Mycobacterial Species As Case- Study of Comparative Genome Analysis

2012

[SCIENTIFIC PRODUCTION]

Doctorat Es Science in Microbiology & Molecular Biology Scientific production 2012

SCIENTIFIC PRODUCTION

A- List of international Publications (06):

1. Fathiah ZAKHAM, Lamiae BELAYACHI, Dave USSERY, Mohammed AKRIM, Abdelaziz BENJOUAD, Rajae El AOUAD and Moulay Mustapha ENNAJI. 2011. Mycobacterial species as a case-study of comparative genome analysis. Cell. Mol. Biol. 57 : 1462-1469 . 2. Fathiah ZAKHAM , Halima BAZOUI, Mohammed AKRIM, Sanae LAMRABET, Ouafae LAHLOU, Mohamed EL MZIBRI, Abdelaziz BENJOUAD, My Mustapha ENNAJI and Rajae ELAOUAD. 2012. Evaluation of conventional Molecular diagnosis of Mycobacterium tuberculosis in the clinical specimens from Morocco. J Infect Dev Ctries. 6(1):40-45. 3. Fathiah ZAKHAM , Mohammed AKRIM, Mohamed ELMZIBRI, Abdelaziz BENJOUAD, Rajae ELAOUAD and My Mustapha ENNAJI. 2012 . Rapid Screening and Diagnosis of Tuberculosis: a real Challenge for the mycobacteriologist. Cell. Mol. Biol . 58 : 1632-1640. 4. Fathiah ZAKHAM, Oufae LAHLOU, Mohammed AKRIM, Nada BOUKLATA, Sanae JAOUHARI, Mohamed ELMZIBRI, Abdelaziz BENJOUAD, Mustapha ENNAJI and Rajae ELAOUAD. 2012. Comparison of a DNA based PCR approach with conventional methods for the detection of Mycobacterium tuberculosis in Morocco . Mediterr J Hematol Infect Dis. 4: (1) 5. Fathiah ZAKHAM , Othmane AOUANE, David USSERY, Abdelaziz BENJOUAD and Mouly Mustapha ENNAJI. 2012. Computational and comparative genomics- proteomics and Phylogeny analysis of twenty one mycobacterial genomes. BMC microbial informatics and experimentation. 7:2. 6. Fathiah ZAKHAM , Imane CHAOUI, Mohammed ABID, Moulay Driss MESSAOUDI, Moulay Mustapha ENNAJI, Mohamed ELMZIBRI. Automated sequencing for the direct detection of Multi drug Mycobacterium tuberculosis strains in the sputum specimens of Moroccan patients. (In preparation).

Doctorat Es Science in Microbiology & Molecular Biology Scientific production 2012

B- Publication of sequences in GenBank at National Center for Biotechnology Information NCBI (10)

HSP65 VFS22 04 11.sqn HSP65S4 JF921153 HSP65 VFS22 04 11.sqn HSP65S2 JF921154 HSP65 VFS22 04 11.sqn HSP65S3 JF921155 HSP65 VFS22 04 11.sqn HSP65S5 JF921156 HSP65 VFS22 04 11.sqn HSP65S7 JF921157 HSP65 VFS22 04 11.sqn HSP65S8 JF921158 HSP65 VFS22 04 11.sqn HSP65S9 JF921159 HSP65 VFS22 04 11.sqn HSP65S6 JF921160 HSP65 VFS22 04 11.sqn HSP65S10 JF921161 HSP65 VFS22 04 11.sqn HSP65S1 JF921162

C- List of Communications (13):

1. Oral presentations (05)

1. Fathiah ZAKHAM . Diagnostic moléculaire de Mycobacterium tuberculosis dans les échantillons cliniques. The 8 th edition of Doctorial in Morocco. Incubateur Universitaire de Marrakech « INMA ». 12-18 th December 2010.

2. Fathiah ZAKHAM , Lamiae BELAYACHI, Dave USSERY, Mohammed AKRIM, Abdelaziz BENJOUAD, Rajae ElAOUAD and M M ENNAJI . International Bioinformatics Software School. Tangier- Morocco. Comparative Genomics and Proteomics for differentiation between fourteen Mycobacterial strains. IBSS 2011, 4-9th April 2011

3. Fathiah ZAKHAM , Halima BAZOUI, Mohammed AKRIM, Sanae LAMRABET, Ouafae LAHLOU, Mohamed ELMZIBRI, Abdelaziz BENJOUAD, Rajae ELAOUAD and My Mustapha ENNAJI. Evaluation of conventional polymerase chain reaction for the diagnosis of Mycobacterium tuberculosis in the Doctorat Es Science in Microbiology & Molecular Biology Scientific production 2012

clinical specimens from Morocco. International Congress: La recherché, la Biotechnologie et le consommateur au service de l’Environnement et de l’industrie Agroalimentaire » Faculty of Science Kenitra. 19 th -20 th May 2011.

4. Fathiah ZAKHAM , Othmane AOUANE, David USSERY, Abdelaziz BENJOUAD and Mouly Mustapha ENNAJI. Computational genome and proteome analysis of Mycobacterium tuberculosis and non tuberculosis mycobacteria. International conference Humboldt Kolleg “New Prospects and Challenges for Science and Education in the MENA region. Marrakesh- Morocco. 9th - 11 th March, 2012.

5. Fathiah ZAKHAM , Imane CHAOUI, Mohammed ABID, Moulay Driss MESSAOUDI, Moulay Mustapha ENNAJI, Mohamed ELMZIBRI. Rapid detection of Multi Drug Resistance Mycobacterium tuberculosis strains in the clinical specimens from Morocco. International conference on Antimicrobial Research. Lisbon, Portugal. 21 st -23 rd November, 2012. (accepted)

2. Poster presentations (08)

1. Fathiah ZAKHAM , Halima BAZOUI , M M Ennaji, Sanae LAMRABET, Ouafae LAHLOU, Mohamed ELMZIBRI, Abdelaziz BENJOUAD, Mohammed AKRIM, and Rajae ELAOUAD. 3rd International Congress of Biochemistry and Molecular Biology. Direct Molecular Diagnosis of Mycobacterium tuberculosis in the sputum specimens. Marrakech, April 20-25 th , 2009.

2. Fathiah Zakham , Lamiae BELAYACHI, Dave USSERY, Mohammed AKRIM, Abdelaziz BENJOUAD, Rajae El AOUAD and Moulay Mustapha ENNAJI. Xth Spanish symposium on Bioinformatics. Comparative Genome Analysis of Mycobacterium sp (Mycobacterium Tuberculosis and other non tuberculosis Mycobacteria). Torremolinos- Malaga, Spain 27-29th . October, 2010.

3. Fathiah ZAKHAM , Lamiae BELAYACHI, Dave USSERY, Mohammed AKRIM, Abdelaziz BENJOUAD, Rajae El AOUAD and Moulay Mustapha ENNAJI. International Bioinformatics Software School IBSS 2011. Computational Genomics and Proteomics are potential tools for the comparison Doctorat Es Science in Microbiology & Molecular Biology Scientific production 2012

between pathogenic and free living Mycobacteria. Tangier- Morocco 4-9th April, 2011.

4. Fathiah ZAKHAM , Oufae LAHLOU, Mohammed AKRIM, Nada BOUKLATA, Sanae JAOUHARI, Mohamed ELMZIBRI, Abdelaziz BENJOUAD, Mustapha ENNAJI and Rajae ELAOUAD. The insertion sequence IS6110 as a potential tool for the detection of Mycobacterium tuberculosis in the critical cases of the Moroccan population. The 7 th European congress of Tropical Medicine and International Health. Barcelona. Spain.3- 6th October. 2011.

5. Fathiah ZAKHAM , Oufae LAHLOU, Mohammed AKRIM, Mohamed ELMZIBRI, Abdelaziz BENJOUAD, Rajae ELAOUAD and Mustapha ENNAJI. Detection of Mycobacterium tuberculosis in the clinical specimens by the PCR technique targeting the insertion sequence IS6110 in Morocco. International engagement: Responsible Bio Science and Secure Society, workshop III. Tunis, Tunisia, 31 st October- 1st November, 2011.

6. Fathiah ZAKHAM , Mohammed AKRIM, Nada BOUKLATA, Mohamed ELMZIBRI, Abdelaziz BENJOUAD, Mustapha ENNAJI and Rajae ELAOUAD. Comparative analysis of conventional and molecular detection of Mycobacterium tuberculosis in the critical cases of the Moroccan population. International conference Humboldt Kolleg “New Prospects and Challenges for Science and Education in the MENA region. Marrakesh- Morocco. 9th - 11 th March, 2012.

7. Fathiah ZAKHAM , Othmane AOUANE, David USSERY, Abdelaziz BENJOUAD, Mohamed ELMZIBRI and Mouly Mustapha ENNAJI. Evolutionary Relationships between pathogenic and free living mycobacterial species. Tuberculosis Conference 2012: Biology, Pathogenesis, Intervention strategies. Pasteur Institute Paris. 12 th -15 th September 2012.

8. Fathiah ZAKHAM , Imane CHAOUI, Mohammed ABID, Moulay Driss MESSAOUDI, Moulay Mustapha ENNAJI, Mohamed ELMZIBRI. Automated sequencing for the rapid detection of Multi Drug Resistant Mycobacterium tuberculosis strains in the sputum specimens of Moroccan patients. Tuberculosis Conference 2012: Biology, Pathogenesis, Intervention strategies. Pasteur Institute Paris. 12 th -15 th September 2012. Doctorat Es Science in Microbiology & Molecular Biology Dedication 2012

DEDICATION

I dedicdedicateate my modest work to every person who helpedhelped me in the process of fulfilling my thesis.

To my daughtedaughterr Romissa’a , my symbol of love

To my parents, my symbol of confidence

To my sisterssisters:: Najat, Mariam and FatimaFatima,, my symbol of kindness

To my friends, my symbol of fidelity and respect

And to whom I’m grateful.grateful.

Fathiah ZAKHAM

Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Foreword & Acknowledgement 2012

FOREWORD & ACKNOWLEDGEMENT This present study was done within the framework between laboratory of Biochemistry and Immunology at Faculty of Science-Rabat (FSR)-University Mohammed V-AGDAL, directed by Pr. Abdelaziz BENJOUAD, the laboratory of Virology and Hygiene &Microbiology (LVHM) at Faculty of Sciences and Techniques (FSTM) - University Hassan II Mohammedia, Casablanca (UH2MC), directed by Pr. Moulay Mustapha Ennaji and Laboratory of Molecular Biology at the National Institute of Hygiene (NIH) of Rabat.

This thesis was realized in collaboration with the Unit of Biology & Medical Research at the National Centre of Nuclear Energy, Sciences & Techniques (CNESTEN) of Rabat.

The computational & bioinformatics analysis were performed in partnership with the Centre for Biological Sequence Analysis (CBS) - Technical University of Denmark, Lyngby, Denmark.

This thesis was financially supported by the Academy Hassan II of Sciences & Techniques within the framework of IMMGEN project and The Ministry of Higher Education and Scientific Research (UH2MC) and the National Centre of Scientific and technical research (CNRST) for supporting a part of technical analysis.

I want to express my sincere thanks to all, who had played a role in the drafting of this manuscript and helped bring this work into the light. My regards and my thanks are due to:

Professor Abdelaziz BENJOUAD, the Director of the CNRST, the head of the UFR Biochemistry and immunology, who co supervised and directed me through the period of my study. In addition, I would like to thank Pr BENJOUAD for his commitment and his competence, despite the many concerns and responsibilities.

Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Foreword & Acknowledgement 2012

Professor Moulay Mustapha Ennaji, Full Professor and Director of LVHM- (FSTM- UH2MC), who supervised and played the role of my Director of my thesis, Firstly, for accepting my candidacy within the PhD program, secondly for giving me a chance to continue my higher studies. Finally, for supervising and directing my work and for being one of my competent professors during the years of higher studies.

Professor Rajae Elaouad, Professor at the Faculty of Medicine and Pharmacy of Rabat and director of the National Institute of Hygiene (NIH) for having pleasantly agreed to apply this research within her establishment.

Dr. Mohammed Akrim, the head of the laboratory of Molecular Biology at NIH, for the honour that he agreed to supervise me at NIH, I am grateful for his invaluable councils, for being always there for me to correct and advise me during the period of my education, for his generosity, sympathy, and encouragements, for accepting to direct my research, guide me during the period of my presence at the laboratory and for devoting his time for reading and correction of this document.

Professor Said AMZAZI, the Dean of the faculty of Science in Rabat, for chairing the committee of the acceptation of this thesis, for the honour of being the president of the jury and hence I am extremely honoured.

I warmly thank Professor Youssef BAKRI to accept judging and being a reporter of this thesis and for his invaluable judgment.

I also want to express my special gratitude to Professor Houssin AZZEDOUG, the Vice Dean of the Faculty of Science Ain Achok- Casablanca, for accepting to be a reporter of my thesis.

Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Foreword & Acknowledgement 2012

I would like to thank Professor Khalid ZEROUALI at the Faculty of Medicine & Pharmacy of Casablanca, for accepting to judge this work and being a reporter in the jury.

I express my sincere thanks to Dr. Mohammed ELMZIBRI, for his advice and help during my presence at CNESTEN, for devoting his time and efforts in reading and correcting the drafts of my scientific articles and for allowing me to finalize the last part of my thesis at his laboratory.

I warmly thank Professor David USSERY at the CBS for his generous help & support, for enabling me to fulfil an important part of my thesis on the server of the CBS, for devoting his time in the correction of my articles and distinguished remarks.

El FAHIME El Mostafa at the Technical Support Units for Scientific Research (UATRS) at the CNRST for his technical support.

MELLOUL Merouane at the UATRS for his help, technical support and scientific councils. I do not forget the people who surrounded me every day, I express thanks to all the staff members of the National laboratory of Reference in Tuberculosis (LNRT) at NIH.

I also thank all the personnel at the laboratory of Molecular Biology at NIH for their assistance and for their sympathy. I thank particularly ELOUDIYI H., LAMRABET S. and KASMI S.

I express my special thanks to CHAOUI I. at CNESTEN for her help and scientific advice. I address my sincere acknowledgements to the Academy of Hassan II in Morocco for the funding of this project.

I would like finally to thank every person who participated in the realization of this project.

Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM Doctorat Es Science Microbiology & Molecular Biology Abstract 2012

Abstract

In spite of the availability of treatment and vaccine, tuberculosis (TB) remains a major public health concern and a great threat of humanity. Recently, an alarming situation has been emerged by the discovery of Multi and extensively drug resistant strains (MDR/XDR-TB). Worldwide, the health care providers face a vast problem for the rapid diagnosis of Mycobacterium tuberculosis (MTB), the causal agent of TB and MDR-TB strains. The conventional techniques for diagnosis of MTB are based on the microscopical examination, which lacks sensitivity and culture that requires several weeks of incubation. Furthermore, the conventional drug susceptibility testing (DST) takes long turnaround time and cumbersome procedure. This present study aim to evaluate the PCR based molecular techniques for the rapid and direct detection of MTB in clinical specimens by using the gene target hsp65 and the insertion sequence IS6110 for this purpose. Automated sequencing of hsp65 gene was used for the identification of MTB to species level. Moreover, the automated sequencing based PCR was also performed for the detection of mutations in specific genes ( rpoB and katG ) for rapid investigation of MDR-TB strains in sputum specimens. For better understanding the evolution of MTB strains, a comparative genome, proteome and phylogeny analysis was done by comparing the available whole mycobacterial genomes against each other and visualizing this comparisons in simple schemes presented by the definition of their pan and core genome, BLAST matrix and 16S r RNA phylogenetic tree. The results of molecular approach showed a good sensitivity and specificity of both targets hsp65 gene and the insertion sequence IS6110, with an excellent agreement between the culture (gold standard) and IS6110 PCR by applying Kappa index. Further, the sequencing of genes responsible of drug resistance rpoB and katG showed that MDR-TB cases were related to previously treated patients (relapse, failure, chronic and treatment abandon) and this will help the national TB program for establishing new strategies for the surveillance of those critical cases. Significantly, the computational and phylogeny analysis showed a high relatedness between the members of the complex MTB and a strong relationship between MTB and other pathogenic mycobacteria and this could provide a new insight of understanding the evolutionary events of those microorganisms and paving the way of new diagnosis targets.

Key words: Mycobacterium tuberculosis , polymerase chain reaction (PCR), diagnosis, evolution

Direct Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science Microbiology & Molecular Biology Abstract 2012

Résumé

Malgré la disponibilité des traitements et de vaccins, la tuberculose (TB) reste un problème majeur de santé publique et une grande menace de l'humanité. Récemment, une situation alarmante a été émergée par la découverte des souches multi-résistance aux médicaments (MDR-TB). Dans le monde, les personnels de santé sont confrontés à un vaste problème pour le diagnostic rapide de Mycobacterium tuberculosis (MTB), l'agent causal de tuberculose et de TB-MDR. Les techniques classiques de diagnostic de MTB sont basées sur l'examen microscopique, qui manque de sensibilité et de la culture qui nécessite plusieurs semaines d'incubation. En outre, les tests de sensibilité aux médicaments antituberculeux (DST) prennent du temps longue et procédure lourde. L’objectif de ce travail est d'évaluer les techniques basées sur la PCR pour la détection moléculaire rapide et directe de MTB dans les échantillons cliniques en utilisant le gène cible hsp65 et la séquence d'insertion IS6110. Le Séquençage automatisé du gène hsp65 a été utilisé pour l'identification de MTB à niveau de l'espèce. Par ailleurs, le séquençage automatisé basé sur la PCR a également été effectuée pour la détection de mutations dans des gènes spécifiques ( rpoB et katG ) pour la détection rapide des souches de MDR-TB dans les crachats Pour une meilleure compréhension de l'évolution des souches de MTB, une analyse comparative, génomique, protéomique et phylogénétique a été réalisée en comparant les génomes entiers disponibles des souches mycobactériennes uns contre les autres et la visualisation, présentées par la définition de pan core génome, la matrice BLAST et 16S r ARN arbre phylogénétique. Les résultats de l'approche moléculaire ont montré une bonne sensibilité et spécificité du gène hsp65 et la séquence d'insertion IS6110, avec une excellente accordance entre la culture et IS6110 PCR en appliquant l’indice de Kappa. En outre, le séquençage des gènes responsables de la résistance aux médicaments rpoB et katG a montré que les cas MDR-TB ont été liés à des patients préalablement traités (rechute, échec, chronique et l'abandon de traitement) et cela aidera le programme national de lutte antituberculeuse pour l'établissement de nouvelles stratégies pour la surveillance de ces cas critiques. De manière significative, l'analyse bioinformatique et la phylogénie ont montré une forte similarité entre les membres de la complexe MTB et une relation forte entre le MTB et d'autres mycobactéries pathogènes, ce qui pourrait donner un nouvel aperçu de la compréhension des événements évolutifs de ces micro- organismes et ouvrant la voie de nouveaux cibles du diagnostic.

Les mots clés: Mycobacterium tuberculosis , PCR, diagnosis, evolution.

Direct Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science Microbiology & Molecular Biology Abstract 2012

ا ا اج وا ح، ال ض ا آا ا وا آا . او اة ت ة اآف ت و دو ادة ض . أء ا ا ا ا وا ا ا ض ا و ات ذات او ادة دو . ات ا ا أي و اي إ ا او اارع ا ا ة أ ا . ووة ذ ارات ا و و إاءات ه . و ه ارا ف إ ات ا ا ا اوي اة ا وا ا ا ض ا و ات ذات او ادة دو ات ا . ا اض اام أ اف h sp65 و ا IS6110 . ا اءة ات او ا اا م أ h sp65 و إ ى اع.

و ا اءة ات او أ اات ت rpoB, katG ا ت ا او دو ت ا. أ أ أاث ر ت ا ا ر ام و اوم، و أ 16rRNA ا ء ة اء وار. وأت ات ا ة و اة اء ام أ h sp65 و ا IS6110 . آ، أت اءة ات او أ ا اات ات ا ات ذات او ادة دو ا ا ا ( ت اس، وا، وات ا وا اج ) وها أن ا و اات ة ا ه ات ا. آ، أ ا ا ارط أء ا و ود ا و ا ا اض اى وها أن م رؤ ة ااث ار ات ا ا و ا آف أهاف ة .

ات اا: ا , اة ا ا, , ار

Direct Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Sciences in Microbiology & Molecular Biology List of Abbreviation 2012

List of abbreviations

A: Adenine AIDS: Acquired Immunodeficiency Syndrome BACTEC MGIT 960: BACTEC Mycobacteria Growth Indicator Tube BACTEC 460 TB system: Fully Automated Instruments for Detection of M. tuberculosis BCG: Bacille Calmette–Guérin BLAST: Basic Local Alignment and Research Tool bp: Base Pair bPCR: Biotinylated PCR. C: Cytosine C°: Celsius degree CDST: Centre de Diagnostic de Santé de la Tuberculose CFU: Cell Forming Unit CMI: Cell-Mediated Immunity ddNTPs: Didesoxynucleotides DELM: Direction Epidémiologique de Lutte contre Maladies DNA: Deoxy Ribonucleic acid dNTP: Deoxy Nucleotides DOTS strategy: Directly Observed Therapy Strategy ED: Dense Electron layer EDTA: Ethylene Diamine Tetra-Acetic acid ELISA: Enzyme Linked Immunosorbent Assay ET: Electron Transparent layer g: Gram G: Guanine HIV: Human Immunodeficiency Virus HSP 65: Heat Shock Protein 65 INH: Institut National d’Hygiène L: Litre LAM: Lipoarabinomannan LiPA : Solid Phase Hybridization Assay

Molecular Detection of MTB in the clinical specimens F.ZAKHAM

Doctorat Es Sciences in Microbiology & Molecular Biology List of Abbreviation 2012

LJ: Löwenstein-Jensen medium MDR: Multi Drug Resistance mg: Milligram µg: Microgram MIC: Minimal Inhibitory Concentration min: Minute mL: Millilitre MTB: Mycobacterium tuberculosis MTBc: Mycobacterium tuberculosis complex NaOH: Sodium hydroxide NTM: Non Tuberculosis Mycobacteria PCR: Polymerase Chain Reaction PE: Glycine- rich Proteins, Pro-Glu pH: Hydrogen potential PM: Plasma Membrane PPE: Pro-Pro-Glu PRA : PCR- Restriction Enzyme Analysis qNRT- PCR: Quantitative Nested Real-Time PCR qPCR: Quantitative PCR. RD: Deleted Regions RFLP: Restriction enzyme Fragment Length Polymorphisme Sp: Species T: Thymine TB: Tuberculosis TBE buffer: Tris-Borate EDTA buffer TE buffer: Tris –EDTA WHO: World Health Organisation.

Molecular Detection of MTB in the clinical specimens F.ZAKHAM

Doctorat Es Science in Microbiology & Molecular Biology List of tables 2012

List of tables

Table 1: Master-Mix and the conditions of hsp65 gene PCR………………………………..42

Table 2: Master-Mix and the conditions of IS6110 PCR...... ………………………………...42

Table 3: Master-Mix and the conditions of rpoB gene PCR………………………………... 43

Table 4: Master-Mix and the conditions of KatG gene PCR………………………………...43

Table 5: Primers used for the realization of each PCR………………………………...... 44

Table 6: The conditions of the sequencing reaction…………………………………………45

Molecular Diagnosis of MTB in clinical specimens F.ZAKHAM

Doctorat Es Science in Microbiology & Molecular Biology List of Figures 2012

List of figures

Figure 1: Opened thorax of Egyptian mummy showed the presence of BK……………….6

Figure 2: double-barred cross, symbol of anti-tuberculosis crusade………………………..6

Figure 3: Model of mycobacterial cell envelope ………………………………………...... 12

Figure 4: Circular map of the chromosome of M. tuberculosis H37Rv ………………...... 13

Figure 5: Scheme of the proposed evolutionary pathway of the tubercle bacilli...... 16

Figure 6: Phylogenetic Position of MTB within the Genus Mycobacterium ...... 17

Figure 7: Principal genetic groups of the complex MTB...... 17

Figure 8: Estimated incidence of tuberculosis in the world in 2011...... 20

Figure 9: Estimated Incidence of TB in African Countries in 1990 and 2005…………….20

Figure 10: Pathogenesis of tuberculosis …………………………………………………..24

Figure 11: Mechanism of host defense against intracellular infection by mycobacteria ....24

Figure 12: Infected macrophages were acid-fast examined by light microscopy ………...30

Figure 13: Colonies of Mycobacterium tuberculosis on Lowenstein-Jensen medium…....30

Figure 14: Steps of Spoligotyping method………………………………………………..34

Figure 15: Chromosome of MTB strains, genotyping by MIRUs…………………...... 34

Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM

Doctorat Es Science Microbiology & Molecular biology List of appendix 2012

List of appendix

Appendix (1)……………………………………………………………………………..80

Appendix (2)……………………………………………………………………………..81

Appendix (3)……………………………………………………………………………..82

Molecular Diagnosis of MTB in clinical specimens F.ZAKHAM

CONTENTS

List of scientific production Dedication Foreword and Acknowledgment Abstract Resume List of abbreviation List of tables List of figures List of appendix Contents

Problematic Hypothesis of thesis

General introduction...... …………………………………………………...... 1 Objectives of this thesis...... ……………………………………………………….....3

PART 1: Bibliographical review I. History of tuberculosis...... 4 I.1. History of disease...... 4 I.2. History of anti-tuberculosis therapy...... 7 II. General bacterial characteristics…………………………………………………...... 8 II.1. Taxonomy & classification of mycobacteria...... 8 II.2. General Characteristics of mycobacteria...... 9 II.3. Morphology………………………………………………………………………10 II.4. Mycobacterial cell envelop……………………………………………………….10 II.5. Metabolism of mycobacteria……………………………………………………..10 II.6. Genomics of mycobacteria...... ……………………………………...11 II.7. Molecular evolution of MTBC...... 14 III. Epidemiology of tuberculosis………………………………………………………...18 III. 1. Tuberculosis in the world...... 18 III. 2. Tuberculosis in Africa...... 19 III. 3. Tuberculosis in Morocco...... 19 IV. Immunology, Pathogenesis & Virulence ……………………………...... 21 IV.1. Pathogenesis…………………………………………………………………….21 IV.2.Host Defenses……………………………………………………………………21 IV.3.Clinical Manifestations…………………………………………………………..22 IV.3.1. Pulmonary tuberculosis ……………………………………………………..22 IV.3.2.Tuberculous meningitis ……………………………………………………...23 IV.3.3. Miliary tuberculosis ………………………………………………………....23 IV.3.4. Renal and urogenital tuberculosis…………………………………………...23 IV.3.5 .Bone and joints tuberculosis ………………………………………………..23 V. Tuberculosis & Co-infection with HIV...... 25 VI. Screening & Diagnosis of MTB...... 25 VI.1. Diagnosis of latent TB …………………………………………………………..25 VI.2. Diagnosis of active TB……………………………………………………...... 26 VI.2.1. Radiological Examination...... 26 VI.2.2. Bacteriological examination...... 26 VI.2.2. A. Microscopic examination...... 27 Ziehl-Neelsen staining technique...... 27 Auramine phenol technique...... 28 VI.2.2. B. Culture...... 28 VI.2.2. C. Phenotypic and biochemical identification...... 28 VI.2.2. D. Drug susceptibility testing DST………………………………….29 VI.2.3. Molecular Examination...... 29 VI.2.3.A. DNA Amplification by PCR, including Real Time PCR……………….31 VI.2.3. B. Nucleic acid Probe……………………………………………………...32 VI.2.3.C. In situ Hybridization…………………………………………………….32 VI.2.3.D. Automated Sequencing…………………………………………………32 VI.2.3.E. Strain typing and DNA fingerprinting………………………………...... 32 VI.2.3.F. Microarray analysis………………………………………………………33 VII. Treatment and Control……………………………………………………………...... 35 IX. Drug resistance & extensively drug resistance...... 36

Study Plan ...... 38 Review article (Publication I)……………………………………………………………...40

PART 2: Practical part A. Materials & Methods I. Specimens Collection...... 41 II. Decontamination of specimens……………………………………………………...... 41 II.1. Decontamination of specimens for hsp65 amplification...... 41 II.2.Decontamination of specimens for IS6110, rpoB and katG amplification...... 41 III.1. TE boiling extraction…………………………………………………………...... 41 IV. Reaction of PCR……………………………………………………………………...42 The amplification of hsp65 gene...... 42 The amplification of the insertion sequence IS6110...... 42 The amplification of the gene rpoB ...... 43 The amplification of the katG gene...... 43 V. Visualisation of the PCR products………………………………………………...... 44 VI. Purification of the PCR products ………………………………………………...... 44 VII. Sequencing Reaction………………………………………………………………..44 VIII. Purification of the products of the reactions of sequences……………………...... 45 IX. Automated Detection of the sequences……………………………………………...46 X. Analysis of the sequences………………………………………………………….....46

B- Results Chapter 1: (Publications II& III)…………………………………………………………47 Chapter 2: (Publications IV)……………………………………………………………...51 Chapter 3: (Publications V & VI)………………………………………………………...54

PART 3: General Discussion ………………………………………………………….....58

PART 4: Conclusion & Perspectives Conclusion …………………………………………………………………………...... 66 Perspectives ………………………………………………………………………...... 67

PART 5: Bibliographical References References ………………………………………………………………………………..68 Appendix………………………………………………………………………………....80

RESUME

Doctorat Es Sciences in Microbiology & Molecular Biology Problematic 2012

Problematic

Tuberculosis (TB) is a major public health problem over the world, with a high incidence rate in Morocco and has an impact on the socioeconomic status of the country, since it infects the youngest productive age group (15- 45 years old) as reported by the Ministry of health.

In many cases, the achievement of TB management is difficult due to the lack or late diagnosis of the disease. The diagnosis is mainly based on the bacilloscopy and sometimes on culture if requested and even so, the long incubation time of these fastidious microorganisms pose another problem.

Therefore, the early diagnosis and appropriate chemotherapy are the keys of TB management and the solutions for preventing the dissemination of the disease in the community.

Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM Doctorat Es Sciences in Microbiology and Molecular Biology Hypothesis of study 2012

Hypothesis of study

Are molecular techniques appropriate for the rapid diagnosis and identification of MTB in clinical specimens in Morocco?

Are molecular techniques appropriate for the detection of mutations in the genes associated with MDR-TB and management of drug resistant TB cases?

Could the Study of the whole entire available genome sequences of mycobacterial strains allow building a new vision of the evolution of Mycobacterium ?

Doctorat Es Science in Microbiology & Molecular Biology General Introduction 2012

General Introduction

Tuberculosis (TB) is as ancient as humanity, killing million of people through the ages and remains a major public health problem. According to the latest reports of the World Health Organization (WHO), one-third of the global population is infected with Mycobacterium tuberculosis (MTB) the causative agent of TB and approximately 9 million new cases of TB arise annually and over 1.1 million deaths among HIV-negative people and 0.35 million deaths among HIV-positive people (WHO, 2011).

Due to demographi c factors, socio-economic status , neglected TB control and HIV epidemic, there are many undiagnosed TB cases (WHO, 2011). Unfortunately, most of patients in the developing countries do not have an access to TB diagnosis and treatment leading to the acquisition of MTB drug resistance or multi drug resistance MDR-TB. With the emergence of MTB/MDR strains, there is a crucial need for the rapid diagnosis of the microorganism, detection of MDR-TB strains and development of new anti-tuberculosis drugs(Brooks et al. , 1998).

The conventional laboratory diagnosis of tuberculosis is based on the method of Ziehl- Neelsen acid –fast bacilli stain and culture of MTB (Cheesbrough, 2000; Gupte, 1999). Ziehl- Neelsen stain is a rapid and cheap method but it lacks sensitivity. The culture is time consuming and requires viable microorganism, and this is a problem especially in the treated patients (Nagesh et al. , 2001). Indeed, several rapid methods to diagnose MTB have been developed, such as DNA probes, and BACTEC system but they require sophisticated equipment.

The polymerase chain reaction (PCR) can amplify a small fragment of DNA with high specificity for the diagnosis of infectious diseases (Abraham et al. , 2012; Ani et al. , 2009; De Wit et al. , 1990; Saltini, 1998; Takahashi et al. , 2007; Zakham et al. , 2012).

In the first part of our study, we evaluated the PCR as a rapid and direct molecular method for diagnosis of MTB in clinical specimens by targeting the gene hsp65 and the insertion sequence IS6110. The hsp65 gene is present in all mycobacteria (Ringuet et al. , 1999) and the insertion sequence IS6110 is specific to the complex MTB (Thorne et al. , 2011) and both of those targets are useful for the diagnosis.

1 Molecular Diagnosis of MTB in Clinical Specimens F. ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology General Introduction 2012

Then, we compared the results of molecular approach with the results of conventional methods to evaluate the direct PCR diagnosis of TB in clinical samples.

Moreover, the identification of MTB strains to species level was also performed by sequencing the hsp65 gene for some specimens and the resulted sequences were registered at NCBI (GenBank) and the accession numbers are available online.

Further, for the direct detection of MDR-TB, both of genes rpoB and katG were used as targets for the investigation of the resistance against the main first line TB drugs Rifampicin and Isoniazid (Brooks et al. , 1998). Automated sequencing of these genes allowed the identification of new mutations associated with drug resistance. This approach provides a same-day drug resistance diagnosis from culture and even clinical samples with high sensitivity and specificity (Neonakis et al. , 2008).

Studying the genomics of MTB and other non tuberculosis mycobacterial strains is crucial for better understanding the evolutionary events and consequently, the conception of their environmental niches, mechanisms of adaptation into human and animal being, pathogencity, virulence determinants that paved the way for appropriate conditions of survival within their hosts and the development of new tools of diagnosis and drug targets for better controlling those threatening diseases (Cole, 2002).

Thus, a comparison between mycobacteral (tuberculosis and non tuberculosis) strains was described and phylogeny analysis performed by applying computational tools (pan and core genome, BLAST matrix, 16S ribosomal RNA phylogenetic tree) on a set of mycobacterial genomes collection, which could provide a key insight and a strong foundation for future investigations on the genetics, evolution, natural physiology, and virulence of these important pathogens.

2 Molecular Diagnosis of MTB in Clinical Specimens F. ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Objectives 2012

Objectives of Thesis

The main objective:

Rapid and direct molecular diagnosis of Mycobacterium tuberculosis (MTB), the causative agent of tuberculosis and molecular detection of Multi Drug Resistance (MDR-TB) by PCR based techniques in clinical specimens.

Specific objectives:

1. Evaluation of polymerase chain reaction (PCR) to amplify the MTB specific insertion sequence IS6110 and the gene hsp65 for identification of MTB.

2. Alignment of hsp65 gene sequences for the identification of MTB complex to the species level.

3. Determination of the specificity and the sensitivity of the PCR diagnostic techniques.

4. Comparison of the routine microbiological laboratory testing and molecular diagnosis for detection of MTB (validation of results).

5. Rapid identification of MDR-TB by DNA sequencing of rpoB and KatG genes for the characterization of the mutations responsible of drug resistance.

6. Comparison of entire genomes and phylogenic analysis between Mycobacterium tuberculosis and other mycobacterial (Pathogenic and environmental) species, which permits the study of more complex evolutionary events for better improving the techniques of diagnosis by uncovering new gene targets.

3 Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM

Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

I. HISTORY OF TUBERCULOSIS (TB):

I.1. History of the disease:

Tuberculosis (TB) is an ancient disease infected mankind since millennia and has a long history. Remarkably, it was fired by different terms; consumption, phthisis, scrofula, Pott's disease and the White Plague…etc. Moreover, the presence of Mycobacterium tuberculosis (MTB), the causal agent of TB in the tissues and skeletal remains show that prehistoric humans (5000 BC) had tuberculosis (Daniel, 2006). Additionally, tubercular decay and skeletal abnormalities, including characteristic of Pott’s deformities, had been detected in the spines of Egyptian mummies (Figure 1) and documented in several studies (Daniel, 2006), either by direct conventional microscopic examination (Zimmerman, 1977) or by the detection of mycobacterial DNA using molecular techniques (Donoghue et al. , 2004; Nerlich et al. , 1997; Ziskind and Halioua, 2007). The existence of pre- Colombian TB was also registered in America, particularly in the Peruvian mummies (Daniel, 2006). Furthermore, according to recent archeological studies carried out on the Siberian skeletal remains from the iron age and based on the single-nucleotide polymorphic loci PCR and the analysis of the regions of difference (RDs) of the MTB complex (MTBC), the presence of M. bovis in those remains was also confirmed (Taylor et al., 2007). Consequently the scientists attributed this persistence and survival to the high amount of lipids, mycolic acid in the mycobacterial cell wall and the high GC content of the DNA (Leao and Portaels, 2007). The term phthisis showed first in the Greek literature; In 460 BC, Hippocrates talked about TB under the term "phthisis," the Greek "decay" and provided the clinical information specific enough to pulmonary TB and described the disease as widespread and almost fatal (Leao and Portaels, 2007). Moreover, he mentioned that phthisis attacks young adults aged between 18- 35 years (Daniel, 2006). Significantly, the accurate pathological and anatomical description of TB began to appear during the 17 th century by Franciscus Sylvius in his Opera Medica , published in 1679, in which was the first description of the progression of the lesions from tubercles to ulcers and cavities. The earliest references to the infectious nature of TB also appeared in 17th century Italian medical literature (Leao and Portaels, 2007).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

In 1720, the English physician Benjamin Marten was the first to speculate, in his publication, A New Theory of Consumption that TB could be caused by "wonderfully minute living creatures," which could engender the lesions and symptoms of the disease (Leao and Portaels, 2007). The discovery of the stethoscope by Doctor Laennec in 1821 developed the first step toward the thoracic auscultation of TB patients (Daniel, 2006). Obviously, owing to the variety of TB symptoms and clinical manifestations, TB was not identified as a unified disease until the 1820s, and was not named tuberculosis until 1839 by Johann Lukas Schönlein (Leao and Portaels, 2007). In 1854, Hermann Brehmer thought that tuberculosis was a curable disease and the introduction of the sanatorium cure provided the first step toward treatment for tuberculosis. In 1865, the French military doctor Jean-Antoine Villemin demonstrated the contagiousness nature of TB by inoculating a small amount of purulent liquid from a tuberculous cavity in rabbits and he postulated that a specific microorganism caused the disease (Daniel, 2006). In 1882, Robert Koch, a German physician, announced that the causal agent of TB had been identified and cultivated; initially, Koch's discovery was rejected by the scientific world, before being accepted worldwide. In 1905 he received the Nobel Prize for Medicine and Physiology for his scientific research (Sakula, 1982). In the late 18 th and 19 th centuries, Europe was booming and had an industrial progress, while the TB endemic was peaked, which can be explained by the increase of the population in developing cities and malnutrition described by that time (Leao and Portaels, 2007) . A further significant advance came in 1895 when Wilhelm Konrad von Rontgen discovered the radiation that now bears his name and actually the radiological examination is mandatory as the first step of diagnosis. As a result of the international efforts for combating against TB, the Central Bureau for the Prevention of Tuberculosis was founded in Berlin in 1902 and Dr. Gilbert Sersiron suggested that the fight against TB was comparable to crusade and it would be appropriate to adopt the emblem of a crusader, then the Duke of Lorraine, bearing the double-barred cross that signified courage and success to crusaders (Leao and Portaels, 2007) became the worldwide symbol of the fight against TB (Figure 2).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Figure 1: Opened thorax of Egyptian mummy Large arrow=pleural adhesions of right lung; small arrow= destruction of boney elements of lumbar vertebral bodies L4 and L5(Nerlich et al. , 1997)

Figure 2: double-barred cross, symbol of anti-tuberculosis crusade (Leao and Portaels, 2007).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Another important development was developed by the French bacteriologist Calmette and Guerin in 1921, who used specific culture media to lower the virulence of the bovine TB bacterium, creating the basis for the BCG (Bacille Calmette Guérin) vaccine, even though relatively ineffective still in widespread use today (Daniel, 2006). I.2. History of Anti tuberculosis Therapy:

Before the introduction of antibiotics, many remedies were used for the treatment of TB, sometimes by offering good diets and herbal extracts.

From 1943, the era of drug therapy was started, which created an important milestone in the history of TB and precisely in 1943 the discovery of paraamino salicylic acid (PAS) by Jorgen Lehmann and of thiosemicarbazone by Gerhard Domagk, yielded the first therapeutic agents with efficacy in the treatment of TB (Daniel, 2006).

In 1944 Albert Schatz, Elizabeth Bugie, and Selman Waksman reported the utilization of streptomycin (SM), the first antibiotic and first bactericidal agent effective against MTB (Daniel, 2006).

In 1952, Domag discovered isoniazid (INH), the first oral mycobactericidal drug, a key compound for the treatment of TB. The PAS + SM combination therapy then evolved into a triple therapy INH + PAS + SM, which provided curative effect on 90 to 90% of patients(Leao and Portaels, 2007).

The problematic of the long duration (24 to 30 months) of treatment was a serious challenge and in 1960, the duration of treatment was reduced to 18 months after the replacement of PAS by ethambutol (EMB). The next step in the evolution of anti-tuberculous therapy was the discovery of rifampicin (RIF) in 1957 (Daniel, 2006) .

In 1980, pyrazinamide (PZA) was introduced into the scheme of treatment and its introduction in the presence of INH and RIF allowed curing more than 95% of patients within 6 months.

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

II. GENERAL BACTERIAL CHARACTERISTICS

II.1. Taxonomy & Classification of Mycobacteria

The causal agent of TB is a bacterium called Mycobacterium tuberculosis (MTB) or Koch Bacillus, which belongs to mycobacteria. Mycobacteria have been classified into the family Mycobacteriaceae within the order Actinomycetales based upon similarities in staining and motility, lack of spore formation and catalase production (Baron, 1996).

However, in almost cases; the MTB is the causal agent of human TB, this illness can be caused by other Mycobacteria in some cases with special conditions (Brooks et al. , 1998), these Mycobacteria belong to the members of MTB complex (MTBC), which are characterized in exception of Mycobacterium canetti, by the RD-9 deleted ancestry (Cole, 2002; Smith and Upton, 2011; Soo et al. , 2006):

• Mycobacterium africanum : That can provoke human tuberculosis, principally in the west of Africa (Demers et al. , 2010). • Mycobacterium bovis : which infects Badgers, cattle, deer, elephants, goats, lions, seals, etc (Cole, 2002) and can spread to humans through inhalation of infectious droplet and by ingestion of raw milk. Furthermore, M. bovis has been associated with extrapulmonary tuberculosis in infants and children, generally occurring due to the consumption of milk, which had not been pasteurized or boiled, from infected cattle (Thoen et al. , 2006), especially in the HIV infected infants (Houde and Dery, 1988). Therefore the zoonotic risk for human represents a serious problem, mostly for those living at the animal-human interface (Michel et al. , 2011). • Mycobacterium bovis, Bacille Calmette–Guérin ( BCG) : this has been largely used as a vaccine against human TB (Bastos et al. , 2009; Dietrich et al. , 2003) and can be obtained by the attenuation of M.bovis and deletion of the RD1 region (Cole, 2002) • Mycobacterium microti : which infect voles, Cats, dogs (Cole, 2002; Rufenacht et al. , 2011) and human as reported recently in immunocompetent patients in France by Panteix et al. (Panteix et al. , 2011). • Mycobacterium canetti : which infects human in limited geographical location, in the horn of Africa (Fabre et al., 2011).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

• Mycobacterium pinnipedii : that infects seals, sea lions and marine mammals (Bigi et al. , 2005; Kiers et al. , 2008). • Mycobacterium caprae : which infects domestic animals such as goats, sheep, ewes, camels, horses, pigs, dogs, cats, wild animal species and human being(Cvetnic et al. , 2006; Mendoza et al. , 2011; Rodríguez et al. , 2011). • Mycobacterium mungi sp. nov: that infects mongoose in Botswana and live in close association with humans (Alexander et al. , 2010). Furthermore, it has been demonstrated that these members are sharing a common ancestor in their evolutionary events (Hewinson et al. , 2006; Zakham et al. , 2011).

It is worth mentioning that there are other mycobacteria called atypical mycobacteria or non tuberculosis mycobacteria (NTM). These mycobacteria are ubiquitous in the environment and in extreme circumstances (immunosuppression, HIV infection, underlying diseases……etc), some of them become pathogenic for humans and can induce opportunistic infections or mycobacterioses(Gupta et al. , 2010). These mycobacteria often are described based on their growth rate and pigmentation with and without exposure to light (Baron, 1996).

The last group of mycobacteria is represented by M leprae , the causal agent of leprosy in humans and characterized by the inability to be cultured in vitro (Kaplan and Cohn, 1986).

II.2. General Characteristics of Mycobacteria

The mycobacteria are rod-shaped, aerobic bacteria that do not form spores. Although they do not stain easily, once it stained they resist decolorization by acid or alcohol and are therefore called “acid fast “bacilli (Brooks et al. , 1998). Furthermore, Mycobacteria are characterized by the presence of long-chain fatty acids, called mycolic acids in their cell walls (Baron, 1996). Consequently, this unusual and complex cell wall of pathogenic mycobacteria plays a major role in pathogenesis, with specific complex lipids acting as defensive, offensive, or adaptive effectors of virulence(Hotter et al. , 2005).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

II.3. Morphology

In tissue, tubercle bacilli are thin straight, curved rods measuring about 0.4×3 m and coccoid and filamentous forms are seen on artificial media, with variable morphology from one species to another. Mycobacteria can not be classified as either gram positive or gram negative. Once stained by basic dyes they can not be decolorized by alcohol, regardless of treatment with iodine. True tubercle bacilli are characterized by “acid fastness”, 95% ethyl alcohol containing 3% hydrochloric acid (acid –alcohol) quickly decolorizes all bacteria except mycobacteria (Brooks et al. , 1998).

