University of Calgary PRISM: University of Calgary's Digital Repository

Graduate Studies Legacy Theses

1997 Tyrosine kinase pathways, smooth muscle function and iNOS induction

Zheng, Xilong

Zheng, X. (1997). Tyrosine kinase pathways, smooth muscle function and iNOS induction (Unpublished doctoral thesis). University of Calgary, Calgary, AB. doi:10.11575/PRISM/17957 http://hdl.handle.net/1880/26938 doctoral thesis

University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca THE UNIVERSITY OF CALGARY

TYROSINE KINASE PATHWAYS, SMOOTEI MUSCLE FUNCTION AND

iNOS INDUCTION

by

Xiiong Zheng

A DISSERTATION

SUBMKTED TO TEE FACULTY OF GRADUATE STUDiES

IN PARTIAL FULE*ILMENT OF THE REQUIREMENTS FOR TEE

DEGREE OF DOCTOR OF PEILOSOPHY

DEPARTMENT OF MEDICAL SCIENCE

CALGARY, ALBERTA

JUNE, 1997

0Xüong Zheng 1997 IYPIIOMI uurary OIUIIUU I~UUI IOUUI I~JU 1*1 oiCanada du Canada Acquisitions and Acquisitions et Bibliographie Services services bibliographiques 395 Weilington Street 395, nie Wellington Ottawa ON KlA ON4 Ottawa ON K1A ON4 Canada Canada

The author has granted a non- L'auteur a accordé une Licence non exclusive licence ailowing the exclusive permettant a la National Library of Canada to Bibliothèque nationafe du Canada de reproduce, loan, distriiute or sell reproduire, prêter, distniuer ou copies of this thesis in microfonn, vendre des copies de cette thése sous paper or electronic formats. la forme de rnicrofiche/fh, de reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni Ia thèse ni des extraits substantiels may be printed or othewise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation- ABSTRACT

The role(s) of tyrosine kinase (TYK) pathways in both a conirade response and

the induction of induciile nitric oxide synthase (iNOS)have been studied in vasniIar and

gastric smooth muscle (SM) tissue. In guinea pig (GP) gastric Iongituduial muscle (LM),

contractions caused by epidermal growth factor-urogastrone (EGF), ethanol and a thrombin receptor activating peptide (PAR@) were found to share signalhg pathway enzymes, including TM(, diacylglycerol lipase and cyclooxygenase. The LM responses to

EGF and PAR,AP also involved MAP kinase-kinase (MEX), phosphatidyhositol3-kinase and protein kinase C, whereas the ethanol response did not. Ethanol PAR,AP and EGF- induced responses were al1 dependent on extracellular Ca2'; the EGF and PAR,AP responses involved a voltage-operated Ca2+charnel whereas the ethanol response involved a receptor-operated channel. Neither the ethano1 nor the PAR,AP contractile response were due to transactivation of the EGF receptor. In the organ bath, WOS was induced spontaneously in rat aorta (RA) and rat gastric circular muscle (RGCM)tissue, but not in RGLM.in the RA, but not in the CM, both a tyrosine kinase inhibitor (AG213) and a tyrosine phosphatase inhibitor (vanadate) blocked fùnctional iNOS induction.

Whereas vanadate blocked both iNOS mRNA induction and the induction of BOS enzyme activity, AG2 13 blocked only the appearance of enzyme activity, as assesseci by an

L-arginine relaxation response. In the RA but not in RGCM, iNOS induction was dependent on NF-kB activity; in the RGCM but not in the RA tissue, iNOS induction depended on the synthesis of a cycloheximide-sensitive factor. In the RGCM tissue, tNOS induction occurred in the macrophage-related cens, but not, as in the RA tissue, in the

iii smooth muscle element. It was concluded that, depending on the smooth muscle phenotype, TYKs and tyrosine phosphatases may play a role in smooth muscle bction, both in tems of regulating the aaite contractile response and in tems of modulating enzyme induction as typified by NOS. There are no words in the world that can be found for me to express my appreciation to my supervisor, Dr. Morley D. Hollenberg, to whom 1 am deeply indebted.

Without Dr. Hollenberg's generous support and bis excellent supervision, the work presented in this thesis wuld not have been accomplished. 1would iike to thank Drs.

David L. Severson and Chris R. Triggle, my supervisory cornmittee members, for their wonderfiil suggestions and encouragement during my study. Dr. Keith A Sharkey is highly appreciated for his help with the immunohistochemical studies in this thesis. 1 would also Iike to thank Dr. Sultan Ahmad for his heIp with the molecular biological studies and

Ms. Winnie Ho for her technical help with irnmunoùistochemical studies. Dr. Mike Walsh and Dr. Roger Loutzenhiser who were examiners in my candidacy examination are also highly appreciated. The input of Drs. Steven L. Pelech and Keith A Sharkey as the extemal examiners of this thesis is also gratefdiy acknowIedged. Partial sdary support that provided for the completion of this thesis work was provided by Wiam H. Davies

Medical Research Scholarship. DEDICATION

TO MY MOTHER

TO MY WIFE, YU AND MY DAUGHTER JIE TABLE OF CONTENTS

APPROVALPAGE ...... u..

DEDICATION ...... vi

TABLEOFCONTENTS ...... vi

LISTOFTABLES ...... xiv

LISTOFFIGURES ...... xv

LISTOFABBREVIATIONS ...... xxi

CHAPTER ONE: INTRODUCTION ...... 1

1.1.0veMew ...... 1

1.2. Mechanisrns of smooth muscle contraction and relaxation ...... 5

1 -2.1. Caz' dependent contractile machinery ...... 5 1.2.2. Regdation of intraceMar fiee Ca2' ...... 6

1.2.3. Myosin regdation ...... 9

1.2.4. Thin filament regdation of smooth muscle ...... 12

1.2.5. Protein kinaseC ...... 14

1.3. The role of tyrosine kinase in signal transduction ...... 15

1.3.1.Introduction ...... 15

1.3 .2. Tyrosine kinase receptors ...... 16

1-3 -3 . Activation of c-Src ...... 18

1-3 .4 . The mitogen activated protein (MAP) kinase cascade ...... 19

1 -3.5 . Phosphatidylinositol3- (PI 3-j kinase ...... 22

1 .3.6.G protein coupled receptors: Introduction ...... 23

1.3.7. Gpy and the MAP kinase cascade ...... 27

1 -3.7.1. Gpy-mediated Ras dependent MAP kinase pathway ... 28

1.3.7.2. Tyrosine kinase pathways and MAPK ...... 29

1 -3.7.3 . Tyrosine kinases as candidates in the activation of MAPK

by G protein coupled receptor ...... 30

1-3 -7 .4 . ûther signaling moIdes ...... 35

1.3.8. G protein Gq and the activation of MAP kinase ...... 37

1.3.9. Tyrosine kinase pathways and smooth muscle fbnction ...... 38

1.4. Signal transduction pathways and the induction of nitric oxide synthase

(mas) ...... 41

1 .4.1. Nïm~oxide synthesis ...... 41

viii 1.4.2. Sigaalling byN0 ...... 42

1 .4.3. NOS isoforms and distribution ...... 45

1.4.4. Structure of NOS ...... 50

1.4.5. Signal transduction and ïNOS induction ...... 51

1.4.5.2. NOS gene ...... 51

1.4.5.2.ïNQS mRNA stabüity ...... 52

1 .4.5 .3 . Functional regulation of 240s ...... 52

1.4.5.4. Signalling for iNOS gene transcription ...... 53

1.4.5.5. Tyrosine kinase pathway and BOS induction ...... 56

1.5 . PreIiminary observations and rationale for the work described in the thesis

...... 58

1.5.1.Background ...... 58

1.5.2. Preliary expenmeuts ...... 60

1.5.3. Main goak of the thesis ...... 61

CHAPTER TWO: MATERIALS AND METHODS ...... 63

2.1. Materials and reagents ...... 63

2.2. Bioassay procedures ...... 64

2.2.1. Gastric smooth muscle preparation ...... 64

2.2.2. Rat aorta preparation ...... 67

2.3. Western blot analysis ...... 68

2.4. Preparation of tissue RN& reverse transcriptase-polymerase chah reaction analysis and nuckotide quencing ...... 69

2.5. L-arginïne-mediateci relaxation assay ...... 70

2.6. Immunohistochemistry ...... 71

CHAPTER THREE: SIGNALLING PATBWAYS FOR THE CONTRACTLE

ACTION OF ETHANOL, EGF AND THROMBIN RECEPTOR

ACTIVATINGPEPTIDE ...... 72

3.1.Introduction ...... 72

3.2. Ethanol-induced contractile response ...... 75

3.2.1. Effts of tyrosine kinase inhibitors, indomethacin and inhibitors of

nerve-released agonists ...... 75

3.2.2. Actions of other aicohols and concentration-effect curves ...... 79

3 .2.3. Role of extracellular calcium ...... 82

3.2.4. Effects ofU57, 908 and mepacrine ...... 82

3 -2.5. Potential roles of protein kinase C, phosphatidylinositol3-kinase and

MAP-kinasekinase(MEK) ...... 85

3 -2.6.Role of EGF receptor kinase activation in the contractile action of

ethanoi ...... 94

3.2.7. Tyrosine phosphatase and phosphotyrosyl proteins ...... 94

3.2.8. Summary ...... 105

3.3. Contraction caused by thrombin receptor activating peptide ...... 106

3.3.1. The contraction causeci by TFLLR-NE& (T,P5-NHJ and the effects of tyrosine kinase inhibitors. indomethach and inhibitors of neme-

