hincha DK (2005) A global survey of gene regulation during cold acclimation in Arabidopsis thaliana. PLoS Genet. 1: e26

Hara M, Shinoda Y, Kubo M, Kashima D, Takahashi I, Kato T, Horiike T, Kuboi T (2011) Biochemical characterization of the Arabidopsis KS-type dehydrin protein, whose gene expression is constitutively abundant rather than stress dependent. Acta Physiol. Plant 33: 2103–2116–2116 Higo K (1999) Plant cis-acting regulatory DNA elements (PLACE) database: 1999. Nucleic Acids Res. 27: 297–300 Hoekstra FA, Golovina EA, Buitink J (2001) Mechanisms of plant desiccation tolerance. Trends Plant Sci. 6: 431–438 Holsters M, Waele D, Depicker A, Messens E, Montagu M, Schell J (1978) Transfection and transformation of Agrobacterium tumefaciens. Mol. Gen. Genet. 163: 181–187 Hu J, Li B, Kihara D (2005) Limitations and potentials of current motif discovery algorithms. Nucleic Acids Res. 33: 4899–4913 Hu TT, Pattyn P, Bakker EG, Cao J, Cheng J-F, Clark RM, Fahlgren N, Fawcett JA, Grimwood J, Gundlach H, et al (2011) The Arabidopsis lyrata genome sequence and the basis of rapid genome size change. Nat. Genet. 43: 476–481 Hughes S, Graether SP (2010) Cryoprotective mechanism of a small intrinsically disordered dehydrin protein. Protein Sci. 20: 42–50 Hundertmark M, Hincha DK (2008) LEA (late embryogenesis abundant) proteins and their encoding genes in Arabidopsis thaliana. BMC Genomics 9: 118 Ito Y, Katsura K, Maruyama K, Taji T, Kobayashi M, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2006) Functional Analysis of Rice DREB1/CBF-type Transcription Factors Involved in Cold-responsive Gene Expression in Transgenic Rice. Plant Cell Physiol. 47: 141–153 Izawa T, Foster R, Nakajima M, Shimamoto K, Chua NH (1994) The rice bZIP transcriptional activator RITA-1 is highly expressed during seed development. Plant Cell 6: 1277–1287 Jaglo KR, Kleff S, Amundsen KL, Zhang X, Haake V, Zhang JZ, Deits T, Thomashow MF (2001) Components of the Arabidopsis C-Repeat/Dehydration- Responsive Element Binding Factor Cold-Response Pathway Are Conserved in Brassica napus and Other Plant Species. Plant Physiol. 127: 910–917

Jaillon O, Aury J-M, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, et al (2007) The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 449: 463– 467 Jin T, Chang Q, Li W, Yin D, Li Z, Wang D, Liu B, Liu L (2010) Stress-inducible expression of GmDREB1 conferred salt tolerance in transgenic alfalfa. Plant Cell Tiss. Org. 100: 219–227 Kaplan B, Davydov O, Knight H, Galon Y, Knight MR, Fluhr R, Fromm H (2006) Rapid Transcriptome Changes Induced by Cytosolic Ca2+ Transients Reveal ABRE-Related Sequences as Ca2+-Responsive cis Elements in Arabidopsis. Plant Cell 18: 2733–2748 Kaplan F, Kopka J, Haskell DW, Zhao W, Schiller KC, Gatzke N, Sung DY, Guy CL (2004) Exploring the temperature-stress metabolome of Arabidopsis. Plant Physiol. 136: 4159–4168 Kasuga M, Miura S, Shinozaki K, Yamaguchi-Shinozaki K (2004) A Combination of the Arabidopsis DREB1A Gene and Stress-Inducible rd29A Promoter Improved Drought- and Low-Temperature Stress Tolerance in Tobacco by Gene Transfer. Plant Cell Physiol. 45: 346–350 Kawahara Y, la Bastide de M, Hamilton JP, Kanamori H, McCombie WR, Ouyang S, Schwartz DC, Tanaka T, Wu J, Zhou S, et al (2013) Improvement of the Oryza sativa Nipponbare reference genome using next generation sequence and optical map data. Rice 6: 4 Kibbe WA (2007) OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res. 35: W43–6 Kim H-J, Kim Y-K, Park J-Y, Kim J (2002) Light signalling mediated by phytochrome plays an important role in cold-induced gene expression through the C- repeat/dehydration responsive element (C/DRE) in Arabidopsis thaliana. Plant J. 29: 693–704 Kim SY, Chung H-J, Thomas TL (1997) Isolation of a novel class of bZIP transcription factors that interact with ABA-responsive and embryo-specification elements in the Dc3 promoter using a modified yeast one-hybrid system. Plant J. 11: 1237–1251