II.4. Mycobacterial cell envelop Essentially, there are four major layers in the cell envelope of mycobacteria. The first layer contains the cytoplasmic, or plasma membrane (PM, Figure 3). The second layer is called the electron dense (ED) layer because of its staining properties when observed by transmission electron microscopy. In this area is found the peptidoglycan/ arabinogalactan moieties that make up the basic structural component of the cell wall. Adjacent to this is a layer that appears to be electron transparent (ET layer) upon observation by transmission electron microscopy. One of the primary components in the ET layer is mycolic acid. In the outer layers of the cell envelope a variety of components can be found, depending upon which mycobacterial species is being considered. These areas are sometimes referred to as the L1 and L2 layers. The outer layers are the most important with regard to initial host interaction (Barrow, 1997). Other important wall components are trehalose dimycolate (so-called cord factor, as it is thought to induce growth in serpentine cords on artificial medium) and mycobacterial sulfolipids, which may play a role in virulence. Another constituent which may contribute to pathogenesis is lipoarabinomannan (LAM).

II.5. Metabolism of mycobacteria

Mycobacteria, like most actinomycetes, can grow in vitro on an extremely wide range of carbohydrates. These oxidized carbon sources include alkanes, alcohols, ketones, and many mono-, di-, and tri-carboxylic acids.With the exception of several glycolytic enzymes, the hexose monophosphate shunt, the Entner–Doudoroff pathway, and phosphoglucose isomerase, carbon metabolism in mycobacteria has not been well characterized. Glycerol is

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

considered to be the preferred carbon source when mycobacteria are grown in vitro, although its utilization is blocked until all other carbon sources, including amino acids, have been consumed (Av-Gay and Sobouti, 2000; Masood et al. , 1985).

II.6. Genomics of Mycobacteria

The first sequenced mycobacterial genome was that of M. tuberculosis H37Rv (Cole et al. , 1998) and significantly, the genome comprises 4,411,529 base pairs, contains around 4,000 genes, and has a very high GC content that is reflected in the biased amino-acid content of the proteins. Two years latter this genome was re-annotated by Camus et al . (Camus et al. , 2002).

Annotation of the M. tuberculosis genome shows that this bacterium has some unique features and interestingly, a large part of its coding sequences is devoted to the production of enzymes involved in the metabolism of fatty acids. Over 200 genes are annotated as encoding enzymes for the metabolism of fatty acids, comprising 6% of the total. Among these are approximately 100 that are predicted to function in the oxidation of fatty acids and this could be related to the ability of this pathogen to grow in the tissues of the infected host, where fatty acids may be the major carbon source ( Figure 4).

This genome is characterized also by the presence of two new families of glycine-rich proteins (PE and PPE families) with a repetitive structure that may represent a source of antigenic variation (Cole et al. , 1998).

Recently, different databases were established and provided the complete genome annotation of the reference strain and other tuberculosis strains, such: TubercuList and TB database (TBDB) (Galagan et al. , 2010; Lew et al. , 2011).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Figure 3: Model of mycobacterial cell envelope (Barrow, 1997).

PM: The plasma membrane, ED: the electron dense, ET: electron transparent, L1 and L2: fibrillar layers, PM: membrane proteins, PG: peptidoglycan, AG: arabinogalactan, LAM: lipoarabinomannan, GPL: glycopeptidolipid, aGPL: apolar glycopeptidolipid.

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Figure 4: Circular map of the chromosome of M. tuberculosis H37Rv (Cole et al. , 1998).

The outer circle shows the scale in Mb, with 0 representing the origin of replication. The first ring from the exterior denotes the positions of stable RNA genes (tRNAs are blue, others are pink) and the direct repeat region (pink cube); the second ring inwards shows the coding sequence by strand (clockwise, dark green; anticlockwise, light green); the third ring depicts repetitive DNA (insertion sequences, orange; 13E12 REP family, dark pink; prophage, blue); the fourth ring shows the positions of the PPE family members (green); the fifth ring shows the PE family members (purple, excluding PGRS); and the sixth ring shows the positions of the PGRSsequences (dark red). The histogram (centre) represents G + C content, with <65% G + C in yellow, and >65% G + C in red.

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

II.7. Molecular evolution of MTBC

The MTBC is one of the most successful pathogens and the sufficient evidence of the common ancestor, evolution, demographical spread of these microorganisms was surrounded by a mystery (Wirth et al. , 2008). A decade ago the scientists thought that the members of MTBc were evolved from M.bovis (Donoghue et al. , 2004), but this hypothesis has been rejected.

Recently, the ambiguity regarding this question mark was uncovered and a new scenario was demonstrated by studying 20 variable deleted regions within the members of the MTBC (Brosch et al. , 2002) and based on the presence or absence of an M. tuberculosis specific deletion (TbD1), M. tuberculosi s strains can be divided into ancestral and ‘‘modern’’ strains, the latter comprising representatives of major epidemics like the Beijing, Haarlem, and African M. tuberculosis clusters (Brosch et al. , 2002). Moreover, consecutive loss of DNA, reflected by region of difference RD9 and other subsequent deletions, was identified for an evolutionary lineage represented by M. africanum , M. microti , and M. bovis that diverged from the ancestor of the present MTB strains before TbD1 occurred (Figure 5). Significantly, M.canettii or the smooth MTB stated to be the common ancestor, which did not lack those regions, unlike M. bovis that lost several genes that are present in MTB and other smooth MTB (Brosch et al. , 2002; Ernst et al. , 2007). Therefore, M.canettii seems to be direct descendant of tubercle bacilli that existed before the M. africanum , M. bovis lineage separated from the MTB lineage and more recently the microarray results demonstrated that those deletions occurred for the ancestral genes whose function are not necessary for surviving (Kato- Maeda et al. , 2001) and the minimal set of essential genes are still conserved. Furthermore, it has become clear that the members of MTBC were originated from a single ancestor resulted from an evolutionary bottleneck and a clonal expansion (Brosch et al. , 2002; Ernst et al. , 2007; Gutierrez et al. , 2005) occurred 20,000 to 35,000 years ago. In addition the progenitor of MTBC offspring was restricted in a limited geographical region (East Africa) and called “ M. prototuberculosis ”(Gutierrez et al. , 2005).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Notably, most of the pathogenic or slow growing mycobacteria are sharing a high similarity and a strong phylogeny relationship (Figure 6) (Devulder et al. , 2005; van Ingen et al. , 2011) and interestingly, several studies confirmed that the pathogenic mycobacteria were originated from a free living progeny (Rastogi and Sola, 2007) and due to the genome reduction and the acquisition of new genes by horizontal gene transfer (HGT) (Jang et al. , 2008; Rosas-Magallanes et al. , 2006; Veyrier et al. , 2009) and gene rearrangement, their capacity of parasitism and infectiousness was developed for enabling them to cause severe and dangerous illnesses.

Remarkably, the pathogenic slow growing mycobacteria had undergone to genome reduction (Wassenaar et al. , 2009) and consequently they have a single rRNA operon and a low number of tRNA, comparing with the RGM and this is due to their long division time (Ussery et al. , 2009). In this context, the loss of genes played an important role in the evolution of slow growing mycobacterial pathogens (Brosch et al., 2001) and some of those genomes were suffered of an extensive genome downsizing like the complex of MLP (Cole et al. , 2001).

On otherwise the members of the complex MTB were subjected to moderate genome reduction and concomitantly acquired new genes towards the speciation to the parasitic life style in mammalian macrophages.

In 1997, Sreevatsan used two non-synonymous SNP but functionally neutral to establish three major genetic groups called PGG1, PGG2 and PGG3 (PGG "Principal Genetic Group"). The two SNPs used are: the codon 463 (Leu463 Arg) of the katG gene encoding catalase-peroxidase KatG and codon 95 (Thr95Ser) gene gyrA encoding GyrA, the A subunit of gyrase (Figure 7)(Sreevatsan et al. , 1997). These two SNPs are not involved in antibiotic resistance. All isolates of MTB can be classified in these three genetic groups. According to studies, it appears that PGG1 MTB groups are ancestral to those of PGG 2 and those of PGG 2 have the same ancestors of PGG3 (Gutacker et al. , 2002). It is also worth mentioning that the PGG1 MTB strains are related to M. bovis , the causative agent of bovine tuberculosis, M. microti and M. africanum .

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Figure 5: Scheme of the proposed evolutionary pathway of the tubercle bacilli illustrating successive loss of DNA in certain lineages (gray boxes). The scheme is based on the presence or absence of conserved deleted regions and on sequence polymorphisms in five selected genes (Brosch et al. , 2002). Blue arrows indicate that strains are characterized by katG 463. CTG (Leu), gyrA 95 ACC (Thr), typical for group 1 organisms. Green arrows indicate that strains belong to group 2 characterized by katG 463 CGG (Arg), gyrA 95 ACC (Thr).The red arrow indicates that strains belong to group 3, characterized by katG 463 CGG (Arg), gyrA 95 AGC (Ser).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Figure 6: Phylogenetic Position of the Tubercle Bacilli within the Genus Mycobacterium (Gutierrez et al. , 2005)

Figure 7: Principal genetic groups of the complex MTB (Sreevatsan et al. , 1997)

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

III. EPIDEMIOLOGY OF TUBERCULOSIS:

III.1.Tuberculosis in the world

In spite of the availability of effective treatment for decades, TB remains a major global health problem. The afforded worldwide efforts in the recent years regarding the detection, surveillance and prevention of TB, allowed apprehending the morbidity and mortality levels due this threatening illness. According to the last reports of The World Health Organization (WHO), it is estimated that one-third of the global population is infected with tuberculosis and that approximately 8.8 million incident cases of TB (range, 8.5 million–9.2 million) are globally reported in 2010, 1.1 million deaths (range, 0.9 million–1.2 million) among HIV- negative cases and an additional 0.35 million deaths (range, 0.32 million–0.39 million) among people who were HIV-positive (Figure 8) (WHO, 2011). TB is particularly common in groups such as elderly, chronically malnourished, alcoholics, and the poor. TB is also more common among men than women, and affects mostly adults in the economically productive age groups; around two-thirds of cases are estimated to occur among people aged 15–59 years (WHO, 2011). The prevalence of clinical TB among the homeless in the United States may be up to 300 times higher than the national average rate. Of particular concern is the very high incidence of TB among recent immigrants. Perhaps the most significant factor influencing the incidence of mycobacterial disease in the United States since 1984 has been the HIV epidemic (Brooks et al. , 1998). TB epidemiology has been clarified significantly by the development of molecular biological techniques which allow the relatively unambiguous identification of a particular clinical isolate. The RFLP database has provided new knowledge of TB epidemiology in the world (Bauer et al. , 1998). Recently, active transmission of a single strain of MTB resulted in clinical isolates from several patients who exhibited identical DNA patterns or "fingerprints".

Since 1991, the Directly-Observed Treatment, Short-course (DOTS) was implanted, 55 million TB patients were treated in programs that had adopted the DOTS/Stop TB Strategy between 1995 and 2010 and 46 million were successfully treated(WHO, 2011).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

III.2. Tuberculosis in the Africa

The situation of TB in Africa is the worst in the world and it counted 24% of high-TB burden countries. In 1990, two African countries, Mali and Togo, had an incidence greater than 300 per 100,000; by 2005, 25 countries had reached that level, and 8 of them had an incidence at least twice that high (Figure 9) (Chaisson and Martinson, 2008). Moreover, the co-infection with HIV was one of the factors which has exacerbated and complicated the situation with 59% of HIV/ TB cases (WHO, 2011). Another critical factor concerns the early diagnosis and treatment of TB. In Africa, diagnosis of TB is based on the microscopical detection of acid-fast bacilli in sputum, an insensitive technique that is particularly ill suited to the detection of TB in HIV-infected patients, who have fewer bacilli in their sputum and have more extrapulmonary TB than HIV negative patients.

III.3. Tuberculosis in Morocco

Despite of the strength of its economy comparing with other African countries, Morocco has a high incidence of TB: 83 cases of all forms of TB per 100,000 inhabitants. The national TB program is performing very well in Morocco. DOTS population coverage has long been 100% and the latest treatment success rate and DOTS case detection rate are 85% and 97%, respectively (PNLAT, 2011; WHO, 2011). In Morocco, TB affects especially young adults and therefore has a high impact on the socio- economic status of the country (65.9% of total TB cases have between 15 and 45 years, with a significant male predilection 59.3%). Morocco has actually achieved the global targets for TB control before the target year of 2005. Consequently, the incidence of TB in Morocco is declining steadily at the rate of 3% per year. Therefore, the fight against TB has been considered a priority by the Ministry of Health in Morocco and the national program of TB (PNLAT) control was established in 1991. The PNLAT has successfully implemented and integrated the DOTS program in the health care institutions. Indeed, the objectives of WHO program are the detection rate of 70% and treatment success rates of at least 85% and this has been achieved in 1995. In the recent years, around 26 000 new TB cases were detected each year, including, 12 000 patients have smear-positive pulmonary tuberculosis (PTB +) and an annual incidence of 37 new cases per 100 000 inhabitants(PNLAT, 2011). 19

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Figure 8: Estimated incidence of tuberculosis in the world in 2011(WHO, 2011).

Figure 9: Estimated Incidence of Tuberculosis per 100,000 Population in African Countries in 1990 and 2005 (Chaisson and Martinson, 2008) .

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

IV. IMMUNOLOGY OF TB, PATHOGENSIS & VIRULENCE:

IV. 1. Pathogenesis

Tuberculosis is easily transmitted by inhalation of droplet nuclei containing a few viable, virulent organisms produced by a sputum-positive individual (Figure 9). The various cell components of tubercle bacilli have different biological activities influencing pathogenesis, allergy and immunity in disease (Gupte, 1999).

The accumulating mycobacteria stimulate an inflammatory lesion which is characterized by a mononuclear cell infiltrate surrounding a core of degenerating epithelioid and multinucleated giant cells. This lesion (called a tubercle), and its centre often progresses to caseous necrosis. In the resistant host, the tubercle eventually becomes calcified. The production of lesions and their progression are determined by:

1) The number of tubercle bacilli in the inoculum and their subsequent multiplication. 2) The resistance and hypersensitivity of the host (Brooks et al. , 1998). In the most people the primary lesion is self healing although not all the bacilli may be eliminated(Cheesbrough, 2000).

IV. 2. Host Defenses

Phagocytosis of MTB by alveolar macrophages is the first event in the host-pathogen relationship that decides outcome of infection. Within 2 to 6 weeks of infection, cell-mediated immunity (CMI) develops, and there is an influx of lymphocytes and activated macrophages into the lesion resulting in granuloma formation. Successful acquired resistance is mediated by T lymphocytes (Raja, 2004).

Antimycobacterial antibodies, although present in many patients, do not play a protective role in TB. (Figure 11) depicts two of the principal mechanisms by which T lymphocytes activated by specific mycobacterial antigens can limit the replication of tubercle bacilli. Cells of the helper/inducer phenotype (CD4 +) up-regulate populations of antigen-specific effectors T cells (CD4 +) and cytotoxic T cells (CD8 +). CD4 cells produce factors (e.g., gamma interferon) that activate macrophages and endow them with enhanced mycobacteriostatic or mycobactericidal capabilities. Unlike normal macrophages, these activated cells can limit the replication of

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

intracellular M tuberculosis and may kill tubercle bacilli. CD8 cells attack infected macrophages expressing mycobacterial antigens and lyse the cells, releasing the mycobacteria from their protective niche and exposing them to activated macropha ges (Baron, 1996; Janeway et al. , 2001) . The mechanisms of intracellular survival are not clear and may vary from species to species. There is some evidence that M tuberculosis can prevent phagosome - lysosome fusion. Other studies have demonstrated that virulent mycobacteria can prevent acidification of the phagolysosome, perhaps by modulating the activity of a membrane proton pump. In addition, some of the components of the mycobacterial cell wall may be directly cytotoxic to macrophages.

Although haemolysins and lipases are produced by M.tuberculosis , their role in escape of tubercle bacilli from the phagosome, and the importance of extravacuolar organisms in pathogenesis are unknown (Baron, 1996) .

IV. 3. Clinical Manifestations

The first sign of a new infection i s often conversion of the intradermal skin test with purified protein derivative (PPD) to positive or detection of a lesion by chance on a chest x -ray in an otherwise asymptomatic individual. Clinical signs and symptoms develop in only a small proportion (5 10 percent) of infected healthy people (Baron, 1996). These patients usually present with pulmonary disease; prominent symptoms are chronic, productive cough, low - grade fever, night sweats, easy fatigability, and weight loss. Pulmonary TB was defined as a disease confined to the lungs, pleura, and mediastinal lymph nodes. Disease outside these sites was considered extrapulmonary. Disseminated TB was defined as the involvement of 2 or more non contiguous extrapulmonary organs (Rebollo et al. , 2006). Extrapulmonary TB of bone, genito-urinary system, meninges, peritoneum, or skin occurs in about 15 per cent of TB patients (Raja, 2004) . Therefore, there are many forms of tuberculosis:

IV.3 .1. Pulmonary tuberculosis

This can occur when the primary infection does not heal completely and there is continuous multiplication or reactivation of microorganisms in the lung due to poor health (malnutrition, defective immune responses ….etc). An inflammatory reaction leads to a liquefied destruction of lungs tissue with caseation (break down of infected tissue in to a cheese -like mass).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Liquefaction of the caseous material and erosion of the tubercle into an adjacent airway may result in cavitation and the release of massive numbers of bacilli into the sputum (Baron, 1996; Cheesbrough, 2000).

The main symptoms of pulmonary tuberculosis in adults are a chronic cough with producing of mucopurulent sputum which may contain blood. In the later stages of the disease, there is loss of weight, fever, night sweats, fatigue, chest pain and anaemia. In children, pulmonary tuberculosis is more difficult to diagnose because the rarely production of sputum during coughing .A diagnosis may be realized by the X-ray.

IV.3.2. Tuberculous meningitis

Tubercle bacilli reach the meninges in the blood .it occurs in non-vaccinated infants and young children. The condition is often fatal unless treated at an early stage.

IV.3.3. Miliary tuberculosis

It can occur if a site of primary infection ruptures through the blood vessel and bacilli are disseminated throughout the body. Many small granulomata are formed which on a chest X- ray, look like millet seeds (hence name miliary tuberculosis).

IV.3.4. Renal and urogenital tuberculosis

Tubercle bacilli reach to kidneys and genital tract by the way of blood circulation. Usually some years following the primary infection. Renal infection is suspected when the repeated urine specimens contain pus cells but no organisms are isolated by routine culture. Tuberculosis of genital tract (epididmitis in males and endometrial tuberculosis in females) can cause infertility and pelvic inflammatory disease.

IV.3.5. Bone and joints tuberculosis

A commonly infected site is spine which may lead to the collapse of vertebrae and the formation of a “cold “abscess in the groin. This form of the disease is rare(Cheesbrough, 2000).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Figure 10: Pathogenesis of tuberculosis (Baron, 1996).

Figure 11: Mechanism of host defense against intracellular infection by mycobacteria (Janeway, 2001).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

V. TUBERCULOSIS & HIV COINFECTION:

One of the most important problems facing the TB management is the HIV epidemic. In fact the risk of developing TB infection is much higher among people infected with HIV. Precariously, the reemergence of the illness in the late ’80s increased by the (HIV/AIDS) pandemic and TB now is a leading cause of death among people with HIV/AIDS in low income countries (Brooks et al. , 1998). Moreover, the co infection with HIV and TB poses a high risk of mortality in Africa, where the prevalence of HIV is exceedingly high and the DOT strategy has failed to prevent rising TB incidence rates in those area (Corbett et al. , 2007).

Further, the HIV pandemic prompted the emergence of MDR/ XDR TB cases and worsened the situation for the health care providers and Significantly, the HIV pandemic presents a great challenge for global TB control and the prevention of HIV and TB, the extension of WHO DOTS programs, and an alert effort to control HIV-related TB in areas of high HIV prevalence are matters of vast urgency. The Stop TB Partnership, WHO and UNAIDS have set a target of decreasing the number of TB deaths among HIV-positive people by 2015 compared with 2004 (the year in which TB mortality among HIV-positive people is estimated to have peaked). Early and rapid diagnosis and treatment of TB as well as antiretroviral therapy (ART) and co- trimoxazole preventive therapy (CPT) can cut mortality rates among TB patients living with HIV(WHO, 2011).

VI. SCREENING & DIAGNOSIS OF MTB:

VI.1. Diagnosis of the latent tuberculosis (Immunological assays):

In 2005, the CDC guidelines for controlling the tuberculosis and the reduction of the mortality and morbidity cases due to this horrible illness, one of the most important strategies for the achievement of this gaol is the identification of the persons with latent TB infection (LTBI), especially those who are at high risk for potentially active TB disease (ATS, 2005).

The diagnosis of LTBI has habitually been based upon results of tuberculin skin testing or Mantoux test (Mark and Perkins, 2000). This test involves an intradermal injection of the

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Purified Protein Derivative (PPD) or the tuberculin (Arias Guillen et al. , 2011; Baron, 1996). The response typically appears a day or two after the injection and consists of a raised, red, and indurated area in the skin, which then disappears as the antigen degraded (Baron, 1996; Brooks et al. , 1998). This indicates the presence of antibodies or lymphocytes that are specific for that antigen (cellular immunity).

Moreover, the immunological tests (the QuantiFERON-TB Gold® and TSPOT®- TB tests), or the whole blood interferon gamma release assays (IGRAs), are now other options for detecting LTBI and are potential tools for diagnosing LTBI (Lalvani and Pareek, 2010; Morris, 2003). These tests are based on the principle that T cells from most persons that have been infected with MTB will release IFN-γ when re-exposed to the same mycobacterial antigens ( in vitro ). In fact these immunological tests on peripheral blood alone can not differentiate between active and latent TB (Lange and Mori, 2010).

VI.2.Diagnosis of active TB

It is important to know that tuberculosis can be diagnosed accurately by identifying the causative organism, MTB in the clinical sample and the suspicion of TB disease in a patient requires the completion more thorough medical examinations (Davies and Pai, 2008):

VI.2.1. Radiological Examination: The radiological diagnosis can highlight the pulmonary form of TB and the chest X ray is the most traditional technique for the screening of TB (Lange and Mori, 2010). Although the presence of abnormality findings in the conventional radiography is not decisive for the TB infection (González-Martín et al. , 2010; Jeong and Lee, 2008) , the cavitation is still the most remarkable sign of the active TB or the post primary infection and can indicate the severity of disease (McAdams et al. , 1995).

VI.2.2. Bacteriological examination: Generally, the investigation of the tubercle bacilli can be done on pulmonary samples after their decontamination, though it can also be performed on the other extrapulmonary specimens or other body fluids (Urine, cerebrospinal fluid, semen, gastric liquid……..etc) and the diagnosis of MTB can be achieved by:

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

VI.2.2.A. Microscopic examination: The smear microscopy is the first step and the key of bacteriological diagnosis of TB. However the smear microscopy can not distinguish between viable and dead microorganism and does not differentiate between the species of mycobacteria (Hobby et al. , 1973). Moreover, it can only detect acid -fast bacilli in concent rations of 10,000 organisms per ml or more(Yeager et al. , 1967) , but from an economical view the conventional microscopy is still the most useful tool or the sole tool in the low income countries (Steingart et al. , 2006) , where the diagnosis of smear negative tuberculosis poses a serious problem for the health care providers, especially in the HIV c o infected patients (Borgdorff et al. , 2002; Cheesbrough, 2000; Siddiqi et al. , 2003) . In fact there are differ ent staining methods, but the widely used technique is the Ziehl-Neelsen method (Cheesbrough, 2000) , which lack sensitivity and require the good expert technicians for the investigation about the bacillus in different fields on the smear (Mark and Perkins, 2000) . The problem of sensitivity can be improved by the concentration by centrifugation of the specimens after adding the disinfectant NaOCl as demonstrated by Gebre et al ., in different developing countries (Gebre et al. , 1995). Nevertheless the sensitivity of the microscopical exam ination has been developed in the industrial countries by the utility of the Fluorescence microscopy (Steingar t et al. , 2006) , which provides more accurate results.

Ziehl-Neelsen staining technique The Ziehl Neelsen technique is used to stain M.tuberculosis , unlike other bacteria, do not stain well by the Gram technique. They can be stained by carbol fuchsin .the stain binds to mycolic acid in the mycobacterial cell wall. After staining an acid decolorizing solution is applied .Following decolourization, the smear is counterstained with malachite green or methylene blue which stains t he background material (Fi gure 12) (Cheesbrough, 2000) . In smears stained with carbol fuchsin, mycobacteria typically appear as red rods (1 10 µm long and 0.2 0.6 µm wide) and often are beaded or banded, but also may appear coccoid or filamentous (Figure 12).

Auramine phenol technique The auramine phenol fluorochrome staining technique can be used to detect M. tuberculosis In sputum, cerebrospinal fluid, and other s pecimens when facilities for fluorescence

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

microscopy are available compared with Ziehl-Neelsen technique, the auramine-phenol fluorochrome technique enables a more rapid examination of smears because the 40X objective can be used. When tubercle bacilli are few they are more likely to be successfully detected in auramine-phenol stained smears (Cheesbrough, 2000).

VI.2.2.B. Culture The culture is the gold standard for the diagnosis and detection of TB (Phelan et al. , 2011). Most laboratories use solid medium for the isolation of MTB. After homogenizing and decontaminating the specimen, inoculation the media by means of a pipette delivering around 0.2ml as recommended by WHO (WWW.WHO.INT/EMC. , 1996.). Two media are used for MTB growth, Middle brook's medium which is an agar based medium and Lowenstein-Jensen medium which is an egg based medium (Figure 13). Both types of media contain inhibitors to keep contaminants from out-growing MTB and the culture should be examined during 4-6 weeks to get visual colonies on either type of media. It is noteworthy to mention that there are also new liquid techniques that have been developed to shorten the time of culturing, comparing with traditional techniques of culturing on solid medium, such as: BACTEC 460 TB, BacT/ALERT 3D and BACTEC MGIT 960, ESP II culture system (Anargyros et al. , 1990; Nazish, 2009; Piersimoni et al. , 2001; Tortoli et al. , 1999). Although of the rapidity of liquid media in culturing mycobacteria, the solid medium still has the advantage of enabling the differentiation of mycobacterial growth and contamination, even more the colonial morphology, production of pigments, rates of growth and the optimal temperature of growth can help in the identification and the discrimination between rapid and slow growing mycobacteria (Lambi, 1992).

VI.2.2.C. Phenotypic and biochemical identification: Even though their consumption of time and cumbersomeness, the biochemical identification is still useful in the developing countries for the differentiation among MTB complex and other mycobacteria, particularly the niacin test (Gadre et al. , 1995) and due to the large number of tests in this topic, we can not mention them in detail and briefly passing through the most important utilized phenotypic and biochemical tests, we can point out: Catalase, Niacin test, Nitrate reduction, Aryl sulphatase, Tween80 analysis, Urease Activity, Pyrazinamide (PZA), Iron Uptake, Growth inhibition by Thiophene 2 carboxylic acid

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Hydrazide (TCH) , Growth on 5% sodium chloride, ß glucosidase, tellurite reduction (Gupte, 1999; Leao et al. , 2005). Levy-Frebault et al., had evaluated 8 rapid biochemical and enzymatic tests for the identification of 18 species of mycobacteria (niacin, catalase, nitrate reductase, ß glucosidase, urease, penicillinase, trehalase and cephalosporinase) and they found that those tests were able in some cases to discriminate between closely related species (Lévy- Frébault et al. , 1982).

VI.2.2.D. Drug susceptibility testing DST: After the detection and the identification of MTB, the DST is the main analysis to be performed for better management of TB, using different anti tuberculosis agents. The most used method of DST is the proportional method, adjusted from the method described by Canetti (Canetti et al. , 1969). This technique consists of observing the mycobacterial growth on the Löwenstein-Jensen medium containing different concentrations of tested antibiotics, this method is currently the method of choice for estimating drug resistance but it takes approximately four weeks for the final assessment. This period can be halved by the implementation of the DST on the BACTEC liquid media (Hanna et al. , 1999; Huang et al. , 2004; Tortoli et al. , 2002). There are also different commercially colorimetric methods for performing the DST; the Reszurin test is one of the low cost, rapid and accurate tests for the detection of drug resistance of MTB strains (Lemus et al. , 2004).

VI.2.3. Molecular Examination: Nowadays, there are many molecular techniques are commercially available which have decreased the time for the diagnosis, detection, identification of MTB and drug susceptibility pattern (Kessler, 2003). However, they have an excellent sensitivity and specificity when used from a culture, these techniques have currently insufficient sensitivity when applied directly to respiratory and other samples (Kim et al. , 2009), these tests are numerous and we can list the most important tests:

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Figure 12: Infected macrophages were acid-fast examined by light microscopy (Barrow, 1997)

Figure 13: Colonies of Mycobacterium tuberculosis on Lowenstein-Jensen medium.

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

VI.2.3.A. DNA Amplification by PCR, including Real Time PCR: The utilisation of PCR for the detection of MTB in clinical samples has been reported and commercially available amplification and detection kits as well as manual in-house methods are also applied in routine diagnostic laboratories (De Wit et al. , 1990; Gillellamudi, 2010; Jonas et al. , 1993; Lima et al. , 2008; Nagesh et al. , 2001; Rafi and Naghily, 1998; Rebollo et al. , 2006; Restrepo et al. , 2006; Saltini, 1998; Yam et al. , 2004) and its reliability has been questioned (Noordhoek et al. , 1993). Moreover, the paucibacilary nature of specimens (sputum, biopsies, pus and body fluids) was a challenge for the detection of this microorganism. The insertion sequence IS 6110 (Ben Kahla et al. , 2011; Eisenach et al. , 1988; Eisenstein, 1990; Takahashi et al. , 2007) 16S rRNA (Clarridge et al. , 1993; Kox et al. , 1995; Nakano et al. , 2010) and hsp 65(Kim et al. , 2010) are the most common targets used for the MTB diagnosis in the clinical specimens. Additionally there are different types of PCR- based assays have been developed and modified for this purpose, the Real-time PCR is one of the promising tools with high sensitivity for the rapid identification of different mycobacterial species, with the advantage of possible identification and detection of a given target sequence directly from clinical specimens(Tobler et al. , 2006).

The Multiplex PCR is also a potential tool for distinguishing between the pathogenic species of mycobacteria and it is supposed to be simple, rapid, cost effective and superior to the traditional methods (Gupta et al. , 2010). Recently, Warren et al., have developed a new multiplex PCR for the differentiation the members of MTBC by the amplification of genomic regions of difference (RD1, RD1 mic , RD2 seal , RD4, RD9, RD12) (Warren et al. , 2006). The PCR-restriction endonuclease analysis (PRA) had been used and evaluated for the differentiating between 39 pathogenic rapid growing mycobacteria (RGM) by Wang et al., and they found good results (Wang et al. , 2005), in addition of the fast identification comparing with conventional method and it could be used into the clinical laboratory setting, particularly for patients who are suffering of infection due to pathogenic RGM and according to Varma-Basil et al., the PCR-RFLP was recently used for the direct identification of MTB in the clinical specimens and could offer a considerable benefit for clinician for their chemotherapy choice (Varma-Basil et al. , 2010).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

VI.2.3.B. Nucleic acid Probe: The DNA probe is one of the efficient methods for the identification of MTB members from pure culture (Neonakis et al. , 2008) and the most used DNA probes in the routine laboratories are the AccuProbe for the rapid identification of MTB.

Badak et al., demonstrated that the AccuProbe allows the accurate and rapid identification of MTB when applied directly on the positive MB/BacT broth(Badak et al. , 1999). Furthermore it can also be used for the identification of other non tuberculosis mycobacteria (Tortoli et al. , 1996)

VI.2.3.C. In situ Hybridization The fluorescence hybridization in situ by using Peptide Nucleic Acid Probes has been recently demonstrated a good results for the identification of the members of the MTBC and the differentiation tuberculosis and non tuberculosis mycobacteria, especially in the liquid culture (Drobniewski et al. , 2000; Hongmanee et al. , 2001; Padilla et al. , 2002).

VI.2.3.D. Automated Sequencing: Genetic sequencing techniques have progressively become useful tools for mycobacterial differentiation (Li et al. , 2003) and sequencing of a fragment of conserved genes such as 16S rRNA (Han et al. , 2002; Rogall et al. , 1990; Yam et al. , 2006) or hsp65 (da Silva Rocha et al. , 1999; Ringuet et al. , 1999; Swanson et al. , 1996) are the most sensitive methods for identification of a large number of mycobacterial species. Recently a single step sequencing technique has been applied for the identification of the eight closely related members of the complex MTB, called the Exact Tandem Repeat D or the ETR-D sequencing (Djelouadji et al. , 2008). Importantly, sequencing is also used for DST to characterize the genetic mutations associated with resistance to antituberculosis drugs.

VI.2.3.E. Strain typing and DNA fingerprinting: Tuberculosis epidemiology has been significantly clarified by the development of molecular biological techniques which allow the relatively unambiguous identification of a particular clinical isolate (Baron, 1996). The restriction fragment length polymorphism (RFLP) using the insertion sequence IS6110 has become the standard international method for fingerprinting isolates of M. tuberculosis (Baron, 1996; van Soolingen et al. , 1991). The

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

IS6110 is a transposable element present in the members of MTB complex in multiple copies (up to 25 copies) (Thierry et al. , 1990; Thorne et al. , 2011) except M. bovis BCG which harbours a single copy (Noordhoek et al. , 1993) and absent in other mycobacteria. Furthermore, due to its high numerical and positional polymorphism, has become a widely used marker in the epidemiological studies (Mazurek et al. , 1991; McEvoy et al. , 2007; Otal et al. , 1991), identification and phylogenetic analysis (Thorne et al. , 2011; van Embden et al. , 1993). In the last decade many methods for typing of clinical strains of MTB were developed, the most commonly used methods; the spoligotyping and MIRU-VNTR.

The spoligotyping relies on the analysis of a unique chromosomal region of the genome with high polymorphism, called DR or direct repeat and contains of 36 bp that are separated by non repetitive DNA spacers (Kamerbeek et al. , 1997), the order of spacers is identical in all mycobacterial strains, but their presence or absence varies from one isolate to another (Figure 14). MIRUs (Mycobacterial Interspersed Repetitive Units) are loci in the MTB genome that contain variable numbers of tandem repeats (VNTRs) (Frothingham and Meeker-O'Connell, 1998). MIRU-VNTR typing based on PCR amplification targeted areas and determining the number of repetitions of the unit. The end result is a numeric code corresponding to the 12- digit number of repeats observed each chromosomal locus (Neonakis et al. , 2008) (Figure 15). Recently a standardized method based on analysis of 15 MIRU loci instead of 12, with a discriminatory power has been proposed as a new standard for epidemiological studies and 24 loci was anticipated as a method of high-resolution for phylogenetic studies (Supply et al. , 2006).

VI.2.3.F. Microarray analysis: The microarray analysis or the DNA chips are a collection of labeled DNA probes fixed on a solid surface, after the hybridization with the DNA in question, the intensity can be computed and fluorescent image can be visualised (Neonakis et al. , 2008). The microarray of the mycobacterial genom provided a new insight of understanding and measuring the genes expression on multiple regions on the genome, which can be exploited for improving drugs, vaccines, and diagnostics tools for controlling mycobacterial diseases (Butcher, 2004; Kendall et al. , 2004).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

Figure 14: Steps of Spoligotyping method

Figure 15: Chromosome of MTB (X) strain, genotyping of M. bovis BCG, H37Rv MTB strain on the basis of repeated units MIRUs .

On the top: a chromosome of MTB strain, The three lower panels show the results of genotyping based on MIRUs. The MIRUS contain repeated units; the analysis of MIRUS involves a PCR amplification followed by electrophoresis to look for the number and size of the elements repeated in 12 independent loci, each with one repeated sequence. The sizes of molecular weight marker (M) and PCR products (A, B, CD) BCG, H37Rv and X strains are given. The specific sizes of the different MIRUS in each strain are the result of a distinct fingerprint of the strain. 34

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

VII. TREATMENT OF TB & VACCINATION:

The primary treatment of tuberculosis is specific chemotherapy. The two major drugs used to treat tuberculosis are isoniazid, rifampcin; the other first line drugs are pyrazinamide, and ethambutol. Second line of drugs are more toxic or less effective (or both), and they should be used in therapy only under extenuating circumstances (eg, treatment failure, multiple drug resistance).

Second line drugs include kanamycin, capreomycin, ethionamide, cycloserine, ofloxacin, and ciprofloxacin (Brooks et al. , 1998). Some progress has been made in the research laboratory in elucidating the mechanisms of drug resistance in mycobacteria. Multiple-drug resistance in mycobacteria is apparently the result of the step-wise accumulation of resistance to individual drugs. For example, mutations in the katG and inhA genes are associated with isoniazid resistance, while the rpoB gene responsible for RNA polymerase is altered in many clinical isolates resistant to rifampcin. The threat of drug-resistant tuberculosis has made susceptibility testing mandatory for all initial isolates. Unfortunately, more rapid techniques are needed to provide this information in a timely manner to physicians (Baron, 1996).

An attenuated strain of M. bovis Bacille Calmette–Guérin (BCG) is one of the most widely used vaccines. Modern techniques in genome manipulation allow the construction of recombinant (r)-BCG strains that can be employed as highly immunogenic vaccines against tuberculosis with a good safety profile. Furthermore, the development of novel procedures to cultivate BCG will allow the large-scale production of future BCG-based vaccines(Dietrich et al. , 2003). In addition, comparison of genome sequence of M. tuberculosis and other mycobacteria has led to the identification of DNA segments/genes specific for M. tuberculosis . Some of these genes encode antigenically important proteins that are promising reagents for specific diagnosis and new candidate vaccines against TB (Mustafa, 2002).Vaccination is the only possible approach to control this disease in much of the developing world (Baron, 1996).

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

IX. DRUG RESISTANCE & EXTENSIVELY DRUG RESISTANCE MDR& XDR-TB:

The emergence of drug-resistant strains of MTB, especially multidrug-resistant (MDR-TB) strains, defined as resistant to at least Isoniazid and Rifampin, poses a threat to the success of tuberculosis control programs. Recently, a bleaker picture has emerged for TB control programs with the discovery of extreme drug resistant TB (XDR-TB) strains, raising concerns of a future epidemic of virtually untreatable TB. These strains are not only MDR (resistant to RIF and INH), but are also resistant to the second line drugs (fluoroquinolones and at least one of the other injectable drugs i.e. kanamycin, amikacin or capriomycin) (Madariaga et al. , 2008; Park et al. , 2009).

As a consequence of this and the restricted number of therapeutic agents, there has been a renewed effort during the last decade to define the molecular basis of drug resistance in M. tuberculosis . Resistance to drugs is due to particular genomic mutations in specific genes of M. tuberculosis. Genes known to be linked to resistance to antituberculosis drugs are: katG , inhA , aphC , kasA, ndh for Izoniazid resistance; rpoB for Rifampicin resistance; rpsL and rrs for streptomycin (SM); embB for ethambutol and pncA for pyrazinamide resistance– all first line drugs (6). The molecular mechanisms to 2 nd line drug resistance are less well defined. The following genes are associated with 2 nd line resistance - gyr A for Fluoroquinolone, rrs for Kanamycin / Amikacin and tly A for Capreomycin. Multiple drug resistance is the consequence of an accumulation of mutations(Van Rie et al. , 2001).

Indeed there is an urgent need for new, rapid diagnostics to investigate about multidrug- resistant (MDR) and extensively drug-resistant (XDR) TB. Current identification and detection of drug susceptibility testing for the majority of Mycobacteria, is based on the proportional method, which is performed on solid media such as Löwenstein-Jensen slants or Middle brook agar. In this method, the ratio of the number of colonies growing on drug containing medium to the number of colonies growing on drug-free medium indicates the proportion of drug resistant mycobacteria within the bacterial population.including MTB , this method is the standard conventional method but it requires several weeks and multiple methodologies to complete Gupte, 1999). There is, therefore, a clear need to implement reliable molecular techniques for the detection of all forms of drug resistant strains to improve

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Bibliographical part 2012

health management of HIV, TB and malaria. Molecular techniques are rapid and prevent crucial delays, in treatment of individuals.

In the last decade, advances in molecular biology have made it possible to use mutations in specific genes for rapid detection of drug. Molecular methods for mutation analysis and strain typing may be used in conjunction to identify outbreaks strains. In this field, many PCR-based strategies have been used to detect mutations in the target genes of interest, which include DNA sequencing, pyrosequencing, SSCP and the hybridization by using of probes(Neonakis et al. , 2008) .

Molecular Diagnosis of MTB in Clinical Specimens F.ZAKHAM Doctorat Es Science in Microbiology and Molecular Biology Study Plan 2012

STUDY PLAN

The relative data of the potential contribution of the direct molecular diagnosis of MTB and the detection of MDR-TB strains were the objective of a scientific review article entitled: Rapid screening and diagnosis of tuberculosis: a real challenge for the mycobacteriologist.

Publication I:

Fathiah ZAKHAM , Mohammed AKRIM, Mohamed ELMZIBRI, Abdelaziz BENJOUAD, Rajae ELAOUAD & My Mustapha ENNAJI. 2012. Rapid Screening and Diagnosis of Tuberculosis: a real Challenge for the mycobacteriologist. Cell. Mol. Biol . 58: 1632-1640.

......

The practical results are presented as scientific original articles, preceded by a brief introduction, principal observations and discussion.

The 1st chapter of the results section is a highlight of the main objective of this thesis, in which we focus on the direct molecular diagnosis of MTB in clinical specimens.

Publication II & III:

Fathiah ZAKHAM , Halima BAZOUI, Mohammed AKRIM, Sanae LAMRABET, Ouafae LAHLOU, Mohamed ELMZIBRI, Abdelaziz BENJOUAD, My Mustapha ENNAJI and Rajae ELAOUAD. 2012. Evaluation of conventional Molecular diagnosis of Mycobacterium tuberculosis in the clinical specimens from Morocco. J Infect Dev Ctries. 6(1):40-45.

Fathiah ZAKHAM , Oufae LAHLOU, Mohammed AKRIM, Nada BOUKLATA, Sanae JAOUHARI, Mohamed ELMZIBRI, Abdelaziz BENJOUAD, Mustapha ENNAJI and Rajae ELAOUAD. 2012. Comparative analysis of conventional and molecular detection of Mycobacterium tuberculosis in the critical cases of the Moroccan population. Mediterranean Journal of Hematology and Infectious Diseases.

Doctorat Es Science in Microbiology and Molecular Biology Study Plan 2012

The 2nd chapter of the results section is a continuation towards TB management by the automated sequencing of genes responsible of resistance against anti-tuberculosis drugs in the high risk groups.

Publication IV: Fathiah ZAKHAM , Imane CHAOUI, Mohammed ABID, Moulay Driss MESSAOUDI, Moulay Mustapha ENNAJI, Mohamed ELMZIBRI. Automated sequencing for the direct detection of Multi drug Mycobacterium tuberculosis strains in the sputum specimens of Moroccan patients. (In preparation)

The 3rd chapter of the results presented a comparative genome, proteome and phylogeny analysis of tuberculosis and non tuberculosis mycobacterial strains in order to provide new insights of novel target genes for diagnosis of TB by the application of computational and bioinformatics tools.

Publications V & VI:

Fathiah ZAKHAM , Lamiae BELAYACHI, Dave USSERY, Mohammed AKRIM, Abdelaziz BENJOUAD, Rajae El AOUAD and Moulay Mustapha ENNAJI. 2011. Mycobacterial species as a case-study of comparative genome analysis. Cell. Mol. Biol. 57 : 1462-1469.

Fathiah ZAKHAM , Othmane AOUANE, David USSERY, Abdelaziz BENJOUAD and Mouly Mustapha ENNAJI. 2012. Computational and comparative genomics-proteomics and Phylogeny analysis of twenty one mycobacterial genomes. BMC Microbial informatics& experimentation.

REVIEW ARTICLE

Publication I:

RAPID SCREENING AND DIAGNOSIS OF TUBERCULOSIS: A REAL CHALLENGE FOR THE MYCOBACTERIOLOGIST

F. ZAKHAM1,2,3, M. AKRIM1, M. ELMZIBRI4, A. BENJOUAD3, R. ELAOUAD1* and M. M. ENNAJI2* 

1 Institut National d’Hygiène, Rabat, Morocco.

2 Laboratoire de Virologie et Hygiène & Microbiologie, Faculté des Sciences et Techniques. Mohammedia, Morocco. 3 Laboratoire de Biochimie et Immunologie, Faculté des Sciences. Université Mohammed V-Agdal. Rabat. Morocco. 4 Unité de Biologie et Recherches Médicales, Centre National de l’Energie, des Sciences et Techniques Nucléaires- Rabat- Morocco.

*My M. ENNAJI and R. ELAOUAD share senior authorship in this study (equal contribution).