released agonists ...... 106

3 -3.2 . Effécts of US?. 908 and mqacrine ...... 111

3.3 .3. Potential roles of protein kinase C, phosphatidyhositoI3-kinase and

MAP-kinasekinase(MEK) ...... 116

3.3.4. Role of the EGF receptor kinase in the T,PS-NH, response .... 125

3 -3.5 . Potentiai role of GS~Ckinase in T,PS.NH&duced contractions

...... 125

3.3.6. Summary ...... 132

CHAPTER FOUR: TYROSINE KINASE PATHWAYS AND WOS INDUCTION

IN SMOOTH MUSCLE PREPARATIONS

...... 141

4.1.Introduction ...... 141

4.2. Methods ...... 144

4.2.1. Characterization of BOS induction usmg the LR relaxation assay

...... 144

4.3.Resdt ...... 145

4.3.1. L-arwe induced relaxation ...... 145

4.3 .2 . Inhibition of L-arginine-induced relaxation by aminoguanidine and

LY83583 ...... 149

4.3.3. The induction of NOS mRNA ...... 249 4.3.4. Cloning and sequencing of the NOS PCR hgment ...... 156

4.3 .5 . Locafization of NOS in gastrk tissue ...... 163

4.4. Effects of actinomycin D and cycloheximide on NOS induction ...... 164

4.5. Effects of NF-& inhibitors on NOS induction ...... 176

4.6. Effects of tyrosine kinase inhibitorson NOS induction ...... 181

4.7. Efféct of tyrosine phosphatase inhicbitor vanadate on the NOS induction

...... 186

4.8. Induction of NOS by interkukh-1 p ...... 193

4.8.1. Potentiation ofNOS induction in the presence of interleukin- 1

...... 193

4.8.2. Signahg and IL-1P-stimulateci NOS induction in the rat aorta

tissue ...... 198

4.9.S ummary ...... 205

CHAPTERFIVEDISCUSSION ...... 209

5.1. Integration ...... 209

5.2. Signal transduction pathways and smooth muscle contraction ...... 210

5.2.1. The contractile response caused by ethanol ...... 210

5.2.2. Thrombin receptor activating peptide induceci contraction ..... 218

5.3. Induction of iNOS in smooth muscle preparations ...... 230

5.3.1. Characterization of NOS induction ...... 230

5.3 .2 . Differential signahg in the induction of NOS ...... 234

xii xiii LIST OF TABLES

Table 1.1 Isofonns of nitric oxide synthase ...... 48

Table 3.1 Modulation of EGF and ethaaol induced contractile rcsponscs by various

signalling pathway regdatom ...... 99

Table 3.2 Signaliing pathways shdby both EGF and tbrombin receptor

activating peptide in the contractile rtsponse of LM preparations ...... 140

Table 4.1 Diffenntial induction of NOS in rat aorta and CM tissues ...... 206

Table 4.2 Induction of iNOS in rat aorta tissue ...... 208

xiv LIST OF FIGURES

Fig. 1.1 The mode1 of reguiation of smoath muscle fuactbn ...... 3

Fig. 1.3 The domUn structure of nitric oxide synthasc and the pmess of nimk oxide

synthesis...... 43

Fig. 1.4 The regulation ofsmooth musde fundion by nitric oride nkwcd fmm

endotheüd ceb and nerve ending ...... 46

Fig. 2.1 Aaatomid structure of stomach and biorssay procedum...... 65

Fig. 3.1 The contractile actions of ethano! and EGF or TGF-ain gastric longituduid

(LM) and circular muscle (CM) strips: effcets of genistein (GS) and

indomethacin (INDO)...... 77

Fig. 3.2 The inhibition of ethanol-stimulated contractions in LM and CM tissue by

either genistein (GS) or tyrphostin 47 (TP): concentration-effeet curves. .. 80

Fig. 3.3 The contractile responses of LM and CM muscie sbips to metbanol, ethanol

and propanol: concentration-effkct curves...... 83

Fig. 3.4 The role of extracellular caicium...... 86

Fig. 3.5 The mie of calcium infiux in the contracale actions of ethanol and EGF in

longitudinai muscle strïps effeets of nifedipine and SKF96365 ...... 88

Fig. 3.6 Effects of inbibiton of phospbolipase A, and diacylgiycerol lipase on

ethanol-induced contractions in LM and CM tissue strips...... 90

Fig. 3.7 Differential effeet of protein kinase C inhibitor on the contractiie responses

in LM tissue caused by EGF...... 92

Fig. 3.8 Effeets of inhibitors of PI 3 kinase and MAP kinase kinase (MEK) on longitudinal strip contractions causai by EGF and etbanol ...... 95

Fig. 3.9 Cross-acthation of the EGF receptor does not account for ethanol-inducd

Iongitudinai muscle contractions ...... 97

Fig. 3-10Potentiation of ethanoCinduccd contractions in longitudiaal muscie by

pervanadate ...... 101

Fig. 3.11 The stimulation of proteii tyrosine phospho ylation by EGF and ethanol

in longitudinal muscle strips ...... 103

Fig. 3.12 Contractile action of T,PS-NH, peptide in gastric LM tissues:

concentration-efftct cuwe ...... 107

Fig. 3-13 Effects of the tyrosine kinase inhibitor tyrphostin 47/AG 213 (TP) and the

cyclo-oxygenase inhibitor indomethach (iND) on contractile mponses in

guinerpigLMtWu...... 109

Fig. 3.14 The dependence of the contractüe mponse on extmceNular calcium. . 112

Fig. 3.15 Effects of the diacylglycerol lijmse inhibitor US7908 on EGF and T,PS-

NE,-induced contraction in LM tissue strips ...... 114

Fig. 3.16 Effects of the protein kinase C iabibitor GF109203X on the contractile

responses of LM tissue...... 1 17

Fig. 3.17 Effect of wortmannin on the contractile rtsponse to EGF: concentration-

effectcurve, ...... 119

Fig. 3.18 Effkcts of inhibitors of PI 3 kinase on agonist induced contractions in the

longitudinaà muscle ppnaration ...... 12 1

Fig. 3.19 Inhibition of contractiie responses by the MEK inhibitor, PD9059 and the

xvi PI 3-kinase inhibitor, wortmannin 0...... 123

Fig. 3.20 Concentration-efféct cu~afor the MEK inhibitor, PD98059 ...... 126

Fig. 3.21 Concea#ration-dependent effeet of PDl5J035 ou the contractile nsponse

...... 128

Fig. 3.22 Lack of effeet of the EGF kinase inhibitor, PD153035 on contraction

caused by thrombin receptor activation...... 130

Fig. 3.23 Concentration-effcet curve for CP118,556, a.Src-famiïy kinase inhibitor, on

the contractile responses of LM tissue ...... 134

Fig 334 Inhibition of contractile responscs by the Sm-family kinase inhibitor,

CP118,556...... 136

Fig. 3.25 Concentration-efféct curve for the tyrosine kinase inhibitor, PD89828 on

the contractile responses of LM tissue...... 138

Fig. 4.1 Induction of Larginine relnration in rat aort. preparations ...... 146

Fig. 4.2 L-amnine (LR) responses in the gastric cirtular (CM) and' longitudinal

(LM) muscle preparatïons ...... 150

Fig. 4.3 Time-depeadent L-agiaine (LR)-induced relaxation in the CM preparation

...... 152

Fig. 4.4 Effeets of the NOS inhibitor, aminoguiaidine (AG) (left portion) and the

guanylyl cydase inhibitor, LYû3583 (LY) (right portion) on L-arginine (LR)-

induced relaxation in the rit aortl without endotbdium (-endo) and rat

gastric CM (RGCM) preparations

xvii Fig. 4.5 The induction of NOS mRNA in rat aorta tissue ...... 157

Fig. 4.6 Correlation of the devehpment of an Luginint (LR)-induced relaxation

(lower panel) with the appcarance of NOS mRNA (upper panels) ...... 159

Fig. 4.7 Nucleotide sequence of the PCR fngment amplificd from gastric CM tissue

...... 161

Fig. 4.8 Immuaohistochemicai detection of iNOS and bNOS...... 165

Fig. 4.9 Co-localkation of iNOS-positive immunoreactivity with macrophagodated

ceUs in "induced" CM tissue ...... 167

Fig. 4.10 Effects of actinomycin D (ACTD)and cycloherimide (CBX)on the

induction of Garginine (LR) mediated relaxation in both rat aorta without

endothelium (left) and rat gastric CM (RGCM)(right) ...... 169

Fig. 4.11 Effeets of actinomycin D (ACTD) and cyclohesimide (CBX)on the

induction of NOS mRNA ...... 171

Fig. 4.12 Induction of c-fos protein in gastric CM preparation ...... 174

Fig. 4.13 Effects of the inhibitors of NF-- activation on the induction of Larginine