Kitashiba H, Ishizaka T, Isuzugawa K, Nishimura K, Suzuki T (2004) Expression of a sweet cherry DREB1/CBF ortholog in Arabidopsis confers salt and freezing tolerance. J. Plant Physiol. 161: 1171–1176 Knight H, Trewavas AJ, Knight MR (1997) Calcium signalling in Arabidopsis thaliana responding to drought and salinity. Plant J. 12: 1067–1078 Knight H, Zarka DG, Okamoto H, Thomashow MF, Knight MR (2004) Abscisic Acid Induces CBF Gene Transcription and Subsequent Induction of Cold-Regulated Genes via the CRT Promoter Element. Plant Physiol. 135: 1710–1717 Koag MC, Wilkens S, Fenton RD, Resnik J, Vo E, Close TJ (2009) The K-Segment of Maize DHN1 Mediates Binding to Anionic Phospholipid Vesicles and Concomitant Structural Changes. Plant Physiol. 150: 1503–1514 Kovacs D, Kalmar E, Torok Z, Tompa P (2008) Chaperone Activity of ERD10 and ERD14, Two Disordered Stress-Related Plant Proteins. Plant Physiol. 147: 381– 390 Kreps J, Budworth P, Goff S, Wang R (2003) Identification of putative plant cold responsive regulatory elements by gene expression profiling and a pattern enumeration algorithm. Plant Biotechnol. J. 1: 345–352 Kreps JA, Wu Y, Chang H-S, Zhu T, Wang X, Harper JF (2002) Transcriptome Changes for Arabidopsis in Response to Salt, Osmotic, and Cold Stress. Plant Physiol. 130: 2129–2141 Lagrange T, Gauvin S, Yeo HJ, Mache R (1997) S2F, a leaf-specific trans-acting factor, binds to a novel cis-acting element and differentially activates the RPL21 gene. Plant Cell 9: 1469–1479 Laloi C, Mestres-Ortega D, Marco Y, Meyer Y, Reichheld J-P (2004) The Arabidopsis cytosolic thioredoxin h5 gene induction by oxidative stress and its W-box-mediated response to pathogen elicitor. Plant Physiol. 134: 1006–1016 Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, et al (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948 Lee B-H, Henderson DA, Zhu J-K (2005) The Arabidopsis cold-responsive transcriptome and its regulation by ICE1. Plant Cell 17: 3155–3175

Lee C-M, Thomashow MF (2012) Photoperiodic regulation of the C-repeat binding factor (CBF) cold acclimation pathway and freezing tolerance in Arabidopsis thaliana. Proc. Natl. Acad. Sci. U.S.A. 109: 15054–15059 Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouzé P, Rombauts S (2002) PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 30: 325–327 Lessard PA, Allen RD, Bernier FO, Crispino JD, Fujiwara T, Beachy RN (1991) Multiple nuclear factors interact with upstream sequences of differentially regulated β-conglycinin genes. Plant Mol. Biol. 16: 397–413 Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K (1998) Two Transcription Factors, DREB1 and DREB2, with an EREBP/AP2 DNA Binding Domain Separate Two Cellular Signal Transduction Pathways in Drought- and Low-Temperature-Responsive Gene Expression, Respectively, in Arabidopsis. Plant Cell 10: 1391–1406 Liu X, Brutlag DL, Liu JS (2001) BioProspector: discovering conserved DNA motifs in upstream regulatory regions of co-expressed genes. Pac Symp Biocomput 6: 127– 138 MacIsaac KD, Fraenkel E (2006) Practical Strategies for Discovering Regulatory DNA Sequence Motifs. PLoS Comput. Biol. 2: e36 Mahadevappa M, Warrington JA (2002) Housekeeping Genes. eLS. doi: 10.1038/npg.els.0000846 Mahony S, Benos PV (2007) STAMP: a web tool for exploring DNA-binding motif similarities. Nucleic Acids Res. 35: W253–W258 Martínez-Hernández A, López-Ochoa L, Argüello-Astorga G, Herrera-Estrella L (2002) Functional Properties and Regulatory Complexity of a Minimal RBCS Light- Responsive Unit Activated by Phytochrome, Cryptochrome, and Plastid Signals. Plant Physiol. 128: 1223–1233

