When you get a result that you expect, you have another result, but when you get a result you don’t expect, you have a discovery.
STUDIES ON
MYCOBACTERIUM AVIUM SUBSP. PARATUBERCULOSIS:
GENOTYPIC AND PHENOTYPIC VARIATIONS
DISSERTATION
Presented in Partial Fulfillment of the Requirements for
the Degree Doctor of Philosophy in the Graduate
School of The Ohio State University
By
Alifiya H. Ghadiali, M.Sc.
*****
The Ohio State University
2005
Dissertation Committee: Approved by
Professor Srinand Sreevatsan, Adviser ______Professor Y. Mohamed Saif Adviser Professor William P. Shulaw Graduate Program in Professor Jeffrey T. LeJeune Veterinary Preventive Medicine
Copyright by
Alifiya Huzefa Ghadiali
2005 ABSTRACT
The objective of the study was to understand the genotypic and phenotypic
variations across Mycobacterium avium subsp. paratuberculosis (M. paratuberculosis) isolates form diverse hosts and geographic locations.
Multiplex PCR of IS900 loci (MPIL) fingerprint analysis of M. paratuberculosis isolates recovered from diverse hosts and geographic localities clustered 78% of bovine origin isolates into a major node, while isolates from human and ovine sources showed greater genetic diversity. Amplified fragment length polymorphism (AFLP) analysis clustered 75% of the isolates from bovine sources into 2 major nodes while those recovered from sheep or human clustered on distinct branches. This suggested that the M. paratuberculosis isolates were genotypically homogenous or were converging into a common fingerprint.
To evaluate the alternate possibility that MPIL and AFLP analyses were
inadequate for dissecting the M. paratuberculosis genotypes, short sequence repeat (SSR) analysis was performed on mycobacterial isolates obtained from 33 different host species and from environmental sources. Sequence based characterization of the G-repeat locus enabled differentiation of the M. paratuberculosis isolates from the major MPIL cluster into seven distinct alleles. Subsequent analysis of M. paratuberculosis isolates from human Crohn’s disease cases using two polymorphic SSR loci (G- and GGT- repeats)
ii identified a limited number of genotypes amongst the human strains indicating an
association of a few M. paratuberculosis types with the pathobiology of Crohn’s disease.
SSR analysis using both polymorphic loci also enabled identification of varying levels of within-farm and between farm diversity and indicated that 7g-4ggt as the most common genotype in animals from Ohio dairy farms.
To explore whether the differences in fingerprint profiles translated to variation in
biological function and/or host adaptation, cDNA microarray analysis of a human
macrophage cell line exposed to M. paratuberculosis isolated from cattle and human
hosts was undertaken. Results indicated that the expression profiles induced by
representative cattle and human M. paratuberculosis strains differed in several key
inflammatory and apoptotic pathways suggesting that M. paratuberculosis strains with different genotypes induce variant transcriptional regulation.
Taken together, the results of our genotypic and phenotypic analyses
demonstrated that SSR analysis enabled the genetic characterization of M. paratuberculosis isolates from different host species, and provided support for a genotype-phenotype association in M. paratuberculosis infection.
iii
Dedicated to my father
Saifuddin B. Motiwala
iv ACKNOWLEDGMENTS
…the words may be few but the gratitude is sincere and heart-felt…
Grateful acknowledgment is due to my adviser, Dr. Srinand Sreevatsan, who
encouraged and challenged me throughout my academic program. I have learned
substantially from his uncompromising emphasis on quality and meaningful research. His
refusal to accept anything less than my best efforts enabled me to achieve more than what
I believed possible.
I would also like to thank my committee members, Dr. Y. Mohamed Saif, Dr.
William P. Shulaw and Dr. Jeffrey T. LeJeune, for providing me with constructive comments, advice and encouragement throughout the research program.
Special thanks are due to Megan Strother for technical assistance at various stages in my research, for culturing and maintaining of samples and strains, for handling laboratory supplies at any time of the day, for locating precious samples saved
‘somewhere’ in the -70°C and -20°C freezers, and last but not the least for the laughs and tears and words of encouragement during these years and for sharing my frustrations in work with the fastidious M. paratuberculosis.
.
v I also thank all my colleagues in the Sreevatsan Laboratory for sharing experiences and knowledge and for steady encouragement throughout the course of this work.
Finally, I take this opportunity to express my profound gratitude to my mother,
Zulekha S. Motiwala, and my sister, Mariyam M. Patni, for supporting me in my educational pursuits. I also want to thank my husband, Huzefa M. Ghadiali, for his unwavering patience and understanding in dealing with my crazy schedules and inexplicable emotional tantrums (which were inversely proportional to the success of my experiments)!
vi VITA
February 7, 1976 …….… Born – Mumbai (Bombay), India
1996 …………..……….. Bachelor of Science (Major-Microbiology and Biochemistry) Mithibai College, University of Mumbai, India
1998 …………..……….. Master of Science (Major-Biochemistry) Seth GS Medical College, University of Mumbai, India
1998 - 1999 …….……… Research Assistant Department of Clinical Pharmacology, Seth GS Medical College and KEM Hospital, Mumbai, India
1999 - 2001 …….……… Research Assistant and Co-ordinator Sneha-India and Medical Research Council - Environmental Epidemiology Unit, United Kingdom Mumbai, India
2001 – present …...…….. Graduate Research Associate Food Animal Health Research Program, Ohio Agricultural Research Development Center and Department of Veterinary Preventive Medicine, The Ohio State University, Columbus, Ohio
PUBLICATIONS
1. Ghadiali A.H., M. Strother, N.E. Theus, R.W. Stich, B. Byrum, W.P. Shulaw, V. Kapur and S. Sreevatsan. Rapid detection and strain typing of Mycobacterium avium subsp. paratuberculosis from broth cultures. In press. J. Clin. Microbiol.
2. Rajeev S., Y. Zhang, S. Sreevatsan, A.S. Motiwala and B. Byrum. 2005. Evaluation of multiple genomic targets for identification and confirmation of Mycobacterium avium subsp. paratuberculosis isolates using real-time PCR. Vet. Microbiol. 105: 215-21. vii 3. Ghadiali A.H., M. Strother, S.A. Naser, E.J.B. Manning and S. Sreevatsan. 2004. Genetic analysis of polymorphic loci in Mycobacterium avium subspecies paratuberculosis isolated from Crohn’s disease patients and animal species exhibit similar polymorphic loci patterns. J. Clin. Microbiol. 42:5345-5348.
4. Motiwala, A.S., A. Amonsin, M. Strother, E.J.B. Manning, V. Kapur, and S. Sreevatsan. 2004. Molecular Epidemiology of Mycobacterium avium subsp. paratuberculosis Isolates Recovered from Wild Animal Species. J. Clin. Microbiol. 42:1703-1712.
5. Amonsin, A., L.L. Li, Q. Zhang, J.P. Bannantine, A.S. Motiwala, S. Sreevatsan, and V. Kapur. 2004. Multilocus Short Sequence Repeat Sequencing Approach for Differentiating among Mycobacterium avium subsp. paratuberculosis Strains. J. Clin. Microbiol. 42:1694-1702.
6. Ozbek, A., F.C. Michel, M. Strother, A.S. Motiwala, B.R. Byrum, W.P. Shulaw, C.G. Thornton, and S. Sreevatsan. 2003. Evaluation of two recovery methods for detection of Mycobacterium avium subsp. paratuberculosis by PCR: direct-dilution- centrifugation and C(18)-carboxypropylbetaine processing. FEMS Microbiol. Lett. 229:145-51.
7. Motiwala, A.S., M. Strother, A. Amonsin, B. Byrum, S.A. Naser, J.R. Stabel, W.P. Shulaw, J.P. Bannantine, V. Kapur, and S. Sreevatsan. 2003. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis: evidence for limited strain diversity, strain sharing, and identification of unique targets for diagnosis. J. Clin. Microbiol. 41:2015-26.
PUBLISHED ABSTRACTS
1. Ghadiali A.H., M. Strother, N.E. Theus, B. Byrum, R.W. Stich, W.P. Shulaw, S. Sreevatsan. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis in Ohio dairy farms. Conference of Research Workers in Animal Diseases. 85th Annual Meeting, Chicago, Illinois, November 14-16, 2004. (Abstract # 99).
2. Ghadiali A.H., S.A. Naser, E.J.B. Manning and S. Sreevatsan. Short sequence repeat analysis of Mycobacterium avium subsp. paratuberculosis isolates from Crohn’s disease patients exhibit genetic similarity to extant clones of animal origin. 2004 OARDC Annual Research Conference, Wooster, Ohio, April 29, 2004 (Poster # 11).
viii 3. Motiwala A.S., S.A. Naser and S. Sreevatsan. Short sequence repeat analysis of Mycobacterium avium subsp. paratuberculosis isolates from Crohn’s disease patients exhibit genetic similarity to extant clones of bovine and caprine origin. Conference of Research Workers in Animal Diseases. 84rd Annual Meeting, Chicago, Illinois, November 9-11, 2003. (Abstract # 18P).
4. Motiwala A.S., M. Strother, E.J.B. Manning and Sreevatsan S. Restricted Diversity within Mycobacterium avium subsp. paratuberculosis Isolated from Exotic Animal Species from Diverse Geographic Locations. American Society for Microbiology. 103rd General Meeting, Washington DC, May 18-22, 2003. (Abstract # U-39).
5. Motiwala A.S., M. Strother, E.J.B. Manning and Sreevatsan S. Restricted Diversity within Mycobacterium avium subsp. paratuberculosis Isolated from Exotic Animal Species from Diverse Geographic Locations. 2003 OARDC Annual Research Conference, Columbus, Ohio, April 24, 2003 (Poster # 18).
6. Motiwala A.S., M. Strother, N.E. Theus, B. Byrum, R.W. Stitch, W.P. Shulaw and S. Sreevatsan. Target and Signal Amplification of Mycobacterium avium subsp. paratuberculosis Specific Sequences from Early Broth Cultures. Conference of Research Workers in Animal Diseases. 83rd Annual Meeting, St Louis, Missouri, November 10-12, 2002. (Abstract # 114).
7. Ozbek A., A.S. Motiwala, A. Amonsin, V. Kapur, J. Bannantine, S.A. Naser and S. Sreevatsan. A Comparative Analysis of 55 Short Gene Segments Identified by Genome Sequencing for Mycobacterium avium paratuberculosis Specificity. Conference of Research Workers in Animal Diseases. 83rd Annual Meeting, St Louis, Missouri, November 10-12, 2002. (Abstract # 115).
8. Ozbek A., M. Strother, A.S. Motiwala, B. Byrum, W. Shulaw, F.C. Michel, Jr and S. Sreevatsan. Comparative Evaluation of Two Recovery Methods to Diagnose Mycobacterium avium subspecies paratuberculosis by Direct Fecal PCR. North Central Conference of Veterinary Laboratory Diagnosticians. 41st Annual Meeting, Reynoldsburg, Ohio, June 10-11, 2002. (Oral presentation).
9. Motiwala A.S., M. Strother, B. Byrum, J.R. Stabel, W.P. Shulaw, S.A. Naser and Sreevatsan S. Molecular Approach to Detect and Fingerprint Mycobacterium paratuberculosis. American Society for Microbiology. 102nd General Meeting, Salt Lake City, Utah, May 19-23, 2002. (Abstract # U-5).
ix FIELDS OF STUDY
Major Field: Veterinary Preventive Medicine
Minor Field: Molecular Microbiology
x TABLE OF CONTENTS
Abstract …………………………………………………………...………………………ii
Dedication ……………………………………………………….…...... iv
Acknowledgments …………………………………………………………...... v
Vita …………………………………………………………………………….………..vii
List of Tables ……………………………….………………………...... xviii
List of Figures ………………………………………………………………...... xix
List of Phylogenetic Terms …………………………………………………………...…xx
Chapter 1. Literature review: Current understanding of the genetic diversity
1.1. Abstract ……………………………...……………………………..…………1
1.2. Introduction ……………………………………….………………..…………2
1.3. Genotyping methods based on insertion elements …………..……..…………5
1.3.1. IS900 - restriction fragment length polymorphism .………..…………6
1.3.2. IS1311 - restriction fragment length polymorphism ……...…………14
1.3.3. Multiplex PCR for IS900 loci …………………………………….…15
1.4. Genotyping methods based on repetitive elements ……………………….…18
1.4.1. Variable number tandem repeats (VNTR) ……………..……………18
xi 1.4.2. Mycobacterial interspersed repetitive units (MIRU) ……..…………23
1.5 Genotyping methods based on single nucleotide polymorphisms ..…………24
1.5.1. Amplified fragment length polymorphism (AFLP) …………………25
1.5.2. Randomly amplified polymorphic DNA (RAPD) …..………………27
1.5.3. Pulse field gel electrophoresis (PFGE) …...…………………………29
1.5.4. rRNA gene and spacer region analysis …...…………………………32
1.6. Comparative genomics …….………………...………………………………33
1.7. Concluding comments ………………………………………………………38
1.8. Acknowledgment ……………………………………………………………42
1.9. References ……………………...……………………………………………42
Chapter 2. Molecular epidemiology of Mycobacterium avium subspecies paratuberculosis: Evidence for limited strain diversity, strain sharing, and identification of unique targets for diagnosis.
2.1. Abstract ………………………………………………………...... 57
2.2. Introduction …………………………………………………….……………58
2.3. Materials and methods …………………………………………...………….61
2.3.1. Bacteria …………………………………………………...…………61
2.3.2. DNA extraction ……………………………………………...………62
2.3.3. Genetic fingerprinting using multiplex PCR for integration loci …...62
2.3.4. Analysis of MPIL fingerprints …………………………………...….63
2.3.5. Amplified fragment length polymorphism (AFLP) ……………...….63
2.3.6. Computer assisted analysis of AFLP fingerprints ………………..…65
2.3.7. Concordance analysis ………………………………………………..65
xii 2.3.8. PCR amplification and hybridization for IS900 integration loci …....65
2.3.9. PCR amplification of M. paratuberculosis-unique sequence 251 …..67
2.3.10. PCR – REA for polymorphisms in hsp65 and IS1311 genes …….…67
2.3.11. DNA sequencing ………………………………………………….…68
2.4. Results …………………………………………….…………...... 68
2.4.1. Fingerprinting by MPIL ………………………………………….….68
2.4.2. Fingerprinting by AFLP …………………………………………..…69
2.4.3. PCR – REA for polymorphisms in IS1311 gene ……………………71
2.4.4. PCR amplification of two IS900 integration sites ………………..…72
2.4.5. Presence of M. paratuberculosis-specific target 251 ………………..72
2.4.6. PCR – REA for polymorphisms in hsp65 gene …………………..…73
2.5. Discussion ………………………………………….………………………..73
2.5.1. Molecular diversity in M. paratuberculosis ……………………...….74
2.5.2. Integration loci as M. paratuberculosis-unique targets ………….….78
2.6. Acknowledgment ……………………………..………………………...…...81
2.7. References …………………………………………….………………..……81
Chapter 3. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis recovered from wild animal species.
3.1. Abstract …………………………………………….…………...... 98
3.2. Introduction …………………………………………….…………………....99
3.3. Materials and methods ……………………………………………………100
3.3.1. Bacterial isolates ………………………………………………….100
xiii 3.3.2. DNA extraction ………………………………………………….…101
3.3.3. Molecular characterization of the isolates …………………………102
3.3.4. MPIL fingerprint analysis …………………………………….……103
3.3.5. Short sequence repeat analysis ………………………………..……104
3.4. Results ……………………………………………………….……….….....105
3.4.1. Molecular characterization of wildlife isolates …………………….105
3.4.2. MPIL fingerprint analysis …………………………………….……106
3.4.3. Short sequence repeat analysis ………………………………..……107
3.5. Discussion ……………………………………………………….…..……..109
3.5.1. Definitive identification requires multiple markers ………..………110
3.5.2. Molecular diversity analysis of M. paratuberculosis …...…………111
3.5.3. Restricted diversity revealed by MPIL analysis ………...…………112
3.5.4. SSR sequencing enables high-resolution subtyping ………….……113
3.5.5. Evidence for interspecies strain transmission and host-specificity 114
3.5.6. Concluding comments ……………………………………..………116
3.6. Acknowledgment ……………….………………………………….…...... 117
3.7. References ………………………………………...….…………………….117
Chapter 4. Mycobacterium avium subspecies paratuberculosis strains isolated from Crohn’s disease patients and animal species exhibit similar polymorphic loci patterns.
4.1. Abstract ……………..………………………….……………..……………133
4.2. Introduction ………..……………………………….………………………134
xiv 4.3. Materials and methods …………..…………………………………………135
4.4. Results ……………..………………………….…………...... ……………137
4.5. Discussion ………………….....………………….…………...……………138
4.6. Acknowledgment ……………………..………………….…...……………142
4.7. References ………...…………………………………………..……………142
Chapter 5. Rapid detection and strain typing of Mycobacterium avium subsp. paratuberculosis from broth cultures.
5.1. Abstract ……………………………………...……………..………………149
5.2. Introduction ……………………………………………….………..………150
5.3. Materials and methods ……………………………………..………………152
5.3.1. Fecal sample processing ……………………………….…..………152
5.3.2. Liquid-solid double culture method ………………...……...………153
5.3.3. Molecular detection …………………………….…...……..………154
5.3.4. Short sequence repeat analysis ………………………….….………155
5.4. Results ……………………………………………………….……..…...... 156
5.4.1. M. paratuberculosis detection ……………………………..………156
5.4.2. Short sequence repeat analysis ……………………...……...………157
5.5. Discussion ……….……..…………………………….…...………..………158
5.5.1. Diagnostics ……..……………………………….….………………159
5.5.2. Molecular subtyping ……….……………………….…...…………161
5.6. Acknowledgment ….…...……………………………….…...……..………164
xv 5.7. References …………………………………………….…...……….………164
Chapter 6. Transcriptional analysis of human macrophages exposed to human
and bovine strains of Mycobacterium avium subsp. paratuberculosis reveals distinct profiles
6.1. Abstract ………………………………...………………....………..………174
6.2. Introduction …………………………………………….…………..………175
6.3. Materials and methods ……………………………………………..………177
6.3.1. Bacterial cultures ...…………………………..…….………………177
6.3.2. Macrophages (THP-1 cells) …………...……….…………..………177
6.3.3. Infections ……………………………………….…………..………178
6.3.4. cRNA target preparation and array hybridization …………..…...…178
6.3.5. Microarray data analysis …………………………………..…….…178
6.3.6. RT-PCR assays ……………………………...……………..………179
6.4. Results …………………………………….…………...... ………………180
6.4.1. Genes similarly regulated in THP-1 cells infected with human
and bovine M. paratuberculosis strains ……….…………………180
6.4.2. Genes differentially regulated in THP-1 cells infected with
human and bovine M. paratuberculosis strains …...... …………180
6.4.3. Analysis of altered gene expression by RT-PCR analysis …………181
6.5. Discussion …………………...………………….……….....………………181
6.6. Acknowledgment ………………………………………....…………..……184
xvi 6.7. References ………………………………………………..…………...……184
Bibliography ……………………………………………………………..……………194
xvii LIST OF TABLES
1.1. Comparison of the discrimination power of various M.
paratuberculosis fingerprinting techniques …………………………………...... 55
2.1. Bacterial isolates used for analysis …………….………………...... 96
3.1. Molecular characteristics of acid fast strains by host and geographic locality ...128
4.1. Short sequence repeat analysis results by host species and targets ……...... 148
5.1. Contingency tables by four identification protocols ………...……...... 173
6.1. Genotypic characteristic of the M. paratuberculosis isolates analyzed …….....189
6.2. RT-PCR targets analyzed and the corresponding primer pairs ……………...... 190
6.3. Genes similarly regulated in THP-1 cells infected with human and
bovine M. paratuberculosis strains .……………….....…...... 191
6.4. Genes differentially regulated in THP-1 cells infected with human
and bovine M. paratuberculosis strains .……………..…...... 193
xviii LIST OF FIGURES
2.1. Distribution of MPIL and AFLP fingerprints of M.
paratuberculosis isolates by US states and OH counties …..……………………88
2.2. Multiplex PCR of IS900 loci of M. paratuberculosis isolates ……………...…90
2.3. MPIL cluster analysis using UPGMA …………...……………………………91
2.4. AFLP cluster analysis …………...………….…………………………………94
2.5. Typical IS1311 PCR-REA undigested and HinfI digested patterns …………….95
3.1. Dendrogram showing the distribution of MPIL fingerprints .…………………124
3.2. Phylogenetic tree showing the distribution of strains by the
numbers of G – repeats ………...………………………….……..…………….126
4.1. Dendrogram showing the distribution of strains by the number of
G and GGT – repeats .…………...…………………………………..…………145
4.2. Allele distribution across various host species ..……………………………….147
5.1. Distribution of short sequence repeat fingerprints of M.
paratuberculosis isolates from Ohio …………………………...………………170
5.2. Identification of M. paratuberculosis in fecal samples by four
protocols …….…………….……...……………………………………………172
xix LIST OF PHYLOGENETICS TERMS
alignment: The determination of positional homology for molecular sequences, involving the juxtaposition of amino acids or nucleotides in homologous molecules.
clade: A monophyletic group (= a branch on a cladogram, diagnosed by at least one synapomorphy).
cladogram: A branching diagram (tree) assumed to be an estimate of a phylogeny.
classification: Arranging organisms into named groups (taxa), whether natural or artificial.
dendrogram: Any branching diagram (or tree).
distance: Usually treated as a measure of evolutionary divergence, i.e. phylogenetic distance increases with increasing evolutionary divergence. Distances are usually expressed pair-wise among the terminal taxa, and can be calculated based on a specified evolutionary model; the model specifies the probabilities of character-state change
xx through evolutionary time. Distances are popular for building phylogenetic trees from molecular sequence data.
node: A branch-point on a tree / cladogram.
phylogeny: The unique historical relationship (resulting from evolution) among terminal taxa, represented as a tree.
phylogram: A branching diagram (tree) assumed to be an estimate of a phylogeny; usually distinguished from a cladogram in that the branch lengths are proportional to the amount of inferred evolutionary change.
tree: Mathematically, an acyclic (cycle-free) line graph. Used to represent the evolutionary history of a set of taxa, with the leaves (or terminal branches) representing contemporary taxa and the internal branches representing hypothesised ancestors.
xxi CHAPTER 1
LITERATURE REVIEW
Current understanding of the genetic diversity
1.1. ABSTRACT
Mycobacterium avium subsp. paratuberculosis (M. paratuberculosis), a member of the Mycobacterium avium complex, is the etiological agent of Johne’s disease (or paratuberculosis). Johne’s disease is a chronic gastroenteritis mainly affecting cattle, sheep and other ruminants. Paratuberculosis is now recognized cause serious economic and animal health consequences in domesticated ruminant species throughout the world.
M. paratuberculosis is also of concern to the dairy industry worldwide due to the heretofore unresolved issue of its possible role in Crohn’s disease in humans. A number of genotyping schemes have been applied to study transmission dynamics, genotype- disease phenotype associations, epidemiology and molecular evolution of M. paratuberculosis isolates. However, no single method has proven to perform satisfactorily at desired high levels of resolution. In order to properly use the results from a variety of methods applied, one must understand the nature of the changes in the genome that produce the heterogeneity reflected in the genotypes, and understand the discriminatory power of the various methods. We present here a review of the typing
1 methods used to study the molecular epidemiology of M. paratuberculosis. The following broad categories of typing methods are reviewed: (i) mobile genetic elements
(ii) repetitive elements; (iii) random single nucleotide polymorphisms and (iv) whole- genome analysis. Summary of the findings to date is presented and the discriminatory power, advantage and disadvantages of the methods are compared and discussed. A model that incorporates all of the above genomic characteristics for the determination of isolate relatedness in taxonomic, typing and evolutionary studies is presented.
1.2. INTRODUCTION
The mycobacteria, in general, and the Mycobacterium avium (M. avium) complex
in particular, are a closely related group of microorganisms, which do not readily lend
themselves to identification or differentiation. The M. avium complex includes the
closely related species M. avium subsp. avium (M. avium), M. avium subsp.
paratuberculosis (M. paratuberculosis), M. intracellulare as well as the wood pigeon
bacillus. This complex is characterized by over 90% similarity at the nucleotide level but
differ widely in terms of their host tropisms, microbiological and disease phenotypes, and
pathogenicity. They are associated with animal and human diseases including infections
of the lung, lymph nodes, skin, bones, and gastrointestinal and genitourinary tracts (50,
51, 71). In recent years, M. avium complex strains have assumed greater importance in
human medicine, largely because of intractable Mycobacterium avium complex infections
in AIDS patients and also because of the possible association of Crohn’s disease with M.
paratuberculosis (50, 71).
2 M. paratuberculosis is the causative organism of Johne’s disease (or
paratuberculosis), a debilitating chronic gastroenteritis in ruminants (46, 71). Crohn’s disease is also a chronic inflammation of distal intestines and exhibits pathology similar to that of Johne’s disease in ruminants. Several studies have associated M.
paratuberculosis with a proportion of Crohn’s disease cases (15, 85). Although
indistinguishable strains have been documented (37), the evidence for a link remains
controversial as a causal role of M. paratuberculosis has not been demonstrated (42, 45).
Johne’s disease is now recognized to be of serious economic and animal health
consequences in domesticated ruminant species (primarily dairy and beef cattle, sheep
and goats) throughout the world (71, 108). Johne’s disease has the greatest economic
impact in dairy cattle, where premature culling, reduced carcass value, decreased weight
gain and milk production result in estimated losses up to US$250 million annually (18,
71, 75).
Research has long been hampered by the lack of sensitive methods for systematic differentiation of M. paratuberculosis strains. Strain identification is a useful tool in epidemiological investigations in order to gain a better understanding of origin of an infection, identification of risk factors that influence transmission, characterization of the
pathogenesis and evaluation of regional control programs permitting a rational design of
more adequate control measures. An understanding of the genomic diversity among M.
paratuberculosis may also provide additional insight into the mechanisms of host-
specificity and association of specific genotypes with overt disease versus subclinical
states. Different control strategies are warranted depending on whether a new infection is
the result of introducing livestock from another herd or is attributable to animal contact
3 with something on farm environment, such as contaminated pasture. Use of a standard fingerprinting technique for comparison of strains in large-scale national/international studies can lead to a better understanding of the global epidemiology, phylogenetic structure as well as population genetics of this economically important organism.
Currently, few of the M. paratuberculosis typing techniques permit a satisfactory and meaningful differentiation of the isolates. Isolates of M. paratuberculosis from different clinical sources have few distinguishing phenotypic characteristics. The only major features that differentiate strains of M. paratuberculosis in culture are the rate at which they grow and sometimes, variations in pigmentation (90). Two different phenotypes are observed on the basis of the bacterial growth rate on solid media. One phenotype is characterized by colonies visible only after 16 weeks of incubation.
Colonies of the other phenotype appeared significantly faster and are macroscopically visible after 6 to 12 weeks of incubation. Each of these growth phenotypes appear to be associated with M. paratuberculosis isolates from particular host species. Slow growers, sometimes pigmented, are usually observed in cultures of fecal samples from sheep, while the fast growers are most frequently observed in cultures of fecal samples from goats and cattle. However, interspecies transmission has also been indicated by documentation of sheep strains in cattle and vice-versa (27, 79, 101, 103, 109). A variety of other methods have been evaluated as potential differentiation criteria including serology, biochemical assays (20), gas-liquid chromatography (22, 83), and antimicrobial susceptibility (20).
Over the past 20 years, several molecular typing methods have become available.
In comparison to the above studies, molecular strain typing has had greater influence in
4 defining the diversity within M. paratuberculosis. They have allowed researchers to assess previously unresolved issues in the epidemiology of Johne’s disease. Recent availability of the whole genome sequence of a bovine M. paratuberculosis strain has lead to the discovery of additional molecular markers that may allow for even better differentiation of the isolates. In this chapter, we summarize the accomplishments in
Johne’s disease epidemiology and consider the implications of molecular typing for the design and analysis of epidemiological studies. This review will be restricted to studies related to molecular fingerprinting techniques. The studies are grouped together on basis of target regions used for strain differentiation.
1.3. GENOTYPING METHODS BASED ON INSERTION ELEMENTS
Insertion sequences or mobile genetic elements are relatively short DNA
segments capable of transposing within and between prokaryotic genomes, often causing
insertional mutations and chromosomal rearrangements. Use of insertion sequences as
probes provides discrimination due to the tendency of these transposable elements to
insert randomly and occupy multiple sites in the genome. In certain cases, the localization
of different specific insertion elements at defined places in the genome is sufficiently stable to allow them to be used as markers for species typing and for epidemiological purposes (32). The discovery of M. avium complex insertion sequences, often present in multiple copies, provided a simpler approach for characterizing M. avium complex strains. The first M. avium complex insertion sequence, IS900, was identified 15 years ago in strains of M. paratuberculosis and was shown to be a characteristic of this species
(26, 41). The closely related insertion sequences, IS901 and the indistinguishable IS902
5 were discovered subsequently (56, 68). More recently, IS1245 and IS1311 have been identified in M. avium complex strains (44). Several studies have demonstrated the usefulness of insertion sequences in determining strain distribution of mycobacteria such as IS6110 in M. tuberculosis (87, 99) and IS1245 in M. avium (100) as well as other
bacteria like IS711 in Brucella sp. (11), IS200 in Salmonella sp. (89) and IS1004 in
Vibrio cholerae (9).
1.3.1 IS900 - restriction fragment length polymorphism
Restriction fragment length polymorphism (RFLP) is a technique in which
organisms may be differentiated by analysis of patterns derived from restriction
endonuclease digestion of their DNA followed by electrophoresis of DNA fragments.
The similarity (or difference) of the banding patterns thus generated can be used to
differentiate species and strains. However, interpretation of the results can be difficult because the large number of fragments often generate complex banding patterns. To
augment the strain discrimination power of RFLP, southern hybridization of the restricted fragments is often performed using probes targeting a unique region in the organism of interest such as IS6110-based RFLP for M. tuberculosis and IS1245-based RFLP for M. avium (33, 49).
It is believed that one of the principal differences between M. paratuberculosis and other members of the Mycobacterium avium complex is the presence of 14 to 18 copies of the insertion element IS900 within M. paratuberculosis genome (41). Among the techniques used for molecular strain typing of M. paratuberculosis, IS900 based
RFLP has been applied most extensively. It has often been used as reference for assessing
6 the discriminatory power of the new M. paratuberculosis fingerprinting techniques (13,
76).
One of the first reports on application of restriction endonuclease analyses (25)
for strain differentiation of M. paratuberculosis used three reference strains and 23 cattle
strains from New Zealand. All isolates were characterized using 3 separate enzymes,
BstEII, PvuII and BclI. No hybridization probe was used in this analysis. All enzymes
gave the same pattern for all isolates except for the vaccine strain 18 and one of the cattle
isolates. The study indicated that there was close genetic homogeneity in the cattle strains
suggesting that restriction endonuclease analysis may be of limited use for strain typing
of M. paratuberculosis in this population. A subsequent study (104) which analyzed 31
M. paratuberculosis isolates using the restriction endonucleases, BstEII and PstI, showed similar lack of genetic diversity in isolates from diverse geographic locations (23
American states, Argentina and Nova Scotia, Canada) and host species (cattle, goat and sheep).
Subsequent to identification of IS900 in M. paratuberculosis (26, 41), Collins et
al. (27) analyzed four reference strains and 46 isolates of M. paratuberculosis from New
Zealand, Australia, Canada, and Norway. In their analysis, they compared restriction
patterns generated by BstEII digestion, both with and without hybridization with a probe
specific for a portion of the repetitive element present in M. paratuberculosis. While both
the techniques differentiated M. paratuberculosis strains into two groups, DNA
hybridization revealed more differences between strains within the larger group. All the
strains from cattle and many strains from other animals belonged to this group. The
second group of nine strains included the Faroe Islands sheep strain, all New Zealand
7 sheep strains, and one New Zealand goat strain. Thus, one of the major groups consisted mostly of strains that had been recovered from sheep, while the other one comprised strains which were commonly associated with paratuberculosis in cattle and goats. The latter group also contained six strains isolated from sheep in Canada. However, the study did not include M. paratuberculosis strains from other animal hosts in Canada. Thus, an epidemiological link between the cattle-type strains isolated from the Canadian sheep and the strain type found in cattle (or other animal hosts) remained unverified. The study thus identified the presence of two distinct groups of M. paratuberculosis strains and their predominant distribution in different host animals. Despite the dual scheme of classification, there was little heterogeneity detected within the two major clades.
Twenty-nine of the 38 isolates from the ‘C’ group were C1 type while eight of the nine isolates in the ‘S’ group were S1 type. Simpson’s diversity index value of 0.599 is in accordance with the low degree of discrimination achieved. Remarkably, this classification based on IS900 and southern blot analysis of RFLP is consistent with the results obtained using PvuII digests of genomic DNA of M. paratuberculosis strains isolated from very distant areas like Germany, United States and South Africa (6).
Several other groups used IS900-RFLP and found only minor difference between
M. paratuberculosis isolates of different origins and hosts (30, 95, 103). These studies however, had analyzed only a limited number of isolates. A larger study performed by
Pavlik et al. (79), investigated the hybridization patterns and distribution of 90 strains of
M. paratuberculosis, isolated in 9 countries, using restriction endonuclease PstI. The analysis included bovine (n=73), ovine (n=15), caprine (n=1) and reference human (n=1) strains. Hybridization of the restricted bands with an IS900 probe identified three types,
8 designated A (n=37), B (n=51) and C (n=2). Of the bovine strains 27, 45 and 1 were classified as belonging to types A, B and C, respectively; of the 15 ovine strains 10 and 5 belonged to types A and B, respectively; while the caprine strain belonged to type C. The
ATCC human strain (Linda) belonged to B type. The authors observed a degree of type uniformity among strains isolated within one herd in the course of several years, and recorded the prevalence of a single type within individual regions of the Czech Republic and Slovakia. When selected strains of RFLP type A (n=14) and B (18 strains) were digested with restriction endonuclease BstEII, the strains within each group were identical. Comparison of the patterns with those published by Collins et al. (27) indicates that all type A strains were C1 group. The hybridization pattern revealed by type B strains had not described by Collins et al. (27) and was designated Cx group. This group was labeled as C10 in a subsequent analysis of 1008 strains of M. paratuberculosis (80).
In the subsequent study, hybridization-RFLP using endonucleases PstI and BstEII, identified 13 PstI RFLP types designated as A, B, C, D, E, F, G, H, I, J, K, L and M and
20 BstEII RFLP types designated as C1–3, C5, C7–20, S1 and I1 (80). A combination of both PstI and BstEII results revealed a total of 28 different RFLP types. Simpson’s diversity indices for the analyses suggests that the strain discrimination achieved using
BstEII (1-D=0.577) was slightly higher than that achieved by using PstI (1-D=0.559).
The combined analysis using BstEII and PstI had a discrimination index of 0.697.
Cousins et al. evaluated additional restriction enzymes for IS900-RFLP (28). Their results indicated that BamHI was most effective followed by BstEII, while PstI and PvuII were relatively ineffectual.
9 Using IS900-RFLP, Pavlik et al. were able to assess the epidemiology of paratuberculosis in wild ruminants in Czech Republic (78). Four RFLP types were found in wild ruminants (B-C1, B-C9, D-C12, M-C16), while four RFLP types were found in three cattle herds (A-C10, B-C1, I-C13, B-C16). RFLP type B-C1 was identified at the highest frequency in both cattle (90%) and wild ruminants (53%). Based on the RFLP types identified in their studies, the authors concluded that transmission from domestic infected ruminants to wild animals had occurred. However, they were unable to find any relationship between the RFLP type or ruminant species and clinical status of the animal.
IS900-RFLP analysis of isolates from Scotland (43) evaluated the potential for the role of wildlife in paratuberculosis transmission. M. paratuberculosis strains isolated from rabbits and cattle present on 22 farms were compared by 3 different fingerprinting techniques; pulsed-field gel electrophoresis (PFGE), IS900-RFLP, and chemotype profiles. Of the 210 rabbits investigated, 15 were found to be culture positive. The PFGE profiles generated using 2 different restriction enzymes, HindIII and SpeI, did not reveal any differences between the rabbit and cattle isolates from the same farm or between farms. IS900-RFLP analysis identified all but one of the rabbit and cattle isolates as
RFLP type B-C17. The remaining isolate was RFLP type B-C16. The major RFLP type identified in their analysis was the same as that predominantly found in cattle and sheep strains in the United Kingdom. Their results suggested that a single strain may infect both species and that interspecies transmission may occur.
In an analysis of 61 M. paratuberculosis isolates from cattle (n=50) and deer
(n=11) from the Buenos Aires province, four different RFLP patterns were identified in
BstEII digests of the genomic DNA (67). The patterns were arbitrarily designated ‘A’,
10 ‘B’, ‘C’ and ‘E’ and do not correspond to the RFLP types assigned by Pavlik et al. (79).
The most frequently observed type, pattern ‘A’, was found in 46 isolates (75%). The
second, pattern ‘E’, included 8 isolates (13%), while the third, pattern ‘B’, included 6
isolates (10%). Pattern ‘C’ was found for only one isolate. All of the deer isolates were
classified as pattern ‘A’ while cattle isolates represented all four RFLP patterns. Of the
twenty-one isolates representing the four different BstEII RFLP patterns, twenty carried
identical PstI RFLP pattern. Comparison of the BstEII RFLP patterns from Argentinean cattle and deer with 83 M. paratuberculosis patterns found in cattle (n=71), goat (n=1), deer (n=2), rabbit (n=6), and human isolates (n=3) from Europe indicated that the most common pattern in Argentina ‘A’, was identical to a pattern (R9/C17) occurring in 3.7% of isolate from Europe. However, this pattern was identified as a predominant pattern in cattle, sheep and rabbit stains in United Kingdom (43). The other Argentinean patterns
‘B’, ‘C’ and ‘E’, were not found in the Europe. Since pattern ‘C’ was found in only one isolate, absence of this pattern in the European population may be related to a sampling bias in Europe. These results indicated that the distribution of M. paratuberculosis isolates was geographically restricted while sharing of strains could be attributed to import of cattle from United Kingdom into Argentina.
A more recent study on 328 isolates from sheep, cattle, and other species with
Johne’s disease, provided useful insight into the RFLP types of M. paratuberculosis present in sheep and cattle populations in Australia (106). RFLP analysis of genomic
DNA using BstEII and an IS900 probe identified 12 IS900 RFLP types. As expected,
Johne’s disease in sheep was always due to strains designated ‘S’ strains, while cattle were infected only with strains designated ‘C’ strains. Although several previously
11 unidentified RFLP-types were reported, the results were broadly consistent with those of
earlier studies in which ‘C’ strains have been found in cattle and other species while ‘S’
strains predominated in sheep. There was a general lack of diversity of RFLP types
within the cattle and sheep isolates. RFLP type S1 was the dominant strain in sheep
(97%) while RFLP types C3 and C1 were most common (collectively 85%). Two goat
isolates and three alpaca strains carried the C RFLP type as did three isolates from
alpacas, one isolate from a rhinoceros, and two isolates from a single human with
Crohn’s disease. The prevalence of specific RFLP types in Australia differed from those
reported in Europe and elsewhere.
Considerable arguments exist for the implication of M. paratuberculosis in the
pathogenesis of some cases of Crohn’s disease. Evidence of strain sharing between
bovine and human M. paratuberculosis isolates is of special interest since this implies the existence of a potential animal reservoir for Crohn’s disease. Francois et al. applied
IS900-RFLP to assess the degree of similarity between the M. paratuberculosis strains isolated from animals with Johne’s disease and humans with Crohn’s disease (35).
Hybridizations were performed using DNA restricted with three different enzymes,
BstEII, PvuII and PstI. The BstEII profiles were similar in four human isolates and six of the nine animal isolates. Two different PvuII profiles were observed among the human strains. One of these profiles was observed in two of the four human isolates and six of the nine animal isolates. The second profile, found in the other two human isolates, differed from the first profile in the absence of a single band. PstI profiles were identical in the 3 human isolates analyzed and 5 of the 9 animal isolates. PstI profile for one of the human isolate was not reported. The results of their analysis outlined the restricted
12 genetic heterogeneity among strains isolated from Crohn’s disease patients and the major group within animal strains. This suggests a zoonotic potential of the M. paratuberculosis. Alternately, it a may be indicative of a common ancestor for M. paratuberculosis isolated from humans and the animal strains.
In summary, most studies using IS900-RFLP have highlighted the fact that M. paratuberculosis has a broad host range. The analyses have been able to separate the M. paratuberculosis strains into two distinct groups, one seen predominantly in cattle and goats while the second observed mostly in sheep. Some groups have also noted the occurrence of the cattle type in sheep and possibly, vice versa (27, 79, 101, 103, 109).
However, most reports have been unable to identify any distinct host-specific strain/s of
M. paratuberculosis in livestock and wild ruminants or human. The apparent segregation of strains within sheep and cattle populations may also reflect a lack of opportunity to exchange infection rather than a real biological barrier to infection. IS900-RFLP studies to date suggest that a single predominant M. paratuberculosis type is capable of infecting many different species in diverse geographic localities in the world. Alternately, this indicates that the IS900-RFLP was inadequate for detecting genetic variation in populations of M. paratuberculosis. This possibility is supported by the low discrimination index values achieved in studies using IS900-RFLP for typing (Table
1.1.).
Although RFLP yielded excellent results in case of mycobacteria other than M. paratuberculosis (99), the method is time consuming, labor intensive and requires relatively large quantities of high quality DNA. RFLP based approach to the molecular typing of M. paratuberculosis is also limited by the very slow growing nature of most
13 strains and lack of growth of others, particularly from sheep, in conventional culture.
Besides, due to lack of polymorphism identified within the host-species in the major
groups, IS900-RFLP analysis may have a limited role in epidemiological studies of
Johne’s disease.
1.3.2. IS1311 - restriction fragment length polymorphism
Among the other insertion elements that have been exploited for strain typing is
IS1311. Southern blot analysis of RFLP patterns using IS1311 as probe indicated that there are 7-10 copies of IS1311 in M. paratuberculosis as compared to 14-18 copies of
IS900 (105). Whittington et al. described a PCR-restriction endonuclease analysis that targeted a point mutation in the IS1311 sequences and enabled distinction of M.
paratuberculosis isolates from sheep and cattle (64, 105). The restriction pattern that was
generated on digestion with HinfI was due to the presence of a cytosine to thymidine
(CÆT) mutation at position 223 (according to GenBank accession number U16276) in some of the IS1311 copies in M. paratuberculosis isolates from cattle. An additional study identified a novel IS1311 genotype in which all copies of the element possessed the
C223T substitution. This genotype was observed uniquely in 16 bison isolates representing nine individual bison (107). This finding is consistent with those generated in our laboratory in 10 of 12 bison strains analyzed (Ghadiali and Sreevatsan, unpublished). However, we observed the similar patterns in M. paratuberculosis isolates from cattle (n=9), armadillo (n=3), elk (n=1), kudu (n=1) and cotton tail rabbit (n=1).
Notably, five of the cattle isolates with the polymorphic IS1311 pattern were from a
14 single facility in Texas suggesting a transmission link between these isolates (Ghadiali
and Sreevatsan, unpublished).
RFLP associated with IS1311 divided M. paratuberculosis strains into the same
groups as IS900-RFLP (24). RFLP analysis using four different restriction enzymes
(BstEII, BamHI, PstI and PvuII) similarly showed lower discrimination as compared to
IS900-RFLP (105). Although the grouping of strains with IS1311 agreed with IS900
results, IS1311 may have limited use in the epidemiological studies of M.
paratuberculosis strains because it is not unique to this species, has lower copy number
(possibly due to lower transpositional activity) and does not discriminate between as
many strains within a group as IS900.
1.3.3. Multiplex PCR for IS900 Loci
An alternate IS900-based genotypic method applied to fingerprint M. paratuberculosis is multiplex PCR for IS900 loci (MPIL). Bull et al. (13, 14) characterized genomic DNA and genes flanking 14 IS900 loci present in M.
paratuberculosis and exploited the sequence information to develop a multiplex PCR
typing method. A panel of 81 M. paratuberculosis strains from 10 different countries,
including isolates of bovine, ovine, caprine and human origin, were included in the
analysis. The isolates represented 17 different PstI/BstEII RFLP types. MPIL typing
identified 10 MPIL types with consistent differences between those of bovine and ovine
origin. These MPIL types corresponded to strains of M. paratuberculosis, which either
lacked an IS900 element at one or more conserved loci, or which had an apparent
genomic rearrangement involving the DNA flanking an IS900 locus. IS900 insertions
15 into 7 of the 14 loci were conserved in all strains tested, including bovine, ovine, caprine
and human isolates. Nine of the 10 MPIL types (M2 through M10) corresponded to one
distinct PstI/BstEII RFLP type. MPIL types M2-M10 matched exactly strains with the
PstI/BstEII RFLP types E-C1, B-C5, C-S1, F-I1, B-C3, B-C9, K-C11, B-C15 and A-C12, respectively. The remaining MPIL type, M1, contained all 14 loci filled with IS900 and corresponded with eight PstI/BstEII RFLP types – B-C1, A-C10, D-C12, L-C13, B-C16,
B-C17, B-C18, and B-C19. This indicated that the two typing methods addressed the similar genetic variations and suggested that the resolving power of MPIL was less than
RFLP. This conclusion is further supported by the Simpson’s diversity index (1-
D=0.560) for MPIL as compared to that of RFLP (1-D=0.803) for the same set of isolates. However, there may be a bias in this comparison since the M. paratuberculosis isolates were chosen to represent different RFLP types resulting in a higher discrimination index for the RFLP analysis.
MPIL analysis of 210 M. paratuberculosis isolated from cattle (n=168), sheep
(n=16), goat (n=17), human (n=7), deer (n=1) and mouse (n=1), mostly from United
States was reported by Motiwala et al. (70). Cluster analysis of the fingerprints divided
the isolates into two major branches designated A and B. Branch A had 18 different
fingerprints while branch B had 11 fingerprints. A majority of the M. paratuberculosis
isolates (201 of 210 analyzed) clustered in branch A. Seventy-eight percent of the United
States bovine isolates, including those from Argentina and Nova Scotia, fell within one
major cluster (A18). This indicated a significant degree of uniformity within isolates
infecting bovine hosts. M. paratuberculosis strains from other ruminants, such as goat
and deer, and a mouse strain also fell within the same cluster. Fourteen of the ovine
16 isolates were scattered throughout the dendrogram, with 50% clustering in the same node
(A7 to A12) along with bovine isolates. M. paratuberculosis isolates from the Crohn’s
disease patients appeared to be more diverse with phylogenetic proximities at various
levels to strains isolated from both bovine and ovine host species. All of the M. avium
complex strains (isolated from Crohn’s disease patients and other sources) clustered in
branch B. This branch also included two ovine strains and seven bovine strains. The
analysis identified clear genetic diversity between ovine isolates, whereas there were
limited differences within strains from bovine hosts across several geographic localities.
However, there was no significant relationship between MPIL type and host or
geographic locations. The Simpson’s diversity index for the analysis was 0.597. The
index when calculated using only the M. paratuberculosis isolates analyzed was 0.456.
This suggested that the strain diversity achieved by MPIL was not as robust as that
achieved by RFLP.
MPIL analysis requires very small quantities of genomic DNA and is applicable
to degraded DNA samples that are not suitable for RFLP analysis. Since the amount of
DNA required is minimal it can also be applied for non-culturable strains of M. paratuberculosis. A disadvantage of the MPIL technique is that presence of a limited number of insertion sites for IS900 may result in the convergence of MPIL types. This indeed may be the reason for the large number of strains with 14 ‘filled’ loci. Despite some technical advantages over RFLP, MPIL does not provide any additional discrimination and hence may have limited application in strain typing of M. paratuberculosis.
17 1.4. GENOTYPING METHODS BASED ON REPETITIVE ELEMENTS
Repetitive elements in bacterial DNA are frequently used as markers for the
differentiation and subtyping of bacterial pathogens associated with human and animal
diseases (96, 97). Short sequence repeats (SSRs) consist of simple homopolymeric tracts
of a single nucleotide (mononucleotide repeats) or multimeric tracts (homogeneous or
heterogeneous repeats), such as di- or trinucleotide repeats (110). Many of these
sequences present allelic hypervariability related to the number of repeats and to inter-
allelic sequence variability and are called variable number of tandem repeats (VNTRs).