Abstract Article information

Tuberculosis (TB) is an infectious, devastating and contagious disease, which infects third of the global population Received on October 2, 2011 worldwide with high rates of incidence in the developing countries, where the health care providers face a serious problem and a real challenge during their clinical practice for controlling and preventing the transmission of this illness. Indeed the Accepted on January 13, 2012 first step of control is the correct diagnosis and the initiation of the drug treatment regimen at the early stage of infection, which mandate the rapidity of screening and the accuracy of laboratory testing. In this paper we aim to highlight the  Corresponding author different actual techniques, regarding the rapid screening and diagnosis of tuberculosis. Tel: + 212 6 61 74 88 62 Fax: +212 5 23 31 53 53 Key words: Mycobacterim tuberculosis MTB, Bacteriological techniques, Molecular techniques, Diagnosis, Identification. E-mail:[email protected]

Introduction deer, elephants, goats, lions, seals, etc (15) and can spread to humans through inhalation of infectious Tuberculosis (TB) is an infectious, devastating and con- droplet and by ingestion of raw milk. Furthermore, tagious disease caused by a Mycobacterium, called Koch M. bovis has been associated with extrapulmonary tu- s’ bacillus (KB). berculosis in infants and children, generally occurring This disease is an ancient infection which affected the due to the consumption of milk, which had not been human being since millennia and that had been document- pasteurized or boiled, from infected cattle (93), espe- ed and detected in Egyptian mummies in several studies, cially in the HIV infected infants (37). Therefore the either by direct conventional microscopic examination zoonotic risk for human represents a serious problem, (111) or by molecular techniques (67,112). mostly for those living at the animal-human interface Furthermore, tuberculosis is still a major threatening of (61). humanity especially in developing countries and accord- • Mycobacterium bovis, Bacille Calmette–Guérin ing to the last reports of The World Health Organization (BCG): this has been largely used as a vaccine against (WHO), it is estimated that one-third of the global popula- human tuberculosis (6, 19) and can be obtained by the tion is infected with tuberculosis and that approximately attenuation of M.bovis and deletion of the RD1 region 8.9- 9.9 million new cases of tuberculosis arise annually (15). and over 1.3 million deaths among HIV-negative people • Mycobacterium microti: which infects voles, Cats, and 0.38 million deaths among HIV-positive people (105). dogs (15, 82) and human as reported recently in im- In almost cases; the causal agent of human tuberculosis munocompetent patients in France by Panteix et al, is Mycobacterium tuberculosis (MTB). However TB can 2010 (71). be caused by other Mycobacteria in some cases with spe- • Mycobacterium canetti: which infects human in lim- cial conditions (10), these Mycobacteria are belonging ited geographical location, in the horn of Africa (24). to the members of Mycobacterium tuberculosis complex • Mycobacterium pinnipedii: that infects seals, sea lions (MTBc), (15, 85, 86) which include: and marine mammals (8, 45). • Mycobacterium caprae: which can infects domestic • Mycobacterium africanum: That can provoke human animals such as goats, sheep, ewes (60), camels, hors- tuberculosis, principally in the west of Africa (18). es, pigs, dogs, cats (16), wild animal species (80) and • Mycobacterium bovis: which infect Badgers, cattle, human being. 1632 F. ZAKHAM et al. / Screening and Diagnosis Techniques of Tuberculosis. Furthermore, it has been demonstrated that these mem- MTB in the clinical sample (17) and the suspicion of TB bers are sharing a common ancestor in their evolutionary disease in a patient requires the completion more thorough events (34, 110) and has been settled that M. tuberculosis medical examinations: arose from M. bovis and M. tuberculosis emerged approximately 10–15,000 years ago, when the bovine tubercle ba- Radiological Examination: The radiological diagnosis cillus was transmitted to the mankind (15, 34). can highlight the pulmonary form of TB and the chest X It is worth mentioning that there are other mycobacteria ray is the most traditional technique for the screening of called atypical mycobacteria or non tuberculosis myco- TB (51). Although the presence of abnormality findings in bacteria (NTM). the conventional radiography is not decisive for the TB in- These mycobacteria are ubiquitous in the environment fection (29, 39), the cavitation is still the most remarkable and in extreme circumstances (immunosuppression, HIV sign of the active TB or the post primary infection and can infection, underlying diseases……etc), some of them be- indicate the severity of disease (58). come pathogenic for humans and can induce opportunistic infections or mycobacterioses (30). These mycobac- Bacteriological examination: Generally, the investi- teria often are described based on their growth rate and gation of the tubercle bacilli can be done on pulmonary pigmentation with and without exposure to light (5). The samples after their decontamination, though it can also be last group of mycobacteria is represented by M leprae, the performed on the other extrapulmonary specimens or other causal agent of leprosy in humans and characterized by the body fluids (Urine, cerebrospinal fluid, semen, gastric liq- inability to be cultured in vitro (42). uid……..etc) and the diagnosis of MTB can be achieved Although the diagnosis of TB can be made by differ- by: ent techniques: radiological, clinical and immunological techniques, the identification of causative organism MTB • Microscopic examination in the clinical sample is the most accurate and reliable for the final decision of tuberculosis and for initiating the drug The smear microscopy is the first step and the key of treatment regimen (17). In this paper we aim to outline the bacteriological diagnosis of TB. However the smear mi- different actual techniques regarding the rapid screening croscopy can not distinguish between viable and dead mi- and diagnosis of tuberculosis. croorganism and does not differentiate between the species of mycobacteria (35), Moreover it can only detect acid- Screening and Detection of the com- fast bacilli in concentrations of 10,000 organisms per ml plex Mycobacterium tuberculosis (MTBc) or more (109), but from an economical view the conventional microscopy is still the most useful tool or the sole Diagnosis of the latent tuberculosis tool in the low income countries (88), where the diagnosis of smear negative tuberculosis poses a serious problem for In 2005, the CDC guidelines for controlling the tuber- the health care providers, especially in the HIV co infected culosis and the reduction of the mortality and morbidity patients (9, 84). In fact there are different staining meth- cases due to this horrible illness, one of the most important ods, but the widely used technique is the Ziehl-Neelsen strategies for the achievement of this gaol is the identifica- method (13), which lack sensitivity and require the good tion of the persons with latent TB infection (LTBI), espe- expert technicians for the investigation about the bacillus cially those who are at high risk for potentially active TB in different fields on the smear (56). The problem of sensi- disease (3). tivity can be improved by the concentration by centrifuga- The diagnosis of LTBI has habitually been based upon tion of the specimens after adding the disinfectant NaOCl results of tuberculin skin testing or Mantoux test (56). This as demonstrated by Gebre et al., in different developing test involves an intradermal injection of the Purified Pro- countries (27). Nevertheless the sensitivity of the micro- tein Derivative (PPD) or the tuberculin (2). The response scopical examination has been developed in the industrial typically appears a day or two after the injection and con- countries by the utility of the Fluorescence microscopy sists of a raised, red, and indurated area in the skin, which (88), which provides more accurate results. then disappears as the antigen degraded (5, 10). This indicates the presence of antibodies or lymphocytes that are • Culture specific for that antigen (cellular immunity). Moreover, the immunological tests (the QuantiFERON- The culture is the gold standard for the diagnosis and TB Gold® and TSPOT®- TB tests) which are whole blood detection of TB (72). Most laboratories use solid medium interferon gamma release assays (IGRAs), are now other for the isolation of MTB. After homogenizing and decon- options for detecting LTBI and are potential tools for diag- taminating the specimen, inoculation the media by means nosing LTBI (49, 62). These tests are based on the princi- of a pipette delivering around 0.2ml as recommended by ple that T cells from most persons that have been infected WHO (106). Two media are used for MTB growth, Mid- with MTB will release IFN-γ when re-exposed to the same dle brook’s medium which is an agar based medium and mycobacterial antigens (in vitro).In fact these immuno- Lowenstein-Jensen medium which is an egg based medi- logical tests on peripheral blood alone can not differentiate um. Both types of media contain inhibitors to keep con- between active and latent TB (51). taminants from out-growing MTB and the culture should be examined during 4-6 weeks to get visual colonies on Diagnosis of active TB either type of media. It is noteworthy to mention that there are also new liquid techniques that have been developed to It is important to know that tuberculosis can be diag- shorten the time of culturing, comparing with traditional nosed accurately by identifying the causative organism, techniques of culturing on solid medium, such as: BAC- 1633 F. ZAKHAM et al. / Screening and Diagnosis Techniques of Tuberculosis.

Table 1. Some of the morphological and biochemical properties of tubercle bacilli.

Mycobacterial Host Colony Consumption Urease hydrolysis PZA TCH Niacin Nitrate strain Morphology of Oxygen at 3 h at 18 h accumulation reduction

M.tuberculosis Humans eugonic aerophilic - + S R + + M.bovis Wild and domestic dysgonic Micro aerophilic - + R S - - animals M. bovis BCG ------eugonic Micro aerophilic + + R S - - M. africanum Humans in the dysgonic Micro aerophilic - + S R/S +/- +/- West of Africa M. microti Wild and domestic eugonic aerophilic - + S S + - animals M.canetti Humans in the Very smooth, aerophilic + + R R + + horn of Africa eugonic M.caprae Wild and domestic eugonic aerophilic - + S S + - animals M.pinnipedii Seals, sea lions eugonic aerophilic - + S S + -

TCH: thiophen-2-carboxylic hydrazide, PZA: pyrazinamide, R: resistant, S: sensitive

TEC 460 TB, BacT/ALERT 3D and BACTEC MGIT 960, The most used method of DST is the proportional method, ESP II culture system (1, 65, 73, 96). Although of the ra- adjusted from the method described by Canetti (12). This pidity of liquid media in culturing mycobacteria, the solid technique consists of observing the mycobacterial growth medium still have the advantage of enabling the differen- on the Löwenstein-Jensen medium containing different tiation of mycobacterial growth and contamination, even concentrations of tested antibiotics, this method is current- more the colonial morphology, production of pigments, ly the method of choice for estimating drug resistance but rates of growth and the optimal temperature of growth it takes approximately four weeks for the final assessment. can help in the identification and the discrimination be- This period can be halved by the implementation of the tween rapid and slow growing mycobacteria (50). Table1 DST on the BACTEC liquid media (33, 38, 98). There are shows some of the colonial morphology, the production of also different commercially colorimetric methods for per- pigments and oxygen consumption for the differentiation forming the DST; the Reszurin test is one of the low cost, among the complex MTB. Therefore it is recommended rapid and accurate tests for the detection of drug resistance to combine both of solid and liquid medium for the best of MTB strains (53). recovery of mycobacteria (87). Molecular Examination: Nowadays, there are many mo- • Phenotypic and biochemical identification lecular techniques are commercially available which have decreased the time for the diagnosis, detection, identifica- Even though their consumption of time and cumber- tion of MTB and drug susceptibility pattern (44). Howev- someness, the biochemical identification is still useful in er, they have an excellent sensitivity and specificity when the developing countries for the differentiation among used from a culture, these techniques have currently insuf- MTB complex and other mycobacteria, particularly the ficient sensitivity when applied directly to respiratory and niacin test (26) and due to the large number of tests in this other samples (46), these tests are numerous and we can topic, we can not mention them in detail and briefly pass- list the most important are: ing through the most important utilized phenotypic and biochemical tests, we can point out: Catalase, Niacin test, • DNA Amplification by PCR, including Real Time Nitrate reduction, Aryl sulphatase, Tween80 analysis, Ure- PCR ase Activity, Pyrazinamide (PZA), Iron Uptake, Growth inhibition by Thiophene 2 carboxylic acid Hydrazide The utilisation of PCR for the detection of MTB in clini- (TCH), Growth on 5% sodium chloride, ß glucosidase, tel- cal samples has been reported and commercially available lurite reduction (31, 52). amplification and detection kits as well as manual in-house Levy-Frebault et al., had evaluated 8 rapid biochemical methods are also applied in routine diagnostic laboratories and enzymatic tests for the identification of 18 species of (28, 40, 55, 63, 75-77, 83, 104, 107) and its reliability has mycobacteria (niacin, catalase, nitrate reductase, ß gluco- been questioned (68). Moreover, the paucibacilary nature sidase, urease, penicillinase, trehalase and cephalospori- of specimens (sputum, biopsies, pus and body fluids) was nase) and they found that those tests were able in some a challenge for the detection of this microorganism. cases to discriminate between closely related species (54). The insertion sequence IS 6110 (7, 22, 23, 91) 16S rRNA Table 1 show also the most used biochemical tests for (14, 48, 64) and hsp 65 (47) are the most common targets the phonotypical and biochemical differentiation among used for the MTB diagnosis in the clinical specimens. Ad- the complex MTB quoted from (15, 20). ditionally there are different types of PCR-based assays have been developed and modified for this purpose, the • Drug susceptibility testing DST Real-time PCR is one of the promising tools with high sensitivity for the rapid identification of different myco- After the detection and the identification of MTB, the bacterial species, with the advantage of possible identifica- DST is the main analysis to be performed for better man- tion and detection of a given target sequence directly from agement of TB, using different anti tuberculosis agents. clinical specimens (95). 1634 F. ZAKHAM et al. / Screening and Diagnosis Techniques of Tuberculosis. The Multiplex PCR is also a potential tool for distin- fingerprinting isolates of M. tuberculosis (62, 100). The guishing between the pathogenic species of mycobacteria IS6110 is a transposable element present in the members and it is supposed to be simple, rapid, cost effective and of MTB complex in multiple copies (up to 25 copies) (92, superior to the traditional methods (30). Recently, Warren 94) except M. bovis BCG which harbours a single copy et al., have developed a new multiplex PCR for the dif- (68) and absent in other mycobacteria. Furthermore, due ferentiation the members of MTBC by the amplification to its high numerical and positional polymorphism, has be- of genomic regions of difference (RD1, RD1mic, RD2seal, come a widely used marker in the epidemiological studies RD4, RD9, RD12) (103). The PCR-restriction endonucle- (57, 59, 69), identification (99) and phylogenetic analysis ase analysis (PRA) had been used and evaluated for the (94). In the last decade many methods for typing of clini- differentiating between 39 pathogenic rapid growing my- cal strains of MTB were developed, the most commonly cobacteria (RGM) by Wang et al., and they found good used methods; the spoligotyping and MIRU-VNTR. results (102) , in addition of the fast identification compar- The spoligotyping relies on the analysis of a unique ing with conventional method and it could be used into chromosomal region of the genome with high polymor- the clinical laboratory setting, particularly for patients who phism, called DR or direct repeat and contains of 36 bp are suffering of infection due to pathogenic RGM and ac- that are separated by non repetitive DNA spacers (41), the cording to Varma-Basil et al., the PCR-RFLP was recently order of spacers is identical in all mycobacterial strains, used for the direct identification of MTB in the clinical but their presence or absence varies from one isolate to specimens and could offer a considerable benefit for clini- another (Figure 1). cian for their chemotherapy choice (101).

• Nucleic acid Probe

The DNA probe is one of the efficient methods for the identification of MTB members from pure culture (66) and the most used DNA probes in the routine laboratories are the AccuProbe for the rapid identification of MTB. Badak et al., demonstrated that the AccuProbe allows the accurate and rapid identification of MTB when applied directly on the positive MB/BacT broth (4). Furthermore it can also be used for the identification of other non tuberculosis mycobacteria (97)

• In situ Hybridization

The fluorescence hybridization in situ by using Peptide Nucleic Acid Probes has been recently demonstrated a Figure 1. Steps of Spoligotyping method. good results for the identification of the members of the MTBC and the differentiation tuberculosis and non tuberculosis mycobacteria, especially in the liquid culture (21, 36, 70).

• Automated Sequencing

Genetic sequencing techniques have progressively become useful tools for mycobacterial differentiation (74) and sequencing of a fragment of conserved genes such as 16S rRNA (32, 81, 108) or hsp65 (78, 79, 90) are the most sensitive methods for identification of a large number of mycobacterial species. Recently a single step sequencing technique has been applied for the identification of the eight closely related members of the complex MTB, called the Exact Tandem Repeat D or the ETR-D sequencing (20). Importantly, sequencing is also used for DST to characterize the genetic mutations associated with resistance to antituberculosis drugs. Figure2. Chromosome of MTB (X) strain, genotyping of M. bovis BCG, H37Rv MTB strain on the basis of repeated units MIRUs. On Strain typing and DNA fingerprinting the top: a chromosome of MTB strain, the three lower panels show the results of genotyping based on MIRUs. The MIRUS contain repeated Tuberculosis epidemiology has been clarified significant- units; the analysis of MIRUS involves a PCR amplification followed ly by the development of molecular biological techniques by electrophoresis to look for the number and size of the elements which allow the relatively unambiguous identification of repeated in 12 independent loci, each with one repeated sequence.The a particular clinical isolate (5). The restriction fragment sizes of molecular weight marker (M) and PCR products (A, B, CD) length polymorphism (RFLP) using the insertion sequence BCG, H37Rv and X strains are given. The specific sizes of the different IS6110 has become the standard international method for MIRUS in each strain are the result of a distinct fingerprint of the strain. 1635 F. ZAKHAM et al. / Screening and Diagnosis Techniques of Tuberculosis.

Higher cost is the main limitation and good expertise in the analysis of sequences is the standard international The IS 6110 method, but this technique is difficult to perform. The spoligotyping and MIRU-VNTR must be combined for better discrimination and between strains. differentiation High cost and necessitate a good expert skills. The sensitivity of MTB detection in clinical specimen has been questioned. Higher cost and limited availability. Variable Variable Higher cost and limited availability. sensitivity. Inferior sensitivity for non respiratory specimens. Does not allow ruling out tuberculosis Cumbersome and takes a long time (up to 8 weeks) especially on solid media. The presence of viable bacteria is necessary and it is not always possible, especially in treated people. Limitations Limitations

The IS 6110 is the standard international The IS 6110 Rapid Identification of a large number of Rapid Identification of a large mycobacterial species method. fingerprinting The strain typing and DNA help in the epidemiological studies Identification of MTBC members between MTB and NTM Differentiation especially in liquid culture. Rapid identification of MTBC members from pure culture. between MTB and NTM Differentiation High specificity. High specificity. Fast results. Allows identification and investigation of genetic resistance patterns Gold standard Characteristics, morphology and pigmentation of colonies can help in the detection, identification of MTB and DST testing Advantages Advantages Culture based techniques Culture Molecular based Techniques Molecular 6110 and repetitive 6110 The discrimination between mycobacterial strains based on polymorphism of the insertion sequence IS DNA elements such as the polymorphic DNA GC-rich sequence (PGRS) and the direct- repeat (DR) region. The determination of the nucleotides order in the genes Fluorescence hybridization of the Bacterial Acid Probes with Peptide Nucleic DNA Detection a complementary target sequence target a complementary Detection in a nucleic acid Detection of the presence MTB genomic in clinical DNA samples after amplification Principle Detection of bacterial growth after inoculation of clinical specimens on media culture Principle Strain typing and DNA Strain typing and DNA fingerprinting (RFLP Techniques Spoligotyping and MIRU Automated Sequencing In situ Hybridization Nucleic acid Probe PCR and various techniques: Real time PCR Multiplex PCR…etc Technique Technique Culture based techniques (MTB detection, identification and DST) Technique Technique Table 2. Culture and Molecular based techniques (Principles, advantages limitations) Table

1636 F. ZAKHAM et al. / Screening and Diagnosis Techniques of Tuberculosis. MIRUs (Mycobacterial Interspersed Repetitive Units) 6. Bastos, R. G., Borsuk, S., Seixas, F. K. and Dellagostin, O. A. Re- are loci in the MTB genome that contain variable numbers combinant Mycobacterium bovis BCG. Vaccine. 2009, 27(suppl 47): of tandem repeats (VNTRs) (25). MIRU-VNTR typing 6495-503. based on PCR amplification targeted areas and determin- 7. Ben Kahla, I., Ben Selma,W., Marzouk, M., Ferjeni, A., Ghezal, S. ing the number of repetitions of the unit. The end result and Boukadida, J. Evaluation of a simplified IS6110 PCR for the rapid is a numeric code corresponding to the 12-digit number diagnosis of Mycobacterium tuberculosis in an area with high tubercu- of repeats observed each chromosomal locus (66) (Figure losis incidence. Pathologie Biologie. 2011, 59 (suppl 3):161-5. 2). Recently a standardized method based on analysis of 8. Bigi, F., Garcia-Pelayo, M. , Nuñez-García, J., Peralta, A., Caimi, K., 15 MIRU loci instead of 12, with a discriminatory power Golby, P., Hinds, J., Cataldi, A., Gordon, S. and Romano, M. Identifica- has been proposed as a new standard for epidemiological tion of genetic markers for Mycobacterium pinnipedii through genome studies and 24 loci was anticipated as a method of high- analysis. . FEMS Microbiol Lett. 2005. 15(suppl 2):147-52. resolution for phylogenetic studies (89). 9. Borgdorff, M. W., Floyd, K. and Broekmans, J. F. Interventions to reduce tuberculosis mortality and transmission in low- and middle-in- Microarray analysis come countries. Bull World Health Organ. 2002, 80 (suppl 3): 217-27. 10. Brooks, G., Butel, J. and Morse, S. In: Jawetz, Melnick, Adelberg‘s The microarray analysis or the DNA chips are a collec- Medical Microbiology, 21st edition ed. Lange Medical book. 1998. PP. tion of labeled DNA probes fixed on a solid surface, after 279-283. the hybridization with the DNA in question, the intensity 11. Butcher, P. D. Microarrays for Mycobacterium tuberculosis. Tuber- can be computed and fluorescent image can be visualised culosis. (Edinburgh, Scotland). 2004, 84 (suppl 3-4):131-7. (66). 12. Canetti, G., Fox,W., Khomenko, A., Mahler, H., Menon, N., Mitchi- The microarray of the mycobacterial genom provided a son, D., Rist ,N. and Smelev, N. Advances in techniques of testing my- new insight of understanding and measuring the genes ex- cobacterial drug sensitivity, and the use of sensitivity tests in tubercu- pression on multiple regions on the genome, which can be losis control programmes. Bull World Health Organ. 1969, 41: 21-43. exploited for improving drugs, vaccines, and diagnostics 13. Cheesbrough, M. In: District laboratory practice in tropical coun- tools for controlling mycobacterial diseases (11, 43). tries. . Cambridge University Press.2000. 14. Clarridge, J. E., Shawar, R. M., Shinnick, T. M. and Plikaytis, B. B. Concluding remarks Large-scale use of polymerase chain reaction for detection of Mycobac- terium tuberculosis in a routine mycobacteriology laboratory. J. Clin. The screening of TB can be performed by different tech- Microbiol. 1993, 31(suppl 8): 2049-56. niques: radiologic, clinical, immunological, bacteriologi- 15. Cole, S. T. Comparative and functional genomics of the Mycobac- cal and molecular techniques. However the final decision terium tuberculosis complex. Microbiology. 2002, 148 (suppl 10):2919- of the infection of TB can be merely completed by the 28. identification of MTB. 16. Cvetnic, Z., Spicic, S., Katalinik-Jankovic, v., Marjanovic, S., Ob- The conventional techniques of MTB identification are rovac, M., Benic, M., Mitak, M. M. and Pavlik, I. Mycobacterium based on the bacteriological examinations which are time caprae infection in cattle and pig son one family farm in Croatia: a case consuming. However in the over last decades, different report. Vet Med. 2006, 51(suppl 11):523–31. molecular techniques have been developed and provided 17. da Silva Rocha, A., da Costa Leite, C., Torres, H. l. M., de Miranda, excellent, rapid and accurate results. A. B., Pires Lopes, M. r. Q., Degrave, W. M. and Suffys, P. N. Use of The main limitation of their utilization is the high cost PCR-restriction fragment length polymorphism analysis of the hsp65 of their application in routine analysis and in conclusion, gene for rapid identification of mycobacteria in Brazil. J. Microbiol. the culture for MTB is irreplaceable but molecular tech- Methods. 1999, 37(suppl 3):223-9. niques are optional to save the life of patients in the high 18. Davies, P. D. O., and Pai, M. The diagnosis and misdiagnosis of suspected cases of tuberculosis and briefly the principles, tuberculosis [State of the art series. Tuberculosis. Edited by I. D. Ru- main advantages and limitations of culture and molecular sen. Number 1 in the series]. Int. J. Tuberc. Lung Dis. 2008, 12(suppl based techniques have been summarized in Table 2. 11):1226-34. 19. De Wit, D., Steyn, L., Shoemaker, S. and Sogin, M. Direct detection REFERENCES of Mycobacterium tuberculosis in clinical specimens by DNA amplification. J. Clin. Microbiol. 1990, 28(suppl 11):2437-41. 1. Anargyros, P., Astill, D. S. and Lim, I. S. Comparison of improved 20. Demers, A.-M., Mostowy, S., Coetzee, D., Warren, R., van Helden, BACTEC and Lowenstein-Jensen media for culture of mycobacteria P. and Behr, M. A. Mycobacterium africanum is not a major cause of from clinical specimens. J. Clin. Microbiol. 1990, 28 (suppl 6):1288- human tuberculosis in Cape Town, South Africa. Tuberculosis. (Edin- 91. burgh, Scotland). 2010, 90 (suppl 2):143-4. 2. Arias Guillen, M., Palomar,R. and Arias, M. Advances in the diag- 21. Dietrich, G., Viret, J.-F. and Hess, J. r. Mycobacterium bovis BCG- nosis of latent tuberculosis infection in patients receiving renal replace- based vaccines against tuberculosis: novel developments. Vaccine. ment therapy. Nefrologia .2011, 31(suppl 2):137-41. 2003,21 (suppl 7-8):667-70. 3. ATS. Controlling tuberculosis in the United States: recommendations 22. Djelouadji, Z., Raoult, D., Daffa, M. and Drancourt, M. A Single- from the American Thoracic Society. CDC, and the Infectious Diseases Step Sequencing Method for the Identification of Mycobacterium tuber- Society of America. 2005, 54: 15. culosis Complex Species. PLoS Negl Trop Dis .2008, 2(suppl 6):e253. 4. Badak, F. Z., Goksel, S., Sertoz, R., Nafile, B., Ermertcan, S., Cavu- 23. Drobniewski, F. A., More, P. G. and Harris,G. S. Differentiation of soglu, C. and Bilgic, A. Use of Nucleic Acid Probes for Identification of Mycobacterium tuberculosis Complex and Nontuberculous Mycobac- Mycobacterium tuberculosis Directly from MB/BacT Bottles. J. Clin. terial Liquid Cultures by Using Peptide Nucleic Acid-Fluorescence In Microbiol. 1999, 37(suppl 5):1602-05. Situ Hybridization Probes. J. Clin. Microbiol. 2000, 38(suppl 1): 444-7. 5. Baron, S. In: Medical Microbiology. Galveston (TX):University of 24. Eisenach, K. D., Crawford,J. T. and Bates, J. H. Repetitive DNA Texas. Medical Branch, Texas. 1996. NCBI bookshelf. sequences as probes for Mycobacterium tuberculosis. J. Clin. Micro- 1637 F. ZAKHAM et al. / Screening and Diagnosis Techniques of Tuberculosis. biol.1988, 26 (suppl 11):2240-5. amplification of rRNA.J. Clin. Microbiol. 1993, 31(suppl 9):2410-16. 25. Eisenstein, B. I. The Polymerase Chain Reaction. A new method of 43. Kamerbeek, J., Schouls, L., Kolk, A., van Agterveld, M., van using molecular genetics for medical diagnosis. N. Engl. J. Med. 1990, Soolingen, D., Kuijper, S., Bunschoten, A., Molhuizen, H., Shaw, R., 322(suppl 3):178-83. Goyal, M.and van Embden, J. Simultaneous detection and strain differ- 26. Fabre, M., Hauck, Y., Soler, C., Koeck, J.-L., van Ingen, J., van entiation of Mycobacterium tuberculosis for diagnosis and epidemiol- Soolingen, D., Vergnaud, G. and Pourcel, C. Molecular characteristics ogy. J. Clin. Microbiol. 1997, 35 (suppl 4):907-14. of Mycobacterium canettii the smooth Mycobacterium tuberculosis ba- 44. Kaplan, G., and Cohn, Z. A. 1986. The immunobiology of leprosy. cilli. Infect. Genet. Evol. 2011, 10 (suppl 8):1165-73. Int Rev Exp Pathol. 1986, 28:45-78. 27. Frothingham, R., and Meeker-O’Connell, W. A. Genetic diversity in 45. Kendall, S. L., Rison, S. C. G., Movahedzadeh, F., Frita, R. and the Mycobacterium tuberculosis complex based on variable numbers of Stoker, N. G. What do microarrays really tell us about M. tuberculosis? tandem DNA repeats. Microbiology. 1998, 144(suppl 8):1189-96. Trends. Microbiol. 2004, 12 (suppl 12):537-44. 28. Gadre, D., Mahajan, M., Singh, N., Agarwal, D. and Talwar, V. Nia- 46. Kessler, H. H. Molecular diagnosis of mycobacteria. Wien Med cin test for mycobacteria: a comparative study of two methods. Ind. J. Wochenschr 2003, 153(suppl 15-16):336-41. Tub.1995, 42:225-6. 47. Kiers, A., Klarenbeek, A., Mendelts, B., Van Soolingen, D. and 29. Gebre, N., Karlsson, U., Jonsson, G., Macaden, R., Wolde, A., As- Koter, G. Transmission of Mycobacterium pinnipedii to humans in a sefa, A.and Miorner, H. Improved microscopical diagnosis of pulmo- zoo with marine mammals. Int. J.Tuberc. Lung Dis. 2008, 12(suppl nary tuberculosis in developing countries. Trans R Soc Trop Med Hyg. 12):1469-1473. 1995, 89 (suppl 2):191-3. 48. Kim, J. Y., Ferraro, M. J. and Branda, J. A. False-Negative Results 30. Gillellamudi, S. Role of Urinary PCR in Diagnosis of Genitourinary Obtained with the Gen-Probe Amplified Mycobacterium tuberculosis Tuberculosis. Glob. J. Med. Res. 2010, 10 (suppl 2):2-5. Direct Test Caused by Unrecognized Inhibition of the Amplification 31. González-Martín, J., García-García, J., Anibarro, L., Vidal, R., Es- Reaction. J. Clin. Microbiol. 2009, 47(suppl 9):2995-2997. teban, J., Blanquer, R., Moreno, S. and Ruiz-Manzano, J. Consensus 49. Kim, K., Lee, H., Lee, M.-K., Lee, S.-A., Shim, T.-S., Lim, S. Y., document on the diagnosis, treatment and prevention of tuberculosis. Koh, W.-J., Yim, J.-J., Munkhtsetseg, B., Kim, W., Chung, S.-I., Kook, Arch Bronconeumol. 2010, 46 (suppl 5):255-74. Y.-H. and Kim, B.-J. Development and Application of Multiprobe Re- 32. Gupta, S., Bandyopadhyay, D., Paine, S. K., Banerjee, S., Bhat- al-Time PCR Method Targeting the hsp65 Gene for Differentiation of tacharya, S., Gachhui, R. and Bhattacharya, B. Rapid identification of Mycobacterium Species from Isolates and Sputum Specimens. J. Clin. mycobacterium species with the aid of multiplex polymerase chain re- Microbiol. 2010, 48 (suppl 9):3073-80. action (PCR) from clinical isolates. Open Microbiol J. 2010, 4:93-7. 50. Kox, L. F., van Leeuwen, J., Knijper, S., Jansen, H. M. and Kolk, A. 33. Gupte, S. In: Short Textbook of medical microbiology, 7th edition H. PCR assay based on DNA coding for 16S rRNA for detection and ed, New Delh. 1999.P: 264-83. identification of mycobacteria in clinical samples. J. Clin. Microbiol. 34. Han, X. Y., Pham, A. S., Tarrand, J. J., Sood, P. K. and Luthra, 1995, 33(suppl 12): 3225-33. R. Rapid and Accurate Identification of Mycobacteria by Sequencing 51. Lalvani, A., and Pareek, M. A 100 year update on diagnosis of tuber- Hypervariable Regions of the 16S Ribosomal RNA Gene. Am. J. Clin. culosis infection. Br. Med. Bull. 2010, 93: 69-84. Pathol. 2002, 118 (suppl 5):796-801. 52. Lambi, E. A. In: Medium selection and incubation for the isola- 35. Hanna, B. A., Ebrahimzadeh, A., Elliott, L. B., Morgan, M. A., tion of mycobacteria., 1992, vol. 1. American Society for Microbiology, Novak, S. M., Rusch-Gerdes, S., Acio, M., Dunbar, D. F., Holmes, T. Washington D.C. M., Rexer, C. H., Savthyakumar, C. and Vannier, A. M. Multicenter 53. Lange, C., and Mori, T. Advances in the diagnosis of tuberculosis. . Evaluation of the BACTEC MGIT 960 System for Recovery of Myco- Respirology. 2010, 15 (suppl 2):220–240. bacteria. J. Clin. Microbiol.1999, 37 (suppl 11):748-52. 54. Leao, S., Martin, A., Mejia, G., Palomino, J., Robledo, J., Telles, 36. Hewinson, R. G., Vordermeier, H. M., Smith, N. H., and Gordon, M. A. S. and Portaels, F. In: Practical handbook for the phenotypic and S. V. Recent advances in our knowledge of Mycobacterium bovis: A genotypic identification of mycobacteria. 2005. feeling for the organism. Vet. Microbiol. 2006, 112 (suppl 2-4):127-39. 55. Lemus, D., Martin, A., Montoro, E., Portaels, F. and Palomino, 37. Hobby, G. L., Holman, A. P., Iseman, M. D., and Jones, J. M. Enu- J. C. Rapid alternative methods for detection of rifampicin resistance meration of Tubercle Bacilli in Sputum of Patients with Pulmonary Tu- in Mycobacterium tuberculosis. J. Antimicrob. Chemother. 2004, 54 berculosis. 1973, 4: 94-104. (suppl 1):130-3. 38. Hongmanee, P., Stender, H. and Rasmussen,O. F. Evaluation of a 56. Lévy-Frébault, V., Grandry, J. and David, H. Evaluation of rapid Fluorescence In Situ Hybridization Assay for Differentiation between tests for the identification of mycobacteria. J Med Microbiol. 1982, 15 Tuberculous and NontuberculousMycobacterium Species in Smears of (suppl 4): 575- 77. Lowenstein-Jensen and Mycobacteria Growth Indicator Tube Cultures 57. Li, X. J., Wu, Q. X. and Zeng, X. S. Nontuberculous mycobac- Using Peptide Nucleic Acid Probes. J. Clin. Microbiol. 2001, 39 (suppl terial cutaneous infection confirmed by biochemical tests, polymerase 3): 1032-35. chain reaction-restriction fragment length polymorphism analysis and 39. Houde, C., and Dery, P. Mycobacterium bovis sepsis in an in- sequencing of hsp65 gene. Br. J. Dermatol. 2003, 149 (suppl 3):642-6. fant with human immunodeficiency virus infection. Pediatr. Infect. 58. Lima, S. S. S., Clemente, W. T., Palaci, M., Rosa, R. V., Antunes, Dis.J.1998, 7:810–12. C. M. d. F. and Serufo, J. C. Conventional and molecular techniques in 40. Huang, T.-S., Lee, S. S.-J., Tu, H.-Z., Huang, W.-K., Chen, Y.-S., the diagnosis of pulmonary tuberculosis: a comparative study. J. Bras Huang, C.-K., Wann, S.-R., Lin, H.-H.and Liu, Y.-C. Use of MGIT 960 Pneumol. 2008, 34 (suppl 12):1056-62. for rapid quantitative measurement of the susceptibility of Mycobacte- 59. Mark, D., and Perkins, M. New diagnostic tools for tuberculosis. Int rium tuberculosis complex to ciprofloxacin and ethionamide.J. Antimi- J tuberc Lung Dis. 2000, 4(suppl 12):182-188. crob. Chemother. 2004, 53 (suppl 4):600-3. 60. Mazurek, G. H., Cave, M. D., Eisenach, K. D., Wallace, R. J., Bates, 41. Jeong, Y. J., and Lee, K. S. Pulmonary Tuberculosis: Up-to-Date Im- J. H.and Crawford, J. T. Chromosomal DNA fingerprint patterns pro- aging and Management. Am. J. Roentgenol. 2008, 191 (suppl3):834-44. duced with IS6110 as strain-specific markers for epidemiologic study of 42. Jonas, V., Alden, M. J., Curry, J. I., Kamisango, K., Knott, C. A., tuberculosis. J. Clin. Microbiol.1991, 29 (suppl 9):2030-33. Lankford, R., Wolfe, J. M. and Moore, D. F. Detection and identifica- 61. McAdams, H. P., Erasmus, J. and Winter, J. A. Radiologic manifes- tion of Mycobacterium tuberculosis directly from sputum sediments by tations of pulmonary tuberculosis. Radiol. Clin. North. Am. 1995, 33 1638 F. ZAKHAM et al. / Screening and Diagnosis Techniques of Tuberculosis.

(suppl 4):655-78. polymerase chain reaction. Diagn. Microbiol. Infect. dis. 2006, 56 (sup- 62. McEvoy, C. R. E., Falmer, A. A., van Pittius, N. C. G., Victor, T. C., pl 2):141-6. van Helden, P. D.and Warren, R. M. The role of IS6110 in the evolution 79. Restrepo, B. I., Gomez, D. I., Shipley, G. L., McCormick, J. B. and of Mycobacterium tuberculosis. Tuberculosis. (Edinburgh, Scotland). Fisher-Hoch, S. P. Selective enrichment and detection of mycobacte- 2007, 87 (suppl 5):393-404. rial DNA in paucibacillary specimens. J. Microbiol. Methods. 2006, 67 63. Mendoza, M., Juan, L., Menandez, S., Ocampo, A., Mourelo, (suppl 2):220-9. J., Saez,J. L., Domanguez, L., Gortazar, C., Garcia Marin, J. F. and 80. Ringuet, H., Akoua-Koffi, C., Honore, S., Varnerot, A., Vincent, V., Balseiro, A. Tuberculosis due to Mycobacterium bovis and Mycobacte- Berche, P., Gaillard, J. L. and Pierre-Audigier, C. hsp65 Sequencing rium caprae in sheep. Vet. J. 2011, 191(suppl 2):267-9. for Identification of Rapidly Growing Mycobacteria.J. Clin. Microbiol. 64. Michel, A. L., Maller, B. and van Helden, P. D. Mycobacterium 1999, 37 (suppl 3):852-7. bovis at the animal“human interface: A problem, or not? Vet. Microbiol. 81. Rodríguez, S., Bezos, J., Romero, B., de Juan, L., Álvarez, J., Cas- 2011, 140 (suppl 3-4):371-81. tellanos, E., Moya, N., Lozano, F., Javed, M., Sáez-Llorente, J., Liéba- 65. Morris, A. Mycobacteriology: Laboratory Methods and Standards. na, E., Mateos, A., Domínguez, L. and Aranaz, A. Mycobacterium Guidelines for Tuberculosis Control in New Zealand. 2003. caprae infectionin livestock and wildlife, Spain. Spanish Network on 66. Nagesh, B. S., Sehgal,S. , Jindal, S. K. and Arora, S. K. Evaluation Surveillance and Monitoring of Animal Tuberculosis. Emerg. Infect. of Polymerase Chain Reaction for Detection of Mycobacterium tuber- Dis.2011, 17 (suppl 3):532-5. culosis in Pleural Fluid. Chest. 2001, 119 (suppl 6):1737-41. 82. Rogall, T., Wolters, J. R., Flohr, T. and Bottger, E. C. Towards a 67. Nakano, N., Wada, R., Yajima, N., Yamamoto, N., Wakai, Y. and Phylogeny and Definition of Species at the Molecular Level within the Otsuka, H. Mycobacterial infection of the musculoskeletal tissues: the Genus Mycobacterium. Int. J. Syst. Bacteriol. 1990, 40 (suppl 4):323- use of pathological specimens for identification of causative species 330. by PCR-direct sequencing of 16S rDNA. Jpn. J. Infect. Dis. 2010, 63 83. Rufenacht, S., Bogli-Stuber, K., Bodmer, T., Jaunin, V. F., Jmaa, D. (suppl 3): 188-91. C. and Gunn-Moore, D. A. Mycobacterium microti infection in the cat: 68. Nazish, F. Newer diagnostic techniques for tuberculosis. Respira- a case report, literature review and recent clinical experience. J. Feline. tory Medicine CME 2009, 2:151–4. Med. Surg. 2011, 13 (suppl3):195-204. 69. Neonakis, I. K., Gitti, Z., Krambovitis, E. and Spandidos, D. A. Mo- 84. Saltini, C. Direct amplification of Mycobacterium tuberculosis de- lecular diagnostic tools in mycobacteriology. J. Microbiol. Methods. oxyribonucleic acid in paucibacillary tuberculosis. Eur. Respir. J. 1998, 2008, 75 (suppl 1):1-11. 11(supl 6):1215-17. 70. Nerlich, A. G., Haas, C. J., Zink, A., Szeimies, U. and Hagedorn H. 85. Siddiqi, K., Lambert, M.-L. and Walley, J. Clinical diagnosis of G. Molecular evidence for tuberculosis in an ancient Egyptian mummy. smear-negative pulmonary tuberculosis in low-income countries: the Lancet, 1997, 350 (suppl 9088):1404. current evidence. Lancet Infect. Dis. 2003, 3 (suppl 5):288-96. 71. Noordhoek, G. T., van Embden, J. D. A. and Kolk, A. H. J. Ques- 86. Smith, N. H., and Upton, P. Naming spoligotype patterns for the tionable Reliability of the Polymerase Chain Reaction in the Detection RD9-deleted lineage of the Mycobacterium tuberculosis complex; In- of Mycobacterium Tuberculosis. N. Engl. J. Med. 1993, 329 (suppl fect. Genet. Evol. 2011. (In press). 27):2036-36. 87. Soo, P.C., Horng, Y.T., Hsueh, P.R., Shen, B.J., Wang, J.Y., Tu, H.H., 72. Otal, I., Martin, C., Vincent-Levy-Frebault, V., Thierry, D. and Wei, J.R., Hsieh, S.C., Huang, C.C. and Lai, H.C. Direct and Simulta- Gicquel, B. Restriction fragment length polymorphism analysis using neous Identification of Mycobacterium tuberculosis complex (MTBC) IS6110 as an epidemiological marker in tuberculosis. J. Clin. Micro- and Mycobacterium tuberculosis (MTB) by Rapid Multiplex nested biol. 1991, 29 (suppl 6):1252-54. PCR-ICT assay. J. Microbiol. Methods. 2006, 66 (suppl 3):440-8. 73. Padilla, E., Manterola, J., Rasmussen, O., Lonca, J., Domínguez, J., 88. Stager, C. E., Libonati, J. P., Siddiqi, S. H., Davis, J. R., Hooper, Matas, L., Hernández, A.and Ausina, V. Evaluation of a fluorescence N. M., Baker, J. F. and Carter, M. E. Role of solid media when used in hybridisation assay using peptide nucleic acid probes for identification conjunction with the BACTEC system for mycobacterial isolation and and differentiation of tuberculous and non-tuberculous mycobacteria identification. J. Clin. Microbiol. 1991, 29 (suppl 1):154-7. in liquid cultures. Eur. J. Clin. Microbiol. Infect. Dis. 2002, 19 (suppl 89. Steingart, K. R., Henry, M., Ng, V., Hopewell, P. C., Ramsay, A., 2):140-5. Cunningham, J., Urbanczik, R., Perkins, M., Aziz, M. A.and Pai, M. 74. Panteix, G., Gutierrez, M. C., Boschiroli, M. L., Rouviere, M., Fluorescence versus conventional sputum smear microscopy for tuber- Plaidy, A., Pressac, D., Porcheret, H., Chyderiotis, G., Ponsada, K., Van culosis: a systematic review. Lancet Infect. Dis. 2006, 6 (suppl 9):570- Oortegem, M., Salloum, S., Cabuzel, S., Bauls, A. L., Van de Perre, P. 581. and Godreuil, S. Pulmonary tuberculosis due to Mycobacterium mi- 90. Supply, P., Allix, C., Lesjean, S., Cardoso-Oelemann, M., Rch- croti: a study of six recent cases in France. J. Med. Microbiol. 2011, 59 Gerdes, S., Willery, E., Savine, E., de Haas, P., van Deutekom, H., (suppl 8):984-9. Roring, S., Bifani, P., Kurepina, N., Kreiswirth, B., Sola, C., Rastogi, 75. Phelan, E., El-Gammal, A. and O’Connor, T. In: Tuberculosis, En- N., Vatin, V., Gutierrez, M. C., Fauville, M., Niemann, S., Skuce, R., cyclopedia of Environmental Health. 2011, p. 408-17, Kremer, K., Locht, C. and van Soolingen, D. Proposal for Standard- 76. Piersimoni, C., Scarparo, C., Callegaro, A., Tosi, C. P., Nista, ization of Optimized Mycobacterial Interspersed Repetitive Unit-Vari- D., Bornigia, S., Scagnelli, M., Rigon, A., Ruggiero, G. and Goglio, able-Number Tandem Repeat Typing of Mycobacterium tuberculosis. J. A. Comparison of MB/BacT ALERT 3D System with Radiometric Clin. Microbiol.2006, 44 (suppl 12):4498-510. BACTEC System and Lowenstein-Jensen Medium for Recovery and 91. Swanson, D. S., Pan, X.and Musser, J. M. Identification and sub- Identification of Mycobacteria from Clinical Specimens: a Multicenter specific differentiation of Mycobacterium scrofulaceum by automated Study. J. Clin. Microbiol. 2001, 39 (suppl 2):651-7. sequencing of a region of the gene (hsp65) encoding a 65-kilodalton 77. Rafi, A., and Naghily, B. Efficiency of Polymerase Chain Reaction heat shock protein. J. Clin. Microbiol.. 1996, 34 (suppl 12): 3151-9. for the diagnosis of tuberculous meningitis. Med J.Islam. Acad. Sci. 92. Takahashi, T., Tamura, M., Takahashi, S. N., Matsumoto, K., 1998, 11(suppl 4):117-20. Sawada, S., Yokoyama, E., Nakayama, T., Mizutani, T. Takasu, T. and 78. Rebollo, M. J., San Juan Garrido, R., Folgueira, D., Palenque, E., Nagase, H. Quantitative nested real-time PCR assay for assessing the Daz-Pedroche, C., Lumbreras, C. and Aguado, J. M. Blood and urine clinical course of tuberculous meningitis. J. neuro.sci. 2007, 255 (suppl samples as useful sources for the direct detection of tuberculosis by 5):69-76. 1639 F. ZAKHAM et al. / Screening and Diagnosis Techniques of Tuberculosis.