Maruyama K, Sakuma Y, Kasuga M, Ito Y, Seki M, Goda H, Shimada Y, Yoshida S, Shinozaki K, Yamaguchi-Shinozaki K (2004) Identification of cold-inducible downstream genes of the Arabidopsis DREB1A/CBF3 transcriptional factor using two microarray systems. Physiol. Plant 38: 982–993 Maruyama K, Takeda M, Kidokoro S, Yamada K, Sakuma Y, Urano K, Fujita M, Yoshiwara K, Matsukura S, Morishita Y, et al (2009) Metabolic Pathways Involved in Cold Acclimation Identified by Integrated Analysis of Metabolites and Transcripts Regulated by DREB1A and DREB2A. Plant Physiol. 150: 1972–1980 Medina J, Bargues M, Terol J, Pérez-Alonso M, Salinas J (1999) The Arabidopsis CBF Gene Family Is Composed of Three Genes Encoding AP2 Domain- Containing Proteins Whose Expression Is Regulated by Low Temperature but Not by Abscisic Acid or Dehydration. Plant Physiol. 119: 463–470 Medina J, Catalá R, Salinas J (2011) The CBFs: Three Arabidopsis transcription factors to cold acclimate. Plant Sci. 180: 3–11 Mette MF, Aufsatz W, van der Winden J, Matzke MA, Matzke AJM (2000) Transcriptional silencing and promoter methylation triggered by double-stranded RNA. Nat. Rev. Micro. 19: 5194–5201 Mikkelsen MD, Thomashow MF (2009) A role for circadian evening elements in cold- regulated gene expression in Arabidopsis. Plant J. 60: 328–339 Ming R, Hou S, Feng Y, Yu Q, Dionne-Laporte A, Saw JH, Senin P, Wang W, Ly BV, Lewis KLT, et al (2008) The draft genome of the transgenic tropical fruit tree papaya (Carica papaya Linnaeus). Nature 452: 991–996 Miura K, Jin JB, Lee J, Yoo CY, Stirm V, Miura T, Ashworth EN, Bressan RA, Yun D-J, Hasegawa PM (2007) SIZ1-Mediated Sumoylation of ICE1 Controls CBF3/DREB1A Expression and Freezing Tolerance in Arabidopsis. Plant Cell 19: 1403–1414 Motamayor JC, Mockaitis K, Schmutz J, Haiminen N, Livingstone D, Cornejo O, Findley SD, Zheng P, Utro F, Royaert S, et al (2013) The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color. Genome Biol. 14: R53

Mølgaard P (1982) Temperature Observations in High Arctic Plants in Relation to Microclimate in the Vegetation of Peary Land, North Greenland. Arctic Alpine Res. 14: 105–115 Nakashima K, Fujita Y, Katsura K, Maruyama K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2006) Transcriptional Regulation of ABI3- and ABA- responsive Genes Including RD29B and RD29A in Seeds, Germinating Embryos, and Seedlings of Arabidopsis. Plant Mol. Biol. 60: 51–68–68 Ngai N, Tsai F-Y, Coruzzi G (1997) Light-induced transcriptional repression of the pea AS1 gene: identification of cis-elements and transfactors. Plant J. 12: 1021–1034 Novillo F, Alonso JM, Ecker JR, Salinas J (2004) CBF2/DREB1C is a negative regulator of CBF1/DREB1B and CBF3/DREB1A expression and plays a central role in stress tolerance in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 101: 3985– 3990 Oh S-J, Kwon C-W, Choi D-W, Song SI, Kim J-K (2007) Expression of barley HvCBF4 enhances tolerance to abiotic stress in transgenic rice. Plant Biotechnol. J. 5: 646–656 Oh S-J, Song SI, Kim YS, Jang H-J, Kim SY, Kim M, Kim Y-K, Nahm BH, Kim J-K (2005) Arabidopsis CBF3/DREB1A and ABF3 in Transgenic Rice Increased Tolerance to Abiotic Stress without Stunting Growth. Plant Physiol. 138: 341–351 Ohno R, Takumi S, Nakamura C (2003) Kinetics of transcript and protein accumulation of a low-molecular-weight wheat LEA D-11 dehydrin in response to low temperature. J. Plant Physiol. 160: 193–200 Örvar BL, Sangwan V, Omann F, Dhindsa RS (2000) Early steps in cold sensing by plant cells: the role of actin cytoskeleton and membrane fluidity. Plant J. 23: 785– 794 Park HC, Kim ML, Kang YH, Jeon JM, Yoo JH, Kim MC, Park CY, Jeong JC, Moon BC, Lee JH, et al (2004) Pathogen- and NaCl-Induced Expression of the SCaM-4 Promoter Is Mediated in Part by a GT-1 Box That Interacts with a GT-1-Like Transcription Factor. Plant Physiol. 135: 2150–2161 Pavesi G, Mauri G, Pesole G (2001) An algorithm for finding signals of unknown length in DNA sequences. Bioinformatics 17: S207–S214