The variability of the repeats is believed to be caused by slipped-strand mispairing or
replication slippage events (91), the genetic instability of polynucleotide tracts, especially
poly(G-T) (47); and DNA recombination between homologous repeat sequences (97).
VNTRs are considered high-speed molecular clocks (96) and have been used for
subspecies discrimination of several mycobacterial species including M. tuberculosis (36,
55, 66, 110) and M. bovis (82) as well as other bacterial species with very little genomic
variation such as Yersinia pestis (1, 54), Salmonella enterica subsp. enterica serovar typhimurium (59), and Bacillus anthracis (1, 52-54, 59).
1.4.1. Variable number tandem repeats (VNTR)
Amonsin et al. described a VNTR based multilocus short sequence repeat
(MLSSR) sequencing approach for genotyping of M. paratuberculosis strains (2).
Preliminary bioinformatics analysis of the whole genome sequence of M.
paratuberculosis strain K10 identified 78 perfect repeats dispersed throughout the
genome. Only 11 of these were found to be polymorphic when preliminary analysis was
18 carried out on six M. paratuberculosis isolates from different host species and geographic locations. Comparative sequencing of the 11 loci polymorphic short sequence repeats
(SSRs) was used to genotype a total of 33 M. paratuberculosis isolates that had been previously characterized by MPIL and amplified fragment length polymorphism (AFLP) analyses (70). The analysis differentiated the 33 M. paratuberculosis isolates representing different MPIL and/or AFLP types into 20 distinct MLSSR types. Cluster analysis identified 20 distinct MLSSR types among the 33 M. paratuberculosis isolates that were grouped into two major clusters, clusters M and N. Cluster M contained 88% of the isolates in the sample, including isolates recovered from bovine, caprine, murine, deer, rabbit, and human sources, and one ovine isolate. Cluster M was further divided into three groups, clusters M1, M2 and M3. In contrast to cluster M, which consisted of isolates recovered from a variety of animal species, all four isolates that were included in cluster N were recovered from sheep. The analysis was thus able to distinguish between sheep and cattle isolates of M. paratuberculosis and also differentiated strains representing the predominant MPIL genotype (A18) and AFLP genotypes (Z1 and Z2) of
M. paratuberculosis described previously (70). Although the allelic variation observed in the study focused on the number of copies of the SSRs, it was observed that some loci also revealed one or two base substitutions in some isolates. Interestingly, the majority of the nucleotide substitutions were found in an isolate recovered from a sheep. The
Simpson’s diversity index (1-D) value for MPIL and AFLP for the isolates included in the analysis was 0.50 and 0.92, respectively. In comparison MLSSR distinguished 20 subtypes among the 33 isolates in the analysis with a D value of 0.967, indicating that it had a relatively high index of discrimination. The D value for each SSR locus was in the
19 range of 0.100 to 0.700 with the di-nucleotide GC-repeat having the lowest and the
mono-nucleotide G-repeat having the highest value.
The molecular diversity of M. paratuberculosis in wild animal species using SSR was reported by Motiwala et al. (69). A total of 76 M. paratuberculosis isolates obtained from 33 wild species from several geographic locations were analyzed. The mononucleotide G-residue repeat locus, that was indicated as the most discriminatory (1-
D=0.700) in the MLSSR analysis, was used for fingerprinting in this study (2). The M. paratuberculosis isolates were simultaneously typed using MPIL (13, 14, 70).
Fingerprinting by MPIL clustered 88% (67 of 76) of M. paratuberculosis strains from 22
different species into a single clade (A18). The other M. paratuberculosis strains exhibited fingerprints designated A1 (n=1), A18 variant (n=1), B4 (n=2), and unique
(n=5). MPIL cluster analysis had a diversity index (1-D) of 0.533. In contrast, sequence-
based characterization of the G-repeat region enabled the differentiation of the M.
paratuberculosis isolates in clade A18 into seven distinct alleles. A total of eight alleles
with 7 to 20 G-residue repeats (7Gs to 20Gs, respectively) were identified among 76 M.
paratuberculosis isolates. Interestingly, there appeared to be a relation between allele
type and host species. This finding is significant, since previous analyses using a variety
of fingerprinting techniques, failed to find any association between the fingerprint type
and host species other than cattle and sheep (70, 78, 80). However, concordance analysis
of the G-repeat alleles from each geographic zone showed no correlation between
fingerprint types and geographic zones. This was attributed to the possibility that the
captive animals acquired the infection in the location they were born before being
20 transferred to zoo facilities. The Simpson’s diversity index value for the G-repeat
analysis was 0.751 indicating a relatively robust discriminatory capability.
The clonal distribution and degree of diversity of M. paratuberculosis strains isolated from humans with Crohn’s disease was evaluated by Ghadiali et al. (37). Two
SSR loci with the highest discriminatory capacity were used for the analysis (2). Ninety- four M. paratuberculosis isolates from a variety of ruminant and non-ruminant animals were assessed including 11 isolates from human with Crohn’s disease. Cluster analysis divided the isolates into three distinct clades and a total of 13 distinct alleles. Cattle
(n=28, including ATCC strains) and goat (n=20) isolates were classified into nine and five alleles, respectively. The sheep isolates (n=17) were classified into eight alleles, three of which formed a distinct clade designated ‘B’. Two sheep strain-specific nucleotide polymorphisms were also identified. Two distinct alleles were identified among the 11 human isolates (including ATCC strains), and each clustered with cattle, sheep, and goat isolates. Isolates derived from free-ranging or feral non-ruminant host species (n=18) were dispersed evenly in clades A and C (Fig. 1). The restricted allelic variation identified within the human M. paratuberculosis strains analyzed may be indicative of the ability of a few animal genotypes to be associated with the pathobiology of Crohn’s disease. However, the presence of the same two alleles in 52% of the animal isolates is suggestive of strain sharing and interspecies transmission. Simpson’s diversity index for the analysis was 0.78.
Distribution and molecular diversity among M. paratuberculosis strains from farms in Ohio was reported by Ghadiali et al. (38), identified 7g-4ggt as a dominant (51 of 80 isolates) M. paratuberculosis sub-type in cattle herds in Ohio as well as the
21 existence of multiple subtypes of M. paratuberculosis on three of the dairy farms with
infected cattle. This suggests that the M. paratuberculosis strains in Ohio may be clonal with a non-random distribution and may reflect the trade and management practices in this region. However, more systematic prospective study involving multiple herds and operation types needs to be undertaken to evaluate the associations and rule out the possibility of the current observation being a sampling bias.
VNTR based analysis (also termed multilocus variable number of tandem repeat-
MLVA) by Overduin et al. identified 376 VNTR sequences based on in-silico comparison of the incomplete M. paratuberculosis K10 genome and the complete M. avium 104 genome (76). On analysis of 20 potentially interesting VNTR loci, only 5 of
them allowed discrimination between the 49 M. paratuberculosis isolates under
investigation. The MLVA typing yielded a total of 8 different types including 2 alleles
polymorphic within the region analyzed. The analysis subdivided 40 M. paratuberculosis
isolates with the most predominant RFLP type R01 into 6 types. However, no association
was found between the MLVA types and the host or the country of origin. The
discriminatory power of the MLVA technique was compared to that of RFLP using
Simpson’s diversity index. The diversity index for RFLP (1-D=0.751) was higher than
that of MLVA (1-D=0.316) indicating that RFLP is more comparatively more
discriminative. However, the authors argue that the strains selection used for MLVA was
based on RFLP types and hence it favored RFLP. The Simpson’s diversity index was re-
calculated using the equation 1-∑ (allele frequency)2 as the value for RFLP was
erroneously reported as 0.448 in the manuscript.
22 An important advantage of the multi-locus sequence typing approach is that it
indexes variations at known genetic loci and has the ability to identify multiple alleles per
locus (63). Together, these attributes not only allow an increase in the strain-resolving
power of the assay but also enable an understanding of the genetic mechanisms driving
strain diversification and evolution within the species.
1.4.2. Mycobacterial interspersed repetitive units (MIRU)
Methods based on minisatellites that contain variable numbers of tandem repeats
(VNTRs) have been demonstrated to be effective and portable methods for typing M.
tuberculosis (92). Mycobacterial interspersed repetitive units (MIRU) comprise of
variable number of short tandem repeats found at multiple loci in the genome. MIRU was
first identified in M. tuberculosis and were shown to be present in up to 40 loci (92).
Phylogenetic comparison of multiple strains of M. bovis BCG using MIRU typing has
shown that MIRU constitute one of the most plastic elements within these mycobacterial genomes (93). The MIRU-VNTR typing when compared with IS6110-based RFLP and
spoligotyping produced more distinct patterns (5, 29).
Bull et al. assessed the utility of MIRU typing in strain discrimination of M.
paratuberculosis (16). A total of 18 conserved loci were identified throughout the
common portions of the M. paratuberculosis and M. avium genomes. In an analysis of 62
M. paratuberculosis, seven M. avium, three M. intracellulare and one M. avium subsp.
silvaticum (M. silvaticum) isolates, 12 distinct profiles were identified among the 73
mycobacterial isolates. Six of the loci were found to differ between M. avium and M.
paratuberculosis in the number of tandem repeat motifs occurring at each MIRU locus.
23 PCR at either MIRU locus 1 or MIRU locus 4 distinguished between M. paratuberculosis
and all other M. avium complex tested while PCR at both the loci distinguished M.
paratuberculosis from M. intracellulare. Locus specific PCR at four of these loci (loci 1
through 4) identified four distinct profiles among the 62 M. paratuberculosis isolates
which included 37 bovine, 7 rabbit, 11 human, 4 ovine and 3 vaccine strains. Most of the
M. paratuberculosis isolates grouped within the profiles 3-7-5-1 (n=34) and 3-9-5-1
(n=25). Notably, these two groups differed only in the number of repeats at MIRU locus
2. The vaccine strain 316F of bovine origin had the profile 3-7-3-1. The two pigmented
ovine M. paratuberculosis strains had the profile 3-15-3-1 and were distinguished by the
unusually large number of repeats at MIRU locus 2. Thus, two major groups were
identified among the M. paratuberculosis isolates which were distinct from the groups
containing the ovine-pigmented strains of M. paratuberculosis and the M.
paratuberculosis vaccine strain 316F. The Simpson’s diversity index for the analysis was
0.535. Although MIRU typing served as a simple and rapid procedure for the
differentiation of M. tuberculosis isolates (5, 29), it may not be as discriminatory for M.
paratuberculosis strains.
1.5. GENOTYPING METHODS BASED ON SINGLE NUCLEOTIDE
POLYMORPHISMS
Single nucleotide polymorphisms (SNP) are the most abundant form of DNA polymorphism. Compared with other molecular markers, SNPs exhibit low mutation rates, making them valuable for phylogenetic and evolutionary analyses. The great increase in the available DNA sequences in the databases has made it possible to identify
24 SNPs by database mining. PCR-based DNA fingerprinting techniques like amplified fragment length polymorphism (AFLP), randomly amplified polymorphic DNA (RAPD) and macro-restriction analysis by PFGE targets SNPs within anonymous DNA markers.
For organisms that do not have a genome sequence data available, SNP discovery can be achieved by direct sequencing of AFLP bands (73).
1.5.1. Amplified fragment length polymorphism (AFLP)
Amplified fragment-length polymorphism (AFLP) is a PCR-based fingerprinting
technology, which allows high-resolution genotyping for the rapid screening of genetic
diversity. AFLP involves the restriction of genomic DNA, typically with two restriction
enzymes - a frequent cutting enzyme and an infrequent cutting enzyme, followed by
ligation of adaptors complimentary to the restriction sites and selective PCR
amplification of a subset of the adapted restriction fragments. These fragments are
visualized on denaturing polyacrylamide gels by autoradiography and more recently by
fluorescence based methods. The availability of many different restriction enzymes and
corresponding primer combinations provides a great deal of flexibility, enabling the
direct manipulation of AFLP fragment generation for defined applications like polymorphism screening, quantitative trait locus (QTL) analysis, genetic mapping.
Another advantage of the AFLP technology is its sensitivity to polymorphism detection at the total-genome level. With all of these assets, AFLP markers are fast becoming a molecular standard for investigations ranging from systematics to population genetics.
Motiwala et al. analyzed 104 M. paratuberculosis from diverse hosts and geographic locations using AFLP (70). Isolates representing different MPIL fingerprint
25 profiles were selected for the AFLP analysis and included 86 M. paratuberculosis
isolates (bovine, n=72; ovine, n=4; caprine, n=7; murine, n=1; human, n=2) and 16 M. avium complex isolates (human host, n=10; unknown host, n=6). M. paratuberculosis strain K-10 and M. avium TIGR strain 104 were also included. The analysis showed that
72% of the M. paratuberculosis fell into either one of the two major clusters designated
Z1 and Z2. These branches included 90% of the bovine M. paratuberculosis isolates as well as the goat and mouse isolates. In agreement with previous studies, the two major branches included only one of the four ovine isolates, while the other two ovine strains clustered into distinct branches in close proximity to a bovine isolate. The M. avium
complex isolates from Crohn’s disease patients and other unknown hosts clustered into
distinct branches, indicating a clear segregation. In contrast to earlier reports, AFLP
fingerprints of the human M. paratuberculosis isolates were unique and did not cluster with either the bovine or ovine strains (70, 79, 106). Overall, the study identified a high degree of genetic similarity between M. paratuberculosis strains recovered from cattle regardless of geographic origin. Further, the analysis indicated a relatively higher degree of genetic heterogeneity among M. paratuberculosis isolates recovered from human and ovine sources. The Simpson’s diversity index (1-D) for the analysis was 0.711. The index when calculated using only the M. paratuberculosis isolates analyzed was 0.592.
O’Shea et al. used AFLP to characterize 20 M. paratuberculosis field isolates and the M. paratuberculosis type strain 19698 using 96 primer sets (74). The study revealed
11 genotypes among the M. paratuberculosis isolates investigated. In contrast to previous analyses, the results indicated an apparent high degree of genomic polymorphism among
M. paratuberculosis subtypes (3, 4, 70, 79, 106). Due to lack of information regarding the
26 host species and geographic location it was difficult to assess whether the classification
was epidemiological meaningful. There was insufficient information in the publication to
enable calculation of Simpson’s diversity index.
Although AFLP would appear to have a greater resolving power than MPIL and
RFLP, it suffers from the limitation that the allelic variation is indexed at anonymous
biallelic sites or locations.
1.5.2. Randomly amplified polymorphic DNA (RAPD)
Randomly amplified polymorphic DNA (RAPD) analysis described by Williams
et al. (111) is a commonly used molecular marker in genetic diversity studies. Low-
stringency PCR amplification of genomic DNA using a single short primer (10–22 bases)
of arbitrary sequence is used to generate a set of fragments that is characteristic of the species or strain from which the DNA was prepared. It is a simple and inexpensive method which has shown promise in identification and sub-typing of Streptococcus (39)
Mycoplasma (19) as well as mycobacteria including M. tuberculosis (57, 60) and M. avium (65).
Scheibl et al. (84) presented the first description of RAPD analysis for the identification and differentiation of M. paratuberculosis isolates. The analysis used a total of 16 M. paratuberculosis isolates including 15 clinical strains from cattle from various locations in Germany and the ATCC strain 19698. In their study, 60 decamer primers with GC contents of 60 to 70% were evaluated. Fourteen of the 60 decamer primers used resulted in distinct amplification products for most of the isolates. For seven of the primers, the size of the amplification products varied among strains thus allowing
27 the specific identification of eight of the 16 isolates; of the remaining eight isolates five could each be differentiated from 14 other isolates, two from 13, and one from 12 isolates. However, the data was insufficient to conclude that RAPD can serve as a suitable M. paratuberculosis typing system.
In a more recent study, Pillai et al. (81) used a commercially available kit consisting of twenty 10-mer random sequence primers to identify a single 10-mer primer which permitted identification and sub-typing of M. paratuberculosis and M. avium using
RAPD analysis. Primer OPE-20 was selected after a preliminary analysis of 20 strains which included four ATCC reference strains of M. paratuberculosis and eight field strains of M. paratuberculosis and M. avium each. The primer was further evaluated for its ability to identify and subtype by analysis of an additional 200 field isolates of M. paratuberculosis. RAPD patterns were obtained for a total of 212 M. paratuberculosis strains including strains isolated from cattle (n=202, including 1 ATCC strain), goat
(n=5), ovine (n=2) and human (n=3, all ATCC strains). The bovine collection included at least 1 isolate from 27 different states in the US thereby representing a wide variety of geographic locations. The fingerprint patterns consisted of five common fragments (620,
450, 310, 230, 180 bp) and nine variable fragments resulting in six distinct genotypes designated ‘mp1’ through ‘mp6’. Genotype mp3 (34.5%) and genotype mp4 (23.5%) were the predominant genotypes. All 4 ATCC isolates including 1 from bovine and 3 from human belonged to bovine genotype mp3. All five M. paratuberculosis isolated from goat had fingerprints identical to genotype mp1 of cattle. RAPD fingerprints of one of the two isolates from sheep were similar to genotype mp6 of cattle. However, the other isolate from sheep had an additional variable fragment of about 480 bp, besides the
28 fragments seen in genotype mp6 of cattle. The diversity index achieved by this analysis
was 0.777
Other related techniques include arbitrary primed PCR (AP-PCR) (102) and DNA
amplification fingerprinting (17). These methods differ from RAPD in primer length, the
stringency conditions and the method of separation and detection of the fragments. AP-
PCR analysis by Francois et al. showed identical patterns for four M. paratuberculosis
isolated from Crohn’s disease patients and eight of 11 M. paratuberculosis isolates
(representing different IS900-RFLP profiles) from cattle and goat with Johne’s disease
(35). The remaining three M. paratuberculosis isolates from cattle had three distinct AP-
PCR profiles. Genetic characterization by AP-PCR of three M. paratuberculosis isolates
from infected red deer showed similar genetic polymorphism to that of bovine strains
isolated in different Italian areas (72).
1.5.3. Pulse field gel electrophoresis (PFGE)
Pulsed field gel electrophoresis (PFGE) is an adaptation of conventional RFLP.
The method uses an infrequent cutting enzyme that generates high molecular weight
fragments. Similar to conventional gel electrophoresis, the fragments are separated in size dependent manner. However, during a PFGE run, the relative orientation of the gel and the electric field is periodically altered, allowing efficient fractionation of DNA fragments up to several mega bases in size. The main limitation of the technique is that small polymorphisms characteristic for mycobacteria will not produce sufficient discrimination.
29 In a PFGE analysis described by Levy-Frebault et al., several representative
isolates of M. avium complex were compared by restriction endonuclease DraI digestion
and field inversion gel electrophoresis (a prototype of PFGE) (58). The M. paratuberculosis isolates tested included ATCC 19698, vaccine strains – 316F and St 18 and clinical isolates obtained from cow (n=2), goat (n=2) and sheep (n=1). All clinical
M. paratuberculosis strains, including the type strain, produced identical patterns except for the 2 vaccine strains and one goat strain. The two mycobacterial isolates from
Crohn’s disease patients also produced identical profiles. The vaccine strain St 18 produced a pattern that was similar to that of M. avium while 316F produced a unique pattern. The restriction profile produced by the goat strain indicated that it had been mis-
identified as a M. paratuberculosis strain. In conclusion, the PFGE analysis did not allow
any discrimination between the M. paratuberculosis strains obtained from at least 3
different clinical hosts. However, absence of strain diversity may be a function of the
small number of M. paratuberculosis strains tested. However, it should be noted that the
sheep strain, which can be discriminated by most fingerprinting techniques, also showed
identical profile to the cattle strains.
Similar indistinguishable profiles were reported Coffin et al. when they used SspI
digests for PFGE of M. paratuberculosis (23). In agreement with Levy-Frebault et al., the study indicated that the PFGE profile of vaccine strain St 18 was similar to that of M. avium (23, 58). An additional PFGE analysis was reported by Feizabadi et al. (34). A total of 36 M. paratuberculosis isolates from several animal species including the vaccine strain 316F were analyzed using DraI and XbaI digests. As previously reported, all isolates gave identical patterns except for the vaccine strain 316F. Patterns achieved by
30 using XbaI digests divided the 36 M. paratuberculosis isolates analyzed into 2 groups,
X1 and X2. These patterns differed only in having a single or double band at about 169 kbp. Group X1 included cattle and alpaca isolates while X2 included cattle, goat and sheep isolates. The Simpson’s diversity index for the analysis was 0.461.
Greig et al. (43) studied interspecies transmission of M. paratuberculosis strains
isolated from rabbits and cattle on 22 farms by 3 different fingerprinting techniques;
pulsed-field gel electrophoresis (PFGE), IS900-RFLP, and chemotype profiles. Of the
210 rabbits investigated, 15 were found to be culture positive. The PFGE profiles
generated using 2 different restriction enzymes, HindIII and SpeI, did not reveal any
differences between the rabbit and cattle isolates from the same farm or between farms.
The SpeI profiles obtained were identical to the X2 PFGE profile described previously
(34).
A more comprehensive PFGE analysis was reported by Stevenson et al. (90). The
genetic diversity between pigmented and non-pigmented isolates was investigated by
using multiplex PFGE data from the analysis of 5 pigmented isolates and 88 non-
pigmented isolates of M. paratuberculosis from a variety of host species and geographic
locations. All of the isolates were analyzed using the enzymes SnaBI and SpeI. Among
the pigmented isolates, three distinct profiles each were identified with SnaBI (designated
9, 10, and 11) and SpeI (designated 7, 8, and 9) resulting in three multiplex profiles 9-7,
10-8, and 11-9. Among the 88 non-pigmented isolates of M. paratuberculosis, eight
PFGE types (designated 1 to 8) were detected using SnaBI while six PFGE profiles
(designated 1 to 6) were detected when typed with SpeI. These represented 13 multiplex
profiles within the non-pigmented strains. M. paratuberculosis isolates analyzed by
31 PFGE segregated into two distinct clusters. Cluster I encompassed the pigmented ovine
isolates while cluster II comprised of isolates from a wider host range. This division into
two clusters was consistent with the division of isolates into two types of strains, S and C,
as reported by Collins et al. and Bauerfeind et al. (6, 27). All of the pigmented isolates had the same IS900-RFLP BstEII and PvuII profiles corresponding to the BstEII profile
‘S’ described by Collins et al. and others (27, 28, 106) and PvuII type 6 described by
Cousins et al. (28), respectively. In contrast, non-pigmented isolates representative of the
13 multiplex PFGE profiles corresponded to BstEII profiles C1, C5, and C17 as defined
by Pavlik et al. (80) and two previously unpublished profiles while the PvuII profiles
corresponded to types 1, 2, and 3 as defined by Whipple et al. (103) and a new profile not
previously described. This suggests that the discrimination achieved by multiplex PFGE
was greater than that achieved by RFLP. However, there was insufficient information in
the publication to enable calculation of Simpson’s diversity index.
1.5.4. rRNA gene and spacer region analysis
The RFLP analysis of the rRNA gene region described by Chiodini (21) included
19 M. paratuberculosis strains of bovine (n=6), caprine (n=4), ovine (n=4), subhuman
primate (n=1), and human (n=4) origins from different geographic locations. The
analysis used 5S rRNA gene from Escherichia coli as the probe. RFLP analysis using 11
different restriction enzymes identified indistinguishable restriction fragments of the 5S
rRNA gene region in all 19 M. paratuberculosis strains. The results suggested that M.
paratuberculosis isolates possessed a single copy of the rRNA genes within their
genomes. Furthermore, the results suggested lack of restriction sites (for all the 11
32 restriction enzymes tested) within the 5S rRNA gene, its spacer region and the proximal
end of the 23S rRNA. Lack of differentiation among the M. paratuberculosis strains
isolated from humans, subhuman primates, and animals, suggested that M.
paratuberculosis strains were genetically identical to each other and lacked the genetic
heterogeneity regardless of host and geographic location of origin.
Many investigators have used 16S rDNA sequence to differentiate bacteria at the
genus and species level. However, the 16S rDNA sequences do not vary greatly within a
species. Similarly, the overall 23S rDNA sequence identity between M. paratuberculosis
and M. avium is 99.7% (nine mismatches), showing the very close relatedness of these mycobacteria (98). In contrast, the internal transcribed spacer between 16S rDNA and
23S rDNA is more variable than 16S rDNA (94). It is a single-copy region of 278 bp in slow growing mycobacteria including M. paratuberculosis and M. avium (8). This region has been reported to have only two mismatches between M. paratuberculosis and M.
avium (98). An analysis of the spacer region of the rDNA described by Scheibl et al. (84)
indicated lack of discrimination as it revealed an identical sequence for all 16 cattle M.
paratuberculosis strains tested.
1.6. COMPARATIVE GENOMICS
Although traditional techniques used for studying population genetics of bacteria
are useful for determining population structures, they target only a few genomic loci and
often provide no or limited insight into the functional consequences of genetic diversity.
The elucidation of whole genome sequences and the development of DNA microarray technology have led to new approaches in which loci can be analyzed on the whole-
33 genome scale. Genomic DNA from an isolate of interest can be hybridized to a DNA
microarray constructed from a sequenced strain, revealing the presence or absence of
genomic sequence at every interrogated locus (48). Availability of the whole genome
sequence of M. paratuberculosis has allowed investigators to begin examination of the
genetic relatedness in greater detail through direct nucleotide-nucleotide comparisons.
These comparisons are particularly important in instances of highly conserved species,
such as mycobacteria, where SNPs are rare and insertion-deletion events (InDels) are the
principal source of genome plasticity (7, 12, 40). InDels result from recombinational or
insertion sequence-mediated events, expansion of repetitive DNA sequences, or
replication errors based on repetitive motifs that remove blocks of genes or contract
coding sequences. Notably, the hybridization-based approach allows identification of
significant variations in the overall sequence of related genetic features but is insensitive
to very small changes such as point mutations.
To assess the extent of large sequence polymorphisms (LSPs) in M. avium
subspecies, Semret et al. assembled a whole-genome DNA microarray representing 4,158 of the 4,480 the predicted coding sequences of M. avium strain 104 (86). Genomic DNA comparisons of M. avium strain 104 was made with M. paratuberculosis K10 (cow strain), M. paratuberculosis LN20 (sheep strain), and M. silvaticum (ATCC 49884) in co-
hybridization experiments using the M. avium complex. There were extensive homologies between the 3 subspecies of M. avium complex studied. However, 14 LSPs
(LSP1 to LSP14) ranging in length from 21 to 197 kb and encompassing 572 genes were detected as missing from M. paratuberculosis and M. silvaticum. The LSPs collectively comprised 727 kb and represented 13.5% of the M. avium 104 genome. Seven of the
34 LSPs revealed were simple genomic deletions or insertions compared to the reference
strain M. avium 104. The other seven LSPs involved more complex combination of
insertion and deletion events. To determine the distribution of the LSPs across the M.
avium complex, PCR confirmation for the presence or absence of a region was performed
for a panel of 43 isolates including 20 isolates each of M. avium and M. paratuberculosis
and 3 isolates of M. silvaticum. In contrast to that observed in M. tuberculosis, proteins of
the PE/PPE family were highly conserved among tested strains. In M. tuberculosis,
diversity among PE/PPE elements has been proposed to be an important source of
antigenic variation (10). Of the 14 LSPs identified, all but one was consistently absent in
the M. paratuberculosis isolates. LSP 11, which contained part of mce2 operon, was
found to be variably present in M. paratuberculosis strains. Further characterization of a
larger collection of M. paratuberculosis isolates may clarify the reasons for host species
specificities and pathogenic potentials of the M. avium subspecies in general, and M.
paratuberculosis in particular. It may also provide further insight into their complex
evolutionary history.
Genomic subtraction is another powerful technique for whole-genome comparisons of mycobacteria (62). Unlike microarrays, the strength of this technique is its ability to identify regions that are present in some members of a species but absent from the genome of the sequenced strain. Dohmann et al. investigated the differences between M. paratuberculosis type I and type II strains using representational difference analysis (RDA) to isolate M. paratuberculosis subspecies as well as type-specific DNA fragments (31). RDA is essentially a PCR based enrichment of sequences present in the test but not the driver DNA (61). It has been designed to identify differences between
35 genomic DNA populations. For the identification of M. paratuberculosis-specific DNA
regions the genome of M. avium strain ATCC 25291 was subtracted from that of the bovine M. paratuberculosis strain 6783. The analysis revealed three fragments specific
for M. paratuberculosis. The regions designated RDI130, RDII60, and RDIII10 ranged
from 456 to 652 bp with 54 to 58% homology to the M. avium 104 and 100% homology to the M. paratuberculosis K10 genome. Fragment RDI130 contained identical sequences in all nine M. paratuberculosis type II isolates but included 11 additional nucleotides in all the M. paratuberculosis type I isolates. The nucleotide sequence for the fragments
RDII60 and RDIII10 were identical in all 13 of the M. paratuberculosis strains. For the identification of M. paratuberculosis type-specific DNA regions the non-pigmented bovine M. paratuberculosis strain 6783 was used as the tester and the pigmented ovine
M. paratuberculosis strain M189 was used as the driver, and vice versa. Analysis using
the bovine type II strain as tester and the ovine type I strain as driver did not result in any
specific product, suggesting that M. paratuberculosis type II strains did not contain
extended loci of type-specific DNA. Reversing the tester and driver strains resulted in
three M. paratuberculosis type I-specific DNA fragments. These were designated pig-
RDA10, pig-RDA20, and pig-RDA30 and showed no homology to the M. paratuberculosis K-10 genome (a type II strain) but contained 98 to 99% homology to M. avium 104 sequences. PCR with specific primers showed variable presence of these three regions in M. avium isolates. Analysis of the location of these fragments as well as the regions flanking these fragments indicated that type II strains had undergone more deletions and rearrangements of regions than type I strains that have corresponding loci in M. avium. The data also suggested that both types of M. paratuberculosis strains
36 originated from a common progenitor and that the two types were not derived from divergent M. avium strains that had similarly acquired IS900. These findings are consistent with the hypothesis that M. paratuberculosis type I isolates are an evolutionary intermediate between M. avium and M. paratuberculosis type II strains. However, subtractions of M. avium versus M. paratuberculosis type I and vice versa was not performed. Additional data will be needed to substantiate this hypothesis.
A whole-genome microarray representing over 95% of the predicted coding sequences in M. paratuberculosis K10 was utilized to examine the genetic conservation between 10 M. paratuberculosis isolates, two isolates each of M. avium and M. silvaticum, and one isolate each of M. intracellulare and M. smegmatis (77). Overall, the
9 clinical isolates of M. paratuberculosis showed a high degree of genetic conservation and were very similar to M. paratuberculosis K10. A core set of 1230 open reading frames (ORFs) was classified as present among all of the M. paratuberculosis isolates.
An analysis of the proteins encoded by these conserved ORFs revealed that the distribution of predicted functions was similar to the whole genome, indicating that no functional categories were preferentially represented. Similar to the findings of Dohmann et al. (31), the analysis revealed that many of the common regions of divergence among the non-paratuberculosis M. avium complex isolates were grouped into clusters of adjacent ORFs and that a majority of these divergent regions were bordered by inversions in the genome sequences. In contrast to the findings of Dohmann et al. (31), region homologous to the mce gene family was identified as present in all of the M. paratuberculosis isolates. This disparity may be on account of all the isolates examined being the cattle-type, as per classification described by Whittington et al. (105). The
37 closely related M. avium, M. intracellulare, and M. silvaticum displayed varying amounts of genetic divergence from M. paratuberculosis K10 and contain core groups of ORFs that appeared to diverge across all of the non-paratuberculosis M. avium complex isolates examined. Future studies examining additional M. paratuberculosis isolates from a variety of host species and geographic locations are warranted to determine the level of conservation in a larger population.
Presence of few specific markers distinguishing M. paratuberculosis strains and the absence of a well-defined genetic system, a comparative genomic approach holds great potential in addressing the genetic basis for many of the phenotypic differences and disease presentation.
1.7. CONCLUDING COMMENTS
In Johne’s disease, thus far, two host-specific subgroups of M. paratuberculosis strains have been recognized. In addition to phenotypic data and epidemiological observations, all strain typing techniques, irrespective of their discrimination power, concur in this respect. Almost without exception and regardless of geographic location, isolates from cattle have been of the C type (type II), as have most isolates from goats and deer. In complete contrast, isolates from sheep have been of C, S (type I), or I
(intermediate) type, with most countries tending to have only one type in their sheep population. The under-representation of S strains in cattle, deer, and goats might reflect the difficulty of laboratory culture of such strains, but their identification in sheep from a similar range of countries suggests that culturability alone does not explain the apparent segregation within host species. Indeed, a C strain was recovered from a cow and an S
38 strain was recovered from seven sheep on the same farm in one study (106). This raises
the possibility that the M. paratuberculosis strains display a degree of host specificity or
at least host preference. Several studies attempted to determine whether there was
evidence of segregation of M. paratuberculosis strains among sheep, cattle, and other species and whether there are likely to be geographic or farm enterprise differences in the strains of M. paratuberculosis present in animals naturally affected with paratuberculosis.
In summary, solid evidence of host specificity for the phenotypically defined sheep and cattle strains of M. paratuberculosis is lacking. Thus, the true degree of host adaptation or preference of these strains remains unknown
The possibility that a particular group of M. paratuberculosis strains may be
involved in Crohn’s disease also exists. Using specific oligonucleotide primers for IS900
and DNA amplification by PCR, several groups reported a positive correlation between
the presence of IS900 DNA and Crohn’s disease. However, frequency of detection of the
IS900 sequence differed substantially from one study to another. Therefore M.
paratuberculosis appears to be associated in the pathogenesis of a subgroup of Crohn’s
disease patients. So far, only a limited number of M. paratuberculosis isolates from
human is available for typing and has hampered progress in this direction Given this
limitation, there is consistency in the observation that a limited number of genotypes are
exhibited by M. paratuberculosis isolates from Crohn’s disease patients (16, 35, 37, 76,
81). Clustering of the human strains with strains derived from animal species is
suggestive of inter- and intra-species transmission (35, 37, 106) and an association of a
few animal M. paratuberculosis strains with the pathobiology of Crohn’s disease. These
speculations are, however, based on genomic polymorphism identified at distinct sites
39 within the genome. Whole genome comparisons, at transcriptome and proteome levels, of
strains derived from human and animal hosts may yield additional insight into a variation
in biological function and/or host adaptation.
Measuring the genetic diversity within a population is of particular importance for
bacterial pathogens, as it can result in differences in virulence, antibiotic susceptibility,
and other phenotypes important for the treatment and control of infectious diseases.
Knowledge of the population structure of a bacterial species can also shed light on the
epidemiology, evolution, and emergence of pathogenic organisms (88). Molecular
differences between M. paratuberculosis type I and type II strains that may provide
important clues with respect to (i) the evolutionary relationship between the two M. paratuberculosis types, (ii) the different phenotypes, and (iii) the differences in host preference have not as yet been elucidated. Genetic events that may have contributed to the broad host spectrum and sometimes different disease presentation are not understood.
There are now a plethora of molecular approaches available for assessing genetic variation within strains. It is necessary to assess the power and resolution of the currently available and the newly developed molecular markers to elucidate their application to molecular epidemiology studies of M. paratuberculosis. An ideal strain differentiation
method should target stable markers at known multi-allelic genetic loci. It should be
rapid, reproducible and applicable to all strains. Amenability to adaptation for high-
throughput analysis and inter-laboratory comparisons is an added practical advantage.
Thus far, MPIL, AFLP and RFLP have, generally, been unable to resolve M.
paratuberculosis isolates into meaningful epidemiological groups due to apparent restricted genetic diversity within the subspecies. In contrast, SSR fingerprinting has
40 shown some promise and so have whole-genome microarray analyses. The high degree of
genomic homogeneity of M. paratuberculosis calls for application of at least two
fingerprinting techniques targeting different categories of polymorphisms. For example,
SSR analysis using two polymorphic loci (G- and GGT- repeats) did not discriminate
between the eight cattle isolates from a facility in Texas. However, analysis of IS1311
polymorphism (107) indicated the presence of two distinct types (Ghadiali and
Sreevatsan, unpublished).
Until relatively recently it had not been possible to trace pathways of
paratuberculosis transmission within populations. Although minor phenotypic differences
among clinical isolates have long been recognized, it was not previously possible to
determine whether they were stably associated with specific lineages of M. paratuberculosis circulating in the population. Most of the strains identified have been
associated with large clusters that are widely dispersed both geographically and
temporally, raising the possibility that they are either more transmissible or more likely to
cause disease once transmitted than are other strains. Answers to whether there is an
association between these ‘successful’ strains and clinical or subclinical disease and the extent to which these merely represent the strains that could be readily cultured in the laboratory are open speculations. Whether these strains have an enhanced capacity to
replicate in macrophages and if this function might be associated with the organism’s
success warrants further studies. The advent of molecular typing of M. paratuberculosis may allow researchers to describe strain-specific variation in clinical phenotypes such as virulence, growth characteristics, immunogenicity, and transmissibility.
41 1.8. ACKNOWLEDGMENT
This work was supported by state and federal funds appropriated to the Ohio
Agricultural Research and Development Center (OARDC). Research in SS laboratory is supported through OARDC Competitive Research Enhancement Grants and the Johne’s disease integrated program grant (USDA-NRICAP).
1.9. REFERENCES
1. Adair, D. M., P. L. Worsham, K. K. Hill, A. M. Klevytska, P. J. Jackson, A. M. Friedlander, and P. Keim. 2000. Diversity in a variable-number tandem repeat from Yersinia pestis. J.Clin.Microbiol. 38:1516-9.
2. Amonsin, A., L. L. Li, Q. Zhang, J. P. Bannantine, A. S. Motiwala, S. Sreevatsan, and V. Kapur. 2004. Multilocus Short Sequence Repeat Sequencing Approach for Differentiating among Mycobacterium avium subsp. paratuberculosis Strains. J.Clin.Microbiol. 42:1694-1702.
3. Bannantine, J. P., E. Baechler, Q. Zhang, L. Li, and V. Kapur. 2002. Genome Scale Comparison of Mycobacterium avium subsp. paratuberculosis with Mycobacterium avium subsp. avium Reveals Potential Diagnostic Sequences. J.Clin.Microbiol. 40:1303-1310.
4. Bannantine, J. P., Q. Zhang, L. L. Li, and V. Kapur. 2003. Genomic homogeneity between Mycobacterium avium subsp. avium and Mycobacterium avium subsp. paratuberculosis belies their divergent growth rates. BMC Microbiol 3:10.
5. Barlow, R. E., D. M. Gascoyne-Binzi, S. H. Gillespie, A. Dickens, S. Qamer, and P. M. Hawkey. 2001. Comparison of variable number tandem repeat and IS6110-restriction fragment length polymorphism analyses for discrimination of high- and low-copy-number IS6110 Mycobacterium tuberculosis isolates. J.Clin.Microbiol 39:2453-7.
6. Bauerfeind, R., S. Benazzi, R. Weiss, T. Schliesser, H. Willems, and G. Baljer. 1996. Molecular characterization of Mycobacterium paratuberculosis
42 isolates from sheep, goats, and cattle by hybridization with a DNA probe to insertion element IS900. J.Clin.Microbiol. 34:1617-1621.
7. Behr, M. A., M. A. Wilson, W. P. Gill, H. Salamon, G. K. Schoolnik, S. Rane, and P. M. Small. 1999. Comparative genomics of BCG vaccines by whole- genome DNA microarray. Science 284:1520-3.
8. Bercovier, H., O. Kafri, and S. Sela. 1986. Mycobacteria possess a surprisingly small number of ribosomal RNA genes in relation to the size of their genome. Biochem.Biophys.Res.Commun 136:1136-41.
9. Bik, E. M., R. D. Gouw, and F. R. Mooi. 1996. DNA fingerprinting of Vibrio cholerae strains with a novel insertion sequence element: a tool to identify epidemic strains. J.Clin.Microbiol 34:1453-61.
10. Brennan, M. J., and G. Delogu. 2002. The PE multigene family: a 'molecular mantra' for mycobacteria. Trends Microbiol 10:246-9.
11. Bricker, B. J., and S. M. Halling. 1994. Differentiation of Brucella abortus bv. 1, 2, and 4, Brucella melitensis, Brucella ovis, and Brucella suis bv. 1 by PCR. J.Clin.Microbiol 32:2660-6.
12. Brosch, R., A. S. Pym, S. V. Gordon, and S. T. Cole. 2001. The evolution of mycobacterial pathogenicity: clues from comparative genomics. Trends Microbiol 9:452-8.
13. Bull, T. J., J. Hermon-Taylor, I. Pavlik, F. El Zaatari, and M. Tizard. 2000. Characterization of IS900 loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex PCR typing. Microbiology 146 ( Pt 9):2185-2197.
14. Bull, T. J., J. Hermon-Taylor, I. I. Pavlik, F. El-Zaatari, and M. Tizard. 2000. Characterization of IS900 loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex PCR typing. Microbiology 146 (Pt 12):3285.
15. Bull, T. J., E. J. McMinn, K. Sidi-Boumedine, A. Skull, D. Durkin, P. Neild, G. Rhodes, R. Pickup, and J. Hermon-Taylor. 2003. Detection and verification of Mycobacterium avium subsp. paratuberculosis in fresh ileocolonic mucosal
43 biopsy specimens from individuals with and without Crohn's disease. J.Clin.Microbiol. 41:2915-23.
16. Bull, T. J., K. Sidi-Boumedine, E. J. McMinn, K. Stevenson, R. Pickup, and J. Hermon-Taylor. 2003. Mycobacterial interspersed repetitive units (MIRU) differentiate Mycobacterium avium subspecies paratuberculosis from other species of the Mycobacterium avium complex. Mol.Cell.Probes 17:157-64.
17. Caetano-Anolles, G., B. J. Bassam, and P. M. Gresshoff. 1991. DNA amplification fingerprinting using very short arbitrary oligonucleotide primers. Biotechnology (N Y) 9:553-7.
18. CAST Issue Paper: Johne's Disease in Cattle. Council on Agriculture, Science and Technology Task Force. May 2001.
19. Charlton, B. R., A. A. Bickford, R. P. Chin, and R. L. Walker. 1999. Randomly amplified polymorphic DNA (RAPD) analysis of Mycoplasma gallisepticum isolates from turkeys from the central valley of California. J.Vet.Diagn.Invest 11:408-15.
20. Chiodini, R. J. 1986. Biochemical characteristics of various strains of Mycobacterium paratuberculosis. Am.J.Vet.Res 47:1442-5.
21. Chiodini, R. J. 1990. Characterization of Mycobacterium paratuberculosis and organisms of the Mycobacterium avium complex by restriction polymorphism of the rRNA gene region. J.Clin.Microbiol. 28:489-494.
22. Chiodini, R. J., and H. J. Van Kruiningen. 1985. Characterization of Mycobacterium paratuberculosis of bovine, caprine, and ovine origin by gas- liquid chromatographic analysis of fatty acids in whole-cell extracts. Am.J.Vet.Res 46:1980-9.
23. Coffin, J. W., C. Condon, C. A. Compston, K. N. Potter, L. R. Lamontagne, J. Shafiq, and D. Y. Kunimoto. 1992. Use of restriction fragment length polymorphisms resolved by pulsed- field gel electrophoresis for subspecies identification of mycobacteria in the Mycobacterium avium complex and for isolation of DNA probes. J.Clin.Microbiol. 30:1829-1836.
44 24. Collins, D. M., S. Cavaignac, and G. W. de Lisle. 1997. Use of four DNA insertion sequences to characterize strains of the Mycobacterium avium complex isolated from animals. Mol.Cell.Probes 11:373-380.
25. Collins, D. M., and G. W. de Lisle. 1986. Restriction endonuclease analysis of various strains of Mycobacterium paratuberculosis isolated from cattle. Am J Vet Res 47:2226-9.
26. Collins, D. M., D. M. Gabric, and G. W. De Lisle. 1989. Identification of a repetitive DNA sequence specific to Mycobacterium paratuberculosis. FEMS Microbiol.Lett. 51:175-8.
27. Collins, D. M., D. M. Gabric, and G. W. de Lisle. 1990. Identification of two groups of Mycobacterium paratuberculosis strains by restriction endonuclease analysis and DNA hybridization. J.Clin.Microbiol. 28:1591-6.
28. Cousins, D. V., S. N. Williams, A. Hope, and G. J. Eamens. 2000. DNA fingerprinting of Australian isolates of Mycobacterium avium subsp paratuberculosis using IS900 RFLP. Aust.Vet.J. 78:184-190.
29. Cowan, L. S., L. Mosher, L. Diem, J. P. Massey, and J. T. Crawford. 2002. Variable-number tandem repeat typing of Mycobacterium tuberculosis isolates with low copy numbers of IS6110 by using mycobacterial interspersed repetitive units. J.Clin.Microbiol 40:1592-602.
30. de Lisle, G. W., G. F. Yates, and D. M. Collins. 1993. Paratuberculosis in farmed deer: case reports and DNA characterization of isolates of Mycobacterium paratuberculosis. J.Vet.Diagn.Invest 5:567-71.
31. Dohmann, K., B. Strommenger, K. Stevenson, L. de Juan, J. Stratmann, V. Kapur, T. J. Bull, and G. F. Gerlach. 2003. Characterization of genetic differences between Mycobacterium avium subsp. paratuberculosis type I and type II isolates. J.Clin.Microbiol. 41:5215-23.
32. Dombek, P. E., L. K. Johnson, S. T. Zimmerley, and M. J. Sadowsky. 2000. Use of repetitive DNA sequences and the PCR To differentiate Escherichia coli isolates from human and animal sources. Appl.Environ.Microbiol 66:2572-7.
45 33. Dvorska, L., L. Matlova, M. Bartos, I. Parmova, J. Bartl, P. Svastova, T. J. Bull, and I. Pavlik. 2004. Study of Mycobacterium avium complex strains isolated from cattle in the Czech Republic between 1996 and 2000. Vet.Microbiol 99:239-50.
34. Feizabadi, M. M., I. D. Robertson, A. Hope, D. V. Cousins, and D. J. Hampson. 1997. Differentiation of Australian isolates of Mycobacterium paratuberculosis using pulsed-field gel electrophoresis. Aust.Vet.J 75:887-9.
35. Francois, B., R. Krishnamoorthy, and J. Elion. 1997. Comparative study of Mycobacterium paratuberculosis strains isolated from Crohn's disease and Johne's disease using restriction fragment length polymorphism and arbitrarily primed polymerase chain reaction. Epidemiol.Infect. 118:227-33.
36. Gascoyne-Binzi, D. M., R. E. Barlow, R. Frothingham, G. Robinson, T. A. Collyns, R. Gelletlie, and P. M. Hawkey. 2001. Rapid identification of laboratory contamination with Mycobacterium tuberculosis using variable number tandem repeat analysis. J.Clin.Microbiol. 39:69-74.
37. Ghadiali, A. H., M. Strother, S. A. Naser, E. J. Manning, and S. Sreevatsan. 2004. Mycobacterium avium subsp. paratuberculosis strains isolated from Crohn's Disease patients and animal species exhibit similar polymorphic locus patterns. J.Clin.Microbiol. 42:5345-5348.
38. Ghadiali, A. H., M. Strother, N. Theus, R. W. Stich, B. Byrum, W. P. Shulaw, V. Kapur, and S. Sreevatsan. Rapid detection and strain typing of Mycobacterium avium subsp. paratuberculosis from broth cultures. In Press. J.Clin.Microbiol.
39. Gillespie, B. E., B. M. Jayarao, and S. P. Oliver. 1997. Identification of Streptococcus species by randomly amplified polymorphic deoxyribonucleic acid fingerprinting. J.Dairy.Sci 80:471-6.
40. Gordon, S. V., R. Brosch, A. Billault, T. Garnier, K. Eiglmeier, and S. T. Cole. 1999. Identification of variable regions in the genomes of tubercle bacilli using bacterial artificial chromosome arrays. Mol.Microbiol 32:643-55.
41. Green, E. P., M. L. Tizard, M. T. Moss, J. Thompson, D. J. Winterbourne, J. J. McFadden, and J. Hermon-Taylor. 1989. Sequence and characteristics of
46 IS900, an insertion element identified in a human Crohn's disease isolate of Mycobacterium paratuberculosis. Nucleic Acids Res. 17:9063-9073.