(LR) relaxation ...... 177

Fig. 4.14 Effect of TPCK on NOS messenger RNA induction in rat aoi2a tissue

...... 179

Fig. 4.15 Effects of the tyrosine kinase inhibitors genistein (GS) and tyrphostin

47lAG 213 (TP 47) on the appearance of Larginine (LR) induced relaxation

...... 182

Fig. 4.16 Appearance of *OS mRNA: (a) EffFects of the tyrosine kinase inhibitors

xviii genistein (GS) and tyrphostin 47/AG 213 (TP) in rat aorta tissues and (b)

effmt of tpphostin 47/AG 213 and TPCK in the CM prepantions .... 184

Fig. 4.17 Effect of tyrpbostin 47/AG 213 (TP 47) on Garghine (LR) inducd

relaxation in rat aorta preparation after the induction of the LR relaxation

response...... 187

Fig. 4.18 Differentiai cffects of vanadate (VAN) on the induction of Larginine (LR)

induced daxation responsts in rat aorta tissue (RA) and the gastic CM

preparation (RGCM)...... 189

Fig. 4.19 Effet of vanadate (VAN) on the induction of iNOS messenger in rat aorta

tissue...... 191

Fig. 4.20 Effects of ILlP on Larginine (LR)induced daration in rat aorta (RA)

and gastric circuiar muscle (CM) preparations ...... 194

Fig. 4.21 Effects of aminoguanidine on the tension loss of phenylephrine induced

contractile response in untreated and IGletreated smooth muscle

preparations ...... 1%

Fig. 4.22 Effects of ILlP on the appearance of BOS messenger RNA in the rat

aorta (RA) and gastric circular muscle (CM) tissues ...... 149

Fig. 4.23 Effect of tyrphostin 47 (TP)/AG 213 on the induction of iNOS messenger

RNA by ILlP (10 ng/ml) in rat aom (RA) tissue...... 201

Fig. 4.24 Effect of the NF-KB inhibitor TPCK and the tyrosine phosphatase

inhibitor vanadate (VAN) on the induction of NOS messenger stimuhted by

LLlP (10 ng/ml) in the rat aortri (RA) tissue...... 203 Fig. 5.1 Possible targets for ethano1 to cause a contractile mpnse in smooth musde.

...... 2 19

Fig. 5.2 Signalling map for G protein coupled tbrombin receptor and EGF tyrosine

kinase receptor in the contractüt responst of smooth muscle ...... 228

Fig. 5.3 Differentiai induction of DIOS in rat aortie smooth muscle cclls and

macrophage-related ceüs in gastric CM tissue ...... 235 LIST OF ABBREVIATIONS

AA: arachidonic acid

AC: adenylyl cycIase

ACTD: actinomycin D

ADP: adenosine 5'-diphosphate

AG: aminoguanidine

AII: angiotensin 11

ATP: adenoshe S'-triphosphate

BH4: tetrahydrobiopte~

Btk: B-cell tyrosine kinase

B ARK: beta-adrenergic receptor kinase

CaM: cdmodulin

CaMKII: Ca2*-CaMdependent protein kinase II

CaD: caldesmon

CAMP:cyclic adenosine 3'3 monophosphate

Cap: CaIponin

Cch: carbachol

cDNA: complementary DNA

cGMP: cyclic guanosine 3'3' monophosphate

CHX: cyclohe~de

CM: circula. muscle

cNOS: constitutive nitnc oxide synthase

xxi cPLA2: cytosolic phospholipase A2

CREB: CAMP response eIememt binding protein

Csk: c-Src kinase

DAG: diacylglycerol

DNA: deoxyribonucleic acids

EGF: epidermai growth factor-urogastrone

EGTA: ethylegiycol-bis (Ma-amùioethyl ether)-N, N-tetra acetic acid

ERK: extraceiiuiar-regdated kinase

ERKK: extraceildar response kinase kinase

FAD: fiavin adenine dinucieotide

FMN: flavin monomcleotide

FRAP: rapamycin-associated protein

GADPH: gl yceraldehyde 3-phosphat e dehydrogenase

GAP: GTPase-activating protein

GAS: gamma MF-activated site

GI: gastrointestinal

GPCM: guinea pig gasmc circular muscle preparation

GPLM: guinea pig gastnc Iongitudd muscle preparation

GPCR: G protein coupled receptor

ûrb2: growth factor receptor binding protein 2

GRKs: G protein coupied receptor kinases

GS: genistein HA-ERK: hemaglutinin epitope-tagged extracellular regulated kinase

IFN: interféron

MB: inhibitory subunit of NF-KB

IL-1 P: interleukin- 1P

IND:indornethacin iNOS: inducible nitic oxide synthase

P3 : inositoI 1,4,5-trisphosphate y -IRE:interferon-y response elemenî

JNK: Jun N-terminal kinase

LC20: Iight chain-20

LM:1ongitudinaI muscle

LP A: lysophosphatidic acid

LPS: lipopolysaccharide

LR: L-arginine mAchR: muscarinic acetyf choline receptor

MAPK: mitogen-activated protein kinase

MEK: MAP-kinase kinase

MLCK: myosin Light chah kinase

MP: mepacrine

NADP: nicotinamide adenine dinucleotide phosphate

NANC: non-adrenergic non-chotinergic

NDGA: nordihydroguairetic acid nNOS: neural nitnc oxide synthase

NO: nitric oxide

PBS: phosphate buffered saline

PC : phosphatidylcholine

PCR: polymerase chah reaction

PDB:phorbol dibutyrate

PDGF:platelet-derived growth factor

PDTC : pyrrolidine dithiobawarnate

PE: phenylephrine

PH domain: pleckstria homology domain

PU Kinase: phosphatidylinositol3-kuÿise

PIP3 : phosphatidylinositol-3 phosphate

PIP,: phosphatidylinositol4,5-bisphosphate

PKA: protein kinase A

PKB: proteh kinase B

PKC: protein kinase C

PKG: protein kinase G

PLC: phospholipase C

PMA: phorbol 12-myristate 13-acetate

PP 1: protein phosphatase 1

PP2A: proteh phosphatase 2 A

PTB domain: phosphotyosine binding domain

xxiv PTX: pernissis toxh

PYKî: protein tyrosine kinase 2

RA: rat aorta

RGCM: rat gastric circular muscle

RNA: ribonucleic acid

RT-PCR: reverse transcriptase-poIymerase chah reaction

SH2 dornain: Src homoIogy 2 domain

SH3 domain: Src homology 3 dornain

SM: smooth muscle

SNP: sodium nitroprusside

SOS: son of seveniess

SR: sarcoplasmic reticulurn

TGF: transfonning growth factor

THB: tetrahydrobiopterin

TNF: turnor necrosis fàctor

TM;RE: tumor necrosis factor response element

T,P5-NH,: TFLLR-NE&

TP: tyrphostin 47

TPCK: N-a-toçyl-L-phenylalanine-chloromethyketone

TTX:tetrodotoxin

UV: ultraviolet

VAN: vanadate WM: wortmannin CHAPTER ONE: INTRODUCTION

1.1. Ove~ew

Smooth muscle can be found in many physioiogicai systems, including vascular smooth muscle present in the circulatory systern and non-vasdar smooth muscle found in the gastrointestinal (GI), respiratory and genitourinary systems. The Mional regdation of either vascular or non-vascular smooth muscle bas been documenteci to play important roles in the pathophysiology of these anatomid systems, which contain smooth muscte elements. The digestion and absorption in the digestive system largely depend on the fiinction of smooth muscle present in the entire GI tract. There is no doubt that the investigation of the tùnctional regdation of GI smooth muscle wiil facilitate the understanding of pathophysiologicai processes and the trament of some clinid diseases.

In addition, the vascular smooth muscle in the blood vessels bas been weil docwnented to play a criticaI role in the regulation of blood pressure, either directly through the responses of smooth muscle to various hormones and neurotransmitters such as adrenaline, or indiiectly through the responses of smooth muscle in the blood vessels to factors released fiom the endothelium such as nitric oxide. The dydbnction of vascular smooth muscle in endotoxic shock during sepsis is found to result at hast partially fiom the appearance of inducible nitnc oxide synthase (iNOS) in smooth muscle elements. This enzyme produces an excessive amount of nitric oxide, Ieading to clinid hypotension through inducing a direct relaxation of smooth muscle and an attenuated response to some vasoconstrictors

(Schott et al., 1993; Gold el arl.. 1990; Jovanovic et al., 1994; Corbett er al.,1993). 2 The regulation ofsmooth muscle fiinction, including both contraction and relaxation, can be achieved by various extracellular regdators through stimdating various signal transduction pathways. Both contraction and relaxation of smooth muscle are tightly regdated under physiologicai conditions (Fig. 1.1). After a single contractile stimulus causes an acute tonic or phasic contraction of smooth muscle, the smooth muscle may auto-regulate its function at several levels such as acute desensituation to the contractile agonist or a delayed regdation of gene transcription to produce a new signalhg moleaile to dom-regulate the respoase. To explore the fùnctiod regulation of smooth muscle in either physiological or pathological process, it is obligatory to review an updated description of the contrade machinery in smooth muscle, as outlined in Section

1.2. below. Since the ftnction of smooth muscle has been descnbed to be regulated either positively by contractile agonists, such as those for tyrosine kinase receptors and G protein coupled receptors, or negatively by the synthesis of inducible nitnc onde synthase, that produces nitric oxide, an investigation of the signal transduction pathways triggered by either tyrosine kinase receptors or G protein coupled receptors and an analysis of the pathways employed for the induction ofiNOS in both smooth muscle and other ceII types would be expected to lead to a better understanding of the hctional regulation of srnooth muscle systems. These areas of investigation (Le. paraüel contraaile sipiling pathways activated by a tyrosine kinase receptor, by G protein coupled agonists and by other contractile agonist, and signal pathways involved in iNOS induction) form the basis of this thesis. Fig. 1.1 The mode1 of regdation of smooth muscle function TRANSCRIPTION SICNALLING SlCrNALLlNC MOLECULES MOLECULES

CONTRACTION RELAXATION 1.2. Mechanisms of smooth muscle contraction and relaxation

In the smooth muscle di, there are several important filaments (thick, thin and intermediate) responsible for ceIl contraction and the maintenance of nomal ce11 shape.