Pavesi G, Mereghetti P, Mauri G, Pesole G (2004) Weeder Web: discovery of transcription factor binding sites in a set of sequences from co-regulated genes. Nucleic Acids Res. 32: W199–W203 Pellegrineschi A, Reynolds M, Pacheco M, Brito RM, Almeraya R, Yamaguchi- Shinozaki K, Hoisington D (2004) Stress-induced expression in wheat of the Arabidopsis thaliana DREB1A gene delays water stress symptoms under greenhouse conditions. Genome 47: 493–500 Pino M-T, Skinner JS, Park E-J, Jeknić Z, Hayes PM, Thomashow MF, Chen THH (2007) Use of a stress inducible promoter to drive ectopic AtCBF expression improves potato freezing tolerance while minimizing negative effects on tuber yield. Plant Biotechnol. J. 5: 591–604 Plesch G, Ehrhardt T, Mueller-Roeber B (2001) Involvement of TAAAG elements suggests a role for Dof transcription factors in guard cell-specific gene expression. Plant J. 28: 455–464 Prochnik S, Marri PR, Desany B, Rabinowicz PD, Kodira C, Mohiuddin M, Rodriguez F, Fauquet C, Tohme J, Harkins T, et al (2012) The Cassava Genome: Current Progress, Future Directions. Trop. Plant Biol. 5: 88–94 Qin F, Sakuma Y, Li J, Liu Q, Li Y-Q, Shinozaki K, Yamaguchi-Shinozaki K (2004) Cloning and Functional Analysis of a Novel DREB1/CBF Transcription Factor Involved in Cold-Responsive Gene Expression in Zea mays L. Plant Cell Physiol. 45: 1042–1052 Rahman LN, Chen L, Nazim S, Bamm VV, Yaish MW, Moffatt BA, Dutcher JR, Harauz G (2010) Interactions of intrinsically disordered Thellungiella salsuginea dehydrins TsDHN-1 and TsDHN-2 with membranes — synergistic effects of lipid composition and temperature on secondary structure. Biochem. Cell Biol. 88: 791– 807 Rahman LN, McKay F, Giuliani M, Quirk A, Moffatt BA, Harauz G, Dutcher JR (2013) Interactions of Thellungiella salsuginea dehydrins TsDHN-1 and TsDHN-2 with membranes at cold and ambient temperatures—Surface morphology and single-molecule force measurements show phase separation, and reveal tertiary and quaternary associations. Biochim. Biophys. Acta 1828: 967–980

Rahman LN, Smith GST, Bamm VV, Voyer-Grant JAM, Moffatt BA, Dutcher JR, Harauz G (2011) Phosphorylation of Thellungiella salsuginea dehydrins TsDHN-1 and TsDHN-2 facilitates cation-induced conformational changes and actin assembly. Biochemistry 50: 9587–9604 Rawat R, Xu Z-F, Yao K-M, Chye M-L (2005) Identification of cis-elements for ethylene and circadian regulation of the Solanum melongena gene encoding cysteine proteinase. Plant Mol. Biol. 57: 629–643 Rontein D, Basset G, Hanson AD (2002) Metabolic engineering of osmoprotectant accumulation in plants. Metab. Eng. 4: 49–56 Rorat T (2006) Plant dehydrins — tissue location, structure and function. Cell Mol. Biol. Lett. 11: 536–556 Rorat T, Grygorowicz WJ, Irzykowski W, Rey P (2003) Expression of KS-type dehydrins is primarily regulated by factors related to organ type and leaf developmental stage during vegetative growth. Planta 218: 878–885 Roth FP, Hughes JD, Estep PW, Church GM (1998) Finding DNA regulatory motifs within unaligned noncoding sequences clustered by whole-genome mRNA quantitation. Nat. Biotechnol. 16: 939–945 Rushton PJ, Torres JT, Parniske M, Wernert P, Hahlbrock K, Somssich IE (1996) Interaction of elicitor-induced DNA-binding proteins with elicitor response elements in the promoters of parsley PR1 genes. EMBO J. 15: 5690–5700 Sablowski RW (2007) Gene Expression in Plants. eLS. doi: 10.1002/9780470015902.a0002664.pub2 Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki K (2002) DNA-Binding Specificity of the ERF/AP2 Domain of Arabidopsis DREBs, Transcription Factors Involved in Dehydration- and Cold-Inducible Gene Expression. Biochem. Biophys. Res. Commun. 290: 998–1009 Sangwan V, Foulds I, Singh J, Dhindsa RS (2001) Cold-activation of Brassica napus BN115 promoter is mediated by structural changes in membranes and