42. Greenstein, R. J. 2003. Is Crohn's disease caused by a mycobacterium? Comparisons with leprosy, tuberculosis, and Johne's disease. Lancet Infect.Dis 3:507-14.
43. Greig, A., K. Stevenson, D. Henderson, V. Perez, V. Hughes, I. Pavlik, M. E. Hines, I. McKendrick, and J. M. Sharp. 1999. Epidemiological study of paratuberculosis in wild rabbits in Scotland. J.Clin.Microbiol. 37:1746-1751.
44. Guerrero, C., C. Bernasconi, D. Burki, T. Bodmer, and A. Telenti. 1995. A novel insertion element from Mycobacterium avium, IS1245, is a specific target for analysis of strain relatedness. J.Clin.Microbiol. 33:304-307.
45. Harris, J. E., and A. M. Lammerding. 2001. Crohn's disease and Mycobacterium avium subsp. paratuberculosis: current issues. J.Food Prot. 64:2103-10.
46. Harris, N. B., and R. G. Barletta. 2001. Mycobacterium avium subsp. paratuberculosis in Veterinary Medicine. Clin.Microbiol.Rev. 14:489-512.
47. Henderson, S. T., and T. D. Petes. 1992. Instability of simple sequence DNA in Saccharomyces cerevisiae. Mol.Cell.Biol. 12:2749-57.
48. Joyce, E. A., K. Chan, N. R. Salama, and S. Falkow. 2002. Redefining bacterial populations: a post-genomic reformation. Nat.Rev.Genet 3:462-73.
49. Kanduma, E., T. D. McHugh, and S. H. Gillespie. 2003. Molecular methods for Mycobacterium tuberculosis strain typing: a users guide. J Appl Microbiol 94:781-91.
50. Karakousis, P. C., R. D. Moore, and R. E. Chaisson. 2004. Mycobacterium avium complex in patients with HIV infection in the era of highly active antiretroviral therapy. Lancet Infect Dis 4:557-65.
51. Katoch, V. M. 2004. Infections due to non-tuberculous mycobacteria (NTM). Indian J.Med.Res 120:290-304. 47 52. Keim, P., L. B. Price, A. M. Klevytska, K. L. Smith, J. M. Schupp, R. Okinaka, P. J. Jackson, and M. E. Hugh-Jones. 2000. Multiple-locus variable- number tandem repeat analysis reveals genetic relationships within Bacillus anthracis. J.Bacteriol. 182:2928-36.
53. Kim, W., Y. P. Hong, J. H. Yoo, W. B. Lee, C. S. Choi, and S. I. Chung. 2002. Genetic relationships of Bacillus anthracis and closely related species based on variable-number tandem repeat analysis and BOX-PCR genomic fingerprinting. FEMS Microbiol.Lett. 207:21-7.
54. Klevytska, A. M., L. B. Price, J. M. Schupp, P. L. Worsham, J. Wong, and P. Keim. 2001. Identification and characterization of variable-number tandem repeats in the Yersinia pestis genome. J.Clin.Microbiol. 39:3179-85.
55. Kremer, K., D. van Soolingen, R. Frothingham, W. H. Haas, P. W. Hermans, C. Martin, P. Palittapongarnpim, B. B. Plikaytis, L. W. Riley, M. A. Yakrus, J. M. Musser, and J. D. van Embden. 1999. Comparison of methods based on different molecular epidemiological markers for typing of Mycobacterium tuberculosis complex strains: interlaboratory study of discriminatory power and reproducibility. J.Clin.Microbiol. 37:2607-18.
56. Kunze, Z. M., S. Wall, R. Appelberg, M. T. Silva, F. Portaels, and J. J. McFadden. 1991. IS901, a new member of a widespread class of atypical insertion sequences, is associated with pathogenicity in Mycobacterium avium. Mol.Microbiol. 5:2265-2272.
57. Lee, T. Y., T. J. Lee, and S. K. Kim. 1994. Differentiation of Mycobacterium tuberculosis strains by arbitrarily primed polymerase chain reaction-based DNA fingerprinting. Yonsei.Med.J 35:286-94.
58. Levy-Frebault, V. V., M. F. Thorel, A. Varnerot, and B. Gicquel. 1989. DNA polymorphism in Mycobacterium paratuberculosis, "wood pigeon mycobacteria," and related mycobacteria analyzed by field inversion gel electrophoresis. J.Clin.Microbiol. 27:2823-2826.
59. Lindstedt, B. A., E. Heir, E. Gjernes, and G. Kapperud. 2003. DNA fingerprinting of Salmonella enterica subsp. enterica serovar typhimurium with emphasis on phage type DT104 based on variable number of tandem repeat loci. J.Clin.Microbiol. 41:1469-79.
48 60. Linton, C. J., H. Jalal, J. P. Leeming, and M. R. Millar. 1994. Rapid discrimination of Mycobacterium tuberculosis strains by random amplified polymorphic DNA analysis. J.Clin.Microbiol 32:2169-74.
61. Lisitsyn, N., and M. Wigler. 1993. Cloning the differences between two complex genomes. Science 259:946-51.
62. Mahairas, G. G., P. J. Sabo, M. J. Hickey, D. C. Singh, and C. K. Stover. 1996. Molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis. J.Bacteriol 178:1274-82.
63. Maiden, M. C., J. A. Bygraves, E. Feil, G. Morelli, J. E. Russell, R. Urwin, Q. Zhang, J. Zhou, K. Zurth, D. A. Caugant, I. M. Feavers, M. Achtman, and B. G. Spratt. 1998. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc.Natl.Acad.Sci. USA 95:3140-5.
64. Marsh, I., R. Whittington, and D. Cousins. 1999. PCR-restriction endonuclease analysis for identification and strain typing of Mycobacterium avium subsp. paratuberculosis and Mycobacterium avium subsp. avium based on polymorphisms in IS1311. Mol.Cell.Probes 13:115-126.
65. Matsiota-Bernard, P., S. Waser, P. T. Tassios, A. Kyriakopoulos, and N. J. Legakis. 1997. Rapid discrimination of Mycobacterium avium strains from AIDS patients by randomly amplified polymorphic DNA analysis. J.Clin.Microbiol 35:1585-8.
66. Mazars, E., S. Lesjean, A. L. Banuls, M. Gilbert, V. Vincent, B. Gicquel, M. Tibayrenc, C. Locht, and P. Supply. 2001. High-resolution minisatellite-based typing as a portable approach to global analysis of Mycobacterium tuberculosis molecular epidemiology. Proc Natl Acad Sci USA 98:1901-6.
67. Moreira, A. R., F. Paolicchi, C. Morsella, M. Zumarraga, A. Cataldi, B. Fabiana, A. Alicia, O. Piet, D. van Soolingen, and R. M. Isabel. 1999. Distribution of IS900 restriction fragment length polymorphism types among animal Mycobacterium avium subsp. paratuberculosis isolates from Argentina and Europe. Vet.Microbiol. 70:251-259.
68. Moss, M. T., Z. P. Malik, M. L. Tizard, E. P. Green, J. D. Sanderson, and J. Hermon-Taylor. 1992. IS902, an insertion element of the chronic-enteritis- 49 causing Mycobacterium avium subsp. silvaticum. J.Gen.Microbiol. 138 ( Pt 1):139-145.
69. Motiwala, A. S., A. Amonsin, M. Strother, E. J. Manning, V. Kapur, and S. Sreevatsan. 2004. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis isolates recovered from wild animal species. J.Clin.Microbiol. 42:1703-1712.
70. Motiwala, A. S., M. Strother, A. Amonsin, B. Byrum, S. A. Naser, J. R. Stabel, W. P. Shulaw, J. P. Bannantine, V. Kapur, and S. Sreevatsan. 2003. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis: evidence for limited strain diversity, strain sharing, and identification of unique targets for diagnosis. J.Clin.Microbiol. 41:2015-26.
71. National Academy of Sciences Report. Diagnosis and Control of Johne's Disease (2003). http://books.nap.edu/openbook/0309086116/html/index.html.
72. Nebbia, P., P. Robino, E. Ferroglio, L. Rossi, G. Meneguz, and S. Rosati. 2000. Paratuberculosis in red deer (Cervus elaphus hippelaphus) in the western Alps. Vet.Res.Commun 24:435-43.
73. Nicod, J. C., and C. R. Largiader. 2003. SNPs by AFLP (SBA): a rapid SNP isolation strategy for non-model organisms. Nucleic Acids Res 31:e19.
74. O'Shea, B., S. Khare, K. Bliss, P. Klein, T. A. Ficht, L. G. Adams, and A. C. Rice-Ficht. 2004. Amplified fragment length polymorphism reveals genomic variability among Mycobacterium avium subsp. paratuberculosis isolates. J.Clin.Microbiol 42:3600-6.
75. Ott, S. L., S. J. Wells, and B. A. Wagner. 1999. Herd-level economic losses associated with Johne's disease on US dairy operations. Prev.Vet.Med. 40:179-92.
76. Overduin, P., L. Schouls, P. Roholl, A. van der Zanden, N. Mahmmod, A. Herrewegh, and D. van Soolingen. 2004. Use of multilocus variable-number tandem-repeat analysis for typing Mycobacterium avium subsp. paratuberculosis. J.Clin.Microbiol 42:5022-8.
77. Paustian, M. L., V. Kapur, and J. B. Bannantine. 2005. Comparative genomic hybridizations reveal genetic regions within Mycobacterium avium complex that 50 are divergent from Mycobacterium avium subsp. paratuberculosis isolates. Accepted for publication in J.Clin.Microbiol.
78. Pavlik, I., J. Bartl, L. Dvorska, P. Svastova, R. du Maine, M. Machackova, W. Yayo Ayele, and A. Horvathova. 2000. Epidemiology of paratuberculosis in wild ruminants studied by restriction fragment length polymorphism in the Czech Republic during the period 1995-1998. Vet.Microbiol. 77:231-51.
79. Pavlik, I., L. Bejckova, M. Pavlas, Z. Rozsypalova, and S. Koskova. 1995. Characterization by restriction endonuclease analysis and DNA hybridization using IS900 of bovine, ovine, caprine and human dependent strains of Mycobacterium paratuberculosis isolated in various localities. Vet.Microbiol. 45:311-318.
80. Pavlik, I., A. Horvathova, L. Dvorska, J. Bartl, P. Svastova, M. R. du, and I. Rychlik. 1999. Standardisation of restriction fragment length polymorphism analysis for Mycobacterium avium subspecies paratuberculosis. J.Microbiol.Methods 38:155-167.
81. Pillai, S. R., B. M. Jayarao, J. D. Gummo, E. C. Hue, D. Tiwari, J. R. Stabel, and R. H. Whitlock. 2001. Identification and sub-typing of Mycobacterium avium subsp. paratuberculosis and Mycobacterium avium subsp. avium by randomly amplified polymorphic DNA. Vet.Microbiol. 79:275-284.
82. Roring, S., A. Scott, D. Brittain, I. Walker, G. Hewinson, S. Neill, and R. Skuce. 2002. Development of variable-number tandem repeat typing of Mycobacterium bovis: comparison of results with those obtained by using existing exact tandem repeats and spoligotyping. J.Clin.Microbiol 40:2126-33.
83. Saxegaard, F., I. Baess, and E. Jantzen. 1988. Characterization of clinical isolates of Mycobacterium paratuberculosis by DNA-DNA hybridization and cellular fatty acid analysis. Apmis 96:497-502.
84. Scheibl, P., and G. F. Gerlach. 1997. Differentiation of Mycobacterium paratuberculosis isolates by rDNA-spacer analysis and random amplified polymorphic DNA patterns. Vet.Microbiol. 57:151-8.
85. Schwartz, D., I. Shafran, C. Romero, C. Piromalli, J. Biggerstaff, N. Naser, W. Chamberlin, and S. A. Naser. 2000. Use of short-term culture for
51 identification of Mycobacterium avium subsp. paratuberculosis in tissue from Crohn's disease patients. Clin.Microbiol.Infect. 6:303-307.
86. Semret, M., G. Zhai, S. Mostowy, C. Cleto, D. Alexander, G. Cangelosi, D. Cousins, D. M. Collins, D. van Soolingen, and M. A. Behr. 2004. Extensive genomic polymorphism within Mycobacterium avium. J.Bacteriol 186:6332-4.
87. Small, P. M., and J. D. van Embden. 1994. Molecular epidemiology of tuberculosis. In B. R. Bloom (ed.), Tuberculosis: pathogenesis, protection and control. American Society of Microbiology, Washington, D.C.
88. Spratt, B. G., and M. C. Maiden. 1999. Bacterial population genetics, evolution and epidemiology. Philos.Trans.R.Soc.Lond.B.Biol.Sci 354:701-10.
89. Stanley, J., N. Baquar, and E. J. Threlfall. 1993. Genotypes and phylogenetic relationships of Salmonella typhimurium are defined by molecular fingerprinting of IS200 and 16S rrn loci. J.Gen.Microbiol 139 Pt 6:1133-40.
90. Stevenson, K., V. M. Hughes, L. de Juan, N. F. Inglis, F. Wright, and J. M. Sharp. 2002. Molecular characterization of pigmented and nonpigmented isolates of Mycobacterium avium subsp. paratuberculosis. J.Clin.Microbiol. 40:1798- 1804.
91. Strand, M., T. A. Prolla, R. M. Liskay, and T. D. Petes. 1993. Destabilization of tracts of simple repetitive DNA in yeast by mutations affecting DNA mismatch repair. Nature 365:274-6.
92. Supply, P., J. Magdalena, S. Himpens, and C. Locht. 1997. Identification of novel intergenic repetitive units in a mycobacterial two-component system operon. Mol.Microbiol. 26:991-1003.
93. Supply, P., E. Mazars, S. Lesjean, V. Vincent, B. Gicquel, and C. Locht. 2000. Variable human minisatellite-like regions in the Mycobacterium tuberculosis genome. Mol Microbiol 36:762-71.
94. Suzuki, Y., A. Nagata, Y. Ono, and T. Yamada. 1988. Complete nucleotide sequence of the 16S rRNA gene of Mycobacterium bovis BCG. J.Bacteriol 170:2886-9.
52 95. Thoresen, O. F., and I. Olsaker. 1994. Distribution and hybridization patterns of the insertion element IS900 in clinical isolates of Mycobacterium paratuberculosis. Vet.Microbiol. 40:293-303.
96. van Belkum, A. 1999. The role of short sequence repeats in epidemiologic typing. Curr.Opin.Microbiol. 2:306-11.
97. van Belkum, A., S. Scherer, L. van Alphen, and H. Verbrugh. 1998. Short- sequence DNA repeats in prokaryotic genomes. Microbiol.Mol.Biol.Rev. 62:275- 93.
98. van der Giessen, J. W., R. M. Haring, and B. A. van der Zeijst. 1994. Comparison of the 23S ribosomal RNA genes and the spacer region between the 16S and 23S rRNA genes of the closely related Mycobacterium avium and Mycobacterium paratuberculosis and the fast-growing Mycobacterium phlei. Microbiology 140 ( Pt 5):1103-8.
99. van Embden, J. D., M. D. Cave, J. T. Crawford, J. W. Dale, K. D. Eisenach, B. Gicquel, P. Hermans, C. Martin, R. McAdam, T. M. Shinnick, and et al. 1993. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J.Clin.Microbiol. 31:406-9.
100. van Soolingen, D., J. Bauer, V. Ritacco, S. C. Leao, I. Pavlik, V. Vincent, N. Rastogi, A. Gori, T. Bodmer, C. Garzelli, and M. J. Garcia. 1998. IS1245 restriction fragment length polymorphism typing of Mycobacterium avium isolates: proposal for standardization. J.Clin.Microbiol. 36:3051-3054.
101. Watt, J. A. A. 1954. Johne's disease in bovine associated with the pigmented strain of Mycobacterium johnei. Vet. Rec. 27:387.
102. Welsh, J., and M. McClelland. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res 18:7213-8.
103. Whipple, D., P. Kapke, and C. Vary. 1990. Identification of restriction fragment length polymorphisms in DNA from Mycobacterium paratuberculosis. J.Clin.Microbiol. 28:2561-2564.
53 104. Whipple, D. L., P. A. Kapke, and R. E. Andrews, Jr. 1989. Analysis of restriction endonuclease fragment patterns of DNA from Mycobacterium paratuberculosis. Vet.Microbiol 19:189-94.
105. Whittington, R., I. Marsh, E. Choy, and D. Cousins. 1998. Polymorphisms in IS1311, an insertion sequence common to Mycobacterium avium and M. avium subsp. paratuberculosis, can be used to distinguish between and within these species. Mol.Cell.Probes 12:349-358.
106. Whittington, R. J., A. F. Hope, D. J. Marshall, C. A. Taragel, and I. Marsh. 2000. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis: IS900 restriction fragment length polymorphism and IS1311 polymorphism analyses of isolates from animals and a human in Australia. J.Clin.Microbiol. 38:3240-3248.
107. Whittington, R. J., I. B. Marsh, and R. H. Whitlock. 2001. Typing of IS1311 polymorphisms confirms that bison (Bison bison) with paratuberculosis in Montana are infected with a strain of Mycobacterium avium subsp. paratuberculosis distinct from that occurring in cattle and other domesticated livestock. Mol.Cell.Probes 15:139-45.
108. Whittington, R. J., and E. S. Sergeant. 2001. Progress towards understanding the spread, detection and control of Mycobacterium avium subsp. paratuberculosis in animal populations. Aust.Vet.J. 79:267-278.
109. Whittington, R. J., C. A. Taragel, S. Ottaway, I. Marsh, J. Seaman, and V. Fridriksdottir. 2001. Molecular epidemiological confirmation and circumstances of occurrence of sheep (S) strains of Mycobacterium avium subsp. paratuberculosis in cases of paratuberculosis in cattle in Australia and sheep and cattle in Iceland. Vet.Microbiol. 79:311-322.
110. Wiid, I. J., C. Werely, N. Beyers, P. Donald, and P. D. van Helden. 1994. Oligonucleotide (GTG)5 as a marker for Mycobacterium tuberculosis strain identification. J.Clin.Microbiol. 32:1318-21.
111. Williams, J. G., A. R. Kubelik, K. J. Livak, J. A. Rafalski, and S. V. Tingey. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res 18:6531-5.
54
Methods Target region (1-D)* No. of MAP Reference strains Genotyping methods based on insertion elements IS900-RFLP IS900 (BstEII) 0.599 48 (27) IS900 (PstI) 0.509 90 (79) IS900 (BstEII) 0.577 1008 (80) IS900 (PstI) 0.559 1008 (80) IS900 (BstEII and PstI) 0.697 1008 (80) IS900 (BstEII) 0.634 293 (106) 1S1311-RFLP IS1311 (BstEII) NA 10 (24) IS1311 (BstEII) 0.588 17 (105) IS1311 (BamHI) 0.560 15 (105) IS1311 (PvuII) 0.444 15 (105) IS1311 (PstI) 0.604 13 (105) MPIL IS900 insertion loci 0.560 81 (13) IS900 insertion loci 0.597 247 (70) IS900 insertion loci 0.533 112 (69) Genotyping methods based on repetitive elements MLSSR VNTRs at 11 loci 0.967 33 (2) SSR G-repeats 0.751 93 (69) SSR G & GGT repeats 0.783 94 (37) MLVA VNTRs at 5 loci 0.316 50 (76) MIRU short tandem repeats 0.535 62 (16) Genotyping methods based on single nucleotide polymorphisms RAPD random regions 0.777 212 (81) AFLP SNPs 0.711 104 (70) PFGE SNPs 0.461 36 (34) PFGE SNPs NA 93 (90)
Table 1.1. Comparison of the discrimination power of various M. paratuberculosis fingerprinting techniques. 55 Table 1.1. - continued
*: Simpson’s diversity index (1-D) was calculated based on information in the published paper using the equation 1-∑ (allele frequency)2
MAP: M. avium subsp. paratuberculosis
NA: Insufficient information in the published paper to enable calculation
56 CHAPTER 2
MOLECULAR EPIDEMIOLOGY OF MYCOBACTERIUM AVIUM SUBSPECIES
PARATUBERCULOSIS: EVIDENCE FOR LIMITED STRAIN DIVERSITY,
STRAIN SHARING, AND IDENTIFICATION OF UNIQUE TARGETS FOR
DIAGNOSIS
2.1. ABSTRACT
The objectives of this study were to understand the molecular diversity of animal and human strains of Mycobacterium avium subsp. paratuberculosis (M. paratuberculosis) isolated in the United States and identify M. paratuberculosis-specific diagnostic molecular markers to aid in disease detection, prevention and control.
Multiplex PCR of IS900 integration loci (MPIL) and amplified fragment length polymorphism (AFLP) analyses were used to fingerprint M. paratuberculosis isolates recovered from animals (n=203) and patients with Crohn’s disease (n=7) from diverse geographic localities. Six-hundred bacterial cultures including M. paratuberculosis
(n=303), non-M. paratuberculosis mycobacteria (n=129) and other non mycobacterial species (n=168) were analyzed to evaluate the specificity of two IS900 integration loci and a newly described M. paratuberculosis-specific sequence (locus 251) as potential
57 targets for the diagnosis of M. paratuberculosis. MPIL fingerprint analysis revealed that
78% of bovine origin M. paratuberculosis isolates clustered together into a major node,
while isolates from human and ovine sources showed greater genetic diversity. MPIL
analysis also showed that the M. paratuberculosis isolates from ovine and bovine sources
from the same state were more closely associated than were isolates from different
geographic regions, suggesting that some of the strains are shared between these
ruminant species. AFLP fingerprinting revealed a similar pattern, with most isolates from
bovine sources clustering into 2 major nodes while those recovered from sheep or
humans were clustered on distinct branches. Overall, the study identified a high degree of
genetic similarity between M. paratuberculosis strains recovered from cows regardless of
geographic origin. Further, the results of our analyses reveal a relatively higher degree of
genetic heterogeneity amongst M. paratuberculosis isolates recovered from human and
ovine sources compared to the isolates obtained from cattle sources, suggesting that they
are ancestral.
2.2. INTRODUCTION
Paratuberculosis or Johne’s disease is a chronic granulomatous enteritis of
ruminants caused by Mycobacterium avium subspecies paratuberculosis (M.
paratuberculosis) (49). It is estimated that 35% of the US herds are infected with M.
paratuberculosis resulting in annual losses of $200 million USD (7). Crohn’s disease
(Crohn’s disease) is also a chronic inflammation of distal intestines of humans exhibiting
similar pathology as Johne’s disease in ruminants. The prevalence of Crohn’s disease is
estimated to be 0.15% among the US population resulting in substantial morbidity and
58 medical costs (1). M. paratuberculosis has been implicated as a cause of Crohn’s disease in humans (13, 21, 37). Currently, the evidence for a link remains inconclusive since strain sharing or a causal role of M. paratuberculosis has not been conclusively demonstrated.
Comprehensive analysis of the molecular diversity and comparative molecular pathology of M. paratuberculosis will help establish the degree of heterogeneity in strains isolated from a variety of host species. The extent of strain sharing across a variety of hosts will reflect the degree of interspecies transmission. It will also identify any strain sharing between isolates causing Johne’s and Crohn’s diseases. Until recently, an IS900- based restriction fragment length polymorphism (RFLP) fingerprinting has been applied to study molecular epidemiology of M. paratuberculosis isolates. Extensive analyses of the IS900-RFLP patterns have identified that Johne’s disease in cattle and other species like goats and rabbits (3, 20, 34) is caused by indistinguishable strains. Two M. paratuberculosis isolates from a Crohn’s disease patient were also shown to carry a bovine-like IS900-RFLP fingerprint (48). Johne’s disease in sheep appears to be caused by a different M. paratuberculosis strain (3, 48). However, the occurrence of a ‘sheep strain’ in cattle with Johne’s disease has been reported, indicating that interspecies transmission cannot be ruled out (50). Use of other independent fingerprinting and molecular diversity analysis tools to verify strain sharing is essential to provide substantial evidence of interspecies transmission of particular genetic subtypes of M. paratuberculosis.
The control and eradication of Johne’s disease is severely hindered by prolonged incubation time, presence of undetected sub-clinical cases, absence of M.
59 paratuberculosis specific diagnostic tools, and the lack of knowledge of strain diversity.
Current diagnostic methods include isolation from fecal and tissue specimens, enzyme- linked immunosorbent assay (ELISA), and IS900 based PCR. While culturing the organisms is considered a ‘gold standard’, it is fraught with difficulties. For example, the organism takes at least 12 to 16 weeks to grow to detectable levels and even the most sensitive culture methods have only 50% sensitivity (44). Serologic tests such as agar gel immunodiffusion (18), complement fixation (25) and ELISA are limited in their use because of low specificity and sensitivity since antibodies may not be detectable either due to anergy or until their late appearance in the pathogenesis of Johne’s disease (32,
43).
Conventional wisdom is that M. paratuberculosis differs from other members of the M. avium complex in having 14-18 copies of IS900 inserted into conserved loci in its genome. Insertion element IS900 is a 1451 bp segment that lacks inverted terminal
repeats and has features characteristic of the IS900 family such as homologous
transposases and particular insertion sites (19). IS900 based PCR identification
techniques have been routinely used for M. paratuberculosis diagnosis (22, 51) and a
number of studies have used DNA probes based on IS900 for M. paratuberculosis
detection in tissues (29, 51), fecal specimens (17, 44) and milk samples (36). There is
growing concern about the zoonotic potential of M. paratuberculosis and several studies
have attempted to show a causal relationship between M. paratuberculosis and Crohn’s
disease by demonstration of IS900 in tissue (22, 38) and milk (31) samples of Crohn’s
disease patients. Additionally, based on the presence of IS900, several studies have
implied that bovine milk may potentially serve as a mode of transmission of M.
60 paratuberculosis (9, 36). However, IS900-like elements have been found in M. avium
complex (30) and some atypical mycobacteria (10, 14, 28). Thus, the diagnosis of M.
paratuberculosis based on detection of IS900 alone need to be evaluated with caution.
Hence, there is a need for identification and large-scale analysis of additional M.
paratuberculosis-specific molecular targets other than IS900 to confirm diagnosis. We
report in this manuscript a molecular test that exploits the fact that IS900 is integrated
into conserved loci in the genome and that these integration sites are unique to M. paratuberculosis. Microtiter plate hybridization to integration-site specific probes was used to confirm specificity of PCR amplification (41). A recently identified M. paratuberculosis-unique sequence 251 (2) was also evaluated as a target sequence for use in molecular diagnosis. Presence of hsp65 polymorphism was used to confirm identification of M. paratuberculosis (15, 26). Two different molecular typing methods, multiplex PCR of 28 IS900 integration loci (MPIL) (5) and amplified fragment length polymorphism (AFLP) analysis were used to fingerprint M. paratuberculosis isolates obtained from a variety of geographical localities and hosts species. An IS1311 PCR and restriction endonuclease analysis (PCR-REA) was used to differentiate between bovine and ovine M. paratuberculosis isolates (47) within MPIL and AFLP clusters.
2.3. MATERIALS AND METHODS
2.3.1. Bacteria: Mycobacterial strains were obtained from a variety of hosts and
geographical localities (Table 2.1.). One hundred and seventy-three field isolates were
from Ohio farms and represented 33 counties (Figure 2.1.). About 43% of the isolates
were from Columbiana (n=16), Holmes (n=22), Logan (n=18), and Medina (n=19)
61 counties in the state of Ohio. Nationally, 27 states were represented. A bovine isolate
each from Argentina and Nova Scotia were also analyzed. Some human M. paratuberculosis strains analyzed in this study have been described elsewhere (31). Most isolates were provided as distinct colonies on Herrold’s egg yolk medium (HEYM) slants containing mycobactin J. Some mycobacterial strains that were received as bacterial suspensions in water or broth were subcultured on HEYM with mycobactin J. DNA from
Mycobacterium tuberculosis isolates, representing the extent of diversity within the species based on IS6110 fingerprinting and classification into the three major groups
(42), were a kind gift from the collection of Dr. B. N. Kreiswirth (Public Health Research
Institute, New York, NY). DNA extracts from M. bovis and BCG strains were a kind gift
of Dr. B. C. Cooksey (Centers for Disease Control, Atlanta, GA).
2.3.2. DNA extraction: Bacteria were harvested into 500µl of sterile deionized
(DI) water for DNA extraction. QIAamp® DNA Blood Mini Kit (Qiagen Inc., Valencia,
CA) was used with a few modifications. Briefly, the cell suspension was pelleted by
centrifugation, 180µl of 20 mg/ml lysozyme (Sigma Aldrich, St. Louis, MO) was added
and vigorously vortexed to obtain a homogenous mixture. After incubation at 37ºC for 30 minutes, 20µl of protease and 200µl of lysis buffer were added, vortexed thoroughly and incubated at 70ºC for 30 minutes. Protease was inactivated by incubating at 95ºC for 15 minutes. Subsequently, the DNA was bound to columns, washed, and eluted in 200 µl of preheated sterile DI water as suggested by the manufacturer. An extraction blank was included in each batch and used as negative control for molecular analyses.
2.3.3. Genetic fingerprinting using multiplex PCR for integration loci
(MPIL): Genetic fingerprints of a subset of the M. paratuberculosis and M. avium
62 complex isolates were generated using the method described (5) with several
modifications. Briefly, 6 sets of multiplex PCRs referred as 9R1, 5R2, 4L1, 4L2, 3L3 and
3L4 were carried out as described. The modifications to the published technique included
the use of primer designated Loc14L in set 5R2 (instead of Loc14R) and primer
designated Loc14R (6) in set 3L3 (instead of Loc14L). All primers were used at a
concentration of 0.2 µM except the common primer which was used at a concentration of
1 µM in a reaction volume of 50µl which contained 5 U Taq polymerase, 1X PCR buffer containing 1.5 mM MgCl2 (Qiagen Inc., Valencia, CA), 200 µM deoxyribonucleotide triphosphates (Amersham Pharmacia Biotech Inc., Piscataway, NJ), 10% DMSO and 1µl
(approx. 50ng/µl) of genomic DNA. The thermal cycler parameters were as described (5).
The PCR products were electrophoresed at 100V for 4 hours in a 2% agarose gel pre- stained with ethidium bromide and visualized on a UV transilluminator (Alpha Innotech
Corporation, San Leandro, CA).
2.3.4. Analysis of MPIL fingerprints: The resulting fingerprints were converted into binary data where 1 indicated the presence while 2 indicated the absence of a specific band. Cluster analysis was done using Molecular Evolutionary Genetics
Analysis (MEGA, version 2.1, www.megasoftware.net) by the Unweighted Pair Group
Method with Averages (UPGMA) (40). The distance matrix for input into the MEGA program was created from the binary data using ETDIV and ETMEGA
(http://foodsafe.msu.edu/whittam/programs/).
2.3.5. Amplified fragment length polymorphism (AFLP) of M. paratuberculosis: AFLP was performed as described in the AFLP Microbial
Fingerprinting Kit protocol (Perkin Elmer-Applied Biosystems Division, Foster City,
63 CA). In brief, the M. paratuberculosis DNA was restricted with endonucleases EcoRI and MseI. The restricted fragments were then ligated to EcoRI and MseI adapters. The restriction-ligation reaction mixture included 100 ng genomic DNA, 5 U EcoRI (New
England Biolabs Inc., Beverly, MA), 5 U MseI (NEB), 1 U DNA ligase (NEB) and 0.4
µM of adapter pairs in T4 DNA ligase buffer (50 mM Tris-HCl (pH 7.8), 10 mM DTT, 1 mM ATP, 25 µg BSA). Preselective amplification was carried out in a final reaction volume of 20µl which contained 4µl of the products of the restriction-ligation reaction,
125 pmol of AFLP preselective primer pairs (EcoRI preselective primer: 5’-GAC TGC
GTA CCA ATT C and MseI preselective primer: 5’-GAT GAG TCC TGA GTA A), and
15µl AFLP core mix (PE-ABD). PCR reactions were performed in a thermal cycler
(GeneAmp PCR system 9700, Perkin-Elmer) with an initial denaturation at 72ºC for 2 minutes, followed by 20 PCR cycles of denaturation at 94ºC for 1 second, annealing at
56ºC for 30 seconds, extension step at 72ºC for 2 minutes and a final extension step at
60ºC for 30 minutes. Selective amplification was performed using the EcoRI selective primer containing a fluorescent label on the 5’ end with additional base C
(Carboxyfluorescein dye [FAM]-EcoRI-C: FAM-5’-GAC TGC GTA CCA ATT CC) and
MseI selective primer with no additional base (MseI-O: 5’-GAT GAG TCC TGA GTA
A), in a final reaction volume of 10µl containing 1.5µl of the preselective amplification products, 125 pmol MseI-O primer, 25 pmol of FAM-EcoRI-C primer, and 7.5µl of
AFLP core mix (PE-ABD) in a thermal cycler (GeneAmp PCR system 9700; Perkin-
Elmer). Aliquots (1µl) of each amplification product were mixed with 2µl of sterile water and subjected to electrophoresis in 5% Long Ranger gels (LMC Bioproducts, Rockland,
ME) using the ABI model 377 automated DNA fragment analyzer (Perkin-Elmer). An
64 internal size standard (GS-500, ROX size standard) was included in each lane. The AFLP
fingerprint profiles were then automatically analyzed with GeneScan (Perkin-Elmer).
Sizes of amplified products were then tabulated and exported for cluster analysis using
Molecular Analyst software (Bio-Rad, Hercules, CA). To analyze AFLP fingerprints,
DNA fragments sized from 50 to 500 bp were included for cluster analysis.
2.3.6. Computer assisted analysis of AFLP fingerprints: Molecular Analyst
software (Bio-Rad, Hercules, CA) was used to compare the AFLP fingerprint profiles
amongst M. paratuberculosis isolates. The program automatically computed the
similarity for each pair of fingerprints on the basis of band positions using the Dice
coefficient (SD). Pairs of isolates with similarity coefficient (SD) of 0.95 were considered as similar and not distinguishable. Cluster analysis amongst isolates was performed by the UPGMA linkage method.
2.3.7. Concordance analysis: Kappa statistics (27) were calculated for each concordant pair of the isolates (n=100) which were analyzed by both MPIL and AFLP techniques to assess the degree of agreement between the two fingerprinting techniques.
2.3.8. PCR amplification and hybridization for IS900 integration loci L1 and
L9: Two IS900 integration sites designated as locus L1 (left side integration site of
IS900 into an unknown ORF) and locus L9 (left side integration of IS900 into alkA) were amplified using PCR. The primers used were L1: 5'-CCC GTG ACA AGG CCG AAG
A-3', L9: 5'-CGG CCC TGG CGT TCC TAT G-3' and a biotinylated common forward
primer 900R: 5'-/5Bio/ACG CTG TCT ACC ACC CCG CA-3' (5). Primers were used at
a final concentration of 0.2 µM in a 50µl PCR reaction master mix also including 1.25 U
Taq polymerase, 1X PCR buffer containing 1.5 mM MgCl2 (Qiagen Inc., Valencia, CA),
65 200 µM deoxyribonucleotide triphosphates (Amersham Pharmacia Biotech Inc.,
Piscataway, NJ). 5µl (approx. 50 ng/µl) of genomic DNA was used in each reaction. The
thermal cycler parameters used for amplification included an initial 95ºC incubation step
for 15 minutes for Taq polymerase activation followed by 35 cycles of denaturation at
94ºC for 15 seconds, annealing at 58ºC for 20 seconds and extension at 72ºC for 20 seconds with a final extension step at 72ºC for 7 minutes. A PCR blank was included for each batch and used as negative control for molecular analyses. The amplification products were detected in two independent ways. First, they were visualized on a UV transilluminator (Alpha Innotech Corporation, San Leandro, CA) after electrophoresis at
125V for 45 minutes in 1.5% agarose gels pre-stained with ethidium bromide. Second, the biotinylated amplicons were detected in a reverse hybridization reaction on a microtiter plate as described (41). The probes were designed to target the unique integration regions (spanning IS900 into the genes of insertion) located within the amplicons. Probes used were PrL1 (spanning the IS900-unknown ORF region): 5’-TAC
ACA CAG CCG CCA TAC ACT TCG CTT CAT GCC CTT ACG-3' and PrL9
(spanning the IS900-alkA region ): 5’–AGC CAT CGA AGG GGA TTC TCA ATG
ACG TTG TCA A-3'. The two integration loci were detected simultaneously in microtiter wells (Corning Incorporated, Corning, NY) coated with a mixture of both probes as described (41). DNA extraction blanks, PCR amplification negatives and hybridization negatives were used in all analyses as negative controls. The cut-off optical density was set at 0.2 on the basis of analysis of several known negatives and M. paratuberculosis positives.
66 2.3.9. PCR amplification of M. paratuberculosis-unique sequence 251: Primers used to amplify the entire 417 bp open reading frame of M. paratuberculosis-unique sequence 251 have been published elsewhere (2). PCR reactions were performed in 25µl volumes, which included 0.625 U Taq polymerase, 1X PCR buffer, 2.5 mM MgCl2, 200
µM deoxyribonucleotide triphosphates (Amersham Pharmacia Biotech Inc., Piscataway,
NJ), 0.2 µM of each primer, 5% DMSO and 2µl (approx. 50ng/µl) of genomic DNA. The thermal cycler parameters used for amplification included an initial 95ºC incubation step for 15 minutes for Taq polymerase activation followed by 35 cycles of denaturation at
94ºC for 20 seconds, annealing at 53ºC for 30 seconds and extension at 72ºC for 30 seconds with a final extension step at 72ºC for 7 minutes. Amplicons were visualized after electrophoresis at 125V for 45 minutes in a 1.5% agarose gel pre-stained with ethidium bromide.
2.3.10. PCR – REA for polymorphisms in hsp65 and IS1311 genes: New primers were designed to target previously described (15, 47) polymorphic regions of hsp65 and IS1311. A 248 bp fragment of hsp65 was amplified using primers hsp3: 5’-
GCC GCT GCT GAT CAT CGC CGA–3’ and hsp4: 5’-CCT TGG TGA CGA CGA
CCT T–3’ while a 749 bp region of IS1311 was amplified using primers IS1311F: 5’-
GCG TGA GGC TCT GTG GTG AA–3’ and IS1311R: 5’-TCA GAG ATC ACC AGC
TGC AC–3’. PCR was carried out in a reaction volume of 50µl. The master mix included
1.25 U Taq polymerase, 0.2 µM of each primer, 1X PCR buffer containing 1.5 mM
MgCl2 (Qiagen Inc., Valencia, CA), 200 µM deoxyribonucleotide triphosphates
(Amersham Pharmacia Biotech Inc., Piscataway, NJ), 5% DMSO and 2µl (approx.
50ng/µl) of genomic DNA. The thermal cycler parameters used were as described for
67 integration loci PCR. A PCR blank was included in each batch and used as negative
control for molecular analyses. After the amplification, 10µl of each PCR product was
digested with 4 U of restriction enzyme at 37ºC for one hour as per the supplier’s
instructions. PstI (New England BioLabs Inc., Beverly, MA) was used to detect
polymorphism in nucleotide #861 of hsp65 ORF (GenBank accession number X74518,
ORF from 125 to 1750) and HinfI (New England BioLabs Inc., Beverly, MA) was used to detect IS1311 polymorphism in nucleotide #167 of IS1311 ORF (GenBank accession
number AJ223974, ORF from 35 to 1219). Both digested and undigested amplicons were
electrophoresed in adjacent wells of 1.5% agarose gels pre-stained with ethidium bromide
and visualized on a UV transilluminator (Alpha Innotech Corporation, San Leandro, CA).
2.3.11. DNA sequencing: PCR products were sequenced using standard dye terminator chemistry and analyzed on an automated DNA sequencer (Perkin-Elmer ABI
377). Sequences were aligned against sequences in GenBank database and analyzed using
Editseq and MegAlign programs (DNASTAR, Inc., Madison, WI).
2.4. RESULTS
2.4.1. Fingerprinting by MPIL: Of the 390 bacterial isolates fingerprinted by
MPIL (Figure 2.2.), a panel of 247 isolates, including 210 M. paratuberculosis isolates from a variety of species and geographic localities and 37 M. avium complex isolates, were subjected to cluster analysis (Table 2.1.). Negative control strains were excluded from the analysis due to absence of a fingerprint. These included extraction blank (n=1), non-mycobacterial isolate (n=1), atypical mycobacteria (n=6), uncharacterized mycobacterial (BACTEC positives) controls (n=14), and M. avium complex strains with
68 0 or 1 band (n=64). M. paratuberculosis isolates fingerprinted in duplicate (for technique
validation and amplification quality control) either from the same (n=21) or different
culture tubes (n=30) were also excluded from the cluster analysis. Six of the M.
paratuberculosis isolates were excluded due to absence of sufficient DNA for
fingerprinting. Cluster analysis using UPGMA sorted the fingerprints into 90
electrophoretic types (ETs). The distances were generated as proportion differences. ET
clusters at a distance of less than 0.1 units were grouped together and assigned a
fingerprint. The major branches were arbitrarily designated as A and B. Branch A had 18
different fingerprints while branch B had 11 fingerprints (Figure 2.3.). A majority of the
M. paratuberculosis isolates (201 out of 210 analyzed) clustered in branch A. Seventy-
eight percent of the total bovine isolates clustered in A18. Isolates from Ohio showed
limited variation across the counties (Figure 2.1.). Fourteen of ovine isolates were
scattered throughout the branch with 50% clustering in the same node (A7-A12) along
with bovine isolates from Ohio and Iowa. Four of the human isolates also fell in the
major cluster A18 while two appeared in close proximity to a bovine and an ovine strain
(A5, A14). The other human isolate had a distinct fingerprint (A13). All the M. avium
complex strains (isolated from Crohn’s patients and other sources) clustered in the branch
B. This branch also included 2 ovine strains and 7 bovine strains. On basis of distance,
both the ovine strains were closer to the M. avium complex than to the bovine strains.
2.4.2. Fingerprinting by AFLP: AFLP analysis was performed for 104 isolates
from our culture collection. Isolates identified as distinct ETs and representing all the
MPIL fingerprint profiles were selected for AFLP analysis. These included 86 M. paratuberculosis isolates (bovine, n=72; ovine, n=4; caprine, n=7; murine, n=1; and
69 human, n=2) and 16 M. avium complex isolates (human host, n=10 and unknown host,
n=6). Type strains M. paratuberculosis K-10 and TIGR M. avium subsp. avium (M.
avium) 104 were also included as positive controls. The dendrogram clustered 90% of the
bovine M. paratuberculosis isolates into two major branches designated Z1 and Z2
(Figure 2.4.). These branches also included the goat and mouse isolates. Only one of the
sheep isolate clustered into the major branch Z2. The other 2 Ohio ovine isolates
clustered together in close proximity on one major node with a bovine isolate from New
York, and were assigned to Z7, Z8, and Z9 genetic types (97% similarity), respectively.
The M. avium complex isolates from Crohn’s patients and unknown hosts clustered into
distinct branches suggesting a clear segregation between the strains. Both the human M.
paratuberculosis isolates analyzed, appeared on independent branches. One bovine M.
paratuberculosis isolate from Iowa appeared on a distinct branch and was assigned a
unique fingerprint (Z21) (Figure 2.4.).
Concordance analysis was performed for isolates (n=100) that were fingerprinting by both MPIL and AFLP. The major MPIL cluster A18 containing 73% of the isolates could be further divided into different Z fingerprints by AFLP analysis as follows – Z1
(n=23), Z2 (n=42), Z4 (n=1), Z5 (n=1), Z6 (n=1), Z9 (n=1), Z10 (n=1), Z11 (n=1), Z12
(n=1) and Z21 (n=1). Isolates (n=7) which had the B11 fingerprint could be divided into
Z13 (n=1), Z17 (n=1), Z19 (n=1), Z24 (n=1), Z25 (n=1) and Z26 (n=2). Isolates (n=8)
which had the B6 fingerprint could be divided into Z16 (n=3), Z22 (n=2), Z23 (n=1) and
Z24 (n=2). Similarly, the major AFLP cluster Z2 (n=49) could be divided into A4 (n=1),
A6 (n=1), A15 (n=3), A18 (n=42) and B2 (n=1). Kappa coefficients of the major MPIL-
AFLP pairs were A18-Z1 κ=0.2 and A18-Z2 κ=0.25.
70 2.4.3. PCR – REA for polymorphisms in IS1311 gene: A C→T polymorphism in nucleotide #167 in ORF (GenBank accession number AJ223974, ORF from 35 to
1219) of insertion element IS1311 is unique to bovine M. paratuberculosis isolates while ovine M. paratuberculosis strains are identical to M. avium in this locus (47). This results in the gain of a HinfI restriction site in M. paratuberculosis from bovine origin. A panel of 190 isolates (Table 2.1.) was analyzed for polymorphism in IS1311 gene. Undigested amplicons from all M. avium complex isolates and an atypical mycobacterium (M. xenopi) showed presence of a single 749 bp band after PCR. After digestion with HinfI all cattle, goat, mouse and deer M. paratuberculosis and 5 M. avium complex isolates
showed presence of the predicted 4 bands (67 bp, 85 bp, 218 bp and 379 bp) while all
ovine M. paratuberculosis and 50 of 55 M. avium complex showed presence of 3 bands
(85 bp, 285 bp and 379 bp) indicating absence of the restriction site (Figure 2.5.). The other five atypical mycobacteria and non-mycobacterial isolates did not amplify the
IS1311 segment. Amplification specificity was confirmed by sequencing a bovine, an ovine and a M. avium complex isolate. All 3 isolates showed homology to the published sequences (GenBank accession numbers AJ308375, AJ223975 and U16276) as well as the expected polymorphism. One bovine isolate, which was L1-L9 and 251 positive showed a different pattern when the restriction enzyme products were electrophoresed
(Figure 2.5.). The undigested product was of the expected band length (749 bp).
Nucleotide sequence of this product revealed that this isolate had numerous mutations resulting in a total of 6 restriction sites only one of which was in the expected position.
Restriction digestion resulted in 7 fragments (31bp, 63bp, 85bp, 95bp, 130bp, 148bp and
195bp) instead of the expected 3 or 4.
71 2.4.4. PCR amplification of two IS900 integration sites: A panel of 600
bacterial isolates including M. paratuberculosis (n=303), M. avium complex (n=85), M.
tuberculosis complex (n=38), atypical mycobacteria (n=6), non-mycobacterial negative
controls (n=35) and other uncharacterized non-M. paratuberculosis control isolates
(n=133) from a variety of geographic locations and hosts were analyzed for the presence
of two integration sequences (Table 2.1.). PCR amplified two regions corresponding to
the integration sites of IS900 at loci L1 (206 bp) and L9 (147 bp). Gel electrophoresis
showed presence of two bands of expected sizes in 296 M. paratuberculosis and 5 of the
85 isolates from the M. avium complex group. Microtiter plate hybridization results were
positive for all the known M. paratuberculosis isolates (n=303). All other isolates including DNA extraction, PCR and hybridization negatives were below the cut-off value of 0.2 optical density at 450 nm.
2.4.5. Presence of M. paratuberculosis-specific target 251 in known M. paratuberculosis isolates: A subset of 328 isolates from the culture collection was
analyzed for presence of M. paratuberculosis-unique sequence 251 (Table 2.1.). Agarose
gel electrophoresis showed presence of a 417 bp band for all 113 known M.
paratuberculosis and 5 M. avium complex isolates which were also positive by L1-L9
PCR. The locus was absent in all other mycobacteria (n=27), atypical mycobacteria (n=6)
and non-mycobacterial bacterial isolates analyzed (n=121). PCR products from 9 bovine
(OH), 3 human (Crohn’s) and 3 ovine (OH) isolates were sequenced. The nucleotide
sequences had 100% identity with the published open reading frame of locus 251
(GenBank accession number AF445445, 123-539) indicating the stability of this target
and its usefulness in Johne’s disease diagnostics.
72 2.4.6. PCR – REA for polymorphisms in hsp65 gene: A subset of 272 isolates
(Table 2.1.) that were analyzed for presence of L1 and L9 integration sites were reflexed for identity confirmation by PCR-REA analysis of this locus. A G→T polymorphism in nucleotide #861 in the ORF (GenBank accession number X74518) of hsp65 gene is unique to M. paratuberculosis and leads to loss of a PstI restriction site in the species.