93. Thierry, D., Cave, M. D., Eisenach, K. D., Crawford, J. T. Bates, 102. Varma-Basil, M., Pathak, R., Singh, K., Dwivedi, S., Garima, K., J.H., Gicquel, B. and Guesdon, J. L. IS6110, an IS-like element of My- Kumar, S., Sharma, D., Dhiman, B. and Bose, M. Direct early iden- cobacterium tuberculosis complex. Nucleic. Acids. Res.1990, 18 (suppl tification of Mycobacterium tuberculosis by PCR-restriction fragment 1):188. length polymorphism analysis from clinical samples. Jpn. J. Infect. Dis. 94. Thoen, C., LoBue, P. and de Kantor, I. The importance of Mycobac- 2010, 63 (suppl 1):55-7. terium bovis as a zoonosis. Vet. Microbiol.2006, 112 (suppl 2-4):339- 103. Wang, S., Tay, L.and Sng, L. Rapid identification of pathogenic 45. rapidly growing mycobacteria by PCR-restriction endonuclease analy- 95. Thorne, N., Borrell, S., Evans, J., Magee, J., Garcaa de Viedma, D., sis. Ann Acd Med Singapore. 2005, 34(suppl 1):137-140. Bishop, C., Gonzalez-Martin, J., Gharbia, S. and Arnold, C. IS6110- 104. Warren, R. M., Gey van Pittius, N. C., Barnard, M., Hesseling, based global phylogeny of Mycobacterium tuberculosis. Infect. Genet. A., Engelke, E., de Kock, M., Gutierrez, M. C., Chege, G. K., Victor, Evol.2011, 11 (suppl 1):132-8. T. C., Hoal, E. G.and van Helden, P. D. Differentiation of Mycobacte- 96. Tobler, N. E., Pfunder, M., Herzog, K., Frey, J. E. and Altwegg, M. rium tuberculosis complex by PCR amplification of genomic regions of Rapid detection and species identification of Mycobacterium spp. using difference [Short Communication]. Int. J. Tuberc. Lung Dis. 2006, 10 real-time PCR and DNA-Microarray. J. Microbiol. Methods. 2006, 66 (suppl 7):818-822. (suppl 1):116-24. 105. WHO Report. Global Tuberculosis Control: epidemiology, strat- 97. Tortoli, E., Benedetti, M., Fontanelli, A. and Simonetti, M. T. Eval- egy, financing WHO/ HTM/TB/ 2010, 300. . WHO Report. uation of Automated BACTEC MGIT 960 System for Testing Suscep- 106. WWW.WHO.INT/EMC. Guidelines for speciation within the My- tibility of Mycobacterium tuberculosis to Four Major Antituberculous cobacterium tuberculosis complex. Emerging and other Communicable Drugs: Comparison with the Radiometric BACTEC 460TB Method Diseases, Surveillance and Control. 1996. and the Agar Plate Method of Proportion. J. Clin. Microbiol 2002, 40 107. Yam, W.C., Yuen, K.Y., Kam, S.Y., Yiu, L.S., Chan, K.S., Leung, (suppl 2):607-10. C.C., Tam, C.M. Ho, P.O., Yew, W.W., Seto, W.H.and Ho, P.L. Diag- 98. Tortoli, E., Cichero, P., Piersimoni, C., Simonetti, M. T., Gesu, G. nostic application of genotypic identification of mycobacteria. J. Med. and Nista, D. Use of BACTEC MGIT 960 for Recovery of Mycobac- Microbiol. 2006, 55 (suppl 5):529-36. teria from Clinical Specimens: Multicenter Study. J. Clin. Microbiol. 108. Yam, W. C., Cheng, V. C. C., Hui, W. T., Wang, L. N., Seto, W. 1999, 37(suppl 11):3578-82. H. and Yuen, K. Y. Direct detection of Mycobacterium tuberculosis 99. Tortoli, E., Simonetti, M. T.and Lavinia, F. Evaluation of reformu- in clinical specimens using single-tube biotinylated nested polymerase lated chemiluminescent DNA probe (AccuProbe) for culture identifi- chain reaction-enzyme linked immunoassay (PCR-ELISA). Diagn. Mi- cation of Mycobacterium kansasii. J. Clin. Microbiol.1996, 34 (suppl crobiol. infect. dis.2004, 48 (suppl 4):271-5. 11):2838-40. 109. Yeager, H., Lacy, J. J., Smith, L. and Le Maistre, C. Quantitative 100. van Embden, J. D., Cave, M. D., Crawford, J. T., Dale, J. W., studies of mycobacterial populations in sputum and saliva. Am. Rev. Eisenach, K. D., Gicquel, B., Hermans, P., Martin, C., McAdam, R.and Respir. Dis. 1967, 95:998-1004. Shinnick, T. M. Strain identification of Mycobacterium tuberculosis by 110. Zakham, F., Belayachi, L., Ussery, D., Akrim, M., Benjouad, A., DNA fingerprinting: recommendations for a standardized methodology. El Aouad, R. and Ennaji, M. Mycobacterial species as Case study of J. Clin. Microbiol. 1993, 31(suppl 2):406-9. comparative genome analysis. . Cell. Mol. Biol. 2011, 57:1462-69. 101. van Soolingen, D., Hermans, P. W., de Haas, P. E., Soll, D. R. and 111. Zimmerman, M. R. Pulmonary and osseous tuberculosis in an van Embden, J. D. Occurrence and stability of insertion sequences in Egyptian mummy. Bull. N.Y. Acad. Med. 1977, 55 (suppl 6):604-8. Mycobacterium tuberculosis complex strains: evaluation of an insertion 112. Ziskind, B., and Halioua, B. La tuberculose en ancienne. Rev. sequence-dependent DNA polymorphism as a tool in the epidemiology Mal. Respir. 2007, 24 (suppl 10): 1277-83. of tuberculosis. J. Clin. Microbiol. 1991, 29 (suppl 11):2578-86.

1640 Doctorat Es Sciences in Microbiology & Molecular Biology Materials & Methods 2012

I. Specimens collection Four hundred sixty five pulmonary and extra-pulmonary specimens (from which 40 specimens are within the IMMGEN Academy Hassan II funded Project) were obtained from the centres of diagnosis of tuberculosis and respiratory diseases (CDTMR: Centre de Diagnostic de la Tuberculose et des Maladies Respiratoires) from different cities in Morocco. There samples were sent to the National Reference Laboratory for Tuberculosis (LNRT) at the National Institute of Hygiene (INH) in Rabat for initial TB diagnosis. One hundred thirty tree sputa specimens, which we used for the investigation of MDR-TB were obtained from Pasteur Institutes in Tangier and Casablanca. All the specimens were tested by the conventional techniques, Zheil-Nelseen staining (see appendix 1) and culture on Löwenstein- Jensen solid medium, for the investigation about the presence of the tubercle bacilli in these specimens.

II. Decontamination of specimens for PCR

Decontamination of specimens for hsp65 amplification: Sputum samples were first liquefied, decontaminated by adding 2 ml of NaOH 40g/L (4%). After vortex and incubation at +37°C for 20 min, 18 ml of neutral buffer were added ([3.40 g

KH 2PO 4 + 3.55g Na 2HPO 4]/ L, [pH 6.8]), then the specimens were centrifuged at 3500 g for 20 min, and the supernatant discarded. Finally we added 1ml of the same neutral buffer, the specimens were vortexed and preserved by freezing at -20°C until their utilisation.

Decontamination of specimens for IS6110, rpoB and kat G amplification: N-acetyl-l-cysteine (NALC) method was performed for the rest of specimens for more details see appendix 2.

III. DNA TE boiling extraction For the extraction procedure, the specimen was first thawed and centrifuged at 6,000 g for 1 min. The supernatant was discarded, and the pellet was processed for procedure as follows. A 200 µl aliquot of TE buffer (10 mM Tris-HCl [pH 8.0], 1 mM EDTA) was added, and the mixture was briefly mixed on a vortex mixer. The suspension was placed in a boiling water bath for 15 min to destroy any viable mycobacteria and then centrifuged at 16,000 g for 5 min. A 100 µl aliquot of the supernatant was transferred to a sterile tube and stored at -20°C until PCR testing.

41 Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM

Doctorat Es Sciences in Microbiology & Molecular Biology Materials & Methods 2012

IV. Reaction of PCR The amplification of hsp65 gene A final volume of 100 µl containing the Master-Mix for PCR and mycobacterial DNA was used; the conditions of PCR are summarized in Table1.

Table 1: Master-Mix and the conditions of PCR for hsp65 amplification

Reagent (SM) Final concentration Volume PCR buffer (1X) 1X 10 µl dNTPs (2.5mM each of dATP, dCTP, dGTP, and dTTP) 2.5mM 2µl Primer sens (10 µM) 10 µM 2µl Primer anti-sens (10 µM) 10 µM 2µl H2O 72.6 µl Taq start fast (5U/ µl) 0.4 µl MgCl2 25 mM 6µl Amplicons of PCR 5µl Total 100 µl

PCR was performed for 35 cycles of: 4 min at 94°C 1 min at 94°C 1 min at 64°C 35cycles 2 min at 72°C 10min at 72°C

The amplification of the insertion sequence IS6110: A final volume of 50 µl containing the Master-Mix for PCR and mycobacterial DNA was used; the conditions of PCR are summarized in Table 2.

Table 2: Master-Mix and the conditions of PCR PCR for IS6110 amplification

Reagent (SM) Final concentration Volume PCR buffer (1X) 1X 10 µl dNTPs (2.5mM each of dATP, dCTP, dGTP, and dTTP) 2.5mM 1µl Primer sens (10 µM) 10 µM 1µl Primer anti-sens (10 µM) 10 µM 1µl H2O 28.75 µl Taq start fast (5U/ µl) 0.25 µl MgCl2 25 mM 3µl Amplicons of PCR 5µl Total 50 µl

PCR was performed for 35 cycles of: 10 min at 95°C 1 min at 95°C 1 min at 65°C 35cycles 1 min at 72°C 10min at 72°C

42 Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM

Doctorat Es Sciences in Microbiology & Molecular Biology Materials & Methods 2012

The amplification of the gene rpoB : A final volume of 50 µl containing the Master-Mix for PCR and mycobacterial DNA was used; the conditions of PCR are summarized in Table 3.

Table 3: Master-Mix and the conditions of PCR PCR for rpoB gene amplification Reagent (SM) Final concentration Volume PCR buffer (1X) 1X 5µl dNTPs (2.5mM each of dATP, dCTP, dGTP, and dTTP ) 2.5mM 4µl Primer sens (10 µM) 10 µM 0.25 µl Primer anti-sens (10 µM) 10 µM 0.25 µl H2O 27.1 µl Taq start fast (5U/ µl) 0.4 µl MgCl2 25 mM 1µl Q solution 5X 10 µl Amplicons of PCR 2µl Total 50 µl

PCR was performed for 35 cycles of: 15 min at 94°C 1 min at 94°C 1 min at 58°C 35cycles 1 min at 72°C 10min at 72°C

The amplification of the katG gene: A final volume of 50 µl containing the Master-Mix for PCR and mycobacterial DNA was used; the conditions of PCR are summarized in Table 4.

Table 4: Master-Mix and the conditions of PCR for katG gene amplification Reagent (SM) Final concentration Volume PCR buffer (1X) 1X 5µl dNTPs (2.5mM each of dATP, dCTP, dGTP, and dTTP ) 2.5mM 4µl Primer sens (10 µM) 10 µM 0.25 µl Primer anti-sens (10 µM) 10 µM 0.25 µl H2O 27.1 µl Taq start fast (5U/ µl) 0.4 µl MgCl2 25 mM 1µl Q solution 5X 10 µl Amplicons of PCR 2µl Total 50 µl

PCR was performed for 35 cycles of: 15 min at 95°C 1 min at 94°C 1 min at 62°C 35cycles 1 min at 72°C 10min at 72°C

43 Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM

Doctorat Es Sciences in Microbiology & Molecular Biology Materials & Methods 2012

Primers: The primers used for the realization of each PCR are listed in Table 5.

Table 5: The primers used for the realization of each PCR Gene Size Primer Sequence References hsp65 441 TB 11 ACCAACGATGGTGTG TCCAT (Taylor et al. , TB 12 CTTGTCGAACCGCATACCCT 1997) IS6110 123 IS6110 a CCTGCGAGCGTAGGCGTCGG (Eisenach et IS6110 b CTCGTCCAGCGCCGCITCGG al. , 1990) rpoB 123 TR8 TGCACGTCGCGGACCTCCA (Abdelaal et TR9 TCGCCGCGATCAAGGAGT al. , 2009) katG 419 RTB 59 TGGCCGCGGCGGTCGACATT (Cingolani et RTB 38 GGTCAGTGGCCAGCATCGTC al. , 1999)

V. Visualisation of the PCR products The amplified product was electrophoresed on a 1.5% agarose gel in 1X Tris-borate-EDTA buffer at a pH of 8.6. The gel was stained with ethidium bromide of 10mg/ml (see appendix 3) 2µL in 100mL 1X Tris-borate-EDTA, and the 441-bp amplified band was visualized on an ultraviolet transilluminator to check for DNA amplification.

VI. Purification of the PCR products We have fulfilled the purification to remove the non incorporated d NTPs and primers. For this purpose the ExoSap kit was used. Technical Procedure: - Mix 5 µL of the PCR product with 2 µL of the Exosap reagent. - Incubate at 37°C for 15 min. - Inactivate the Exosap by heating to 80°C for another 15 min (preferably in the thermal cycler)

VII. Sequencing Reaction The method of sequencing employed is the enzymatic method of Sanger. It consists in synthesizing complementary DNA of each strand by extension of the primers while incorporating didesoxynucleotides randomly (ddNTPs). As soon as a didesoxynucleotide is built-in, the synthesis of DNA stops since it does not have grouping hydroxyl in position 3' necessary to form the connection phosphodiester connecting the didesoxynucleotides between them. The ddNTPs being in very weak concentration are incorporated only seldom and randomly. Statistically, of the fragments of DNA of all the sizes are formed, container at their 44 Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM

Doctorat Es Sciences in Microbiology & Molecular Biology Materials & Methods 2012 final 3' end the ddNTPs of stop .We used automatic sequencing by using Big dye terminator kit that uses didesoxynucleotides marked with four fluorochromes of different colours. Each of the two strands of ADN of each gene is sequenced in an independent reaction. The primers used in this reaction are the same ones quoted for the PCR reaction.

Technical Procedure: Big Dye Terminator Kit was used, the conditions of the sequence reaction are mentioned in Table 6. Table 6: Conditions of sequencing reaction Reagent Volume for each reaction (µl) Big Dye Terminaor 1 Primer 0.5 Pure water 6.5 PCR product 2 Total 10

The reaction was performed for 25 cycles of: 1 min at 96°C 10 sec at 96°C 5 sec at 50°C 25cycles 4 min at 60°C

VIII. Purification of the products of the reactions of sequences on the gel of Sephadex Sephadex is a resin of filtration on gel. The fragments of ADN pass on the level filtrate after centrifugation whereas the remainder of the components of the mixture remains on the level of the pores. Technical procedure - Fill the plate Multiscreen MAHVN by the Sephadex resin. - Soak with 300µl the unit with the wells. - Let inflate the resin during 3 hours at room temperature. - Centrifuge the plate with 910xg during 5 minutes all while maintaining it with the top of another plate empties in order to remove the water excess. - Add 20µl of each sequence product on the wells, then centrifuge with 910xg on a plate in which one will recover the purified products.

45 Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM

Doctorat Es Sciences in Microbiology & Molecular Biology Materials & Methods 2012

IX. Automated Detection of the sequences The purified products of the reactions of sequence are denatured by addition of formamide. The samples are then charged on the level with analyzer ABI PRISM 310 (Figure13). The sequencing implies the creation of an electric flux in the negative direction towards positive through capillary polymer (migration in capillary with polymer POP6). The smallest fragments of DNA migrate more quickly than the longer fragments. As each fragment is excited by the laser with ions argon, fluorescence is detected by a camera CCC and is converted into sequence by the software of analysis of sequencing of ADN (ABI PRISM DNA Sequencing Analysis).The sequences are aligned and compared; ambiguities are raised by direct analysis of the profiles of electrophoresis.

X. Analysis of the sequences The correction of the sequences is done manually by alignment of the two sequences and anti- direction. The sequence consensus of the gene hsp 65 is introduced into the data base of the Mycobacterim available on BLAST program to compare the sequences in question with those of other mycobacterial species in GenBank.The analysis of the sequences on the site gives information on the sub-type of Mycobacterium spp. The resulting chromatograms were manually edited to ensure sequence accuracy and added to the alignment component of MEGA software version 4.

46 Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM

Doctorat Es Science in Microbiology & Molecular Biology Results 2012

CHAPTER 1

Molecular Diagnosis of Mycobacterium tuberculosis in the Clinical specimens

Presentation of Paper II & III:

Background:

The early and rapid diagnosis of Mycobacterium tuberculosis (MTB) is crucial for controlling and initiation drug treatment regimen. The laboratory diagnosis of TB is mainly based on the microscopic examination by the Ziehl-Neelsen (ZN) staining but this technique is unable to distinguish between MTB members and other atypical mycobacteria. Moreover, ZN staining can only detect acid-fast bacilli in concentrations exceeding 10,000 organisms per ml. MTB culture, which is the gold standard method, requires viable microorganisms and long time incubation (up to 4 weeks).

Molecular approaches have been introduced into clinical mycobacteriology laboratories. In this field, the most common technique widely used is the DNA amplification by the Polymerase Chain Reaction (PCR) technique. The main objective was to evaluate PCR for amplification of MTB specific insertion sequence IS6110 and the gene hsp65 for the diagnosis of TB, the alignment of hsp65 gene sequences and the identification of MTB

Doctorat Es Science in Microbiology & Molecular Biology Results 2012

complex to the species level. The specificity and sensitivity of the PCR diagnostic techniques were determined and the routine microbiological laboratory testing and molecular diagnosis for detection of MTB were also compared.

Methodology:

The specimens were tested by the direct microscopy examination (ZN method) and bacterial culturing on Lowenstein Jensen (LJ) medium for the investigation about the tubercle bacilli. Immediate PCR was performed on the clinical specimens for the investigation about MTB DNA either by using the hsp65 as a target, followed by automated sequencing of the same gene (paper II) or by targeting the insertion sequence “IS6110" (paper III).

Results & Discussion:

The early diagnosis of MTB is a great challenge, particularly in the paucibacillary specimens. Both of studies showed that culture has a high sensitivity in comparison with the direct examination and this is with an agreement with the worldwide use of MTB culture as a “gold standard” technique. Thus, the sensitivity, specificity, positive and negative predictive values of the PCR techniques were calculated in combination with the culture results.

The results of the in house “IS6110" PCR showed a good sensitivity (92.4%) and high specificity (98.0%), the positive and negative predictive values were 96.4% and 95.3% respectively.

The sensitivity of hsp65 amplification was 81.1%, with specificity of 88.2%; the positive and negative predictive values were 95.6% and 60.0%, respectively. The results of hsp65 amplification were confirmed by automated sequencing for the differentiation between the members of the complex MTB and other non tuberculosis mycobacteria, since it exists in all mycobacteria. In contrast, the insertion sequence “IS6110" is present only in the MTB complex members and thus, could be a very cost efficient potential tool for the rapid detection of MTB.

Conclusion:

The utility of PCR on the clinical specimens demonstrated a great usefulness in the routine analysis for the rapid detection of MTB, especially for critical cases and would be of great interest to help the clinician in the misdiagnosed critical cases by the traditional radiology.

Doctorat Es Science in Microbiology & Molecular Biology Results 2012

Publication II

Original Article

Evaluation of conventional molecular diagnosis of Mycobacterium tuberculosis in clinical specimens from Morocco

Fathiah Zakham 1,2,3 , Halima Bazoui 1, Mohammed Akrim 1, Sanae Lamrabet 1,Ouafae Lahlou 1, Mohamed Elmzibri 4, Abdelaziz Benjouad 3, My Mustapha Ennaji 2+ ,Rajae Elaouad 1+

+ My M. Ennaji and Rajae Elaouad share senior authorship in this study (equal contribution).

1Institut National d’Hygiène, Rabat, Morocco 2Laboratoire de Virologie et Hygiène et Microbiologie, Faculté des Sciences et Techniques. Mohammedia, Morocco 3Laboratoire de Biochimie et Immunologie, Faculté des Sciences. Université Mohammed V-Agdal. Rabat, Morocco 4Unité de Biologie et Recherches Médicales, Centre National de l’Energie, de s Sciences et Techniques Nucléaires, Rabat, Morocco

Abstract Introduction: Tuberculosis is a major public health threat, annually affecting new individuals worldwide, especially those in developing countries. Rapid detection of the agent and effective treatment are two important factors in controlling this disease. Methodology: The present study aimed to evaluate polymerase chain reaction (PCR) as a rapid and direct molecular method for the diagnosis of Mycobacterium tuberculosis (MTB) in 70 clinical specimens (62 sputum samples, six cerebrospinal fluids, and two biopsies) using heat shock protein (hsp65) as the gene target. Automated sequencing of the same gene was used for the identification of MTB to the species level. Results: The sensitivity of PCR was 81.13%, with specificity of 88.24%; the positive and negative predictive values were 95.56% and 60%, respectively. Conclusion: Based on these results, the hsp65 gene sequence can be used to differentiate the members of MTB complex from non- tuberculosis mycobacteria (NTM).

Key words : Mycobacterim tuberculosis ; polymerase chain reaction; PCR; hsp65 target gene; diagnosis

J Infect Dev Ctries 2012; 6(1):40-45.

(Received 16 January 2011 – Accepted 17 May 2011)

Copyright © 2012 Zakham et al . This is an open-access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction The conventional laboratory diagnosis of The World Health Organization (WHO) reports tuberculosis is based on the method of Ziehl-Neelsen that, tuberculosis (TB) remains a major public health acid –fast bacilli stain and culture of MTB [3-5]. The problem as a first-line infectious disease [1]. Ziehl-Neelsen stain is a rapid and cheap method, but It is estimated that one-third of the global it lacks sensitivity. The culture requires time and population is infected with Mycobacterium viable microorganisms, which are difficult to obtain, tuberculosis (MTB) , the causative agent of especially in treated patients. Several rapid methods tuberculosis, and that approximately between 8.9 and for MTB diagnosis, such as DNA probes that require 9.9 million new cases of tuberculosis arise annually sophisticated equipment [6], have been developed. and cause over 1.3 million deaths among HIV- The polymerase chain reaction (PCR) is an negative people and 0.38 million deaths among HIV- alternative method that can amplify a small fragment positive people [1]. of DNA with high specificity for the diagnosis of In Morocco , TB remains a major public health infectious diseases [7]. PCR has recently been used to issue, even though the results of the antituberculosis detect MTB in respiratory samples [8-10] and other program were positive, as demonstrated by the clinical specimens [11-14]. decrease in new cases, and 25,562 cases were In this study, conventional PCR was used as a recorded between 2000 and 2007 [2]. However, rapid and direct molecular method for the detection effective care for MTB-infected individuals requires of MTB in the clinical specimens. For this purpose an effective diagnosis. the hsp65 gene was targeted; because this gene is

Zakham et al. - Molecular diagnosis of MTB in clinical specimens J Infect Dev Ctries 2012; 6(1):40-45. highly conserved among mycobacterial species and PCR for amplification of hsp65 gene present in all mycobacteria, it is more variable than The forward primer Tb11 (5’ the 16S rRNA gene sequence and for this reason it is ACCAACGATGGTGTG TCCAT-3’) and the a potential tool for the identification of genetically reverse primer related species of mycobacteria [15,18]. Tb12 (5’ CTTGTCGAACCGCATACCCT -3’) Automated sequencing of the same gene was were used to amplify a 441-bp portion of the hsp65 used for the identification of MTB to species level. gene [17]. The results were then compared with the results of A final volume of 100 μl of the Master Mix the conventional methods to evaluate the direct PCR (Roche Diagnostic, Manheim, Germany) for the PCR diagnosis of MTB in clinical samples. reaction mixture contained 1× PCR buffer, 25 mm MgCl, 2.5 mM each of deoxynucleoside Methodology triphosphates ( i.e. , deoxyadenosine triphosphate, Sampling deoxycytosine triphosphate, deoxyguanosine A total of 70 (62 sputum samples, six triphosphate, and deoxythymidine triphosphate), 0.5 cerebrospinal fluid samples and two biopsies) mm each, primer Tb11 and primer Tb12, and five specimens were collected and sent to the laboratory units of Taq DNA polymerase enzyme (Roche of Medical Microbiology at the National Institute of Diagnostic, Manheim, Germany). The DNA from the Hygiene (NIH) in Rabat, Morocco. The specimens clinical samples was added, and the volume increased were examined using the Ziehl-Neelsen method; with autoclaved distilled water. Each set of PCR bacterial culturing was performed according to the reactions contained a positive control containing Petroff method, which includes decontamination of DNA from the H37Rv strain of MTB and a negative sputa, then neutralization and inoculation onto control containing the same amount of autoclaved Lowenstein Jensen (LJ) medium [19]. Species water. The thermal cycler (Gene Amp, PCR system identificaiton included a macroscopic analysis of 9700, Applied Biosystems, Foster City, US) was colonies on LJ medium and a microscopic analysis. programmed for 35 cycles with initial denaturation at In addition, complementary niacin, nitrate reductase, 94°C for four minutes. Each cycle was performed and catalase tests at room temperature and at 68°C with denaturation at 94°C for one minute, annealing were performed to confirm the MTB species [19]. at 64°C for one minute with an extension at 72°C for For PCR, sputum samples were first liquefied two minutes. At the end of the last cycle, the mixtures and then decontaminated by adding 2 ml of NaOH were incubated at 72°C for 10 minutes. 40g/L (4%), after which they were vortexed and incubated at 37°C for 20 minutes and 18 ml of neutral Visualisation of the PCR products buffer (3.40 g KH 2PO 4 + 3.55g Na 2HPO 4/ L, [pH The amplified product was submitted to 6.8]) were added. After centrifugation at 3500g for 20 electrophoresis on a 1.5% agarose gel in 1X Tris- minutes, the supernatant was discarded. Finally, 1 ml borate-EDTA buffer at pH of 8.6. The gel was of the same neutral buffer was added and after stained with ethidium bromide of 10 mg/ml 2 μl in shaking, the specimens were stored at -20°C until 100 ml of 1X Tris-borate-EDTA, and the 441-bp testing. amplified band was visualized on an ultraviolet transilluminator to check for DNA amplification. Bacterial lysis MTB bacteria were lysed using the heat shock Sequencing reaction treatment. The specimen was first thawed and Direct sequencing of amplified PCR products centrifuged at 6,000 g for one minute. The supernatant was performed on an ABI PRISM sequencing was discarded and the pellet was resuspended in 200 apparatus (ABPRISM 310 Genetic Analyser, Applied µl of TE buffer (10 mM Tris-HCl [pH 8.0], 1 mM Biosystems) using Big Dye Terminator kit (Applied EDTA). The mixture was then vortexed and placed in Biosystems) that includes didesoxynucleotides a boiling water bath for 15 minutes to inactivate marked with four fluorochromes of different colours. bacteria and release DNA. After centrifugation at For each PCR product, both strands were sequenced, 16,000 g for five minutes, an aliquot of 100 μl of the in independent reactions, using Tb11 or Tb12 supernatant was transferred to a sterile tube and primers. stored at -20°C for PCR testing [20].

41 Zakham et al. - Molecular diagnosis of MTB in clinical specimens J Infect Dev Ctries 2012; 6(1):40-45.

Figure 1. Consensus sequence of the hsp65 gene obtained by MEGA software version 4 1 ATCGGCGCCGAGCTGGTCAAAGAGGTAGCCAAGAAGACCGATGACGTCGCAT CG GC GC CG AG CT GG TC AA AG AG GT AG CC AA GA AG AC CG AT GA CG TC GC 50 51 CGGTGACGGCACCACGACGGCCACCGTGCTGGCCCAGGCGTTGGTTCGCG 100 101 AGGGCCTGCGCAACGTCGCGGCCGGCGCCAACCCGCTCGGTCTCAAACGC 150 151 GGCATCGAAAAGGCCGTGGAGAAGGTCACCGAGACCCTGCTCAAGGGCGC 200 201 CAAGGAGGTCGAGACCAAGGAGCAGATTGCGGCCACCGCAGCGATTTCGG 250 251 CGGGTGACCAGTCCATCGGTGACCTGATCGCCGAGGCGATGGACAAGGTG 300 300 GGCAACGAGGGCGTCATCACCGTCGAGGAGTCCAACACCTTTGGGCTGCA 350 351 GCTCGAGCTCACCGAGGG 368

Analysis of the sequences We may suggest that those results are comparable Data analysis was performed by sequencing to those of the culture method which is accepted as analysis software. The sequence consensus of the the gold standard. gene hsp65 was entered into the database of the Mycobacterim available on the Basic Local Automated partial DNA sequencing of the hsp65 gene Alignment and Research Tool (BLAST) program to and sequence alignment compare the obtained sequences with those of other The PCR products of the hsp65 gene from 10 mycobacterial species in GenBank. The analysis of isolated strains were sequenced. The sequences were the sequences on the site provides information about compared with available DNA sequence databases the sub-type of Mycobacterium spp. using the BLAST program. Results showed that the The resulting electrophoregrams were manually 10 strains present a high percentage of similarities to edited to ensure sequence accuracy and added to the both M. tuberculosis and M. bovis (Table 3). alignment component of MEGA software version 4. The hsp65 gene sequences from the 10 isolates were aligned with the sequence from the MTB H37 Results reference strain (Figure 1) and analysed by MEGA Amplification of mycobacterial DNA software version 4. Results showed high similarity, This study was performed on 70 clinical confirming the BLAST analyses. Those sequences specimens. As shown in Table 1, conventional are available in GenBank at NCBI and their accession analyses, including Ziehl-Neelsen staining and numbers are reported in Table 3. bacterial culture, showed the presence of MTB infection in 53 samples (75.71%). Molecular MTB Discussion infection was based on the presence of a 441 bp band Tuberculosis is a major public health problem, corresponding to the hsp65 gene amplification after annually affecting new individuals, especially in electrophoresis. Using the direct PCR approach, 45 developing countries. According to the last report of specimens, including 44 sputum samples and one the Ministry of Health, tuberculosis remains one of cerebrospinal fluid, were positive (64.29%) (Table 1). the first line of infectious diseases in Morocco, with A comparison of MTB detection in the 70 an incidence of 82.1 new cases per 100,000 specimens using conventional and molecular inhabitants in 2007 [2]. Tuberculosis especially techniques is reported in Table 2. affects young adults and thus has a high impact on Concordance of results was found in 58 clinical the socio-economic status of the country. In fact, specimens: 43 were specimens MTB positive and 15 65.9% of total TB cases are between 15 and 45 years were MTB negative. A total of 10 samples were of age, with a significant male predilection (59.3%). positive in culture and negative in PCR. The two Worldwide, the main problems in TB samples that were positive by PCR and negative in management remain the early diagnosis of MTB and culture were subject to further analyses for drug-resistance testing. Rapid diagnosis and confirmation. Sequence analysis of the two strains appropriate chemotherapy become the first priorities showed that both were affiliated with the MTB and a serious challenge in the improvement of TB complex, and thus considered true positives. PCR treatment and the reduction of the dissemination of technique had good sensitivity (81.13%) and good MTB strains. Currently, TB screening is done by specificity (88.24%) with the positive and negative conventional techniques, including the method of predictive values of 95.56 % and 60%, respectively. Ziehl-Neelsen staining and MTB culture.

42 Zakham et al. - Molecular diagnosis of MTB in clinical specimens J Infect Dev Ctries 2012; 6(1):40-45.

Table 1. Detection of MTB by direct examination (ZN staining), culture, and PCR in different kinds of specimens TyTypepe of Total number of ZN stainingstainin g Culture PCR specimspecimenen specimenspecimenss PoPositivesiti ve NeNegativega ti ve PoPositivesiti ve NeNegativega ti ve PoPositivesiti ve NeNegativega ti ve Sputum 62 52 10 52 10 44 18 Biopsy 2 Nil 2 Nil 2 Nil 2 Cerebrospinal 6 1 5 1 5 1 5 fluid MTB: Mycobacterium tuberculosis , PCR: Polymerase Chain Reaction

Table 2. Comparison of MTB detection by conventional and molecular techniques

Conventional techntechniqueiq ue ((culture)cultur e) ToTotalta l Techniques of detection of MTB Positive Negative Molecular technique Positive 43 2 45

(Direct PCR) Negative 10 15 25

Total 53 17 70 MTB: Mycobacterium tuberculosis , PCR: Polymerase Chain Reaction

Table 3. The BLAST results of identification of 10 PCR products by automated sequencing of the gene hsp65. Bacterial Sequenced NCBI GenBank Percentage of similarity strains product Accession number to M. Tuberculosis to M. bovis Strain 1 408 JF921162 99% 99%

Strain 2 378 JF921154 99% 99%

Strain 3 397 JF921155 99% 99%

Strain 4 381 JF921153 100% 100%

Strain 5 369 JF921156 99% 99%

Strain 6 377 JF921160 98% 98%

Strain 7 381 JF921157 99% 99%

Strain 8 399 JF921158 100% 100%

Strain 9 310 JF921159 99% 99%

Strain 10 376 JF921161 99% 99%

BLAST : Basic Local Alignment and Research Tool, PCR: Polymerase Chain Reaction gene hsp65 : gene of heat shock protein 65, NCBI: National Center for Biotechnology Information

43 Zakham et al. - Molecular diagnosis of MTB in clinical specimens J Infect Dev Ctries 2012; 6(1):40-45.

Unfortunately, the Ziehl-Neelsen staining lacks The molecular approach based on amplification sensitivity, and bacteria culture is time-consuming of MTB DNA by PCR in clinical specimens is a [6]. There is a clear need to implement reliable valuable screening method, especially when the molecular techniques for the detection of all forms of limitations of the conventional techniques have a TB strains to improve the management of TB. high impact on the patient health; for example, when Molecular techniques are rapid and prevent crucial there is potential for disease relapse or therapeutic delays. In the last decade, advances in molecular failure and in HIV-seropositive patients. biology have made it possible to use rapid and The target gene hsp65 is present in all specific techniques to detect MTB DNA in samples. mycobacteria. It is more variable than the 16S rRNA The current study was planned to evaluate the use of gene and is the most conserved gene among the the PCR technique to detect MTB DNA directly from mycobacterial species. In this study, sequence clinical specimens. analyses showed that DNA extracted from clinical It is widely accepted that PCR is a new and rapid specimens are related to the MTB complex. technique for the diagnosis of bacterial DNA with Moreover, hsp65 gene sequencing is a potential tool high specificity, even in patients who have undergone for differentiating between mycobacteria at the antibiotic treatment because the DNA is still species level, even in the genetically related species, detectable in the absence of a viable microorganism based on PRA and DNA sequencing studies [15-18]. [7]. Therefore, the hsp65 gene could be used for differentiating between the MTB complex and other The sensitivity of PCR is largely dependent on the non-tuberculosis mycobacteria. efficiency of the DNA extraction procedure [21]. The results of this study demonstrate that all the Successful amplification of mycobacterial DNA sequenced products share the consensus sequence, targets is a challenge when biological specimens such and that there is a high similarity between them with as sputum contain several inhibitors of the PCR the species M. tuberculosis and M. bovis, which reaction. In this study, the PCR technique was belong to the MTB complex and share the same evaluated for the detection of limited mycobacteria ancestor in their evolutionary events as previously cells, from clinical specimens, by using the target reported [27,28]. gene hsp65. Among the 70 tested cases, 45 strains These results suggest that the automated were detected by PCR, providing good sensitivity and sequencing of the hsp 65 gene PCR product is one of specificity, as compared to the conventional the most reliable techniques for confirming the technique. The specificity (88.24%) and sensitivity laboratory diagnosis of MTB complex. It could be a (81.13%) of the detection of MTB from clinical potential tool in differentiating between the members specimens by PCR are in concordance with the of MTBc from other non-tuberculosis mycobacteria overall specificity and sensitivity of the PCR [16,18]. However, discrimination between members technique as reported by Zamirian et al. [14]. of MTB complex, especially between MTB and M. Moreover, the sensitivity of the detection of MTB by bovis , must combine hsp65 and pncA gene PCR from clinical specimens was reported to range sequencing [29]. between 55% and 90% [3]. Furthermore, many In conclusion, a molecular approach, based on studies, using different commercial amplification the amplification of hsp65 gene by PCR, is a reliable systems to detect the mycobacterial DNA, have used and rapid method that could be used to detect MTB cultured bacteria as the gold standard [22-24]. strains in clinical specimens. We were not able to cultivate two strains which were PCR positive, and this may possibly be related Acknowledgments to improper decontamination procedures or inhibition The authors thank H. Eloudiyi, M. Melloul, M. Terta and the staff of the Department of Medical Microbiology in the Institute of of growth due to antimicrobial treatment. Hygiene in Rabat, Morocco. The main limitations of the PCR technique are the false-negative results (10 strains in this study), References which can be attributed to either the paucibacillary 1. WHO Report (2010) Global Tuberculosis Control: nature of the specimen, the inefficient extraction of epidemiology, strategy, financing. WHO/HTM/TB/2010. 300. www.who.int/tb/publications/global-report/2010. the DNA, or the presence of PCR inhibitors. The 2. DELM « Direction de l’épidémiologie et de lutte contre les presence of PCR inhibitors has been reported in maladies » (2007) Epidemiologic bulletin. Kingdom of sputum, pus samples and tissue biopsies [25,26]. Morocco. Ministry of Health N°:69-70-71-72. P: 32-33.

44 Zakham et al. - Molecular diagnosis of MTB in clinical specimens J Infect Dev Ctries 2012; 6(1):40-45.

3. Brooks, GF, Butel, JS, and Morse, SA (1998) Jawetz, Polymorphism Analysis for Identification of Mycobacteria Melnick, Adelberg‘s Medical Microbiology. In Brooks GF, Growing in Liquid Media. J Clin Microbiol 35: 79-85. Butel JS and Morse SA, editors. Mycobacteria. 21st edition, 18. Ringuet H, Akoua-Koffi C, Honore S, Varnrot A, Vincent United States of America : Lange Press. 279-283. V, Berche P, Gaillard JL, and Pierre AC (1999) Hsp65 4. Gupte, S (1999) Short Textbook of medical microbiology, In Sequencing for Identification of Rapidly Growing Gupte, S, editor. Mycobacteria. 7th edition. New Delhi: Mycobacteria. J Clin Microbiol 37: 852-857. Jaypee Press, 264-283. 19. David H, Levy Frebault V, Thorel MF (1987). Methodes de 5. Cheesbrough, M (2000) District laboratory practice in Laboratoire pour Mycobactériologie Clinique. Unité de tropical countries. In Cheesbrough, M, editor. tuberculose et des mycobacteries, Institut Pasteur Paris: Mycobacterium tuberculosis. 2 nd part. Cambridge: Institut Pasteur Press 87 p. Cambridge University Press. 207-211. 20. Aldous WK, Pounder JI, Cloud JL, Woods GL (2005) 6. Nagesh BS, Sehgal S, Jindal SK, and Arora, SK (2001) Comparison of Six Methods of Extracting M. tuberculosis Evaluation of Polymerase Chain Reaction for Detection of DNA from Processed Sputum for Testing by Quantitative M. tuberculosis in Pleural Fluid. Chest 119: 1737-1741. Real-Time PCR. J Clin Microbiol 43: 2471-2473. 7. Rebollo MJ, Garrido RS, Folgueir D, Palenque E, 21. Amita J, Vandana T, Guleria RS, Verma RK (2002) Lumbreras C, Aguado JM (2006) Blood and urine samples Qualitative Evaluation of Mycobacterial DNA Extraction as useful sources for the direct detection of tuberculosis by Protocols for Polymerase Chain Reaction. Molecular polymerase chain reaction. Diagn Microbiol Infect Dis 56: Biology Today 3: 43-50. 141-146. 22. Carpentier E, Droullard B, Dailloux M, Moinard D, Vallee 8. Jonas V, Alden MJ, Curry JI, Kamisango K, Knot CA, E, Dutilh B, Maugen J, Bergogne E, Caronnelle B (1995) Lankford R, Wolfe JM, and Moore DF (1993) Detection and Diagnosis of Tuberculosis by Amplicor M. tuberculosis Identification of M. tuberculosis Directly from Sputum Test: a Multicenter Study. J Clin Microbiol 33: 3106-3110. Sediments by Amplification of rRNA. J Clin Microbiol 31: 23. Piersimoni C, Callegaro A, Nista D, Bornigia S, De Conti F, 2410-2416. Santini G, De Sio G (1997) Comparative Evaluation of Two 9. Kim K, Lee H, Lee MK, Lee SA, Shim TS, Lim SY, Koh Commercial Amplification Assays for Direct Detection of WJ, Yim JJ, Munkhtsetseg B, Kim W, Chung SI, Kook YH, M. tuberculosis Complex in Respiratory Specimens. J Clin Kim BJ (2010) Development and application of multiprobe Microbiol 35: 193-196. real-time PCR method targeting the hsp 65 gene for 24. Scarparo C, Piccoli P, Rigon A, Ruggiero G, Scangelli M, differentiation of Mycobacterium species from isolates and Piersimoni C (2000) Comparison of Enhanced M. sputum specimens. J Clin Microbiol 48: 3073-3080. tuberculosis Amplified Direct Test with COBAS 10. Soo PC, Horng YT , Hsueh PR, Shen BJ, Wang JY, Tu HH, AMPLICOR Mycobacterium tuberculosis Assay for Direct Wei JR, Hsieh SC , Huang CC, Lai HC (2006) Direct and Detection of M. tuberculosis Complex in Respiratory and Simultaneous Identification of M. tuberculosis complex Extrapulmonary Specimens. J Clin Microbiol 38: 1559- (MTBc) and M. tuberculosis (MTB) by Rapid Multiplex 1562. nested PCR-ICT assay. J Microbiol Methods 66: 440-448. 25. Amicosante M, Richeldi L, Trenti G, Paone G, Campa M, 11. Yam WC, Cheng VC., Hui WT, Wang LN, Seto WH, Yuen Bisetti A, Saltini C (1995) Inactivation of polymerase KY (2004) Direct detection of M. tuberculosis in clinical inhibitors for M. tuberculosis DNA amplification in sputum specimens using single-tube biotinylated nested polymerase by using capture resin. J Clin Microbiol 33: 629-630. chain reaction-enzyme linked immunoassay (PCR-ELISA). 26. Kesarwani RC, Pandey A, Misra A, Singh AK (2004) Diagn Microbiol Infect 48: 271-275. Polymerase chain reaction (PCR): Its comparison with 12. Restrepo BI, Gomez I, Shipley G, McCormick JB, Fisher- conventional techniques for diagnosis of extra-pulmonary Hoch SP (2006) Selective enrichment and detection of tubercular diseases. Indian Journal of Surgery 66: 84-88. mycobacterial DNA in paucibacillary specimens. J 27. Zakham F, Belayachi L, Ussery D, Akrim M, Benjouad A, Microbiol Methods 67: 220-229. El Aouad R, Ennaji M (2011) Mycobacterial species as 13. Takahashi T, Tamura M, Takahashi SN, Matsumoto K, Case study of comparative genome analysis. Cell. Mol. Biol. Sawada S, Yokoyama, E, Nakayama T, Mizutani T, Takasu 57: 1462-1469. T, Nagase H (2007) Quantitative nested real-time PCR 28. Cole, ST, Comparative and functional genomics of the M. assay for assessing the clinical course of tuberculous tuberculosis complex. Microbiology. 148: 2919-2928. meningitis. J Neuro Sci 255: 69-76. 29. Bannalikar AS and Verma R (2006) Detection of 14. Zamirian M, Mokhtarian M, Motazedian MH, Monabati A, Mycobacterium avium & M. tuberculosis from human Rezaian GR (2007) Constrictive pericarditis: Detection of sputum cultures by PCR-RFLP analysis of hsp65 gene & M. tuberculosis in paraffin-embedded pericardial tissues by pncA PCR. Indian J Med Res 123: 165-172. polymerase chain reaction. Clin Biochem 40: 355-358. 15. Telenti A, Marchesi F, Balz M, Bally F, Bottger E, Bodmer Corresponding author T (1993) Rapid identification of mycobacteria to the species My Mustapha Ennaji level by polymerase chain reaction and restriction enzyme University Hassan II, Mohammedia analysis. J Clin Microbiol 31: 175-178. Casablanca Faculty of Science and Technology Laboratory of Virology 16. Douglas S, Swanson D, Pan XI , Musser JM (1996) Hygiene and Microbiology Identification and Subspecific Differentiation of M. BP 146, 20650, Morocco scrofulaceum by Automated Sequencing of a Region of the Telephone: +212 6 62 01 37 72 / +212 6 61 74 88 62 Fax: +212 5 23 31 53 53 Gene (hsp65) Encoding a 65-Kilodalton Heat Shock Protein. Email: [email protected] J Clin Microbiol 34: 3151-3159. 17. Taylor TB, Patterson C, Hale Y, and, Safranek WW (1997) Conflict of interests: No conflict of interests is declared. Routine Use of PCR-Restriction Fragment Length

45 Doctorat Es Science in Microbiology & Molecular Biology Results 2012

Publication III

MEDITERRANEAN JOURNAL OF HEMATOLOGY AND INFECTIOUS DISEASES www.mjhid.org ISSN 2035-3006

Original Articles

Comparison of a DNA Based PCR Approach with Conventional Methods for the Detection of Mycobacterium tuberculosis in Morocco

Fathiah Zakham1,2,3, Oufae Lahlou1, Mohammed Akrim1, Nada Bouklata1, Sanae Jaouhari1, Khalid Sadki1, 3, Fouad Seghrouchni1, Mohammed Elmzibri4, Abdelaziz Benjouad3, My Mustapha Ennaji2*+ And Rajae Elaouad1+.

1 Institut National d’Hygiène, Rabat, Morocco. 2 Laboratoire de Virologie et Hygiène & Microbiologie, Faculté des Sciences et Techniques. Mohammedia, Morocco. 3 Laboratoire de Biochimie et Immunologie, Faculté des Sciences. Université Mohammed V-Agdal. Rabat. Morocco. 4 Unité de Biologie et Recherches Médicales, Centre National de l’Energie, des Sciences et Techniques Nucléaires- Rabat- Morocco.

+ My M. ENNAJI and R. ELAOUAD share senior authorship in this study (equal contribution).

Correspondence to: Pr. My Mustapha Ennaji, University Hassan II. Mohammedia-Casablanca. Faculty of Sciences and Techniques, Mohammedia-Casablanca. Laboratory of Virology, Hygiene & Microbiology, BP 146, Mohammedia, (20650), Morocco. Tel: +212661748862/ 212662013772, Fax: 212523315353. E-mail: [email protected]

Competing interests: The authors have declared that no competing interests exist.