cytoskeleton, and requires Ca2+ influx. Plant J. 27: 1–12

Sarnighausen E, Karlson DT, Zeng Y, Goldsbrough PB, Raghothama KG,

Ashworth EN (2004) Characterization of a Novel YnSKn Class of Dehydrin-Like cDNAs from Cold Acclimated Red-Osier Dogwood (Cornus sericea L.) Xylem. J. Crop Improv. 10: 17–35 Sato S, Nakamura Y, Kaneko T, Asamizu E, Kato T, Nakao M, Sasamoto S, Watanabe A, Ono A, Kawashima K, et al (2008) Genome Structure of the Legume, Lotus japonicus. DNA Res. 15: 227–239 Satoh R, Nakashima K, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2002) ACTCAT, a Novel cis-Acting Element for Proline- and Hypoosmolarity-Responsive Expression of the ProDH Gene Encoding Proline Dehydrogenase in Arabidopsis. Plant Physiol. 130: 709–719 Schmutz J, Cannon SB, Schlueter J, Ma J, Mitros T, Nelson W, Hyten DL, Song Q, Thelen JJ, Cheng J, et al (2010) Genome sequence of the palaeopolyploid soybean. Nature 463: 178–183 Schneider TD, Stephens RM (1990) Sequence logos: a new way to display consensus sequences. Nucleic Acids Res. 18: 6097–6100 Schroeder JI, Kwak JM, Allen GJ (2001) Guard cell abscisic acid signalling and engineering drought hardiness in plants. Nature 410: 327–330 Seki M, Ishida J, Narusaka M, Fujita M, Nanjo T, Umezawa T, Kamiya A, Nakajima M, Enju A, Sakurai T, et al (2002) Monitoring the expression pattern of around 7,000 Arabidopsis genes under ABA treatments using a full-length cDNA microarray. Funct. Integr. Genomics 2: 282–291 Shahmuradov IA (2005) Plant promoter prediction with confidence estimation. Nucleic Acids Res. 33: 1069–1076 Shahmuradov IA, Gammerman AJ, Hancock JM, Bramley PM, Solovyev VV (2003) PlantProm: a database of plant promoter sequences. Nucleic Acids Res. 31: 114– 117 Shekhawat UKS, Srinivas L, Ganapathi TR (2011) MusaDHN-1, a novel multiple stress-inducible SK(3)-type dehydrin gene, contributes affirmatively to drought- and salt-stress tolerance in banana. Planta 234: 915–932

Shen Y, Tang M-J, Hu Y-L, Lin Z-P (2004) Isolation and characterization of a dehydrin- like gene from drought-tolerant Boea crassifolia. Plant Sci. 166: 1167–1175 Shih M-D, Hoekstra FA, Hsing Y-IC (2008) Late Embryogenesis Abundant Proteins. In J-CKAM Delseny, ed, Advances in Botanical Research. Academic Press, pp 211– 255 Shinozaki K, Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and low temperature: differences and cross-talk between two stress signaling pathways. Curr. Opin. Plant Biol. 3: 217–223 Shulaev V, Sargent DJ, Crowhurst RN, Mockler TC, Folkerts O, Delcher AL, Jaiswal P, Mockaitis K, Liston A, Mane SP, et al (2010) The genome of woodland strawberry (Fragaria vesca). Nat. Genet. 43: 109–116 Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi- Shinozaki K (2003) Two different novel cis-acting elements of erd1, a clpA homologous Arabidopsis gene function in induction by dehydration stress and dark-induced senescence. Plant J. 33: 259–270 Singh S, Rathore M, Goyary D, Singh RK, Anandhan S, Sharma DK, Ahmed Z (2011) Induced ectopic expression of At-CBF1 in marker-free transgenic tomatoes confers enhanced chilling tolerance. Plant Cell Rep. 30: 1019–1028 Skinner JS, Zitzewitz J, Szűcs P, Marquez-Cedillo L, Filichkin T, Amundsen K, Stockinger EJ, Thomashow MF, Chen THH, Hayes PM (2005) Structural, Functional, and Phylogenetic Characterization of a Large CBF Gene Family in Barley. Plant Mol. Biol. 59: 533–551 Slotte T, Hazzouri KM, Ågren JA, Koenig D, Maumus F, Guo Y-L, Steige K, Platts AE, Escobar JS, Newman LK, et al (2013) The Capsella rubella genome and the genomic consequences of rapid mating system evolution. Nat. Genet. 45: 831– 835 Smale ST (2005) Promoters. Encyclopedia of Life Sciences. doi: 10.1038/npg.els.0005025 Smedley D, Haider S, Ballester B, Holland R, London D, Thorisson G, Kasprzyk A (2009) BioMart – biological queries made easy. BMC Genomics 10: 22