Prior to digestion, all mycobacterial isolates analyzed showed presence of a single 248 bp band when visualized by agarose gel electrophoresis. After digestion with PstI, all M. paratuberculosis isolates retained the full 248 bp band while all M. avium complex and other bacterial isolates showed presence of two bands (135 bp and 113 bp) indicating presence of the restriction site. All six atypical mycobacteria and 10 M. tuberculosis complex isolates showed M. avium complex-like pattern. The non-mycobacterial isolates included in the analysis did not amplify the region of interest.
2.5. DISCUSSION
Efficiency of preventive and prophylactic measures in Johne’s disease is restricted
due to lack of M. paratuberculosis-specific diagnostic tools and in particular, the lack of knowledge of strain diversity which has been limited due to its slow growth rate and restricted allelic variation. It is desirable to differentiate among the isolates of M. paratuberculosis to better understand the epidemiology of M. paratuberculosis infections, its host specificity, distribution and prevalence. In the present study we sought to establish the degree of molecular diversity amongst M. paratuberculosis strains from a variety of hosts and locations, to identify any strain sharing among various host species
73 and to identify M. paratuberculosis-specific diagnostic molecular markers to aid in disease prevention and control.
2.5.1 Molecular diversity in M. paratuberculosis: Mutations in structural genes
(24) or antigenic variations (16) can serve as useful molecular markers to study
epidemiology and natural history of an organism. However, in well-conserved genomes
like that of mycobacteria (42), these markers provide limited information in strain typing.
In mycobacterial genomes, degree of diversity in the number and site of integration of
transposable genetic elements or single nucleotide polymorphisms in genes associated
with drug resistance or host immunological pressure may be more useful than those that
rely on genome-wide single nucleotide polymorphisms as indicators of strain variation.
Several molecular epidemiological studies have demonstrated the usefulness of insertion
sequences in determining strain distribution of mycobacteria like IS1245 in M. avium
(46) and IS6110 in M. tuberculosis (45) and IS711 in Brucella sp (4). Other repetitive
elements have also been used in strain typing (12). Seminal studies that identified IS900
in M. paratuberculosis strains suggested that it was exclusively present in M.
paratuberculosis (19). Hence, IS900 has been the marker of choice for most
fingerprinting studies reported (11, 35, 48). This exploits the fact that the IS900 elements
show a high degree of target sequence specificity resulting in similar fingerprints in
related isolates (19). IS900-RFLP analyses have broadly divided the M. paratuberculosis
strains into either sheep or cattle and other ruminant subtypes, designated S and C
respectively (3, 8, 48). In contrast, isolation of an S strain from cattle has been reported
(50). Most investigations have identified limited strain sharing between cattle and sheep
hosts whereas little variation in fingerprints is evident between cattle and other animals
74 which include rabbits, goats and M. paratuberculosis isolates from a human with Crohn’s disease. Evidence of strain sharing between bovine and human M. paratuberculosis isolates is of special interest as this implies the existence of a potential animal reservoir for the etiological agent of Crohn’s disease. Several studies have implicated inability to compare fingerprints from sheep isolates due to difficulties encountered in culturing them. Thus, indication of limited strain sharing between bovine and ovine isolates does not rule out interspecies transmission as there may be a bias in the analysis due to under- representation of the slow growing ovine strains. In summary, there has been inadequate data to support the idea of extensive strain sharing and interspecies transmission. Besides being elaborate and expensive, fingerprinting by RFLP requires large amounts of unsheared genomic DNA extracted from relatively large cultures. There are multiple reports (10, 14, 28, 30) of presence of IS900-like elements in mycobacteria other than M. paratuberculosis. Sequence analysis of a few M. avium complex isolates with the commonly used IS900 primers (3) showed presence of IS900 elements (data not shown).
Nucleotide sequences indicated significant homology between these regions and the
IS900 element in M. paratuberculosis. This supports the notion that the use of IS900 probe as a tool in molecular typing could result in false positives corresponding to IS900 related elements in mycobateria other than M. paratuberculosis (8, 39).
Both techniques reported in this study require very small quantities of genomic
DNA and are applicable to degraded DNA samples not suitable for RFLP analysis. AFLP analysis results using 104 isolates from distinct geographic regions and hosts showed that
72% of the M. paratuberculosis including bovine, caprine and murine strains fell into either one of the two major clusters reiterating the low degree of heterogeneity at
75 genomic level. This suggests that only a few strains may be responsible for disease in
bovine hosts and that interspecies transmission could have occurred since these clusters also included M. paratuberculosis strains isolated from other hosts. In agreement with previous studies, the two major branches included only one of the 4 ovine isolates while the other 2 ovine strains clustered into distinct branches in close proximity to a bovine isolate. In contrast to earlier reports (34, 48) and our MPIL data, AFLP fingerprints of the human M. paratuberculosis isolates were unique and did not cluster with either the bovine or ovine strains suggesting that they were relatively more heterogeneous at the genome level.
In MPIL analysis 78% of the US bovine isolates as well as those from Argentina and Nova Scotia fell within one major cluster indicating a significant degree of uniformity within isolates infecting bovine hosts. M. paratuberculosis strains from other ruminants, like goat and deer, and one mouse strain also fell within this cluster. Similar to
AFLP, this major cluster included only 2 of the 16 ovine isolates analyzed. The analysis identified clear genetic diversity between ovine isolates while there were limited differences within strains from bovine hosts across several geographic localities. M.
paratuberculosis isolates from the human Crohn’s disease patients were more diverse with phylogenetic proximities at varying levels to strains isolated from both bovine and ovine host species, an indication of a greater level of diversity. Although, this suggests a close association of the human and animal strains, it does not provide direct evidence for a causal role of M. paratuberculosis in Crohn’s disease. Comprehensive comparative
genomics with larger numbers of human isolates and reproduction of Johne’s disease in
76 animals by the human strains will be required to demonstrate, albeit indirectly, a causal
association between M. paratuberculosis and Crohn’s disease.
The possibility of non specific amplification of Loc5R and Loc5L primers in M. avium strains due to homology in desA1 and desA2 genes have been described (5).
Similar non-specific amplifications may have been the case in the low copy strains of our
collection. Conversion of this gel based analysis into a microarray using integration site
probes would provide a more accurate picture of the fingerprinting by MPIL.
Concordance analysis showed that AFLP fingerprinting was able to discriminate
between isolates clustered together by MPIL analysis. Similarly, MPIL fingerprinting
discriminated between isolates in one cluster by AFLP analysis. Kappa scores for the
major concordant pairs shows that fingerprints generated by MPIL and AFLP analysis are
independent. This indicates the need to use more than one fingerprinting technique to
distinguish between the M. paratuberculosis strains. Restricted allelic variation within
this mycobacterial subspecies may limit the application of any single fingerprinting
method in epidemiological studies of Johne’s disease. Alternately, the use of other
combinations of restriction enzymes (such as ApaI and TaqI) or application of a
multiplex-AFLP protocol (23) may provide a better indication of diversity.
Analysis of the isolates for presence of polymorphism in IS1311 by PCR-REA
facilitated the classification of the M. paratuberculosis isolates into bovine or ovine
strains. The gain of the HinfI restriction site due to a single nucleotide polymorphism,
which is unique to the bovine strain, is indicative of limited strain sharing between the
two hosts. One bovine isolate from an Ohio farm showed difference in density of the
restricted bands when compared to other isolates in our analysis. This is consistent with
77 the speculation (47) that M. paratuberculosis isolates may vary in the number of IS1311 insertion elements carrying the polymorphism. The well-conserved nature of the mycobacterial genome indicates that the probability of several mutations within one gene is very low. Hence, the bovine M. paratuberculosis isolate with multiple HinfI restriction sites within IS1311 is of special interest. Although, absence of the C→T polymorphism indicates that it is an ovine strain it clustered with other bovine isolates by MPIL analysis.
2.5.2. Integration loci as M. paratuberculosis-unique targets: IS900 is a 1451 bp segment that lacks inverted repeats and has features characteristic of the IS900 family such as homologous transposases and particular insertion sites (19). Detection of a portion of IS900 sequence is routinely used to detect the presence of M. paratuberculosis in field and clinical samples (38, 51). However, presence of IS900-like sequences have been demonstrated in non-M. paratuberculosis mycobacteria including M. avium (30,
39), M. cookii (14), M. marinum and M. scrofulaceum (10, 28). Because of importance of differentiating these closely related mycobacteria in clinical specimens there is a need for molecular targets based on genes other than IS900 to confirm the presence of M. paratuberculosis.
This study reports the development of a multiplex PCR to amplify two distinct integration sites of the insertion element IS900. This exploits the fact that the IS900 elements integrate into conserved loci in the M. paratuberculosis genome (19). Although geographically restricted exceptions cannot be ruled out, this large-scale analysis indicates that the integration sites of IS900 at loci L1 and L9 were unique to M. paratuberculosis and are consistently present in M. paratuberculosis from diverse locations and hosts. These two integration sequences were absent in non-M.
78 paratuberculosis mycobacteria, non-specific bacterial DNA and in 80 of 85 M. avium complex analyzed, 33 of which had low numbers (1-6) of IS900 integration sites by multiplex PCR. The 5 M. avium complex isolates which showed presence of both the
integration sites were re-classified as M. paratuberculosis on the basis of M.
paratuberculosis-like pattern for 6 distinct molecular targets: L1-L9, 251, hsp65 PCR-
REA and IS1311 PCR-REA, MPIL and AFLP (2 isolates) cluster analysis. The isolates
were confirmed to be mycobactin J dependent. This implies that these sites could serve as
valuable tools in molecular diagnostics of M. paratuberculosis and can significantly
reduce the time to diagnosis of M. paratuberculosis from 16-23 weeks to 2-10 days, in
sub-clinical infections. Routine use of the integration sites to detect M. paratuberculosis
will prevent the reporting of false positive IS900 PCR results. A recent study in our
laboratory using feces from farm animals (33) has established the feasibility of
application of this method toward the development of a sensitive assay for primary
clinical samples.
To confirm the stability of the integration loci as diagnostic targets and to
evaluate possibility of reflexing ambiguous isolates to hsp65 PCR-REA, we analyzed a subset of bacterial isolates for polymorphism in hsp65 gene. This subset included M. paratuberculosis strains obtained from a variety of host species. Although this technique proved very valuable for pure cultures, subsequent analysis of M. paratuberculosis from broth cultures showed that it is not as efficient for mixed cultures from feces or broth due to the highly conserved nature of this gene across many species. Hence, hsp65 analysis was restricted to pure cultures while locus 251 was used as an additional marker for broth cultures.
79 Recently identified unique M. paratuberculosis sequences (2) show promise of
serving as target sequences in molecular diagnosis of M. paratuberculosis. One of these
sequences, locus 251 was consistently detected with the L1-L9 integration sites in 118
out of 121 known positive isolates. Sequence analysis from bovine, ovine and human
isolates show 100% homology with the published sequence indicating possibility of
applying this locus in a multiplex PCR/hybridization format along with LI-L9 integration
sites to aid in unambiguous diagnosis of Johne’s disease. While the specificity in
amplification of the locus from M. paratuberculosis isolates in our sample was absolute,
we note that the forward primer (251R) used for the amplification of locus 251 revealed
homology (15 of 20 nts at the 3’ end) to plasmid sequences from the enteric bacteria
Salmonella on BlastN searches with the public databases (GenBank accession numbers
AF250878 and AL513383). Hence, positive results of amplification as seen on a gel must thus be interpreted with caution especially when using fecal samples and the primer pairs used in the current investigation. Post-amplification detection on a solid phase (such as a microtiter plate) through hybridization to an internal sequence is likely to improve the specificity of the results.
In conclusion, the study identified a high degree of genetic similarity within the
bovine isolates indicating that only a few very closely related clones of M. paratuberculosis may be responsible for wide spread infection in cattle, other ruminants and possibly wildlife. The study established strain sharing among isolates from a variety of hosts and geographic locations. In addition, we identified multiple M. paratuberculosis-unique diagnostic targets and protocols that may provide a facile
approach to unambiguously detect M. paratuberculosis. Future comparative genomics
80 and pathogenesis studies with the bovine and ovine M. paratuberculosis strains, and human M. paratuberculosis and M. avium complex isolates will be required to further elucidate the natural history of this organism.
2.6. ACKNOWLEDGMENT
This article has been reprinted with permission from the Journal of Clinical
Microbiology. Copyright © 2003, American Society for Microbiology. All Rights
Reserved.
The study was supported by state and federal funds appropriated to the Ohio
Agricultural Research and Development Center (OARDC) including an OARDC
Competitive Research Enhancement Seed Grant awarded to S. Sreevatsan. Research in the laboratory of V. Kapur is funded by competitive awards from the National Institutes of Health, the U. S. Department of Agriculture, and the Rapid Minnesota Agricultural
Experiment Station.
Collaborative contributions of M. Strother, A. Amonsin, B. Byrum, S.A. Naser,
J.R. Stabel, W.P. Sulaw, J.P. Bannantine and V. Kapur are gratefully acknowledged.
2.7. REFERENCES
1. Ashford D, I. B., Angulo F, and the FoodNet working group, Crohn’s diseaseC, Atlanta, GA. October 2001. Over a Half-Million Persons May Have Crohn's Disease in the United States. Infectious Diseases Society of America. San Francisco, CA.
2. Bannantine, J. P., E. Baechler, Q. Zhang, L. Li, and V. Kapur. 2002. Genome Scale Comparison of Mycobacterium avium subsp. paratuberculosis with Mycobacterium avium subsp. avium reveals potential diagnostic sequences. J.Clin.Microbiol. 40:1303-1310. 81 3. Bauerfeind, R., S. Benazzi, R. Weiss, T. Schliesser, H. Willems, and G. Baljer. 1996. Molecular characterization of Mycobacterium paratuberculosis isolates from sheep, goats, and cattle by hybridization with a DNA probe to insertion element IS900. J.Clin.Microbiol. 34:1617-1621.
4. Bricker, B. J., and S. M. Halling. 1994. Differentiation of Brucella abortus bv. 1, 2, and 4, Brucella melitensis, Brucella ovis, and Brucella suis bv. 1 by PCR. J.Clin.Microbiol. 32:2660-6.
5. Bull, T. J., J. Hermon-Taylor, I. Pavlik, F. El Zaatari, and M. Tizard. 2000. Characterization of IS900 loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex PCR typing. Microbiology. 146 (Pt 9):2185-2197.
6. Bull, T. J., J. Hermon-Taylor, I. Pavlik, F. El-Zaatari, and M. Tizard. 2000. Characterization of IS900 loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex PCR typing. Microbiology. 146:3285.
7. CAST Issue Paper: Johne's Disease in Cattle. Council on Agriculture, Science and Technology Task Force. May 2001.
8. Collins, D. M., D. M. Gabric, and G. W. de Lisle. 1990. Identification of two groups of Mycobacterium paratuberculosis strains by restriction endonuclease analysis and DNA hybridization. J.Clin.Microbiol. 28:1591-6.
9. Corti, S., and R. Stephan. 2002. Detection of Mycobacterium avium subspecies paratuberculosis specific IS900 insertion sequences in bulk-tank milk samples obtained from different regions throughout Switzerland. BMC Microbiol. 2:15.
10. Cousins, D. V., R. Whittington, I. Marsh, A. Masters, R. J. Evans, and P. Kluver. 1999. Mycobacteria distinct from Mycobacterium avium subsp. paratuberculosis isolated from the faeces of ruminants possess IS900-like sequences detectable IS900 polymerase chain reaction: implications for diagnosis. Mol.Cell.Probes. 13:431-442.
11. Cousins, D. V., S. N. Williams, A. Hope, and G. J. Eamens. 2000. DNA fingerprinting of Australian isolates of Mycobacterium avium subsp paratuberculosis using IS900 RFLP. Aust.Vet.J. 78:184-190.
12. Dombek, P. E., L. K. Johnson, S. T. Zimmerley, and M. J. Sadowsky. 2000. Use of repetitive DNA sequences and the PCR To differentiate Escherichia coli isolates from human and animal sources. Appl.Environ.Microbiol. 66:2572-7.
82 13. El Zaatari, F. A., M. S. Osato, and D. Y. Graham. 2001. Etiology of Crohn's disease: the role of Mycobacterium avium paratuberculosis. Trends Mol.Med. 7:247-252.
14. Englund, S., G. Bolske, and K. E. Johansson. 2002. An IS900-like sequence found in a Mycobacterium sp. other than Mycobacterium avium subsp. paratuberculosis. FEMS Microbiol.Lett. 209:267-71.
15. Eriks, I. S., K. T. Munck, T. E. Besser, G. H. Cantor, and V. Kapur. 1996. Rapid differentiation of Mycobacterium avium and M. paratuberculosis by PCR and restriction enzyme analysis. J.Clin.Microbiol. 34:734-737.
16. Espul, C., H. Cuello, N. Martinez, O. Centorbi, M. O'Ryan, L. Jackson, F. Campos, and D. O. Matson. 2000. Genomic and antigenic variation among rotavirus strains circulating in a large city of Argentina. J.Med.Virol 61:504-9.
17. Fang, Y., W. H. Wu, J. L. Pepper, J. L. Larsen, S. A. Marras, E. A. Nelson, W. B. Epperson, and J. Christopher-Hennings. 2002. Comparison of real-time, quantitative PCR with molecular beacons to nested PCR and culture methods for detection of Mycobacterium avium subsp. paratuberculosis in bovine fecal samples. J.Clin.Microbiol. 40:287-291.
18. Ferreira, R., L. S. Fonseca, and W. Lilenbaum. 2002. Agar gel immunodiffusion test (AGID) evaluation for detection of bovine paratuberculosis in Rio de Janeiro, Brazil. Lett.Appl.Microbiol. 35:173-5.
19. Green, E. P., M. L. Tizard, M. T. Moss, J. Thompson, D. J. Winterbourne, J. J. McFadden, and J. Hermon-Taylor. 1989. Sequence and characteristics of IS900, an insertion element identified in a human Crohn's disease isolate of Mycobacterium paratuberculosis. Nucleic Acids Res. 17:9063-9073.
20. Greig, A., K. Stevenson, D. Henderson, V. Perez, V. Hughes, I. Pavlik, M. E. Hines, I. McKendrick, and J. M. Sharp. 1999. Epidemiological study of paratuberculosis in wild rabbits in Scotland. J.Clin.Microbiol. 37:1746-1751.
21. Hermon-Taylor, J. 2001. Protagonist. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn's disease. Gut. 49:755-6.
22. Hulten, K., H. M. El Zimaity, T. J. Karttunen, A. Almashhrawi, M. R. Schwartz, D. Y. Graham, and F. A. El Zaatari. 2001. Detection of Mycobacterium avium subspecies paratuberculosis in Crohn's diseased tissues by in situ hybridization. Am.J.Gastroenterol. 96:1529-1535.
83 23. Huys, G., L. Rigouts, K. Chemlal, F. Portaels, and J. Swings. 2000. Evaluation of amplified fragment length polymorphism analysis for inter- and intraspecific differentiation of Mycobacterium bovis, M. tuberculosis, and M. ulcerans. J.Clin.Microbiol. 38:3675-3680.
24. Jones, M. E., M. B. Avison, E. Damdinsuren, A. P. MacGowan, and P. M. Bennett. 1994. Heterogeneity at the beta-lactamase structural gene ampC amongst Citrobacter spp. assessed by polymerase chain reaction analysis: potential for typing at a molecular level. J.Med.Microbiol. 41:209-14.
25. Kalis, C. H., H. W. Barkema, J. W. Hesselink, C. van Maanen, and M. T. Collins. 2002. Evaluation of two absorbed enzyme-linked immunosorbent assays and a complement fixation test as replacements for fecal culture in the detection of cows shedding Mycobacterium avium subspecies paratuberculosis. J.Vet.Diagn.Invest. 14:219-24.
26. Kapur, V., L. L. Li, M. R. Hamrick, B. B. Plikaytis, T. M. Shinnick, A. Telenti, W. R. Jacobs, Jr., A. Banerjee, S. Cole, K. Y. Yuen, and et al. 1995. Rapid Mycobacterium species assignment and unambiguous identification of mutations associated with antimicrobial resistance in Mycobacterium tuberculosis by automated DNA sequencing. Arch.Pathol.Lab.Med. 119:131-8.
27. Kelsey, J. L., W. D. Thompson, and A. S. Evans. 1986. Measurement error. p. 285-307, In, J.L. Kelsey, W.D.Thompson, and A. S. Evans (ed.), Methods in Observational Epidemiology, Oxford University Press, New York.
28. Kim, S. G., S. J. Shin, R. H. Jacobson, L. J. Miller, P. R. Harpending, S. M. Stehman, C. A. Rossiter, and D. A. Lein. 2002. Development and application of quantitative polymerase chain reaction assay based on the ABI 7700 system (TaqMan) for detection and quantification of Mycobacterium avium subsp. paratuberculosis. J.Vet.Diagn.Invest. 14:126-131.
29. Miller, J. M., A. L. Jenny, and J. B. Payeur. 2002. Polymerase chain reaction detection of Mycobacterium tuberculosis complex and Mycobacterium avium organisms in formalin-fixed tissues from culture-negative ruminants. Vet.Microbiol. 87:15-23.
30. Naser, S. A., J. Felix, H. Liping, C. Romero, N. Naser, A. Walsh, and W. Safranek. 1999. Occurrence of the IS900 gene in Mycobacterium avium complex derived from HIV patients. Mol.Cell.Probes. 13:367-72.
84 31. Naser, S. A., D. Schwartz, and I. Shafran. 2000. Isolation of Mycobacterium avium subsp. paratuberculosis from breast milk of Crohn's disease patients. Am.J.Gastroenterol. 95:1094-5.
32. Nielsen, S. S., C. Gronbaek, J. F. Agger, and H. Houe. 2002. Maximum- likelihood estimation of sensitivity and specificity of ELISAs and faecal culture for diagnosis of paratuberculosis. Prev.Vet.Med. 53:191-204.
33. Ozbek, A., F. C. Michel, M. Strother, A. S. Motiwala, B. Byrum, W. Shulaw, C. G. Thornton, and S. Sreevatsan. 2002. Evaluation of Two Recovery Methods to Unambiguously Detect Mycobaterium avium subspecies paratuberculosis by Direct Fecal PCR. Submitted.
34. Pavlik, I., L. Bejckova, M. Pavlas, Z. Rozsypalova, and S. Koskova. 1995. Characterization by restriction endonuclease analysis and DNA hybridization using IS900 of bovine, ovine, caprine and human dependent strains of Mycobacterium paratuberculosis isolated in various localities. Vet.Microbiol. 45:311-318.
35. Pavlik, I., A. Horvathova, L. Dvorska, J. Bartl, P. Svastova, M. R. du, and I. Rychlik. 1999. Standardisation of restriction fragment length polymorphism analysis for Mycobacterium avium subspecies paratuberculosis. J.Microbiol.Methods. 38:155-167.
36. Pillai, S. R., and B. M. Jayarao. 2002. Application of IS900 PCR for detection of Mycobacterium avium subsp. paratuberculosis directly from raw milk. J.Dairy Sci. 85:1052-7.
37. Quirke, P. 2001. Antagonist. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn's disease. Gut. 49:757-60.
38. Richter, E., J. Wessling, N. Lugering, W. Domschke, and S. Rusch-Gerdes. 2002. Mycobacterium avium subsp. paratuberculosis infection in a patient with HIV, Germany. Emerg.Infect.Dis. 8:729-31.
39. Roiz, M. P., E. Palenque, C. Guerrero, and M. J. Garcia. 1995. Use of restriction fragment length polymorphism as a genetic marker for typing Mycobacterium avium strains. J.Clin.Microbiol. 33:1389-1391.
40. Rzhetsky, A., S. Kumar, and M. Nei. 1995. Four-cluster analysis: a simple method to test phylogenetic hypotheses. Mol.Biol.Evol. 12:163-7.
85 41. Sreevatsan, S., J. B. Bookout, F. Ringpis, V. S. Perumaalla, T. A. Ficht, L. G. Adams, S. D. Hagius, P. H. Elzer, B. J. Bricker, G. K. Kumar, M. Rajasekhar, S. Isloor, and R. R. Barathur. 2000. A multiplex approach to molecular detection of Brucella abortus and/or Mycobacterium bovis infection in cattle. J.Clin.Microbiol. 38:2602-2610.
42. Sreevatsan, S., X. Pan, K. E. Stockbauer, N. D. Connell, B. N. Kreiswirth, T. S. Whittam, and J. M. Musser. 1997. Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination. PNAS. 94:9869-9874.
43. Stabel, J. R. 1998. Johne's disease: a hidden threat. J.Dairy Sci. 81:283-8.
44. Stabel, J. R., S. J. Wells, and B. A. Wagner. 2002. Relationships between fecal culture, ELISA, and bulk tank milk test results for Johne's disease in US dairy herds. J.Dairy Sci. 85:525-531.
45. van Embden, J. D., M. D. Cave, J. T. Crawford, J. W. Dale, K. D. Eisenach, B. Gicquel, P. Hermans, C. Martin, R. McAdam, T. M. Shinnick, and et al. 1993. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J.Clin.Microbiol. 31:406-9.
46. van Soolingen, D., J. Bauer, V. Ritacco, S. C. Leao, I. Pavlik, V. Vincent, N. Rastogi, A. Gori, T. Bodmer, C. Garzelli, and M. J. Garcia. 1998. IS1245 restriction fragment length polymorphism typing of Mycobacterium avium isolates: proposal for standardization. J.Clin.Microbiol. 36:3051-3054.
47. Whittington, R., I. Marsh, E. Choy, and D. Cousins. 1998. Polymorphisms in IS1311, an insertion sequence common to Mycobacterium avium and M. avium subsp. paratuberculosis, can be used to distinguish between and within these species. Mol.Cell.Probes. 12:349-358.
48. Whittington, R. J., A. F. Hope, D. J. Marshall, C. A. Taragel, and I. Marsh. 2000. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis: IS900 restriction fragment length polymorphism and IS1311 polymorphism analyses of isolates from animals and a human in Australia. J.Clin.Microbiol. 38:3240-3248.
49. Whittington, R. J., and E. S. Sergeant. 2001. Progress towards understanding the spread, detection and control of Mycobacterium avium subsp paratuberculosis in animal populations. Aust.Vet.J. 79:267-278.
86 50. Whittington, R. J., C. A. Taragel, S. Ottaway, I. Marsh, J. Seaman, and V. Fridriksdottir. 2001. Molecular epidemiological confirmation and circumstances of occurrence of sheep (S) strains of Mycobacterium avium subsp. paratuberculosis in cases of paratuberculosis in cattle in Australia and sheep and cattle in Iceland. Vet.Microbiol. 79:311-322.
51. Zwick, L. S., T. F. Walsh, R. Barbiers, M. T. Collins, M. J. Kinsel, and R. D. Murnane. 2002. Paratuberculosis in a mandrill (Papio sphinx). J.Vet.Diagn.Invest. 14:326-8.
87 Figure 2.1.
Distribution of MPIL and AFLP fingerprints of M. paratuberculosis isolates by US states and OH counties. The number in parenthesis indicates the number of isolates with
each specific fingerprint. Isolates analyzed by both fingerprinting techniques are
hyphenated. On the OH county map, the first number indicates the M. paratuberculosis
isolates available from those regions, a subset of which was fingerprinted. Five of the
states IA, IL, IN, PA, and FL had more than one fingerprint. a: A1, A2, A5, A10, A15-Z2
(3), A18-Z1 (3), A18-Z2 (8), A18-Z21, A18 (17), B1; b: A18-Z2, A18 (2); c: A18-Z1
(2), A18-Z2; d: A1, A12, A18-Z2, A18 (4) and e: A3, A13-Z15, A14, A18-Z10, A18 (3).
Similarly, OH counties having more than one fingerprint are represented as f (Auglaize):
A1 (2), A2 (2), A6, A18-Z1; g (Hardin): A3, A18-Z2, B3; h (Holmes): A1 (4), A2, A3,
A6-Z2, A18-Z1, A18-Z2, A18 (2), B4; i (Medina): A12, A18 (8), B1 (2), B2-Z2, B4; and
j (Columbiana): A2 (2), A6, A8, A18-Z1, A18-Z2 (3), A18-Z21, A18 (2). Isolates not
included in the map are strains from Nova Scotia, Argentina and those for which source
was not known including ATCC19851.
88
89
Figure 2.2.
Multiplex PCR of IS900 loci of M. paratuberculosis isolates selected from bovine
(lanes 1, 4, 7, 10, 13), ovine (lanes 2, 5, 8, 11, 14), and human (lanes 3, 6, 9, 12, 15) hosts. Lanes 1, 2, 3 depict the IS900 integrations amplified from the right end of the insertion. The left end integration sites were analyzed as separate sets termed as 4L1
(lanes 4-6), 4L2 (lanes 7-9), 3L3 (lanes 10-12) and 3L4 (lanes 13-15).
90 Figure 2.3.
MPIL cluster analysis using UPGMA (Unweighted Paired Group Method with
Averages). Cluster analysis of 247 isolates identified 90 electrophoretic types. Clusters at a proportion distance of less than 0.1 units were grouped together and assigned a fingerprint. Most of the bovine isolates clustered into a major group containing 154 isolates which included the caprine, murine and deer isolates indicating limited diversity.
On the other hand, the sheep isolates were more polymorphic in that they were distributed in several nodes of the tree. Similarly, human isolates were distributed without clustering into any specific nodes. Unless specified, all isolates are M. paratuberculosis.
91
92 Figure 2.4.
AFLP cluster analysis. A total of 104 isolates including type strains M. paratuberculosis
K10 and MAA 104 were fingerprinted using AFLP and analyzed using UPGMA.
Analysis separated the isolates into 25 different fingerprints, which were arbitrarily
designated as Z1, Z2 and Z4-Z26. Isolates with identical fingerprints (100% match) were assigned the same fingerprint. Unless otherwise specified, all isolates are M. paratuberculosis. Majority of the bovine isolates including the caprine and murine isolates clustered into Z1 and Z2. One of the 4 ovine isolates analyzed clustered with the
bovine isolates in Z2 while the other 2 were in close proximity to a NY bovine isolate
and the fourth ovine isolate fell on a distinct branch. One of the human isolates appeared
in closer proximity to the node containing most of the animal M. paratuberculosis
isolates (Z1-Z9) while the other one had a diverse fingerprint. This illustrates the limited variation in bovine isolates from a variety of hosts and the high degree of diversity amongst the ovine and human isolates. The M. avium complex isolates from Crohn’s disease patients and unknown hosts fell in distinct branches.
93
94
Figure 2.5.
Typical IS1311 PCR-REA patterns with undigested and HinfI digested amplicons in adjacent lanes. Shown are bovine M. paratuberculosis (lanes 1, 2), ovine M. paratuberculosis (lanes 3, 4), PCR negative control (lanes 5, 6) and a bovine isolate with several mutations resulting in multiple restriction sites (lanes 7, 8).
95
Number of isolates used in each analysis Strains and Source L1- L91 2512 hsp653 IS13114 MPIL5 AFLP6 MAPa ATCC (700535, 3 3 3 2 3 19698, 19851) Cattle 254 71 105 78 165 72 Sheep 18 11 18 10 16 4 Goat 19 19 8 10 17 7 Crohn’s patients 7 7 7 7 7 2 Deer 1 1 1 1 1 Mouse 1 1 1 1 1 1 K10 1 MACb TIGR 104 1 1 1 1 Crohn’s patients 31 15 30 24 20 10 Unknown host 53 45 53 30 17 6 M. tuberculosis (human) 25 21 5 6 M. bovis (cattle, deer) 9 3 2 2 M. bovis BCG 4 3 3 3 Atypical mycobacteria* 6 6 6 6 (ATCC) Staphylococci 10 10 4 2 Salmonella enterica 3 1 1 subspecies (cattle) E. coli (cattle) 20 20 4 4 Mannheimia hemolytica 2 2 2 2 (cattle) Uncharacterized non- mycobacteria (human and 133 89 19 animal) TotaL 600 328† 272† 190† 247† 104†
Table 2.1. Bacterial isolates used for analysis.
96 Table 2.1. - continued
1: PCR amplification and hybridization for IS900 integration loci L1 (left side integration
site of IS900 into an unknown ORF) and L9 (left side integration of IS900 into alkA), 2:
PCR amplification for locus 251,3: Restriction endonuclease analysis for polymorphisms in hsp65 gene, 4: Restriction endonuclease analysis for polymorphisms in IS1311 gene, 5:
Multiplex PCR for Integration Loci (MPIL), 6: Amplified fragment length polymorphism.
a: Mycobacterium avium subsp. paratuberculosis, b: Mycobacterium avium complex. *:
Atypical mycobacteria include M. chelonea, M. xenopi, M. celatum, M. marinum, M. scrofulaceum, M. smegmatis. †: Numbers represent a convenient subset of isolates analyzed for L1-L9 integration loci.
97 CHAPTER 3
MOLECULAR EPIDEMIOLOGY OF MYCOBACTERIUM AVIUM SUBSP.
PARATUBERCULOSIS RECOVERED FROM WILD ANIMAL SPECIES
3.1. ABSTRACT
Mycobacterial isolates were obtained from 33 different species of captive or free- ranging animals (n=106) and environmental sources (n=3) from 6 geographic zones
within the United States by radiometric culture. Strain identity was confirmed for all 109
isolates using mycobactin J dependence as well as characterization of 5 well-defined
molecular markers including two integration loci of IS900 (L1 and L9), one M.
paratuberculosis-specific sequence (locus 251), one M. avium subsp. avium specific
marker (IS1245), as well as hsp65 and IS1311 restriction endonuclease analyses.
Seventy-six acid-fast isolates were identified as M. paratuberculosis, 15 as belonging to the Mycobacterium avium-intracellulare complex (but not M. paratuberculosis), and the remaining 18 as mycobacteria outside M. avium-intracellulare complex. Fingerprinting by multiplex PCR for IS900 integration loci (MPIL) clustered 67 of the 76 M. paratuberculosis strains into a single clade (designated as A18) and had a Simpson’s diversity index (1-D) of 0.53. In contrast, sequence based characterization of a recently identified M. paratuberculosis short sequence repeat (SSR) region enabled the
98 differentiation of the A18 cluster M. paratuberculosis isolates into 7 distinct alleles (1-
D=0.75). The analysis revealed 8 subtypes from the 33 animal species suggesting interspecies transmission for specific strains. Taken together, the results of our analyses demonstrate that SSR analysis enables the genetic characterization of M. paratuberculosis isolates from different host species, and suggests host-specificity of some strains of M. paratuberculosis as well as sharing of strains between wild and domesticated animal species.
3.2. INTRODUCTION
Paratuberculosis or Johne’s disease is a chronic granulomatous gastroenteritis caused by Mycobacterium avium subspecies paratuberculosis (M. paratuberculosis) (46,
59). The disease occurs worldwide and is primarily a disease of domesticated ruminants including cattle (both beef and dairy), sheep, goats, and farmed deer. Paratuberculosis has been reported to occur in wild ruminant species including deer (10), bison (7), and elk
(13, 40) as well as non-ruminants such as wild rabbits (26), their predators including foxes and stoats (6), and primates such as mandrill and macaques (41, 60), indicating a wide host range. In addition to the economic impact on food animal production with losses estimated at US$200 to US$250 million annually (47), infection in free-ranging and captive wildlife is also of great concern. Up to one third of zoos accredited by the
American Zoo and Aquarium Association have reported at least one culture-confirmed case of paratuberculosis since 1995 (39). In addition, M. paratuberculosis is of interest because of its potential association with Crohn’s disease in humans (19, 28, 29, 51).
99 The existence and importance of wildlife reservoirs of M. paratuberculosis in the
transmission cycle is still undetermined (17) and there have been few investigations
examining the role of wildlife in the epidemiology of this important disease. There is
much to learn about the dynamics of transmission of infection within animal populations
and the involvement of specific subtypes in determining the character of infection and the velocity of their spread. A comprehensive analysis of molecular diversity within M. paratuberculosis strains from various animal species will augment our understanding of the host range, distribution and natural history of M. paratuberculosis infections and also
aid in developing a population genetic frameworks for this economically important
bacterium. DNA–based subtyping techniques such as multiplex PCR for integration loci
(MPIL), amplified fragment length polymorphism (AFLP), and IS900-based restriction
fragment length polymorphism (IS900-RFLP) have been used in an attempt to reveal the
genetic variation in M. paratuberculosis and differentiate among strains infecting
different populations (8, 15, 22, 43, 49, 56). However, these techniques have proved to
have a limited ability to discriminate among strains.
The objective of this study was to analyze the distribution and molecular diversity
in M. paratuberculosis isolated from multiple animal species (captive and free-ranging)
from different geographic zones.
3.3. MATERIALS AND METHODS
3.3.1. Bacterial isolates. Fecal and tissue samples from both captive and free-
ranging animal species throughout the United States were submitted for radiometric
mycobacterial culture (12). Samples were collected from animals suspected of infection
100 with M. paratuberculosis on the basis of exposure to confirmed infected animals or
clinical signs consistent with Johne’s disease (weight loss and/or diarrhea). Water
samples (n=3) were also obtained from enclosures housing infected animals. Acid-fast
isolates were tested for mycobactin J dependency (a characteristic of M.
paratuberculosis) and evaluated for the presence of IS900 by PCR (24). The strains in the
collection represented laboratory acquisitions from zoo specimens between 1993 and
2003 (Table 3.1.). The isolates were assigned a geographic zone on the basis of the
location of host animals at the time of sample collection. Zones 1 through 6 represent
North-West, South-West, North-Central, South-Central, North-East and South-East
regions of United States, respectively.
Freezer stocks of the mycobacterial isolates were revived in 7H9 broth (Becton,
Dickinson and Co., Sparks, MD) for molecular identification and diversity analysis by an
independent laboratory in a blinded fashion. The identity of the strains was revealed after
molecular analyses were complete. Five controls including ATCC type strain 19698, M. paratuberculosis bovine strain and 3 deliberately mixed cultures [known M. paratuberculosis + M. paratuberculosis and M. paratuberculosis + M. avium subsp. avium (n=2)] were also analyzed.
3.3.2. DNA Extraction. Approximately 10ml of turbid 7H9 broth culture was
centrifuged at 2,500 rpm (Beckman GP, Beckman Institute, Urbana, IL) for 25 minutes to
obtain a pellet. The pellet was re-suspended in 500µl of sterile de-ionized distilled water
and used for DNA extraction using QIAamp DNA Blood Mini kit (Qiagen Inc., Valencia,
CA) with a few modifications as described (43).
101 3.3.3. Molecular characterization of the isolates. DNA extracted from the
broth cultures was used to confirm subspecies by characterizing all isolates using well-
defined molecular markers previously described (43): (i) PCR amplification and
hybridization for 2 of integration loci of the insertion sequence IS900, regarded as diagnostically definitive for M. paratuberculosis - L1 (left side integration site of IS900
into an unknown ORF) and L9 (left side integration of IS900 into alkA), (ii) PCR
amplification of a recently identified M. paratuberculosis unique sequence (locus 251)
(4, 43), (iii & iv) hsp65 and IS1311 restriction endonuclease analyses (REA) for
polymorphisms in hsp65 and IS1311 genes as described (43). An additional PCR
amplification of a DNA sequence differing between sheep and cattle types of M. paratuberculosis was carried out as described (11).
An M. avium subsp. avium specific marker (IS1245) was used to distinguish
between M. paratuberculosis and M. avium subsp. avium (27, 33). Primers were designed
to amplify a 300bp region of IS1245 in M. avium subsp. avium that is similar to but not
homologous with a closely related insertion sequence (IS1311) found in M.
paratuberculosis (GI: 7555405, 4210754). The DNA samples were amplified using
primers 5’-/5Bio/GGT CGC GTG TCC GCG TGT GG-3’ and 5’–ACT TCC CGG TGG
CCC ACT GGA–3’. Primers were used at a final concentration of 0.2 µM in a 50µl PCR
reaction master mix also including 1.25 U Hotstar Taq polymerase (Qiagen Inc.,
Valencia, CA), 1X PCR buffer, 2.5 mM MgCl2, 200 µM deoxyribonucleotide triphosphates (Amersham Pharmacia Biotech Inc., Piscataway, NJ), 5% DMSO and 5µl
(approx. 50ng/µl) of genomic DNA. The thermal cycler parameters used for amplification included an initial 95ºC incubation step for 15 minutes to activate the
102 Hotstar Taq polymerase followed by 35 cycles of denaturation at 94ºC for 15 seconds,
annealing at 58ºC for 20 seconds and extension at 72ºC for 20 seconds with a final
extension step at 72ºC for 7 minutes. A microtiter plate based reverse phase hybridization
was carried out using the probe 5’-CTC GCT CTG CTC GAC GTC AGT GAC CAA
AGT GCC GAA AC-3’ as previously described (43, 53). A negative control consisting of
PCR master mix alone lacking genomic DNA was included in all PCR amplifications and
hybridizations. The cut-off optical density was set at 0.2 on the basis of analysis of
several known negatives and M. avium subsp. avium positive controls.
IS900 PCR was performed as described (42). The PCR products were electrophoresed at 100V for 2 hours in a 1.5% agarose gel pre-stained with ethidium bromide and visualized on a UV transilluminator (Alpha Innotech Corporation, San
Leandro, CA).
3.3.4. MPIL fingerprint analysis. Genotyping using MPIL was performed for all isolates using a previously established method (8, 9, 43). Briefly, a total of 28 DNA fragments representing the right and left integration site of IS900 were amplified in 6 sets of multiplex PCRs referred as 9R1, 5R2, 4L1, 4L2, 3L3 and 3L4 as described (43). The
PCR products were electrophoresed at 100V for 4 hours in a 2% agarose gel pre-stained with ethidium bromide and visualized on a UV transilluminator (Alpha Innotech
Corporation, San Leandro, CA). Cluster analysis was done using Molecular Evolutionary
Genetics Analysis (MEGA, version 2.1, www.megasoftware.net) by the Unweighted Pair
Group Method with Arithmetic averages (UPGMA) (36). The distance matrix for input into the MEGA program was created from the binary data using ETDIV and ETMEGA
(http://foodsafe.msu.edu/whittam/programs/).
103 3.3.5. Short sequence repeat analysis. Results of a recently described multi- locus short sequence repeat (MLSSR) analysis (3) for M. paratuberculosis strain differentiation indicated that mononucleotide G-repeat locus within the phosphatidylethanolamine-binding domain (GI: 13881618) was the most discriminatory
(Simpson’s diversity index - 0.7) and was selected for fingerprinting in this study.
Amplification of this short sequence repeat (SSR) locus was carried out using primers 5’-
TCA GAC TGT GCG GTA TGG AA –3’ and 5’ – GTG TTC GGC AAA GTC GTT GT
–3’. Amplification parameters were as described above for IS1245 analysis. A PCR master mix blank was included as negative control for each batch. 5µl of PCR product was electrophoresed at 125V for 45 minutes in 1.5% agarose gels pre-stained with ethidium bromide and visualized on a UV transilluminator (Alpha Innotech Corporation,
San Leandro, CA). PCR products were purified using QIAquick PCR purification kit
(Qiagen Inc., Valencia, CA) and sequenced using standard dye terminator chemistry and analyzed on an automated DNA sequencer (Applied Biosystems 3700 DNA Analyzer).
All chromatograms were visually inspected and sequences were edited with EditSeq
(DNASTAR, Madison, WI) to correct ambiguities and then aligned using MegAlign
(DNASTAR, Madison, WI).
A consensus phylogenetic tree was generated in MEGA 2.1 (36) using a maximum parsimony model with 1000 bootstraps replications. Numbers were assigned to each clade to reflect number of G residues in the polymorphic region. Simpson’s and
Shannon-Wiener’s diversity indices were calculated using equation 1-Σ (allele
2 2 frequency) and -1 x Σ (allele frequency x loge allele frequency) respectively (45).
104 3.4. RESULTS
3.4.1. Molecular characterization of the isolates derived from wildlife species. The results of the molecular target analyses are summarized in Table 3.1. An isolate was characterized as M. paratuberculosis if the profile was L1-L9 positive, 251 positive, IS1245 negative and no hsp65 polymorphism as detected by restriction analysis
(43). An isolate was characterized as belonging to the M. avium-intracellulare complex if the profile was L1-L9 negative, 251 negative, IS1245 positive and carried the polymorphism in hsp65 resulting in a truncated band upon restriction digestion with PstI.
All other acid-fast isolates that failed to amplify any of the targets were classified as mycobacteria outside the M. avium-intracellulare complex. On the basis of these classification criteria, 76 isolates were identified as M. paratuberculosis, 15 as belonging to the M. avium-intracellulare complex and 18 as mycobacteria outside M. avium- intracellulare complex. All M. paratuberculosis isolates were further classified using
IS1311 restriction patterns consistently identified in either cattle (2 restriction sites) or sheep strains (1 restriction site) (43, 57). Of the 76 isolates classified as M. paratuberculosis, 12 isolates from 9 different species (Table 3.1.) had the IS1311 restriction profile reported for sheep strains. The 12 M. paratuberculosis isolates with
IS1311 profiles typical for sheep strains were further analyzed using a recently described molecular marker to distinguish sheep and cattle isolates (11). This identified the genotype reported for cattle strains in 10 isolates derived from several host species. Of the other 2 sheep isolates, one had a cattle-strain genotype indicating that it was a variant.
Non – M. paratuberculosis M. avium-intracellulare complex isolates (n=12) and those outside the M. avium-intracellulare complex (n=2) also had the IS1311 profile typical of
105 sheep strains. Three M. avium-intracellulare complex and 16 mycobaterial isolates
outside M. avium-intracellulare complex failed to amplify the IS1311 region targeted.
All the blinded controls including deliberately mixed cultures were identified accurately by these molecular analyses.
All isolates classified as M. paratuberculosis by molecular analysis were positive by IS900 PCR. Additionally, 4 isolates classified as belonging to the M. avium- intracellulare complex and 2 as mycobacteria outside M. avium-intracellulare complex were positive by IS900 PCR.
Seven of the isolates classified as M. paratuberculosis by independent molecular methods as well as by IS900 PCR were apparently not mycobactin J dependent. Two isolates (1 Non M. paratuberculosis M. avium-intracellulare complex and 1 non - M. avium-intracellulare complex) were positive for locus 251 PCR. Sequence analysis of locus 251 amplicon from the M. avium-intracellulare complex isolate showed 100%
homology to the published sequence (GI:20152939).
Fifteen of the M. paratuberculosis isolates were also positive for the M. avium subsp. avium specific marker - IS1245. Since attempts were not made to isolate single colonies, it is possible that the M. paratuberculosis repository stocks contained a low level of a non - M. paratuberculosis strain whose genetic material was masked for molecular typing purposes by the M. paratuberculosis isolate in the aliquot.
3.4.2. MPIL fingerprint analysis. All isolates (n=109) and 2 M. paratuberculosis controls (ATCC 19698 and field isolate from a cow) were fingerprinted by MPIL. Cluster analysis organized the fingerprints into 30 electrophoretic types.
Electrophoretic types that were separated by distances less than 0.1 units were assigned
106 identical MPIL fingerprints (Figure 3.1.). The fingerprint nomenclature was based on a
previously defined set of M. paratuberculosis MPIL-fingerprints in our collection (43).
Both data sets were merged for cluster analysis and fingerprint assignment. The analysis divided the isolates into two major branches. Ninety-four percent (73 of 76) of the M. paratuberculosis isolates from several species clustered in branch A and could be further divided into A18 (n=69), A18 variant (n=1), A1 (n=1) and unique A (n=2) fingerprints.
Branch A exclusively clustered only M. paratuberculosis isolates. All (non-M. paratuberculosis) M. avium-intracellulare complex isolates (n=15) clustered into branch
B with fingerprints designated B11 (n=14) and unique (n=1). Mycobacterial isolates
outside M. avium-intracellulare complex (n=18) did not amplify any target and were
clustered into branch B with fingerprint designated B11. Five M. paratuberculosis strains
derived from bison, springbok (n=2), and sika (n=2) also clustered in branch B with
fingerprints designated B4 (n=2) and unique B (n=3). The Simpson’s and Shannon-
Wiener’s diversity index values for the MPIL fingerprint analysis were 0.533 and 1.067,
respectively, indicating limited discriminatory capacity.