Smooth muscle thick filaments contain myosin, whereas the thin filaments contain actin, tropomyosia and caldesmon Although smooth muscle is not organized in the same sarcomeric configuration as skeletal muscle, the actin thin filaments attach to dense bodies in the ce11 that provide fixed points for ceU shortening. The intermediate filaments, primdy desmin, form a somewhat rigid cytoskeletal network to maintain ceil shape and to distribute forces (Berner et ai-. 198 1). The cytoskeleton also may sewe to transmit mechanicd signals to the nuclear rnatrix of the smooth muscle ceIL thereby affècting gene expression.

1.2.1. Ca2- dependent contractile machinery

It has been well estabiished that Ca" plays a central role in smooth muscle contraction. An increase of intracellular free Ca2- induced by any agonist or other stimulus can lead to the binding of Ca" to calmodulin (CaM) at the ratio of 4 Ca" to one CaM molecule, inducing the conformational change of CaM that exposes hydrophobie sites for interaction with a number oftarget proteins such as myosin light chain kinase (MLCK).

MLCK afier fodng a temary complex with ca2- and CaM can be aaivated to phosphorylate Ser-19 oftwo 20 kDa Iight chahs of myosin. resulting in an increase of myosin ATPase activity and consequentiy, cross-bridge cycling dong filaments to generate force or contraction. 6

1-2.2. Regulation of intracellular fiee Ca"

Intracellular free CaZ'. a key secondary messenger in smooth muscle contraction, is

maintained at a submicrornolar level despite a hi& extracellular concentration (1 -2 mM).

The increase of intraceliuiar CaZ' during smooth muscle contraction can be induced either

by influx of Ca2* fiom the extracellular space or by release of intraceUular Ca" stores such

as the sarcoplasmic reticulum (SR). Influx of extraceliular Ca" can be mediated by

sarcolemrnal selective or non-selective Ca'- channeis. which may be voltage dependent or voltage independent. There are two types of voltage-dependent Ca2- channels characterized in smooth muscle cefls (McDonaId et ai-.1994), such as T- and L-type channels (transient and long lasting, respectively). The main differences behueen these types of Ca2-cha~els are: 1) the T-channel usually inactivates more rapidly than the L- type and reactivates more slowly; 2) the T-type is les sensitive to block by CdZ' or by classical organic L-type blockers (e-g. Sedipine) than the L-type channel; and 3) the T- type ment is always insensitive to L-type channel agonists (eg. BAY K 8644) (Benham et al.. 1987; Noack er al.. 1992). The L-type channel is the best understood sarcolemmal

Ca2' channel, for which activation is well characterized in smooth muscle; but little is known about its deactivation (McDonald et al., 1994). Ca'' itself has been shown to inhibit the L-type Ca2+channel in isolated portal vein smooth muscle (Ohya et al., 1988), which impticates that Ca2'-CaM dependent protein kinase II (CaMKII) in regulating L- type channel activity (McCarron el al.. 1992). The T-type channel has been show to be present in a high density in spontaneously active smooth muscle types, and this channel may participate in the generation of the action potential, in tissues such as gastrointestinal 7

tract smooth muscle (Huizînga et al.. 1991). Voltage independent Ca2+channels, which

have been identifieci in dinérent srnooth musde types, can be activateci in response to

specific receptor activation. The P2x purinergic receptor for ATP has been well

characterireci to stimulate Ca2' influx via this type of Ca2' channe4 which cm be

distinguished fiom the L-type channel by its insensitivity to nifedipine and Cd2+and its

ability to open at very negative membrane potentiai (Benham & Tsien, 1987). in addition,

CaZ+infiux through the sodium/Ca2' exchanger on the smooth muscle (in the Na' extrusion model) may be also possible under physiologicai conditions (Blaustein, 1993), although this exchanger in smooth muscle has not been characterized as we11 as that in the

cardiomyocytes (Juhamva et al.. 1994). The sarcoled Ca2'-ATPase in smooth muscle has been recentiy reviewed (Lompre et al.. 1994; Mhqvist & Amer, 199 1). The CaZ'-

H+-ATPaseis a Ca2+stimulated Mg'-dependent "P-type" ATPase exchanging Ca" for Ef and is potentially electrogenic (Funikawa et a'. 1989). It has been documented that this

Ca2- pump cm be regulated by C- PKA and PKC, which indicates that both vasoconstrictors (that might activate PLC or PKC) as well as vasodilators (that increase

CAMPor cGMP levels) may activate the same Ca2+pump (O'Donnelldk Owen, 1994;

Raeymaekers & Wuytack, 1993). Additionally, an increase of intracellular fke Ca2+can also be achieved by releasing Ca2+fiom intracellular Ca2' stores, in response to the binding of inositol 1,4,5-triphosphate (IP3) receptor to IP3 generated fiom P& by PLC. The structure and regulation of the IP, receptor has been reviewed recently (Mikoshiba et QI.,

1994; Taylor & Traynor, 1995). In addition to the structural diversity of IP, receptor subtypes coded at least by three different genes, the hction of IP, receptors can be also 8 be regulated by kinase-mediateci phosphorylation, particularly by PKA (Mikoshia et al.,

1994; Nahorski et a'. 1994). Ca"' release induced by l[P, can be affected by intraceiiular ca2+in a positive feedback manner at a concentration of Ca2+below 300 nM, or by a negative feedback when Ca2' is more than that level (Iino & Tsukioka, 1994). Calcium- induced calcium reiease is thought to be mediateci by extracellular Ca" influx, through opening of a Ca2'-gated calcium channel (the ryanodine receptor). The existence of Ca2' induced Ca2+release under physiological conditions in smooth muscle remains controversiai. SR Ca2--~TPasepumps in the smooth muscle and their fünctional regdation have been recently reviewed (Lornpre et al., 1994; Raeymaekers & Wuytack,

1993). Three genes (SERCA1-3) coding for five distinct isoforms have been identifid in manundian cells (Lornpre et al.. 1994). The smooth muscle 100-kDa CaZ'-~TPase,a

Ca"-stimulated M$ dependent P-type ATPase is transcribed fiom the SERCA2 gene

(Berk et al.. 1986). This ATPase can be regulated by a phosphoprotein, phospholamban

(Chen et al., 1994). Like the case in heart, unphosphorylated phospholamban inhibits SR

Ca2'-ATPase activity by decreasing its aanity for Ca" through a direct interaction; the inhibition is then removed in response to phospholamban phosphorylation by the cGMP- dependent protein kinase (Tada, 1992; Karczewski et al.. 1992). In the SR lumen, although it has been identified that there are two Ca2+buffering molecules such as caisequestrin and calreticulin, with differential distribution in rat vas deferens smooth muscle (Vila et al., 1993), there is very Iittle information about the in situ distribution of

Ca2' buffering molecules. In the smooth muscle myoplasm, many Ca2+binding proteins such as CaM that could bind a significant fraction of myoplasmic Ca2- have been fôund, 9 but it still remains to identi@ their distribution and buffering capacity (Kar~acin& Fay,

1991).

1.2.3. Myosin regdation

There are mainly two types of contrade responses in smooth muscle, defined as phasic (transient) and tonic (sustained) contraction. Generaily, phasic smooth muscles such as those fiorn taenia coii of intestine, the portal vein and anmof the stomach have relatively high shortenhg velocities and maintain tone poorly. The tonic muscles such as those from most vascular tissue and the fundus of the aomach, in contrast, do not generaily display action potentids or regenerative elecaical activity under physiologîcal conditions. They have slower shortening velocities but more efféctively maintain tone. The differences in mechanical properties of phasic and tonic smooth muscie couid be due to either alterations in signai transduaion or in the contractile proteins themselves. It has been suggested that the higher levels of borh MLCK and LC20 phosphatase may accelerate turnover in phasic smooth muscle, resulting in the dinérence compared with tonic muscle (Himpens et al., 1988; Kitazawa et ai., 199 1). Altematively, it is possible that aiterations at the level of the contractile proteins might aiso explain differences, particularly in the speed of contraaion, which is mainiy determined by the Mf-~TPase activity of the myosin head.