Starr G, Neuman DS, Oberbauer SF (2004) Ecophysiological analysis of two arctic sedges under reduced root temperatures. Physiol. Plant 120: 458–464 Stockinger EJ, Gilmour SJ, Thomashow MF (1997) Arabidopsis thaliana CBF1 encodes an AP2 domain-containing transcriptional activator that binds to the C- repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in response to low temperature and water deficit. Proc. Natl. Acad. Sci. U.S.A. 94: 1035–1040 Sun C, Palmqvist S, Olsson H, Borén M, Ahlandsberg S, Jansson C (2003) A Novel WRKY Transcription Factor, SUSIBA2, Participates in Sugar Signaling in Barley by Binding to the Sugar-Responsive Elements of the iso1 Promoter. Plant Cell 15: 2076–2092 Suzuki M, Ketterling MG, McCarty DR (2005) Quantitative statistical analysis of cis- regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis. Plant Physiol. 139: 437–447 Sørensen M, Müller M, Skerritt J, Simpson D (1996) Hordein promoter methylation and transcriptional activity in wild-type and mutant barley endosperm. Mol. Gen. Genet. 250: 750–760 Šunderlíková V, Salaj J, Kopecky D, Salaj T, Wilhem E, Matušíková I (2009) Dehydrin genes and their expression in recalcitrant oak (Quercus robur) embryos. Plant Cell Rep. 28: 1011–1021 Takumi S, Shimamura C, Kobayashi F (2008) Increased freezing tolerance through up-regulation of downstream genes via the wheat CBF gene in transgenic tobacco. Plant Physiol. Biochem. 46: 205–211 Tatematsu K, Ward S, Leyser O, Kamiya Y, Nambara E (2005) Identification of cis- elements that regulate gene expression during initiation of axillary bud outgrowth in Arabidopsis. Plant Physiol. 138: 757–766 Terzaghi WB, Cashmore AR (1995) Light-Regulated Transcription. Annu. Rev. Plant Physiol. Plant. Mol. Biol. 46: 445–474 The Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796–815

Thomashow MF (2010) Molecular Basis of Plant Cold Acclimation: Insights Gained from Studying the CBF Cold Response Pathway. Plant Physiol. 154: 571–577 Thomashow MF, Gilmour SJ, Stockinger EJ, Jaglo-Ottosen KR, Zarka DG (2001) Role of the Arabidopsis CBF transcriptional activators in cold acclimation. Physiol. Plant 112: 171–175 Tommasini L, Svensson J, Rodriguez E, Wahid A, Malatrasi M, Kato K, Wanamaker S, Resnik J, Close T (2008) Dehydrin gene expression provides an indicator of low temperature and drought stress: transcriptome-based analysis of Barley (Hordeum vulgare L.). Funct. Integr. Genomics 8: 387–405–405 Tóth R, Kevei E, Hall A, Millar AJ, Nagy F, Kozma-Bognár L (2001) Circadian clock- regulated expression of phytochrome and cryptochrome genes in Arabidopsis. Plant Physiol. 127: 1607–1616 Tuskan GA, DiFazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, et al (2006) The Genome of Black Cottonwood, Populus trichocarpa (Torr. & Gray). Science 313: 1596–1604 Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K (1993) An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. Plant Cell 5: 1529–1539 Van Die IM, Bergmans HEN, Hoekstra WPM (1983) Transformation In Escherichia coli: Studies on the Role of the Heat Shock in Induction of Competence. Microbiology 129: 663–670 Varshney RK, Chen W, Li Y, Bharti AK, Saxena RK, Schlueter JA, Donoghue MTA, Azam S, Fan G, Whaley AM, et al (2011) Draft genome sequence of pigeonpea (Cajanus cajan), an orphan legume crop of resource-poor farmers. Nat. Biotechnol. 30: 83–89 Varshney RK, Song C, Saxena RK, Azam S, Yu S, Sharpe AG, Cannon S, Baek J, Rosen BD, Tar'an B, et al (2013) Draft genome sequence of chickpea (Cicer arietinum) provides a resource for trait improvement. Nat. Biotechnol. 31: 240–246 Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, et al (2010) The genome of the domesticated apple (Malus × domestica Borkh.). Nat. Genet. 42: 833–839