3.4.3. Short sequence repeat analysis. All isolates were amplified for a region
within the M. paratuberculosis genome that carries a variable number of G-residues.
Only isolates (n=91) with a detectable 408bp amplification product were sequenced for
further analysis. These included M. paratuberculosis (n=72), non - M. paratuberculosis
M. avium-intracellulare complex organisms (n=12), organisms outside M. avium-
intracellulare complex (n=5) and control M. paratuberculosis strains (ATCC 19698 and
field isolate from a cow). Of the 72 M. paratuberculosis strains analyzed, 66 had the A18
MPIL fingerprint while 2 carried unique fingerprints. The remaining 4 carried the A1, B4
107 and B11 (n=2) fingerprints. Both of the control M. paratuberculosis isolates displayed
the A18 fingerprint. Two reference strains [M. paratuberculosis K10 and a bovine M.
paratuberculosis (3)] were also included in the cluster analysis. Each allele was assigned
a number congruent with the number of G-residue repeats. A total of 8 alleles with 7 to
20 G-repeats were identified among 76 M. paratuberculosis isolates (including control
and reference strains). Thirty-eight percent of the M. paratuberculosis isolates (n=28) had
the 7Gs fingerprint. This fingerprint clustered all the bison (n=7), impala (n=3), nyala
(n=2), Thomson gazelle (n=2), and goat (n=2) M. paratuberculosis strains included in
this analysis. This allele also clustered 8 of the 13 M. paratuberculosis isolates obtained from elks. Allele 7Gs also included 1 M. paratuberculosis isolate from each of the following: addax, axis deer, oryx, sitatunga and 1 mycobacterial isolate outside the M. avium intracellulare complex from an unknown source. Allele designated 9Gs clustered
all the bay duiker (n=3), Trascaspian urial (n=6) and 3 of the 4 waterbuck M.
paratuberculosis isolates. It also included 1 M. paratuberculosis isolate from each of the
following: springbok, munjtac, gemsbok, sambar, sika, markhor and gnu. Allele 10Gs
contained M. paratuberculosis isolates from the bovine control, springbok, key deer and
white tailed deer. Allele 11Gs contained the M. paratuberculosis type strain ATCC
19698 and another key deer isolate. Allele 13Gs clustered M. paratuberculosis strains
isolated from elk (n=4) and British red deer (n=1). Alleles 15Gs contained an elk and a
sheep M. paratuberculosis isolate. Isolates with more than 15 G-repeats were clustered
into an allele designated ‘>15 Gs’. This allele included the reference strains M.
paratuberculosis K10 with 20Gs and a bovine M. paratuberculosis with 17Gs. An allele
‘2GsC4Gs’ in which the third G within the repeat was substituted by a C was also
108 identified. All non–M. paratuberculosis M. avium-intracellulare complex isolates
(n=12), 4 out of 5 non-M. avium-intracellulare complex isolates and some M.
paratuberculosis strains (n=13) carried this fingerprint. Species included in this allele are
listed in Table 3.1. The phylogenetic analysis thus divided the M. paratuberculosis
isolates (n=66) with A18 fingerprint into 7 distinct alleles. The Simpson’s and Shannon-
Wiener’s diversity index values for the G-repeat analysis were 0.751 and 1.593,
respectively, indicating a relatively robust discriminatory capability.
3.5. DISCUSSION
Paratuberculosis has been well documented in a majority of domestic ruminant
species. It has gained importance in the animal production industry because of economic
losses incurred from herd infections and possible human health hazards associated with
M. paratuberculosis (1, 29, 51). M. paratuberculosis has also been recovered from many
captive and free-ranging non-domestic animal species representing virtually all pseudo-
ruminants and ruminants except giraffids (37, 38). The known host range of M.
paratuberculosis has recently been extended to include non-ruminant wildlife species
such as primates (41, 60), wild rabbits (25), foxes and stoats (6). These reports support
the contention that M. paratuberculosis has a wide host range and that disease caused by this organism may have a more complex epidemiology than has previously been known.
One of the strategies for control and eradication of paratuberculosis in an infected
herd is to eliminate transmission of M. paratuberculosis to susceptible animals. The
presence of a wildlife reservoir with potential to transmit the infection to domestic
animals may affect the success of domestic agriculture control programs. Although the
109 transmission frequency from wildlife to domestic animals has not been documented, there
are several reports suggestive of spread of infection from domestic animals to wildlife
(13, 25). Knowledge of the extent of strain sharing across different host species is vital to
understanding the dynamics of M. paratuberculosis transmission. Methods for differentiation or sub-typing of bacterial strains provide important information for molecular epidemiological analysis and understanding of population genetics of the organism. The present study is the first report of a comprehensive molecular analysis to establish the degree of similarity or heterogeneity in M. paratuberculosis isolates from taxonomically and spatially diverse host species.
3.5.1. Definitive identification of M. paratuberculosis requires confirmation with multiple molecular markers. Current M. paratuberculosis diagnostic methods include isolation of the organism from fecal and tissue specimens, antibody detection via enzyme-linked immunosorbent assay (ELISA) and IS900-based PCR (55). The currently used culturing protocol relies on mycobactin J dependency as a confirmatory test. Our analysis identified 7 M. paratuberculosis isolates (9%) that were not dependent on
mycobactin J for growth. Mycobactin J dependency was determined by 2 serial sub-
cultures on slants with and without mycobactin J supplementation for each of the 7 M.
paratuberculosis isolates. Although attempts were not made to isolate single colonies, all
sub-cultures were carried out with inoculum from slants without mycobactin J to rule out
potential mycobactin J carry-over. This discrepancy indicates that diagnostic tests using
mycobactin J dependency alone need to be interpreted with caution.
IS900-based PCR identification techniques have been routinely used for the detection of presence of M. paratuberculosis (5, 30, 58). However, IS900-like elements
110 have been found in M. avium subsp. avium isolates (44) and in some isolates outside M. avium-intracellulare complex (14, 20, 34). In the present study, 4 isolates classified as within the M. avium-intracellulare complex but not M. paratuberculosis and 2 isolates classified as outside the M. avium-intracellulare complex by extensive molecular analyses were identified as M. paratuberculosis by IS900 PCR. Only one of these isolates was apparently mycobactin J dependent. This implies that diagnosis of M. paratuberculosis based on detection of IS900 alone needs to be evaluated with caution to avoid false positives.
Although our previous analysis indicated that locus 251 was unique to M. paratuberculosis (43), an M. avium-intracellulare complex isolate amplified a PCR product of the expected size and sequence analysis revealed 100% homology to the published sequence of locus 251 (GI:20152939). These discrepancies clearly illustrate the need for multiple molecular markers for confirmatory diagnosis of M. paratuberculosis.
Molecular characterization of acid-fast mycobacterial isolates using 3 specific markers and 2 polymorphic sites aided in the accurate classification of the isolates. In addition, strains that lacked mycobactin J dependency or were positive by IS900 PCR or locus 251
PCR could be correctly identified on the basis of the presence or absence of multiple molecular targets.
3.5.2. Molecular diversity analysis of M. paratuberculosis. Several attempts have been made to identify genetic variation and host specificity in M. paratuberculosis strains isolated from different species. Until recently, IS900 has been the marker of choice for most fingerprinting studies reported (5, 15, 50, 57). While the IS900-based
RFLP analyses are fairly good at discriminating between cattle and sheep M.
111 paratuberculosis strains, M. paratuberculosis strains from cattle and other hosts such as goats and rabbits are indistinguishable with this method (5, 25, 49). A recent study in our laboratory (43) using alternate fingerprinting techniques-MPIL and AFLP demonstrated clustering of 73% and 56% (respectively) of the M. paratuberculosis isolates from several hosts (cattle, sheep, goat, mouse, deer and human). These results were consistent with the hypothesis that there is a relatively small amount of genetic heterogeneity between M. paratuberculosis isolates obtained from different host species.
Many measures of diversity have been proposed, but those that are most
commonly used are the Simpson and the Shannon-Wiener indices. Simpson's diversity
index represents the probability that two individuals randomly selected from a sample
will belong to different species and accounts for both richness (diversity) and the
proportion (percent) of each species. The Simpson's diversity indices for RFLP (n=1008)
(50), MPIL (n=247) (43) and AFLP (n=104) (43) are 0.559, 0.597 and 0.711 respectively.
Higher diversity index indicates that AFLP offers a better discriminatory ability.
However, the clustering by AFLP was random with respect to host species and geographic location and hence was not informative (43). In addition, AFLP is technically demanding and band profiles can not be interpreted in terms of loci and alleles.
3.5.3. Restricted Diversity amongst M. paratuberculosis isolates is also
revealed by MPIL analysis. In the present study, MPIL fingerprinting analysis
separated the M. paratuberculosis and M. avium-intracellulare complex strains into 2
major clusters (Figure 3.1.). Within the M. paratuberculosis cluster, the fingerprint A18
predominated with 88% of the M. paratuberculosis isolates. The other M.
paratuberculosis strains exhibited fingerprints designated A1 (n=1), A18 variant (n=1),
112 B4 (n=2) and unique (n=5). The MPIL cluster analysis had a Simpson’s diversity index of 0.533 and a Shannon-Wiener’s diversity index of 1.067 indicating a limited degree of strain discrimination capability.
A previous study has shown that 9 of the MPIL types correspond to a distinct
PstI/BstEII RFLP type (8). This supports the idea that both MPIL and RFLP address the
same genetic variation and suggests that MPIL typing may substitute for RFLP typing.
Hence, we predict that RFLP analysis of these isolates would result in similarly
indistinguishable fingerprints. MPIL analysis suggests that only a few strains of M.
paratuberculosis may be responsible for the widespread dissemination of infection across
a variety of species. Conversely, the currently available methods lack sufficient
sensitivity for the strain differentiation of M. paratuberculosis. We thus evaluated the
possibility of resolving the A18 fingerprint using an alternate fingerprinting technique.
3.5.4. SSR sequencing enables high-resolution subtyping of M. paratuberculosis isolates from domestic and wild animal species. Restricted allelic variation in mycobacteria is well established (54) and given the small genome size (4.83
Mbp) the expected frequency of polymorphism in M. paratuberculosis is low (18).
However, there may be specific regions within the genome that have a higher rate of polymorphisms. If present, these regions could be used for genotyping the organisms.
Recent studies (16, 52) on Bacillus anthracis, a similarly monomorphic organism, demonstrated the usefulness of single nucleotide polymorphisms, variable number of tandem repeats (VNTRs) and inserted or deleted sequences in discriminating strains within the species. VNTRs or short sequence repeats (SSRs) are generated through natural events such as recombination and strand slipped strand mispairing during
113 replication (31). These have been successfully used as markers to understand the
clonality and distribution of subtypes in several bacterial species such as Mycobacterium
tuberculosis (23), Yersinia pestis (2) and Bacillus anthracis (32, 35).
Recent accomplishment of the whole genome sequence of M. paratuberculosis strain K10 (Li et al., in preparation) allowed the identification of several SSRs in the genome. Eleven of these highly polymorphic SSRs were used in a composite multi-locus short sequence repeat (MLSSR) analysis (3) for M. paratuberculosis strain differentiation. Results indicated that a mononucleotide G-repeat locus within the phosphatidylethanolamine-binding domain (GI: 13881618) was the most discriminatory
(Simpson’s diversity index - 0.7) and was selected for fingerprinting in this study.
The G repeat fingerprinting analysis reported in this manuscript had a Simpson's
diversity index of 0.751 indicative of a comparatively higher degree of strain
discrimination capability. The Shannon-Wiener’s diversity index was 1.593.
Phylogenetic analysis of G-repeat sequences divided the M. paratuberculosis isolates
from the A18 cluster (n=66) into 7 different alleles (Figure 3.2.).
3.5.5. SSR analysis provides strong evidence for interspecies strain
transmission and host-specificity amongst isolates of M. paratuberculosis.
Interestingly, there appeared to be a relation between allele type and host species. For
example, all the bison (n=7), impala (n=3), nyala (n=2), Thomson gazelle (n=2), and goat
(n=2) M. paratuberculosis isolates included in this analysis clustered into allele 7Gs.
Similarly, the allele designated 9Gs clustered all the bay duiker (n=3), Transcaspian urial
(n=6) and 3 of the 4 waterbuck M. paratuberculosis isolates. The elk isolates were
divided between 2 alleles: 7Gs (n=8) and 13Gs (n=4). One of the elk isolates carried the
114 15Gs allele. This finding is significant since all previous analyses using a variety of
fingerprinting techniques have failed to find any association between the fingerprint type
and host species (43, 48, 50). Concordance analysis of the G-repeat alleles from each
geographic zone showed no co-relation between fingerprint types and geographic zones.
Although many of the M. paratuberculosis isolates from the same host species were from
the same geographic zone, kappa analysis for the concordant pairs clearly indicated that
the association between allele type and host species was not due to origin from similar
geographic region. This is not surprising, since many of the captive animals may have
been born in different geographic zones from the ones in which the samples were
collected. That is, they likely acquired the M. paratuberculosis infection in the first six
months of life, but had been transferred to another facility in a different zone as an adult.
Animal movement among institutions is common in the zoo industry. The presence of
multiple strains within a single facility suggests that more than one source of the
organism (and presumably, the hosts) contributed to the infection in the animal
collection. While the presence of multiple strains within a facility suggested that the
isolates may have originated from diverse locations, the consistency of identical
genotypes within host species suggests that transmission may have occurred within
facilities because animals are housed as single species exhibits or herds.
All M. paratuberculosis (n=30) isolates from geographic zone 2 were acquired by our laboratory at the same time from the same animal facility during an apparent Johne’s disease outbreak. Fingerprinting by MPIL analysis showed presence of at least 5 distinct fingerprints – A18, B11 and unique (n=3). Similarly, SSR analysis identified presence of multiple strains – 9Gs, 10Gs, 13Gs and 2GsC4Gs. This clearly indicated involvement of
115 more than one M. paratuberculosis strain in the outbreak. This suggests acquisition of
infection from different sources. Alternately, multiple genotypes could indicate
occurrence of strains with restricted host range.
G-repeat analysis clustered the non-M. paratuberculosis M. avium-intracellulare
complex isolates (n=12) and those outside M. avium-intracellulare complex (n=4) into
one common allele - 2GsC4Gs. This allele also contained 14 M. paratuberculosis isolates
from several species. We noted that all 11 M. paratuberculosis isolates (Table 1) had
sheep-like IS1311 restriction profiles – suggesting that strains with the sheep genotypes
are likely to be ancestral to those that are of the bovine genotype. The 3 M.
paratuberculosis isolates obtained from environmental sources (n=2) and a blesbok that
clustered into this fingerprint had IS1311 restriction profiles consistent with the cattle
strains. An M. paratuberculosis isolate from a sheep with an A18 variant fingerprint was the only isolate that did not carry the 2GsC4Gs fingerprint. This indicates that these M. paratuberculosis isolates were phylogenetically closer to the M. avium complex strains than the cattle genotypes. Together the analyses suggest that the sheep strains may have emerged before the bovine host specialists.
3.5.6. Concluding comments. Our analyses document a relationship between fingerprint types and host species. The results also provide strong evidence that SSR analysis using G-repetitive sequences can be used to study strain sharing and interspecies spread. The approach can also be applied to investigate the role of multiple or single dominant strains in transmission dynamics of M. paratuberculosis infections within and between domestic ruminants and wildlife reservoirs. Similar analysis could potentially be used to illustrate presence or lack of association of the human and animal strains. This
116 will allow us to bridge the gap in our understanding of the epidemiology and evolution of
M. paratuberculosis subsequently leading to more targeted and robust control strategies.
3.6. ACKNOWLEDGMENT
This article has been reprinted with permission from the Journal of Clinical
Microbiology. Copyright © 2004, American Society for Microbiology. All Rights
Reserved.
The study was supported by state and federal funds appropriated to the Ohio
Agricultural Research and Development Center (OARDC) including an OARDC
Competitive Research Enhancement Seed Grant awarded to S. Sreevatsan. Research in the laboratory of Vivek Kapur is supported by competitive grants from the National
Institutes of Health, National Science Foundation, and U. S. Department of Agriculture’s
ARS, CSREES, and VS programs.
Collaborative contributions of A. Amonsin, M. Strother, E.J.B. Manning and V.
Kapur are gratefully acknowledged.
3.7. REFERENCES
1. Anonymous. CAST Issue Paper: Johne's Disease in Cattle. Council on Agriculture, Science and Technology Task Force. May 2001.
2. Adair, D. M., P. L. Worsham, K. K. Hill, A. M. Klevytska, P. J. Jackson, A. M. Friedlander, and P. Keim. 2000. Diversity in a variable-number tandem repeat from Yersinia pestis. J.Clin.Microbiol. 38:1516-9.
3. Amonsin, A., L. L. Li, Q. Zhang, J. P. Bannantine, A. S. Motiwala, S. Sreevatsan, and V. Kapur. A Multi-Locus Short Sequence Repeat Sequencing Approach for Mycobacterium avium subspecies paratuberculosis Strain Differentiation. Submitted to J.Clin.Microbiol. 117 4. Bannantine, J. P., E. Baechler, Q. Zhang, L. Li, and V. Kapur. 2002. Genome Scale Comparison of Mycobacterium avium subsp. paratuberculosis with Mycobacterium avium subsp. avium Reveals Potential Diagnostic Sequences. J.Clin.Microbiol. 40:1303-1310.
5. Bauerfeind, R., S. Benazzi, R. Weiss, T. Schliesser, H. Willems, and G. Baljer. 1996. Molecular characterization of Mycobacterium paratuberculosis isolates from sheep, goats, and cattle by hybridization with a DNA probe to insertion element IS900. J.Clin.Microbiol. 34:1617-1621.
6. Beard, P. M., M. J. Daniels, D. Henderson, A. Pirie, K. Rudge, D. Buxton, S. Rhind, A. Greig, M. R. Hutchings, I. McKendrick, K. Stevenson, and J. M. Sharp. 2001. Paratuberculosis infection of nonruminant wildlife in scotland. J.Clin.Microbiol. 39:1517-1521.
7. Buergelt, C. D., and P. E. Ginn. 2000. The histopathologic diagnosis of subclinical Johne's disease in North American bison (Bison bison). Vet.Microbiol. 77:325-31.
8. Bull, T. J., J. Hermon-Taylor, I. Pavlik, F. El Zaatari, and M. Tizard. 2000. Characterization of IS900 loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex PCR typing. Microbiology 146 ( Pt 9):2185-2197.
9. Bull, T. J., J. Hermon-Taylor, I. I. Pavlik, F. El-Zaatari, and M. Tizard. 2000. Characterization of IS900 loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex PCR typing. Microbiology 146 (Pt 12):3285.
10. Chiodini, R. J., and H. J. Van Kruiningen. 1983. Eastern white-tailed deer as a reservoir of ruminant paratuberculosis. J.Am.Vet.Med.Assoc. 182:168-9.
11. Collins, D. M., M. De Zoete, and S. M. Cavaignac. 2002. Mycobacterium avium subsp. paratuberculosis strains from cattle and sheep can be distinguished by a PCR test based on a novel DNA sequence difference. J.Clin.Microbiol. 40:4760- 2.
12. Collins, M. T., K. B. Kenefick, D. C. Sockett, R. S. Lambrecht, J. McDonald, and J. B. Jorgensen. 1990. Enhanced radiometric detection of Mycobacterium paratuberculosis by using filter-concentrated bovine fecal specimens. J.Clin.Microbiol. 28:2514-9.
118 13. Cook, W. E., T. E. Cornish, S. Shideler, B. Lasley, and M. T. Collins. 1997. Radiometric culture of Mycobacterium avium paratuberculosis from the feces of tule elk. J.Wildl.Dis. 33:635-7.
14. Cousins, D. V., R. Whittington, I. Marsh, A. Masters, R. J. Evans, and P. Kluver. 1999. Mycobacteria distinct from Mycobacterium avium subsp. paratuberculosis isolated from the faeces of ruminants possess IS900-like sequences detectable IS900 polymerase chain reaction: implications for diagnosis. Mol.Cell.Probes 13:431-442.
15. Cousins, D. V., S. N. Williams, A. Hope, and G. J. Eamens. 2000. DNA fingerprinting of Australian isolates of Mycobacterium avium subsp paratuberculosis using IS900 RFLP. Aust.Vet.J. 78:184-190.
16. Cummings, C. A., and D. A. Relman. 2002. Genomics and microbiology. Microbial forensics--"cross-examining pathogens". Science 296:1976-9.
17. Daniels, M. J., M. R. Hutchings, P. M. Beard, D. Henderson, A. Greig, K. Stevenson, and J. M. Sharp. 2003. Do non-ruminant wildlife pose a risk of paratuberculosis to domestic livestock and vice versa in Scotland? J.Wildl.Dis. 39:10-5.
18. Drake, J. W. 1991. A constant rate of spontaneous mutation in DNA-based microbes. Proc.Natl.Acad.Sci. USA 88:7160-4.
19. El Zaatari, F. A., M. S. Osato, and D. Y. Graham. 2001. Etiology of Crohn's disease: the role of Mycobacterium avium paratuberculosis. Trends Mol.Med. 7:247-252.
20. Englund, S., A. Ballagi-Pordany, G. Bolske, and K. E. Johansson. 1999. Single PCR and nested PCR with a mimic molecule for detection of Mycobacterium avium subsp. paratuberculosis. Diagn.Microbiol.Infect.Dis. 33:163-171.
21. Eriks, I. S., K. T. Munck, T. E. Besser, G. H. Cantor, and V. Kapur. 1996. Rapid differentiation of Mycobacterium avium and M. paratuberculosis by PCR and restriction enzyme analysis. J.Clin.Microbiol. 34:734-737.
22. Francois, B., R. Krishnamoorthy, and J. Elion. 1997. Comparative study of Mycobacterium paratuberculosis strains isolated from Crohn's disease and Johne's disease using restriction fragment length polymorphism and arbitrarily primed polymerase chain reaction. Epidemiol.Infect. 118:227-33.
119 23. Gascoyne-Binzi, D. M., R. E. Barlow, R. Frothingham, G. Robinson, T. A. Collyns, R. Gelletlie, and P. M. Hawkey. 2001. Rapid identification of laboratory contamination with Mycobacterium tuberculosis using variable number tandem repeat analysis. J.Clin.Microbiol. 39:69-74.
24. Green, E. P., M. L. Tizard, M. T. Moss, J. Thompson, D. J. Winterbourne, J. J. McFadden, and J. Hermon-Taylor. 1989. Sequence and characteristics of IS900, an insertion element identified in a human Crohn's disease isolate of Mycobacterium paratuberculosis. Nucleic Acids Res. 17:9063-9073.
25. Greig, A., K. Stevenson, D. Henderson, V. Perez, V. Hughes, I. Pavlik, M. E. Hines, I. McKendrick, and J. M. Sharp. 1999. Epidemiological study of paratuberculosis in wild rabbits in Scotland. J.Clin.Microbiol. 37:1746-1751.
26. Greig, A., K. Stevenson, V. Perez, A. A. Pirie, J. M. Grant, and J. M. Sharp. 1997. Paratuberculosis in wild rabbits (Oryctolagus cuniculus). Vet.Rec. 140:141- 3.
27. Guerrero, C., C. Bernasconi, D. Burki, T. Bodmer, and A. Telenti. 1995. A novel insertion element from Mycobacterium avium, IS1245, is a specific target for analysis of strain relatedness. J.Clin.Microbiol. 33:304-307.
28. Harris, J. E., and A. M. Lammerding. 2001. Crohn's disease and Mycobacterium avium subsp. paratuberculosis: current issues. J.Food Prot. 64:2103-10.
29. Hermon-Taylor, J. 2001. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn's disease. Gut 49:755-757.
30. Hulten, K., T. J. Karttunen, H. M. El Zimaity, S. A. Naser, M. T. Collins, D. Y. Graham, and F. A. El Zaatari. 2000. Identification of cell wall deficient forms of M. avium subsp. paratuberculosis in paraffin embedded tissues from animals with Johne's disease by in situ hybridization. J.Microbiol.Methods 42:185-195.
31. Jackson, P. J., E. A. Walthers, A. S. Kalif, K. L. Richmond, D. M. Adair, K. K. Hill, C. R. Kuske, G. L. Andersen, K. H. Wilson, M. Hugh-Jones, and P. Keim. 1997. Characterization of the variable-number tandem repeats in vrrA from different Bacillus anthracis isolates. Appl.Environ.Microbiol. 63:1400-5.
32. Keim, P., L. B. Price, A. M. Klevytska, K. L. Smith, J. M. Schupp, R. Okinaka, P. J. Jackson, and M. E. Hugh-Jones. 2000. Multiple-locus variable-
120 number tandem repeat analysis reveals genetic relationships within Bacillus anthracis. J.Bacteriol. 182:2928-36.
33. Keller, A. P., M. L. Beggs, B. Amthor, F. Bruns, P. Meissner, and W. H. Haas. 2002. Evidence of the presence of IS1245 and IS1311 or closely related insertion elements in nontuberculous mycobacteria outside of the Mycobacterium avium complex. J.Clin.Microbiol. 40:1869-1872.
34. Kim, S. G., S. J. Shin, R. H. Jacobson, L. J. Miller, P. R. Harpending, S. M. Stehman, C. A. Rossiter, and D. A. Lein. 2002. Development and application of quantitative polymerase chain reaction assay based on the ABI 7700 system (TaqMan) for detection and quantification of Mycobacterium avium subsp. paratuberculosis. J.Vet.Diagn.Invest. 14:126-131.
35. Kim, W., Y. P. Hong, J. H. Yoo, W. B. Lee, C. S. Choi, and S. I. Chung. 2002. Genetic relationships of Bacillus anthracis and closely related species based on variable-number tandem repeat analysis and BOX-PCR genomic fingerprinting. FEMS Microbiol.Lett. 207:21-7.
36. Kumar, S., K. Tamura, I. B. Jakobsen, and M. Nei. 2001. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17:1244-5.
37. Manning, E. J. 2001. Mycobacterium avium subspecies paratuberculosis: a review of current knowledge. J.Zoo Wildl.Med. 32:293-304.
38. Manning, E. J., and M. T. Collins. 2001. Mycobacterium avium subsp. paratuberculosis: pathogen, pathogenesis and diagnosis. Rev.Sci.Tech. 20:133- 50.
39. Manning, E. J., and M. Ziccardi. 2000. Johne's disease and captive non- domestic hoofstock: prevalence and prevention. In Proc. American Association of Zoo Veterinarians (AAZV) and International Association for Aquatic Animal Medicine (IAAAM) Conference, 17 September, New Orleans, AAZV/IAAAM, Media, Pennsyvania. 432-34.
40. Manning, E. J. B., T. E. Kucera, N. B. Gates, L. M. Woods, and M. Fallon- McKnight. 2003. Testing for Mycobacterium avium subsp. paratuberculosis infection in asymptomatic free-ranging Tule elk from an infected herd. J.Wildl.Dis. 39.
41. McClure, H. M., R. J. Chiodini, D. C. Anderson, R. B. Swenson, W. R. Thayer, and J. A. Coutu. 1987. Mycobacterium paratuberculosis infection in a colony of stumptail macaques (Macaca arctoides). J.Infect.Dis. 155:1011-9. 121 42. Millar, D., J. Ford, J. Sanderson, S. Withey, M. Tizard, T. Doran, and J. Hermon-Taylor. 1996. IS900 PCR to detect Mycobacterium paratuberculosis in retail supplies of whole pasteurized cows' milk in England and Wales. Appl.Environ.Microbiol. 62:3446-3452.
43. Motiwala, A. S., M. Strother, A. Amonsin, B. Byrum, S. A. Naser, J. R. Stabel, W. P. Shulaw, J. P. Bannantine, V. Kapur, and S. Sreevatsan. 2003. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis: evidence for limited strain diversity, strain sharing, and identification of unique targets for diagnosis. J.Clin.Microbiol. 41:2015-26.
44. Naser, S. A., J. Felix, H. Liping, C. Romero, N. Naser, A. Walsh, and W. Safranek. 1999. Occurrence of the IS900 gene in Mycobacterium avium complex derived from HIV patients. Mol.Cell.Probes 13:367-372.
45. Nei, M. 1973. Analysis of gene diversity in subdivided populations. Proc.Natl.Acad.Sci.USA 70:3321-3.
46. Olsen, I., G. Sigurgardottir, and B. Djonne. 2002. Paratuberculosis with special reference to cattle. A review. Vet.Q. 24:12-28.
47. Ott, S. L., S. J. Wells, and B. A. Wagner. 1999. Herd-level economic losses associated with Johne's disease on US dairy operations. Prev.Vet.Med. 40:179-92.
48. Pavlik, I., J. Bartl, L. Dvorska, P. Svastova, R. du Maine, M. Machackova, W. Yayo Ayele, and A. Horvathova. 2000. Epidemiology of paratuberculosis in wild ruminants studied by restriction fragment length polymorphism in the Czech Republic during the period 1995-1998. Vet.Microbiol. 77:231-51.
49. Pavlik, I., L. Bejckova, M. Pavlas, Z. Rozsypalova, and S. Koskova. 1995. Characterization by restriction endonuclease analysis and DNA hybridization using IS900 of bovine, ovine, caprine and human dependent strains of Mycobacterium paratuberculosis isolated in various localities. Vet.Microbiol. 45:311-318.
50. Pavlik, I., A. Horvathova, L. Dvorska, J. Bartl, P. Svastova, M. R. du, and I. Rychlik. 1999. Standardisation of restriction fragment length polymorphism analysis for Mycobacterium avium subspecies paratuberculosis. J.Microbiol.Methods 38:155-167.
51. Quirke, P. 2001. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn's disease. Gut 49:757-760.
122 52. Read, T. D., S. L. Salzberg, M. Pop, M. Shumway, L. Umayam, L. Jiang, E. Holtzapple, J. D. Busch, K. L. Smith, J. M. Schupp, D. Solomon, P. Keim, and C. M. Fraser. 2002. Comparative genome sequencing for discovery of novel polymorphisms in Bacillus anthracis. Science 296:2028-33.
53. Sreevatsan, S., J. B. Bookout, F. Ringpis, V. S. Perumaalla, T. A. Ficht, L. G. Adams, S. D. Hagius, P. H. Elzer, B. J. Bricker, G. K. Kumar, M. Rajasekhar, S. Isloor, and R. R. Barathur. 2000. A multiplex approach to molecular detection of Brucella abortus and/or Mycobacterium bovis infection in cattle. J.Clin.Microbiol. 38:2602-2610.
54. Sreevatsan, S., X. Pan, K. E. Stockbauer, N. D. Connell, B. N. Kreiswirth, T. S. Whittam, and J. M. Musser. 1997. Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination. Proc.Natl.Acad.Sci. USA 94:9869-74.
55. Stabel, J. R., S. J. Wells, and B. A. Wagner. 2002. Relationships between fecal culture, ELISA, and bulk tank milk test results for Johne's disease in US dairy herds. J.Dairy Sci. 85:525-531.
56. Whittington, R., I. Marsh, E. Choy, and D. Cousins. 1998. Polymorphisms in IS1311, an insertion sequence common to Mycobacterium avium and M. avium subsp. paratuberculosis, can be used to distinguish between and within these species. Mol.Cell.Probes 12:349-358.
57. Whittington, R. J., A. F. Hope, D. J. Marshall, C. A. Taragel, and I. Marsh. 2000. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis: IS900 restriction fragment length polymorphism and IS1311 polymorphism analyses of isolates from animals and a human in Australia. J.Clin.Microbiol. 38:3240-3248.
58. Whittington, R. J., L. Reddacliff, I. Marsh, and V. Saunders. 1999. Detection of Mycobacterium avium subsp paratuberculosis in formalin-fixed paraffin- embedded intestinal tissue by IS900 polymerase chain reaction. Aust.Vet.J. 77:392-397.
59. Whittington, R. J., and E. S. Sergeant. 2001. Progress towards understanding the spread, detection and control of Mycobacterium avium subsp. paratuberculosis in animal populations. Aust.Vet.J. 79:267-278.
60. Zwick, L. S., T. F. Walsh, R. Barbiers, M. T. Collins, M. J. Kinsel, and R. D. Murnane. 2002. Paratuberculosis in a mandrill (Papio sphinx). J.Vet.Diagn.Invest. 14:326-8. 123 Figure 3.1.
Dendrogram showing the distribution of MPIL fingerprints. Shown on the dendrogram are the assigned fingerprints, isolate identities and host species. The proportion distance of each cluster is also indicated. The MPIL analysis had a Simpson's diversity index of 0.533 indicative of a limited degree of strain discrimination capability.
Shannon's diversity index = 1.067. M. paratuberculosis: M. paratuberculosis; MAIC: non M. paratuberculosis M. avium-intracellulare complex; Outside MAIC: Mycobacteria outside M. avium-intracellulare complex.
124
125 Figure 3.2.
Phylogenetic tree showing the distribution of strains by the numbers of G – repeats.
Shown on the dendrogram are the numbers of G repeats, isolate identities, host species
and the major fingerprints by multiplex PCR for integration loci (MPIL). Also shown at
the clade origins are bootstrap values generated by 1000 replications in a maximum parsimony model. The short sequence repeat (SSR) analysis had a Simpson's diversity index of 0.751 indicative of a high degree of strain discrimination capability. Shannon's diversity index = 1.593. M. paratuberculosis: M. paratuberculosis; MAIC: non M.
paratuberculosis M. avium-intracellulare complex; Outside MAIC: Mycobacteria outside
M. avium-intracellulare complex.
126
127
j k f d i b e h g a c 900 1311 1245 251 251 Zone DMC DMC hsp65 MPIL IS Species L1-L9 L1-L9 IS IS MJ dep. MJ G repeat Identification Trascaspian 2 1 1 0 1 1 - 1 A1 9 G MAPl 1 urial Addax 6 1 1 0 1 1 - 1 A18 7 G MAP 1 Angolan 2 1 1 0 1 1 - 1 A18 9 G MAP 1 springbok Angolan 2 1 1 0 1 1 - 1 A18 10 G MAP 1 springbok Axis deer 1 1 1 0 1 1 - 1 A18 7 G MAP 1 Bay duiker 4 1 1 0 1 1 - 1 A18 9 G MAP 1 Bay duiker 4 1 1 0 1 1 - 1 A18 9 G MAP 1 Bay duiker 4 1 1 0 1 1 - 1 A18 9 G MAP 1 Bison 3 1 1 0 1 1 - 1 A18 7 G MAP 1 Bison 3 1 1 0 1 1 - 1 A18 7 G MAP 1 Bison 3 1 1 0 1 1 - 1 A18 7 G MAP 1 Bison 3 1 1 0 1 1 - 1 A18 7 G MAP 1 Bison 3 1 1 0 1 1 - 1 A18 7 G MAP 1 Bison 3 1 1 0 1 1 1 1 A18 7 G MAP 1 Bison 3 1 1 0 1 1 1 1 A18 7 G MAP 1 Blesbok 2 1 1 1 1/0 0 1 1 A18 2GC4G MAP 1 Blesbok 2 1 1 1 1/0 1 - 1 A18 2GC4G MAP 0 British red 2 1 1 0 1 1 - 1 A18 13 G MAP 1 deer Chinese Reeve's 2 1 1 1 1/0 0 1 1 A18 2GC4G MAP 1 muntjac Chinese Reeve's 2 1 1 0 1 1 - 1 A18 9 G MAP 1 muntjac Elk 3 1 1 0 1 1 - 1 A18 7 G MAP 1 Elk 3 1 1 0 1 1 - 1 A18 7 G MAP 1 Elk 1 1 1 0 1 1 - 1 A18 7 G MAP 1 Elk 1 1 1 0 1 1 - 1 A18 7 G MAP 1 Elk 1 1 1 0 1 1 - 1 A18 7 G MAP 1 Elk 1 1 1 0 1 1 - 1 A18 7 G MAP 1 Elk 1 1 1 0 1 1 - 1 A18 13 G MAP 1 Elk 3 1 1 0 1 1 - 1 A18 13 G MAP 1 Elk 3 1 1 0 1 1 - 1 A18 13 G MAP 1 Elk 3 1 1 0 1 1 - 1 A18 13 G MAP 1 Elk 3 1 1 0 1 1 - 1 A18 15 G MAP 1 Ellipsen 2 1 1 1 1/0 1 - 1 A18 9 G MAP 0 waterbuck Environmental 2 1 1 1 1/0 1 - 1 A18 2GC4G MAP 1 water Environmental 2 1 1 1 1/0 1 - 1 A18 2GC4G MAP 0 water (continued) 128 Table 3.1. - continued
j k f d i b e h g a c 900 1311 1245 251 251 Zone DMC DMC hsp65 MPIL IS Species L1-L9 L1-L9 IS IS MJ dep. MJ G repeat Identification Gemsbok 2 1 1 0 1 1 - 1 A18 9 G MAP 1 Goat 3 1 1 0 1 1 - 1 A18 7 G MAP 1 Goat 3 1 1 0 1 1 1 1 A18 7 G MAP 1 Impala 6 1 1 0 1 1 - 1 A18 7 G MAP 1 Impala 6 1 1 0 1 1 - 1 A18 7 G MAP 1 Impala 6 1 1 0 1 1 - 1 A18 7 G MAP 1 Indian axis 2 1 1 1 1/0 0 1 1 A18 2GC4G MAP 0 deer Indian axis 2 1 1 1 1/0 0 1 1 A18 2GC4G MAP 1 deer Indian sambar 2 1 1 1 1 0 1 1 A18 2GC4G MAP 0 Key deer 6 1 1 0 1 1 - 1 A18 10 G MAP 1 Key deer 6 1 1 0 1 1 - 1 A18 11 G MAP 1 Malayan 2 1 1 1 1 1 - 1 A18 9 G MAP 1 sambar Nyala 4 1 1 0 1 1 - 1 A18 7 G MAP 1 Nyala 6 1 1 0 1 1 - 1 A18 7 G MAP 1 Oryx 5 1 1 0 1 1 - 1 A18 7 G MAP 1 Sheep 3 1 1 1 1/0 0 1 1 A18 2GC4G MAP 0 Sika 2 1 1 0 1 1 - 1 A18 9 G MAP 1 Thomson 6 1 1 1 1 1 - 1 A18 7 G MAP 1 gazelle Thomson 6 1 1 0 1 1 - 1 A18 7 G MAP 1 gazelle Turkomen 2 1 1 0 1 1 - 1 A18 9 G MAP 1 markhor Turkomen 2 1 1 1 1/0 0 1 1 A18 2GC4G MAP 1 markhor Trascaspian 2 1 1 0 1 1 - 1 A18 9 G MAP 1 urial Trascaspian 2 1 1 0 1 1 - 1 A18 9 G MAP 1 urial Trascaspian 2 1 1 0 1 1 - 1 A18 9 G MAP 1 urial Trascaspian 2 1 1 0 1 1 - 1 A18 9 G MAP 1 urial Trascaspian 2 1 1 0 1 1 - 1 A18 9 G MAP 1 urial Tule elk 1 1 1 0 1 1 - 1 A18 - MAP 1 Tule elk 1 1 1 0 1 1 1 1 A18 7 G MAP 1 Tule elk 1 1 1 0 1 1 - 1 A18 7 G MAP 1 Sitatunga 6 1 1 0 1 1 - 1 A18 7 G MAP 1 Waterbuck 2 1 1 0 1 1 - 1 A18 9 G MAP 1 Waterbuck 2 1 1 0 1 1 - 1 A18 9 G MAP 1 (continued) 129 Table 3.1. - continued
j k f d i b e h g a c 900 1311 1245 251 251 Zone DMC DMC hsp65 MPIL IS Species L1-L9 L1-L9 IS IS MJ dep. MJ G repeat Identification White tailed 2 1 1 0 1 1 - 1 A18 9 G MAP 1 gnu White tailed 5 1 1 0 1 1 - 1 A18 10 G MAP 1 deer A18 Sheep 3 1 1 0 1 0 2 1 15 G MAP 1 variant Springbok 6 1 1 1 1/0 0 1 1 B4 2GC4G MAP 1 Springbok 3 1 1 1 1/0 0 1 1 B4 2GC4G MAP 1 Bison 3 1 1 0 1 1 - 1 unique - MAP 1 Blesbok 2 1 1 1 1/0 0 1 1 unique 2GC4G MAP 1 Dybowski's 2 1 1 0 1 1 - 1 unique - MAP 1 sika Ellipsen 2 1 1 1 1/0 0 1 1 unique 2GC4G MAP 0 waterbuck Sika 2 1 1 0 0 neg - 1 unique - MAP 1 Angolan 2 0 0 1 0 0 - 1 B11 2GC4G MAICm 1 springbok Bay Duiker 4 0 0 1 0 0 - 0 B11 2GC4G MAIC 0 Bighorn sheep 1 0 0 1 0 neg - 1 B11 - MAIC 0 Dama gazelle 3 0 0 1 0 0 - 0 B11 2GC4G MAIC 0 Dom water 2 0 0 1 0 0 - 0 B11 2GC4G MAIC 0 buffalo Eland 6 0 0 1 0 neg - 0 B11 - MAIC 0 Elk 1 0 0 1 0 0 - 0 B11 2GC4G MAIC 0 Giraffe 1 0 0 1 0 0 - 0 B11 2GC4G MAIC 0 Giraffe 4 0 0 1 0 neg - 0 B11 2GC4G MAIC 0 Impala 6 0 0 1 0 0 - 0 B11 2GC4G MAIC 0 Munjtac 3 0 0 1 0 0 - 0 B11 2GC4G MAIC 0 Nubian ibex 2 0 0 1 0 0 - 1 B11 2GC4G MAIC 0 Sable antelope 2 0 0 1 1/0 0 - 1 B11 2GC4G MAIC 0 Spanish ibex 2 0 0 1 0 0 - 0 B11 2GC4G MAIC 0 Oryx 6 0 0 0 0 neg - 0 B11 - O/MAICn 0 Armenian 2 0 0 0 0 0 - 1 B11 2GC4G O/MAIC 0 mouflon Bison 1 0 1 0 0 neg - 0 B11 2GC4G O/MAIC 0 Springbok 3 0 0 0 0 neg - 0 B11 - O/MAIC 0 Elk 1 0 0 0 0 0 - 0 B11 2GC4G O/MAIC 0 Environmental 2 0 0 0 0 neg - 0 B11 - O/MAIC 0 water Gnu 6 0 0 0 0 neg - 0 B11 - O/MAIC 0 Gnu 6 0 0 0 0 neg - 0 B11 - O/MAIC 0 Goat 3 0 0 0 0 neg - 0 B11 - O/MAIC 0 Impala 6 0 0 0 0 neg - 0 B11 - O/MAIC 0 (continued) 130 Table 3.1. - continued
j k f d i b e h g a c 900 1311 1245 251 251 Zone DMC DMC hsp65 MPIL IS Species L1-L9 L1-L9 IS IS MJ dep. MJ G repeat Identification Indian gaur 2 0 0 0 1/0 neg - 1 B11 - O/MAIC 0 Key deer 6 0 0 0 1 neg - 0 B11 - O/MAIC 0 Macaque 3 0 0 0 0 neg - 0 B11 - O/MAIC 0 Thomson 1 0 0 0 0 neg - 0 B11 - O/MAIC 0 gazelle Thomson 6 0 0 0 0 neg - 0 B11 - O/MAIC 0 gazelle Toucanet bird 3 0 0 0 neg neg - 0 B11 - O/MAIC 0 Unknown 6 0 0 0 0 neg - 0 B11 7 G O/MAIC 0 White tailed 5 0 0 0 0 neg - 0 B11 - O/MAIC 0 deer Trascaspian 2 0 1 1 0 0 - 0 unique 2GC4G MAIC 0 urial Control 3 1 1 0 1 1 - 1 A18 11 G MAP 1 (ATCC 19698) Control 3 1 1 0 1 1 - 1 A18 10 G MAP 1 (Bovine MAP)
Table 3.1. Molecular characteristics of acid fast strains by host and geographic locality.
(continued)
131 Table 3.1. - continued
aZones 1 through 6 represent North-West, South-West, North-Central, South-Central,
North-East and South-East regions of United States, respectively. bL1-L9: PCR amplification and hybridization for IS900 integration loci L1 (left side integration site of
IS900 into an unknown ORF) and L9 (left side integration of IS900 into alkA), 1 =
positive, 0 = negative, c251: PCR amplification of M. paratuberculosis unique sequence locus 251, 1 = positive, 0 = negative, dIS1245: PCR amplification and hybridization for a
region of IS1245 deleted in M. paratuberculosis, 1 = positive, 0 = negative, ehsp65:
Restriction endonuclease analysis for polymorphisms in hsp65 gene (21) (20), 1=no
restriction site, 0=1 restriction site, fIS1311: Restriction endonuclease analysis for
polymorphisms in IS1311 gene, 0 = 2 restriction sites, 1 = 3 restriction sites, neg = no amplification, gDMC: A molecular marker based on a recently identified polymorphism used to differentiate cattle and sheep strains (11), - = not analyzed, hIS900: IS900 PCR
amplification, 1 = positive, 0 = negative, iMPIL: Multiplex PCR for Integration Loci, jG- repeat: Amplification and sequencing of a locus containing variable number of G repeats
(3), - = amplification or sequencing unsuccessful, kMJ dep.: 1 = Growth is dependent on mycobactin J supplementation, 0 = Growth not dependent on mycobactin J supplementation, lMAP: M. paratuberculosis; mMAIC: M. avium-intracellulare
complex; nO/MAIC: Mycobacteria outside M. avium-intracellulare complex.
132 CHAPTER 4
MYCOBACTERIUM AVIUM SUBSPECIES PARATUBERCULOSIS STRAINS
ISOLATED FROM CROHN’S DISEASE PATIENTS AND ANIMAL SPECIES
EXHIBIT SIMILAR POLYMORPHIC LOCI PATTERNS
4.1. ABSTRACT
Genetic analysis of two polymorphic short sequence repeats of Mycobacterium avium subspecies paratuberculosis isolated from human Crohn’s and animal Johne’s disease cases was undertaken to develop a population genetic framework. Cluster analysis of the G- and GGT- repeat loci indicated that cattle and goat isolates could be classified into 9 and 5 alleles, respectively. Sheep isolates were classified into 8 alleles, 3 of which formed a distinct clade. Two alleles were identified in the human isolates, both of which clustered with strains derived from several animal species. Taken together, the data is suggestive of inter- and intra-species transmission and host-restricted distribution of several specific strains. Further, the current study presents evidence for both existence of human disease associated genotypes and strain sharing with animals.The identification of a limited number of genotypes amongst human strains suggests association of a few animal M. paratuberculosis strains with the pathobiology of Crohn’s disease.
133 4.2. INTRODUCTION
Crohn's disease, a chronic inflammation of the intestine, results in substantial
morbidity and medical costs in the United States. Most recent epidemiologic
investigations indicate that there are over 500,000 Crohn’s patients in the United States
(3). The etiology of Crohn’s disease is contentious. However, there is growing support
for the belief that Crohn’s disease may be a multi-factorial disease with numerous causes
for its pathological presentation (9, 19, 21). While several theories regarding its etiology have been proposed, it seems likely that it is a complex interplay between genetic susceptibility and a plethora of infectious, dietary and psychological factors (19, 21).
The most prevalent theory for a microbial etiology of Crohn’s disease is infection
with Mycobacterium avium subspecies paratuberculosis (M. paratuberculosis) - the
etiological agent of a similar disease in animals known as Johne’s disease or paratuberculosis (8, 20). Johne’s disease, which predominantly affects ruminants, is also a chronic inflammatory intestinal infection associated with diarrhea, wasting and a predilection for the ileum (17). It exhibits a pathology that resembles that of human
Crohn’s disease (17). Despite evidence that associates M. paratuberculosis with a portion of Crohn’s disease cases (5, 22), the evidence for a causal link remains controversial.
Thus, the question whether M. paratuberculosis is a true zoonotic pathogen remains
unanswered.
Insufficient knowledge of M. paratuberculosis genetics, physiology and strain
differences has limited our understanding of this organism’s evolution and pathogenic
potential. However, the recent completion of the genome of a bovine strain of M.
paratuberculosis has enabled identification of potentially polymorphic loci that may aid
134 in the development of reproducible high-resolution sub-typing of M. paratuberculosis isolates for molecular epidemiologic and population genetic analyses. As a result, we may now close a major gap in our understanding of the population structure among M.
paratuberculosis isolates.