Smooth muscle myosin 11 is a hewner, composed of two heavy chahs and two pairs of iight chains of 20 kDa (LC20)and 17 kDa (LC 17). Two classes ofisofoms of the smooth muscle myosin heavy chain derin that an extra COOH-terminal tail piece is present in the SM4 (-204 Da) isoform and not in SM-2 (-200 ma) isoform (Nagai et 10

al.. 1989). MLCK is a specific protein kinase that can phosphorylate myosin II at Ser-19

of LCZO in a random manner. Although Thr-18 cm also be phosphorylated at a high

concentration of MLCK no physiological significance has been defineci (Haeberle et al..

1988). Both amino- and carboxy-terminal regions of LC20 have been locaiized at the

head-tail junction of myosin. It has been documented that it is &cient to advate myosin

and induce a maximai contractile response by phosphorylation of only one head of myosin

(Hoar et al.. 1979) even at a low level of phosphorylation. Phosphorylation of the myosin

light chah in smooth muscle appears to serve two major firnctions: 1) it facifitates the

ability of myosin monomers to assemble ïnto filaments, and 2) it increases the ATPase activity of myosin at ieast 100-fold compared with unphosphorylated myosin (Trybus,

1994). Myosin IL containing an ATP-hydrolysis site and an actin-binding site at its heavy chah amino-tenninus can act as an actin-activated Mg'-~TPase, which is supposed to be

inhibited by an unphosphorylated LC20 in myosin. The phosphorylation of LCZO by

MLCK can induce a conformational change of the neck region in myosin, leadhg to activation of myosin Mc-ATPase. The phosphorylation event might affect the step in the actomyosin ATPase cycle. releasing Pi Corn myosin heads afker hydrolysis of ATP.

Furthemore, the phosphorylation of LCZO is tightly regulated by MLCK, an apoenryme, which can be fully activated by (Ca2'),-CaM.

The smooth muscle isofom of MLCK has been found in both smooth muscle and non-muscle tissue. MLCK has a catalytic domain, a CaM-binding domain, a putative autoinhibitory site, an actin-binding site, substrate (myosin and ATP) binding sites, and sites of phosphorylation by various protein kinases (Walsh, 1994). The smooth muscle 11

MLCK mers fiom that of mammaiian skeletai muscle in that the smooth muscle MLCK contains one unc-1 and three unc-II (unknown fùnction) domains, each approximately 100 amino acids in length as found in the unc-22 gene product ofthe nematode

Caenorhabditis eiegmls. The catalytic domain (Gly-526-Trp-773) begins with the consensus ATP-binding sequence, GxGrrxGx,& The CaM-binding site (Ala-796-Leu-

8 23), like that in other CaM binding proteins, has been shown to be an a-helicai structure.

The peptide designed fiom the sequence can bind to CaM in the presence of Caz', competing with enzyme for CaM. It has been shown that the autoinhibitory site (Ser-787-

Val-807, resembling the sequence around Ser-19 of LC20) partidy overlapped with the

CaM binding site that is particularly important in the regulation of lMLCK activity

(Knighton et al., 1992). This pseudosubstrate domain, after the folding of polypeptide chain, is hypothesized to occupy the binding site for myosin, preventing its access to the substrate, myosin (Pearson et al.. 1988). The binding of(Ca2'),-CaM cornplex to MLCK can cause its conformational change, Iding to the exposure of the substrate binding domain by removing the pseudosubstrate domain fiom the myosin binding site (Pearson et al.,1988). The role of actin binding domain in the regulation of MLCK activity is still . unknown. The primary regulator of MLCK is Ca2'/CaM, for which binding to the enzyme can be attenuated by phosphoryIation of MLCK at Ser in the CaM binding domain (Lukas et al.,1986). This phosphorylation can be induced in vitro and in vivo by multi-functional

CaMKiI (Ikebe & Reardon, 1990; Tansey et al.,1992), but it is still unknown how

CaMKiI is involved in the regulation of contraction under physiological conditions. The phosphorylation of Ser in the CaM binding domain by PKA has been proposed to participate in the relaxation of smooth muscle in response to some vasodilators that increase CAMP Ievels (Conti & Adelstein, 198 1; Nishikawa et al.,1984). The phosphorylation of another Ser COOH-terminal to the CaM binding domain by PKG has not been shown to affect the &ty of CaZi/CaM for the kinase (Stull et al., 1993). The phosphoryIation process has been characterized to be always accompanied by dephosphorylation events to maintain a dynamic process under physiologicai conditions.

The physioIogicaI srnooth muscle LC20 phosphatase has been found as a type 1 protein phosphatase (PP-l), which is bound tightly to myosin without dissociation fiom myosin under physiological conditions. The phosphatase is a trimer of two regulatory peptides of

130 and 20 kDa and the 37-kDa catalytic subunit that is targeted to myosin by the 130- kDa subunit (Alessi et al,. 1992; Okubo et al.. 1994). Arachidonic acid cm dissociate the catalytic subunit resuiting in a decrease of phosphatase activity, Ieading to an increased

LC20 phosphorylation at a constant intraceiiular Ievel (Gong et aL, 1995). Alternatively, it was also found that PKC can also decrease phosphatase activity (Tride-Mulcahy et al.,

1995).

1.2.4. Thin filament regulation of smooth muscle

Potential regulatory proteins associated with actin fiiaments in smooth muscle have been identified and characterized in recent years. Although smooth muscle thin filaments do not contain troponin, the trimeric complex responsible for Ca" regulation of skeletal and cardiac-muscle contraction, the proteins calponin (Cap) and caldesmon (CaD) have been localized to the thin filaments of smooth muscle in situ. Smooth muscle CaD, a single polypeptide chain, can bind to F-actin, tropomyosin, myosin, and Ca2+/CaM,resulting in 13 regdation of crossbridge cychg. CaD inhibits ah-activated Mg''-~TPaseof smooth muscle myosin primarily by reducing the fitybetween actin and rnyosin/ADP/Pi, without affiecting the rate of the reaction (Hemrk & Chalovich, 1988). This UihiiÏtion is a result of cornpetition between CaD and the myosin head for a binding site on acth, since

CaD and myosin can displace each other fiom the actin marnent (Marston & Redwood,

1993; Velaz et ai.. 1990). It has been aiso suggested that Ca2+/Ca~binding to CaD may participate in CaD inhibitory activity (Smith et ai.. 1987). The CaD-induced ATPase inhibition can be regulated through phosphorylation by severai protein kinases (Adam et al., 1989; Tanaka et al.. IWO). Recent evidence suggests that stimulation of intact mammalian vascular smooth muscle results in CaD phosphorylation at two specific proiine-directeci serine residues. fisresult is consistent with the phosphorylation of CaD by MAP kinase in vitro (Adam & Hathaway, 1993). The data suggest that MAP kinase rnay be involved in smooth muscle contraction through phosphorylating CaD to remove an inhibition for the contractile machinety. In addition., Cap. a single polypeptide, bids F- actin with higher atnnity for the smooth muscle than the skeletal muscle actin isoform. The inhibition of actomyosin ATPase by Cap is concentration-dependent, requiring a CaP-to- actin ratio of 2:3 to achieve a full inhibition. The inhibition may result fiom a conformational change in actin induced by CaP binding (Noda et ai., 1992) and a concomitant decrease in actin's capacity to activate myosin ATPase. It has been suggested that Cap activity can be regulated through phosphorylation by PKC or CaMKII, both of which reverse Cap's inhiiitory action (Naka et al.. 1990; Winder & Walsh, 1990), so as to result in an increased muscle tension. The major CaP phosphorylation site RI vitro has 14 been identified as either Ser-175 or Thr- 184 (Nakamura et al.. 1993); these residues are dephosphorylated by a type 2A protein phosphatase to restore inhihitory activity (Wmder et al.. 1992). However, the fiinction of Cap in vivo and the regulation of its inhibitory activity needs fbrther investigation.

1-2.5. Protein kinase C

As a serine/threonine kinase, protein kinase C (PKC)has been impticated in the control of smooth muscle contraction The PKC fbly can be divided hto four major groups (Mahoney & Huang, 1995): 1) group A (classical) PKCs: a, PI, PI1 and y; 2) group B (novel) PKCs: 6, E, v/L and 0; 3) group C (atypical) PKCs: C, and L (the human form of mouse PKC-A); and 4) group D: p or PKD. Group A (Ca24ependent) and

Group B (Ca2--independent)can be translocated fiom the cytosoi to the membrane in response to diacylglycerol @AG) or certain phorbol esters, but the group C PKCs do not respond to either ca2- or DAG, akhough they share structural sunilarïties with the remainder of the PKC family. The group D PKCs may be present in the particdate fkaction due to the presence of a signal peptide and transrnembrane sequences near its

NH,-terminus. Several PKC isozymes have been identified in smooth muscle, such as

PKCa, P, 6, E and C. A variety of agonists are known to activate receptor mediated phosp hatidy linositol tumover in smooth muscle through the activation of phospholipase

(PLC), which results in 1) generation of P,,known to induce the Ca" mobiiization £tom

SR causing a transient increase of Ca2' which activates MLCK to initiate a contraction; and 2) DAG, the only weii characterized physiological activator of PKC. DAG can also be generated fiom phosphatidylcholine (PC)by the combined action of phosphatidate 15 phosphatase and PLD, which has been identifiai as a major source for DAG in angiotensin-induced susraineci contraction phase (Lassegue et al.. 1993). Because of their analogous structures, phorbol esters are thought to substitute for DAG and activate PKC.