Verde I, Abbott AG, Scalabrin S, Jung S, Shu S, Marroni F, Zhebentyayeva T, Dettori MT, Grimwood J, Cattonaro F, et al (2013) The high-quality draft genome of peach (Prunus persica) identifies unique patterns of genetic diversity, domestication and genome evolution. Nat. Genet. 45: 487–494 Vincze T, Posfai J, Roberts RJ (2003) NEBcutter: A program to cleave DNA with restriction enzymes. Nucleic Acids Res. 31: 3688–3691 Vogel JP, Garvin DF, Mockler TC, Schmutz J, Rokhsar D, Bevan MW, Barry K, Lucas S, Harmon-Smith M, Lail K, et al (2010) Genome sequencing and analysis of the model grass Brachypodium distachyon. Nature 463: 763–768 Vogel JT, Zarka DG, Van Buskirk HA, Fowler SG, Thomashow MF (2004) Roles of the CBF2 and ZAT12 transcription factors in configuring the low temperature transcriptome of Arabidopsis. Physiol. Plant 41: 195–211 Vornam B, Gailing O, Derory J, Plomion C, Kremer A, Finkeldey R (2011) Characterisation and natural variation of a dehydrin gene in Quercus petraea (Matt.) Liebl. Plant Biol. 13: 881–887 Wachter A, Tunc-Ozdemir M, Grove BC, Green PJ, Shintani DK, Breaker RR (2007) Riboswitch Control of Gene Expression in Plants by Splicing and Alternative 3′ End Processing of mRNAs. Plant Cell 19: 3437–3450 Wang X, Wang H, Wang J, Sun R, Wu J, Liu S, Bai Y, Mun J-H, Bancroft I, Cheng F, et al (2011) The genome of the mesopolyploid crop species Brassica rapa. Nat. Genet. 43: 1035–1039 Wang Z, Hobson N, Galindo L, Zhu S, Shi D, McDill J, Yang L, Hawkins S, Neutelings G, Datla R, et al (2012) The genome of flax (Linum usitatissimum) assembled de novo from short shotgun sequence reads. Plant J. 72: 461–473 Wei K, Chen J, Wang Y, Chen Y, Chen S, Lin Y, Pan S, Zhong X, Xie D (2012) Genome-wide analysis of bZIP-encoding genes in maize. DNA Res 19: 463–476 Wei W, Huang J, Hao Y-J, Zou H-F, Wang H-W, Zhao J-Y, Liu X-Y, Zhang W-K, Ma B, Zhang J-S, et al (2009) Soybean GmPHD-Type Transcription Regulators Improve Stress Tolerance in Transgenic Arabidopsis Plants. PLoS ONE 4: e7209 Weigel D, Glazebrook J (2006) Transformation of Agrobacterium using the freeze-thaw method. CSH Protoc. doi: 10.1101/pdb.prot4666