Published: August 9, 2012 Received: April 30, 2012 Accepted: July 9, 2012 Mediterr J Hematol Infect Dis 2012, 4(1): e2012049, DOI: 10.4084/MJHID.2012.049 This article is available from: http://www.mjhid.org/article/view/10420 This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract. Background: Worldwide, tuberculosis (TB) is a major public health problem and the rapid diagnosis and appropriate chemotherapy become the first priority and a serious challenge to improve TB treatment. In the objective of early TB diagnosis and rapid detection of Mycobacterium tuberculosis (MTB) in the clinical specimens, the utility of the Polymerase Chain Reaction (PCR) using the Insertion Sequence 6110 “IS6110" as target was compared to conventional methods. Methods: Out of 305 patients with different clinical manifestations: suspected, new, drug relapse, drug failure and chronic cases were enrolled in this study and tested by mycobacteriological and PCR techniques for the investigation about the tubercle bacilli. Results: The results of the in house “IS6110" PCR showed a good sensitivity (92.4%) and high specificity (98.0%), the positive and negative predictive values were 96.4 % and 95.3 % respectively. Conclusion: This study showed clearly that the PCR testing using the “IS6110" in the routine analysis is a potential tool for the rapid TB diagnosis, especially for critical cases and would be of great interest to help the clinician in the misdiagnosed critical cases by the traditional radiology.

Mediterr J Hematol Infect Dis 2012; 4; Open Journal System Key words: Tuberculosis, Mycobacterium tuberculosis, PCR, IS6110.

Introduction. Mycobacterium tuberculosis (MTB) is Consequently, “IS6110" sequence is a useful and the causative agent of Tuberculosis (TB), which is reliable tool for the diagnosis of mycobacterial strains responsible for 8 to 10 million new cases of TB and 2 in clinical specimens.20-22 Thus, this study was planned million deaths annually.1 In Morocco, TB is a major to evaluate the use of PCR for “IS6110" sequence problem of the public health with a high incidence amplification for rapid diagnosis of MTB in clinical reaching 82.1 new cases for 100 000 inhabitants.2 samples to improve the TB management in Morocco. Tuberculosis affects especially young adults and therefore has a high impact on the socio-economic Materials and Methods. status of the country. Sampling. A total of 305 specimens were collected The early and rapid diagnosis of MTB is very from different hospitals in and around Rabat city and important for controlling and initiation drug treatment sent to the National laboratory of Reference in regimen. The laboratory diagnosis of TB is mainly Tuberculosis (LNRT) at the National Institute of based on the microscopic examination by the Ziehl- Hygiene in Rabat for MTB detection from February Neelsen staining and MTB culture, which are widely 2010 to May 2011. used in the laboratories of public health centres for the Patients have been classified to five groups routine analysis.3,4 Ziehl-Neelsen staining is a cheap according to their clinical manifestations: suspected, technique and easy to perform but lacks sensitivity and new, treatment failure, treatment relapse and chronic is unable to distinguish between MTB members and TB cases depending on the symptoms and radiological other atypical mycobacteria. Moreover, Ziehl-Neelsen examination. The suspected cases were sent to LNRT staining can only detect acid-fast bacilli in for an initial assessment of TB. The new cases were concentrations exceeding 10,000 organisms per ml.5 sent to confirm the infection with MTB, without MTB culture is the gold standard method but it requires undergoing to any drug treatment regimen. viable microorganisms and long time incubation (up to Patients suffering of drug failure or relapse and 4 weeks), representing a problem especially for chronic cases don’t show any improvement in their patients with critical situations such as health even with treatment after six months and they immunocompromised or AIDS patients. are still having TB profile in their radiological To overcome these limitations, molecular examination. approaches have been introduced into clinical Most of the specimens were pulmonary (sputum, mycobacteriology laboratories. In this field, the most sputum induced by fibre-optic bronchoscopy, bronchial common technique used is the DNA amplification by wash and bronchial aspirations), and some of them the Polymerase Chain Reaction (PCR). The were extrapulmonary (pleural fluid, abscess, urine and opportunity to use PCR for the detection of MTB in gastric liquid). clinical samples has been reported.7-9 Many MTB DNA All the pulmonary specimens were decontaminated sequences; including 16S rDNA and hsp65 genes and and liquefied with N-acetyl-l-cysteine (NALC) “IS6110" are used as targets for MTB detection by method,23 the biopsy was minced, homogenized in a PCR.10-12 sterile homogenizer and concentrated. The rest of The insertion sequence “IS6110" is a transposable specimens were concentrated by centrifugation as element which is present in the members of MTB mentioned by Ben Kahla et al,24 the inoculation was complex in multiple copies (up to 25 copies), except M. performed on Lowenstein Jensen (L/J). A part of each bovis BCG which harbours a single copy and absent in decontaminated specimen was sent to the Molecular other mycobacteria.13,14 For those reasons the insertion biology laboratory for MTB detection by PCR. sequence “IS6110” has been reported as the most common target used for the MTB diagnosis in the Bacterial lysis. Bacterial lysis was performed as clinical samples and demonstrated that the detection described by Aldous, et al.25 Briefly, the specimen was rate of MTB complex targeting “IS6110” was higher first thawed and centrifuged at 6,000 g for 1 min. The than that of microscopy or MTB culturing with a supernatant was discarded and the pellet was considerable time.7,12,15,16 Furthermore, due to its high resuspended in 200 µl of TE buffer and processed in numerical and positional polymorphism, “IS6110" boiling water bath for 15 min to inactivate bacteria and sequence has become a widely used marker in the release DNA. After centrifugation at 16,000 g for 5 epidemiological studies17,18 and the fingerprinting of min, aliquot of 100 μl of the supernatant was this transposable element has been used for the strain transferred to a sterile tube. DNA was immediately identification19 and phylogenetic analysis.14 used for PCR amplification or stored at -20°C until use.

Mediterr J Hematol Infect Dis 2012; 4; Open Journal System bromide (10 mg/ml). PCR for amplification of the insertion sequence IS 6110. The primers 5'- Statistical analysis. Specificity, sensitivity, positive CCTGCGAGCGTAGGCGTCGG-3' and 5'- and negative predictive values were calculated were CTCGTCCAGCGCCGCITCGG-3', were used to calculated in combination with the bacterial culture, as amplify a 123-base-pair fragment as described by a gold standard technique.26 For testing the agreement Eisenach, et al.20 The amplification reaction was between culture and molecular approach, the kappa performed in a total volume of 50 µl of the index was applied.27 amplification mixture contained 0.2 µM of each primer, 0.2 mM of each dNTPs, 2.5 mM MgCl, 5 Units Results. A total of 305 specimens were enrolled in this of Taq DNA polymerase enzyme (Roche diagnostic, study. The demographical and epidemiological GmbH,Manheim, Germany) and 3 µl of DNA sample information about the patients were assessed by a in 1x Taq polymerase buffer. questionnaire regarding (range of age, age median, PCR reactions were performed in thermal cycler percentage of each sex and sex ratio) are summarized (Gene Amp, PCR system 9700, Applied Bio system). in Table 1 and showed that the age medians of the The mixture was first denatured at 95°C for 10 min. different groups were forties with a significant male Then, 40 cycles of PCR were performed with predilection. The results of mycobacteriological denaturation at 95°C for 1 min, primer annealing for 1 examination and PCR testing according to their clinical min at 68°C and primer extension for 1 min at 72°C. At manifestation are also outlined in Table 1. Among the end of the last cycle, the mixture was incubated at the305 specimens, positive results were obtained in 75, 72°C for 10 min. For every reaction a negative control, 116 and 111 cases by direct examination, culture and in which DNA template was omitted from the PCR respectively. amplification mixture, and a positive control, The results showed that culture is more sensitive containing DNA from H37Rv MTB strain are included. than the direct examination in detection of MTB in all PCR products were analysed by electrophoresis on 2% groups of cases. Furthermore, the results of agarose gels followed by staining with ethidium conventional examination and Molecular testing Table 1. The demographical, epidemiological information about the patients and the results of conventional and molecular techniques. Group of Number Range Age Sex % Sex ZN Staining Culture PCR patients of cases of age median Male Femaleratio Positive Negative Positive Negative Positive Negative Suspected 30 [15-80] 48 56.66 43.33 1.30 0 30 0 30 0 30 cases of TB New cases 188 [15-84] 40 63.29 36.70 1.72 50 138 80 108 77 111 Treatment Failure 30 [21-80] 42 83.33 16.66 5.00 4 26 9 21 8 22 cases Treatment relapse 41 [19-70] 43 63.41 36.58 1.73 16 25 21 20 21 20 cases Chronic 16 [20-59] 41 62.50 37.50 1.66 5 11 6 10 5 11 cases Total of 305 [15-84] 75 230 116 189 111 194 Cases

Table 2. The results of conventional examination and PCR according to the kind of specimen. Kind of specimen Total ZN staining Culture PCR Number Positive Negative Positive Negative Positive Negative Pulmonary specimens Sputum 274 70 204 110 164 107 167 BAL 3 - 3 1 2 1 2 Bronchic Aspiration 2 - 2 1 1 1 1 Sputum induced by Fibroscopy 1 - 1 - 1 - 1 Extrapulmonary specimens LP 21 - 21 4 17 2 19 Biopsy 1 - 1 - 1 - 1 Abscess 1 - 1 - 1 - 1 Urine 1 - 1 - 1 - 1 Gastric liquid 1 - 1 - 1 - 1

Mediterr J Hematol Infect Dis 2012; 4: Open Journal System Table 3. Comparison of MTB detection by the direct microscopy Table 4. Comparison of MTB detection by culture and molecular smear and molecular techniques. techniques. Conventional technique Conventional technique Techniques of detection (culture) Total Total Techniques of detection (Direct Examination) of MTB of MTB Positive Negative Positive Negative Molecular Positive 107 4 111 technique Molecular Positive 68 43 111 Negative 9 185 194 technique (Direct (Direct PCR) PCR) Negative 7 187 194 Total 116 189 305 Total 75 230 305 challenge, particularly in the paucibacillary specimens such smear negative sputum, biopsies, pus and body according to the kind of specimens are summarized in fluids.28 Classical radiography still the first step of Table 2. diagnosis after the suspicion of TB by the clinical Comparison of results obtained by direct examination manifestation, but it is not specific for the detection of with the molecular approach is reported in Table 3 and MTB, and merely the identification of the showed a significant difference. In fact, for 43 smear microorganism in the specimens can confirm the negative cases, the presence of MTB DNA was diagnosis.4 Most of people in critical cases are usually revealed by PCR. elder, aged between 48 to 80 years and probably Seven smear positive with low number of seen acid suffering from other underlying diseases rather than TB fast bacilli AFB were negative by PCR approach. and can show atypical clinical presentation of TB.3 Moreover, among the 305 specimens, 187 were Furthermore, it was unexpected to misdiagnose a lot of negative by Ziehl Nielsen and PCR, and 68 were cases as chronic, drug relapse or drug failure according positive by direct examination and confirmed by PCR to their clinical history. testing. Currently, the laboratory diagnosis of TB is based Comparison of MTB detection in the 305 specimens on the conventional techniques, including the method by both culture and PCR is reported in Table 4. Similar of Ziehl-Neelsen staining which lacks sensitivity and results were obtained for 292 clinical specimens. A MTB culture that is time consuming.5,6 In this study, total of 107 cases were positive by both MTB culture the MTB culture provided high sensitivity in and PCR testing, and 185 cases were MTB negative by comparison with the direct examination, 116 in culture culture and confirmed by PCR. However, discordance versus 75 with smear microscopy. These results are in was obtained for 13 cases. A total of 9 samples were agreement with the worldwide use of MTB culture as a positive in culture and negative in PCR. Four samples “gold standard” technique.3 were positive by PCR and negative in culture; with The implementation of reliable and rapid molecular strong sever symptoms of clinical manifestations of TB techniques for the detection of TB strains is likely to be as reported in the clinical data. Among these 4 samples, necessary to improve health surveillance of TB. two were positive in the direct microscopic Therefore, this study was done to evaluate the utility of examination but in low numbers of acid fast bacilli the molecular approach based on PCR testing to detect (AFB). MTB DNA directly from clinical specimens. Many Depending on these results, specificity and studies have evaluated the detection of limited sensitivity of the direct PCR compared to the culture as mycobacteria cells, from clinical specimens, by PCR “gold standard” were calculated of the 305 clinical technique targeting different sequences such as 16S samples. Therefore, the PCR technique has a good rDNA and hsp65 genes, and “IS6110". The 16S rDNA sensitivity (92.6 %) and high specificity (98.0 %). The gene is one of the most used genes for this purpose,10 positive and negative predictive values were 96.4 % but its utilisation is limited by the need of PCR product and 95.3 % respectively. sequencing. Moreover, PCR targeting 16S rDNA gene Moreover, the statistical test for the accordance can not differentiate between the closely related species between PCR and culture was expressed by kappa of mycobacteria.10 The hsp65 was also reported to be index with an excellent agreement of 0.9088. used as a target for PCR testing to detect MTB DNA in clinical cases, but the necessity of sequencing is still Discussion. The diagnosis of tuberculosis poses a mandatory for the differentiation between the complex major problem and a serious challenge, especially in MTB and other non tuberculosis mycobacteria.11,29 countries with limited resource, including Morocco. The insertion sequence “IS6110" which exists only On the international scale, the TB management remains in MTB complex members, is the most used target for a nightmare and the early diagnosis of MTB and drug the mycobacterial DNA amplification7,12,20 and is the resistance testing confront a great defy and a high standard marker for the epidemiologic studies of TB.

Mediterr J Hematol Infect Dis 2012; 4: Open Journal System Moreover, the “IS6110" is a potential tool to a clear evidence of the utility of PCR testing to differentiate between the members of MTB complex enhance direct detection of MTB. and other non tuberculosis and atypical The comparison of PCR testing to the “Gold mycobacteria.18,21,30 In this context, it is noteworthy to standard” technique gives a high sensitivity (98%) and mention that the IS1081 has also been used for the good specificity (92.6 %) and the agreement between detection of MTB complex in the paucibacillary PCR and culture was 0.9088, which is an excellent specimens.31 value. The specificity and sensitivity of detection of The results obtained in each group of patients MTB from clinical specimens by PCR are in according to their TB profile do not show a significant concordance with the results obtained in Tunisia using difference between culture and PCR. In fact, TB profile the same insertion sequence24 and with other studies depends especially on the virulence of the bacteria and that also documented the use of the “IS6110" for the the immunity of the patient, and could be a direct diagnosis of TB with reliable results comparing consequence of drug failure or abandon of treatment. to traditional techniques.15,16 The false-negative results But, bacterial culture and PCR testing rest on the (9 specimens were positive in culture and negative in presence of viable cells and bacterial DNA PCR) can be ascribed either to the paucibacillary respectively. nature of the specimen, inefficient extraction of the The corner stone of this study is the rapid detection DNA or the presence of PCR inhibitors.28 of MTB in the clinical specimens by molecular Moreover some of these strains could lack the approach among critical MTB cases. Thus, Among the insertion sequence “IS6110" as reported by El 305 tested cases, 107 strains were detected by PCR Baghdadi et al. in some strains isolated in Morocco.33 with high positive and negative predictive values. Thus, the use of PCR targeting the insertion When comparing the results obtained by PCR with the sequence “IS6110" in the routine analysis for the direct microscopic examination, a wide gap was found detection of MTB, will be of great interest for the (75 detected by the direct examination versus 111 diagnosis of TB, especially in the critical cases, such as positive by PCR). The 7 positive smears and negative chronic and treatment failure or relapse cases, where by PCR were recorded with low numbers of AFB and the rapid diagnosis is mandatory for the initiation of were also negative by culture. Indeed, the culture chemotherapy. Furthermore, for most accuracy it could requires viable microorganisms and this is a huge be better to make a combination between clinical, problem especially in people under chemotherapy. radiological, bacteriological and PCR testing to Moreover, it’s widely accepted that the detection limit confirm the presence of the MTB for a better of PCR is generally 10 mycobacterial genome copies; management of TB in Morocco. the sputum samples with a score of AFB 1+ may contain smaller amounts of required DNA to be Acknowledgments. This study has been partially amplified.32 On the other hand, MTB DNA from 43 funded by the Academie Hassan II des Sciences & specimens smear negative was detected by PCR, giving Techniques in Morocco.

References:

1. WHO R: Global Tuberculosis Control: epidemiology, strategy, Quantitative nested real-time PCR assay for assessing the clinical financing WHO/ HTM/TB/ 2010. 300. WHO Report 2010. course of tuberculous meningitis. Journal of the neurological 2. «Direction de l’épidémiologie et de lutte contre les maladies» sciences 2007, 255:69-76. DELM: Tuberculosis in Morocco. In Epidemiologic bulletin, vol. http://dx.doi.org/10.1016/j.jns.2007.01.071 PMid:17350048 N°:69-70-71-72. pp. 32-33; 2007:32-33. 8. Rebollo MaJ, San Juan Garrido R, Folgueira D, Palenque E, DÃaz- 3. Lange C, Mori T: Advances in the diagnosis of tuberculosis. . Pedroche C, Lumbreras C, Aguado JM: Blood and urine samples Respirology 2010, 15:220–240. http://dx.doi.org/10.1111/j.1440- as useful sources for the direct detection of tuberculosis by 1843.2009.01692.x PMid:20199641 polymerase chain reaction. Diagnostic microbiology and infectious 4. Davies PDO, Pai M: The diagnosis and misdiagnosis of disease 2006, 56:141-146. tuberculosis [State of the art series. Tuberculosis. Edited by I. D. http://dx.doi.org/10.1016/j.diagmicrobio.2006.03.018 Rusen. Number 1 in the series]. The International Journal of PMid:16698218 Tuberculosis and Lung Disease 2008, 12:1226-1234. 9. Yam WC, Cheng VCC, Hui WT, Wang LN, Seto WH, Yuen KY: PMid:18926032 Direct detection of Mycobacterium tuberculosis in clinical 5. Yeager H, Lacy JJ, Smith L, Le Maistre C: Quantitative studies of specimens using single-tube biotinylated nested polymerase chain mycobacterial populations in sputum and saliva. Am Rev Respir reaction-enzyme linked immunoassay (PCR-ELISA). Diagnostic Dis 1967, 95:998-1004. PMid:4961042 microbiology and infectious disease 2004, 48:271-275. 6. Hobby GL, Holman AP, Iseman MD, Jones JM: Enumeration of http://dx.doi.org/10.1016/j.diagmicrobio.2003.11.006 Tubercle Bacilli in Sputum of Patients with Pulmonary PMid:15062920 Tuberculosis. Antimicrobial Agents and Chemotherapy 1973, 4:94- 10. Nakano N, Wada R, Yajima N, Yamamoto N, Wakai Y, Otsuka H, 104. http://dx.doi.org/10.1128/AAC.4.2.94 PMid:4208508 : Mycobacterial infection of the musculoskeletal tissues: the use of PMCid:444512 pathological specimens for identification of causative species by 7. Takahashi T, Tamura M, Takahashi SN, Matsumoto K, Sawada S, PCR-direct sequencing of 16S rDNA. Jpn J Infect Dis 2010, Yokoyama E, Nakayama T, Mizutani T, Takasu T, Nagase H: 63:188-191. PMid:20495271 11. Kim K, Lee H, Lee M-K, Lee S-A, Shim T-S, Lim SY, Koh W-J,

Mediterr J Hematol Infect Dis 2012; 4: Open Journal System Yim J-J, Munkhtsetseg B, Kim W, et al: Development and 23. Ratnam S, Stead FA, Howes M: Simplified Acetylcysteine-Alkali Application of Multiprobe Real-Time PCR Method Targeting the Digestion-Decontamination Procedure for Isolation of hsp65 Gene for Differentiation of Mycobacterium Species from Mycobacteria from Clinical Specimens. J clin Microbiol 1987, 25 Isolates and Sputum Specimens. Journal of Clinical Microbiology 1428-1432. PMid:3305557 PMCid:269240 2010, 48:3073-3080. http://dx.doi.org/10.1128/JCM.00939-10 24. Ben Kahla I, Ben Selma W, Marzouk M, Ferjeni A, Ghezal S, PMid:20631094 PMCid:2937694 Boukadida J: Evaluation of a simplified IS6110 PCR for the rapid 12. Eisenach KD, Crawford JT, Bates JH: Repetitive DNA sequences diagnosis of Mycobacterium tuberculosis in an area with high as probes for Mycobacterium tuberculosis. Journal of Clinical tuberculosis incidence. Pathologie Biologie 2011, 59:161-165. Microbiology 1988, 26:2240-2245. PMid:3148630 PMCid:266867 http://dx.doi.org/10.1016/j.patbio.2009.04.001 PMid:19477082 13. Thierry D, Cave MD, Eisenach KD, Crawford JT, Bates JH, 25. Aldous W, Pounder J, Cloud JL, Woods G: Comparison of Six Gicquel B, Guesdon JL: IS6110, an IS-like element of Methods of Extracting M. tuberculosis DNA from Processed Mycobacterium tuberculosis complex. Nucleic Acids Research Sputum for Testing by Quantitative Real-Time PCR. J Clin 1990, 18:188. http://dx.doi.org/10.1093/nar/18.1.188 Microbiol 2005, 43:2471–2473. PMid:2155396 PMCid:330226 http://dx.doi.org/10.1128/JCM.43.5.2471-2473.2005 14. Thorne N, Borrell S, Evans J, Magee J, Garcaa de Viedma D, PMid:15872286 PMCid:1153782 Bishop C, Gonzalez-Martin J, Gharbia S, Arnold C: IS6110-based 26. Piersimoni C, Scarparo C, Piccoli P, Rigon A, Ruggiero G, Nista global phylogeny of Mycobacterium tuberculosis. Infection, D, Bornigia S: Performance Assessment of Two Commercial Genetics and Evolution 2011, 11:132-138. Amplification Assays for Direct Detection of Mycobacterium http://dx.doi.org/10.1016/j.meegid.2010.09.011 PMid:20920607 tuberculosis Complex from Respiratory and Extrapulmonary 15. Abraham P, Sharma V, Shivannavar C: Diagnosis of TB from Specimens. Journal of Clinical Microbiology 2002, 40:4138-4142. smear & culture negative sputum specimens by IS 6110 based http://dx.doi.org/10.1128/JCM.40.11.4138-4142.2002 PCR. Indian J Med Res 2012;135: 2012, 135:249-251. PMid:12409387 PMCid:139632 16. Ani A, Okpe S, Akambi M, Ejelionu E, Yakubu B, Owolodun O, 27. Almeda J, García A, González J, Quintó L, Ventura PJ, Vidal R, Ekeh P, Oche A, Tyen D, Idoko J: Comparison of a DNA based Rufí G, Martínez JA, Jiménez de Anta MT, Trilla A, Alonso PL: PCR method with conventional methods for the detection of M. Clinical Evaluation of an In-House IS 6110 Polymerase tuberculosis in Jos, Nigeria. J Infect Dev Ctries 2009, 3:470-475. Chain Reaction for Diagnosis of Tuberculosis. European Journal of http://dx.doi.org/10.3855/jidc.420 Clinical Microbiology & Infectious Diseases 2000, 19:859-867. 17. McEvoy CRE, Falmer AA, van Pittius NCG, Victor TC, van http://dx.doi.org/10.1007/s100960000375 PMid:6756909 Helden PD, Warren RM: The role of IS6110 in the evolution of 28. Kox LF, Rhienthong D, Miranda AM, Udomsantisuk N, Ellis K, Mycobacterium tuberculosis. Tuberculosis (Edinburgh, Scotland) Van Leeuwen J, Van Heusden S, KuijperI S, Kolk AH, : A More 2007, 87:393-404. http://dx.doi.org/10.1016/j.tube.2007.05.010 Reliable PCR for Detection of Mycobacterium tuberculosis in PMid:17627889 Clinical Samples J Clin Microbiol 1994, 32:672-678. 18. Mazurek GH, Cave MD, Eisenach KD, Wallace RJ, Bates JH, 29. Zakham F, Bazoui H, Akrim M, Lemrabet S, Lahlou O, Elmzibri Crawford JT: Chromosomal DNA fingerprint patterns produced M, Benjouad A, Ennaji M, Elaouad R: Evaluation of conventional with IS6110 as strain-specific markers for epidemiologic study of molecular diagnosis of Mycobacterium tuberculosis in clinical tuberculosis. Journal of Clinical Microbiology 1991, 29:2030- specimens from Morocco. J Infect Dev Ctries 2012, 12:40-45. 2033. PMid:1663520 PMCid:270253 30. Otal I, MartÃn C, Vincent-LÃ©vy-Frebault V, Thierry D, Gicquel 19. van Embden JD, Cave MD, Crawford JT, Dale JW, Eisenach KD, B: Restriction fragment length polymorphism analysis using Gicquel B, Hermans P, Martin C, McAdam R, Shinnick TM: Strain IS6110 as an epidemiological marker in tuberculosis. Journal of identification of Mycobacterium tuberculosis by DNA Clinical Microbiology 1991, 29:1252-1254. PMid:1677943 fingerprinting: recommendations for a standardized methodology. PMCid:269979 Journal of Clinical Microbiology 1993, 31:406-409. PMid:8381814 31. Taylor GM, Worth D, Palmer S, Jahans K, Hewinson RG: Rapid PMCid:262774 detection of Mycobacterium bovis DNA in cattle lymph nodes with 20. Eisenach K, Cave M, Bates J, Crawford J: Polymerase chain visible lesions using PCR. BMC Veterinary Research 2007, 3:12. reaction amplification of a repetitive DNA sequence specific for http://dx.doi.org/10.1186/1746-6148-3-12 PMid:17567891 Mycobacterium tuberculosis. . J Infect Dis 1990, 161:977-981. PMCid:1904440 http://dx.doi.org/10.1093/infdis/161.5.977 PMid:2109022 32. Wu T, Chia J, Kuo A, Su L, Wu T, Lai H: Rapid identification of 21. Thierry D, Brisson Noel A, Vincent-Levy-Frebault V, Nguyen S, mycobacteria from smear-positive sputum samples by nested PCR- Guesdon J, Giquel B: Characterization of a Mycobacterium restriction fragment length polymorphism analysis. J Clin tuberculosis Insertion Sequence, IS6110, and Its Application in Microbiol 2008, 46:3591-3594. Diagnosis. J Clin Microbiol 1990, 28 2668-2673. PMid:2177747 http://dx.doi.org/10.1128/JCM.00856-08 PMid:18768657 PMCid:268253 PMCid:2576587 22. Sekar B, Selvaraj L, Alexis A, Ravi S, Arunagiri K, Rathinavel L: 33. El Baghdadi J, Lazraq R, Benani A, Naciri M, Ibrahimy S, The utility of IS6110 sequence based polymerase chain reaction in Benslimane A: PCR detection of Mycobacterium tuberculosis comparison to conventional methods in the diagnosis of extra- lacking IS 6110. Bull Soc Pathol Exot 1997, 90:303-306. pulmonary tuberculosis. Indian J Med Microbiol 2008, 26:352-355. PMid:9507757 http://dx.doi.org/10.4103/0255-0857.43575 PMid:18974489

Mediterr J Hematol Infect Dis 2012; 4: Open Journal System Doctorat Es Science in Microbiology & Molecular Biology Results 2012

CHAPTER 2

Molecular Detection of MDR MTB in the clinical specimens

Presentation of paper IV:

Fathiah ZAKHAM , Imane CHAOUI, Mohammed ABID, Moulay Driss MESSAOUDI, Moulay Mustapha ENNAJI, Mohamed ELMZIBRI. Automated sequencing for the direct detection of Multi drug Mycobacterium tuberculosis strains in the sputum specimens of Moroccan patients. (In preparation)

Background:

Tuberculosis (TB) is a major public threatening with high mortality and morbidity rates especially, in the low income countries. Disturbingly, the emergence of Multi and Extensively Drug Resistance MDR/XDR TB cases had worsened the situation, raising concerns of a future epidemic of virtually untreatable TB.

Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. Current Drug Susceptibility Testing (DST) standard method is based on the conventional proportional method, but this method requires several weeks and multiple methodologies to complete.

The PCR-Sequencing based strategy, designed to rapidly detect mutations associated with drug resistance, is able to provide a same-day diagnosis from culture and even clinical samples with high sensitivity and specificity.

Therefore, this study is an attempt to establish a rapid diagnosis of MDR-TB by sequencing the rpoB and KatG genes, which are linked to resistance to Rifampicin and Isoniazid respectively.

Methodology:

Direct PCR was performed on clinical specimens targeting rpoB and KatG genes for the investigation of MDR-TB. Automated sequencing of the same genes was realized for the detection of the mutations responsible of drug resistance in MTB strains.

Doctorat Es Science in Microbiology & Molecular Biology Results 2012

The resulting “chromatograms” were manually edited to ensure sequence accuracy and added to the alignment component of MEGA software version 4.

Results & Discussion:

MDR TB strains were identified in eight cases; all of them were considered as suspected MDR-TB cases and previously treated by anti tuberculosis drugs. The rest were either sensitive or identified as mono-resistant. The feasibility of PCR on biological samples can allow direct DST by amplification of genes responsible of drug resistance.

This is especially useful for the amplification of rpo B gene, which is responsible of more than 90% Rifampicin drug resistance and the presence of Rifampicin resistance, increases the probability of MDR-TB. Thus, it has been identified as a useful surrogate marker for estimation of MDR

Conclusion:

The automated sequencing is an excellent and valid method for the accuracy and rapidness of the detection of drug-resistant TB in clinical specimens and valuable method for management of suspected MDR-TB cases.

Doctorat Es Science in Microbiology & Molecular Biology Results 2012

Publication IV

Automated sequencing for the rapid detection of Multi Drug Resistant Mycobacterium tuberculosis strains in the sputum specimens of Moroccan patients

ABSTRACT: Tuberculosis (TB) is a major health public problem with high mortality and morbidity rates especially in low income countries. Disturbingly, the emergence of multi and extensively drug resistance MDR/XDR TB cases had worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. Current detection of drug susceptibility testing (DST) is based on the proportional method, which is the standard conventional method but requires several weeks and multiple methodologies to complete. The PCR-Sequencing based strategy designed to rapidly detect mutations associated with drug resistance and able to provide a same-day diagnosis from culture and even clinical samples with high sensitivity and specificity. Therefore, this study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of rpoB and KatG genes, which are linked to resistance to anti- tuberculosis drugs. For this purpose, 133 sputum samples of tuberculosis patients from Morocco, where enrolled in this study. Molecular analysis showed that 7 strains were INH monoresistant and 18 were RIF monoresistant. MDR TB strains were identified in eight cases (6%). Among them, 7 were traditionally diagnosed as critical cases: four chronic and three drug-relapse cases. The last strain was isolated from a new case. In conclusion, the PCR-sequencing approach is an excellent and valid method for the accuracy and rapidness of the detection of drug-resistant TB in clinical specimens, and could be of great interest in the management of TB in critical cases to adjust the treatment regimen and limit the emergence of MDR/XDR strains

Keywords: Mycobacterium tuberculosis , Multi drug-resistance, DNA sequencing. rpoB , katG. INTRODUCTION Tuberculosis (TB) remains one of the most infectious diseases worldwide and the cause of mortality especially in developing countries, where there is a high incidence. Furthermore, fears and concerns of the expected increasing of the mortality and morbidity due to this disease have become more outlined (Rodrigues and Smith, 1990). In this context, the emergence of multi and extensively drug resistance MDR/XDR cases had worsened the situation (WHO, 2011a). Significantly, according to the reports of the World Health Organization (WHO), 250 000 TB patients were diagnosed in 2009 (WHO, 2010), among them, 30 000 (12%) were notified as MDR TB. In 2010, there were an estimated 650 000 cases of MDR-TB among the world’ 12.0 million prevalent cases of TB (WHO, 2011a). Drug-resistant TB emergence is due to ineffective treatment, patient non-adherence to treatment or the transmission of drug-resistant strains of Mycobacterium tuberculosis (MTB). MDR TB, defined as resistance to at least Isoniazid (INH) and Rifampicin (RIF), poses a great threat to the success of TB control programs in many parts of the world (Brooks et al. , 1998) (Chaoui, 2012). The emergence of MDR strains associated with restricted number of therapeutic agents, have allowed to renewed effort during the two last decades to better exploit the molecular basis of drug resistance in MTB. Indeed, drug resistance in MTB develops through spontaneous mutations in target genes, followed by the natural selection of these resistant bacteria on exposure to anti-tuberculosis drugs, which could lead of a sequential accumulation of mutations in specific genes of MTB and consequently MDR-TB cases (Van Rie et al. , 2001). Mutations in the rpo B gene, encoding the β-subunit of DNA-dependent RNA polymerase leads to a resistance against RIF, which is the key first-line anti-tuberculosis drug and RIF resistance increases the probability of MDR-TB (Ramaswamy and Musser, 1998). It is also noteworthy to mention that RIF resistance has been identified as a useful surrogate marker for MDR TB (Ramaswamy and Musser, 1998). One the other hand, the katG gene encodes mycobacterial catalase peroxidase, which is the only enzyme in MTB capable of activating the pro-drug Isoniazid to its active form (Ramaswamy and Musser, 1998). In Morocco, the incidence of TB has stagnated during last years, and is reported to be 81 per 100,000 overall. The prevalence of MDR TB is 0.5% within new cases and reaches to 12.2% among previously treated patients with failure treatment, relapse or chronic cases (WHO, 2010). In Morocco, as other resource limited countries, WHO guidelines recommend the diagnosis of tuberculosis (TB) by smear microscopy in all new TB cases and smear microscopy, culture and drug susceptibility testing (DST) in re-treatment cases [WHO, …]. Currently, drug susceptibility testing (DST) is especially based on the proportional method, which is performed on solid media such as Lowenstein-Jensen (L/J) (Reller et al ., 2000). This culture-based DST is widely recognised as a reference method but requires several weeks and multiple methodologies to complete (Reller et al. , 2000). Moreover, it’s widely accepted that rapid DST is critical in preventing amplification and transmission of drug resistance. Thus, there is an urgent need for new, rapid and effective diagnostics to investigate about MDR-TB. Molecular assays identifying specific drug resistance-causing mutations may be used to accelerate DST and improve the health management of TB (Chaoui, 2012). In this field, many PCR-based strategies have been used to detect mutations in the target genes, which include DNA sequencing, pyrosequencing, SSCP and the hybridization using specific probes (García de Viedma, 2003; Neonakis et al. , 2008). The PCR-Sequencing based strategy, designed to rapidly detect mutations associated with drug resistance, is able to provide a same-day diagnosis from culture and even clinical samples with high sensitivity and specificity. It can also detect new mutations that could be associated with drug resistance. Automated sequencing has been used by several groups in clinical setting for the detection of most frequented mutations and has been found to give excellent benefit to patient care activities (Abdelaal et al. , 2009; Choi et al. , 2010; Kourout et al. , 2009). Moreover, the WHO, as part of the strategy "Stop TB 2006-2015", strongly recommends for countries most affected by TB, the integration of molecular approaches, especially Gen-X- pert, as initial diagnostic test in individuals suspected of having MDR-TB or HIV-associated TB (PNLAT « Direction de l’épidémiologie et de lutte contre les maladies » DELM, 2011; WHO, 2011b). Due to its TB prevalence, Morocco is illegible to implement the Gen-X-pert analysis as a routine diagnostic tool. Thus, this study was planned to assess the consistency and the coherence of the existing mutations conferring resistance in circulating strains in Morocco and the probes used in Gen- X-pert analysis, and to evaluate the usefulness of molecular techniques in the early detection of MDR -TB strains directly from sputum to guide treatment regimens.

MATERIALS & METHODS I. Sampling A total of 133 patients of confirmed pulmonary TB from Moroccan patients were included in this study. Three consecutive sputum samples were collected from each patient as recommended by the WHO (WWW.WHO.INT/EMC. , 1996.) and inoculated on L/J medium after decontamination by N-acetyl-l-cysteine (NALC) (Ratnam et al. , 1987). The direct microscopic examination was performed by Ziehl-Neelsen method (Cheesbrough, 2000). A part of each decontaminated sputum sample was used to extract MTB DNA to fulfil molecular analysis.

II. Bacterial lysis. The specimen was first thawed and centrifuged at 6,000 g for 1 min. The supernatant was discarded and the pellet was treated by the heat shock treatment as described by Aldous, et al . (Aldous et al. , 2005). The crude DNA was immediately used for PCR amplification or stored at -20°C until use. III. PCR for amplification of rpoB and katG genes The katG and rpoB genes were amplified by PCR using the corresponding primers (Table 1).

Table I. Primers for PCR amplification Gene Size Primer Sequence Tm (°C) References TR8 TGCACGTCGCGGACCTCCA rpoB 123 58 (Abdelaal et al. , 2009) TR9 TCGCCGCGATCAAGGAGT RTB 59 TGGCCGCGGCGGTCGACATT katG 419 62 (Cingolani et al. , 1999) RTB 38 GGTCAGTGGCCAGCATCGTC

Amplification reaction was performed in total volume of 50 µl. The amplification mixture contained 0.5 mM of each primer, 2.5 mM of each dNTP (dATP, dCTP, dGTP and dTTP), 25 mM MgCl, 1 unit of Hotstar Taq DNA polymerase (Invitrogen, France) and 5 µl of DNA sample in 1x Taq polymerase buffer. The mixture was first denatured at 94°C for 15 min. Then, 35 cycles of PCR were performed with denaturation at 94°C for 1 min, primer annealing for 1 min at the corresponding Tm and primer extension for 1 min at 72°C. At the end of the last cycle, the mixture was incubated at 72°C for 7 min. For every reaction, a negative control in which DNA template was omitted from the amplification mixture, and a positive control containing DNA from H37Rv strain, were included. Amplicons generated were visualized after electrophoretic fractionation in 1.5 % agarose gel in 1 X TBE buffer and staining with ethidium bromide.

V. Sequencing Reaction Direct sequencing of amplicons was performed using Big Dye Terminator kit (version 3.1) (Applied Biosystem, Foster City, CA, USA) that includes didesoxynucleotides labelled with four fluorochromes of different colours. For each PCR product, both strands were sequenced, in independent reactions, using the mentioned above primers. The resulting chromatograms were manually edited to ensure sequence accuracy and added to the alignment component of MEGA software version 4.

RESULTS Among the 133 clinically symptomatic TB patients enrolled in this study, 100 were new cases, who had active and chemonaive TB or received TB treatment for less than a month. The rest (33) were previously treated patients (drug relapse or failure, chronic) and did not respond to anti TB drugs after a sufficient duration of treatment. The mean age of patients was 38 years old with extreme ages at 15 and 80. According to the sex distribution, 72.52 % of patients were male and only 27.48 % were female, giving a sex ratio of 2.64. Genotypic DST of the 133 samples showed that 7 were INH resistant (5.3 %), 18 were RIF resistant (13.5 %) and 8 were MDRTB (6 %). All the mutations identified by partial sequencing of rpoB and katG genes are listed in Table II. Our results showed that the most recorded mutation in the Rifampicin Resistance Determining Region (RRDR) of rpo B gene is the substitution of TCG > TTG at codon 531 (Ser531Leu) accounting for 46.15% (Table II). Other point mutations and deletions were found in limited number of cases: Asp516Val, Asp516Tyr, 518AAC were found in 2 cases each and GLn513Pro, Gln513Leu, Asp516His, His526Arg, His526Ser, Lys527Gln, Ser531Trp, and 520CCG , in 1 case each. Interestingly, no strain harbored more than one amino acid change. Significantly, all genotypic INH R samples showed mutations at codon 315 of katG gene (AGC to ACC) with Ser315Thr amino acid change. Distribution of genotypic resistant strains according to the patients’ Tb profile is reported in table III. Mono-resistant strains to INH were found both in new cases (5%) and previously treated patients (6%). However, RIF monoresistant strains prevail in new cases (15%). Interestingly, the majority of MDR strains were isolated from previously treated patients (21.2%), especially chronic and drug relapse cases, whereas only one new case was infected with a genotypic MDR strain.

Table II. Frequency of mutations identified by sequencing in the kat G and rpoB genes of MTB isolates

Gene Position Type of Mutation Amino acid change Frequency Total 513 Substitution of CAA→CCA Glutamine → Proline 1 (3.8%) 513 Substitution of GAA →CTA Glutamine → Leucine 1 (3.8%) 516 Substitution of GAC →GTC Asparate → Valine 2 (7.7%) 516 Substitution of GAC →TAC Asparate → Thyrosine 2 (7.7%) 516 Substitution of GAC →CAC Asparate → Histidine 1 (3.8%) rpoB 518 Deletion of AAC 2 (7.7%) 26 520 Deletion of CCG 1 (3.8%) 526 Substitution of CAC →CGC Histidine → Arginine 1 (3.8%) 526 Substitution of CAC →AGC Histidine → Serine 1 (3.8%) 527 Substitution of AAG →CAG Lysine → Glutamine 1 (3.8%) 531 Substitution of TCG →TGG Serine → Tryptophan 1 (3.8%) 531 Substitution of TCG →TTG Serine → Leucine 12 (46%) katG 315 Substitution of AGC →ACC Serine → Threonine 15 (100%) 15

Table III. Distribution of MDR according to the TB profile of patients

Monoresistant strains Tuberculosis Profile N MDR INH RIF strains Smear Positive 72 5 12 1 New cases Smear Negative 28 0 3 0 Chronic 7 0 0 4 Previously treated Drug relapse 18 1 3 3 patients Drug Failure 8 1 0 0 Total 133 7 18 8

Discussion Worldwide, the success of national programs against TB rests on the rapid diagnosis and a good management of drug resistant TB cases. Indeed, the emergence of drug-resistant isolates of MTB poses a serious threat to global TB control. In Morocco, and according to TB control program recommendations, DST testing should be performed for the previously treated cases (relapse, failure and chronic) and the co-infected TB-HIV patients, where the MDR TB cases are highly suspected and the possibility of acquiring further resistance is extremely expected and thus, the decision of treatment is crucial (PNLAT « Direction de l’épidémiologie et de lutte contre les maladies » DELM, 2011; Quy et al. , 2003). Moreover, to improve the performance of the TB control program in Morocco, close evaluation of the monitoring of treatment outcomes of relapse, failure and default cases was strongly recommended (Ottmani et al. , 2006). MDR is a consequence of inappropriate chemotherapy, erratic drug supply, misuse of TB drugs, poor TB management and lack of control. For these reasons, research efforts are directed to find ways to speed up process of susceptibility testing, with limited cost and complexity. According to the WHO’ recommendations and in the perspectives of the implementation of genotypic MDR analysis by Gen-X-pert, this study was planned to perform the direct detection of MDR strains by PCR-sequencing based approach. This standard method for genotyping DST was limited to two specific genes, rpoB and katG , which can predict the MDR-TB strains up to 96% and 75% respectively (Van Rie, et al., 2001). Indeed, It’s well documented that mutations in the rpoB gene, especially in RRDR, account for >95% of RIF - resistance. Similarly, mutations in the katG gene at codon 315 exclusively confer high-level resistance to INH in up to 75% MDR-TB strains Van Rie, et al ., 2001; (Müller et al. , 2011; Ramaswamy and Musser, 1998; Van Rie et al. , 2001). Both for katG and rpoB genes, mutations or deletions found in this study were already reported and are in concordance with previous published data (Abdelaal et al. , 2009; Kourout et al. , 2009). The most recorded mutation, located in the RRDR of the rpo B gene is the substitution Ser531Leu (TCG → TTG), which was widely reported (Aziz et al. , 2006; Telenti et al. , 1993). Interestingly, no double mutations were found in the analyzed samples. Our results clearly show that RIF monoresistance is relatively high. This resistance could be associated with other forms of INH resistance, including other mutations in katG gene or mutations in i nhA or ahpC , or other mechanisms of resistance. Moreover, this high frequency of RIF monoresistance could highlight that this resistance, as reported in previous studies, is not a rare event (Mukinda et al. , 2012). On other hand, only the Ser315Thr point mutation was found in katG gene and is the most frequent mutation in this gene reported worldwide (Evans et al. , 2009, Chaoui et al. , 2009,(Aziz et al. , 2006; Müller et al. , 2011). It’s widely accepted that genotypic DST have a high sensitivity and specificity as compared to the conventional culture-based DST, but still unable to detect all drug resistant strains (Barnard et al. , 2008; Evans et al. , 2009). Thus, the number of MDR strains detected by the PCR-sequencing approach is underestimated. Out of the 133 cases, 8 were genotypic MDR, and the majority was isolated from previously treated patients. This is in agreement with reported data and is of great interest for rapid detection of MDR strains especially in the critical cases, such as chronic and treatment failure or relapse cases, where the rapid diagnosis is mandatory for an efficient chemotherapy(Miotto et al. , 2009). Moreover, 7 MDR-TB were isolated from 33 previously treated patients (21.1%). In 2004, 12.2% of previously treated patients were reported MDR (WHO, 2010). Even the limited number of cases, there’s evidence that the number of MDR have increased in Morocco threatening thereby the success of TB control program. In spite of the high cost and cumbersomeness, the automated sequencing is an excellent and valid method for the accuracy and rapidity of detection of drug-resistant TB in clinical specimens and valuable method for the management of suspected MDR-TB cases (Abdelaal et al. , 2009). Significantly, one important advantage of sequence-based approaches is that the resulting data are virtually unambiguous because the resistance associated mutation is either present or absent (Neonakis et al. , 2008). In Morocco, as it’s the case of other limited resources countries, the introduction of the PCR- sequencing approach to detect MDR cases should be of great benefit as a screening assay in clinical settings for saving patients’ life and preventing the dissemination of TB and MDR TB in the community. Based on our results and as deduced from several international studies (Miotto et al. , 2009), two algorithms associating conventional diagnosis, DST, and genotypic DST could be proposed (Figures 1 and 2). Rapid detection of MDR strains can play a critical role in limiting the emergence of virtually untreatable extensively drug-resistant TB strains (XDR-TB). In fact, amplification of drug resistance in MDR-TB can lead to XDR-TB, defined as MDR-TB plus additional resistance to a fluoroquinolone and one of the injectable second-line drugs kanamycin (KAN), amikacin (AMK) or capreomycin (CPM). In conclusion, the implementation of molecular approaches for direct diagnosis of MDR-TB, as a part of the routine analysis in the laboratories of health care institutions, will be of great benefit to adapt treatment regimens, limit the dissemination of MDR-TB strains and limit the emergence of XDR-MTB strain for better management of TB in Morocco.

Acknowledgment: This study has been funded in part by the International Atomic Energy Agency under the RAF604 project and EMRO/WHO under the RPC/RAB&GH 10 / 11-03 project.