Phorbol ester was reported to cause smooth muscle contraction by increasing intraceiiular

Ca2+and myosin tight chain phosphorylation and to induce contraction in the absence of a change either of myosin phosphorylation or CaZ' (Jiang & Morgan, 1989). h has been documented that PKCa anbe translocated to the membrane to participate in smooth muscle contraction in a Ca" dependent manner in response to some contractile agonists

(Khalil & Morgan, 1992). In resting ferret aorta cells, PKCe is dBbsely distributed in the cytosol, whereas PKCC is concentrated in the perinuclear region. Stimulation with phenylephrine (PE) cm cause membrane translocation of PKCE, resulting in a Ca2+- independent contraction, and nuc1ear transiocation of PKCC (Khalil et al., 1992).

Recently, it has been proposed that redistniution of activated PKC may be sufficient to contribute to smooth musde contraction, but not necessarily through membrane translocation (Nakamura et ai-,1493). As mentioned above, PKC can regulate smooth muscle contraction through phosphorylation of some contractile elements, such as Cap and CaD through activation of MAP kinase.

1.3. The role of tyrosine kinase in signal transduction

1.3.1. Introduction

In addition to the involvement ofCaz' and PKC in smooth muscle contraction, it has been documented that tyrosine kinase activity may be also involved in the contractile response (Berk et al., 1985; Berk et al., 1986; Hollenberg, 1994a).Two main groups of 16 tyrosine kinases have ken demi(Hanks et d-,1988): 1) the membrane receptor tyrosine kinases, including the insulin receptor and the receptors for EGF and PDGF;and

2) non-receptor protein tyrosine kinases, including cytosolic tyrosine kinases such as the proto-oncogene products Abl and Fes and the membrane-associateci non-receptor tyrosine kinases such as the Src kinase My.To date, at least 24 non-receptor tyrosine kinases have been identified comprishg eight difièrent groups (Bolen, 1993), ranging in size l?om around 50 kDa for the c-Src kinase (Csk) fdyto approximately 150 kDa for the Ab1 kinase family. Ail of these kinases are likely to be involved in some type of signaling pathways that modulate the growth, difFerentiation, and fùnction of the cells. In the following sections, the roles of tyrosine kinase pathways have been reviewed in both growth factor (such as EGF) receptor and G protein coupled receptor signaling.

1.3.2. Tyrosine kinase receptors

Growth factor receptors are prototypic members of a family of receptors that are characterized by an extraceiiuIar binding domain, a single transmembrane portion and a large intraceliular catdytic domain with intrinsic tyrosine kinase activity (Fanti et al.,

1993; Heldin, 1995). Autophosphorylation of tyrosine kinase receptor has been shown to be a key event to receptor signahg der ligand binding and receptor dimerization

(Schlessinger & üiirich, 1992; Fanti et aL,1993; Kazlauskas & Cooper, 1989). Tyrosine residues for autophosphorylation can be in a number of regions including the kinase insert domain in the platelet-derived growth factor receptor. In a tyrosine kinase receptor without a kinase insert domain, such as the EGF receptor, the autophosphorylation sites are in the C-terminal tail. It has been documenteci that receptor tyrosine phosphorylation

18

have two SH2 domains and may bind to different sequences on tyrosine kinase recepton.

The binding of a signaiing molecuie to the receptor may resdt in its tyrosine phosphorylation and fkther activation It has been demomtrated that binding of PLC-y to a tyrosine kinase receptor stimulates the tyrosine phosphoqdation of PLC-y at positions

771,783 and 1254, hcreasing the catalytic activity of this enzyme (Kim et d.1991).

Both the tyrosine phosphatase activity of SHPTP-2 and GTPase-activating protein (GAP) adivity have been shown to be increased after binding to and phosphorylation by a receptor tyrosine kinase (Vogel et al.. 1993). ûther adaptor proteins with both SH2 and

SH3 domains such as Grb2, p85 and Nck that do not have intrinsic eqeactivities may regulate the downstream signahg molecules by inducing a conformational change afler the specinc bhding to phosphotyrosine via SH2 domains and after tyrosine phosphorylation by a receptor kinase.

1-3 -3 Activation of c-Src

The Src kinase fdyrepresents a group of non-receptor tyrosine kinases that have been identified to exhibit increased enzymatic activity in response to growth factor receptor stimulation. The Src hase f&ly members with one catalytic domain, one Sm' and one SH3 domain are bound to the inner daceof the ceIl membrane after irreversible myristoyiation of the N-terminal glycine residue (Resh, 1994). The additional reversible palmitoylation on a cysteine residue of some Src farnily rnembers (e-g. Hck) may aiso CO- ordinate membrane locaîization. c-Src kinase (Csk), another non-receptor tyrosine kinase, phosphoryiates c-Src kinase on Tyr-527at the C-terminus. The phosphotyrosine residue at the tail of c-Src (but not v-Src) interacts intramolecularly with the SH2 domain, leading to 19

a negative regdation of enzyme activity (Superti-Furga et a'. 1993). Deletion of the Csk

gene in rnice results in a reduced phosphorylation of c-Src in the C-terminus and increased

Src hase activity (Imamoto & Soriano, 1993). An additional tyrosine phosphorylation

site (Tyr-416)in the catalytic domain has been identified to stimulate kinase activity upon

being autophosphorylated by the iünase itself. The exact rnechanism of Src activation following growth factor receptor stimuiation is still not clear. It has been spedated that

the high afhkyphosphotyrosine ligand on the receptor may competitively displace Tyr-

527 on the c-Src SH2 domain to extend the c-Src C-terminus, leading to an aiiosteric change in the molecde and autophosphoryIation of Src at Tyr-418. It is suggested that protein tyrosine phosphatase rnay also be involved in Src activation (Zheng et al.. 1992).

It has been characterized in both B and T lymphocytes that Src kinases p59fy" and ~56~ can stimulate the activation of PI 3-kinase through the binding of a Src-homology-3 (SM) domain to the proline rkh regions in regdatory subunit p85 (Pleiman et ai., 1994).

1-3.4. The mitogen activated protein (MM)kinase cascade

The intermediates linking an activated growth factor receptor to the activation of

Ras have been identified as Grb2 and SOS (son of seveniess, a guanine nucleotide reIease protein) (McCormick, 1993; Qdiam et al., 1995; BowteU et al., 1992). EGF, for example, causes receptor dimerization and transactivation of the receptor, leading to autophosphorylation of tyrosine residues on the receptor (Uilrich & Schlessinger, 1990), so that the phosphotyrosine residues can then recruit Grb2, an adaptor protein which contains not only one SH2 domain, but also two SH3 domains (Lowenstein et al., 1992).

Both SH3 domains of Grb2 are required to bind to two proline rich regions in the C- 20

terminal region of SOS, a Ras activator (Egan et al.. 1993); the bound cornplex facilitates

the conversion of inactive Ras-GDP to active Ras-GTP (McCormick, 1993). The Ras

proto-oncogene product, a 21 kDa molecular-mass G protein, has been characterized to

play a role in the MAP kinase cascade. Ras-GAP,a Ras GTPase activating protein, was

discovered to regulate Ras activity negatively in the MAP kinase pathway (Trahey &

McCormick, 1987; Hall, 1994). The dominant negative mutants of Ras such as N17 or

Ml7 Ras were found to block the activation of both Raf(Troppmair et aL, 1992) and

MAP kinase (de Vries-Smits et al., 1992) in response to growth factor stimulation It has

been substantiated by the expression of dominant negative mutants of Rafand Ra. antisense RNA that Ras is localized upstream of Raf and MAP kinase (Wood et al., 1992;

Thomas et al.. 1992; Kolch et al., 1992). The interaction of GTP-Ras(not inactive Ras) with the N-terminus of Raf has ken suggested to be direct without any intermediate involved (Vojtek et al., 1993). However, binding to Ras alone is not sufficient for Rafto be activated (Stokoe et al., 1994; Leevers et al., 1994). In the activation process, Raf rnay be activated by other molecules such as 14-3-3 that have been found to interaa with and activate Raf(Freed et ai., 1994; Fantl et al., 1994). Downstream of Raf, a serindthreonine kinase, MEK or MAP base kinase, a dual tyrosine, serindthreonine specific kinase has been identified to be activated in response to the phosphorylation on Ser-218 and Ser-222 induced by c-Raf-1 (Zheng & Guan, 1994b; Yan & Templeton, 1994). At least two MAP kinase kinases have been identified in rnammaiian ceiis, MEKl and ME=, as weli as an alternative splice variant of MEKl, MEKlbeta or MEIU (Seger et al., 1992; Zheng &

Guan, 1993; Zheng & Guan, 1994a), which lacks an interna1 domain of 26 amino acids. 21

The activation of MM kinase (extracellular regulated kinase, ERK) requires phosphorylation at both tyrosine and serine residues by MEK (Anderson et a'. 1990). The

MEK kinase (equivalent to Raf-1) activated by Ras can activate INK (Jun N-terminal kinase) that acts in parallei to MAP kinase via MKK4 (ah known as Sekl) and MEK7.