The primary objective of this report was to study the clonal distribution and
degree of diversity in M. paratuberculosis isolated from different animal species with
Johne’s disease and from humans with Crohn’s disease. Preliminary genotyping analyses
of M. paratuberculosis isolates derived from a variety of disease types, geographic
localities, and hosts suggests an association between allele types and host species (14).
Knowledge of potential strain specificity for the human host and genotypic proximity to
strains responsible for animal disease will be a critical first step in establishing a causal
role for M. paratuberculosis in Crohn’s disease.
4.3. MATERIALS AND METHODS
Mycobacterium avium subspecies paratuberculosis (M. paratuberculosis) strains
were obtained from several animal host species including cattle (n=25), goat (n=20), sheep (n=17) and deer (n=2) diagnosed with Johne’s disease (15). These isolates were derived from different geographic localities (Figure 4.1.) and represent the extent of genotypic diversity determined by multiplex PCR of IS900 loci as reported in our previous study (15). The human isolates (n=7) were obtained from breast milk (16) and intestinal tissues (Naser et al, unpublished) of patients diagnosed with Crohn’s disease.
Three ATCC human M. paratuberculosis strains (43015, 43544, 43545 and 49164), 2
ATCC animal M. paratuberculosis strains (700535 and 19851), and M. paratuberculosis
135 K10 (complete genome, GenBank accession NC002944) were also included in the
analysis. Attempts have been made to isolate M. paratuberculosis from animals/birds in
close vicinity with cattle herds with multiple confirmed cases of Johne’s disease. M.
paratuberculosis strains obtained to date from these free-ranging or feral species were
also included in the study i.e. cat (n=1), mouse (n=1), shrew (n=1), armadillo (n=1), raccoon (n=5) and starling (n=7).
Freezer stocks of the mycobacterial isolates were revived in 7H9 broth (Becton,
Dickinson and Co., Sparks, MD) for molecular identification and diversity analysis. The pellet from approximately 1ml of turbid 7H9 broth culture was used for DNA extraction using QIAamp DNA Blood Mini kit (Qiagen Inc., Valencia, CA) as described (15). The extracted DNA was used to confirm subspecies by characterizing all isolates using well- defined molecular markers as previously described (15): (i) PCR amplification and hybridization for 2 integration loci (L1 and L9) of the insertion sequence IS900 regarded as diagnostically definitive for M. paratuberculosis (ii) PCR amplification of M. paratuberculosis unique sequence (locus 251), (iii & iv) Restriction endonuclease analyses (REA) for polymorphisms in hsp65 and IS1311 genes, and (v) PCR amplification and hybridization of a M. avium subsp. avium (M. avium) specific marker
(IS1245) to distinguish between M. paratuberculosis and M. avium (14).
An isolate was characterized as M. paratuberculosis if the profile was L1-L9 positive, 251 positive, IS1245 negative and absence of polymorphism in hsp65 gene (14).
The M. paratuberculosis isolates were further classified using the IS1311 restriction patterns consistently identified in either cattle (2 restriction sites) or sheep strains (1 restriction site) (14).
136 PCR amplification of the short sequence repeat (SSR) loci and subsequent
sequencing of the PCR product was carried out as described (2). For both the repeat loci
under investigation, only those PCR products that were detectable on 1% agarose gels were sequenced for further analysis. All chromatograms were visually inspected and sequences were edited with EditSeq (DNASTAR, Madison, WI) to correct ambiguities and then aligned using MegAlign (DNASTAR, Madison, WI) to identify the number of repeats in both loci for each isolate. The alleles were assigned a number congruent with the number of G and GGT residues. An allele containing a polymorphism within the repeat region was indicated by a ‘p’ before the allele number.
Cluster analysis was performed using Molecular Evolutionary Genetics Analysis
(MEGA, version 2.1, www.megasoftware.net) by the neighbor joining method (12). The
distance matrix for input into the MEGA program was created from the binary data using
ETDIV and ETMEGA (http://foodsafe.msu.edu/whittam/programs/). Simpson’s diversity
index was calculated using the equation 1-∑ (allele frequency)2 (10).
4.4. RESULTS
Of the 94 M. paratuberculosis isolates analyzed, 92 isolates had a detectable G- repeat product (approx. 400bp) while all 94 isolates had a detectable GGT-repeat product
(approx. 425bp). The number of G- and GGT-repeats identified for each host species is indicated in Table 4.1.
Cluster analysis of the repetitive residues divided the isolates into 3 distinct clades
on the basis of number of G- and GGT-repeats. A total of 13 distinct alleles were
identified. The analysis indicated that cattle isolates (n=28, including ATCC strains)
137 could be classified into 9 alleles while the goat isolates (n=20) could be classified into 5
alleles (Figure 4.1.). All cattle isolates obtained from farms within Ohio had the same
fingerprint i.e. 7g - 4ggt [Holmes (n=3) and Columbiana (n=8) counties]. The sheep
isolates (n=17) were classified into 8 alleles, 3 of which formed a distinct clade. Two
nucleotide polymorphisms identified within the repeat regions were exclusive to the
sheep isolates. The first one was within the allele containing 7 G-repeats (GGGGGGG →
GGCGGGG) while the second polymorphism was within the allele containing 3 GGT- repeats (GGTGGTGGT → AGTGGTGGT). Isolates with either of these polymorphic
alleles had several additional substitutions throughout the sequenced region (GenBank accession in Table 4.1.). Of the 11 human M. paratuberculosis isolates (including the
ATCC strains), 8 clustered into a single allele along with cattle, goat and sheep isolates while the remaining 3 clustered into a separate clade with other cattle, goat and sheep isolates. The isolates derived from free-ranging or feral non-ruminant host species (n=18) were dispersed evenly in clades A and C (Figure 4.1.). The Simpson’s diversity index for the analysis was 0.78 (1-D=0.217), indicative of a strain discrimination capability much higher than other markers or methods reported to date (4, 15, 18).
4.5. DISCUSSION
Knowledge of the extent of strain sharing across different host species is vital to
understanding the dynamics of M. paratuberculosis transmission. Methods for
differentiation or sub-typing of bacterial strains provide important information for
molecular epidemiological analysis and an understanding of population genetics of the
organism. Short sequence repeats (SSRs) have been successfully used as markers to
138 understand the clonality and distribution of subtypes in several bacterial species (1, 7,
11). The present study is an attempt to identify the degree of interspecies transmission and reveal any genotypic strain similarity or heterogeneity in M. paratuberculosis isolates from human and animal hosts.
Results of a recently described multi-locus short sequence repeat analysis (2) for
M. paratuberculosis strain differentiation indicated that a mononucleotide G-repeat locus
within a domain homologous to the phosphatidylethanolamine-binding domain (GenBank
accession AAK46234) and a tri-nucleotide GGT-repeat locus homologous to the mfd
[Mycobacterium tuberculosis H37Rv] domain (GenBank accession CAB06859) were
most discriminatory of the 11 repeats analyzed (Simpson’s diversity indices for G- and
GGT- repeats were 0.70 and 0.67, respectively). Hence, these loci were selected for
fingerprinting in this study.
Cluster analysis distributed the cattle and goat isolates into clades A and C
(Figure 4.1.). Sheep isolates clustered in clades A, B and C with clade B comprising
exclusively of M. paratuberculosis isolates of sheep origin. While the number of alleles identified for cattle and goat isolates was greater than those in sheep isolates, 52% of the cattle and goat strains carried a single SSR genotype (7g-4ggt). This suggests a more recent association of M. paratuberculosis with cattle and goat as compared to sheep.
Presence of nucleotide polymorphisms, exclusive to sheep isolates, is a further indication of the greater diversity amongst the sheep isolates and suggests that sheep strains may be
ancestral. This hypothesis is consistent with the data from a recently published study
which indicated that the sheep strains of M. paratuberculosis were an evolutionary
intermediate between the cattle strain of M. paratuberculosis and M. avium (6).
139 M. paratuberculosis strains from Crohn’s patients had restricted allelic variation.
Presence of only 2 alleles within the human strains analyzed may be indicative of the ability of a few animal genotypes to be associated with the pathobiology of Crohn’s disease (Figure 4.2.). The precedence for this line of thought lies in the acknowledgement that Johne’s disease in sheep is mostly caused by a distinct group of M. paratuberculosis strains. However, presence of the same two alleles in 52% of the animal isolates is suggestive of strain sharing and inter-species transmission. Since the human M. paratuberculosis strains analyzed in this study (other than ATCC strains) were isolated from patients residing in Florida, the probability that they were exposed to a genetically and geographically restricted set of strains certainly exists. However, identification of the same alleles in ATCC strains obtained from diverse localities and the presence of disparate alleles in animal isolates (n=4) from Florida strengthen the possibility that a limited set of strains are associated with Crohn’s disease. This inference is also reflected in the presence of several non-synonymous single nucleotide mutations in human M. paratuberculosis strains as compared to the animal isolates (Zhu and Sreevatsan, unpublished). On the other hand, it is possible that the human M. paratuberculosis isolates from Florida represent a much broader geographic area than just the peninsula as many people retire to Florida from other parts of the country.
Isolation of M. paratuberculosis from tissues of other non-ruminant animal
species (cat, raccoon, shrew and armadillo) and birds, found in the vicinity of infected
farm animals, suggests that M. paratuberculosis is able to infect/colonize non-ruminants.
The histopathologic evaluation of these tissues for signs of M. paratuberculosis -related
pathology is underway. Identification of common strain types between these animals and
140 farm ruminants indicates strain sharing. Although we identified a greater representation
of the 7g-5ggt allele in the raccoon isolates, there was no evidence for an association
between other non-ruminant host species and a particular M. paratuberculosis allele as
that observed for human isolates.
It has been suggested that both genetic susceptibility (NOD2/CARD15
polymorphisms) (13) and exposure to M. paratuberculosis are necessary for
manifestation of Crohn’s disease. Existence of possible modes of exposure and/or
transmission have been indicated by documentation of the presence of M. paratuberculosis in retail pasteurized milk and its long-term survival in soil and water
(19). The prevalence of Crohn’s disease is low despite the suggested wide-spread exposure of people to M. paratuberculosis and isolates from human do not reflect the
strain diversity seen in animal M. paratuberculosis isolates. This raises the speculation
that a few distinct M. paratuberculosis genotypes are associated with the pathobiology of
Crohn’s disease. The current study presents evidence for both existence of human disease associated genotypes and strain sharing with animals. We were unable to establish if the patients carried the NOD2/CARD15 polymorphisms. Larger studies on M. paratuberculosis strains isolated from well-defined Crohn’s patient as well as healthy human populations from diverse geographic locations and time points are warranted to fully elucidate association of specific genotypes of M. paratuberculosis with Crohn’s disease.
141 4.6. ACKNOWLEDGMENT
This article has been reprinted with permission from the Journal of Clinical
Microbiology. Copyright © 2004, American Society for Microbiology. All Rights
Reserved.
The study was supported by state and federal funds appropriated to the Ohio
Agricultural Research and Development Center (OARDC) including an OARDC
Competitive Research Enhancement Seed Grant awarded to S. Sreevatsan.
Collaborative contributions of M. Strother, S.A. Naser and E.J.B. Manning are gratefully acknowledged.
4.7. REFERENCES
1. Adair, D. M., P. L. Worsham, K. K. Hill, A. M. Klevytska, P. J. Jackson, A. M. Friedlander, and P. Keim. 2000. Diversity in a variable-number tandem repeat from Yersinia pestis. J.Clin.Microbiol. 38:1516-9.
2. Amonsin, A., L. L. Li, Q. Zhang, J. P. Bannantine, A. S. Motiwala, S. Sreevatsan, and V. Kapur. 2004. Multilocus Short Sequence Repeat Sequencing Approach for Differentiating among Mycobacterium avium subsp. paratuberculosis Strains. J.Clin.Microbiol. 42:1694-1702.
3. Ashford D, Imhoff B, Angulo F, and C. the FoodNet working group, Atlanta, GA. October 2001. "Over a Half-Million Persons May Have Crohn's Disease in the United States". Infectious Diseases Society of America. San Francisco, CA.
4. Bull, T. J., J. Hermon-Taylor, I. Pavlik, F. El Zaatari, and M. Tizard. 2000. Characterization of IS900 loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex PCR typing. Microbiology 146 ( Pt 9):2185-2197.
5. Bull, T. J., E. J. McMinn, K. Sidi-Boumedine, A. Skull, D. Durkin, P. Neild, G. Rhodes, R. Pickup, and J. Hermon-Taylor. 2003. Detection and verification of Mycobacterium avium subsp. paratuberculosis in fresh ileocolonic mucosal biopsy specimens from individuals with and without Crohn's disease. J.Clin.Microbiol. 41:2915-23. 142 6. Dohmann, K., B. Strommenger, K. Stevenson, L. de Juan, J. Stratmann, V. Kapur, T. J. Bull, and G. F. Gerlach. 2003. Characterization of genetic differences between Mycobacterium avium subsp. paratuberculosis type I and type II isolates. J.Clin.Microbiol. 41:5215-23.
7. Gascoyne-Binzi, D. M., R. E. Barlow, R. Frothingham, G. Robinson, T. A. Collyns, R. Gelletlie, and P. M. Hawkey. 2001. Rapid identification of laboratory contamination with Mycobacterium tuberculosis using variable number tandem repeat analysis. J.Clin.Microbiol. 39:69-74.
8. Hermon-Taylor, J. 2001. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn's disease. Gut 49:755-757.
9. Hugot, J. P., M. Chamaillard, H. Zouali, S. Lesage, J. P. Cezard, J. Belaiche, S. Almer, C. Tysk, C. A. O'Morain, M. Gassull, V. Binder, Y. Finkel, A. Cortot, R. Modigliani, P. Laurent-Puig, C. Gower-Rousseau, J. Macry, J. F. Colombel, M. Sahbatou, and G. Thomas. 2001. Association of NOD2 leucine- rich repeat variants with susceptibility to Crohn's disease. Nature 411:599-603.
10. Hunter, P. R., and M. A. Gaston. 1988. Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J.Clin.Microbiol. 26:2465-6.
11. Keim, P., L. B. Price, A. M. Klevytska, K. L. Smith, J. M. Schupp, R. Okinaka, P. J. Jackson, and M. E. Hugh-Jones. 2000. Multiple-locus variable- number tandem repeat analysis reveals genetic relationships within Bacillus anthracis. J.Bacteriol. 182:2928-36.
12. Kumar, S., K. Tamura, I. B. Jakobsen, and M. Nei. 2001. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17:1244-5.
13. McGovern, D. P., D. A. Van Heel, T. Ahmad, and D. P. Jewell. 2001. NOD2 (CARD15), the first susceptibility gene for Crohn's disease. Gut 49:752-754.
14. Motiwala, A. S., A. Amonsin, M. Strother, E. J. Manning, V. Kapur, and S. Sreevatsan. 2004. Molecular Epidemiology of Mycobacterium avium subsp. paratuberculosis Isolates Recovered from Wild Animal Species. J.Clin.Microbiol. 42:1703-1712.
15. Motiwala, A. S., M. Strother, A. Amonsin, B. Byrum, S. A. Naser, J. R. Stabel, W. P. Shulaw, J. P. Bannantine, V. Kapur, and S. Sreevatsan. 2003. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis:
143 evidence for limited strain diversity, strain sharing, and identification of unique targets for diagnosis. J.Clin.Microbiol. 41:2015-26.
16. Naser, S. A., D. Schwartz, and I. Shafran. 2000. Isolation of Mycobacterium avium subsp. paratuberculosis from breast milk of Crohn's disease patients. Am.J.Gastroenterol. 95:1094-5.
17. National Academy of Sciences Report. Diagnosis and Control of Johne's Disease (2003). http://books.nap.edu/openbook/0309086116/html/index.html.
18. Pavlik, I., A. Horvathova, L. Dvorska, J. Bartl, P. Svastova, M. R. du, and I. Rychlik. 1999. Standardisation of restriction fragment length polymorphism analysis for Mycobacterium avium subspecies paratuberculosis. J.Microbiol.Methods 38:155-167.
19. Possible link between Crohn's disease and Paratuberculosis. Report of the Scientific Committee on Animal Health and Animal Welfare. March 2000. http://gpvec.unl.edu/avc/IssuePapers/out38_en.pdf.
20. Quirke, P. 2001. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn's disease. Gut 49:757-760.
21. Rubery, E. A review of the evidence for a link between exposure to Mycobacterium paratuberculosis and Crohn's disease in humans. A report for the U.K. Foods Standards Agency. January, 2002. http://www.foodstandards.gov.uk/multimedia/pdfs/mapcrohnreport.pdf.
22. Schwartz, D., I. Shafran, C. Romero, C. Piromalli, J. Biggerstaff, N. Naser, W. Chamberlin, and S. A. Naser. 2000. Use of short-term culture for identification of Mycobacterium avium subsp. paratuberculosis in tissue from Crohn's disease patients. Clin.Microbiol.Infect. 6:303-307.
144 Figure 4.1.
Dendrogram showing the distribution of strains by the number of G and GGT – repeats. Shown are the number of G repeats followed by the number of GGT repeats and the host species. Host species not followed by a number indicate one isolate. The geographic locations are indicated in parentheses. Superscripts following geographic location indicate the number of isolates from that location. Also shown at the clade origins are the pairwise distances generated by the neighbor joining model. (unkn:
Unknown).
145
146
Figure 4.2.
Allele distribution across various host species strongly suggests strain sharing and interspecies transmission amongst M. paratuberculosis strains.
147
Species No. of MAP isolates G-repeat alleles GGT-repeat alleles 7, 8, 9, 10, 12, 14, Cattle1 28a 15 4, 5 Sheep2 17 7, p7*, 10, 14, 15 3, p3†, 4, 5 Goat3 20 7, 10, 11, 12, 15 4, 5 Deer 2 7 4 Human4 11b 7 4, 5 Mouse 1 >15 5 Raccoon 5 7, 14 5 Cat 1 14 5 Starling5 7 7, 12, 13, 14, 15 5, 6 Shrew 1 15 5 Armadillo 1 7 4
Table 4.1. Short sequence repeat analysis results by host species and targets
MAP: Mycobacterium avium subsp. paratuberculosis; *: polymorphic 7 G repeats, †: polymorphic 3 GGT repeats; a: Includes 25 clinical strains, 2 ATCC animal strains and
K10; b: Includes 7 clinical strains and 4 ATCC human strains; GenBank accessions 1:
AY587703, AY587706, AY587707, AY587712, AY587714, AY587715, AY587717,
AY587724, AY587728; 2: AY587699, AY587704, AY587708, AY587716, AY587718,
AY587719, AY587720, AY587721, AY587725, AY587729; 3: AY587705, AY587709,
AY587711, AY587713, AY587710, AY587726, AY587730; 4: AY587700, AY587727,
AY587701, AY587722, AY587702, AY587723; 5: AY587731
148 CHAPTER 5
RAPID DETECTION AND STRAIN TYPING OF MYCOBACTERIUM AVIUM
SUBSP. PARATUBERCULOSIS FROM BROTH CULTURES
5.1. ABSTRACT
A liquid culture followed by molecular confirmation was evaluated for potential to improve sensitivity and reduce time-to-diagnosis of Mycobacterium avium subsp. paratuberculosis (M. paratuberculosis) infection. Fecal samples from 240 animals from
Ohio farms were assessed for presence of M. paratuberculosis using 4 different protocols
– (i) sedimentation processing followed by inoculation on Herrold’s Egg Yolk media
(HEYM) slants (monitored biweekly up to 16 weeks) (ii) double centrifugation
processing followed by inoculation on HEYM slants (monitored biweekly up to 16
weeks) (iii) liquid-solid double culture method using modified 7H9 broth (8 weeks)
followed by sub-culture on HEYM slants (monitored up to 8 weeks) and (iv) liquid culture using modified 7H9 broth (8 weeks) followed by molecular assays for the presence of two M. paratuberculosis-specific targets. The number of positive samples detected by each protocol was 37, 53, 65 and 76, respectively. Twenty-seven samples were positive by all four methods. Based on samples positive by at least one method
(n=81), the sensitivities for sedimentation processing, double centrifugation processing,
149 liquid-solid double culture and liquid culture followed by molecular confirmation were
46%, 65%, 80% and 94%, respectively. Fingerprinting of the positive samples using two
polymorphic (G and GGT) short sequence repeat regions identified varying levels of
within-farm and between farm diversity. Our data indicates that liquid culture followed
by molecular confirmation can significantly improve sensitivity and reduce time-to-
diagnosis (from 16 to 8 weeks) of M. paratuberculosis infection and can also be
efficiently employed for the systematic differentiation of M. paratuberculosis strains to
understand the epidemiology of Johne’s disease.
5.2. INTRODUCTION
Johne’s disease is a chronic granulomatous enteritis caused by infection with
Mycobacterium avium subspecies paratuberculosis (M. paratuberculosis). Clinical signs of the disease in cattle include diarrhea, weight loss, fatigue, decreased milk production, and mortality. Johne’s disease is now recognized to be of serious economic and animal health consequences in domesticated ruminant species (primarily dairy and beef cattle, sheep and goats) throughout the world (28, 48). Johne’s disease has the greatest economic impact in dairy cattle, where premature culling, reduced carcass value, decreased weight gain and milk production result in estimated losses up to US$250 million annually (32). The growing recognition of M. paratuberculosis infection in wild ruminant and non-ruminant species is also of great concern as it may limit opportunities to control or eradicate Johne’s disease from domesticated animals (13, 14). In addition,
M. paratuberculosis has been implicated in the etiology of Crohn’s disease in humans (5,
16, 22, 35). This has served as a further impetus to control Johne’s disease.
150 Prevention and control of Johne’s disease is severely hindered due to its long
incubation period, presence of undetected sub-clinical cases, absence of rapid M. paratuberculosis-specific diagnostic tools and efficacious vaccines, and lack of knowledge of strain diversity (28, 41, 45). Isolation of M. paratuberculosis in conjunction with histopathological lesions is regarded as the gold-standard for diagnosis of Johne’s disease (28). However, fecal culture alone is frequently used as an acceptable standard procedure for determining an animal’s infection status. Although the specificity of the fecal culture method is high, the organism can take 12 to 16 weeks to grow to detectable levels, and even the most sensitive culture methods have less than 50% sensitivity (39, 46). Despite considerable research efforts aimed at development of better fecal processing and detection methods, the sensitivity of fecal cultures remains low.
Serologic tests such as agar gel immunodiffusion (18), complement fixation (23), and
ELISA (9, 15, 23) are limited in their use because of both low specificity and sensitivity
(7, 15, 48).
There is much to learn about the dynamics of transmission of infection within animal populations and the involvement of specific subtypes in determining the characteristics of the infections and the velocity of their spread. A comprehensive analysis of within-farm and between farm diversity in M. paratuberculosis strains will augment our understanding of the distribution and natural history of M. paratuberculosis
infections and also aid in the development of a population genetic framework for this
economically important bacterium. A coherent framework is necessary for identifying
genomic regions of evolutionary or functional importance and in determining how M. paratuberculosis may have evolved and adapted to its hosts.
151 This study was aimed at addressing two of the issues that hinder implementation
of prevention and control strategies. First, liquid culture followed by molecular confirmation was evaluated for potential to improve sensitivity and reduce time-to- diagnosis of M. paratuberculosis in field samples. Second, short sequence repeat (SSR) analysis of the M. paratuberculosis strains was undertaken to assess the distribution and molecular diversity among M. paratuberculosis strains from farms in Ohio.
5.3. MATERIALS AND METHODS
5.3.1. Fecal sample processing. A total of 240 fecal samples were obtained
from farms (n=40) from several Ohio counties (n=24) (Figure 5.1.). These samples represent a convenient subset of the field samples submitted to the Animal Disease
Diagnostic Lab (ADDL), Ohio Department of Agriculture over a 4-week period for routine M. paratuberculosis culture. Each fecal sample was processed using two different methods: (i) sedimentation (44) and (ii) double centrifugation (40).
The sedimentation processing was performed as previously described (44).
Briefly, 1 g of feces was mixed with 35 ml of sterile double distilled water and placed on
a shaker for 30 min. The sample was then allowed to settle for 30 min at room
temperature. Five-ml of the supernatant was then transferred to a tube containing 25 ml
of 0.9% hexadecylpyridinium chloride and incubated overnight at room temperature. The
sediment from the bottom of the tube was used to inoculate Herrold’s Egg Yolk media
(HEYM) slants with (2 tubes) and without (1 tube) mycobactin J to assess the mycobactin
J dependence commonly associated with M. paratuberculosis. The tubes were monitored
biweekly for 16 weeks. A sample was considered positive if any one of the HEYM slants
152 with mycobactin J had one or more colonies while the HEYM slant without mycobactin J
had no growth. A sample was considered negative if none of the HEYM slants had any
growth at the end of 16 weeks or if HEYM slants, both with and without mycobactin J,
had growth. A slant with fungal or non-mycobacterial contamination was also considered
negative. The samples were characterized based on the average cfu/slant. Samples with 1-
10, 11-49 and 50 or more cfu/slants were characterized as low, medium and heavy
shedders, respectively.
The double centrifugation processing was performed as previously described (40).
Briefly, 1 g of feces was mixed with 35 ml of sterile double distilled water and placed on
a shaker for 30 min. The sample was then allowed to stand for 30 min. The supernatant
(25 ml) was poured into a sterile centrifuge tube and centrifuged at 4000g for 20 min.
The sediment was resuspended in 25 ml of 0.9% hexadecylpyridinium chloride in 0.5X
Brain Heart Infusion (BHI) broth and incubated overnight at 37ºC. The suspension was
centrifuged again and the pellet resuspended in 0.5X BHI broth with Amphotericin B (50
µg/ml), Vancomycin (100 µg/ml) and Naldixic Acid (100 µg/ml) and incubated overnight
at 37ºC. The processed samples were used to inoculate HEYM slants with and without
mycobactin J as described above. The tubes were monitored biweekly for 16 weeks and
assessed using the same criteria described above.
5.3.2. Liquid-solid double culture method. Fecal samples, processed using the
double centrifugation method, were also used to inoculate MB/BacT® broths. The
MB/BacT® system (BioMerieux, Durham, NC) utilizes a modified Middlebrook 7H9 broth media and a proprietary non-radioactive growth detection system. Broth bottles were incubated in a specialized incubator that monitors changes in CO2 production every
153 10 min. Detection of organism growth was based upon a programmed algorithm. Broth
cultures were incubated until the system indicated growth. 500 µl of the positive broth was sub-cultured onto HEYM slants with (2 tubes) and without (1 tube) mycobactin J as described above. The remaining broth was frozen at -20ºC until use for molecular detection and short sequence repeat analysis. At the end of 8 weeks, all remaining bottles were removed and sub-cultured onto HEYM slants with and without mycobactin J. The sub-cultures were monitored for 8 weeks and assessed using the same criteria as described above.
5.3.3. Molecular detection. An independent laboratory performed the molecular detection from the broth cultures in a blinded fashion. The culture results from sedimentation and double centrifugation processing, and HEYM sub-cultures were revealed after the molecular analyses were complete. The short sequence repeat analysis was then performed on all the samples that were positive by any of the 4 protocols.
Cell pellet from 1 ml of broth culture was used for DNA extraction with QIAamp
DNA Blood Mini kit (Qiagen Inc., Valencia, CA) as described (27). The extracted DNA was used for detection of two well-defined molecular markers as previously described
(27): (i) PCR amplification and hybridization for 2 integration loci (L1 and L9) of the insertion sequence IS900 regarded as diagnostically definitive for M. paratuberculosis and (ii) PCR amplification of M. paratuberculosis-unique sequence (locus 251).
Amplification of hsp65 gene (27) was used to assess presence of PCR inhibitors in the
DNA extracts. A sample was considered positive if it was either positive for both L1-L9 and 251 or positive for L1-L9 alone.
154 Since, IS900 has been demonstrated in mycobacteria other than M.
paratuberculosis (11, 17), its specificity is debatable. In a published analysis of 600
bacterial cultures, L1-L9 and 251 have detected M. paratuberculosis with 100% specificity (27). Hence, L1-L9 and 251 have been the markers of choice over IS900.
However, there still exists the possibility that one or both these loci may be absent in a
rare M. paratuberculosis isolate.
5.3.4. Short sequence repeat (SSR) analysis. PCR amplification of two of the
most discriminatory short sequence repeat (SSR) loci – mononucleotide G and tri-
nucleotide GGT repeats (3) was carried out as described (26) using primer sets (i) 5’-
TCA GAC TGT GCG GTA TGG AA-3’ and 5’-GTG TTC GGC AAA GTC GTT GT-3’,
and (ii) 5’-AGA TGT CGA CCA TCC TGA CC-3’ and 5’-AAG TAG GCG TAA CCC
CGT TC-3’, respectively. Five-µl of the PCR product was electrophoresed at 125 V for
45 min in 1.5% agarose gels prestained with ethidium bromide and visualized on a UV
transilluminator (Alpha Innotech Corporation, San Leandro, CA). For both the repeat loci
under investigation, only those PCR products that were detectable on 1.5% agarose gels
were sequenced for further analysis. The PCR products were purified with a QIAquick
PCR purification kit (Qiagen Inc., Valencia, CA) and sequenced by using standard dye
terminator chemistry, and the sequences were analyzed on an automated DNA sequencer
(3700 DNA Analyzer, Applied Biosystems, Foster City, CA).
A subset of isolates (n=16) representing a single farm in Columbiana county were
further assessed using an additional SSR loci. This loci also contained mononucleotide G
repeats and was the third most discriminatory loci described (3). PCR amplification and
155 sequence analysis was performed as described above using primers 5’-GTG ACC AGT
GTT TCC GTG TG-3’ and 5’-TGC ACT TGC ACG ACT CTA GG-3’
All chromatograms were visually inspected and sequences were edited with
EditSeq (DNASTAR, Madison, WI) to correct ambiguities and then aligned using
MegAlign (DNASTAR, Madison, WI) to identify the number of repeats in both loci for each isolate. The alleles were assigned a number congruent to the number of G and GGT residues.
5.4. RESULTS
5.4.1. M. paratuberculosis detection. A total of 240 fecal samples were analyzed using 4 different protocols. Thirty-seven of the 240 samples were positive by sedimentation processing, 53 by double centrifugation processing, 65 by liquid-solid double culture and 76 by liquid culture followed by molecular confirmation. Thirteen samples were considered negative due to contamination. Of these, 2 were contaminated in the double centrifugation method, 7 were in the liquid-solid double culture method and
4 were contaminated in both methods. Of the 37 samples that were positive by the sedimentation method, 7 were characterized as heavy shedders, 16 as medium shedders and 14 as low shedders. Of the 53 samples that were positive by the double centrifugation method, 23 were characterized as heavy shedders, 12 as medium shedders and 18 as low shedders. Of the 65 samples that were positive by the liquid-solid double culture method,
41 were characterized as heavy shedders, 13 as medium shedders and 11 as low shedders.
Of the 76 samples that were positive by molecular detection, 69 were positive for both
L1-L9 and 251 while 7 were positive for L1-L9 alone.
156 Twenty-seven samples were positive by all four protocols while 81 samples were
positive by at least one of the four methods (Figure 5.2.). Of the five samples that were
negative by molecular detection, one was positive by sedimentation processing, two were
positive by double centrifugation processing and two were positive by liquid-solid double
culture. All five of these samples were confirmed to be M. paratuberculosis positive
using DNA extracts from slant cultures. Using the total number of samples positive by at least one method (n=81), the sensitivities for sedimentation processing, double
centrifugation processing, liquid-solid double culture and liquid culture followed by
molecular confirmation were 46%, 65%, 80% and 94%, respectively. The kappa
coefficients for sedimentation processing, double centrifugation processing and liquid-
solid double culture compared to liquid culture followed by molecular confirmation were
0.54, 0.72 and 0.84, respectively. Contingency tables for sedimentation processing,
double centrifugation processing and liquid-solid double culture compared to liquid
culture followed by molecular confirmation are shown in Table 5.1.
5.4.2. Short sequence repeat (SSR) analysis. To demonstrate the feasibility of
using broth cultures for molecular epidemiology studies, two regions within the M. paratuberculosis genome that carry varying numbers of G and GGT residues were amplified from all samples that were positive for M. paratuberculosis (3). Of the 81 samples analyzed, only those (n=80) with detectable G- and GGT- repeat products
(approx. 425 bp each) were sequenced for further analysis. These samples represented 31 farms from 16 Ohio counties. The fingerprints were designated by the number of G repeats followed by the number of GGT repeats. A total of 11 fingerprints with 7 to 15 G- residue repeats and 4 to 6 GGT-residue repeats were identified among the 80 M.
157 paratuberculosis samples included in the analysis. The distribution of the fingerprints by the farm and county are shown in Figure 5.1. Sixty-four percent of the M. paratuberculosis isolates (51/80) had the 7g-4ggt repeat fingerprint. Fingerprints of isolates from the same farm were identical for all but 3 farms (Figure 5.1.). One farm, in
Hardin county, had two isolates with different fingerprints: 7g-5ggt and 7g-6ggt. The second farm, in Medina county, had three isolates with different fingerprints: 7g-5ggt,
9g-5ggt and 13g-5ggt. The third farm, also in Medina county, had three positive samples, two of which had the 13g-5ggt fingerprint profile while the third one had the 7g-5ggt profile. All isolates (n=16) from a single farm in Columbiana county that were analyzed using the additional G-repeat loci contained 9 G-residue repeats.
5.5. DISCUSSION
Johne’s disease is a chronic and progressive intestinal disease in ruminants caused by M. paratuberculosis (6). This disease has emerged as one of the most prevalent and costly infectious diseases of dairy cattle in countries around the world (28-31). In addition, controversy regarding potential zoonotic association between M. paratuberculosis and Crohn’s disease persists (22, 35). Due to concerns about animal health, economic considerations and zoonotic potential of paratuberculosis, several countries and many states within the United States have instituted Johne’s disease certification programs for prevention and control of the disease (2, 21, 24, 38, 43).
Adequate diagnostic tests are an essential element of a control program. This necessitates the development of high-throughput, sensitive diagnostic methods for the detection of infected and sub-clinical animals. Knowledge of the extent of strain sharing across
158 different host species is vital to understanding the dynamics of M. paratuberculosis transmission. Methods for differentiation or subtyping of bacterial strains provide important information for molecular epidemiological analyses and help provide an understanding of the population genetics of the organism.
5.5.1. Diagnostics. Diagnosis of Johne’s disease presents a major problem in its prevention and control. Currently, cultivation of M. paratuberculosis from fecal and tissue specimens remains the most definitive method for detecting animals with Johne’s disease. However, culturing for M. paratuberculosis has several disadvantages such as long growth time, long processing time, difficulties in control of contamination on culture media and need for storage of fecal specimens for delayed processing. Serological assays such as ELISA, agar gel immunodiffusion assay, and complement-fixation test, are also commonly used to diagnose paratuberculosis in a herd because of the low cost of the test and rapid availability of test results. However, serological tests are of limited value due to low specificity and sensitivity since antibodies may not be detectable either due to anergy or until their late appearance in the pathogenesis of Johne’s disease (7, 48).
The results of this study indicate that liquid culture followed by molecular confirmation was the most effective approach to detecting and typing M. paratuberculosis isolates in feces from naturally infected cattle. In our analysis, only 27 samples tested positive by all four protocols. Seventy-six of the total 81 positive samples were detected with liquid culture followed by molecular confirmation. All but two of the broth enriched-molecular assay positive samples were positive by at least one of the other
3 protocols. This indicates that the 76 samples detected by molecular analyses were true positives and that the other three protocols are less sensitive than molecular assay of
159 liquid cultures. In addition, the liquid culture-molecular assay positive samples were
detected by 8 weeks post inoculation, which is considerably faster than the 16 week
incubation period required for the other 3 procedures.
In the sedimentation procedure, 5 ml of the suspension, representing
approximately 0.14g, is processed. While in the double centrifugation protocol, 25 ml of
the suspension, representing approximately 0.71g, is processed. This difference in the amount of fecal sample processed is reflected in the total number of positive samples by each protocol. Our results support previous observation that the double centrifugation method was a major improvement in sample processing over the sedimentation method
(40). Of the 76 samples that were positive by molecular detection, 69 were positive for both L1-L9 and 251 while 7 were positive for L1-L9 alone. Since, L1-L9 is a PCR- hybridization assay, its sensitivity is at least two logs greater than that of a PCR assay.
Hence, it is expected that L1-L9 assay will detect more positive samples than 251 assay.
The MB/BacT® system used in this study was designed for detection of M.
tuberculosis from human hosts (37). A recent study has indicated that the sensitivity of
detection of M. paratuberculosis in bovine feces by this system using the double
centrifugation processing method was approximately 103 cfu/g of feces (42). However the efficacy of the MB/BacT® system in detection of M. paratuberculosis in field fecal specimens has not been reported. Although the purpose of this study was not to assess if this system can be used for M. paratuberculosis identification in fecal samples, it is worth
noting that a non-radiometric broth-based system (20, 42) provides an easier, safer and
more cost-effective method for detection of mycobacteria than conventional culturing on
solid media.
160 An advantage of fecal and tissue culture is isolation of specific M. paratuberculosis strains causing the infections. Thus, further studies can be performed to facilitate understanding of the biology and molecular epidemiology of this pathogen. An added advantage of broth over solid media based culture is the relatively short time required to detect M. paratuberculosis (8, 10, 25, 42, 47). Some studies have identified
M. paratuberculosis strains that do not show mycobactin J dependency (1, 26), indicating
that diagnostic tests that rely on mycobactin J dependency alone need to be interpreted
with caution. Use of molecular assays to confirm the identity of the isolates instead of
mycobactin J dependency resolves this discrepancy. Although significant increase in
sensitivity was achieved by coupling early broth cultures with molecular assays, there is a
need for alternative processing procedures. For example, several studies have reported
approximately two log-fold loss of M. paratuberculosis during fecal sample processing
(33, 36, 42). Further investigation for alternative methods to process feces prior to culture
may result in improvement of sensitivity of the reported assays.
5.5.2. Molecular subtyping. Critical to the long-term goal of prevention and
control of Johne’s disease is the control of transmission of M. paratuberculosis on dairy
and beef operations, resulting in improved animal (and potentially public) health.
Molecular epidemiologic applications provide unique and powerful tools to assist in this
endeavor. This study evaluated the potential of short sequence repeat (SSR) analysis to
aid in the characterization of transmission of Johne’s disease on dairy farms, a step
critical to advancements in paratuberculosis research.
This study has identified existence of at least one dominant M. paratuberculosis
sub-type (7g-4ggt) in cattle herds in Ohio as well as the existence of multiple subtypes of
161 M. paratuberculosis on three of the dairy farms with infected cattle. In an attempt to further dissect the M. paratuberculosis sub-types, all isolates from a single farm in
Columbiana county were assessed using an additional G-repeat loci. All sixteen of these isolates which had the 7g-4ggt profile also carried identical number of G repeats in the third SSR loci. This suggests that these isolates may be clonal and that there may be occurrence of inter-herd transmission on this particular farm. Although the addition of the third locus did not break down the alleles identified by the first 2 loci, there may be situations where addition of other SSR loci into the analysis may provide meaningful diversity information.
It is expected that herds with a higher percentage of purchased cattle will have a more diverse subtype M. paratuberculosis population than herds with fewer cattle introductions. However, the information about animal purchases was not available. Also, the movement of the dairy industry toward calf–heifer raising operations may increase the possibility of introduction of infected heifer into an uninfected herd. Some of these calf-heifer raising operation may receive infected animals from a variety of sources that could result in introduction of multiple strains. Application of SSR analysis for strain
differentiation of M. paratuberculosis and development of population genetic frameworks could lead to better understanding of the role of cow to calf and other routes of transmission.
Other DNA-based molecular subtyping techniques such as multiplex PCR for
IS900 integration loci (4, 27), restriction fragment length polymorphism analysis (12,
34), and amplified fragment length polymorphism analysis (27) have been unable to resolve M. paratuberculosis isolates into meaningful epidemiologic groups due to the
162 apparent restricted genetic diversity within the subspecies. In contrast, SSR analyses
enabled high-resolution subtyping of M. paratuberculosis isolates from domestic and
wild animal species and has opened new possibilities for a better understanding of
transmission of M. paratuberculosis clonal populations (19, 26). Since the analysis is
based on DNA sequencing, the results are unambiguous, reproducible, and amenable to
adaptation for high-throughput analysis. Furthermore, SSR analyses will enable accurate
inter-laboratory comparisons to be made and the information used in the development of
SSR databases for further molecular epidemiologic studies.
Since the SSR analysis was performed on a convenient subset of the field samples
submitted to the Ohio ADDL over a 4-week period for routine M. paratuberculosis
culturing, the subtypes do not necessarily represent the natural distribution in Ohio. A
more systematic prospective study involving multiple herds and operation types needs to
be undertaken to evaluate the associations between subtype status and dam-daughter
status or other environmental associations and between introduction of new cattle and
change in subtype distribution through time.
In conclusion, early broth cultures coupled with molecular assay not only improve
sensitivity and reduce time-to-diagnosis of M. paratuberculosis from bovine feces but
can potentially be used to aid in characterization of the transmission of Johne’s disease on
dairy farms. Our preliminary analyses suggest that this approach will be of considerable utility in enabling detailed molecular epidemiologic and population genetic analyses of this important animal pathogen.
163 5.6. ACKNOWLEDGMENT
This article has been reprinted with permission from the Journal of Clinical
Microbiology. Copyright © 2005, American Society for Microbiology. All Rights
Reserved.
The study was supported by state and federal funds appropriated to the Ohio
Agricultural Research and Development Center (OARDC) including an OARDC
Competitive Research Enhancement Seed Grant awarded to S. Sreevatsan.
Collaborative contributions of M. Strother, N.E. Theus, R.W. Stich, B. Byrum,
W.P. Shulaw and V. Kapur are gratefully acknowledged.
5.7. REFERENCES
1. Aduriz, J. J., R. A. Juste, and N. Cortabarria. 1995. Lack of mycobactin dependence of mycobacteria isolated on Middlebrook 7H11 from clinical cases of ovine paratuberculosis. Vet Microbiol 45:211-7.
2. Allworth, M. B., and D. J. Kennedy. 2000. Progress in national control and assurance programs for ovine Johne's disease in Australia. Vet Microbiol 77:415- 22.
3. Amonsin, A., L. L. Li, Q. Zhang, J. P. Bannantine, A. S. Motiwala, S. Sreevatsan, and V. Kapur. 2004. Multilocus Short Sequence Repeat Sequencing Approach for Differentiating among Mycobacterium avium subsp. paratuberculosis Strains. J.Clin.Microbiol. 42:1694-1702.
4. Bull, T. J., J. Hermon-Taylor, I. Pavlik, F. El Zaatari, and M. Tizard. 2000. Characterization of IS900 loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex PCR typing. Microbiology 146 ( Pt 9):2185-2197.
5. Bull, T. J., E. J. McMinn, K. Sidi-Boumedine, A. Skull, D. Durkin, P. Neild, G. Rhodes, R. Pickup, and J. Hermon-Taylor. 2003. Detection and verification of Mycobacterium avium subsp. paratuberculosis in fresh ileocolonic mucosal biopsy specimens from individuals with and without Crohn's disease. J.Clin.Microbiol. 41:2915-23. 164 6. Chiodini, R. J., H. J. Van Kruiningen, and R. S. Merkal. 1984. Ruminant paratuberculosis (Johne's disease): the current status and future prospects. Cornell Vet 74:218-62.
7. Collins, M. T. 1996. Diagnosis of paratuberculosis, p. 357-371. In R. W. Sweeney (ed.), The Veterinary Clinics of North America Food Animal Practice. Paratuberculosis (Johne's Disease). W.B. Saunders Co., Philadelphia, PA.
8. Collins, M. T., K. B. Kenefick, D. C. Sockett, R. S. Lambrecht, J. McDonald, and J. B. Jorgensen. 1990. Enhanced radiometric detection of Mycobacterium paratuberculosis by using filter-concentrated bovine fecal specimens. J.Clin.Microbiol. 28:2514-9.
9. Collins, M. T., and D. C. Sockett. 1993. Accuracy and economics of the USDA- licensed enzyme-linked immunosorbent assay for bovine paratuberculosis. J Am Vet Med Assoc 203:1456-63.
10. Cousins, D. V., R. J. Evans, and B. R. Francis. 1995. Use of BACTEC radiometric culture method and polymerase chain reaction for the rapid screening of faeces and tissues for Mycobacterium paratuberculosis. Aust Vet J 72:458-62.
11. Cousins, D. V., R. Whittington, I. Marsh, A. Masters, R. J. Evans, and P. Kluver. 1999. Mycobacteria distinct from Mycobacterium avium subsp. paratuberculosis isolated from the faeces of ruminants possess IS900-like sequences detectable IS900 polymerase chain reaction: implications for diagnosis. Mol.Cell.Probes 13:431-442.
12. Cousins, D. V., S. N. Williams, A. Hope, and G. J. Eamens. 2000. DNA fingerprinting of Australian isolates of Mycobacterium avium subsp paratuberculosis using IS900 RFLP. Aust.Vet.J. 78:184-190.
13. Daniels, M. J., M. R. Hutchings, P. M. Beard, D. Henderson, A. Greig, K. Stevenson, and J. M. Sharp. 2003. Do non-ruminant wildlife pose a risk of paratuberculosis to domestic livestock and vice versa in Scotland? J.Wildl.Dis. 39:10-5.
14. Daniels, M. J., M. R. Hutchings, and A. Greig. 2003. The risk of disease transmission to livestock posed by contamination of farm stored feed by wildlife excreta. Epidemiol Infect 130:561-8.
15. Dargatz, D. A., B. A. Byrum, L. K. Barber, R. W. Sweeney, R. H. Whitlock, W. P. Shulaw, R. H. Jacobson, and J. R. Stabel. 2001. Evaluation of a
165 commercial ELISA for diagnosis of paratuberculosis in cattle. J.Am.Vet.Med.Assoc 218:1163-6.
16. El Zaatari, F. A., M. S. Osato, and D. Y. Graham. 2001. Etiology of Crohn's disease: the role of Mycobacterium avium paratuberculosis. Trends Mol.Med. 7:247-252.
17. Englund, S., G. Bolske, and K. E. Johansson. 2002. An IS900-like sequence found in a Mycobacterium sp. other than Mycobacterium avium subsp. paratuberculosis. FEMS Microbiol.Lett 209:267-71.
18. Ferreira, R., L. S. Fonseca, and W. Lilenbaum. 2002. Agar gel immunodiffusion test (AGID) evaluation for detection of bovine paratuberculosis in Rio de Janeiro, Brazil. Lett Appl Microbiol 35:173-5.
19. Ghadiali, A. H., M. Strother, S. A. Naser, E. J. Manning, and S. Sreevatsan. 2004. Mycobacterium avium subsp. paratuberculosis Strains Isolated from Crohn's Disease Patients and Animal Species Exhibit Similar Polymorphic Locus Patterns. J.Clin.Microbiol 42:5345-5348.
20. Grant, I. R., R. B. Kirk, E. Hitchings, and M. T. Rowe. 2003. Comparative evaluation of the MGIT and BACTEC culture systems for the recovery of Mycobacterium avium subsp. paratuberculosis from milk. J Appl Microbiol 95:196-201.
21. Groenendaal, H., M. Nielen, and J. W. Hesselink. 2003. Development of the Dutch Johne's disease control program supported by a simulation model. Prev Vet Med 60:69-90.
22. Hermon-Taylor, J. 2001. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn's disease. Gut 49:755-757.
23. Kalis, C. H., H. W. Barkema, J. W. Hesselink, C. van Maanen, and M. T. Collins. 2002. Evaluation of two absorbed enzyme-linked immunosorbent assays and a complement fixation test as replacements for fecal culture in the detection of cows shedding Mycobacterium avium subspecies paratuberculosis. J Vet Diagn Invest 14:219-24.
24. Kennedy, D. J., and M. B. Allworth. 2000. Progress in national control and assurance programs for bovine Johne's disease in Australia. Vet Microbiol 77:443-51.