Figure 1. Management of suspected and new cases

Figure 2. Place of genotypic DST in the global management of TB for specific cases: Previously treated patients (chronic, relapse, failure), Co-infection with HIV, patients in close contact with MDR TB cases References:

Abdelaal A, El-Ghaffar H, Zaghloul M, El mashad N, Badran E, Fathy A (2009). Genotypic detection of rifampicin and isoniazid resistant Mycobacterium tuberculosis strains by DNA sequencing: a randomized trial. Annals of Clinical Microbiology and Antimicrobials 8: 4.

Aldous W, Pounder J, Cloud JL, Woods G (2005). Comparison of Six Methods of Extracting M. tuberculosis DNA from Processed Sputum for Testing by Quantitative Real-Time PCR. J Clin Microbiol 43: 2471–2473.

Aziz MA, Wright A, Laszlo A, De Muynck A, Portaels F, Van Deun A et al (2006). Epidemiology of antituberculosis drug resistance (the Global Project on Anti-tuberculosis Drug Resistance Surveillance): an updated analysis. The Lancet 368: 2142-2154.

Brooks G, Butel J, Morse S (1998). Jawetz, Melnick, Adelberg‘s Medical Microbiology , 21st edition edn. Lange Medical book.

Cheesbrough M (2000). District laboratory practice in tropical countries. . Cambridge University Press.

Choi J-H, Lee KW, Kang H-R, Hwang YI, Jang S, Kim D-G et al (2010). Clinical Efficacy of Direct DNA Sequencing Analysis on Sputum Specimens for Early Detection of Drug- Resistant Mycobacterium tuberculosis in a Clinical Setting. CHEST Journal 137: 393-400.

Cingolani A, Antinori A, Sanguinetti M, Gillini L, De Luca A, Posteraro B et al (1999). Application of Molecular Methods for Detection and Transmission Analysis of Mycobacterium tuberculosis Drug Resistance in Patients Attending a Reference Hospital in Italy. Journal of Infectious Diseases 179: 1025-1029.

García de Viedma D (2003). Rapid detection of resistance in Mycobacterium tuberculosis: a review discussing molecular approaches. Clinical Microbiology and Infection 9: 349-359.

Kourout M, Chaoui I, Sabouni R, .Lahlou O, El Mzibri M, Jordaan A et al (2009). Molecular characterisation of rifampicin-resistant Mycobacterium tuberculosis strains from Morocco. Int J Tuberc Lung Dis 13: 1440–1442.

Miotto P, Saleri N, Dembele M, Ouedraogo M, Badoum G, Pinsi G et al (2009). Molecular detection of rifampin and isoniazid resistance to guide chronic TB patient management in Burkina Faso. BMC Infectious Diseases 9: 142.

Mukinda FK, Theron D, van der Spuy GD, Jacobson KR, Roscher M, Streicher EM et al (2012). Rise in rifampicin-monoresistant tuberculosis in Western Cape, South Africa. The International Journal of Tuberculosis and Lung Disease 16: 196-202.

Müller B, Streicher EM, Hoek KGP, Tait M, Trollip A, Bosman ME et al (2011). inhA promoter mutations: a gateway to extensively drug-resistant tuberculosis in South Africa? The International Journal of Tuberculosis and Lung Disease 15: 344-351. Neonakis IK, Gitti Z, Krambovitis E, Spandidos DA (2008). Molecular diagnostic tools in mycobacteriology. Journal of Microbiological Methods 75: 1-11.

Ottmani SE, Zignol M, Bencheikh N, La, sri L, Chaouki N et al (2006). Results of cohort analysis by category of tuberculosis retreatment cases in Morocco from 1996 to 2003. The International Journal of Tuberculosis and Lung Disease 10: 1367-1372.

PNLAT « Direction de l’épidémiologie et de lutte contre les maladies » DELM. (2011). : Rabat.

Quy HTW, Lan NTN, Borgdorff MW, Grosset J, Linh PD, Tung LB et al (2003). Drug resistance among failure and relapse cases of tuberculosis: is the standard re-treatment regimen adequate? The International Journal of Tuberculosis and Lung Disease 7: 631-636.

Ramaswamy S, Musser J (1998). Molecular genetic basis of antimicrobial agent resistance in Mycobacterium tuberculosis: 1998 update. Tuber Lung Dis 79: 3-29.

Ratnam S, Stead FA, Howes M (1987). Simplified Acetylcysteine-Alkali Digestion- Decontamination Procedure for Isolation of Mycobacteria from Clinical Specimens. J clin Microbiol 25 1428-1432.

Reller LB, Weinstein MP, Woods GL (2000). Susceptibility Testing for Mycobacteria. Clinical Infectious Diseases 31: 1209-1215.

Rodrigues LC, Smith PG (1990). Tuberculosis in developing countries and methods for its control. Transactions of the Royal Society of Tropical Medicine and Hygiene 84: 739-744.

Telenti A, Imboden P, Marchesi F, Matter L, Schopfer K, Bodmer T et al (1993). Detection of rifampicin-resistance mutations in Mycobacterium tuberculosis. The Lancet 341: 647-651.

Van Rie A, Warren R, Mshanga I, Jordaan AM, van der Spuy GD, Richardson M et al (2001). Analysis for a Limited Number of Gene Codons Can Predict Drug Resistance of Mycobacterium tuberculosis in a High-Incidence Community. Journal of Clinical Microbiology 39: 636-641.

WHO R (2010). Global Tuberculosis Control: epidemiology, strategy, financing WHO/ HTM/TB/ 2010. 300. . WHO Report .

WHO R. (2011a). WHO/HTM/TB/2011.16 (ed.), pp 258.

WHO R. (2011b). WHO Library Cataloguing-in-Publication Data.

WWW.WHO.INT/EMC. (1996.). .WHO/EMC/ZOO/96.4. (ed.).

Doctorat Es Science in Microbiology & Molecular Biology Results 2012

CHAPTER 3

Genomics, Proteomics and Phylogeny analysis of MTB and other mycobacterial strains

Presentation of paper IV & V:

Background:

The genus Mycobacterium comprises different species; some of them are highly contagious and infectious. The members of the complex Mycobacterium tuberculosis are the most virulent microorganisms that killed human and mammalian animals since millennia and were the first cause of death due to TB.

Additionally, with the huge amount of mycobacterial sequences, there is a crucial need for the visualization and the simplification of their data. In both of papers IV and V, we aimed to highlight a comparative genome, proteome and phylogeny analysis between mycobacterial (Tuberculosis and non tuberculosis) strains. This provides a new insight on mycobacterial genome evolution and then permits a better improvement of diagnosis of TB and MDR-TB by uncovering new gene and nucleotide sequences targets.

For this purpose in the Paper IV, a comparison between fourteen mycobacterial genomes has been done based on their length of genomes, GC content, number of genes in different data bases (Genbank, Refseq, and Prodigal). The BLAST matrix of these genomes has been figured to give a lot of information about the similarity between species in a simple scheme.

Doctorat Es Science in Microbiology & Molecular Biology Results 2012

As a result of multiple genome analysis, the pan and core genome have been defined for twelve mycobacterial species and for examining the phylogenetic relationships among these bacteria, a phylogentic tree was constructed from 16S rRNA gene to understand the evolutionary events of these species.

Paper V , aimed to extend the previous paper by studying the available twenty one mycobacterial genomes for better understanding the evolutionary events.

Methodology:

The main source of information was: http://www.ncbi.nlm.nih.gov/ GenBank at NCBI. From which all available mycobacterial whole genome sequences were used in both of studies. The calculations of the resulted BLAST Matrix and Pan- Core genome plot were performed on house computers of the Centre of Biological Sequence Analysis, in Denmark: http://www.cbs.dtu.dk/services.

Results & Discussion:

Due to long generation time, fastidiousness of growth requirement and high contagiousness risk, serious complications and severity of their inducible diseases, the necessity of uncovering the genomics and phylogeny of MTB strains represent a real priority. Considerably, the result of Pan and Core genome plotting demonstrated that a total set of about 20,000 gene families within the Mycobacterium pan-genome, within which less than 1250 Mycobacterium gene families are conserved across all species in the core genome. As a result of genome analysis of predicted proteomics, the BLAST matrix showed a high similarity among the species of MTB complex. Moreover, the phylogeny analysis demonstrated a high relationship between pathogenic mycobacteria.

Conclusion:

Mycobacteria include important pathogenic species for human and animals and the Mycobacterium tuberculosis complex is the most cause of death of the humankind and the comparative genome analysis approach can lead to a better understanding of mycobacterial genome evolution and paving the way for discovery of new diagnostic targets.

Doctorat Es Science in Microbiology & Molecular Biology Results 2012

Publication V

Cell. Mol. Biol. 57 (supp): OL1462-OL1469 Published on March 15, 2011; DOI 10.1170/167

MYCOBACTERIAL SPECIES AS CASE- STUDY OF COMPARATIVE GENOME ANALYSIS

F. ZAKHAM 1, 2, 3 , L. BELAYACHI 3, D. USSERY 4, M. AKRIM 2, A. BENJOUAD 3, R. EL AOUAD 2 AND M. M. ENNAJI 1

1 Laboratory of Virology and Hygiene & Microbiology, University Hassan II Mohammedia-Casablanca School of Science and Techniques.. BP 146, Mohammedia, 20650, Morocco. 2 National Institute of Hygiene, Laboratory of Molecular Biology, Rabat, Morocco. 3 Laboratory of Immunology and Biochemistry, School of Science. University Mohammed V- Rabat. Morocco. 4 Centre for Biological Sequence Analysis, Technical University of Denmark, Kgs. Lyngby, Denmark.

Abstract

The genus Mycobacterium represents more than 120 species including important pathogens of human and cause major public health problems and illnesses. Further, with more than 100 genome sequences from this genus, comparative genome analysis can provide new insights for better understanding the evolutionary events of these species and improving drugs, vaccines, and diagnostics tools for controlling Mycobacterial diseases. In this present study we aim to outline a comparative genome analysis of fourteen Mycobacterial genomes: M. avium subsp. paratuberculosis K-10, M. bovis AF2122/97, M. bovis BCG str. Pasteur 1173P2, M. leprae Br4923, M. marinum M, M. sp. KMS, M. sp. MCS, M. tuberculosis CDC1551, M. tuberculosis F11, M. tuberculosis H37Ra, M. tuberculosis H37Rv, M. tuberculosis KZN 1435 , M. ulcerans Agy99,and M. vanbaalenii PYR-1, For this purpose a comparison has been done based on their length of genomes, GC content, number of genes in different data bases (Genbank, Refseq, and Prodigal). The BLAST matrix of these genomes has been figured to give a lot of information about the similarity between species in a simple scheme. As a result of multiple genome analysis, the pan and core genome have been defined for twelve Mycobacterial species. We have also introduced the genome atlas of the reference strain M. tuberculosis H37Rv which can give a good overview of this genome. And for examining the phylogenetic relationships among these bacteria, a phylogentic tree has been constructed from 16S rRNA gene for tuberculosis and non tuberculosis Mycobacteria to understand the evolutionary events of these species.

Key words: Mycobacterium , Bioinformatics, comparative genomics.

Article information’s INTRODUCTION Received on November 30, 2010 Accepted on February 8, 2011 The Mycobacteria have been classified into the family Mycobacteriaceae within the order Corresponding author Actinomycetales based on similarities in Professor Moulay Mustapha ENNAJI morphological, physiological, and biochemical Laboratory of Virology and Hygiene & Microbiology, characters (1). This genus represents more than University Hassan II .Mohammedia- Casablanca. School of Sciences and Techniques. BP 146, Mohammedia, 20650, 120 species (16) including important pathogens of Morocco. human and cause major public health problems Fax: 212 5 23 31 53 53 and illnesses, such as tuberculosis, leprosy, and E-mail: [email protected] Buruli ulcer, and emerging diseases induced by Abbreviations: AIDS : Acquired Immunodeficiency atypical Mycobacteria which infect patients with Syndrome; DNA : Deoxyribonucleic Acid; M: AIDS or other immunocompromised individuals Mycobacterium ; rRNA : ribosomal Ribonucleic Acid, (2). BLAST : Basic Local Alignment Search Tool; NCBI: The huge amount of DNA sequence National Center for Biotechnology Information . information has enriched the development of comparative genomics which can be exploited in the field of infectious diseases research (25), Copyright © 2011 Cellular & Molecular Biology http://www.cellmolbiol.com

1462 F. ZAKHAM et al. /

additionally there are many tools available in Linux is an operative system similar to UNIX, which different web sites to facilitate the comparison of can be considered as a programming language by using the command interpreter Shell (bash) that can give us the different microbial genomes (19). opportunity to control executing programs and collect their Further, with more than 100 Mycobacterial results into files; furthermore this system has been used in genome sequences, comparative genome analysis this study to figure the BLAST matrix and the Pan and Core- provides exceptional new insights into the biology genome curve. The main source of information is of these worldwide important pathogens. (http://www.cbs.dtu.dk/services/GenomeAtlas ) (22) which is This analysis gives accurate genomic a web based user interface linked to the Genome Atlas information in respect of the genetic differences Database, can be accessed easily via this web site, in fact between these species, which are useful for better there are seven different structural atlases presented (such as understanding of their evolution, pathogenesis Base Atlas, Structure Atlas, and Repeat Atlas, etc). The Genome Atlas gives us a rapid overview of a mechanism, basis for virulence, and consequently sequenced bacterial genome in a simple scheme (10, 19). A to deal with the scientific priorities of better number of parameters are calculated for the DNA double drugs, vaccines, and diagnostics tools for helix based on the nucleotide sequence (11). These Mycobacterial diseases (6, 9). In this study we parameters belong to three categories: repeats, structural parameters, and the base composition. aim to outline a comparison between fourteen Web sites providing access to the main DNA sequence Mycobacterial genomes, based on the results of databases used in this paper are: bioinformatics methods (Bio Linux) in comparing - http://www.ncbi.nlm.nih.gov/ GenBank at NCBI. genome sequences which permits the study of - http://www.ncbi.nlm.nih.gov/ Ref Seq at NCBI. more complex evolutionary events. - http://prodigal.ornl.gov/(Prokaryotic DynamicProgram- ming Gene finding Algorithm). Most of these genomes are belonging to pathogenic Mycobacteria ( M. avium subsp. paratuberculosis K-10, M. bovis AF2122/9 , M. RESULTS AND DISCUSSION leprae Br4923, M. tuberculosis CDC1551, M. tuberculosis F11, M. tuberculosis H37Ra, M. Genome length tuberculosis H37Rv, M. tuberculosis KZN 1435, As can be observed for the fourteen and M. ulcerans) and the attenuated vaccine Mycobacterial genomes in Table 1, even for the strain M. bovis BCG str. Pasteur 1173P2, with different strains of the same species, there can be some of the free living Mycobacterial genomes a considerable size variation. And this is known (M. marinum M, M. sp. KMS, M. sp. MCS, ,and in bacteria as Ussery and Hallin, 2004 (17), M. vanbaalenii PYR-1) to give an idea about the mentioned in their study of the genomes of gene deletion on the term of evolution for those different strains of Prochlorococcus marinus. pathogenic strains (5). The smallest mycobacterial genome in Table1 is We have also introduced the genome atlas of the genome of M. leprae 3.268Mb, the infectious the reference strain M. tuberculosis H37R v which agent of leprosy (an intracellular bacteria), which can give a good overview of this genome (11, 19). can be explained by an extensive genome As a result of multiple genome analysis, the downsizing or genome decay occurred during the pan and core genome will be defined for some of evolution of M. leprae (5). Mycobacterial species, which is extremely useful On other hand the M. marinum has a to investigate the true diversity within and genome size of 6.65983 (chromosome of 6.63683 between bacterial species (15, 19). Mb plus plasmid of 0.023Mb), a free living And for examining the phylogenetic bacteria which need to have a more extensive relationships among these bacteria, a phylogentic adaptation potential, reflected by a larger tree has been constructed from 16S rRNA gene, genome, in contrast of the for tuberculosis and non tuberculosis pathogenic bacteria which can obtain their needs Mycobacteria to understand the evolutionary from the host (20). events of these species, as stated by other authors (4, 16). GC content and GC skew MATERIALS AND METHODS The GC content is an important tool to classify bacteria and it is considered to be an The bio Linux system issued from Linux, and a lot of additional programs that are often used within indicator of some physical properties of bacterial bioinformatics and computational molecular biology, genome. organized to use easily that made Bio Linux as the efficient As shown in Table 1, from the data which way to deal with and to handle large amounts of biological were obtained in this study Mycobacterial data.

1463 F. ZAKHAM et al. /

Table1. Summary of the mycobacterial genomes discussed in this paper (genome length, GC content, and No of genes in different data bases).

Genome Gene No Gene No Gene No GC Genome length Genbank Refseq Prodigal content Accession No

Mycobacterium avium subsp. paratuberculosis K-10 4.82978 4350 4350 4350 69.0% AE016958

Mycobacterium bovis AF2122/97 4.34549 3918 3918 65.0% BX248333

Mycobacterium bovis BCG str. Pasteur 1173P2 4.37452 3949 3949 3949 65.0% AM408590

Mycobacterium leprae Br4923 3.26807 1604 57.0% FM211192

Mycobacterium marinum 5452 5452

Chromosome 6.63683 65.0% CP000854

Plasmid pMM23 0.023 67.0% CP000895

Mycobacterium sp. KMS 5975 5975 5975

Chromosome 5.73723 68.0% CP000518

Plasmid pMKMS02 0.22 66.0% CP000520

Plasmid pMKMS01 0.3 65.0% CP000519

Mycobacterium sp. MCS 5615 5615 5615

Chromosome 5.70545 68.0% CP000384

Plasmid1 0.215075 66.0% CP000385

Mycobacterium tuberculosis CDC1551 4.40384 4189 4189 4189 65.0% AE000516

Mycobacterium tuberculosis F11 4.42443 3941 3941 3941 65.0% CP000717

Mycobacterium tuberculosis H37Ra 4.4 4034 4034 4034 65.0% CP000611

Mycobacterium tuberculosis H37Rv 4.4 3991 3988 3988 65.0% AL123456

Mycobacterium tuberculosis KZN 1435 4.4 4060 4059 4059 65.0% CP001658

Mycobacterium ulcerans Agy99 4241 4241 4241

Chromosome 5.63161 65.0% CP000325

Plasmid pMUM001 0.17 62.0% BX649209

Mycobacterium vanbaalenii PYR-1 6.5 5979 5979 5979 67.0% CP000511

species, are GC rich bacteria and it appears to be Number of genes in different data bases normal due to the large genome size of these After comparing the genes number in species as stated in different references (14, 19, different data bases: GenBank, ResSeq,and 20, and 21). Prodigal, we approximately obtained the same For most bacterial groups, there is a trend genes number of each species in different data for G’s to be biased towards the replication bases, except in the cases of M. tuberculosis leading strand and a bias for C’s towards the H37Rv (3991 in GenBank and 3988 in both other other strand, and generally there is a tendency of databases), and M. tuberculosis KZN 1435 (4060 GC rich region toward the origin of replication in GenBank and 4059 in both other databases). and a trend of AT rich region around the The different genes number, basically replication terminus as it can melt easily (18, 19). depend on the source of the data, in Genban

1464 F. ZAKHAM et al. /

genes are reported by the authors around the The two other circles of the genome show world, and are submitted to the NCBI data the presence of two kinds of repeats: repository, but the RefSeq genes are derived from The global direct repeats, which are relatively the primary GenBank and have been curated by common for this micro organism, the colours are RefSeq and This means that there can be scaled such that they vary from white for less differences between the two databases, although than 50% to darkly colored for more than 75% GeneBank and RefSeq are data bases at NCBI identity. The next circle shows the global (23). inverted repeats, on the same scale, we noted that But prodigal is an automated gene prediction many of the inverted repeats match the direct program which can analyze an entire microbial repeats; simply because, the sequence is repeated genome in 30 seconds or less both in the forward and reverse directions. (http://prodigal.ornl.gov/) (24). Mycobacteria have relatively many global direct repeats but few global inverted repeats (19). Genome Atlas In M. tuberculosis H37Rv chromosome there The Genome Atlas of the reference strain is a Bias of G’s towards the leading replication chromosome, M. tuberculosis H37Rv Fig 1 strand and the A’s are biased towards the shows, three outer circles which are representing replication lagging strand of the genome, which DNA structural properties: intrinsic DNA clearly shows the DNA replication origin near the curvature in the outermost followed by stacking 12 o’clock position. energy and position preference. Finally, the deviation of AT content from the DNA curvature and base-stacking measure chromosomal average percentage AT is plotted, structural properties of DNA alone, whereas ranging from 40% to 60% AT, with 50% AT in position preference measures the ability of the the middle; we remarked in the genome atlas of DNA helix to be bent by proteins (19, 22). this organism that this germ is GC-rich (blue). In Fig 1 it is also clear that the genes are As showed in Fig 2, the Base skew, towards more or less randomly distributed between the the leading and lagging strand influences the leading and lagging strands, blue on the positive structure of the DNA, the AT and GC skew are strand (Coding sequence proteins CDs+) and red pointing in apposite directions with a clear bias on the negative strand (non Coding sequence of G’s towards the leading replication strand, and proteins CDs-) as re-annotated by Campaus et al the A’s towards the lagging strand. in 2002 (3) for this genome.

Figure 1. Genome Atlas of chromosome of M. tuberculosis H37Rv . The outer three lanes represent physical properties of the DNA (intrinsic curvature, stacking energy and position preference). Following the two lanes with annotated genes for the positive and negative strand, two lanes show the presence of repeats, and the last two lanes are taken from a Base Atlas (http://www.cbs.dtu.dk/services/GenomeAtlas ).

1465 F. ZAKHAM et al. /

tuberculosis H37Rv, M. tuberculosis KZN 1435, M. ulcerans Agy99, and M. vanbaalenii- PYR1, which represent more than 12 500 genes for the pan genome shown in Fig.4., which are larger three times than are present in the reference strain M. tuberculosis H37Rv. Some of these genes are only found in one or a few genomes, whereas others are present in most or all of the sequenced isolates. However, if we look at the pan-genome of an individual species, for instance, M. bovis AF2122/97 which infects a very wide variety of mammalian species Figure 2. The M. tuberculosis H37Rv genome at the including humans, or M. bovis BCG str. Pasteur displays a clear bias of G’s towards the leading replication 1173P2 which is an attenuated variant of M.bovis strand, and the A’s towards the lagging strand (7), their species’ pan-genome would contain (http://www.cbs.dtu.dk/services/GenomeAtlas ). approximately the same genes of their typical genomes. Blast Matrix As expected, there is a jump when adding a BLAST matrix is one of the important new species, in our case M. leprae which is an methods of comparing bacterial genomes (19), intracellular bacterium induces the leprosy in which plots the number of hits in a given set of humans . proteomes against each other. In this matrix, the The core genome of a single Mycobacterium similarity between fourteen Mycobacterial sp contains approximately 550 genes. Thus, genomes have been introduced with inter and approximately a 1/7of the genes are intra-species comparison Fig.3. The intra species indispensable genes. Since the core genome comparison of M. tuberculosis strains (M. covers all genes conserved between all tuberculosis CDC1551, M. tuberculosis F11, M. (sequenced) members of a species and will also tuberculosis H37Ra, M. tuberculosis H37Rv, M. contain all genes that are essential for all life tuberculosis KZN 1435) represents a good forms, such as genes coding for transcription, example of similarity among intra-species, which translation, replication, and essential metabolism ranged between; 96.1% -99.2 (which is darker proteins (19). green, indicative of a higher degree of similarity One thing to note is that the pan-genome of within these strains). M. bovis AF2122/97, and M. bovis BCG str, is A high similarity between these strains and similar to the core genome which is remarked by other M. tuberculosis complex members ( M. the two adherent curves in this part of the graph. bovis AF2122/97, and M. bovis BCG str. Pasteur Another remarkable point that the five M. 1173P2) has been observed, which ranged tuberculosis strains have the same core and pan- between (93.0%- 94.8%). In contrast with other genome presented by the straight curve above Mycobacterial species, this similarity has been each strain which is in correlation with the results decreased especially in the free living of the BLAST Matrix and the phylogentic Mycobacteria (indicated by pale colours). analysis( as we will see later) on the term of similarity between these strains. A significant Pan and core Genome jump in the pan-genome is introduced when The core genome and a pan-genome are moving to the last two genomes of M. ulcerans hypothetical combinations of genes that describe Agy99, and M. vanbaalenii- PYR1, although the the full genetic collection of an investigated core genome is still the same number of genes in population as in the pan-genome (15), or the both of them. hypothetical set of genes that will always be present in the investigated population as the core Phylogenic relation genome. Phylogenetic trees are often constructed Here we have defined the pan-genome and from 16S rRNA genes. These are genes that code core genome of 12 Mycobacterial genomes of for a 16S rRNA that is found within the small (M. bovis AF2122/97, M. bovis BCG str. Pasteur subunit of the ribosome. 1173P2, M. leprae Br4923 M. marinum M, M. The 16S rRNA gene sequence is about 1,550 sp. KMS, M. sp. MCS, M. tuberculosis CDC1551, bp long and is composed of both variable and M. tuberculosis F11, M. tuberculosis H37Ra, M. conserved regions. The gene is large enough, Copyright © 2011 Cellular & Molecular Biology http://www.cellmolbiol.com

1466 F. ZAKHAM et al. /

Figure 3. The blast matrix of fourteen mycobacterial genomes.

Figure 4. The pan-genome ( blue line ) and core genome ( red line ) for Mycobacterium. The number of discovered novel genes (dark bars ) and novel gene families ( light-grey bars ) are also shown for each added genome.

1467 F. ZAKHAM et al. /

with sufficient inter specific polymorphisms of necessity for improving techniques of diagnosis 16S rRNA gene, to provide distinguishing and and controlling these diseases. statistically applicable measurements (4). Whole- The software of bioinformatics and genome analysis has been tried, but it is quite computational sequence analysis are potential difficult because the genomes have different and powerful tools to view and to analyse sizes; however, it has been observed that the trees sequence data generated from databases. based on whole-genomic analysis and the 16S Furthermore the comparative genomic tool rRNA gene trees are similar (8) and for this allows direct, and interactive, comparisons of raison these trees are used to investigate long- multiple genomes/sequences. This enables us to distance evolutionary relationships. exploit the growing number of genomes from From Fig 5 we found that the species of M. closely related organisms to look at genome vanbaalenii- PYR1 and M. sp MCS (their architecture and evolution. genomes length are 6.5, 5.9, respectively), which are environmental micro organisms, able to metabolize a wide range of polycyclic aromatic hydrocarbons (12), are separated by a complete outlier. The horizontal line at the top (in this case, 0.005) is used to provide a rough measure of genetic distance. In contrast of the pathogenic Mycobacteria which represent the other outlier, as we mentioned in the first part of this paper, a lot of these bacteria had undergone to genome reduction due to their parasitic life style which offer their needs from the host (20). The strains of M. tuberculosis MTB ( M. tuberculosis CDC1551, M. tuberculosis H37Ra, M. tuberculosis H37Rv, M. tuberculosis KZN 1435), are presented by a separated clade, which indicate, that these bacteria are sharing the same Figure 5. Phylogenetic tree based on 16S rRNA of 10 ancestor in their evolutionary events. For the mycobacterial species constructed by a neighbor-joining algorithm. other pathogenic non tuberculosis mycobacteria (M. leprae Br4923, sp. KMS, M. sp. MCS, M. Acknowledgments - This study was held at the National ulcerans Agy99 ), which are displayed by Centre of Scientific Research & Techniques (CNRST), in different clades, representing the relatedness Rabat, Morocco, in collaboration with School of Science between these species and the members of MTB and Techniques- Mohammedia (Laboratory of Virology and as proved by different studies on comparative Hygiene & Microbiology), School of Science-Rabat, and National Institute of Hygiene-Rabat. genome analysis, for example Li et al in 2005(13) The authors thank Pr. Peter Dawyndt and Karen Langensen identified more than 3,000 genes of M. avium for their generous assistance with informatics. Special subspecies paratuberculosis strain K-10,( the thanks to Pr. Mohammed Amar the head of Microbiology causative agent of Johne’s disease in cattle ) are department and Pr. EL Mustafa El Fahime the head of Molecular Biology department in the CNRST. homologs to the human pathogen M. tuberculosis . Even for M. leprae (5) which suffered of an extensive genome downsizing. REFERENCES

Concluding Remarks 1. Baron, S., In: Medical Microbiology , Galveston (TX): With this wealthness of knowledge of University of Texas. Medical Branch. 1996. NCBI bookshelf. bacterial genomes, there’s a special need for tools 2. Brooks, G. F., Butel, J. S., Morse, S. A., In: Jawetz, of comparison, visualization and analyzing these Melnick, Adelberg‘s Medical Microbiology, 21 st edition, huge amount of sequence information. Lange Medical book. 1998, PP. 279-283. Especially in the case of pathogenic micro 3. Camus, J.C., Pryor, M. J., Medigue, C. and Cole, S. T., Re-annotation of the genome sequence of Mycobacterium organisms which represent a real threat of tuberculosis H37Rv. Microbiology . 2002, 148 : 2967–2973. humanity such as M. tuberculosis , and M. leprae 4. Clarridge III, J. E., Impact of 16S rRNA Gene Sequence the causative agents of tuberculosis and leprosy, Analysis for Identification of Bacteria on Clinical respectively. Indeed there is an important Microbiology and Infectious Diseases. 2004, Clin Microbiol reveiw , 840–862.

1468 F. ZAKHAM et al. /

5. Cole, S.T., Eiglmeier, K. , Parkhill, J, James K. D., 13. Li L, Bannantine J P., Zhang et al, 2005.The complete Thomson, N. R., Wheeler, P. R., Honore , N., Garnier, T., genome sequence of M. avium subspecies paratuberculosis. Churcher, C., Harris, D., Mungall, K., Basham, D., Brown, PNAS , 102 : 12344–12349. D., Chillingworth, T., Connor, R., Davies, R. M., Devlin, K., 14. Mann, S., Chen, Y. P., Bacterial genomic G+C Duthoy, S., Feltwell, T., Fraser, A., Hamlin, N., Holroyd, S., composition-eliciting environmental adaptation. Genomics. Hornsby, T., Jagels, K., Lacroix, C., Maclean, J. , Moule, S., 2010, 95 :7–15. Murphy, L., Oliver, K., Quail,M. A., Rajandream, M.-A., 15. Read, T. D. and Ussery, D. W., Opening the pan- Rutherford, K. M., Rutter, S., Seeger, K., Simon, S. , genomics box. Current Opinion in Microbiol. 2006, 9:496– Simmonds, M., Skelton, J., Squares, R., Squares, S., 498. Stevens, K., Taylor, K., Whitehead, S., Woodward, J. R. and 16. Tortoli, E., The new mycobacteria: an update. FEMS Barrell, B. G., Massive gene decay in the leprosy bacillus. Immunol Med Microbiol . 2006, 48 : 159–178. Nature . 2001, 409 : 1007-1011. 17. Ussery, D. W. and Hallin, P. F., Genome Update: length 6. Cole, S. T., Comparative mycobacterial genomics as a distributions of sequenced prokaryotic genomes. Microbiol tool for drug target and antigen discovery. Eur Respir J . Comment. 2004a, 150 : 513-516. 2002a, 20 (Suppl 36) : 78–86. 18. Ussery, D. W. and Hallin, P. F., Genome Update: AT 7. Cole, S. T., Comparative and functional genomics of the content in sequenced prokaryotic genomes. Microbiol M. tuberculosis complex. Microbiology. 2002 b, 148 :2919– Comment. 2004b, 150 :749-752. 2928. 19. Ussery, D. W., Borini, S., Wassenaar, T. M., In: 8. Eisen, A. J., Assessing evolutionary relationships among Computing for Comparative Microbial Genomics: microbes from whole-genome analysis. Current Opinion in Bioinformatics for Microbiologists (Computational series). Microbiol . 2000, 3:475–480. London, Verlag: Springer. 2009. 9. Fraser, C. M., Eisen, J. A. and Salzberg, S. L., Microbial 20. Wassenaar T.M, Bohlin J, Binnewies T.T and Ussery genome sequencing. Nature . 2000, 406 : 799-803. D.W., Genome Comparison of Bacterial Pathogens. 10. Hallin, P. F. and Ussery, D. W., CBS Genome Atlas Microbial Pathogenomics. 2009, 6: 1–20. Database: a dynamic storage for bioinformatic results and 21. Wassenaar T. M, Binnewies T. T, Hallin P. F, Ussery D. sequence data. Bioinformatics . 2004, 20 :3682–3686. W. 2010 Tools for Comparison of Bacterial Genomes. 11. Jensen, L.J., Friis, C., and Ussery, D.W., Three views of Handbook of Hydrocarbon and Lipid Microbiology. microbial genomes. Res Microbiol. 1999, 150 : 773–777. Springer-Verlag Berlin Heidelberg. 12. Kim, S. J., Kweon, O., Freeman, J. P., et al, Molecular 22. www.cbs.dtu.dk/services/GenomeAtlas . Cloning and Expression of Genes Encoding a Novel 23. www.ncbi.nlm.nih.gov . Dioxygenase Involved in Low- and High-Molecular-Weight 24. www.prodigal.ornl.gov. Polycyclic Aromatic Hydrocarbon Degradation in M. 25. Zhang R, Zhang C-T. The impact of comparative vanbaalenii PYR-1. Applied & Ennvironmental Microbiol . genomics on infectious disease research. Microbes and 2006, 72 : 1045–1054. Infection. 2006, 8: 1613-1622.

1469 Doctorat Es Science in Microbiology & Molecular Biology Results 2012

Publication VI Fathiah ZAKHAM , Othmane AOUANE, David USSERY, Abdelaziz BENJOUAD and Mouly Mustapha ENNAJI. 2012. Computational and comparative genomics-proteomics and Phylogeny analysis of twenty one mycobacterial genomes. BMC Microbial informatics& experimentation (Accepted).

Zakham et al. Microbial Informatics and Experimentation 2012, 2:7 http://www.microbialinformaticsj.com/content/2/1/7

1 RESEARCH Open Access

2 Computational genomics-proteomics

3 and Phylogeny analysis of twenty one

4 mycobacterial genomes (Tuberculosis &

5 non Tuberculosis strains)

1† 2,3† 4 2 1* 6 Fathiah Zakham , Othmane Aouane , David Ussery , Abdelaziz Benjouad and Moulay Mustapha Ennaji

7 Abstract

8 Background: The genus Mycobacterium comprises different species, among them the most contagious and 9 infectious bacteria. The members of the complex Mycobacterium tuberculosis are the most virulent microorganisms 10 that have killed human and other mammals since millennia. Additionally, with the many different mycobacterial 11 sequences available, there is a crucial need for the visualization and the simplification of their data. In this present 12 study, we aim to highlight a comparative genome, proteome and phylogeny analysis between twenty-one 13 mycobacterial (Tuberculosis and non tuberculosis) strains using a set of computational and bioinformatics tools 14 (Pan and Core genome plotting, BLAST matrix and phylogeny analysis). 15 Results: Considerably the result of pan and core genome Plotting demonstrated that less than 1250 Mycobacterium 16 gene families are conserved across all species, and a total set of about 20,000 gene families within the 17 Mycobacterium pan-genome of twenty one mycobacterial genomes. 18 Viewing the BLAST matrix a high similarity was found among the species of the complex Mycobacterium 19 tuberculosis and less conservation is found with other slow growing pathogenic mycobacteria. 20 Phylogeny analysis based on both protein conservation, as well as rRNA clearly resolve known relationships 21 between slow growing mycobacteria. 22 Conclusion: Mycobacteria include important pathogenic species for human and animals and the Mycobacterium 23 tuberculosis complex is the most cause of death of the humankind. The comparative genome analysis could 24 provide a new insight for better controlling and preventing these diseases.

25 Keywords: BLAST matrix, Comparative genome analysis, Evolution, Mycobacterium tuberculosis, Pan- core genome, 26 Phylogeny

27 Background mammals and its DNA is still detectable in the bones of 35 28 The genus Mycobacterium comprises more than 120 Egyptian mummies [2-4]. It is noteworthy that the 36 29 species, among them the most contagious and infectious human TB could be also induced by M. bovis, which 37 30 bacteria [1]. In particular, M. tuberculosis (MTB) is the belongs to the MTB complex (MTBC) and principally 38 31 causal agent of tuberculosis (TB), which is an ancient infects cattle, but the zoonotic risk for human represents 39 32 microorganism infecting and killing humans for thou- a serious problem predominantly, for those who are liv- 40 33 sands of years. Several studies demonstrated that this ing at animal-human interface [5]. 41 34 bacterium is an intracellular microorganism restricted to Moreover, according to the recent archeological stud- 42 ies carried out on the Siberian skeletal remains from the 43 * Correspondence: [email protected] iron age and based on the single-nucleotide polymorphic 44 †Equal contributors loci PCR and the analysis of the regions of difference 45 1Laboratoire de Virologie et Hygiène & Microbiologie, Faculté des Sciences et Techniques, BP 146, Mohammedia 20650, Morocco (RDs) of the MTBC, Taylor et al. confirmed the presence 46 Full list of author information is available at the end of the article

© 2012 Zakham et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Zakham et al. Microbial Informatics and Experimentation 2012, 2:7 Page 2 of 9 http://www.microbialinformaticsj.com/content/2/1/7

47 of M. bovis in those remains [6]. Before this discovery database (TBDB) [23,24] and with the huge amount of 101 48 many studies suggested that the common ancestor of mycobacterial sequences, there is a crucial need for the 102 49 MTBC was M. bovis [7,8], but this idea has been refuted visualization, simplification and comparative genomics 103 50 and the genetics of the MTBC explained different clues of their data for better understanding their evolutionary 104 51 for debating in the term of their evolution over the events and consequently, the conception of their envir- 105 52 years. The sufficient evidence of the common ancestor onmental niches, mechanisms of adaptation into human 106 53 of these microorganisms was surrounded by a mystery and animal being, pathogencity, virulence determinants 107 54 and recently, the ambiguity regarding this question mark that paved the way for appropriate conditions of survival 108 55 was uncovered and a new scenario was demonstrated by within their hosts and the development of new tools of 109 56 studying 20 variable deleted regions within the MTBC diagnosis and drug targets for better controlling those 110 57 members [9]. As a result of those studies, M.canettii sta- threatening diseases [25]. 111 58 ted to be the common ancestor that did not lack those Thus, a set of different approaches were used for 112 59 regions, unlike M. bovis that lost several genes are studying the phylogeny of MTBC by fingerprinting the 113 60 present in MTB and smooth MTB [9]. insertion sequence IS6110 [26] or by the SNPs based 114 61 Furthermore, it has become clear that the members of analysis [21,22] and the phylogeny of other mycobacteial 115 62 MTBC were originated from a single ancestor resulted species was performed based on the extracted 16S rRNA 116 63 from an evolutionary bottleneck and a clonal expansion sequences [27,28]. 117 64 occurred 20,000 to 35,000 years ago [9-11]. In addition Recently, the availability of bioinformatics tools for 118 65 the progenitor of MTBC offspring was restricted in a genomic comparison facilitated handling, visualizing and 119 66 limited geographical region (East Africa) and called “M. analyzing of enormous amount of sequence information 120 67 prototuberculosis” [11]. of multispecies bacterial genomes [29,30]. Therefore, this 121 68 Importantly, most of the pathogenic or slow growing present study aims to highlight a comparative genome, 122 69 mycobacteria are sharing a high similarity and a strong proteome and phylogeny analysis by the computational 123 70 phylogeny relationship [12,13] and interestingly, several and bioinformatics tools (Pan and Core genome plotting, 124 71 studies confirmed that the pathogenic mycobacteria BLAST matrix and phylogeny analysis for the compari- 125 72 were originated from a free living progeny [9] and due son between twenty-one mycobacteral strains, some of 126 73 to the genome reduction and the acquisition of new them are belonging to the MTBC and other non tuber- 127 74 genes by horizontal gene transfer (HGT) [14-17] and culosis mycobacterial (NTM) strains (pathogenic and 128 75 gene rearrangement [17], their capacity of parasitism free living myobacteria). 129 76 and infectiousness was developed for enabling them to 77 cause severe and dangerous illnesses. Results 130 78 Indeed, the efforts worldwide focus on the combat Twenty-one mycobacterial genomes were obtained from 131 79 against TB, leprosy, Buruli ulcer and other mycobacterial the GenBank database and used in this study, eight of 132 80 diseases and the medical care providers face a great chal- them are belonging to the MTBC and thirteen genomes 133 81 lenge toward the achievement of this goal. As a result, are representing non tuberculosis mycobacteria. 134 82 the first sequenced mycobacterial genome was that of Table 1 summarizes a number of characteristics for each 135 T1 83 the reference strain M. tuberculosis H37 Rv [18] and it of the analyzed genome, such as size, number of predicted 136 84 was re annotated in 2002 by Camus et al. [19]. In 2002, genes, rRNA operons, tRNA genes and GC content. 137 85 the second MTB genome sequence of the clinical strain The size of genomes is considerably varied between 138 86 CDC1551 was completed and a whole comparative gen- species. Moreover, the common character of mycobac- 139 87 ome analysis was done with the reference strain H37 RV terial species is their high GC content and remarkably 140 88 based on Large Sequence Polymorphisms (LSPs) and most of the pathogenic slow growing mycobacteria have 141 89 Single Nucleotide Polymorphisms (SNPs) [20].The SNPs a single rRNA operon and a low number of tRNA, com- 142 90 were also used as comparative genome markers for paring with the RGM. 143 91 studying the evolution, pathogensis and molecular epi- 92 demiology of clinical MTB strains and a new phylogeny Pan- and core- genome plot 144 93 analysis based on SNPs arrangement was established by The proteomes of the genomes against each other were 145 94 Alland et al. [21]. More recently, Fillol et al. also predicted, extracted, and BLASTed, from all the ana- 146 95 described the same approach and they have identified lyzed genomes. 147 96 six SNP cluster groups (SCGs) and five subgroups within Twenty-one Mycobacterial genomes coded for 97,304 148 97 the MTBC members [22]. genes in total, with 4,633 genes in average per genome 149 98 Recently, different databases were established and pro- were used for uncovering the pan and core genome. The 150 99 vided the complete genome annotation of the reference pan and core-genome was calculated and the resulting 151 100 strain and other TB strains, such: TubercuList and TB plot is shown in Figure 1. 152 F1 Zakham et al. Microbial Informatics and Experimentation 2012, 2:7 Page 3 of 9 http://www.microbialinformaticsj.com/content/2/1/7

t1:1 Table 1 Characteristics of 21 mycobacterial genomes t1:2 Genome Genome Number GC 5S rRNA 16S rRNA 23S rRNA tRNA Gen Bank Size of genes content count count count count Accession Number t1:3 Mycobacterium leprae Br4923 3268071 2720 57.8 1 1 1 45 FM211192 t1:4 Mycobacterium leprae TN 3268203 2720 57.8 1 1 1 45 AL450380 t1:5 Mycobacterium bovis AF2122/97 4345492 3953 65.6 1 1 1 45 BX248333 t1:6 Mycobacterium bovis BCG str. Pasteur 1173P2 4371711 3988 65.6 1 1 1 47 AM408590 t1:7 Mycobacterium bovis BCG str. Tokyo 172 4371711 3984 65.6 1 1 1 45 AP010918 t1:8 Mycobacterium tuberculosis KZN 1435 4398250 4060 65.6 1 1 1 45 CP001658 t1:9 Mycobacterium tuberculosis CDC1551 4403837 4189 65.6 1 1 1 45 AE000516 t1:10 Mycobacterium tuberculosis H37Rv 4411532 3999 65.6 1 1 1 45 AL123456 t1:11 Mycobacterium tuberculosis H37Ra 4419977 4034 65.6 1 1 1 45 CP000611 t1:12 Mycobacterium tuberculosis F11 4424435 3950 65.6 1 1 1 45 CP000717 t1:13 Mycobacterium abscessus ATCC 19977 5090491 4941 64.1 1 1 1 47 CU458896 t1:14 Mycobacterium avium subsp. paratuberculosis K-10 4829781 4350 69.3 1 1 1 46 AE016958 t1:15 Mycobacterium avium 104 5475491 5120 69.0 1 1 1 46 CP000479 t1:16 Mycobacterium ulcerans Agy99 5805761 4241 65.4 1 1 1 45 CP000325 t1:17 Mycobacterium sp. MCS 5920523 5615 68.4 2 2 2 48 CP000384 t1:18 Mycobacterium gilvum PYR-GCK 5982829 5579 67.7 2 2 2 47 CP000656 t1:19 Mycobacterium sp. JLS 6048425 5739 68.4 2 2 2 48 CP000580 t1:20 Mycobacterium sp. KMS 6256079 5975 68.2 2 2 2 48 CP000518 t1:21 Mycobacterium vanbaalenii PYR-1 6491865 5979 67.8 2 2 2 49 CP000511 t1:22 Mycobacterium marinum M 6660144 5452 65.7 1 1 1 46 CP000854 t1:23 Mycobacterium smegmatis str. MC2 155 6988209 6716 67.4 2 2 2 47 CP000480

153 For each proteome, a BLAST search was performed By the addition of new genomes the variability be- 178 154 against all previous proteomes and were considered con- tween genomes was obviously unambiguous, especially 179 155 served if they showed sequence similarity of 50% over in the pan genome, which correlates with the larger gen- 180 156 more than 50% of the full length, as defined in the ma- ome sizes with new accessory genes, especially in the 181 157 terial section. free living mycobacteria or the RGM, that have the big- 182 158 The first two genomes represented are belonging to ger genome sizes, as shown in the plot. 183 159 the complex MLP and they approximately have the same The core-genome, which represents the minimal set of 184 160 pan and core genome and both of pan and core genome conserved gene families, was dropped and at the time of 185 161 curves are adherent together, which indicate that most calculation, based on the best fitting extrapolation; it 186 162 of dispensable genes are lost and the conserved genes was estimated to be approximately 1250 gene families 187 163 are still persisting in those species. Since the core gen- for twenty one myocbacterial genomes. 188 164 ome covers all genes conserved between all (sequenced) Moreover, a total set of about 20,000 gene families 189 165 members of a species and will also contain all genes that within the Mycobacterium pan-genome were defined, in- 190 166 are essential for all life forms, such as genes coding for cluding the conserved and dispensable genes. 191 167 transcription, translation, replication, and essential me- 168 tabolism proteins. 169 As expected, moving along to the new genomes of BLAST matrix 192 170 MTBC members, there is a significant jump for both of The results of the genomic analysis of predicted prote- 193 171 pan and core genome curves. By the addition of the ome are visualized by BLAST matrix Figure 2, in which 194 F2 172 accessory genes, the pan genome is increased, in con- the pairwise whole-genome comparison was done. 195 173 trast of the conserved genes presented by the core gen- The percentage of similarity for each combination is 196 174 ome that are dropped. presented by green color between genomes and red 197 175 Significantly, all the species of the MTBC have the color shows similarity within the same genome. 198 176 same pan and core genomes, reflecting the high degree The comparison of the MTB the species reveals a high 199 177 of similarity between them. similarity among them, ranging between; 96.1–99.2% 200 Zakham et al. Microbial Informatics and Experimentation 2012, 2:7 Page 4 of 9 http://www.microbialinformaticsj.com/content/2/1/7

New genes New gene families Core genome Pan genome 0 5000 10000 15000 20000 123456789101214161820 Figure 1 The pan-genome (blue line) and core genome (red line) for Mycobacterium. The number of discovered novel genes (dark bars) and novel gene families (light-grey bars) are also shown for each added genome.