The p38 HOG Iike MAP kinase is activated by either MWor Kek7 in response to osmotic stress, heat shock or lipopolysaccharide (LPS) (Seger & Krebs, 1995).

It has been found that there are at lest two isoforms of MA'kinases such as pp44 and pp42, with a third, pp54, sharing an approximately 50% sequence simdarity (Boulton er al.. 1990) The phosphorylation of pp4Z MAP kinase both at Thr- 183 and Tyr4 85 residues (first on Tyr residue) in the mammaiian enzyme by MEK (Anderson et al.. 1990) is essential for the activation of MAP kinase, since a single point mutation can produce a inactive MAPK mutant (Zhang el aL. 1994). It has been found that the activation of MAP kinase is not ody induced by growth factor receptor stimulation, but it can aiso be triggered by G protein coupled receptor signaüng, as discussed in the following sections.

Targets for MAP base, a proline directed se~e/threon.inekinase, have been identifieci as c-Jun (Pulverer el al.. 1991). p90 niosorna1 S6 kinase (p90"L), cytosolic phospholipase A2

(cPLA2), the glucose transporter and tau protein (Pelech, 1995; BIenis, 1993). The parallel MAP kinase pathways in yeast (Mech, 1996) have been found to mediate the responses to severai stimuli including the mating pheromone, pseudohyphal development, invasive growth, ce11 integrity, spomlation, and high extracellular osmolarity (Levin &

Errede, 1995; Seger & Krebs, 1995). 22

In addition to the Ras MAP kinase pathway, several other targets for Ras protein

such as Ras-GAP @oguski & McCormick, 1993), neurofibromin and PI 3-kinase

(Rodriguez-Viciana et d,1994; Kauffmam-Zeh et al.. 1997) have been proposed (Feig

& Schaffhausen, 1994). The catalytic subunit of PI 3-beis wggested to interact with

Ras through the Ras effior site. In PC12 celis, a dominant negative Ras mutant has been found to inhibit growth fàctor-induced PIP, production through PI 3-kinase

(Rodriguez-Viciana et al.. 1994). Furthemore, the transfection of Ras, but not R& into

COS-7 celIs was observed to induce an increase of PI 3-kinase products.

1-3 -5. Phosphatidylinositol3- (PI 3.) kinase

Several species of PI 3-l0nases have been cloned and characterked. Heterodimeric

PI 3-kinase alpha and beta isoforms that consia of a p 1 10 catdytic subunit and Merem p85 adaptor moleailes can be regulated by the recepton with int~sictyrosine kinase activity (Kapeller & Cantley, 1994). Another isofonn, termed PI 3-Ky,has been shown to be activated by both Ga and py subunits in vitro, but it does not interact with p85

(Stoyanov et al.. 1995). It has been shown in a series of acute labeling studies thaî in response to growth factors the formation of phosphatidylinositol-3 phosphate (PIF,) was achieved by direct phosphorylation of PIP, by PI 3-kinase, rather than by the interconversion of other phospholipids (Stephens et al.. 1991; Hawkins et d.1992). It has been proposed that a PKC-independent serine phosphorylation and activation of pi0 ribosomal S6K can be induced in response to stimulation of PI 3-kinase, which is sensitive to the PI 3-kinase inhibitors, wortmannin and LY294002 (Churtg et al.. 1994; Cheatham et ai., 1994). Insulin-induced stimulation of glucose transport and p70~can aiso be 23

dissociated by the macroiide raparnycin (Fingar et al,, 1993)- for which the intraceiiular

target is believed to be a rapamycin-associateci protein (FRAP)(Fingar et al., 1993). A

role for Ras in the activation of PI 3-kinase has been identifd recently in some specific

celi types (Rodriguez-Viciana et al., 1994), and Ras may recnit p 1 10 to the membrane or

promote the interaction of p 110 with its iipid substrate. Additionally. atypid PKC isoforms may be activated by PP,, leading to a stimulation of the MAP kinase cascade

(Toker et al., 1994). More recently, at least three reports (Franke et al., 1995; Burgering

& Coffer, 1995; Franke et al., 1997) have proposeci protein kinase B (PKB)/Akt as a target of PDK The PIP, product produceci by PDK may bind to the N-tennuid regulatory AH or PH (Akt and pleckestrin homology) dornains of PKB, leading to dimerization, autophosphorylation and ultimately to the activation of this kinase. A possible downstream target of PKB is p70S61;,which phosphorylates niosomal protein S6, to regulate protein translation. Although the mechanism for PI 3 K signding is not yet clear, it has been documented that PI 3-kinase is involved in a series of intraceIiular events, such as protein trafiicking, the regdation ofcytosketetd ftnction, platelet aggregation, and endothelial ce11 membrane ruffling (Zhang et al., 1993; Wennstrom et al, 1994).

1.3 -6.G protein coupled receptors: Introduction

A heterotrimeric G protein exists as a complex of GDP-bound a subunit and a dimeric py subunit (Linder & Gilman, 1992). Upon binding its appropriate ligand, a G protein-mupled receptor stimulates the exchange of bound GDP for GTP on the a subunits, leading to a subsequent dissociation of the GTP-a subunit fiom the py diier.

The a subunit has an intrinsic GTPase activity, which can hydrolyze the bound GTP to 24

GDP. a-GDP and the py subunit reassociate to hm an inactive heterotrimer (Fig. 1.2).

In G protein coupled receptor signaling, both the GTP-bound a subunit and py hermay regulate downstream effectors to induce ceIl responses (Clapham & Neer, 1993; Kim et al., 1989; Langhans-Rajasekaran et al.. 1995). It bas been welI known that the cr, subunit stimulates membrane bound adenylyl cyclase (AC) activity, leading to the production of

CAMP fiom ATP. Increased intraceliular CAMP activates protein kinase A @KA) by binding to regdatory subunits to release catalytic subunits, leading to phosphorylation

(serine or threonine in the context X-R-R-S-X) and fùnctional regulation of dowostream molecules, such as phosphorylase b kinase. PKA can also be translocated to the nucleus fiom its cytoplasmic and Golgi complex anchoring sites. In the nucleus PKA can phosphorylate Ser-133 on CREB (CAMPresponse element binding protein), Ieading to gene transcriptional regulation (Kwok et al.. 1994; Arias et al., 1994). PKA can also directly phosphoqdate KB, an inhibitory subunit of NF-kB (nuclear transcription factor), resulting in the dissociation of NF-kB fiom IKB (Whiteside & Goodboun, 1993).

Recently, PKA has been fond to phosphorylate and inhibit Raf-1 kinase (Marx, 1993), leading to suppression of the Ras-MAPK pathway. in addition to the inhibition of AC by the ai subunit inducing a decrease of CAMP levei, py subunits dissociated fiom the q subunit have been characterized to play pivotal roles in ceU signahg in response to Gi coupled receptor activation (Clapham & Neer, 1993). The efFéctor molecules regulated by

By subunits can be ACs (ibition /activation), PLCP, PI 3-kinase, protein tyrosine kinase, K' channels, Ca2+channels and receptor kinases. py subunits can also crosstalk to Fig. 1.2 G protein coupled receptor and MAP kinase cascade.

27 the signal transduction pathways initiated fiom growth factor receptor activation (ingiese et aL, 1995).

1.3.7. GPy and the MAP kinase cascade

GPy has been shown to be a tightly associated dimer (Fig. 1.2) (Linder & Giiman,

1992). There are five known GP subunits, each approximately 35 kDa; they are highiy conserveci (sharing 50-90% identity of sequence), but not every P subunit can form a dimer with each Gy subunit (Neer, 1995). Crystal structure analysis indicates that WD repeats of the P subunit define the stereochemistry of the overall structure by forming a P propeller of seven P sheets. Each sheet contains four antiparallel strands radiating outward fiom a central core (Sondek el al.. 1996). The N-terminal region of the P subunit des up part of the Py interaction site (Pronin & Gautam, 1992). The WD repeats of the P subunit are proposed to enable the Py subunit to adopt multipIe conformations (Neer,

1995). There are about ten Gy subunits that have been found (sharing 27-75% homology)

(Clapharn & Neer, 1993). The Gy subunit of about 6-9 kDa contains a -CM(C: cys, A: aliphatic residue, X: leucine or serine) motif in its C-terminus, coding for post-translational isoprenylation of the cysteine. The membrane biiding of isoprenylated Gy is important for its interaction with the Ga subunit and association with receptor kinases (Casey, 1994).

The arnino-terminal helix of Gy foms a coiled-coi1 with amino-terminus of GP. Selectivity of the y subunits for different P subunits is determined by a stretch of 14 amino acids in the middle of the y subunits. The GPy dimer facilitates the association of Ga with membrane receptors to form the temary cornplex of receptor-apy that is poised to bind ligands with a high affinity (Neer et al., 1994). Through a region that contains a plestrin- 28 homology (PH) domain, GPy subunits may bind and regulate several effectors, such as G protein coupled receptor kinases (GRKs), GTPase-activating proteins for Ras, PLC-y, or the B-ceIl tyrosine kinase (Btk) (Touhara et al-,1994; IngIese et al., 1995).