Weisshaar B, Armstrong GA, Block A, da Costa e Silva O, Hahlbrock K (1991) Light-inducible and constitutively expressed DNA-binding proteins recognizing a plant promoter element with functional relevance in light responsiveness. EMBO J. 10: 1777 Welling A, Rinne P, Vihera-Aarnio A, Kontunen-Soppela S, Heino P, Palva ET (2004) Photoperiod and temperature differentially regulate the expression of two dehydrin genes during overwintering of birch (Betula pubescens Ehrh.). J. Exp. Bot. 55: 507–516 Wisniewski M, Norelli J, Bassett C, Artlip T, Macarisin D (2011) Ectopic expression of a novel peach (Prunus persica) CBF transcription factor in apple (Malus × domestica) results in short-day induced dormancy and increased cold hardiness. Planta 233: 971–983 Wisniewski ME, Bassett CL, Renaut J, Farrell R, Tworkoski T, Artlip TS (2006) Differential regulation of two dehydrin genes from peach (Prunus persica) by photoperiod, low temperature and water deficit. Tree Physiol. 26: 575–584 Wong CE, Li Y, Whitty BR, Díaz-Camino C, Akhter SR, Brandle JE, Golding GB, Weretilnyk EA, Moffatt BA, Griffith M (2005) Expressed sequence tags from the Yukon ecotype of Thellungiella reveal that gene expression in response to cold, drought and salinity shows little overlap. Plant Mol. Biol. 58: 561–574 Xu N, Hagen G, Guilfoyle T (1997) Multiple auxin response modules in the soybean SAUR 15A promoter. Plant Sci. 126: 193–201 Xue Y, Carpenter R, Dickinson HG, Coen ES (1996) Origin of allelic diversity in antirrhinum S locus RNases. Plant Cell 8: 805–814 Yamasaki Y, Koehler G, Blacklock BJ, Randall SK (2013) Dehydrin expression in soybean. Plant Physiol. Biochem. 70: 213–220 Yanagisawa S, Sheen J (1998) Involvement of Maize Dof Zinc Finger Proteins in Tissue-Specific and Light-Regulated Gene Expression. Plant Cell 10: 75–89 Yang R, Jarvis DE, Chen H, Beilstein MA, Grimwood J, Jenkins J, Shu S, Prochnik S, Xin M, Ma C, et al (2013) The Reference Genome of the Halophytic Plant Eutrema salsugineum. Front. Plant Sci. doi: 10.3389/fpls.2013.00046

Young ND, Debellé F, Oldroyd GED, Geurts R, Cannon SB, Udvardi MK, Benedito VA, Mayer KFX, Gouzy J, Schoof H, et al (2011) The Medicago genome provides insight into the evolution of rhizobial symbioses. Nature 480: 520–524 Zarka DG, Vogel JT, Cook D, Thomashow MF (2003) Cold induction of Arabidopsis CBF genes involves multiple ICE (inducer of CBF expression) promoter elements and a cold-regulatory circuit that is desensitized by low temperature. Plant Physiol. 133: 910–918 Zhang G, Liu X, Quan Z, Cheng S, Xu X, Pan S, Xie M, Zeng P, Yue Z, Wang W, et al (2012) Genome sequence of foxtail millet (Setaria italica) provides insights into grass evolution and biofuel potential. Nat. Biotechnol. 30: 549–554 Zhang S, Mehdy MC (1994) Binding of a 50-kD Protein to a U-Rich Sequence in an mRNA Encoding a Proline-Rich Protein That Is Destabilized by Fungal Elicitor. Plant Cell 6: 135–145 Zhang X, Henriques R, Lin S-S, Niu Q-W, Chua N-H (2006) Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc. 1: 641–646 Zhao Z, Tan L, Dang C, Zhang H, Wu Q, An L (2012) Deep-sequencing transcriptome analysis of chilling tolerance mechanisms of a subnival alpine plant, Chorispora bungeana. BMC Plant Biol. 12: 222 Zhou D, Zhou J, Meng L, Wang Q, Xie H, Guan Y, Ma Z, Zhong Y, Chen F, Liu J (2009) Duplication and adaptive evolution of the COR15 genes within the highly cold-tolerant Draba lineage (Brassicaceae). Gene 441: 36–44 Zhou MQ, Shen C, Wu LH, Tang KX, Lin J (2011) CBF-dependent signaling pathway: A key responder to low temperature stress in plants. Crit Rev. in Biotech. 31: 186– 192 Zimmer AD, Lang D, Buchta K, Rombauts S, Nishiyama T, Hasebe M, Van de Peer Y, Rensing SA, Reski R (2013) Reannotation and extended community resources for the genome of the non-seed plant Physcomitrella patens provide insights into the evolution of plant gene structures and functions. BMC Genomics 14: 498

Zúñiga-Feest A, Ort DR, Gutiérrez A, Gidekel M, Bravo LA, Corcuera LJ (2005) Light regulation of sucrose-phosphate synthase activity in the freezing-tolerant grass Deschampsia antarctica. Photosynth. Res. 83: 75–86

100