201 (colored with darker green, an indicative of a higher de- The results of Phylogentic analysis are shown in 221 202 gree of similarity within these strains). Figure 3; remarkably the free living mycobacteria are 222 F3 203 The similarity between M. bovis with MTB strains was separated by a complete outlier (in exception of M. 223 204 ranged between; 93.7–94.8% and between M.bovis and abscessus) and the pathogenic mycobacteria represent 224 205 attenuated M. bovis BCG vaccine strains were 96.7% and the other outlier, the later is composed of four separated 225 206 97.1%, with M bovis BCG str. Pasteur 1173P2, M bovis clades: MTBC, M. ulcerans-marinum, MAV and MPL 226 207 BCG str. Tokyo 172 respectively. complex. The horizontal line at the top (in this case, 227 208 The similarity between the members of the complex 0.005) is used to provide a rough measure of genetic dis- 228 209 MLP was of 97.5% and it was very low between the mem- tance. Moreover, the booststraps values are also indicated 229 210 bers of MTBC and MLP. Interestingly, the similarity be- on the constructed phylogenetic tree Figure 3. 230 211 tween the MTBC and M.Marinum was ranged between Significantly, the members of MTBC are clustered to- 231 212 47.0–47.7% and less similarities were found between the gether; demonstrating a high similarity between them 232 213 MTBC, M ulcerans Agy99 and the MAV complex. and confirming that the MTBC members are sharing the 233 214 Furthermore, the similarity between pathogenic and same ancestor in their evolutionary events and there is a 234 215 free living mycobacteria was very low, presented by the high relatedness between them and other pathogenic 235 216 pale green color between their predicted proteomes. NTM; especially M. Marinum, as mentioned above in 236 the results of the BLAST matrix. 237 217 Phylogentic analysis 218 For studying the evolution of the mycobacterial species a Discussion 238 219 phylogenetic tree was constructed, based on the The genus Mycobacterium comprises more than 120 239 220 extracted 16S rRNA sequences. species; among them the saprophytes that adopted for 240 Zakham et al. Microbial Informatics and Experimentation 2012, 2:7 Page 5 of 9 http://www.microbialinformaticsj.com/content/2/1/7

Figure 2 Genomic analysis of predicted proteome for twenty one mycobacterial strains by BLAST matrix, based on pairwise whole- genome comparison. The percentage of similarity for each combination is presented by green color between genomes and red color shows similarity within the same genome.

241 free living lifestyle. Others are contagious, infectious and and the discovery of new genome sequences could add 269 242 cause dangerous diseases for human and animals [1]. new genes to the current pan genome. 270 243 Moreover, the availability of complete genome sequences Unsurprisingly, the results of the core genome are in 271 244 of these important pathogens provided a wealth of infor- correlation with a previous experimental study realized 272 245 mation that could enable understanding the mechanisms by Marmiesse et al., in which they have estimated about 273 246 of evolution, pathogenesis and systematically potential 1439 genes as minimal set of conserved genes in the 274 247 targets of drug discovery [25]. In general, the mycobac- core genome of MTB and MLP, among them 219 genes 275 248 teria belong to the phylum of Actinobacteria that are that code for proteins show no similarity with proteins 276 249 characterized by their large genome size and high GC from other mycobacterial species [33]. Consequently, 277 250 content [30] and owing to their different lifestyles and this approach could help in the designation of new TB 278 251 environmental niches, the sizes of their genomes are var- vaccines as reported by Jungblut et al. [34]. 279 252 ied [29]. In reality, one genome sequence is not enough for the 280 253 Remarkably, the pathogenic slow growing mycobac- development of a valuable vaccine and the definition of 281 254 teria had undergone to genome reduction [29] and pan and core genome can provide a new insight for 282 255 consequently, they have a single rRNA operon and a attaining this goal. 283 256 low number of tRNA, comparing with the RGM [30]. Even more, the comparative genomic analysis of pre- 284 257 In this context, the loss of genes played an important dicted proteome by BLAST matrix showed a high simi- 285 258 role in the evolution of slow growing mycobacterial larity among MTB strains as already reported [35]. The 286 259 pathogens [31] and some of those genomes were similarity values between MTB strains, M.bovis and atte- 287 260 suffered of an extensive genome downsizing like the nuated M. bovis BCG vaccine strains were reasonable 288 261 MLP complex [32]. On otherwise the members of and the slight difference between the two vaccine strains 289 262 MTBC were subjected to moderate genome reduction (96.7%, 97.1%) could be attributed to the lack of RD 14 290 263 and concomitantly, acquired new genes towards the and the restricted duplication DU1 in the BCG Pasteur 291 264 speciation to the parasitic life style in mammalian strain [36]. Interestingly, the similarity between the 292 265 macrophages. MTBC and M.marinum was ranged between 47.0– 293 266 With the considerable genome size differences among 47.7%. Regardless of the bigger genome size of M. Mari- 294 267 the species included in this study, the number of added num, the close relatedness between those two species 295 268 new genes per genome has increased the pan genome was documented and 3000 orthologs were shared 296 Zakham et al. Microbial Informatics and Experimentation 2012, 2:7 Page 6 of 9 http://www.microbialinformaticsj.com/content/2/1/7

0.005 Mycobacterium abscessus ATCC 19977

Mycobacterium vanbaalenii PYR-1

Mycobacterium gilvum PYR-GCK 93

Mycobacterium smegmatis str. MC2 155 46

29 Mycobacterium sp. JLS

100 Mycobacterium sp. MCS

85 Mycobacterium sp. KMS

Mycobacterium tuberculosis KZN 1435 43

35 Mycobacterium tuberculosis H37Rv

39 Mycobacterium tuberculosis H37Ra 100 36 Mycobacterium bovis BCG str. Tokyo 172

31 Mycobacterium bovis BCG Pasteur 1173P2

64 Mycobacterium bovis AF2122/97

100 Mycobacterium tuberculosis CDC1551

88 Mycobacterium tuberculosis F11

Mycobacterium marinum M 63 100 Mycobacterium ulcerans Agy99

Mycobacterium leprae TN

100 Mycobacterium leprae Br4923

Mycobacterium avium 104

100 Mycobacterium avium subsp. paratuberculosis K-10 Figure 3 Phylogenetic tree based on extracted 16S rRNA sequences of twenty one mycobacterial species. The members of the complex Mycobacterium tuberculosis are clustered together and sorted from the same clade.

297 between both genomes [37]. This support the hypothesis [40] showed a less similarity and the least similarity was 310 298 of the decendy of MTB from an environmental Myco- found with the complex MLP and this could be attribu- 311 299 bacterium and due to the genome downsizing and the ted to the loss of PE_PGRS proteins in both of those 312 300 acquisition of new genes by HGT [14,38], their capability species [41], Furthermore, the absence of many genes in 313 301 of parasitism was evolved towards the mammalian MAV and the presence of pseudogenes in MLP elucidate 314 302 macrophages [14,37]. the specificity of their virulence, tropism, the ability of 315 303 M ulcerans Agy99, which evolved from the same an- cultivation and drug susceptibility pattern [42]. 316 304 cestor of M. marinum and has shown a less similarity For better understanding the evolution of mycobacter- 317 305 with MTBC members (43%) and notably, this bacterium ial strains a phylogenetic tree was constructed based on 318 306 suffered of deletions, mainly, in the ESX1 locus [39], 16 rRNA sequences, which allows the identification of 319 307 which is present in MTB and M marinum. most species within the genus Mycobacterium and can 320 308 Significantly, M. aviums sp. Paratuberculosis strain K- separate between the slow and RGM [27] and can be 321 309 10 with more than 3,000 homologous genes with MTB used for the systematic phylogeny analysis [28]. 322 Zakham et al. Microbial Informatics and Experimentation 2012, 2:7 Page 7 of 9 http://www.microbialinformaticsj.com/content/2/1/7

323 Unsurprisingly, the results of phylogeny analysis were genome analysis, which can provide new insights for bet- 375 324 in correlation with the previous results of genomic ana- ter controlling and preventing infectious diseases. 376 325 lysis of predicted proteome, which leads to an assertion 326 that the ancestral MTBC and M. marinum genomes 327 might be descended from the same ancestry owing to Materials & methods 377 328 their close genetic relationship and phylogenetic Bacterial strains 378 329 relatedness. The main source of information is: http://www.ncbi.nlm. 379 330 Markedly, before the evolutionary bottleneck and nih.gov/ GenBank at NCBI, from which twenty one gen- 380 331 clonal expansion of MTB members, the ancestral M. omes of pathogenic and free living mycobacterial strains 381 332 prototuberculosis species had acquired the particular were retrieved for this study. Among them eight strains 382 333 Rv0986-8 virulence operon by HGT from an alpha pro- belong to the MTBC: the reference strain M tuberculosis 383 334 teobacterium [15] and evidently this operon still exists H37Rv, the attenuated laboratory strain M tuberculosis 384 335 only in MTBC members. H37Ra, the modern laboratory strains: M tuberculosis 385 336 Moreover, our study confirmed the high phylogenetical KZN 1435, M tuberculosis CDC1551, M tuberculosis 386 337 relationship among: MTBC, M.marinum- ulcerans, F11, the bovine TB strain M bovis AF2122/97 and two 387 338 MAV and MLP complex, showing that the pathogenic attenuated vaccine strains M bovis BCG str. Pasteur 388 339 slow growing mycobacteria define a distinct and com- 1173P2, M bovis BCG str. Tokyo 172. 389 340 mon line of evolutionary descent from a free living Two genomes belong to the complex of M. Leprae 390 341 bacterium. (MLP), which is responsible of leprosy in human: M 391 342 Interestingly, the RGM have also acquired different leprae Br4923, M leprae TN. 392 343 genes toward the speciation to their environmental niches, Other two strains were among the complex of M. 393 344 like the acquisition of PAH Catabolism Genes in: Msp. Avium (MAV) that induce Johne’s disease in cattle and 394 345 MCS, M gilvum PYR-GCK, M sp. JLS, M sp KMS and M other ruminants: M avium subsp. paratuberculosis K-10, 395 346 vanbaalenii PYR-1) [43], which enabled them to degrade M avium104. The causative agent of Buruli ulcer M 396 347 polycyclic aromatic hydrocarbons. Significantly, many of ulcerans Agy99 and M marinumthat causes granuloma- 397 348 RGM are ubiquitous in the environment and could be- tous lesions in fish and sometimes skin lesions in human 398 349 come pathogenic for humans and induce opportunistic in- were also included. 399 350 curable infections like, M. abscessus and M. smegmatis M abscessus ATCC 19977 that induces cystic fibrosis 400 351 due to their resistance against bactericidal agents. and severe lung disease was the sole pathogen in the 401 352 Simultaneously, those RGM still share some conserved rapid growing mycobacteria (RGM), the rest were 402 353 genes with the slow growing pathogenic mycobacteria, among the free living mycobacteria: M sp.MCS, M gil- 403 354 like the locus ESX3 which is highly conserved among all vum PYR-GCK, M sp. JLS, M sp KMS and M vanbaale- 404 355 mycobacterial species [37] and as a result of comparative nii PYR-1 and M. smegmatis str. MC2155. 405 356 genomics this locus was exploited as a recombinant M. The features of those genomes (Genome length, GC 406 357 smegmatis vaccine against MTB [44]. content, number of genes, tRNA genes and rRNA oper- 407 358 Thus, the combination of different sets of computa- ons) are summarized in (Table 1). 408 359 tional genome, proteome and phylogeny analysis could 360 easily visualize the evolutionary events and similarity Computational tools 409 361 relationships between mycobacterial species, which could The calculations of the BLAST Matrix, Pan- Core gen- 410 362 help for better improving new diagnosis approaches and ome plot and the prediction of 16S ribosomal RNA 411 363 vaccines against TB and other mycobacterial diseases. using RNAmmer were performed using in-house scripts 412 on computers at the Centre of Biological Sequence Ana- 413 lysis, in Denmark. 414 364 Conclusion 365 Mycobacteria include important pathogenic species for 1. Pan- and Core- genome plot construction 415 366 humans and animals, and the Mycobacterium tubercu- Pan- and core-genome plots are graphs that display to 416 367 losis complex can be a major cause of death in humans. what extent gene families are conserved within a set 417 368 With the progress of molecular diagnosis of infectious of genomes. The method used here is an 418 369 diseases in this era of huge amounts of DNA sequences, approximation as described previously for calculating 419 370 the visualization of data becomes one of the most im- the pan- and core-genome of 32 E. coli genomes [45]. 420 371 portant priorities to facilitate the analysis and the inter- Conservation is evaluated by first blasting the 421 372 pretation of the evolutionary events of the bacteria. predicted proteomes of the genomes against each 422 373 Furthermore, the combination of different sets of bio- other. For each proteome, a BLAST search is 423 374 informatics tools could offer a good comparative performed against all previous proteomes. The result 424 Zakham et al. Microbial Informatics and Experimentation 2012, 2:7 Page 8 of 9 http://www.microbialinformaticsj.com/content/2/1/7

425 is a set of numbers specific for that time point that A phylogenetic tree was constructed using Bootstrap 475 426 represents the proteome in the order of the input list, neighbour-joining method and visualized by NJPlot 476 427 showing: (Figure 3). 477

Abbreviations 478 428 Number of new genes MTB: Mycobacterium tuberculosis; MTBC: MTB complex; TB: Tuberculosis; 479 429 Number of new families NTM: Non Tuberculosis Myocbacteria. 480 430 Size of core genome Competing interests 481 431 Size of pan genome The authors declare that they have no competing interests. 482

’ 432 Two genes are considered to belong to the same gene Authors contributions 483 FZ performed analyzed the data and wrote the first draft of the manuscript. 484 433 family if the two are more than 50% identical over AO performed the computational analysis and participated in the design of 485 434 more than 50% of their length (Figure 1). the study. DU made substantial contribution to conception and design of 486 435 2. BLAST matrix construction from hypothetical genes/ the study and participated in data interpretation. All authors read and 487 approved the final manuscript. 488 436 proteins 437 A BLAST matrix is a comparison of proteomes Acknowledgments 489 438 (proteins from a genome) used to estimate how many The authors would like to acknowledge the colleagues at the centre of 490 Biological Sequence analysis in Denmark for their technical help. 491 439 proteins is found in common between two genomes. 440 All annotated proteins of all 21genome sequences Author details 492 1 441 currently available have been collected, and blasted Laboratoire de Virologie et Hygiène & Microbiologie, Faculté des Sciences et 493 Techniques, BP 146, Mohammedia 20650, Morocco. 2Faculté des Sciences, 494 442 each of the individual sequences against the collection. Université Mohammed V-Agdal, Rabat, Morocco. 3Experimental physik, 495 443 For each bacterium, the number of genes distinct for Universität des Saarlandes, Postfach 151150, 66041, Saarbrücken, Germany. 496 4 444 that organism and the number of genes shared with Center for Biological Sequence Analysis, Technical University of Denmark, 497 Lyngby, Denmark. 498 445 the other species have been extracted. The BLAST 446 matrix was constructed, showing protein similarity Received: 15 March 2012 Accepted: 2 August 2012 499 447 between all combinations of mycobacterial genomes Published: 28 August 2012 500 448 (Figure 2), and reflect to some extent an evolutionary References 501 449 distance or similarity between the individual species. 1. Tortoli E: The new mycobacteria: an update. FEMS Immunol Med Microbiol 502 – 450 The algorithm of the BLAST matrix is simple, and 2006, 48:159 178. 503 2. Nerlich AG, Haas CJ, Zink A, Szeimies U, Hagedorn HG: Molecular evidence 504 451 consists of three parts: for tuberculosis in an ancient Egyptian mummy. Lancet 1997, 350:1404. 505 3. Ziskind B, Halioua B: La tuberculose en ancienne. Rev Mal Respir 2007, 506 – 452 I. A match requirement. 24:1277 1283. 507 4. Donoghue HD, Lee OYC, Minnikin DE, Besra GS, Taylor JH, Spigelman M: 508 453 When two proteins are blasted against each other, Tuberculosis in Dr Granville's mummy: a molecular re-examination of 509 454 the matching region should have at least 50% the earliest known Egyptian mummy to be scientifically examined and 510 – 455 identity, while covering at least 50% of the length given a medical diagnosis. P Roy Soc B-Biol Sci 2010, 277:51 56. 511 5. Michel AL, Maller B, van Helden PD: Mycobacterium bovis at the 512 456 of the longer protein. animalâ“human interface: A problem, or not? Vet Microbiol 2011, 513 457 II. A protein family building scheme. 140:371–381. 514 458 The protein families were built by blasting proteins 6. Taylor GM, Murphy E, Hopkins R, Rutland P, Chistov Y: First report of 515 Mycobacterium bovis DNA in human remains from the Iron Age. 516 459 together. If they satisfy the match criteria, they Microbiology 2007, 153:1243–1249. 517 460 are clustered together. If one of the proteins in 7. Cole ST: Comparative and functional genomics of the Mycobacterium 518 – 461 the match is a member of an existing gene tuberculosis complex. Microbiology 2002, 148:2919 2928. 519 8. Donoghue HD, Spigelman M, Greenblatt CL, Lev-Maor G, Kahila Bar-Gal G, 520 462 family, the other protein is added to the same Matheson C, Vernon K, Nerlich A G, Zink A R: Tuberculosis: from prehistory 521 463 family. to Robert Koch, as revealed by ancient DNA. Lancet Infect Dis 2004, 522 – 464 III. Comparisons between and within proteome. 4:584 592. 523 9. Brosch R, Gordon SV, Marmiesse M, Brodin P, Buchrieser C, Eiglmeier K, 524 465 The protein families were created both within and Garnier T, Gutierrez C, Hewinson G, Kremer K, et al: A new evolutionary 525 466 between proteomes. For comparisons building scenario for the Mycobacterium tuberculosis complex. Proc Natl Acad Sci 526 – 467 between proteome, every protein within one 2002, 99:3684 3689. 527 10. Gutierrez MC, Brisse S, Brosch R, Fabre M, Omaas B, Marmiesse M, Supply P, 528 468 proteome is compared to all proteins in the other Vincent V: Ancient Origin and Gene Mosaicism of the Progenitor of 529 469 proteome. Mycobacterium tuberculosis. PLoS Pathog 2005, 1:e5. 530 11. Ernst JD, Trevejo-NuÃ±ez G, Banaiee N: Genomics and the evolution, 531 pathogenesis, and diagnosis of tuberculosis. J Clin Invest 2007, 117: 532 470 3. 16 Ribosomal RNA phlogenetic tree construction 1738–1745. 533 471 The sequences encoding 16S ribosomal RNA were 12. Devulder G, de Montclos MP, Flandrois JP: A multigene approach to 534 472 predicted using RNAmmer [46] and were extracted phylogenetic analysis using the genus Mycobacterium as a model. Int J 535 Syst Evol Microbiol 2005, 55:293–302. 536 473 for the set of twenty-one genomes. Alignment was 13. van Ingen J, Boeree MJ, van Soolingen D, Iseman MD, Heifets LB, Daley CL: 537 474 done with ClustalX. Are phylogenetic position, virulence, drug susceptibility and in vivo response to 538 Zakham et al. Microbial Informatics and Experimentation 2012, 2:7 Page 9 of 9 http://www.microbialinformaticsj.com/content/2/1/7

539 treatment in mycobacteria interrelated? Genetics and Evolution: Infection; proteome analysis of Mycobacterium tuberculosis and Mycobacterium 610 540 2011. bovis BCG strains: towards functional genomics of microbial pathogens. 611 541 14. Jang J, Becq J, Gicquel B, Deschavanne P, Neyrolles O: Horizontally Mol Microbiol 1999, 33:1103–1117. 612 542 acquired genomic islands in the tubercle bacilli. Trends Microbiol 2008, 35. Zakham F, Belayachi L, Ussery D, Akrim M, Benjouad A, El Aouad R, Ennaji 613 543 16:303–308. M: Mycobacterial species as Case study of comparative genome analysis. 614 544 15. Rosas-Magallanes V, Deschavanne P, Quintana-Murci L, Brosch R, Gicquel B, Cell Mol Biol 2011, 57:1462–1469. 615 545 Neyrolles O: Horizontal Transfer of a Virulence Operon to the Ancestor of 36. Domenech P, Barry Iii CE, Cole ST: Mycobacterium tuberculosis in the 616 546 Mycobacterium tuberculosis. Mol Biol Evol 2006, 23:1129–1135. post-genomic age. Curr Opin Microbiol 2001, 4:28–34. 617 547 16. Veyrier F, Pletzer D, Turenne C, Behr M: Phylogenetic detection of 37. Stinear TP, Seemann T, Harrison PF, Jenkin GA, Davies JK, Johnson PDR, 618 548 horizontal gene transfer during the step-wise genesis of Mycobacterium Abdellah Z, Arrowsmith C, Chillingworth T, Churcher C, et al: Insights from 619 549 tuberculosis. BMC Evol Biol 2009, 9:196. the complete genome sequence of Mycobacterium marinum on the 620 550 17. Garcia-Betancur JC, Menendez MC, Del Portillo P, Garcia MJ: Alignment of evolution of Mycobacterium tuberculosis. Genome Res 2008, 18:729–741. 621 551 multiple complete genomes suggests that gene rearrangements may 38. Becq J, Gutierrez MC, Rosas-Magallanes V, Rauzier J, Gicquel B, Neyrolles O, 622 552 contribute towards the speciation of Mycobacteria. Genetics and Evolution: Deschavanne P: Contribution of Horizontally Acquired Genomic Islands 623 553 Infection; 2011. to the Evolution of the Tubercle Bacilli. Mol Biol Evol 2007, 24:1861–1871. 624 554 18. Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, Gordon SV, 39. Stinear TP, Seemann T, Pidot S, Frigui W, Reysset G, Garnier T, Meurice G, 625 555 Eiglmeier K, Gas S, Barry CE, et al: Deciphering the biology of Simon D, Bouchier C, Ma L, et al: Reductive evolution and niche 626 556 Mycobacterium tuberculosis from the complete genome sequence. adaptation inferred from the genome of Mycobacterium ulcerans, the 627 557 Nature 1998, 393:537–544. causative agent of Buruli ulcer. Genome Res 2007, 17:192–200. 628 558 19. Camus J-C, Pryor MJ, Madigue C, Cole ST: Re-annotation of the genome 40. Li L, Bannantine JP, Zhang Q, Amonsin A, May BJ, Alt D, Banerji N, Kanjilal S, 629 559 sequence of Mycobacterium tuberculosis H37Rv. Microbiology 2002, Kapur V: The complete genome sequence of Mycobacterium avium 630 560 148:2967–2973. subspecies paratuberculosis. Proc Natl Acad Sci U S A 2005, 102: 631 561 20. Fleischmann RD, Alland D, Eisen JA, Carpenter L, White O, Peterson J, DeBoy 12344–12349. 632 562 R, Dodson R, Gwinn M, Haft D, et al: Whole-Genome Comparison of 41. Marri PR, Bannantine JP, Golding GB: Comparative genomics of metabolic 633 563 Mycobacterium tuberculosis Clinical and Laboratory Strains. J Bacteriol pathways in Mycobacterium species: gene duplication, gene decay and 634 564 2002, 184:5479–5490. lateral gene transfer. FEMS Microbiol Rev 2006, 30:906–925. 635 565 21. Alland D, Whittam TS, Murray MB, Cave MD, Hazbon MH, Dix K, Kokoris M, 42. Cole ST: Comparative mycobacterial genomics. Curr Opin Microbiol 1998, 636 – 566 Duesterhoeft A, Eisen JA, Fraser CM, Fleischmann RD: Modeling Bacterial 1:567 571. 637 567 Evolution with Comparative-Genome-Based Marker Systems: Application 43. DeBruyn JM, Mead TJ, Sayler GS: Horizontal Transfer of PAH Catabolism 638 568 to Mycobacterium tuberculosis Evolution and Pathogenesis. J Bacteriol Genes in Mycobacterium: Evidence from Comparative Genomics and 639 569 2003, 185:3392–3399. Isolated Pyrene-Degrading Bacteria. Environ Sci Technol 2011, . 640 570 22. Filliol I, Motiwala AS, Cavatore M, Qi W, HazbÃn MH, Bobadilla del Valle M, 44. Sweeney KA, Dao DN, Goldberg MF, Hsu T, Venkataswamy MM, Henao- 641 571 Fyfe J, Garcaa-Garcaa L, Rastogi N, Sola C, et al: Global Phylogeny of Tamayo M, Ordway D, Sellers RS, Jain P, Chen B, et al: A recombinant 642 572 Mycobacterium tuberculosis Based on Single Nucleotide Polymorphism Mycobacterium smegmatis induces potent bactericidal immunity against 643 – 573 (SNP) Analysis: Insights into Tuberculosis Evolution, Phylogenetic Mycobacterium tuberculosis. Nat Med 2011, 17:1261 1268. 644 574 Accuracy of Other DNA Fingerprinting Systems, and Recommendations 45. Willenbrock H, Hallin P, Wassenaar T, Ussery D: Characterization of 645 575 for a Minimal Standard SNP Set. J Bacteriol 2006, 188:759–772. probiotic Escherichia coli isolates with a novel pan-genome microarray. 646 576 23. Lew JM, Kapopoulou A, Jones LM, Cole ST: TubercuList: 10 years after. Genome Biol 2007, 8:R267. 647 577 Tuberculosis (Edinb) 2011, 91:1–7. 46. Lagesen K, Hallin P, Radland EA, Starfeldt H-H, Rognes T, Ussery DW: 648 578 24. Galagan JE, Sisk P, Stolte C, Weiner B, Koehrsen M, Wymore F, Reddy TBK, RNAmmer: consistent and rapid annotation of ribosomal RNA genes. 649 – 579 Zucker JD, Engels R, Gellesch M, et al: TB database 2010: Overview and Nucleic Acids Res 2007, 35:3100 3108. 650 580 update. Tuberculosis (Edinb) 2010, 90:225–235. 581 25. Cole ST: Comparative mycobacterial genomics as a tool for drug target doi:10.1186/2042-5783-2-7 651 582 and antigen discovery. Eur Respir J 2002, 20:78s–86s. Cite this article as: Zakham et al.: Computational genomics-proteomics 652 583 26. van Embden JD, Cave MD, Crawford JT, Dale JW, Eisenach KD, Gicquel B, and Phylogeny analysis of twenty one mycobacterial genomes 653 (Tuberculosis & non Tuberculosis strains). Microbial Informatics and 654 584 Hermans P, Martin C, McAdam R, Shinnick TM: Strain identification of Experimentation 2012 2:7. 655 585 Mycobacterium tuberculosis by DNA fingerprinting: recommendations 586 for a standardized methodology. J Clin Microbiol 1993, 31:406–409. 587 27. Stahl DA, Urbance JW: The division between fast- and slow-growing 588 species corresponds to natural relationships among the mycobacteria. 589 J Bacteriol 1990, 172:116–124. 590 28. Rogall T, Wolters JR, Flohr T, Bottger EC: Towards a Phylogeny and 591 Definition of Species at the Molecular Level within the Genus 592 Mycobacterium. Int J Syst Bacteriol 1990, 40:323–330. 593 29. Wassenaar T, Bohlin J, Binnewies T, Ussery D: Genome Comparison of 594 Bacterial Pathogens. Microbial Pathogenomics 2009, 6:1–20. 595 30. Ussery DW, Wassenaar TM, Borini S: Computing for Comparative Microbial 596 Genomics: Bioinformatics for Microbiologists. London: Springer; 2009. Submit your next manuscript to BioMed Central 597 31. Brosch R, Pym AS, Gordon SV, Cole ST: The evolution of mycobacterial and take full advantage of: 598 pathogenicity: clues from comparative genomics. Trends Microbiol 2001, 599 9:452–458. • Convenient online submission 600 32. Cole ST, Eiglmeier K, Parkhill J, James KD, Thomson NR, Wheeler PR, Honore 601 N, Garnier T, Churcher C, Harris D, et al: Massive gene decay in the leprosy • Thorough peer review – 602 bacillus. Nature 2001, 409:1007 1011. • No space constraints or color ﬁgure charges 603 33. Marmiesse M, Brodin P, Buchrieser C, Gutierrez C, Simoes N, Vincent V, 604 Glaser P, Cole ST, Brosch R: Macro-array and bioinformatic analyses reveal • Immediate publication on acceptance 605 mycobacterial â€~coreâ€™ genes, variation in the ESAT-6 gene family • Inclusion in PubMed, CAS, Scopus and Google Scholar 606 and new phylogenetic markers for the Mycobacterium tuberculosis • Research which is freely available for redistribution 607 complex. Microbiology 2004, 150:483–496. 608 34. Jungblut PR, Schaible UE, Mollenkopf HJ, Zimny-Arndt U, Raupach B, 609 Mattow J, Halada P, Lamer S, Hagens K, Kaufmann SHE: Comparative Submit your manuscript at www.biomedcentral.com/submit Doctorat Es Science in Microbiology & Molecular Biology Discussion 2012

General Discussion

Tuberculosis (TB) is an infectious and contagious disease with high morbidity and mortality rates. Even if, TB is a preventable and a curable disease, it remains a main threat of public health worldwide. It is estimate that one third of the global population is infected with Mycobacterium tuberculosis (MTB) , the causative agent of TB (Brooks et al. , 1998) with 8.8 million incident cases and 1.45 million deaths (WHO, 2011a). Regardless of the worldwide efforts for fighting against TB, the medical care providers still face great difficulties toward the achievement of this goal, especially in the co infected HIV patients (Gandhi et al. , 2011).

Alarmingly, the emergence of Multi and extensively drug resistant (MDR/XDR) cases had worsened the situation. MDR-TB strains are defined as strains resistant to at least, the two main first line drugs used to treat TB that are Rifampcin and Isoniazid. The other first line drugs are pyrazinamide and ethambutol. The second line drugs include kanamycin, Amikacin, capreomycin, ethionamide, cycloserine, Fluoroquinolones such as ofloxacin, and ciprofloxacin (Brooks et al. , 1998). These drugs are more toxic and/or less effective, and they should be used in therapy only under extenuating circumstances (e.g., treatment failure, multiple drug resistance) (Brooks et al. , 1998).

XDR-TB strains are strains that where not only MDR, but are also resistant to the second line drugs (fluoroquinolones and at least one of the other injectable drugs i.e. kanamycin, amikacin or capriomycin) (Madariaga et al. , 2008; Park et al. , 2009). Significantly, according to the reports of the WHO, 250 000 TB patients are suffering of MDR TB in 2009 (WHO, 2010) and among them only 30 000 (12%) were laboratory confirmed and notified as MDR- TB. In 2010, the estimated number of MDR-TB increased to more than 650 000 cases among the world’ 12.0 millions prevalent cases of TB (WHO, 2011a). Recently, a bleaker picture has emerged for TB control programs with the discovery of extreme drug resistant TB (XDR-TB) strains, raising concerns of a future epidemic of virtually untreatable TB.

In Morocco, TB is a major public health problem, since it affects young adults and has a high impact on the socio-economic status of the country (65.9% of total TB cases have between 15 and 45 years, with a significant male predilection 59.3%)(Direction de l’épidémiologie et de lutte contre les maladies "DELM", 2007) .Therefore, the Ministry of Health in Morocco has established the national program of fight against TB (PNLAT) in 1991 and consequently, the

Doctorat Es Science in Microbiology & Molecular Biology Discussion 2012

PNLAT has implemented the DOTS strategy in the basic health care institutions (PNLAT, 2011). The implementation of the DOTS strategy in public health services has had a positive impact on the TB burden in the Moroccan population. Indeed, after fifteen years of its implementation, the incidence of smear-positive TB declined steadily from year to year.

However, this decrease is slow (only around 3% per year) and at this rate, approximately 10,000 cases of TB will be still detected in Morocco in 2050, a year targeted by WHO and the Global Partnership "Stop TB" for the elimination of this disease in the world (Stop TB Strategy, 2006). To strengthen TB control, the PNLAT adopted the Stop TB Strategy 2006 - 2015, and declined it in a national strategic plan articulated around the following points:

1. Consolidating and improving the quality of DOTS; 2. Fight against TB / HIV co-infection, MDR-TB and TB in high risk groups; 3. Contribution to strengthening health systems; 4. Involvement of all health care providers in TB control; 5. Promotion of operational research focused on the needs of the fight against TB in Morocco; 6. Deployment of the communications strategy, advocacy and social mobilization.

Worldwide, the diagnosis of TB poses a major problem and a serious challenge. On the national scale, the TB management is facing a great difficulty and the early diagnosis of MTB and drug resistance testing confront a great defy, particularly in the paucibacillary specimens. Currently, the laboratory diagnosis of TB is based on the conventional techniques, including the method of Ziehl-Neelsen staining which lacks sensitivity and MTB culture that requires long incubation time (Nagesh et al. , 2001).

Internationally, the implementation of reliable and rapid molecular techniques for the detection of MTB in clinical specimens has been well established to improve health surveillance of TB patients (Abraham et al. , 2012; Ani et al. , 2009; De Wit et al. , 1990; Nagesh et al. , 2001; Saltini, 1998; Takahashi et al. , 2007; Zakham et al. , 2012).

Therefore, one of the objectives of this study was to evaluate the utility of the molecular approach based on PCR techniques for direct diagnosis of MTB in clinical specimens by targeting the gene hsp65 or the specific insertion sequence IS6110. The results of hsp65 amplification were confirmed by automated sequencing for the differentiation between the members of the complex MTB and other non tuberculosis mycobacteria, since this gene exists in all mycobacteria (Ringuet et al. , 1999; Zakham et al. , 2012). In contrast, the insertion

Doctorat Es Science in Microbiology & Molecular Biology Discussion 2012

sequence “IS6110" is present only in the members of MTB complex in multiple copies (up to 25 copies), except M. bovis BCG which has a single copy and this insertion sequence is absent in other mycobacteria (Thierry et al. , 1990; Thorne et al. , 2011) and thus, could be a very cost efficient potential tool for the rapid detection of MTB.

In the first chapter of this thesis, both of established PCR techniques showed that the sensitivity, specificity, positive and negative predictive values were very good and the accordance between IS6110 PCR and culture (the gold standard) was excellent by applying Kappa index, as already reported (Almeda et al. , 2000).

Hence, the use of PCR targeting specific genes or insertion sequences in the routine analysis for the detection of MTB will be of a great interest for the diagnosis of TB, especially in the critical cases, where rapid MTB diagnosis, combined with drug susceptibility testing (DST) by amplification of genes responsible of drug resistance is mandatory for the rapid initiation of adapted chemotherapy. According to the recommendations of the PNLAT, the DST testing should be performed for the previously treated cases (relapse, failure and chronic) where the MDR TB cases are highly suspected and co-infected TB-HIV patients, where the decision of treatment is crucial for saving the life of patients (PNLAT, 2011).

Owing to the slow turnaround time and cumbersomeness procedure of the standard proportional conventional method, the WHO, as part of the strategy "Stop TB 2006-2015", strongly recommends that countries most affected by TB have to integrate Gen-X-pert diagnostic device in their national TB program and Gen-X-pert MTB/RIF as initial diagnostic test in individuals suspected of having MDR-TB or HIV-associated TB (PNLAT, 2011; WHO, 2011b). Therefore, the PNLAT in collaboration with the National Reference Laboratory of Tuberculosis (NRLT) at the INH will progressively introduce the commercial molecular techniques in the near future for the diagnosis of MTB and DST such: Gen-X-pert, GenoType ® MTBC and GenoType MTBDR plus of Hain Lifesciences…etc (PNLAT, 2011). The Gen-X-pert includes reagents for the detection of mycobacteria belonging to MTBC and the detection of Rifampicin resistance which is the more often associated with resistance to Isoniazid. The primers of the test Gen-X-pert amplify a fragment of 81 pairs of bases corresponding to a hot spot region known in rpoB gene as including more than 90% of

Doctorat Es Science in Microbiology & Molecular Biology Discussion 2012

mutations responsible of resistance to Rifampicin. The probes identify mutations in this region that are compared to the wild-type sequence of reference (WHO, 2011b). Indeed, in the second part of this thesis, we focused on the utility of the molecular approach by automated sequencing based PCR technique, as a standard method for the detection of mutations in specific genes ( rpoB and katG ) for rapid investigation of MDR-TB strains and determining the most frequented mutations of the circulating strains in Morocco, which could provide an insight for positioning, establishing the test Gen-X-pert in the public health laboratories of Morocco. Mutations in the rpo B gene, encoding the β-subunit of DNA-dependent RNA polymerase leads to a resistance against Rifampicine, which is a key first-line anti-tuberculosis drug and the presence of Rifampicin resistance, increases the probability of MDR-TB. It is also noteworthy to mention that Rifampicin resistance has been identified as a useful surrogate marker for estimation of MDR (Ramaswamy and Musser, 1998). More than 35 mutations have been reported within the hot spot region of the gene rpoB, the most common mutations are located at codons 516, 526 or 531 (Ramaswamy and Musser, 1998; Telenti et al. , 1993).

One the other hand, the katG gene encodes mycobacterial catalase peroxidase which is the only enzyme in MTB capable of activating the pro-drug Isoniazid to active form. Furthermore, katG gene is involved in detoxification of endogenously generated or exogenously supplied hydrogen peroxide.

In spite of the high cost and cumbersomeness, the automated sequencing is an excellent and valid method for the accuracy and rapidness of detection of drug-resistant TB in clinical specimens and valuable method for the management of suspected MDR-TB cases (Abdelaal et al. , 2009). Significantly, one important advantage of sequence-based approaches is that the resulting data are virtually unambiguous because the resistance associated mutation is either present or absent (Neonakis et al. , 2008). Thus, our results showed that the most recorded mutation, located in the Rifampicin Resistance Determining Region (RRDR) of the rpo B gene is the substitution of TCG → TTG at codon 531 (Serine → Leucine). This result has been widely reported (Aziz et al. , 2006; Telenti et al. , 1993).

Further, the advantage of our in house sequencing, compared to the available commercial tests, is the detection of new mutations that have never been recorded neither at national nor at

Doctorat Es Science in Microbiology & Molecular Biology Discussion 2012

international scales. Such the new deletions that not previously described, in strains collected between 2002 and 2004 by our group (Kourout et al. , 2009).

On other hand the most frequented mutation in katG was that of the substitution AGC → ACC at the codon 315 (Serine → Threonine). Our results are in accordance with the most frequented mutations as already reported in the region (Abdelaal et al. , 2009; Ramaswamy and Musser, 1998). For this reason, we recommend the utilization of automated sequencing for research purposes in reference laboratories to establish an overview about the pattern of drug resistance in the country. Differently to the most commercial kits that are usually restricted to rpoB mutations, this technique could be used to detect other mutations related to MDR/XDR-TB strains. Thus mutations in genes like inhA, aphC , and kasA for Isoniazid resistance, rrs for Streptomycin resistance, embB for Ethambutol resistance, pncA for pyrazinamide resistance and gyrA responsible for fluoroquinolones resistance (Van Rie et al. , 2001). Gen-X-pert should be of great benefit as a screening assay in clinical settings for saving patients’s life and preventing the dissemination of TB and MDR TB in the community, especially, in those patients who do not respond to anti-tuberculosis treatment and show no improvement in their TB profile.

Actually, with the huge amount of mycobacterial sequences, there is a crucial need for the visualisation, simplification and comparative genomics of their data. This was the objective of the third part of the thesis, since we believe that the comprehension of the evolution of these contagious bacteria could help in the improvement of new targets, either for diagnosis or drug treatment. Indeed, we have highlighted a comparative genome, proteome and phylogeny analysis between mycobacterial (Tuberculosis and non tuberculosis) strains using a set of computational and bioinformatics tools (Pan and Core genome plotting, BLAST matrix and phylogeny analysis).

The first sequenced mycobacterial genome was that of the reference strain M. tuberculosis H37 Rv (Cole et al. , 1998). It was re annotated in 2002 by Camus et al (Camus et al. , 2002). In 2002, the second MTB genome sequence of the clinical strain CDC1551 was completed and a whole comparative genome analysis was done with the reference strain H37 Rv based on Large Sequence Polymorphisms (LSPs) and Single Nucleotide Polymorphisms (SNPs) (Fleischmann et al. , 2002). The SNPs were also used as comparative genome markers for

Doctorat Es Science in Microbiology & Molecular Biology Discussion 2012

studying the evolution, pathogensis and molecular epidemiology of clinical MTB strains and a new phylogeny analysis based on SNPs arrangement was established by Alland et al (Alland et al. , 2003). More recently, Fillol et al also described the same approach and they have identified six SNP cluster groups (SCGs) and five subgroups within the MTBC members (Filliol et al. , 2006). Recently, different databases were established and provided the complete genome annotation of the reference strain and other tuberculosis strains, such: TubercuList and TB database (TBDB) (Galagan et al. , 2010; Lew et al. , 2011).

Several studies suggested that the common ancestor of MTB was M. bovis (Cole, 2002; Donoghue et al. , 2004), but this idea has been refuted and the genetics of the MTBC explained different clues for debating in the term of their evolution over the years.The sufficient evidence of the common ancestor of these microorganisms was surrounded by a mystery and recently the ambiguity regarding this question mark was uncovered and a new scenario was demonstrated by studying 20 variable deleted regions within the members of the MTBC (Brosch et al. , 2002). As a result, M.canettii stated to be the common ancestor, which did not lack those regions, unlike M. bovis that lost several genes are present in MTB and other smooth MTB (Brosch et al. , 2002).

Furthermore, it has become clear that the members of MTBC were originated from a single ancestor resulted from an evolutionary bottleneck and a clonal expansion (Brosch et al. , 2002; Ernst et al. , 2007; Gutierrez et al. , 2005) occurred 20,000 to 35,000 years ago. In addition, the progenitor of MTBC offspring was restricted in a limited geographical region (East Africa) and called “ M. prototuberculosis ” (Ernst et al. , 2007).

Significantly, most of the pathogenic or slow growing mycobacteria are sharing a high similarity and a strong phylogeny relationship (Devulder et al. , 2005; van Ingen et al. , 2011) and interestingly, several studies confirmed that the pathogenic mycobacteria were originated from a free living progeny (Brosch et al. , 2002) and due to the genome reduction and the acquisition of new genes by horizontal gene transfer (HGT) (Garcia-Betancur et al. , 2011; Jang et al. , 2008; Rosas-Magallanes et al. , 2006; Veyrier et al. , 2009) and gene rearrangement (Garcia-Betancur et al. , 2011), their capacity of parasitism and infectiousness was developed for enabling them to cause severe and dangerous illnesses.

With the considerable genome size differences among the species included in this study, the number of added new genes per genome has increased the pan genome and the discovery of new

Doctorat Es Science in Microbiology & Molecular Biology Discussion 2012

genome sequences could add new genes to the current pan genome. Unsurprisingly, the results of the core genome are in correlation with a previous experimental study realized by Marmiesse et al ., in which they have estimated about 1439 genes as minimal set of conserved genes in the core genome of MTB and MLP, among them 219 genes that code for proteins show no similarity with proteins from other mycobacterial species (Marmiesse et al. , 2004), some of them are belonging to the ESAT-6 family, which has a high antigenic and virulence activity (Ernst et al. , 2007) and significantly this family is present in the RD1 region which is absent in all the BCG M.bovis vaccine strains(Domenech et al. , 2001) and its reintroduction provoked virulence in those attenuated strains (Mahairas et al. , 1996).

Even more, the comparative genomic analysis of predicted proteome by BLAST matrix showed a high similarity among MTB strains as already reported by our group (Zakham et al. , 2011). The similarity values between MTB strains, M.bovis and attenuated M. bovis BCG vaccine strains were reasonable and the slight difference between the two vaccine strains (96.7%, 97.1%) could be attributed to the lack of RD 14 and the restricted duplication DU1 in the BCG Pasteur strain (Domenech et al. , 2001).

Interestingly, the similarity between the MTBC and M.marinum was ranged between 47.0% - 47.7%. Regardless of the bigger genome size of M. Marinum , the close relatedness between those two species was documented and 3000 orthologs were shared between both genomes (Stinear et al. , 2008). This support the hypothesis of the decendy of MTB from an environmental Mycobacterium and due to the genome downsizing and the acquisition of new genes by HGT (Becq et al. , 2007; Jang et al. , 2008), their capability of parasitism was evolved towards the mammalian macrophages (Jang et al. , 2008; Stinear et al. , 2008).

M ulcerans Agy99, which evolved from the same ancestor of M. marinum and has shown a less similarity with MTBC members (43%) and notably, this bacterium suffered of deletions, mainly, in the ESX1 locus (Stinear et al. , 2007) , which is present in MTB and M marinum .

Significantly, M. avium s sp. Paratuberculosis strain K-10 with more than 3,000 homologous genes with MTB (Li et al. , 2005) showed a less similarity and the least similarity was found with the complex MLP and this could be attributed to the loss of PE_PGRS proteins in both of those species (Marri et al. , 2006), Furthermore, the absence of many genes in MAV and the presence of pseudogenes in MLP elucidate the specificity of their virulence, tropism, the ability of cultivation and drug susceptibility pattern (Cole, 1998).