166 25. Kim, S. G., S. J. Shin, R. H. Jacobson, L. J. Miller, P. R. Harpending, S. M. Stehman, C. A. Rossiter, and D. A. Lein. 2002. Development and application of quantitative polymerase chain reaction assay based on the ABI 7700 system (TaqMan) for detection and quantification of Mycobacterium avium subsp. paratuberculosis. J.Vet.Diagn.Invest. 14:126-131.
26. Motiwala, A. S., A. Amonsin, M. Strother, E. J. Manning, V. Kapur, and S. Sreevatsan. 2004. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis isolates recovered from wild animal species. J.Clin.Microbiol. 42:1703-1712.
27. Motiwala, A. S., M. Strother, A. Amonsin, B. Byrum, S. A. Naser, J. R. Stabel, W. P. Shulaw, J. P. Bannantine, V. Kapur, and S. Sreevatsan. 2003. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis: evidence for limited strain diversity, strain sharing, and identification of unique targets for diagnosis. J.Clin.Microbiol. 41:2015-26.
28. National Academy of Sciences Report. Diagnosis and Control of Johne's Disease (2003). http://books.nap.edu/openbook/0309086116/html/index.html.
29. National Animal Health Monitoring System. 1997. Johne's disease on U. S. dairy operations. Report N245.1087. USDA, APHIS, VS, CEAH, National Animal Health Monitoring System, Fort Collins, Colorado.
30. Nielsen, S. S., C. Gronbaek, J. F. Agger, and H. Houe. 2002. Maximum- likelihood estimation of sensitivity and specificity of ELISAs and faecal culture for diagnosis of paratuberculosis. Prev.Vet.Med. 53:191-204.
31. Ott, S. L., S. J. Wells, and B. A. Wagner. 1999. Herd-level economic losses associated with Johne's disease on US dairy operations. Prev.Vet.Med. 40:179-92.
32. Ott, S. L., S. J. Wells, and B. A. Wagner. 1999. Herd-level economic losses associated with Johne's disease on US dairy operations. Prev Vet Med 40:179-92.
33. Ozbek, A., F. C. Michel, M. Strother, A. S. Motiwala, B. R. Byrum, W. P. Shulaw, C. G. Thornton, and S. Sreevatsan. 2003. Evaluation of two recovery methods for detection of Mycobacterium avium subsp. paratuberculosis by PCR: direct-dilution--centrifugation and C(18)-carboxypropylbetaine processing. FEMS Microbiol Lett 229:145-51.
34. Pavlik, I., A. Horvathova, L. Dvorska, J. Bartl, P. Svastova, M. R. du, and I. Rychlik. 1999. Standardisation of restriction fragment length polymorphism
167 analysis for Mycobacterium avium subspecies paratuberculosis. J.Microbiol.Methods 38:155-167.
35. Quirke, P. 2001. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn's disease. Gut 49:757-760.
36. Reddacliff, L. A., A. Vadali, and R. J. Whittington. 2003. The effect of decontamination protocols on the numbers of sheep strain Mycobacterium avium subsp. paratuberculosis isolated from tissues and faeces. Vet Microbiol 95:271- 82.
37. Rohner, P., B. Ninet, C. Metral, S. Emler, and R. Auckenthaler. 1997. Evaluation of the MB/BacT system and comparison to the BACTEC 460 system and solid media for isolation of mycobacteria from clinical specimens. J Clin Microbiol 35:3127-31.
38. Sockett, D. C. 1996. Johne's disease eradication and control: regulatory implications. Vet Clin North Am Food Anim Pract 12:431-40.
39. Sockett, D. C., T. A. Conrad, C. B. Thomas, and M. T. Collins. 1992. Evaluation of four serological tests for bovine paratuberculosis. J Clin Microbiol 30:1134-9.
40. Stabel, J. R. 1997. An improved method for cultivation of Mycobacterium paratuberculosis from bovine fecal samples and comparison to three other methods. J Vet Diagn Invest 9:375-80.
41. Stabel, J. R., T. L. Bosworth, T. A. Kirkbride, R. L. Forde, and R. H. Whitlock. 2004. A simple, rapid, and effective method for the extraction of Mycobacterium paratuberculosis DNA from fecal samples for polymerase chain reaction. J Vet Diagn Invest 16:22-30.
42. Stich, R. W., B. Byrum, B. Love, N. Theus, L. Barber, and W. P. Shulaw. 2004. Evaluation of an automated system for non-radiometric detection of Mycobacterium avium paratuberculosis in bovine feces. J.Microbiol.Methods 56:267-75.
43. Tharaldsen, J., B. Djonne, B. Fredriksen, O. Nyberg, and O. Siguroardottir. 2003. The National Paratuberculosis Program in Norway. Acta Vet Scand 44:243- 6.
168 44. Whipple, D. L., D. R. Callihan, and J. L. Jarnagin. 1991. Cultivation of Mycobacterium paratuberculosis from bovine fecal specimens and a suggested standardized procedure. J Vet Diagn Invest 3:368-73.
45. Whitlock, R. H., and C. Buergelt. 1996. Preclinical and clinical manifestations of paratuberculosis (including pathology). Vet.Clin.North Am.Food Anim Pract. 12:345-356.
46. Whitlock, R. H., S. J. Wells, R. W. Sweeney, and J. Van Tiem. 2000. ELISA and fecal culture for paratuberculosis (Johne's disease): sensitivity and specificity of each method. Vet Microbiol 77:387-98.
47. Whittington, R. J., I. Marsh, M. J. Turner, S. McAllister, E. Choy, G. J. Eamens, D. J. Marshall, and S. Ottaway. 1998. Rapid detection of Mycobacterium paratuberculosis in clinical samples from ruminants and in spiked environmental samples by modified BACTEC 12B radiometric culture and direct confirmation by IS900 PCR. J.Clin.Microbiol. 36:701-707.
48. Whittington, R. J., and E. S. Sergeant. 2001. Progress towards understanding the spread, detection and control of Mycobacterium avium subsp. paratuberculosis in animal populations. Aust.Vet.J. 79:267-278.
169 Figure 5.1.
Distribution of short sequence repeat fingerprints of M. paratuberculosis isolates from Ohio. Open diamonds indicate the counties from which samples were obtained.
Closed circles indicate the counties from which a sample was found to be M. paratuberculosis positive. The alleles are indicated by the number of G repeats followed by the number of GGT repeats. When samples were obtained from more one than one farm in a county, they are indicated as F1, F2 and so on. The number of isolates from a particular farm is one unless otherwise indicated by a number in parenthesis.
170
171
Liquid-solid Liquid culture and double culture molecular conformation
22 22
313 318 27 33
17 12 6 0 Sedimentation Double centrifugation Sedimentation Double centrifugation processing processing processing processing
Liquid culture and Liquid culture and molecular confirmation molecular confirmation
7 2
633 11 23 30 40
12 22 0 0 Sedimentation Liquid-solid Double centrifugation Liquid-solid processing double culture processing double culture
Figure 5.2.
Identification of M. paratuberculosis in fecal samples by sedimentation processing, double centrifugation processing, liquid-solid double culture and liquid culture followed
by molecular confirmation.
172
Sedimentation Double centrifugation Liquid-solid
processing processing double culture
+ - + - + -
Liquid culture + 36 40 51 25 63 13 and molecular confirmation - 1 163 2 162 2 162
κ-score 0.54 0.72 0.84
Table 5.1. Shown are the contingency tables for sedimentation processing, double centrifugation processing and liquid-solid double culture compared to liquid culture followed by molecular confirmation and the respective kappa-coefficients.
173 CHAPTER 6
TRANSCRIPTIONAL ANALYSIS OF HUMAN MACROPHAGES EXPOSED TO
HUMAN AND BOVINE STRAINS OF MYCOBACTERIUM AVIUM SUBSP.
PARATUBERCULOSIS REVEALS DISTINCT PROFILES.
6.1. ABSTRACT
Interactions between Mycobacterium avium subsp. paratuberculosis and host macrophages represent critical early events in the pathogenesis of Johne’s disease. We present the first report on genome-wide characterization of the transcriptional changes within THP-1 cells (a human macrophage cell line) in response to a cattle and human strain of M. paratuberculosis. We identified several host genes that were differentially expressed during early intracellular stage of infection. These included genes that are known to be regulated differentially in response to many other bacterial pathogens such as tumor necrosis factor, interleukin-6 receptor and interleukin-1β. We also identified genes that appeared to be differentially regulated in response to the two strains of M. paratuberculosis. Cattle strain induced a host response similar to the un-infected control and succeeded in down-regulating most pro-inflammatory pathways while the human strain suppressed the common phagosome-lysosome pathway but did not successfully
174 suppress inflammation. Global analysis of the early host responses is suggestive of variations dependent on genotype of the infecting M. paratuberculosis strain.
6.2. INTRODUCTION
Crohn's disease is a systemic inflammatory disease characterized by an
uncontrolled chronic inflammatory response (2, 28). Although it primarily affects the
gastrointestinal tract, extra-intestinal symptoms are often exhibited (3, 23). There are
approximately 500,000 people in the United States who suffer from Crohn’s disease (2).
Currently, no therapies exist for Crohn’s disease and most medical treatments aim to
suppress the symptoms. Many theories have been proposed to explain the etiology of
Crohn’s disease, which appears to be associated with multiple factors for its pathological
presentation (12, 25, 27). One popular infectious etiology that has been extensively
investigated is that the disease is caused by a bacterial infection, with the principal suspect being mycobacteria, and more specifically, Mycobacterium avium subsp. paratuberculosis (M. paratuberculosis) (10, 21, 22, 26). Recently, there have been several advances in understanding this organism, and there is indication that at least some cases of Crohn's disease, are associated with M. paratuberculosis infection (4, 29).
Although strain sharing has been demonstrated, a causal link remains controversial (9).
It is widely acknowledged that there are at least two phenotypically and
genotypically distinct M. paratuberculosis strains associated with different disease
characteristics (24, 36). An analysis of a highly polymorphic repetitive locus within M.
paratuberculosis isolates from several hosts, geographic localities and time points
demonstrated that M. paratuberculosis is a diverse group of organisms and opened the
175 possibility of identifying a non-random distribution of persistent and rapidly spreading
strain(s) amongst animal (and human) populations (1, 19). Polymorphic repeats analysis
of M. paratuberculosis isolates from Crohn’s disease patients identified a subset of
genotypes associated with animal disease among the human strains implying the
existence of human disease-associated genotypes and strain sharing with animals (9).
Available data supports the hypothesis that M. paratuberculosis strains from different
host species that appeared indistinguishable by previous strain-differentiation techniques
are in fact distinct and may have differences in their phenotypes that reflect a variation in
biological function and/or host adaptation.
Host–pathogen relationships are characterized by the complex interplay between
host defense mechanisms and attempts to circumvent these defenses by microorganisms
(8, 13). Much of the M. paratuberculosis-host interaction takes place within
macrophages. While no satisfactory animal models are currently available for studying
M. paratuberculosis infection and pathogenesis, tissue-culture models offer a practical
alternative. Human macrophages, both from primary cultures and from transformed
monocytic cell lines such as THP-1, have been used as a model of early stages of infection as well as for measurement of intracellular growth rates of M. tuberculosis isolates (15, 18, 30, 31, 37).
To investigate the contention that differences in fingerprint profiles would
translate to functional and biomedically significant attributes such as variance in host
preference and/or difference in magnitude of infections, we undertook a global scale
analysis of diverse M. paratuberculosis genotypes isolated from a cattle and human host
using DNA microarrays. In comparing the expression patterns induced in response to
176 each strain, we identified host genes specifically induced or repressed in response to each
strain as well as genes that are part of a common theme in immune responses induced by
many or all bacterial pathogens.
6.3. MATERIAL AND METHODS
6.3.1. Bacterial cultures. M. paratuberculosis isolates selected for analysis had
been previously characterized using several molecular techniques and were representative
of the cattle and human isolates (1, 19, 20) (Table 1). The isolates were cultured, in
duplicate, on MB7H9 plates (Becton Dickinson, Sparks, MD) supplemented with OADC
enrichment medium and mycobactin J. After 3-4 weeks of incubation at 37ºC, several
loopfuls of growth was inoculated in MB7H9 broth (Becton Dickinson, Sparks, MD) supplemented with OADC enrichment medium and mycobactin J. The broth cultures were placed on a shaker during incubation to allow uniform growth. Optical density at
600 nm (OD600) was determined for five day-old cultures to obtain the colony forming
9 units (cfu) of the mycobacteria (0.3 OD600=10 cfu/ml; Dr. C.C. Wu, personal communication).
6.3.2. Macrophages (THP-1 cells). The human monocytic-like cell line, THP-1, was obtained from American Type Culture Collection (Rockville, MD). Cell cultures were maintained in modified RPMI 1640 medium (ATCC, Rockville, MD), supplemented with 10% fetal bovine serum (ATCC, Rockville, MD) and antibiotic- antimycotic mixture containing penicillin (100 U/ml), streptomycin (100 µg/ml) and amphotericin B (0.25µg/ml) (Gibco-BRL, division of Invitrogen Corporation, Carlsbad,
CA) at 37°C in 5% CO2 in a humidified incubator. Equal volume of fresh media was
177 added on every third day and the cells were split every sixth day, at an approximate
density of 2 x 105 cells/ml. Cell culture medium without antibiotic-antimycotic
supplementation was used at least 24 hours prior to infection to relieve the THP-1 cells of
the antibiotics and antimycotic agents.
6.3.3. Infections. Bacterial to cell ratio of 5:1 was used for infecting
approximately 107 THP-1 cells. Sterile MB7H9 broth was used as control. Infections
were carried out in duplicate using two separate broth cultures for both M. paratuberculosis isolate analyzed. Control stimulationswere also performed in duplicate.
The cell suspension was processed for RNA extraction 2 hours post-infection.
6.3.4. cRNA target preparation and array hybridization. RNA was extracted from the macrophages by using 2 ml of TRIzol Reagent (Invitrogen Corporation,
Carlsbad, CA) according to the manufacturer’s instructions. The RNA was further purified with RNeasy Midi columns (Qiagen, Valencia, CA). RNA quality and purity were examined using Bioanalyzer 2100 (Agilent Technologies, Inc., Palo Alto, CA).
Total RNA was processed to cRNA, labeled, and hybridized, according to standard
Affymetrix protocols, to Human Genome U133 Plus 2.0 oligonucleotide array containing probesets for 54,600 transcripts (Affymetrix, Santa Clara, CA) (17). Scanned output files
were visually inspected for hybridization artifacts. A total of six microarray hybridizations representing the biological duplicates of THP-1 cells infected with the human and bovine M. paratuberculosis strains and uninfected control were analyzed.
6.3.5. Microarray data analysis. Gene expression levels were estimated from
GeneChip PM probe intensities as described in (11) using an enhanced version of the Li-
Wong PM-only algorithm (14). The enhanced algorithm: 1) applies quantile scaling to all
178 PM and MM probe intensities in order to minimize between-array differences in the
scaled probe intensity distributions; 2) applies between-array regression analysis to
estimate PM-specific sensitivities, excluding any PM probes that fail to show
significantly positive sensitivities; 3) estimates gene expression levels by regressing
scaled PM probe intensities on estimated PM probe sensitivities, excluding any PM
probes that show significant non-monospecificity. A fold change was calculated for the
duplicate sets of data within the groups using the average gene expression levels. To
eliminate potentially insignificant changes, only 2.5 fold or greater differences were
evaluated.
6.3.6. RT-PCR assays. Reverse transcription (RT) and PCR were used to
validate the microarray data corresponding to the expression profiles of selected genes.
Targets for amplification were selected from within the Affymetrix exemplar sequence
region and were compared by BlastN to all other sequences in the GenBank to ensure
fidelity. Primers were selected to obtain an amplicon of approximately 125bp length with
Tm of at least 60ºC. The targets analyzed and the corresponding primer pairs are enlisted
in table 2. Single step real time RT-PCR reactions were performed using the QuantiTect
SYBR Green RT-PCR kit (Qiagen, Valencia, CA) as recommended by the manufacturer.
Each reaction mixture contained 10µl of master mix, 0.2 µl of RT mix, 5 pmol of each
primer and 75 ng of template RNA. Control reactions were done without RT mix to
ensure that there was no contaminating DNA in the RNA samples being assayed. Each
-∆∆C amplicon was assessed for specificity by a melting curve analysis. The 2 T method was
used to analyze the relative changes in gene expression from the real-time quantitative
PCR data normalized against β-actin expression levels (16).
179 6.4. RESULTS
Unsupervised hierarchical cluster analysis of all six samples showed that the
THP-1 cells infected with the human strain grouped separately from those infected with the bovine strain and the uninfected control. At 2 hours after addition of M.
paratuberculosis to the THP-1 cells, a total of 86 genes were found to be differentially
expressed with fold change 2.5 or greater.
6.4.1. Genes similarly regulated in THP-1 cells infected with human and
bovine M. paratuberculosis strains. Sixty genes were similarly regulated in the infected macrophages as compared to the un-infected control (Table 6.3.). Sixteen genes were up regulated in THP-1 cells infected with either human or cattle M. paratuberculosis strain
while 44 genes were down regulated in THP-1 cells infected with either human or cattle
M. paratuberculosis strain. The genes similarly expressed were classified into functional
categories including antimicrobial humoral response , inflammatory response, negative
regulation of transcription, cell adhesion, cell-cell signaling, signal transduction, negative
regulation of cell proliferation, regulation of cell cycle, anti-apoptosis, actin binding and
actin filament polymerization, cell-matrix adhesion, protein biosynthesis, protein folding,
protein transport, lipid metabolism, one-carbon compound metabolism, and tricarboxylic
acid cycle.
6.4.2. Genes differentially regulated in THP-1 cells infected with human and
bovine M. paratuberculosis strains. Twenty six genes were differentially regulated in
THP-1 cells infected with either human or cattle M. paratuberculosis strain (Table 6.4.).
Of these, twenty one genes were down-regulated in THP-1 cells infected with cattle M.
paratuberculosis strain while they were up-regulated in THP-1 cells infected with the
180 human M. paratuberculosis strain. These genes were classified into functional categories including DNA replication, negative regulation of cell cycle, RNA splicing, regulation of transcription, signal transduction, intracellular signaling cascade, protein amino acid phosphorylation, proteolysis and peptidolysis, protein complex assembly, intracellular protein transport, lipid catabolism, endocytosis, electron transport and response to stress.
Five genes were up-regulated in THP-1 cells infected with cattle M. paratuberculosis strain while they were down-regulated in THP-1 cells infected with the human M. paratuberculosis strain. These genes were classified into functional categories including signal transduction, intracellular signaling cascade, protein amino acid phosphorylation, response to oxidative stress, superoxide metabolism, calcium-mediated signaling, cell cycle arrest, cell motility, cell-cell signaling, induction of positive chemotaxis, negative regulation of cell proliferation, neutrophil activation, neutrophil chemotaxis, regulation of cell adhesion, ion transport.
6.4.3. Analysis of altered gene expression by RT-PCR analysis. To ensure that the microarray data represented real changes in expression, we used semi- quantitative real time RT-PCR for four representative genes to validate the changes
(Table 6.2.). Overall the responses were qualitatively similar to those observed in the
microarray analysis, indicating that the two independent methods supported each other.
6.5. DISCUSSION
Paratuberculosis or Johne’s disease is an infectious disease occurring worldwide,
largely in cattle, goats and sheep but also in wild ruminants (21). The causative agent of
Johne’s disease, M. paratuberculosis, is an intracellular pathogen that is adapted to infect
181 and persist with host tissues. Among the first steps in infection with mycobacteria is
phagocytosis of the bacteria by the macrophages. During these early stages of infection, a
key determinant of virulence is the ability to enter and replicate within the phagosome,
thereby evading the natural host defense mechanisms (6, 33). In the contest for survival
between the host and pathogen, complex cell mediated immune responses are elicited (7,
32).
Several studies have presented data on effects of a single strain of M.
paratuberculosis on host macrophages obtained at different clinical stages (5). However, the effects of the genotype of the infecting bacteria on host gene expression have yet to be clearly defined. It was therefore of interest to examine the transcriptional changes that occur within infected macrophages and identify genes that are induced or repressed in response to different strains of M. paratuberculosis. The THP-1 human macrophage cell line provided a convenient cell culture model system for these experiments, as it has been used widely in the past for studies of other mycobacteria (15, 18, 30, 31, 37). Based on our microscopic observations at 0 minutes, 30 minutes, 1 hour, 2 hours and 4 hours post- infection, at 2 hours post infection all strains of M. paratuberculosis used in this analysis were phagocytosed or in the process of being phagocytosed by the THP-1 cells (data not shown). This time point, thus, represented early infection across all M. paratuberculosis isolates and was chosen for the transcriptional analysis.
We identified several host genes that were differentially expressed during this intracellular stage of infection. These loci included both genes known to be differentially regulated in response to many other bacterial pathogens such as tumor necrosis factor, interleukin-6 receptor and interleukin-1β and those that appear to be differentially
182 regulated in response to different strains of M. paratuberculosis such interleukin-8, superoxide dismutase and epidermal growth factor receptor. Hierarchical clustering of the
expression profiles suggested that the expression profiles in THP-1 cells infected with the
cattle strain was similar to that in the un-infected control but differed from that in THP-1
cells infected with the human M. paratuberculosis strain.
The data suggests that the genotype carried by the bovine strain succeeds in
down-regulating most pro-inflammatory pathways while the genotype represented by the
human strain suppresses the common phagosome-lysosome pathway but does not
successfully suppress inflammation. Thus, the early host responses are suggestive of
variations dependent on genotype of the infecting strains. Whether these represent true
genotype-dependent variation or reflect the time required for a particular genotype to
establish infection warrants additional studies.
A broad survey of gene expression changes by cDNA microarray analysis can
define target genes for further study. We observed differences in M. paratuberculosis
strains across genes from a single pathway. For example, the expression levels of tumor
necrosis factor and interleukin-1 , which are involved in the MAPK signaling pathway
was elevated in the THP-1 cells infected with the human M. paratuberculosis strain as
compared to the THP-1 cells infected with the cattle M. paratuberculosis strain. This
suggests that expression of genes identified as potentially important by microarray
analysis may then be followed by RT-PCR in a large sample population at a reasonable
cost.
A global analysis of gene expression changes by cDNA microarray analysis thus
allowed simultaneous detection and quantification of differential expression of thousands
183 of genes as well as investigation of many different molecular pathways. Examination of these transcriptional differences can lead us to targets to understand the genotype- phenotype associations that translate into biologically significant issues such as virulence, disease phenotypes and velocity of spread. Additional microarray analyses for M. paratuberculosis strains from other host species are underway. Further characterization of the transcriptional differences by analysis of expression of key cytokines by ELISA and comparative proteomics are planned.
6.6. ACKNOWLEDGMENT
Assistance in microarray data analysis by Syed B. Mohiddin is gratefully acknowledged. This study was supported by OARDC Competitive Research
Enhancement Grants and the Johne’s disease integrated program grant (USDA-
NRICAP).
6.7. REFERENCES
1. Amonsin, A., L. L. Li, Q. Zhang, J. P. Bannantine, A. S. Motiwala, S. Sreevatsan, and V. Kapur. 2004. Multilocus Short Sequence Repeat Sequencing Approach for Differentiating among Mycobacterium avium subsp. paratuberculosis Strains. J.Clin.Microbiol. 42:1694-1702.
2. Ashford D, Imhoff B, Angulo F, and C. the FoodNet working group, Atlanta, GA. October 2001. "Over a Half-Million Persons May Have Crohn's Disease in the United States". Infectious Diseases Society of America. San Francisco, CA.
3. Bradley, P. J., A. Ferlito, K. O. Devaney, and A. Rinaldo. 2004. Crohn's disease manifesting in the head and neck. Acta Otolaryngol 124:237-41.
4. Bull, T. J., E. J. McMinn, K. Sidi-Boumedine, A. Skull, D. Durkin, P. Neild, G. Rhodes, R. Pickup, and J. Hermon-Taylor. 2003. Detection and verification
184 of Mycobacterium avium subsp. paratuberculosis in fresh ileocolonic mucosal biopsy specimens from individuals with and without Crohn's disease. J.Clin.Microbiol. 41:2915-23.
5. Caetano-Anolles, G., B. J. Bassam, and P. M. Gresshoff. 1991. DNA amplification fingerprinting using very short arbitrary oligonucleotide primers. Biotechnology (N Y) 9:553-7.
6. Clemens, D. L., and M. A. Horwitz. 1995. Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J.Exp.Med 181:257-70.
7. Coussens, P. M. 2004. Model for immune responses to Mycobacterium avium subspecies paratuberculosis in cattle. Infect.Immun 72:3089-96.
8. Fortunato, E. A., A. K. McElroy, I. Sanchez, and D. H. Spector. 2000. Exploitation of cellular signaling and regulatory pathways by human cytomegalovirus. Trends Microbiol 8:111-9.
9. Ghadiali, A. H., M. Strother, S. A. Naser, E. J. Manning, and S. Sreevatsan. 2004. Mycobacterium avium subsp. paratuberculosis strains isolated from Crohn's Disease patients and animal species exhibit similar polymorphic locus patterns. J.Clin.Microbiol. 42:5345-5348.
10. Hermon-Taylor, J. 2001. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn's disease. Gut 49:755-757.
11. Huang, Y., M. Prasad, W. J. Lemon, H. Hampel, F. A. Wright, K. Kornacker, V. LiVolsi, W. Frankel, R. T. Kloos, C. Eng, N. S. Pellegata, and A. de la Chapelle. 2001. Gene expression in papillary thyroid carcinoma reveals highly consistent profiles. Proc.Natl.Acad.Sci. USA 98:15044-9.
12. Hugot, J. P., M. Chamaillard, H. Zouali, S. Lesage, J. P. Cezard, J. Belaiche, S. Almer, C. Tysk, C. A. O'Morain, M. Gassull, V. Binder, Y. Finkel, A. Cortot, R. Modigliani, P. Laurent-Puig, C. Gower-Rousseau, J. Macry, J. F. Colombel, M. Sahbatou, and G. Thomas. 2001. Association of NOD2 leucine- rich repeat variants with susceptibility to Crohn's disease. Nature 411:599-603.
13. Knodler, L. A., J. Celli, and B. B. Finlay. 2001. Pathogenic trickery: deception of host cell processes. Nat.Rev.Mol.Cell.Biol 2:578-88.
185 14. Li, C., and W. Hung Wong. 2001. Model-based analysis of oligonucleotide arrays: model validation, design issues and standard error application. Genome Biol 2:RESEARCH0032.
15. Li, Q., C. C. Whalen, J. M. Albert, R. Larkin, L. Zukowski, M. D. Cave, and R. F. Silver. 2002. Differences in rate and variability of intracellular growth of a panel of Mycobacterium tuberculosis clinical isolates within a human monocyte model. Infect.Immun 70:6489-93.
16. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-8.
17. Lockhart, D. J., H. Dong, M. C. Byrne, M. T. Follettie, M. V. Gallo, M. S. Chee, M. Mittmann, C. Wang, M. Kobayashi, H. Horton, and E. L. Brown. 1996. Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat.Biotechnol 14:1675-80.
18. Manca, C., L. Tsenova, C. E. Barry, 3rd, A. Bergtold, S. Freeman, P. A. Haslett, J. M. Musser, V. H. Freedman, and G. Kaplan. 1999. Mycobacterium tuberculosis CDC1551 induces a more vigorous host response in vivo and in vitro, but is not more virulent than other clinical isolates. J.Immunol 162:6740-6.
19. Motiwala, A. S., A. Amonsin, M. Strother, E. J. Manning, V. Kapur, and S. Sreevatsan. 2004. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis isolates recovered from wild animal species. J.Clin.Microbiol. 42:1703-1712.
20. Motiwala, A. S., M. Strother, A. Amonsin, B. Byrum, S. A. Naser, J. R. Stabel, W. P. Shulaw, J. P. Bannantine, V. Kapur, and S. Sreevatsan. 2003. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis: evidence for limited strain diversity, strain sharing, and identification of unique targets for diagnosis. J.Clin.Microbiol. 41:2015-26.
21. National Academy of Sciences Report. Diagnosis and Control of Johne's Disease (2003). http://books.nap.edu/openbook/0309086116/html/index.html.
22. Ohkusa, T., T. Nomura, and N. Sato. 2004. The role of bacterial infection in the pathogenesis of inflammatory bowel disease. Intern.Med 43:534-9.
23. Omori, H., H. Asahi, Y. Inoue, T. Irinoda, and K. Saito. 2004. Pulmonary involvement in Crohn's disease report of a case and review of the literature. Inflamm Bowel Dis 10:129-34. 186 24. Pavlik, I., L. Bejckova, M. Pavlas, Z. Rozsypalova, and S. Koskova. 1995. Characterization by restriction endonuclease analysis and DNA hybridization using IS900 of bovine, ovine, caprine and human dependent strains of Mycobacterium paratuberculosis isolated in various localities. Vet Microbiol 45:311-8.
25. Possible link between Crohn's disease and Paratuberculosis. Report of the Scientific Committee on Animal Health and Animal Welfare. March 2000. http://gpvec.unl.edu/avc/IssuePapers/out38_en.pdf.
26. Quirke, P. 2001. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn's disease. Gut 49:757-760.
27. Rubery, E. A review of the evidence for a link between exposure to Mycobacterium paratuberculosis and Crohn's disease in humans. A report for the U.K. Foods Standards Agency. January, 2002. http://www.foodstandards.gov.uk/multimedia/pdfs/mapcrohnreport.pdf.
28. Scholmerich, J. 2003. Inflammatory bowel disease. Endoscopy 35:164-70.
29. Schwartz, D., I. Shafran, C. Romero, C. Piromalli, J. Biggerstaff, N. Naser, W. Chamberlin, and S. A. Naser. 2000. Use of short-term culture for identification of Mycobacterium avium subsp. paratuberculosis in tissue from Crohn's disease patients. Clin.Microbiol.Infect. 6:303-307.
30. Theus, S. A., M. D. Cave, and K. D. Eisenach. 2004. Activated THP-1 cells: an attractive model for the assessment of intracellular growth rates of Mycobacterium tuberculosis isolates. Infect.Immun 72:1169-73.
31. Theus, S. A., M. D. Cave, and K. D. Eisenach. 2005. Intracellular macrophage growth rates and cytokine profiles of Mycobacterium tuberculosis strains with different transmission dynamics. J.Infect.Dis 191:453-60.
32. Tooker, B. C., J. L. Burton, and P. M. Coussens. 2002. Survival tactics of M. paratuberculosis in bovine macrophage cells. Vet.Immunol.Immunopathol 87:429-37.
33. Via, L. E., D. Deretic, R. J. Ulmer, N. S. Hibler, L. A. Huber, and V. Deretic. 1997. Arrest of mycobacterial phagosome maturation is caused by a block in vesicle fusion between stages controlled by rab5 and rab7. J.Biol.Chem 272:13326-31.
187 34. Whittington, R., I. Marsh, E. Choy, and D. Cousins. 1998. Polymorphisms in IS1311, an insertion sequence common to Mycobacterium avium and M. avium subsp. paratuberculosis, can be used to distinguish between and within these species. Mol.Cell.Probes 12:349-358.
35. Whittington, R. J., I. B. Marsh, and R. H. Whitlock. 2001. Typing of IS1311 polymorphisms confirms that bison (Bison bison) with paratuberculosis in Montana are infected with a strain of Mycobacterium avium subsp. paratuberculosis distinct from that occurring in cattle and other domesticated livestock. Mol.Cell.Probes 15:139-45.
36. Whittington, R. J., C. A. Taragel, S. Ottaway, I. Marsh, J. Seaman, and V. Fridriksdottir. 2001. Molecular epidemiological confirmation and circumstances of occurrence of sheep (S) strains of Mycobacterium avium subsp. paratuberculosis in cases of paratuberculosis in cattle in Australia and sheep and cattle in Iceland. Vet Microbiol 79:311-22.
37. Zhang, M., J. Gong, Z. Yang, B. Samten, M. D. Cave, and P. F. Barnes. 1999. Enhanced capacity of a widespread strain of Mycobacterium tuberculosis to grow in human macrophages. J.Infect.Dis 179:1213-7.
188
Isolate ID M6 1018 References
Host species human cattle
Geographic location† Florida New York
MPIL1 A18 A18 (20)
AFLP2 Z10 Z9 (20)
IS1311 cattle-type cattle-type (34, 35)
MLSSR locus 1 (G-repeat)3 7 7 (1, 9, 19)
MLSSR locus 8 (GGT-repeat) 5 4 (1, 9, 19)
MLSSR locus 2 (G-repeat) 11 10 (1, 9, 19)
Table 6.1. Genotypic characteristic of the M. paratuberculosis isolates analyzed.
†: location of host at time to sample collection; *: Not analyzed; 1: Multiplex PCR for
IS900 loci; 2: Amplified fragment length polymorphism; 3: Multi-locus short sequence repeat
189
Gene Gene Title Forward primer Reverse primer
symbol
ACTB actin, beta tgatatcgccgcgctcgtcg ccatcacgccctggtgcctg
NFKBIA nuclear factor of kappa ccaactacaatggccacac ggcagtccggccattaca
light polypeptide gene
enhancer in B-cells
inhibitor, alpha
TNF tumor necrosis factor (TNF ctacagctttgatccctgac gaggaaggcctaaggtcca
superfamily, member 2)
IL1β interleukin 1, beta atgtggactcaatccctagg ttagcactaccctaaggcag
CRK v-crk sarcoma virus CT10 gacttcagctgagtatagtt gcttatataaactagactgct
oncogene homolog (avian)
Table 6.2. RT-PCR targets analyzed and the corresponding primer pairs.
190
Human Cattle Gene Gene name strain strain symbol MAIL Molecule possessing ankyrin repeats induced by ↑ ↑ lipopolysaccharide (MAIL), homolog of mouse ↑ ↑ TNFAIP3 Tumor necrosis factor, alpha-induced protein 3 ↑ ↑ TNFAIP3 Tumor necrosis factor, alpha-induced protein 3 MAIL Molecule possessing ankyrin repeats induced by ↑ ↑ lipopolysaccharide (MAIL), homolog of mouse ↑ ↑ IL1B Interleukin 1, beta ↑ ↑ TNFAIP6 Tumor necrosis factor, alpha-induced protein 6 MYST3 MYST histone acetyltransferase (monocytic ↑ ↑ leukemia) 3 ↑ ↑ IL4I1 Interleukin 4 induced 1 ↑ ↑ SRP68 Signal recognition particle 68kDa ↑ ↑ CXCL2 Chemokine (C-X-C motif) ligand 2 NFKBIA Nuclear factor of kappa light polypeptide gene ↑ ↑ enhancer in B-cells inhibitor, alpha ↑ ↑ IL1B Interleukin 1, beta ↑ ↑ BCL3 B-cell CLL/lymphoma 3 ↑ ↑ TNF Tumor necrosis factor (TNF superfamily, member 2) ↑ ↑ KIAA0663 KIAA0663 gene product ↑ ↑ CCNT1 Cyclin T1 ↓ ↓ SHMT1 Serine hydroxymethyltransferase 1 (soluble) ↓ ↓ RNASEH1 Ribonuclease H1 ↓ ↓ FOXO3A Forkhead box O3A CRK V-crk sarcoma virus CT10 oncogene homolog ↓ ↓ (avian) PRKAR1A Protein kinase, cAMP-dependent, regulatory, type I, ↓ ↓ alpha (tissue specific extinguisher 1) ↓ ↓ ANXA1 Annexin A1 ↓ ↓ SEC10L1 SEC10-like 1 (S. cerevisiae) DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X- ↓ ↓ linked ↓ ↓ WDR1 WD repeat domain 1 FOS V-fos FBJ murine osteosarcoma viral oncogene ↓ ↓ homolog ↓ ↓ PDE3B Phosphodiesterase 3B, cGMP-inhibited ↓ ↓ FLOT2 Flotillin 2 ↓ ↓ ARHGAP1 Rho GTPase activating protein 1 MASK-BP3 Alternate reading frame gene, ankyrin repeat and KH ↓ ↓ domain containing 1 ↓ ↓ 38241 Septin 11 ↓ ↓ HSPA4 Heat shock 70kDa protein 4 ↓ ↓ CDK2 Cyclin-dependent kinase 2 (continued) 191 Table 6.3. - continued
Human Cattle Gene Gene name strain strain symbol ↓ ↓ PSPC1 Paraspeckle component 1 ↓ ↓ IL6R Interleukin 6 receptor ↓ ↓ CCR2 Chemokine (C-C motif) receptor 2 ↓ ↓ APOL6 Apolipoprotein L, 6 FUS Fusion (involved in t(12;16) in malignant ↓ ↓ liposarcoma) ↓ ↓ NXT2 Nuclear transport factor 2-like export factor 2 ↓ ↓ EXOC7 Exocyst complex component 7 YWHAE Tyrosine 3-monooxygenase/tryptophan 5- monooxygenase activation protein, epsilon ↓ ↓ polypeptide ↓ ↓ HNRPH1 Heterogeneous nuclear ribonucleoprotein H1 (H) ↓ ↓ RASSF5 Ras association (RalGDS/AF-6) domain family 5 ↓ ↓ FH Fumarate hydratase ↓ ↓ ENO1 Enolase 1, (alpha) ↓ ↓ KIAA0220 In multiple clusters ↓ ↓ MAT2A Methionine adenosyltransferase II, alpha ↓ ↓ VARS2 Valyl-tRNA synthetase 2 SFRS1 Splicing factor, arginine/serine-rich 1 (splicing factor ↓ ↓ 2, alternate splicing factor) ↓ ↓ IRF5 Interferon regulatory factor 5 ↓ ↓ GSN Gelsolin (amyloidosis, Finnish type) ↓ ↓ HP1-BP74 HP1-BP74 CTNNA1 Catenin (cadherin-associated protein), alpha 1, ↓ ↓ 102kDa ITGA4 Integrin, alpha 4 (antigen CD49D, alpha 4 subunit of ↓ ↓ VLA-4 receptor) ↓ ↓ HIATL2 Hippocampus abundant gene transcript-like 2 ↓ ↓ CBFB Core-binding factor, beta subunit ↓ ↓ CCNE2 Cyclin E2 ↓ ↓ EMILIN2 Elastin microfibril interfacer 2 ↓ ↓ WBSCR16 Williams-Beuren syndrome chromosome region 16 ↓ ↓ NAB2 NGFI-A binding protein 2 (EGR1 binding protein 2)
Table 6.3. Genes similarly regulated in THP-1 cells infected with human and bovine M. paratuberculosis strains.
192
Human Cattle Gene Gene name strain strain symbol EGFR Epidermal growth factor receptor (erythroblastic ↓ ↑ leukemia viral (v-erb-b) oncogene homolog, avian) ↓ ↑ PLA2G12A Phospholipase A2, group XIIA EGFR Epidermal growth factor receptor (erythroblastic ↓ ↑ leukemia viral (v-erb-b) oncogene homolog, avian) ↓ ↑ HIF3A Hypoxia inducible factor 3, alpha subunit ↓ ↑ ASB12 Ankyrin repeat and SOCS box-containing 12 ALS2CR7 Amyotrophic lateral sclerosis 2 (juvenile) ↓ ↑ chromosome region, candidate 7 ↓ ↑ MCF2L MCF.2 cell line derived transforming sequence-like DKFZP586 Regeneration associated muscle protease ↓ ↑ H2123 ↓ ↑ KIAA1128 MCM4 MCM4 minichromosome maintenance deficient 4 (S. ↓ ↑ cerevisiae) ↓ ↑ ITM2A Integral membrane protein 2A ↓ ↑ AP1S3 Adaptor-related protein complex 1, sigma 3 subunit PICALM Phosphatidylinositol binding clathrin assembly ↓ ↑ protein ↓ ↑ HIPK3 Homeodomain interacting protein kinase 3 ↓ ↑ CAB39 Calcium binding protein 39 ↓ ↑ XPO7 Exportin 7 ADAM9 A disintegrin and metalloproteinase domain 9 ↓ ↑ (meltrin gamma) PRPF4B PRP4 pre-mRNA processing factor 4 homolog B ↓ ↑ (yeast) ↓ ↑ YTHDF3 YTH domain family, member 3 ↓ ↑ PRG1 Proteoglycan 1, secretory granule STIP1 Stress-induced-phosphoprotein 1 (Hsp70/Hsp90- ↓ ↑ organizing protein) PDE4B Phosphodiesterase 4B, cAMP-specific ↑ ↓ (phosphodiesterase E4 dunce homolog, Drosophila) ↑ ↓ SOD2 Superoxide dismutase 2, mitochondrial ↑ ↓ IL8 Interleukin 8 ↑ ↓ CSNK2A1 Casein kinase 2, alpha 1 polypeptide ↑ ↓ PRKWNK1 Protein kinase, lysine deficient 1
Table 6.4. Genes differentially regulated in THP-1 cells infected with human and bovine
M. paratuberculosis strains.
193 BIBLIOGRAPHY
1. Adair, D. M., P. L. Worsham, K. K. Hill, A. M. Klevytska, P. J. Jackson, A. M. Friedlander, and P. Keim. 2000. Diversity in a variable-number tandem repeat from Yersinia pestis. J.Clin.Microbiol. 38:1516-9.
2. Aduriz, J. J., R. A. Juste, and N. Cortabarria. 1995. Lack of mycobactin dependence of mycobacteria isolated on Middlebrook 7H11 from clinical cases of ovine paratuberculosis. Vet Microbiol 45:211-7.
3. Allworth, M. B., and D. J. Kennedy. 2000. Progress in national control and assurance programs for ovine Johne's disease in Australia. Vet Microbiol 77:415- 22.
4. Amonsin, A., L. L. Li, Q. Zhang, J. P. Bannantine, A. S. Motiwala, S. Sreevatsan, and V. Kapur. 2004. Multilocus Short Sequence Repeat Sequencing Approach for Differentiating among Mycobacterium avium subsp. paratuberculosis Strains. J.Clin.Microbiol. 42:1694-1702.
5. Ashford D, Imhoff B, Angulo F, and C. the FoodNet working group, Atlanta, GA. October 2001. "Over a Half-Million Persons May Have Crohn's Disease in the United States". Infectious Diseases Society of America. San Francisco, CA.
6. Bannantine, J. P., E. Baechler, Q. Zhang, L. Li, and V. Kapur. 2002. Genome Scale Comparison of Mycobacterium avium subsp. paratuberculosis with Mycobacterium avium subsp. avium Reveals Potential Diagnostic Sequences. J.Clin.Microbiol. 40:1303-1310.
7. Bannantine, J. P., Q. Zhang, L. L. Li, and V. Kapur. 2003. Genomic homogeneity between Mycobacterium avium subsp. avium and Mycobacterium avium subsp. paratuberculosis belies their divergent growth rates. BMC Microbiol 3:10.
8. Barlow, R. E., D. M. Gascoyne-Binzi, S. H. Gillespie, A. Dickens, S. Qamer, and P. M. Hawkey. 2001. Comparison of variable number tandem repeat and IS6110-restriction fragment length polymorphism analyses for discrimination of
194 high- and low-copy-number IS6110 Mycobacterium tuberculosis isolates. J.Clin.Microbiol 39:2453-7.
9. Bauerfeind, R., S. Benazzi, R. Weiss, T. Schliesser, H. Willems, and G. Baljer. 1996. Molecular characterization of Mycobacterium paratuberculosis isolates from sheep, goats, and cattle by hybridization with a DNA probe to insertion element IS900. J.Clin.Microbiol. 34:1617-1621.
10. Beard, P. M., M. J. Daniels, D. Henderson, A. Pirie, K. Rudge, D. Buxton, S. Rhind, A. Greig, M. R. Hutchings, I. McKendrick, K. Stevenson, and J. M. Sharp. 2001. Paratuberculosis infection of nonruminant wildlife in scotland. J.Clin.Microbiol. 39:1517-1521.
11. Behr, M. A., M. A. Wilson, W. P. Gill, H. Salamon, G. K. Schoolnik, S. Rane, and P. M. Small. 1999. Comparative genomics of BCG vaccines by whole- genome DNA microarray. Science 284:1520-3.
12. Bercovier, H., O. Kafri, and S. Sela. 1986. Mycobacteria possess a surprisingly small number of ribosomal RNA genes in relation to the size of their genome. Biochem.Biophys.Res.Commun 136:1136-41.
13. Bik, E. M., R. D. Gouw, and F. R. Mooi. 1996. DNA fingerprinting of Vibrio cholerae strains with a novel insertion sequence element: a tool to identify epidemic strains. J.Clin.Microbiol 34:1453-61.
14. Bradley, P. J., A. Ferlito, K. O. Devaney, and A. Rinaldo. 2004. Crohn's disease manifesting in the head and neck. Acta Otolaryngol 124:237-41.
15. Brennan, M. J., and G. Delogu. 2002. The PE multigene family: a 'molecular mantra' for mycobacteria. Trends Microbiol 10:246-9.
16. Bricker, B. J., and S. M. Halling. 1994. Differentiation of Brucella abortus bv. 1, 2, and 4, Brucella melitensis, Brucella ovis, and Brucella suis bv. 1 by PCR. J.Clin.Microbiol 32:2660-6.
17. Brosch, R., A. S. Pym, S. V. Gordon, and S. T. Cole. 2001. The evolution of mycobacterial pathogenicity: clues from comparative genomics. Trends Microbiol 9:452-8.
18. Buergelt, C. D., and P. E. Ginn. 2000. The histopathologic diagnosis of subclinical Johne's disease in North American bison (Bison bison). Vet.Microbiol. 77:325-31.
195 19. Bull, T. J., J. Hermon-Taylor, I. Pavlik, F. El Zaatari, and M. Tizard. 2000. Characterization of IS900 loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex PCR typing. Microbiology 146 ( Pt 9):2185-2197.
20. Bull, T. J., J. Hermon-Taylor, I. I. Pavlik, F. El-Zaatari, and M. Tizard. 2000. Characterization of IS900 loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex PCR typing. Microbiology 146 (Pt 12):3285.
21. Bull, T. J., E. J. McMinn, K. Sidi-Boumedine, A. Skull, D. Durkin, P. Neild, G. Rhodes, R. Pickup, and J. Hermon-Taylor. 2003. Detection and verification of Mycobacterium avium subsp. paratuberculosis in fresh ileocolonic mucosal biopsy specimens from individuals with and without Crohn's disease. J.Clin.Microbiol. 41:2915-23.
22. Bull, T. J., K. Sidi-Boumedine, E. J. McMinn, K. Stevenson, R. Pickup, and J. Hermon-Taylor. 2003. Mycobacterial interspersed repetitive units (MIRU) differentiate Mycobacterium avium subspecies paratuberculosis from other species of the Mycobacterium avium complex. Mol.Cell.Probes 17:157-64.
23. Caetano-Anolles, G., B. J. Bassam, and P. M. Gresshoff. 1991. DNA amplification fingerprinting using very short arbitrary oligonucleotide primers. Biotechnology (N Y) 9:553-7.
24. CAST Issue Paper: Johne's Disease in Cattle. Council on Agriculture, Science and Technology Task Force. May 2001.
25. Charlton, B. R., A. A. Bickford, R. P. Chin, and R. L. Walker. 1999. Randomly amplified polymorphic DNA (RAPD) analysis of Mycoplasma gallisepticum isolates from turkeys from the central valley of California. J.Vet.Diagn.Invest 11:408-15.
26. Chiodini, R. J. 1986. Biochemical characteristics of various strains of Mycobacterium paratuberculosis. Am.J.Vet.Res 47:1442-5.
27. Chiodini, R. J. 1990. Characterization of Mycobacterium paratuberculosis and organisms of the Mycobacterium avium complex by restriction polymorphism of the rRNA gene region. J.Clin.Microbiol. 28:489-494.
28. Chiodini, R. J., and H. J. Van Kruiningen. 1985. Characterization of Mycobacterium paratuberculosis of bovine, caprine, and ovine origin by gas- liquid chromatographic analysis of fatty acids in whole-cell extracts. Am.J.Vet.Res 46:1980-9. 196 29. Chiodini, R. J., and H. J. Van Kruiningen. 1983. Eastern white-tailed deer as a reservoir of ruminant paratuberculosis. J.Am.Vet.Med.Assoc. 182:168-9.