Doctorat Es Science in Microbiology & Molecular Biology Discussion 2012

For understanding the evolution of mycobacterial strains a phylogenetic tree was constructed based on 16 rRNA sequences, which allows the identification of most species within the genus Mycobacterium and can separate between the slow and RGM (Stahl and Urbance, 1990) and can be used for the systematic phylogeny analysis (Rogall et al. , 1990).

Unsurprisingly, the results of phylogeny analysis were in correlation with the previous results of genomic analysis of predicted proteome, which leads to an assertion that the ancestral MTBC and M. marinum genomes might be descended from the same ancestry owing to their close genetic relationship and phylogenetic relatedness. Obviously, before the evolutionary bottleneck and clonal expansion of MTB members, the ancestral M. prototuberculosis species had acquired the particular Rv0986-8 virulence operon by HGT from an alpha proteobacterium (Rosas-Magallanes et al. , 2006) and evidently this operon still exists only in MTBC members.

Moreover, our study confirmed the high phylogenetical relationship among: MTBC, M.marinum- ulcerans , MAV and MLP complex, showing that the pathogenic slow growing mycobacteria define a distinct and common line of evolutionary descent from a free living bacterium.

Interestingly, the RGM have also acquired different genes toward the speciation to their environmental niches, like the acquisition of PAH Catabolism Genes in: M sp.MCS, M gilvum PYR-GCK, M sp. JLS, M sp KMS and M vanbaalenii PYR-1) (DeBruyn et al. , 2011), which enabled them to degrade polycyclic aromatic hydrocarbons. Significantly, many of RGM are ubiquitous in the environment and could become pathogenic for humans and induce opportunistic incurable infections like, M. abscessus and M. smegmatis due to their resistance against bactericidal agents.

Doctorat Es Science in Microbiology & Molecular Biology Conclusion 2012

Conclusion

The PCR amplification of nucleic acids and the selection of specific targets and primers makes the PCR procedure a routine tool, but the success of the technique still depends primarily how the sample is processed. Therefore, an easy but effective sample processing method for the target nucleic acids is an essential component for PCR. An inefficient DNA extraction method will greatly affect the sensitivity or even the success of the whole amplification of the target.

In this study, the results registered here suggest that with hsp65, IS6110, rpoB and katG manufactured primers, DNA amplification may potentially be a very useful and valuable tool for the rapid detection of Mycobacterium tuberculosis and MDR-TB strains in uncultured clinical specimens. Our experience recommended the utility of sequencing of different genes related to resistance against anti-tuberculosis drugs (like inhA, aphC , and kasA for Isoniazid resistance, rrs for Streptomycin resistance, embB for Ethambutol resistance, pncA for pyrazinamide resistance and gyrA responsible for fluoroquinolones resistance) for establishing an overview about the pattern of drug resistance in the country.

66 Molecular Diagnosis of MTB in clinical Specimens F. ZAKHAM Doctorat Es Science in Microbiology & Molecular Biology Perspectives 2012

PERSPECTIVES

We are looking forward to improving the techniques of the rapid and direct molecular diagnosis M. tuberculosis in the clinical specimens by different ways:

Determination of phylogenetic relationships among members of Mycobacterium tuberculosis complex by the concatenation of the different genes: 16S rRNA, hsp65 , pncA , recA and rpoB gene sequencing. Differential identification of M. tuberculosis and M. bovis by the utilisation of pnc A PCR assays. Characterization of mycobacterial strains by molecular techniques and epidemiological analysis. The rapid identification of extensively drug resistant (XDR) TB by the DNA sequencing of different genes used for characterization of the mutations responsible of resistance against the second line of MTB drugs.

Molecular Diagnosis of MTB in clinical specimens F. ZAKHAM 67

Doctorat Es Sciences in Microbiology & Molecular Biology References 2012

Bibliographical References

Abraham P, Sharma V, Shivannavar C (2012). Diagnosis of TB from smear & culture negative sputum specimens by IS 6110 based PCR. Indian J Med Res. 2012;135: 135: 249-51.

Alexander KA, Laver PN, Michel AL, Williams M, van Helden PD, Warren RM et al (2010). Novel Mycobacterium tuberculosis complex pathogen, M. mungi. Emerg Infect Dis 16: 1296-9.

Alland D, Whittam TS, Murray MB, Cave MD, Hazbon MH, Dix K et al (2003). Modeling Bacterial Evolution with Comparative-Genome-Based Marker Systems: Application to Mycobacterium tuberculosis Evolution and Pathogenesis. Journal of Bacteriology 185: 3392-3399.

Almeda J, García A, González J, Quintó L, Ventura PJ, Vidal R et al (2000). Clinical Evaluation of an In-House IS <i>6110</i> Polymerase Chain Reaction for Diagnosis of Tuberculosis. European Journal of Clinical Microbiology & Infectious Diseases 19: 859-867.

Anargyros P, Astill DS, Lim IS (1990). Comparison of improved BACTEC and Lowenstein-Jensen media for culture of mycobacteria from clinical specimens. Journal of Clinical Microbiology 28: 1288-1291.

Ani A, Okpe S, Akambi M, Ejelionu E, Yakubu B, Owolodun O et al (2009). Comparison of a DNA based PCR method with conventional methods for the detection of M. tuberculosis in Jos, Nigeria. J Infect Dev Ctries 3: 470-5.

Arias Guillen M, Palomar R, Arias M (2011). [Advances in the diagnosis of latent tuberculosis infection in patients receiving renal replacement therapy]. Nefrologia 31: 137-41.

ATS (2005). Controlling tuberculosis in the United States: recommendations from the American Thoracic Society. CDC, and the Infectious Diseases Society of America. 54 15.

Av-Gay Y, Sobouti R (2000). Cholesterol is accumulated by mycobacteria but its degradation is limited to non-pathogenic fast-growing mycobacteria. Can J Microbiol 46: 826-31.

Badak FZ, Goksel S, Sertoz R, Nafile B, Ermertcan S, Cavusoglu C et al (1999). Use of Nucleic Acid Probes for Identification of Mycobacterium tuberculosis Directly from MB/BacT Bottles. Journal of Clinical Microbiology 37: 1602-1605.

Baron S (1996). Medical Microbiology . University of Texas. Medical Branch: Texas.

Barrow WW (1997). Processing of mycobacterial lipids and effects on host responsiveness. Front Biosci 2: d387-400.

Bastos RG, Borsuk S, Seixas FK, Dellagostin OA (2009). Recombinant Mycobacterium bovis BCG. Vaccine 27: 6495-6503.

Doctorat Es Sciences in Microbiology & Molecular Biology References 2012

Bauer J, Yang Z, Poulsen S, Andersen ÃsB (1998). Results from 5 Years of Nationwide DNA Fingerprinting of Mycobacterium tuberculosis Complex Isolates in a Country with a Low Incidence of M. tuberculosis Infection. Journal of Clinical Microbiology 36: 305-308.

Becq J, Gutierrez MC, Rosas-Magallanes V, Rauzier J, Gicquel B, Neyrolles O et al (2007). Contribution of Horizontally Acquired Genomic Islands to the Evolution of the Tubercle Bacilli. Molecular Biology and Evolution 24: 1861-1871.

Ben Kahla I, Ben Selma W, Marzouk M, Ferjeni A, Ghezal S, Boukadida J (2011). Evaluation of a simplified IS6110 PCR for the rapid diagnosis of Mycobacterium tuberculosis in an area with high tuberculosis incidence. Pathologie Biologie 59: 161-165.

Bigi F, Garcia-Pelayo M, Nuñez-García J, Peralta A, Caimi K, Golby P et al (2005). Identification of genetic markers for M. pinnipedii through genome analysis. . FEMS Microbiol Lett. 15: 147-152.

Borgdorff MW, Floyd K, Broekmans JF (2002). Interventions to reduce tuberculosis mortality and transmission in low- and middle-income countries. Bulletin of the World Health Organization 80: 217- 227.

Brooks G, Butel J, Morse S (1998). Jawetz, Melnick, Adelberg‘s Medical Microbiology , 21st edition edn. Lange Medical book.

Brosch R, Gordon SV, Marmiesse M, Brodin P, Buchrieser C, Eiglmeier K et al (2002). A new evolutionary scenario for the Mycobacterium tuberculosis complex. Proceedings of the National Academy of Sciences 99: 3684-3689.

Brosch R, Pym AS, Gordon SV, Cole ST (2001). The evolution of mycobacterial pathogenicity: clues from comparative genomics. Trends in Microbiology 9: 452-458.

Butcher PD (2004). Microarrays for Mycobacterium tuberculosis. Tuberculosis (Edinburgh, Scotland) 84: 131-137.

Camus J-C, Pryor MJ, MÃ©digue C, Cole ST (2002). Re-annotation of the genome sequence of Mycobacterium tuberculosis H37Rv. Microbiology 148: 2967-2973.

Canetti G, Fox W, Khomenko A, Mahler H, Menon N, Mitchison D et al (1969). Advances in techniques of testing mycobacterial drug sensitivity, and the use of sensitivity tests in tuberculosis control programmes. Bull World Health Organ 41: 21-43.

Chaisson RE, Martinson NA (2008). Tuberculosis in Africa Combating an HIV-Driven Crisis. New England Journal of Medicine 358: 1089-1092.

Cheesbrough M (2000). District laboratory practice in tropical countries. . Cambridge University Press.

Clarridge JE, Shawar RM, Shinnick TM, Plikaytis BB (1993). Large-scale use of polymerase chain reaction for detection of Mycobacterium tuberculosis in a routine mycobacteriology laboratory. Journal of Clinical Microbiology 31: 2049-2056.

Doctorat Es Sciences in Microbiology & Molecular Biology References 2012

Cole ST (1998). Comparative mycobacterial genomics. Current Opinion in Microbiology 1: 567-571.

Cole ST (2002). Comparative and functional genomics of the Mycobacterium tuberculosis complex. Microbiology 148: 2919-2928.

Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D et al (1998). Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393: 537-544.

Cole ST, Eiglmeier K, Parkhill J, James KD, Thomson NR, Wheeler PR et al (2001). Massive gene decay in the leprosy bacillus. Nature 409: 1007-1011.

Corbett EL, Bandason T, Cheung YB, Munyati S, Godfrey-Faussett P, Hayes R et al (2007). Epidemiology of Tuberculosis in a High HIV Prevalence Population Provided with Enhanced Diagnosis of Symptomatic Disease. PLoS Med 4: e22.

Cvetnic Z, Spicic S, Katalinik-Jankovic v, Marjanovic S, Obrovac M, Benic M et al (2006). Mycobacterium caprae infection in cattle and pig son one family farm in Croatia: a case report. Vet Med. 51: 523–531. da Silva Rocha A, da Costa Leite C, Torres HlM, de Miranda AB, Pires Lopes MrQ, Degrave WM et al (1999). Use of PCR-restriction fragment length polymorphism analysis of the hsp65 gene for rapid identification of mycobacteria in Brazil. Journal of Microbiological Methods 37: 223-229.

Daniel TM (2006). The history of tuberculosis. Respiratory medicine 100: 1862-1870.

Davies PDO, Pai M (2008). The diagnosis and misdiagnosis of tuberculosis [State of the art series. Tuberculosis. Edited by I. D. Rusen. Number 1 in the series]. The International Journal of Tuberculosis and Lung Disease 12: 1226-1234.

De Wit D, Steyn L, Shoemaker S, Sogin M (1990). Direct detection of Mycobacterium tuberculosis in clinical specimens by DNA amplification. Journal of Clinical Microbiology 28: 2437-2441.

DeBruyn JM, Mead TJ, Sayler GS (2011). Horizontal Transfer of PAH Catabolism Genes in Mycobacterium: Evidence from Comparative Genomics and Isolated Pyrene-Degrading Bacteria. Environmental Science & Technology .

Demers A-M, Mostowy S, Coetzee D, Warren R, van Helden P, Behr MA (2010). Mycobacterium africanum is not a major cause of human tuberculosis in Cape Town, South Africa. Tuberculosis (Edinburgh, Scotland) 90: 143-144.

Devulder G, de Montclos MPr, Flandrois JP (2005). A multigene approach to phylogenetic analysis using the genus Mycobacterium as a model. International Journal of Systematic and Evolutionary Microbiology 55: 293-302.

Dietrich G, Viret J-F, Hess Jr (2003). Mycobacterium bovis BCG-based vaccines against tuberculosis: novel developments. Vaccine 21: 667-670.

Direction de l’épidémiologie et de lutte contre les maladies "DELM". (2007). Epidemiologic bulletin, Vol. N°:69-70-71-72 , pp 32-33.

Djelouadji Z, Raoult D, DaffÃ M, Drancourt M (2008). A Single-Step Sequencing Method for the Identification of Mycobacterium tuberculosis Complex Species. PLoS Negl Trop Dis 2: e253.

Doctorat Es Sciences in Microbiology & Molecular Biology References 2012

Domenech P, Barry Iii CE, Cole ST (2001). Mycobacterium tuberculosis in the post-genomic age. Current Opinion in Microbiology 4: 28-34.

Donoghue HD, Spigelman M, Greenblatt CL, Lev-Maor G, Kahila Bar-Gal G, Matheson C et al (2004). Tuberculosis: from prehistory to Robert Koch, as revealed by ancient DNA. The Lancet Infectious Diseases 4: 584-592.

Drobniewski FA, More PG, Harris GS (2000). Differentiation of Mycobacterium tuberculosis Complex and Nontuberculous Mycobacterial Liquid Cultures by Using Peptide Nucleic Acid- Fluorescence In Situ Hybridization Probes. Journal of Clinical Microbiology 38: 444-447.

Eisenach K, Cave M, Bates J, Crawford J (1990). Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis. . J. Infect. Dis 161: 977-981.

Eisenach KD, Crawford JT, Bates JH (1988). Repetitive DNA sequences as probes for Mycobacterium tuberculosis. Journal of Clinical Microbiology 26: 2240-2245.

Eisenstein BI (1990). The Polymerase Chain Reaction. A new method of using molecular genetics for medical diagnosis. New England Journal of Medicine 322: 178-183.

Ernst JD, Trevejo-NuÃ±ez G, Banaiee N (2007). Genomics and the evolution, pathogenesis, and diagnosis of tuberculosis. The Journal of Clinical Investigation 117: 1738-1745.

Fabre M, Hauck Y, Soler C, Koeck J-L, van Ingen J, van Soolingen D et al (2011). Molecular characteristics of Mycobacterium canettii the smooth Mycobacterium tuberculosis bacilli. Infection, Genetics and Evolution 10: 1165-1173.

Filliol I, Motiwala AS, Cavatore M, Qi W, HazbÃ³n MH, Bobadilla del Valle M et al (2006). Global Phylogeny of Mycobacterium tuberculosis Based on Single Nucleotide Polymorphism (SNP) Analysis: Insights into Tuberculosis Evolution, Phylogenetic Accuracy of Other DNA Fingerprinting Systems, and Recommendations for a Minimal Standard SNP Set. Journal of Bacteriology 188: 759- 772.

Fleischmann RD, Alland D, Eisen JA, Carpenter L, White O, Peterson J et al (2002). Whole-Genome Comparison of Mycobacterium tuberculosis Clinical and Laboratory Strains. Journal of Bacteriology 184: 5479-5490.

Frothingham R, Meeker-O'Connell WA (1998). Genetic diversity in the Mycobacterium tuberculosis complex based on variable numbers of tandem DNA repeats. Microbiology 144: 1189-1196.

Gadre D, Mahajan M, Singh N, Agarwal D, Talwar V (1995). Niacin test for mycobacteria: a comparative study of two methods. Ind. J. Tub 42: 225-226.

Galagan JE, Sisk P, Stolte C, Weiner B, Koehrsen M, Wymore F et al (2010). TB database 2010: Overview and update. Tuberculosis (Edinburgh, Scotland) 90: 225-235.

Gandhi NR, Shah NS, Andrews JR, Vella V, Moll AP, Scott M et al (2011). HIV Coinfection in Multidrug- and Extensively Drug-Resistant Tuberculosis Results in High Early Mortality. American Journal of Respiratory and Critical Care Medicine 181: 80-86.

Garcia-Betancur JC, Menendez MC, Del Portillo P, Garcia MJ (2011). Alignment of multiple complete genomes suggests that gene rearrangements may contribute towards the speciation of Mycobacteria. Infection, Genetics and Evolution .

Doctorat Es Sciences in Microbiology & Molecular Biology References 2012

Gebre N, Karlsson U, Jonsson G, Macaden R, Wolde A, Assefa A et al (1995). Improved microscopical diagnosis of pulmonary tuberculosis in developing countries. Trans R Soc Trop Med Hyg 89: 191-3.

Gillellamudi S (2010). Role of Urinary PCR in Diagnosis of GenitourinaryTuberculosis. Global Journal of Medical Research 10: 2-5.

González-Martín J, García-García J, Anibarro L, Vidal R, Esteban J, Blanquer R et al (2010). Consensus document on the diagnosis, treatment and prevention of tuberculosis. Arch Bronconeumol. 46: 255-274.

Gupta S, Bandyopadhyay D, Paine SK, Banerjee S, Bhattacharya S, Gachhui R et al (2010). Rapid identification of mycobacterium species with the aid of multiplex polymerase chain reaction (PCR) from clinical isolates. Open Microbiol J 4: 93-7.

Gupte S (1999). Short Textbook of medical microbiology , 7th edition edn: New Delh.

Gutacker MM, Smoot JC, Migliaccio CAL, Ricklefs SM, Hua S, Cousins DV et al (2002). Genome- Wide Analysis of Synonymous Single Nucleotide Polymorphisms in Mycobacterium tuberculosis Complex Organisms: Resolution of Genetic Relationships Among Closely Related Microbial Strains. Genetics 162: 1533-1543.

Gutierrez MC, Brisse S, Brosch R, Fabre M, OmaÃ¯ s B, Marmiesse M et al (2005). Ancient Origin and Gene Mosaicism of the Progenitor of Mycobacterium tuberculosis. PLoS Pathog 1: e5.

Han XY, Pham AS, Tarrand JJ, Sood PK, Luthra R (2002). Rapid and Accurate Identification of Mycobacteria by Sequencing Hypervariable Regions of the 16S Ribosomal RNA Gene. American Journal of Clinical Pathology 118: 796-801.

Hanna BA, Ebrahimzadeh A, Elliott LB, Morgan MA, Novak SM, Rusch-Gerdes S et al (1999). Multicenter Evaluation of the BACTEC MGIT 960 System for Recovery of Mycobacteria. Journal of Clinical Microbiology 37: 748-752.

Hewinson RG, Vordermeier HM, Smith NH, Gordon SV (2006). Recent advances in our knowledge of Mycobacterium bovis: A feeling for the organism. Veterinary Microbiology 112: 127-139.

Hobby GL, Holman AP, Iseman MD, Jones JM (1973). Enumeration of Tubercle Bacilli in Sputum of Patients with Pulmonary Tuberculosis. Antimicrobial Agents and Chemotherapy 4: 94-104.

Hongmanee P, Stender H, Rasmussen OF (2001). Evaluation of a Fluorescence In Situ Hybridization Assay for Differentiation between Tuberculous and NontuberculousMycobacterium Species in Smears of Lowenstein-Jensen and Mycobacteria Growth Indicator Tube Cultures Using Peptide Nucleic Acid Probes. Journal of Clinical Microbiology 39: 1032-1035.

Hotter GS, Wards BJ, Mouat P, Besra GS, Gomes J, Singh M et al (2005). Transposon Mutagenesis of Mb0100 at the ppe1-nrp Locus in Mycobacterium bovis Disrupts Phthiocerol Dimycocerosate (PDIM) and Glycosylphenol-PDIM Biosynthesis, Producing an Avirulent Strain with Vaccine Properties At Least Equal to Those of M. bovis BCG. Journal of Bacteriology 187: 2267-2277.

Houde C, Dery P (1988). Mycobacterium bovis sepsis in an infant with human immunodeficiency virus infection. Pediatr. Infect. Dis. J 7: 810–812.

Doctorat Es Sciences in Microbiology & Molecular Biology References 2012

Huang T-S, Lee SS-J, Tu H-Z, Huang W-K, Chen Y-S, Huang C-K et al (2004). Use of MGIT 960 for rapid quantitative measurement of the susceptibility of Mycobacterium tuberculosis complex to ciprofloxacin and ethionamide. Journal of Antimicrobial Chemotherapy 53: 600-603.

Janeway CA, Travers P, Walport M, Shlomchik M (eds) (2001) Immunobiology . Garland Science: New York and London.

Jang J, Becq J, Gicquel B, Deschavanne P, Neyrolles O (2008). Horizontally acquired genomic islands in the tubercle bacilli. Trends in Microbiology 16: 303-308.

Jeong YJ, Lee KS (2008). Pulmonary Tuberculosis: Up-to-Date Imaging and Management. American Journal of Roentgenology 191: 834-844.

Jonas V, Alden MJ, Curry JI, Kamisango K, Knott CA, Lankford R et al (1993). Detection and identification of Mycobacterium tuberculosis directly from sputum sediments by amplification of rRNA. Journal of Clinical Microbiology 31: 2410-2416.

Kamerbeek J, Schouls L, Kolk A, van Agterveld M, van Soolingen D, Kuijper S et al (1997). Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. Journal of Clinical Microbiology 35: 907-14.

Kaplan G, Cohn ZA (1986). The immunobiology of leprosy. Int Rev Exp Pathol 28: 45-78.

Kato-Maeda M, Rhee JT, Gingeras TR, Salamon H, Drenkow J, Smittipat N et al (2001). Comparing Genomes within the Species Mycobacterium tuberculosis. Genome Research 11: 547-554.

Kendall SL, Rison SCG, Movahedzadeh F, Frita R, Stoker NG (2004). What do microarrays really tell us about M. tuberculosis? Trends in Microbiology 12: 537-544.

Kessler HH (2003). [Molecular diagnosis of mycobacteria]. Wien Med Wochenschr 153: 336-41.

Kiers A, Klarenbeek A, Mendelts B, Van Soolingen D, Ko, ter G (2008). Transmission of Mycobacterium pinnipedii to humans in a zoo with marine mammals. The International Journal of Tuberculosis and Lung Disease 12: 1469-1473.

Kim JY, Ferraro MJ, Branda JA (2009). False-Negative Results Obtained with the Gen-Probe Amplified Mycobacterium tuberculosis Direct Test Caused by Unrecognized Inhibition of the Amplification Reaction. Journal of Clinical Microbiology 47: 2995-2997.

Kim K, Lee H, Lee M-K, Lee S-A, Shim T-S, Lim SY et al (2010). Development and Application of Multiprobe Real-Time PCR Method Targeting the hsp65 Gene for Differentiation of Mycobacterium Species from Isolates and Sputum Specimens. Journal of Clinical Microbiology 48: 3073-3080.

Kox LF, van Leeuwen J, Knijper S, Jansen HM, Kolk AH (1995). PCR assay based on DNA coding for 16S rRNA for detection and identification of mycobacteria in clinical samples. Journal of Clinical Microbiology 33: 3225-33.

Lalvani A, Pareek M (2010). A 100 year update on diagnosis of tuberculosis infection. British Medical Bulletin 93: 69-84.

Doctorat Es Sciences in Microbiology & Molecular Biology References 2012

Lambi EA (1992). Medium selection and incubation for the isolation of mycobacteria. , vol. 1. American Society for Microbiology: Washington D.C.

Lange C, Mori T (2010). Advances in the diagnosis of tuberculosis. . Respirology. 15: 220–240.

Leao S, Martin A, Mejia G, Palomino J, Robledo J, Telles MAS et al (2005). Practical handbook for the phenotypic and genotypic identification of mycobacteria.

Leao SC, Portaels F (2007). History of Tuberculosis. In: Palomino JC, Leao SC and Ritacco V (eds). Tuberculosis from basic science to patient care. pp 25-52.

Lemus D, Martin A, Montoro E, Portaels Fo, Palomino JC (2004). Rapid alternative methods for detection of rifampicin resistance in Mycobacterium tuberculosis. Journal of Antimicrobial Chemotherapy 54: 130-133.

Lévy-Frébault V, Grandry J, David H (1982). Evaluation of rapid tests for the identification of mycobacteria. J Med Microbiol 15: 575- 577.

Lew JM, Kapopoulou A, Jones LM, Cole ST (2011). TubercuList : 10 years after. Tuberculosis (Edinburgh, Scotland) 91: 1-7.

Li L, Bannantine JP, Zhang Q, Amonsin A, May BJ, Alt D et al (2005). The complete genome sequence of Mycobacterium avium subspecies paratuberculosis. Proceedings of the National Academy of Sciences of the United States of America 102: 12344-12349.

Li XJ, Wu QX, Zeng XS (2003). Nontuberculous mycobacterial cutaneous infection confirmed by biochemical tests, polymerase chain reaction-restriction fragment length polymorphism analysis and sequencing of hsp65 gene. British Journal of Dermatology 149: 642-646.

Lima SSS, Clemente WT, Palaci M, Rosa RV, Antunes CMdF, Serufo JC (2008). Matodos convencionais e moleculares para o diagnastico da tuberculose pulmonar: um estudo comparativo. Jornal Brasileiro de Pneumologia 34: 1056-1062.

Madariaga MG, Lalloo UG, Swindells S (2008). Extensively Drug-resistant Tuberculosis. The American journal of medicine 121: 835-844.

Mahairas GG, Sabo PJ, Hickey MJ, Singh DC, Stover CK (1996). Molecular analysis of genetic differences between M. bovis BCG and virulent M. bovis. Journal of Bacteriology 178: 1274-82.

Mark D, Perkins M (2000). New diagnostic tools for tuberculosis. Int J tuberc Lung Dis. 4: 182-188.

Marmiesse M, Brodin P, Buchrieser C, Gutierrez C, Simoes N, Vincent V et al (2004). Macro-array and bioinformatic analyses reveal mycobacterial â€˜coreâ€™ genes, variation in the ESAT-6 gene family and new phylogenetic markers for the Mycobacterium tuberculosis complex. Microbiology 150: 483-496.

Marri PR, Bannantine JP, Golding GB (2006). Comparative genomics of metabolic pathways in Mycobacterium species: gene duplication, gene decay and lateral gene transfer. FEMS Microbiology Reviews 30: 906-925.

Masood R, Sharma Y, Venkitasubramanian K (1985). Metabolism of Mycobacteria. J. Biosci 7: 421– 431.

Doctorat Es Sciences in Microbiology & Molecular Biology References 2012

Mazurek GH, Cave MD, Eisenach KD, Wallace RJ, Bates JH, Crawford JT (1991). Chromosomal DNA fingerprint patterns produced with IS6110 as strain-specific markers for epidemiologic study of tuberculosis. Journal of Clinical Microbiology 29: 2030-2033.

McAdams HP, Erasmus J, Winter JA (1995). Radiologic manifestations of pulmonary tuberculosis. Radiol Clin North Am 33: 655-78.

McEvoy CRE, Falmer AA, van Pittius NCG, Victor TC, van Helden PD, Warren RM (2007). The role of IS6110 in the evolution of Mycobacterium tuberculosis. Tuberculosis (Edinburgh, Scotland) 87: 393-404.

Mendoza M, Juan Ld, MenÃ©ndez S, Ocampo An, Mourelo J, SÃ¡ez JL et al (2011). Tuberculosis due to Mycobacterium bovis and Mycobacterium caprae in sheep. The Veterinary Journal .

Michel AL, MÃ¼ller B, van Helden PD (2011). Mycobacterium bovis at the animalâ€“human interface: A problem, or not? Veterinary Microbiology 140: 371-381.

Morris A (2003). Mycobacteriology: Laboratory Methods and Standards. Guidelines for Tuberculosis Control in New Zealand.

Mustafa AS (2002). Development of new vaccines and diagnostic reagents against tuberculosis. Molecular Immunology 39: 113-119.

Nagesh BS, Sehgal S, Jindal SK, Arora SK (2001). Evaluation of Polymerase Chain Reaction for Detection of Mycobacterium tuberculosis in Pleural Fluid. Chest 119: 1737-1741.

Nakano N, Wada R, Yajima N, Yamamoto N, Wakai Y, Otsuka H et al (2010). Mycobacterial infection of the musculoskeletal tissues: the use of pathological specimens for identification of causative species by PCR-direct sequencing of 16S rDNA. Jpn J Infect Dis. 63: 188-191.

Nazish F (2009). Newer diagnostic techniques for tuberculosis. Respiratory Medicine CME 2: 151– 154.

Neonakis IK, Gitti Z, Krambovitis E, Spandidos DA (2008). Molecular diagnostic tools in mycobacteriology. Journal of Microbiological Methods 75: 1-11.

Nerlich AG, Haas CJ, Zink A, Szeimies U, Hagedorn HG (1997). Molecular evidence for tuberculosis in an ancient Egyptian mummy. The Lancet 350: 1404.

Noordhoek GT, van Embden JDA, Kolk AHJ (1993). Questionable Reliability of the Polymerase Chain Reaction in the Detection of Mycobacterium Tuberculosis. New England Journal of Medicine 329: 2036-2036.

Otal I, MartÃ-n C, Vincent-LÃ©vy-Frebault V, Thierry D, Gicquel B (1991). Restriction fragment length polymorphism analysis using IS6110 as an epidemiological marker in tuberculosis. Journal of Clinical Microbiology 29: 1252-1254.

Padilla E, Manterola J, Rasmussen O, Lonca J, Domínguez J, Matas L et al (2002). Evaluation of a fluorescence hybridisation assay using peptide nucleic acid probes for identification and differentiation of tuberculous and non-tuberculous mycobacteria in liquid cultures. Eur J Clin Microbiol Infect Dis. 19: 140-145.

Doctorat Es Sciences in Microbiology & Molecular Biology References 2012

Panteix G, Gutierrez MC, Boschiroli ML, Rouviere M, Plaidy A, Pressac D et al (2011). Pulmonary tuberculosis due to Mycobacterium microti: a study of six recent cases in France. Journal of Medical Microbiology 59: 984-989.

Park S-K, Kim J-H, Kang H, Cho JS, Smego RA (2009). Pulmonary resection combined with isoniazid- and rifampin-based drug therapy for patients with multidrug-resistant and extensively drug- resistant tuberculosis. International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases 13: 170-175.

Phelan E, El-Gammal A, O’Connor T. (2011). Encyclopedia of Environmental Health , pp 408-417.

Piersimoni C, Scarparo C, Callegaro A, Tosi CP, Nista D, Bornigia S et al (2001). Comparison of MB/BacT ALERT 3D System with Radiometric BACTEC System and LÃ¶wenstein-Jensen Medium for Recovery and Identification of Mycobacteria from Clinical Specimens: a Multicenter Study. Journal of Clinical Microbiology 39: 651-657.

PNLAT. (2011). . DELM Ddléedlclm (ed.): Rabat.

Rafi A, Naghily B (1998). Efficiency of Polymerase Chain Reaction for the diagnosis of tuberculous meningitis. Medical Journal of Islamic Academy of Sciences 11: 117-120.

Raja A (2004). Immunology of tuberculosis. Indian J Med Res. 2012;135 120: 213-232.

Ramaswamy S, Musser J (1998). Molecular genetic basis of antimicrobial agent resistance in Mycobacterium tuberculosis: 1998 update. Tuber Lung Dis 79: 3-29.

Rastogi N, Sola C (2007). Molecular Evolution of the Mycobacterium tuberculosis Complex. In: Palomino JC, Leao SC and Ritacco V (eds). Tuberculosis from basic science to patient care. , First Edition edn. pp 53-91.

Rebollo MaJ, San Juan Garrido R, Folgueira D, Palenque E, DÃ-az-Pedroche C, Lumbreras C et al (2006). Blood and urine samples as useful sources for the direct detection of tuberculosis by polymerase chain reaction. Diagnostic microbiology and infectious disease 56: 141-146.

Restrepo BI, Gomez DI, Shipley GL, McCormick JB, Fisher-Hoch SP (2006). Selective enrichment and detection of mycobacterial DNA in paucibacillary specimens. Journal of Microbiological Methods 67: 220-229.

Ringuet H, Akoua-Koffi C, Honore S, Varnerot A, Vincent V, Berche P et al (1999). hsp65 Sequencing for Identification of Rapidly Growing Mycobacteria. Journal of Clinical Microbiology 37: 852-857.

Rodríguez S, Bezos J, Romero B, de Juan L, Álvarez J, Castellanos E et al (2011). Mycobacterium caprae infectionin livestock and wildlife, Spain. Spanish Network on Surveillance and Monitoring of Animal Tuberculosis. Emerg Infect Dis. 17: 532-535.

Rogall T, Wolters JR, Flohr T, BÃ–Ttger EC (1990). Towards a Phylogeny and Definition of Species at the Molecular Level within the Genus Mycobacterium. International Journal of Systematic Bacteriology 40: 323-330.

Rosas-Magallanes V, Deschavanne P, Quintana-Murci L, Brosch R, Gicquel B, Neyrolles O (2006). Horizontal Transfer of a Virulence Operon to the Ancestor of Mycobacterium tuberculosis. Molecular Biology and Evolution 23: 1129-1135.

Doctorat Es Sciences in Microbiology & Molecular Biology References 2012

Rufenacht S, Bogli-Stuber K, Bodmer T, Jaunin VF, Jmaa DC, Gunn-Moore DA (2011). Mycobacterium microti infection in the cat: a case report, literature review and recent clinical experience. J Feline Med Surg 13: 195-204.

Sakula A (1982). Robert Koch: centenary of the discovery of the tubercle bacillus, 1882. Thorax 37: 246-51.

Saltini C (1998). Direct amplification of Mycobacterium tuberculosis deoxyribonucleic acid in paucibacillary tuberculosis. European Respiratory Journal 11: 1215-1217.

Siddiqi K, Lambert M-L, Walley J (2003). Clinical diagnosis of smear-negative pulmonary tuberculosis in low-income countries: the current evidence. The Lancet Infectious Diseases 3: 288- 296.

Smith NH, Upton P (2011). Naming spoligotype patterns for the RD9-deleted lineage of the Mycobacterium tuberculosis complex; www.Mbovis.org . Infection, Genetics and Evolution .

Soo P-C, Horng Y-T, Hsueh P-R, Shen B-J, Wang J-Y, Tu H-H et al (2006). Direct and Simultaneous Identification of Mycobacterium tuberculosis complex (MTBC) and Mycobacterium tuberculosis (MTB) by Rapid Multiplex nested PCR-ICT assay. Journal of Microbiological Methods 66: 440-448.

Sreevatsan S, Pan X, Stockbauer KE, Connell ND, Kreiswirth BN, Whittam TS et al (1997). Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination. Proceedings of the National Academy of Sciences 94: 9869-9874.

Stager CE, Libonati JP, Siddiqi SH, Davis JR, Hooper NM, Baker JF et al (1991). Role of solid media when used in conjunction with the BACTEC system for mycobacterial isolation and identification. Journal of Clinical Microbiology 29: 154-157.

Stahl DA, Urbance JW (1990). The division between fast- and slow-growing species corresponds to natural relationships among the mycobacteria. Journal of Bacteriology 172: 116-124.

Steingart KR, Henry M, Ng V, Hopewell PC, Ramsay A, Cunningham J et al (2006). Fluorescence versus conventional sputum smear microscopy for tuberculosis: a systematic review. The Lancet Infectious Diseases 6: 570-581.

Stinear TP, Seemann T, Harrison PF, Jenkin GA, Davies JK, Johnson PDR et al (2008). Insights from the complete genome sequence of Mycobacterium marinum on the evolution of Mycobacterium tuberculosis. Genome Research 18: 729-741.

Stinear TP, Seemann T, Pidot S, Frigui W, Reysset G, Garnier T et al (2007). Reductive evolution and niche adaptation inferred from the genome of Mycobacterium ulcerans, the causative agent of Buruli ulcer. Genome Research 17: 192-200.

Supply P, Allix C, Lesjean S, Cardoso-Oelemann M, RÃ¼sch-Gerdes S, Willery E et al (2006). Proposal for Standardization of Optimized Mycobacterial Interspersed Repetitive Unit-Variable- Number Tandem Repeat Typing of Mycobacterium tuberculosis. Journal of Clinical Microbiology 44: 4498-4510.

Swanson DS, Pan X, Musser JM (1996). Identification and subspecific differentiation of Mycobacterium scrofulaceum by automated sequencing of a region of the gene (hsp65) encoding a 65- kilodalton heat shock protein. Journal of Clinical Microbiology 34: 3151-9.

Doctorat Es Sciences in Microbiology & Molecular Biology References 2012

Takahashi T, Tamura M, Takahashi SN, Matsumoto K, Sawada S, Yokoyama E et al (2007). Quantitative nested real-time PCR assay for assessing the clinical course of tuberculous meningitis. Journal of the neurological sciences 255: 69-76.

Taylor GM, Murphy E, Hopkins R, Rutland P, Chistov Y (2007). First report of Mycobacterium bovis DNA in human remains from the Iron Age. Microbiology 153: 1243-1249.

Taylor TB, Patterson C, Hale Y, Safranek WW (1997). Routine use of PCR-restriction fragment length polymorphism analysis for identification of mycobacteria growing in liquid media. Journal of Clinical Microbiology 35: 79-85.

Telenti A, Imboden P, Marchesi F, Matter L, Schopfer K, Bodmer T et al (1993). Detection of rifampicin-resistance mutations in Mycobacterium tuberculosis. The Lancet 341: 647-651.

Thierry D, Cave MD, Eisenach KD, Crawford JT, Bates JH, Gicquel B et al (1990). IS6110, an IS-like element of Mycobacterium tuberculosis complex. Nucleic Acids Research 18: 188.

Thoen C, LoBue P, de Kantor I (2006). The importance of Mycobacterium bovis as a zoonosis. Veterinary Microbiology 112: 339-345.

Thorne N, Borrell S, Evans J, Magee J, Garcaa de Viedma D, Bishop C et al (2011). IS6110-based global phylogeny of Mycobacterium tuberculosis. Infection, Genetics and Evolution 11: 132-138.

Tobler NE, Pfunder M, Herzog K, Frey JE, Altwegg M (2006). Rapid detection and species identification of Mycobacterium spp. using real-time PCR and DNA-Microarray. Journal of Microbiological Methods 66: 116-124.

Tortoli E, Benedetti M, Fontanelli A, Simonetti MT (2002). Evaluation of Automated BACTEC MGIT 960 System for Testing Susceptibility of Mycobacterium tuberculosis to Four Major Antituberculous Drugs: Comparison with the Radiometric BACTEC 460TB Method and the Agar Plate Method of Proportion. Journal of Clinical Microbiology 40: 607-610.

Tortoli E, Cichero P, Piersimoni C, Simonetti MT, Gesu G, Nista D (1999). Use of BACTEC MGIT 960 for Recovery of Mycobacteria from Clinical Specimens: Multicenter Study. Journal of Clinical Microbiology 37: 3578-3582.

Tortoli E, Simonetti MT, Lavinia F (1996). Evaluation of reformulated chemiluminescent DNA probe (AccuProbe) for culture identification of Mycobacterium kansasii. Journal of Clinical Microbiology 34: 2838-40.

Ussery DW, Wassenaar TM, Borini S (2009). Computing for Comparative Microbial Genomics: Bioinformatics for Microbiologists Springer: London, 285pp. van Embden JD, Cave MD, Crawford JT, Dale JW, Eisenach KD, Gicquel B et al (1993). Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. Journal of Clinical Microbiology 31: 406-409. van Ingen J, Boeree MJ, van Soolingen D, Iseman MD, Heifets LB, Daley CL (2011). Are phylogenetic position, virulence, drug susceptibility and in vivo response to treatment in mycobacteria interrelated? Infection, Genetics and Evolution .

Doctorat Es Sciences in Microbiology & Molecular Biology References 2012

van Soolingen D, Hermans PW, de Haas PE, Soll DR, van Embden JD (1991). Occurrence and stability of insertion sequences in Mycobacterium tuberculosis complex strains: evaluation of an insertion sequence-dependent DNA polymorphism as a tool in the epidemiology of tuberculosis. Journal of Clinical Microbiology 29: 2578-2586.

Varma-Basil M, Pathak R, Singh K, Dwivedi S, Garima K, Kumar S et al (2010). Direct early identification of Mycobacterium tuberculosis by PCR-restriction fragment length polymorphism analysis from clinical samples. Jpn J Infect Dis 63: 55-57.

Veyrier F, Pletzer D, Turenne C, Behr M (2009). Phylogenetic detection of horizontal gene transfer during the step-wise genesis of Mycobacterium tuberculosis. BMC Evolutionary Biology 9: 196.

Wang S, Tay L, Sng L (2005). Rapid identification of pathogenic rapidly growing mycobacteria by PCR-restriction endonuclease analysis. Ann Acd Med Singapore 34: 137-140.

Warren RM, Gey van Pittius NC, Barnard M, Hesseling A, Engelke E, de Kock M et al (2006). Differentiation of M. tuberculosis complex by PCR amplification of genomic regions of difference [Short Communication]. The International Journal of Tuberculosis and Lung Disease 10: 818-822.

Wassenaar T, Bohlin J, Binnewies T, Ussery D (2009). Genome Comparison of Bacterial Pathogens. Microbial Pathogenomics 6: 1–20.

WHO R. (2011a). WHO/HTM/TB/2011.16 (ed.), pp 258.

WHO R. (2011b). WHO Library Cataloguing-in-Publication Data.

Wirth T, Hildebrand F, Allix-BÃ©guec C, WÃ¶lbeling F, Kubica T, Kremer K et al (2008). Origin, Spread and Demography of the Mycobacterium tuberculosis Complex. PLoS Pathog 4: e1000160.

WWW.WHO.INT/EMC . (1996.). .WHO/EMC/ZOO/96.4. (ed.).

Yam W-C, Yuen K-Y, Kam S-Y, Yiu L-S, Chan K-S, Leung C-C et al (2006). Diagnostic application of genotypic identification of mycobacteria. Journal of Medical Microbiology 55: 529-536.

Yam WC, Cheng VCC, Hui WT, Wang LN, Seto WH, Yuen KY (2004). Direct detection of Mycobacterium tuberculosis in clinical specimens using single-tube biotinylated nested polymerase chain reaction-enzyme linked immunoassay (PCR-ELISA). Diagnostic microbiology and infectious disease 48: 271-275.

Yeager H, Lacy JJ, Smith L, Le Maistre C (1967). Quantitative studies of mycobacterial populations in sputum and saliva. Am. Rev. Respir. Dis. 95: 998-1004.

Zakham F, Bazoui H, Akrim M, Lemrabet S, Lahlou O, Elmzibri M et al (2012). Evaluation of conventional molecular diagnosis of Mycobacterium tuberculosis in clinical specimens from Morocco. J Infect Dev Ctries 12: 40-5.

Zakham F, Belayachi L, Ussery D, Akrim M, Benjouad A, El Aouad R et al (2011). Mycobacterial species as Case study of comparative genome analysis. . Cellular Molecular Biology 57: 1462-1469.

Zimmerman MR (1977). Pulmonary and osseous tuberculosis in an Egyptian mummy. Bull. N.Y. Acad. Med 55: 604-608.

Ziskind B, Halioua B (2007). La tuberculose en ancienne. Rev Mal Respir 24: 1277-1283

Doctorat Es Science Microbiology & Molecular biology Appendix 2012

Appendix (1)

Decontamination of sputum specimens by N-acetyl cysteien and sodium hydroxide (Kubica method) 1) Preparation of solution (1) sodium citrate: Trisodium citrate, 3 H20 ...... 29.4 g Distilled water ...... 1000 ml Dispense in 50 ml vials. Autoclave 10 min at 120 ° C. Store at room temp. 2) Preparation of solution (2) 4% sodium Sodium hydroxide pellets, ...... 40 g Distilled water ...... 1000 ml Dispense in 50 ml vials. Autoclave. Store at room temp. Mix 50 ml of each solution 1 and 2 in a sterile container, and store at room temp. 3) Preparation of the solution of N-acetyl cysteine Solution of N-acetyl - cysteine ...... 0.5 g A mixture of two solutions ...... 100 ml Filter. CAUTION: The final mixture should be done every day, because the reagent does not keep. Procedure : Decontamination using acetyl cysteine and sodium hydroxide (Kubica method) In a conical centrifuge tube: - Add to 3 ml of pathological product, 4 ml of decontamination solution. - Mix by vortexing for 20 seconds, return the tube to complete the contact. - Leave for 20 minutes at room temperature with gentle agitation on shaker Kahn. - Add up to 50 ml phosphate buffer. - Centrifuge 30 min at 3000 g. - Discard the supernatant and the pellet again with 1 ml of phosphate buffer.

Doctorat Es Science Microbiology & Molecular biology Appendix 2012

Appendix (2)

Ziehl-Neelsen staining: REAGENTS: 1) Ziehl-Neelsen Carbol-Fuchsin Solution: Basic fuchsin 2.5 gm Distilled water 250.0 ml 100% alcohol 25.0 ml Phenol crystals, melted 12.5 ml Mix well, filter into brown bottle. Label bottle with date and initials, solution is stable for 1 year.

2) 1% Acid Alcohol: Hydrochloric acid 10.0 ml 70% Alcohol 990.0 ml Mix well, label with date and initials, stable for 1 year.

3) Methylene Blue Stock Solution: Methylene blue 0.7 gm Distilled water 50.0 ml Mix well, filter into bottle. Label with date and initials, stable for 1 year. Methylene Blue Working Solution: Methylene Blue Stock 5.0 ml Distilled water 45.0 ml Pour into coplin jar, stable for 2 months. PROCEDURE: 1. Allow slides to stand in hot solution of Carbol-Fuchsin for 5 minutes. 2. Wash in running tap water. 3. 1% Acid alcohol until light pink and color stops running. 4. Wash in running tap water for 5 minutes.. 5. Rinse in distilled water.

Doctorat Es Science Microbiology & Molecular biology Appendix 2012

6. Working methylene blue for 1 min. 8. Rinse in water. 9. Dehydrate, clear, and coverslip.

Appendix (3)

Electrophoresis on gel;

Buffer TBE 5X:

Tris base 54g

Boric acid 27.5g

EDTA 0.5 M 20ml

Distilled water 1000ml

Ethidium bromide 10mg/ml

E.B 50 mg

D.W 5ml

0.5 EDTA:

EDTA 93 g

H2Oqsp 500ml