30. Chiodini, R. J., H. J. Van Kruiningen, and R. S. Merkal. 1984. Ruminant paratuberculosis (Johne's disease): the current status and future prospects. Cornell Vet 74:218-62.
31. Clemens, D. L., and M. A. Horwitz. 1995. Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J.Exp.Med 181:257-70.
32. Coffin, J. W., C. Condon, C. A. Compston, K. N. Potter, L. R. Lamontagne, J. Shafiq, and D. Y. Kunimoto. 1992. Use of restriction fragment length polymorphisms resolved by pulsed- field gel electrophoresis for subspecies identification of mycobacteria in the Mycobacterium avium complex and for isolation of DNA probes. J.Clin.Microbiol. 30:1829-1836.
33. Collins, D. M., S. Cavaignac, and G. W. de Lisle. 1997. Use of four DNA insertion sequences to characterize strains of the Mycobacterium avium complex isolated from animals. Mol.Cell.Probes 11:373-380.
34. Collins, D. M., and G. W. de Lisle. 1986. Restriction endonuclease analysis of various strains of Mycobacterium paratuberculosis isolated from cattle. Am J Vet Res 47:2226-9.
35. Collins, D. M., M. De Zoete, and S. M. Cavaignac. 2002. Mycobacterium avium subsp. paratuberculosis strains from cattle and sheep can be distinguished by a PCR test based on a novel DNA sequence difference. J.Clin.Microbiol. 40:4760- 2.
36. Collins, D. M., D. M. Gabric, and G. W. De Lisle. 1989. Identification of a repetitive DNA sequence specific to Mycobacterium paratuberculosis. FEMS Microbiol.Lett. 51:175-8.
37. Collins, D. M., D. M. Gabric, and G. W. de Lisle. 1990. Identification of two groups of Mycobacterium paratuberculosis strains by restriction endonuclease analysis and DNA hybridization. J.Clin.Microbiol. 28:1591-6.
38. Collins, M. T. 1996. Diagnosis of paratuberculosis, p. 357-371. In R. W. Sweeney (ed.), The Veterinary Clinics of North America Food Animal Practice. Paratuberculosis (Johne's Disease). W.B. Saunders Co., Philadelphia, PA.
197 39. Collins, M. T., K. B. Kenefick, D. C. Sockett, R. S. Lambrecht, J. McDonald, and J. B. Jorgensen. 1990. Enhanced radiometric detection of Mycobacterium paratuberculosis by using filter-concentrated bovine fecal specimens. J.Clin.Microbiol. 28:2514-9.
40. Collins, M. T., and D. C. Sockett. 1993. Accuracy and economics of the USDA- licensed enzyme-linked immunosorbent assay for bovine paratuberculosis. J Am Vet Med Assoc 203:1456-63.
41. Cook, W. E., T. E. Cornish, S. Shideler, B. Lasley, and M. T. Collins. 1997. Radiometric culture of Mycobacterium avium paratuberculosis from the feces of tule elk. J.Wildl.Dis. 33:635-7.
42. Corti, S., and R. Stephan. 2002. Detection of Mycobacterium avium subspecies paratuberculosis specific IS900 insertion sequences in bulk-tank milk samples obtained from different regions throughout Switzerland. BMC Microbiol 2:15.
43. Cousins, D. V., R. J. Evans, and B. R. Francis. 1995. Use of BACTEC radiometric culture method and polymerase chain reaction for the rapid screening of faeces and tissues for Mycobacterium paratuberculosis. Aust Vet J 72:458-62.
44. Cousins, D. V., R. Whittington, I. Marsh, A. Masters, R. J. Evans, and P. Kluver. 1999. Mycobacteria distinct from Mycobacterium avium subsp. paratuberculosis isolated from the faeces of ruminants possess IS900-like sequences detectable IS900 polymerase chain reaction: implications for diagnosis. Mol.Cell.Probes 13:431-442.
45. Cousins, D. V., S. N. Williams, A. Hope, and G. J. Eamens. 2000. DNA fingerprinting of Australian isolates of Mycobacterium avium subsp paratuberculosis using IS900 RFLP. Aust.Vet.J. 78:184-190.
46. Coussens, P. M. 2004. Model for immune responses to Mycobacterium avium subspecies paratuberculosis in cattle. Infect.Immun 72:3089-96.
47. Cowan, L. S., L. Mosher, L. Diem, J. P. Massey, and J. T. Crawford. 2002. Variable-number tandem repeat typing of Mycobacterium tuberculosis isolates with low copy numbers of IS6110 by using mycobacterial interspersed repetitive units. J.Clin.Microbiol 40:1592-602.
48. Cummings, C. A., and D. A. Relman. 2002. Genomics and microbiology. Microbial forensics--"cross-examining pathogens". Science 296:1976-9.
198 49. Daniels, M. J., M. R. Hutchings, P. M. Beard, D. Henderson, A. Greig, K. Stevenson, and J. M. Sharp. 2003. Do non-ruminant wildlife pose a risk of paratuberculosis to domestic livestock and vice versa in Scotland? J.Wildl.Dis. 39:10-5.
50. Daniels, M. J., M. R. Hutchings, and A. Greig. 2003. The risk of disease transmission to livestock posed by contamination of farm stored feed by wildlife excreta. Epidemiol Infect 130:561-8.
51. Dargatz, D. A., B. A. Byrum, L. K. Barber, R. W. Sweeney, R. H. Whitlock, W. P. Shulaw, R. H. Jacobson, and J. R. Stabel. 2001. Evaluation of a commercial ELISA for diagnosis of paratuberculosis in cattle. J.Am.Vet.Med.Assoc 218:1163-6.
52. de Lisle, G. W., G. F. Yates, and D. M. Collins. 1993. Paratuberculosis in farmed deer: case reports and DNA characterization of isolates of Mycobacterium paratuberculosis. J.Vet.Diagn.Invest 5:567-71.
53. Dohmann, K., B. Strommenger, K. Stevenson, L. de Juan, J. Stratmann, V. Kapur, T. J. Bull, and G. F. Gerlach. 2003. Characterization of genetic differences between Mycobacterium avium subsp. paratuberculosis type I and type II isolates. J.Clin.Microbiol. 41:5215-23.
54. Dombek, P. E., L. K. Johnson, S. T. Zimmerley, and M. J. Sadowsky. 2000. Use of repetitive DNA sequences and the PCR To differentiate Escherichia coli isolates from human and animal sources. Appl.Environ.Microbiol 66:2572-7.
55. Drake, J. W. 1991. A constant rate of spontaneous mutation in DNA-based microbes. Proc.Natl.Acad.Sci. USA 88:7160-4.
56. Dvorska, L., L. Matlova, M. Bartos, I. Parmova, J. Bartl, P. Svastova, T. J. Bull, and I. Pavlik. 2004. Study of Mycobacterium avium complex strains isolated from cattle in the Czech Republic between 1996 and 2000. Vet.Microbiol 99:239-50.
57. El Zaatari, F. A., M. S. Osato, and D. Y. Graham. 2001. Etiology of Crohn's disease: the role of Mycobacterium avium paratuberculosis. Trends Mol.Med. 7:247-252.
58. Englund, S., A. Ballagi-Pordany, G. Bolske, and K. E. Johansson. 1999. Single PCR and nested PCR with a mimic molecule for detection of Mycobacterium avium subsp. paratuberculosis. Diagn.Microbiol.Infect.Dis. 33:163-171. 199 59. Englund, S., G. Bolske, and K. E. Johansson. 2002. An IS900-like sequence found in a Mycobacterium sp. other than Mycobacterium avium subsp. paratuberculosis. FEMS Microbiol.Lett 209:267-71.
60. Eriks, I. S., K. T. Munck, T. E. Besser, G. H. Cantor, and V. Kapur. 1996. Rapid differentiation of Mycobacterium avium and M. paratuberculosis by PCR and restriction enzyme analysis. J.Clin.Microbiol. 34:734-737.
61. Espul, C., H. Cuello, N. Martinez, O. Centorbi, M. O'Ryan, L. Jackson, F. Campos, and D. O. Matson. 2000. Genomic and antigenic variation among rotavirus strains circulating in a large city of Argentina. J.Med.Virol 61:504-9.
62. Fang, Y., W. H. Wu, J. L. Pepper, J. L. Larsen, S. A. Marras, E. A. Nelson, W. B. Epperson, and J. Christopher-Hennings. 2002. Comparison of real-time, quantitative PCR with molecular beacons to nested PCR and culture methods for detection of Mycobacterium avium subsp. paratuberculosis in bovine fecal samples. J.Clin.Microbiol. 40:287-291.
63. Feizabadi, M. M., I. D. Robertson, A. Hope, D. V. Cousins, and D. J. Hampson. 1997. Differentiation of Australian isolates of Mycobacterium paratuberculosis using pulsed-field gel electrophoresis. Aust.Vet.J 75:887-9.
64. Ferreira, R., L. S. Fonseca, and W. Lilenbaum. 2002. Agar gel immunodiffusion test (AGID) evaluation for detection of bovine paratuberculosis in Rio de Janeiro, Brazil. Lett Appl Microbiol 35:173-5.
65. Fortunato, E. A., A. K. McElroy, I. Sanchez, and D. H. Spector. 2000. Exploitation of cellular signaling and regulatory pathways by human cytomegalovirus. Trends Microbiol 8:111-9.
66. Francois, B., R. Krishnamoorthy, and J. Elion. 1997. Comparative study of Mycobacterium paratuberculosis strains isolated from Crohn's disease and Johne's disease using restriction fragment length polymorphism and arbitrarily primed polymerase chain reaction. Epidemiol.Infect. 118:227-33.
67. Gascoyne-Binzi, D. M., R. E. Barlow, R. Frothingham, G. Robinson, T. A. Collyns, R. Gelletlie, and P. M. Hawkey. 2001. Rapid identification of laboratory contamination with Mycobacterium tuberculosis using variable number tandem repeat analysis. J.Clin.Microbiol. 39:69-74.
68. Ghadiali, A. H., M. Strother, S. A. Naser, E. J. Manning, and S. Sreevatsan. 2004. Mycobacterium avium subsp. paratuberculosis strains isolated from
200 Crohn's Disease patients and animal species exhibit similar polymorphic locus patterns. J.Clin.Microbiol. 42:5345-5348.
69. Ghadiali, A. H., M. Strother, N. Theus, R. W. Stich, B. Byrum, W. P. Shulaw, V. Kapur, and S. Sreevatsan. Rapid detection and strain typing of Mycobacterium avium subsp. paratuberculosis from broth cultures. In Press. J.Clin.Microbiol.
70. Gillespie, B. E., B. M. Jayarao, and S. P. Oliver. 1997. Identification of Streptococcus species by randomly amplified polymorphic deoxyribonucleic acid fingerprinting. J.Dairy.Sci 80:471-6.
71. Gordon, S. V., R. Brosch, A. Billault, T. Garnier, K. Eiglmeier, and S. T. Cole. 1999. Identification of variable regions in the genomes of tubercle bacilli using bacterial artificial chromosome arrays. Mol.Microbiol 32:643-55.
72. Grant, I. R., R. B. Kirk, E. Hitchings, and M. T. Rowe. 2003. Comparative evaluation of the MGIT and BACTEC culture systems for the recovery of Mycobacterium avium subsp. paratuberculosis from milk. J Appl Microbiol 95:196-201.
73. Green, E. P., M. L. Tizard, M. T. Moss, J. Thompson, D. J. Winterbourne, J. J. McFadden, and J. Hermon-Taylor. 1989. Sequence and characteristics of IS900, an insertion element identified in a human Crohn's disease isolate of Mycobacterium paratuberculosis. Nucleic Acids Res. 17:9063-9073.
74. Greenstein, R. J. 2003. Is Crohn's disease caused by a mycobacterium? Comparisons with leprosy, tuberculosis, and Johne's disease. Lancet Infect.Dis 3:507-14.
75. Greig, A., K. Stevenson, D. Henderson, V. Perez, V. Hughes, I. Pavlik, M. E. Hines, I. McKendrick, and J. M. Sharp. 1999. Epidemiological study of paratuberculosis in wild rabbits in Scotland. J.Clin.Microbiol. 37:1746-1751.
76. Greig, A., K. Stevenson, V. Perez, A. A. Pirie, J. M. Grant, and J. M. Sharp. 1997. Paratuberculosis in wild rabbits (Oryctolagus cuniculus). Vet.Rec. 140:141- 3.
77. Groenendaal, H., M. Nielen, and J. W. Hesselink. 2003. Development of the Dutch Johne's disease control program supported by a simulation model. Prev Vet Med 60:69-90.
201 78. Guerrero, C., C. Bernasconi, D. Burki, T. Bodmer, and A. Telenti. 1995. A novel insertion element from Mycobacterium avium, IS1245, is a specific target for analysis of strain relatedness. J.Clin.Microbiol. 33:304-307.
79. Harris, J. E., and A. M. Lammerding. 2001. Crohn's disease and Mycobacterium avium subsp. paratuberculosis: current issues. J.Food Prot. 64:2103-10.
80. Harris, N. B., and R. G. Barletta. 2001. Mycobacterium avium subsp. paratuberculosis in Veterinary Medicine. Clin.Microbiol.Rev. 14:489-512.
81. Henderson, S. T., and T. D. Petes. 1992. Instability of simple sequence DNA in Saccharomyces cerevisiae. Mol.Cell.Biol. 12:2749-57.
82. Hermon-Taylor, J. 2001. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn's disease. Gut 49:755-757.
83. Huang, Y., M. Prasad, W. J. Lemon, H. Hampel, F. A. Wright, K. Kornacker, V. LiVolsi, W. Frankel, R. T. Kloos, C. Eng, N. S. Pellegata, and A. de la Chapelle. 2001. Gene expression in papillary thyroid carcinoma reveals highly consistent profiles. Proc.Natl.Acad.Sci. USA 98:15044-9.
84. Hugot, J. P., M. Chamaillard, H. Zouali, S. Lesage, J. P. Cezard, J. Belaiche, S. Almer, C. Tysk, C. A. O'Morain, M. Gassull, V. Binder, Y. Finkel, A. Cortot, R. Modigliani, P. Laurent-Puig, C. Gower-Rousseau, J. Macry, J. F. Colombel, M. Sahbatou, and G. Thomas. 2001. Association of NOD2 leucine- rich repeat variants with susceptibility to Crohn's disease. Nature 411:599-603.
85. Hulten, K., H. M. El Zimaity, T. J. Karttunen, A. Almashhrawi, M. R. Schwartz, D. Y. Graham, and F. A. El Zaatari. 2001. Detection of Mycobacterium avium subspecies paratuberculosis in Crohn's diseased tissues by in situ hybridization. Am.J.Gastroenterol. 96:1529-1535.
86. Hulten, K., T. J. Karttunen, H. M. El Zimaity, S. A. Naser, M. T. Collins, D. Y. Graham, and F. A. El Zaatari. 2000. Identification of cell wall deficient forms of M. avium subsp. paratuberculosis in paraffin embedded tissues from animals with Johne's disease by in situ hybridization. J.Microbiol.Methods 42:185-195.
87. Hunter, P. R., and M. A. Gaston. 1988. Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J.Clin.Microbiol. 26:2465-6.
202 88. Huys, G., L. Rigouts, K. Chemlal, F. Portaels, and J. Swings. 2000. Evaluation of amplified fragment length polymorphism analysis for inter- and intraspecific differentiation of Mycobacterium bovis, M. tuberculosis, and M. ulcerans. J.Clin.Microbiol. 38:3675-3680.
89. Jackson, P. J., E. A. Walthers, A. S. Kalif, K. L. Richmond, D. M. Adair, K. K. Hill, C. R. Kuske, G. L. Andersen, K. H. Wilson, M. Hugh-Jones, and P. Keim. 1997. Characterization of the variable-number tandem repeats in vrrA from different Bacillus anthracis isolates. Appl.Environ.Microbiol. 63:1400-5.
90. Jones, M. E., M. B. Avison, E. Damdinsuren, A. P. MacGowan, and P. M. Bennett. 1994. Heterogeneity at the beta-lactamase structural gene ampC amongst Citrobacter spp. assessed by polymerase chain reaction analysis: potential for typing at a molecular level. J.Med.Microbiol 41:209-14.
91. Joyce, E. A., K. Chan, N. R. Salama, and S. Falkow. 2002. Redefining bacterial populations: a post-genomic reformation. Nat.Rev.Genet 3:462-73.
92. Kalis, C. H., H. W. Barkema, J. W. Hesselink, C. van Maanen, and M. T. Collins. 2002. Evaluation of two absorbed enzyme-linked immunosorbent assays and a complement fixation test as replacements for fecal culture in the detection of cows shedding Mycobacterium avium subspecies paratuberculosis. J.Vet.Diagn.Invest 14:219-24.
93. Kanduma, E., T. D. McHugh, and S. H. Gillespie. 2003. Molecular methods for Mycobacterium tuberculosis strain typing: a users guide. J Appl Microbiol 94:781-91.
94. Kapur, V., L. L. Li, M. R. Hamrick, B. B. Plikaytis, T. M. Shinnick, A. Telenti, W. R. Jacobs, Jr., A. Banerjee, S. Cole, K. Y. Yuen, and . 1995. Rapid Mycobacterium species assignment and unambiguous identification of mutations associated with antimicrobial resistance in Mycobacterium tuberculosis by automated DNA sequencing. Arch.Pathol.Lab Med. 119:131-138.
95. Karakousis, P. C., R. D. Moore, and R. E. Chaisson. 2004. Mycobacterium avium complex in patients with HIV infection in the era of highly active antiretroviral therapy. Lancet Infect Dis 4:557-65.
96. Katoch, V. M. 2004. Infections due to non-tuberculous mycobacteria (NTM). Indian J.Med.Res 120:290-304.
97. Keim, P., L. B. Price, A. M. Klevytska, K. L. Smith, J. M. Schupp, R. Okinaka, P. J. Jackson, and M. E. Hugh-Jones. 2000. Multiple-locus variable- 203 number tandem repeat analysis reveals genetic relationships within Bacillus anthracis. J.Bacteriol. 182:2928-36.
98. Keller, A. P., M. L. Beggs, B. Amthor, F. Bruns, P. Meissner, and W. H. Haas. 2002. Evidence of the presence of IS1245 and IS1311 or closely related insertion elements in nontuberculous mycobacteria outside of the Mycobacterium avium complex. J.Clin.Microbiol. 40:1869-1872.
99. Kelsey, J. L., W. D. Thompson, and A. S. Evans. 1986. Measurement Error, p. 285-307. In J. L. Kelsey, W. D. Thompson, and A. S. Evans (ed.), Methods in Observational Epidemiology. Oxford University Press, New York.
100. Kennedy, D. J., and M. B. Allworth. 2000. Progress in national control and assurance programs for bovine Johne's disease in Australia. Vet Microbiol 77:443-51.
101. Kim, S. G., S. J. Shin, R. H. Jacobson, L. J. Miller, P. R. Harpending, S. M. Stehman, C. A. Rossiter, and D. A. Lein. 2002. Development and application of quantitative polymerase chain reaction assay based on the ABI 7700 system (TaqMan) for detection and quantification of Mycobacterium avium subsp. paratuberculosis. J.Vet.Diagn.Invest. 14:126-131.
102. Kim, W., Y. P. Hong, J. H. Yoo, W. B. Lee, C. S. Choi, and S. I. Chung. 2002. Genetic relationships of Bacillus anthracis and closely related species based on variable-number tandem repeat analysis and BOX-PCR genomic fingerprinting. FEMS Microbiol.Lett. 207:21-7.
103. Klevytska, A. M., L. B. Price, J. M. Schupp, P. L. Worsham, J. Wong, and P. Keim. 2001. Identification and characterization of variable-number tandem repeats in the Yersinia pestis genome. J.Clin.Microbiol. 39:3179-85.
104. Knodler, L. A., J. Celli, and B. B. Finlay. 2001. Pathogenic trickery: deception of host cell processes. Nat.Rev.Mol.Cell.Biol 2:578-88.
105. Kremer, K., D. van Soolingen, R. Frothingham, W. H. Haas, P. W. Hermans, C. Martin, P. Palittapongarnpim, B. B. Plikaytis, L. W. Riley, M. A. Yakrus, J. M. Musser, and J. D. van Embden. 1999. Comparison of methods based on different molecular epidemiological markers for typing of Mycobacterium tuberculosis complex strains: interlaboratory study of discriminatory power and reproducibility. J.Clin.Microbiol. 37:2607-18.
106. Kumar, S., K. Tamura, I. B. Jakobsen, and M. Nei. 2001. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 17:1244-5. 204 107. Kunze, Z. M., S. Wall, R. Appelberg, M. T. Silva, F. Portaels, and J. J. McFadden. 1991. IS901, a new member of a widespread class of atypical insertion sequences, is associated with pathogenicity in Mycobacterium avium. Mol.Microbiol. 5:2265-2272.
108. Lee, T. Y., T. J. Lee, and S. K. Kim. 1994. Differentiation of Mycobacterium tuberculosis strains by arbitrarily primed polymerase chain reaction-based DNA fingerprinting. Yonsei.Med.J 35:286-94.
109. Levy-Frebault, V. V., M. F. Thorel, A. Varnerot, and B. Gicquel. 1989. DNA polymorphism in Mycobacterium paratuberculosis, "wood pigeon mycobacteria," and related mycobacteria analyzed by field inversion gel electrophoresis. J.Clin.Microbiol. 27:2823-2826.
110. Li, C., and W. Hung Wong. 2001. Model-based analysis of oligonucleotide arrays: model validation, design issues and standard error application. Genome Biol 2:RESEARCH0032.
111. Li, Q., C. C. Whalen, J. M. Albert, R. Larkin, L. Zukowski, M. D. Cave, and R. F. Silver. 2002. Differences in rate and variability of intracellular growth of a panel of Mycobacterium tuberculosis clinical isolates within a human monocyte model. Infect.Immun 70:6489-93.
112. Lindstedt, B. A., E. Heir, E. Gjernes, and G. Kapperud. 2003. DNA fingerprinting of Salmonella enterica subsp. enterica serovar typhimurium with emphasis on phage type DT104 based on variable number of tandem repeat loci. J.Clin.Microbiol. 41:1469-79.
113. Linton, C. J., H. Jalal, J. P. Leeming, and M. R. Millar. 1994. Rapid discrimination of Mycobacterium tuberculosis strains by random amplified polymorphic DNA analysis. J.Clin.Microbiol 32:2169-74.
114. Lisitsyn, N., and M. Wigler. 1993. Cloning the differences between two complex genomes. Science 259:946-51.
115. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-8.
116. Lockhart, D. J., H. Dong, M. C. Byrne, M. T. Follettie, M. V. Gallo, M. S. Chee, M. Mittmann, C. Wang, M. Kobayashi, H. Horton, and E. L. Brown. 1996. Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat.Biotechnol 14:1675-80. 205 117. Mahairas, G. G., P. J. Sabo, M. J. Hickey, D. C. Singh, and C. K. Stover. 1996. Molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis. J.Bacteriol 178:1274-82.
118. Maiden, M. C., J. A. Bygraves, E. Feil, G. Morelli, J. E. Russell, R. Urwin, Q. Zhang, J. Zhou, K. Zurth, D. A. Caugant, I. M. Feavers, M. Achtman, and B. G. Spratt. 1998. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc.Natl.Acad.Sci. USA 95:3140-5.
119. Manca, C., L. Tsenova, C. E. Barry, 3rd, A. Bergtold, S. Freeman, P. A. Haslett, J. M. Musser, V. H. Freedman, and G. Kaplan. 1999. Mycobacterium tuberculosis CDC1551 induces a more vigorous host response in vivo and in vitro, but is not more virulent than other clinical isolates. J.Immunol 162:6740-6.
120. Manning, E. J. 2001. Mycobacterium avium subspecies paratuberculosis: a review of current knowledge. J.Zoo Wildl.Med. 32:293-304.
121. Manning, E. J., and M. T. Collins. 2001. Mycobacterium avium subsp. paratuberculosis: pathogen, pathogenesis and diagnosis. Rev.Sci.Tech. 20:133- 50.
122. Manning, E. J., and M. Ziccardi. 2000. Johne's disease and captive non- domestic hoofstock: prevalence and prevention. In Proc. American Association of Zoo Veterinarians (AAZV) and International Association for Aquatic Animal Medicine (IAAAM) Conference, 17 September, New Orleans, AAZV/IAAAM, Media, Pennsyvania. 432-34.
123. Manning, E. J. B., T. E. Kucera, N. B. Gates, L. M. Woods, and M. Fallon- McKnight. 2003. Testing for Mycobacterium avium subsp. paratuberculosis infection in asymptomatic free-ranging Tule elk from an infected herd. J.Wildl.Dis. 39.
124. Marsh, I., R. Whittington, and D. Cousins. 1999. PCR-restriction endonuclease analysis for identification and strain typing of Mycobacterium avium subsp. paratuberculosis and Mycobacterium avium subsp. avium based on polymorphisms in IS1311. Mol.Cell.Probes 13:115-126.
125. Matsiota-Bernard, P., S. Waser, P. T. Tassios, A. Kyriakopoulos, and N. J. Legakis. 1997. Rapid discrimination of Mycobacterium avium strains from AIDS patients by randomly amplified polymorphic DNA analysis. J.Clin.Microbiol 35:1585-8.
206 126. Mazars, E., S. Lesjean, A. L. Banuls, M. Gilbert, V. Vincent, B. Gicquel, M. Tibayrenc, C. Locht, and P. Supply. 2001. High-resolution minisatellite-based typing as a portable approach to global analysis of Mycobacterium tuberculosis molecular epidemiology. Proc Natl Acad Sci USA 98:1901-6.
127. McClure, H. M., R. J. Chiodini, D. C. Anderson, R. B. Swenson, W. R. Thayer, and J. A. Coutu. 1987. Mycobacterium paratuberculosis infection in a colony of stumptail macaques (Macaca arctoides). J.Infect.Dis. 155:1011-9.
128. McGovern, D. P., D. A. Van Heel, T. Ahmad, and D. P. Jewell. 2001. NOD2 (CARD15), the first susceptibility gene for Crohn's disease. Gut 49:752-754.
129. Millar, D., J. Ford, J. Sanderson, S. Withey, M. Tizard, T. Doran, and J. Hermon-Taylor. 1996. IS900 PCR to detect Mycobacterium paratuberculosis in retail supplies of whole pasteurized cows' milk in England and Wales. Appl.Environ.Microbiol. 62:3446-3452.
130. Miller, J. M., A. L. Jenny, and J. B. Payeur. 2002. Polymerase chain reaction detection of Mycobacterium tuberculosis complex and Mycobacterium avium organisms in formalin-fixed tissues from culture-negative ruminants. Vet Microbiol 87:15-23.
131. Moreira, A. R., F. Paolicchi, C. Morsella, M. Zumarraga, A. Cataldi, B. Fabiana, A. Alicia, O. Piet, D. van Soolingen, and R. M. Isabel. 1999. Distribution of IS900 restriction fragment length polymorphism types among animal Mycobacterium avium subsp. paratuberculosis isolates from Argentina and Europe. Vet.Microbiol. 70:251-259.
132. Moss, M. T., Z. P. Malik, M. L. Tizard, E. P. Green, J. D. Sanderson, and J. Hermon-Taylor. 1992. IS902, an insertion element of the chronic-enteritis- causing Mycobacterium avium subsp. silvaticum. J.Gen.Microbiol. 138 ( Pt 1):139-145.
133. Motiwala, A. S., A. Amonsin, M. Strother, E. J. Manning, V. Kapur, and S. Sreevatsan. 2004. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis isolates recovered from wild animal species. J.Clin.Microbiol. 42:1703-1712.
134. Motiwala, A. S., M. Strother, A. Amonsin, B. Byrum, S. A. Naser, J. R. Stabel, W. P. Shulaw, J. P. Bannantine, V. Kapur, and S. Sreevatsan. 2003. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis: evidence for limited strain diversity, strain sharing, and identification of unique targets for diagnosis. J.Clin.Microbiol. 41:2015-26. 207 135. Motiwala, A. S., M. Strother, S. A. Naser, E. J. Manning, and S. Sreevatsan. Mycobacterium avium subspecies paratuberculosis strains isolated from Crohn's disease patients and animal species exhibit similar polymorphic loci patterns. Accepted for publication in J.Clin.Microbiol.
136. Naser, S. A., J. Felix, H. Liping, C. Romero, N. Naser, A. Walsh, and W. Safranek. 1999. Occurrence of the IS900 gene in Mycobacterium avium complex derived from HIV patients. Mol.Cell.Probes 13:367-372.
137. Naser, S. A., D. Schwartz, and I. Shafran. 2000. Isolation of Mycobacterium avium subsp. paratuberculosis from breast milk of Crohn's disease patients. Am.J.Gastroenterol. 95:1094-5.
138. National Academy of Sciences Report. Diagnosis and Control of Johne's Disease (2003). http://books.nap.edu/openbook/0309086116/html/index.html.
139. National Animal Health Monitoring System. 1997. Johne's disease on U. S. dairy operations. Report N245.1087. USDA, APHIS, VS, CEAH, National Animal Health Monitoring System, Fort Collins, Colorado.
140. Nebbia, P., P. Robino, E. Ferroglio, L. Rossi, G. Meneguz, and S. Rosati. 2000. Paratuberculosis in red deer (Cervus elaphus hippelaphus) in the western Alps. Vet.Res.Commun 24:435-43.
141. Nei, M. 1973. Analysis of gene diversity in subdivided populations. Proc.Natl.Acad.Sci.USA 70:3321-3.
142. Nicod, J. C., and C. R. Largiader. 2003. SNPs by AFLP (SBA): a rapid SNP isolation strategy for non-model organisms. Nucleic Acids Res 31:e19.
143. Nielsen, S. S., C. Gronbaek, J. F. Agger, and H. Houe. 2002. Maximum- likelihood estimation of sensitivity and specificity of ELISAs and faecal culture for diagnosis of paratuberculosis. Prev.Vet.Med. 53:191-204.
144. Ohkusa, T., T. Nomura, and N. Sato. 2004. The role of bacterial infection in the pathogenesis of inflammatory bowel disease. Intern.Med 43:534-9.
145. Olsen, I., G. Sigurgardottir, and B. Djonne. 2002. Paratuberculosis with special reference to cattle. A review. Vet.Q. 24:12-28.
208 146. Omori, H., H. Asahi, Y. Inoue, T. Irinoda, and K. Saito. 2004. Pulmonary involvement in Crohn's disease report of a case and review of the literature. Inflamm Bowel Dis 10:129-34.
147. O'Shea, B., S. Khare, K. Bliss, P. Klein, T. A. Ficht, L. G. Adams, and A. C. Rice-Ficht. 2004. Amplified fragment length polymorphism reveals genomic variability among Mycobacterium avium subsp. paratuberculosis isolates. J.Clin.Microbiol 42:3600-6.
148. Ott, S. L., S. J. Wells, and B. A. Wagner. 1999. Herd-level economic losses associated with Johne's disease on US dairy operations. Prev.Vet.Med. 40:179-92.
149. Overduin, P., L. Schouls, P. Roholl, A. van der Zanden, N. Mahmmod, A. Herrewegh, and D. van Soolingen. 2004. Use of multilocus variable-number tandem-repeat analysis for typing Mycobacterium avium subsp. paratuberculosis. J.Clin.Microbiol 42:5022-8.
150. Ozbek, A., F. C. Michel, M. Strother, A. S. Motiwala, B. R. Byrum, W. P. Shulaw, C. G. Thornton, and S. Sreevatsan. 2003. Evaluation of two recovery methods for detection of Mycobacterium avium subsp. paratuberculosis by PCR: direct-dilution-centrifugation and C(18)-carboxypropylbetaine processing. FEMS Microbiol.Lett. 229:145-51.
151. Paustian, M. L., V. Kapur, and J. B. Bannantine. 2005. Comparative genomic hybridizations reveal genetic regions within Mycobacterium avium complex that are divergent from Mycobacterium avium subsp. paratuberculosis isolates. Accepted for publication in J.Clin.Microbiol.
152. Pavlik, I., J. Bartl, L. Dvorska, P. Svastova, R. du Maine, M. Machackova, W. Yayo Ayele, and A. Horvathova. 2000. Epidemiology of paratuberculosis in wild ruminants studied by restriction fragment length polymorphism in the Czech Republic during the period 1995-1998. Vet.Microbiol. 77:231-51.
153. Pavlik, I., L. Bejckova, M. Pavlas, Z. Rozsypalova, and S. Koskova. 1995. Characterization by restriction endonuclease analysis and DNA hybridization using IS900 of bovine, ovine, caprine and human dependent strains of Mycobacterium paratuberculosis isolated in various localities. Vet.Microbiol. 45:311-318.
154. Pavlik, I., A. Horvathova, L. Dvorska, J. Bartl, P. Svastova, M. R. du, and I. Rychlik. 1999. Standardisation of restriction fragment length polymorphism analysis for Mycobacterium avium subspecies paratuberculosis. J.Microbiol.Methods 38:155-167. 209 155. Pillai, S. R., and B. M. Jayarao. 2002. Application of IS900 PCR for detection of Mycobacterium avium subsp. paratuberculosis directly from raw milk. J.Dairy Sci 85:1052-7.
156. Pillai, S. R., B. M. Jayarao, J. D. Gummo, E. C. Hue, D. Tiwari, J. R. Stabel, and R. H. Whitlock. 2001. Identification and sub-typing of Mycobacterium avium subsp. paratuberculosis and Mycobacterium avium subsp. avium by randomly amplified polymorphic DNA. Vet.Microbiol. 79:275-284.
157. Possible link between Crohn's disease and Paratuberculosis. Report of the Scientific Committee on Animal Health and Animal Welfare. March 2000. http://gpvec.unl.edu/avc/IssuePapers/out38_en.pdf.
158. Quirke, P. 2001. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn's disease. Gut 49:757-760.
159. Read, T. D., S. L. Salzberg, M. Pop, M. Shumway, L. Umayam, L. Jiang, E. Holtzapple, J. D. Busch, K. L. Smith, J. M. Schupp, D. Solomon, P. Keim, and C. M. Fraser. 2002. Comparative genome sequencing for discovery of novel polymorphisms in Bacillus anthracis. Science 296:2028-33.
160. Reddacliff, L. A., A. Vadali, and R. J. Whittington. 2003. The effect of decontamination protocols on the numbers of sheep strain Mycobacterium avium subsp. paratuberculosis isolated from tissues and faeces. Vet Microbiol 95:271- 82.
161. Richter, E., J. Wessling, N. Lugering, W. Domschke, and S. Rusch-Gerdes. 2002. Mycobacterium avium subsp. paratuberculosis infection in a patient with HIV, Germany. Emerg.Infect.Dis 8:729-31.
162. Rohner, P., B. Ninet, C. Metral, S. Emler, and R. Auckenthaler. 1997. Evaluation of the MB/BacT system and comparison to the BACTEC 460 system and solid media for isolation of mycobacteria from clinical specimens. J Clin Microbiol 35:3127-31.
163. Roiz, M. P., E. Palenque, C. Guerrero, and M. J. Garcia. 1995. Use of restriction fragment length polymorphism as a genetic marker for typing Mycobacterium avium strains. J.Clin.Microbiol. 33:1389-1391.
164. Roring, S., A. Scott, D. Brittain, I. Walker, G. Hewinson, S. Neill, and R. Skuce. 2002. Development of variable-number tandem repeat typing of Mycobacterium bovis: comparison of results with those obtained by using existing exact tandem repeats and spoligotyping. J.Clin.Microbiol 40:2126-33. 210 165. Rubery, E. A review of the evidence for a link between exposure to Mycobacterium paratuberculosis and Crohn's disease in humans. A report for the U.K. Foods Standards Agency. January, 2002. http://www.foodstandards.gov.uk/multimedia/pdfs/mapcrohnreport.pdf.
166. Rzhetsky, A., S. Kumar, and M. Nei. 1995. Four-cluster analysis: a simple method to test phylogenetic hypotheses. Mol.Biol.Evol. 12:163-7.
167. Saxegaard, F., I. Baess, and E. Jantzen. 1988. Characterization of clinical isolates of Mycobacterium paratuberculosis by DNA-DNA hybridization and cellular fatty acid analysis. Apmis 96:497-502.
168. Scheibl, P., and G. F. Gerlach. 1997. Differentiation of Mycobacterium paratuberculosis isolates by rDNA-spacer analysis and random amplified polymorphic DNA patterns. Vet.Microbiol. 57:151-8.
169. Scholmerich, J. 2003. Inflammatory bowel disease. Endoscopy 35:164-70.
170. Schwartz, D., I. Shafran, C. Romero, C. Piromalli, J. Biggerstaff, N. Naser, W. Chamberlin, and S. A. Naser. 2000. Use of short-term culture for identification of Mycobacterium avium subsp. paratuberculosis in tissue from Crohn's disease patients. Clin.Microbiol.Infect. 6:303-307.
171. Semret, M., G. Zhai, S. Mostowy, C. Cleto, D. Alexander, G. Cangelosi, D. Cousins, D. M. Collins, D. van Soolingen, and M. A. Behr. 2004. Extensive genomic polymorphism within Mycobacterium avium. J.Bacteriol 186:6332-4.
172. Small, P. M., and J. D. van Embden. 1994. Molecular epidemiology of tuberculosis. In B. R. Bloom (ed.), Tuberculosis: pathogenesis, protection and control. American Society of Microbiology, Washington, D.C.
173. Sockett, D. C. 1996. Johne's disease eradication and control: regulatory implications. Vet Clin North Am Food Anim Pract 12:431-40.
174. Sockett, D. C., T. A. Conrad, C. B. Thomas, and M. T. Collins. 1992. Evaluation of four serological tests for bovine paratuberculosis. J Clin Microbiol 30:1134-9.
175. Spratt, B. G., and M. C. Maiden. 1999. Bacterial population genetics, evolution and epidemiology. Philos.Trans.R.Soc.Lond.B.Biol.Sci 354:701-10.
211 176. Sreevatsan, S., J. B. Bookout, F. Ringpis, V. S. Perumaalla, T. A. Ficht, L. G. Adams, S. D. Hagius, P. H. Elzer, B. J. Bricker, G. K. Kumar, M. Rajasekhar, S. Isloor, and R. R. Barathur. 2000. A multiplex approach to molecular detection of Brucella abortus and/or Mycobacterium bovis infection in cattle. J.Clin.Microbiol. 38:2602-2610.
177. Sreevatsan, S., X. Pan, K. E. Stockbauer, N. D. Connell, B. N. Kreiswirth, T. S. Whittam, and J. M. Musser. 1997. Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination. Proc.Natl.Acad.Sci. USA 94:9869-74.
178. Stabel, J. R. 1997. An improved method for cultivation of Mycobacterium paratuberculosis from bovine fecal samples and comparison to three other methods. J Vet Diagn Invest 9:375-80.
179. Stabel, J. R. 1998. Johne's disease: a hidden threat. J Dairy Sci 81:283-8.
180. Stabel, J. R., T. L. Bosworth, T. A. Kirkbride, R. L. Forde, and R. H. Whitlock. 2004. A simple, rapid, and effective method for the extraction of Mycobacterium paratuberculosis DNA from fecal samples for polymerase chain reaction. J Vet Diagn Invest 16:22-30.
181. Stabel, J. R., S. J. Wells, and B. A. Wagner. 2002. Relationships between fecal culture, ELISA, and bulk tank milk test results for Johne's disease in US dairy herds. J.Dairy Sci. 85:525-531.
182. Stanley, J., N. Baquar, and E. J. Threlfall. 1993. Genotypes and phylogenetic relationships of Salmonella typhimurium are defined by molecular fingerprinting of IS200 and 16S rrn loci. J.Gen.Microbiol 139 Pt 6:1133-40.
183. Stevenson, K., V. M. Hughes, L. de Juan, N. F. Inglis, F. Wright, and J. M. Sharp. 2002. Molecular characterization of pigmented and nonpigmented isolates of Mycobacterium avium subsp. paratuberculosis. J.Clin.Microbiol. 40:1798- 1804.
184. Stich, R. W., B. Byrum, B. Love, N. Theus, L. Barber, and W. P. Shulaw. 2004. Evaluation of an automated system for non-radiometric detection of Mycobacterium avium paratuberculosis in bovine feces. J.Microbiol.Methods 56:267-75.
185. Strand, M., T. A. Prolla, R. M. Liskay, and T. D. Petes. 1993. Destabilization of tracts of simple repetitive DNA in yeast by mutations affecting DNA mismatch repair. Nature 365:274-6. 212 186. Supply, P., J. Magdalena, S. Himpens, and C. Locht. 1997. Identification of novel intergenic repetitive units in a mycobacterial two-component system operon. Mol.Microbiol. 26:991-1003.
187. Supply, P., E. Mazars, S. Lesjean, V. Vincent, B. Gicquel, and C. Locht. 2000. Variable human minisatellite-like regions in the Mycobacterium tuberculosis genome. Mol Microbiol 36:762-71.
188. Suzuki, Y., A. Nagata, Y. Ono, and T. Yamada. 1988. Complete nucleotide sequence of the 16S rRNA gene of Mycobacterium bovis BCG. J.Bacteriol 170:2886-9.
189. Tharaldsen, J., B. Djonne, B. Fredriksen, O. Nyberg, and O. Siguroardottir. 2003. The National Paratuberculosis Program in Norway. Acta Vet Scand 44:243- 6.
190. Theus, S. A., M. D. Cave, and K. D. Eisenach. 2004. Activated THP-1 cells: an attractive model for the assessment of intracellular growth rates of Mycobacterium tuberculosis isolates. Infect.Immun 72:1169-73.
191. Theus, S. A., M. D. Cave, and K. D. Eisenach. 2005. Intracellular macrophage growth rates and cytokine profiles of Mycobacterium tuberculosis strains with different transmission dynamics. J.Infect.Dis 191:453-60.
192. Thoresen, O. F., and I. Olsaker. 1994. Distribution and hybridization patterns of the insertion element IS900 in clinical isolates of Mycobacterium paratuberculosis. Vet.Microbiol. 40:293-303.
193. Tooker, B. C., J. L. Burton, and P. M. Coussens. 2002. Survival tactics of M. paratuberculosis in bovine macrophage cells. Vet.Immunol.Immunopathol 87:429-37.
194. van Belkum, A. 1999. The role of short sequence repeats in epidemiologic typing. Curr.Opin.Microbiol. 2:306-11.
195. van Belkum, A., S. Scherer, L. van Alphen, and H. Verbrugh. 1998. Short- sequence DNA repeats in prokaryotic genomes. Microbiol.Mol.Biol.Rev. 62:275- 93.
196. van der Giessen, J. W., R. M. Haring, and B. A. van der Zeijst. 1994. Comparison of the 23S ribosomal RNA genes and the spacer region between the 16S and 23S rRNA genes of the closely related Mycobacterium avium and
213 Mycobacterium paratuberculosis and the fast-growing Mycobacterium phlei. Microbiology 140 ( Pt 5):1103-8.
197. van Embden, J. D., M. D. Cave, J. T. Crawford, J. W. Dale, K. D. Eisenach, B. Gicquel, P. Hermans, C. Martin, R. McAdam, T. M. Shinnick, and et al. 1993. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J.Clin.Microbiol. 31:406-9.
198. van Soolingen, D., J. Bauer, V. Ritacco, S. C. Leao, I. Pavlik, V. Vincent, N. Rastogi, A. Gori, T. Bodmer, C. Garzelli, and M. J. Garcia. 1998. IS1245 restriction fragment length polymorphism typing of Mycobacterium avium isolates: proposal for standardization. J.Clin.Microbiol. 36:3051-3054.
199. Via, L. E., D. Deretic, R. J. Ulmer, N. S. Hibler, L. A. Huber, and V. Deretic. 1997. Arrest of mycobacterial phagosome maturation is caused by a block in vesicle fusion between stages controlled by rab5 and rab7. J.Biol.Chem 272:13326-31.
200. Watt, J. A. A. 1954. Johne's disease in bovine associated with the pigmented strain of Mycobacterium johnei. Vet. Rec. 27:387.
201. Welsh, J., and M. McClelland. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res 18:7213-8.
202. Whipple, D., P. Kapke, and C. Vary. 1990. Identification of restriction fragment length polymorphisms in DNA from Mycobacterium paratuberculosis. J.Clin.Microbiol. 28:2561-2564.
203. Whipple, D. L., D. R. Callihan, and J. L. Jarnagin. 1991. Cultivation of Mycobacterium paratuberculosis from bovine fecal specimens and a suggested standardized procedure. J Vet Diagn Invest 3:368-73.
204. Whipple, D. L., P. A. Kapke, and R. E. Andrews, Jr. 1989. Analysis of restriction endonuclease fragment patterns of DNA from Mycobacterium paratuberculosis. Vet.Microbiol 19:189-94.
205. Whitlock, R. H., and C. Buergelt. 1996. Preclinical and clinical manifestations of paratuberculosis (including pathology). Vet.Clin.North Am.Food Anim Pract. 12:345-356.
214 206. Whitlock, R. H., S. J. Wells, R. W. Sweeney, and J. Van Tiem. 2000. ELISA and fecal culture for paratuberculosis (Johne's disease): sensitivity and specificity of each method. Vet Microbiol 77:387-98.
207. Whittington, R., I. Marsh, E. Choy, and D. Cousins. 1998. Polymorphisms in IS1311, an insertion sequence common to Mycobacterium avium and M. avium subsp. paratuberculosis, can be used to distinguish between and within these species. Mol.Cell.Probes 12:349-358.
208. Whittington, R. J., A. F. Hope, D. J. Marshall, C. A. Taragel, and I. Marsh. 2000. Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis: IS900 restriction fragment length polymorphism and IS1311 polymorphism analyses of isolates from animals and a human in Australia. J.Clin.Microbiol. 38:3240-3248.
209. Whittington, R. J., I. Marsh, M. J. Turner, S. McAllister, E. Choy, G. J. Eamens, D. J. Marshall, and S. Ottaway. 1998. Rapid detection of Mycobacterium paratuberculosis in clinical samples from ruminants and in spiked environmental samples by modified BACTEC 12B radiometric culture and direct confirmation by IS900 PCR. J.Clin.Microbiol. 36:701-707.
210. Whittington, R. J., I. B. Marsh, and R. H. Whitlock. 2001. Typing of IS1311 polymorphisms confirms that bison (Bison bison) with paratuberculosis in Montana are infected with a strain of Mycobacterium avium subsp. paratuberculosis distinct from that occurring in cattle and other domesticated livestock. Mol.Cell.Probes 15:139-45.
211. Whittington, R. J., L. Reddacliff, I. Marsh, and V. Saunders. 1999. Detection of Mycobacterium avium subsp paratuberculosis in formalin-fixed paraffin- embedded intestinal tissue by IS900 polymerase chain reaction. Aust.Vet.J. 77:392-397.
212. Whittington, R. J., and E. S. Sergeant. 2001. Progress towards understanding the spread, detection and control of Mycobacterium avium subsp. paratuberculosis in animal populations. Aust.Vet.J. 79:267-278.
213. Whittington, R. J., C. A. Taragel, S. Ottaway, I. Marsh, J. Seaman, and V. Fridriksdottir. 2001. Molecular epidemiological confirmation and circumstances of occurrence of sheep (S) strains of Mycobacterium avium subsp. paratuberculosis in cases of paratuberculosis in cattle in Australia and sheep and cattle in Iceland. Vet.Microbiol. 79:311-322.
215 214. Wiid, I. J., C. Werely, N. Beyers, P. Donald, and P. D. van Helden. 1994. Oligonucleotide (GTG)5 as a marker for Mycobacterium tuberculosis strain identification. J.Clin.Microbiol. 32:1318-21.
215. Williams, J. G., A. R. Kubelik, K. J. Livak, J. A. Rafalski, and S. V. Tingey. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res 18:6531-5.
216. Zhang, M., J. Gong, Z. Yang, B. Samten, M. D. Cave, and P. F. Barnes. 1999. Enhanced capacity of a widespread strain of Mycobacterium tuberculosis to grow in human macrophages. J.Infect.Dis 179:1213-7.
217. Zwick, L. S., T. F. Walsh, R. Barbiers, M. T. Collins, M. J. Kinsel, and R. D. Murnane. 2002. Paratuberculosis in a mandrill (Papio sphinx). J.Vet.Diagn.Invest. 14:326-8.
216