1.3.7.1. Gpy-mediated Ras dependent MAP kinase pathway

It has been documented that the stimulation of some G protein coupled receptors can induce MAP kinase activation via the Ras-Raf pathway (Fig. 1.2). G protein wupled receptor agonists such as thrombin and Iysophosphatidic acid (LPA) were observeci to stimulate MAP kinase activity, which can be blocked by pretreatment of the cells with pertussis toxin (PTX). Since PTX has been well defined to cause ADP ribosylation of the aisubunit, preventing the receptor mediated dissociation of the Gi protein complg the data suggest that a G protein is involved in MAP kinase activation ïndued by G protein coupled receptor agonists (Koch et aL,1994). As the aisubunit itseif in overexpression experiments has not been shown to stimulate MAP kinase, the py subunit released fiom the a,which can reach a high concentration, was hypothesized as a candidate to trigger the MAP kinase pathway (Fig. 1.2). This hypothesis has been supported by several diierent approaches such as overexpression of By subunits done and by overexpression of PARK C-terminal peptide to quench Py subunits (Crespo et al.. 1994; Koch et al..

1994). In COS-7 cells with an overexpression of a Gi-coupled receptor and an epitope- tagged MAP kinase (HA-ERK2) (Crespo et ai., 1994), it was show that a PTX-sensitive

G protein is involved in the increase of MAPK (HA-ERK2) activity induced by carbachol.

Coexpression of Gta, acbng to sequester GPy, attenuated the activation of HA-ERK2.

They also showed that coexpression of GPy stimulated ERK2 enqmatic activity, and that 29 coexpression of a dominant-negative mutant of Ras (NI 7-Ras) abolished ERK.2 activation, suggesting that the GPy dimer plays a role in signalhg fkom G protein coupied receptors to Ras-dependent MAP kinase activation-

1-3.7.2. Tyrosine kinase pathways and MAPK

A tyrosine phosphorylation event has been characterized as an intermediate step between GP y and the Ras-MAP kinase pathway by several experimental approaches. It has been demonstrated that the activation ofMAP kinase by a Gi coupled receptor nich as the thrombin receptor is preceded by the GPy mediated tyrosine phosphorylation of Shc, leading to an increased hctionai association between Shc, Grb2 and SOS (Fig. 1.2).

Moreover, disruption of the Shc-Grb2-SOS complex blocks G protein mediated MAP kinase activation (van Biesen el al., 1995). These data indicate that GPy mediated MAP kinase activation is initiated by a tyrosine phosphorylation event and proceeds by a pathway common to both G protein wupled receptors and tyrosine kinase receptor (van

Biesen et al., 1995). In COS-7 ceus, it has been shown that Shc phosphorylation can be - induced by lysophosphatidic acid (LPA), an % -adrenergic receptor agonist or by transient expression of Gpy . Both Shc phosphorylation and W kinase activation are completely blocked by pretreatment with PTX or by coexpression of a GPy binduig peptide denved fiom the C-terminal sequence of PARK1 (B kt). The data suggest that Gi-coupled receptors mediate Shc phosphorylation entireIy through GPy. Furthemore it has been documented that the formation ofthe Shc-Grb2 complex is dependent on Shc phosphorylation (Touhara et al., 1995). Coexpression of P 1ct can inhibit Shc-Grb2 complex formation stimulated by LPA and the q-adrenergic receptor agonia. It has also 30 shown that the disruption of the Shc-Grb2-SOS cornplex cminhibit the GPy subd signaiing, suggesting that the Shc-Grb2-SOS cumplex is an upstrearn effector of MAP kinase activation in GPy signaling. The phosphotyrosine bhding domain (Pm) in Shc, stmcturalIy sidar to the PH domain, may be involveci in the membrane targeting of

ShdGrbUSos (Zhou et al., 1 995)The synergistic stimulation of MAP kinase between overexpressed GPy and mSOS 1 in CHO ceils and the block of MAP kinase activation by tyrosine kinase inhibitors such as genistein (van Biesen et a'. 1995) have substantiated the evidence to infer the tyrosine phosphorylation of Shc is arnong the earliest events in GPy mediated Ras dependent activation of the MAP kiwe pathway. Since a tyrosine phosphorylation event is involved in the linkage between py and Ras-MAP kinase pathway, it has been suggested that an as yet unidentified tyrosine kinase may participate in this process. Recently, a number of protein tyrosine kinases, such as Src farnily kinase

(Luttreil et al.. 1 W6),Pyk2 (Dikic et al.. 1996), the EGF receptor (Wan et ai.. 1996), and

Syk (Wan el al.. 1996; El-HiIlal et al.. 1997) have been reported as candidates for this crossta1.k process.

1.3-7.3. Tyrosine kinases as candidates in the activation of MAPK by G protein coupled receptor

Src kinase: In G protein coupled receptor signaling, it has been documented that

Src kinase is activated in response to the stimulation by the receptor agonist (Luttrell et al.. 1996). In COS-7 cells, it was found that Src kinase can be co-irnmunoprecipated with

Shc by antiBhc antibody and that there is an inaeased kinase activity of Src after stimulation of cells with LPA (Fig. 1.2). The increase in Src activity can be blocked by 31 pretreatment of ceii with PTX. Moreover, the expression of GBy in COS-7 ceiis can mimic LPA induced Src activation and MAP kinase stimulation. Csk overexpression in

COS-7 cells was stiown to inhibit LPA and GPy induced Shc phosphorylation and MAP hase stimdation (Luttreii et al., 1996). However, how the GPy subunit causes activation of Src kinase is unknown. It is speculated that Goy may stimulate some membrane bound tyrosine phosphatase or receptor tyrosine phosphatase, leading to dephosphorylation and activation of c-Src. There has been some evidence to indicate involvement of a tyrosine phosphatase in G protein signaling such that the protein tyrosine phosphatase can be inhibited by the activation of angiotensin receptor type 2 in rat pheochromocytoma ceUs

(Takahasi et al.. 1994).

PykUCAK: Protein tyrosine kinase 2 (Pyk2)- found in neural cells and equivalent to cytoskeletaI-associated kinase beta (CAK)(Sasaki et al., 1995)- has been shown to play a critical role using the Iinkage fiom GPy to Ras MAP kinase pathway (Fig. 1.2). In transient transfection experiments in PC12 cells (Dikic et al., 1996), it was shown that tyrosine phosphorylation of Pyk2 is stimulateci in response to LPA; pretreatmem of PC12 cells with PTX inhibited this response. These results indicated that LPA-induced Pyk2 phosphorylation and activation is dependent, at least in part, on a PTX sensitive Gi- dependent pathway in PC 12 cells. Tyrosine phosphorylated PykZ can bind to the SE domain of Src to fom a complex in response to LPA or bradykinin stimulation.

Furthmore, transient overexpression of a dominant interferhg mutant of Pyk2 (Pyk2-

Y402F) or c-Src kinase (Csk), a negative regulator of Src kinase, was shown to reduce

LPA-induced MAP kinase activation. Therefore, it was suggested that SrcPyk2 may play 32 an important role in the linkage between GPy and the Ras-MAP kinase pathway. The overexpression of dominant intenering mutants of Grb2 and SOS also biock MAP kinase activation in the same system- The question is then raid as to how GPy subunits might induce the activation of Pyk.2. Since Pyk2 is activated indiredy by increases in intracellular Ca2+.it may be speculated that GPy subunits stimulate Pyk2 by increasing intraceIlular Ca" and activating PKC through PLC-P, which produces iP, and DAG fiom

PIP? The regdation of Pyk2 by PKC has yet to be explored,

EGF receptor: It has been mentioned above that the EGF receptor tyrosine kinase is trans-activated and autophosphorylated by specific EGF ligand binding and receptor diierization. The activated EGF receptor cmtrigger the Ras MAP kinase pathway either directly via Grb2-SOS complex formation or indiredy via CO-activationof Src kinase and the tyrosine phosphorylation of the Shc adaptor protein which binds to Grb2-SOS. It has been reported that EGF receptor tram-activation is involved in G protein coupled receptor activation of MAP kinase (Fig. 1.2). In Rat-1 fibroblast ceus, it was found that the EGF receptor was rapidly tyrosine-phosphorylated by stimulation with the GPCR agonists endothelin-1, LPA, and thrombin @aub et al., 19%). Specific inhiiition of EGF receptor fimction by either the selective tyrphostin AG1478 or a dominant negative EGF receptor mutant suppressed MAP kinase activation and strongiy inhiiited induction of fos gene expression and DNA synthesis. It can be speculated that the Src kinase may be responsible for EGF receptor phosphorylation and transactivation to trigger the Ras MAP kinase pathway. However, it is also possible that GPy subunits stimulate the EGF receptor via an 33 unknown mechanism, and that the EGF receptor activates the Ras MAP kinase pathway with or without Src activation-

Syk: This protein is a 72-kDa non-receptor tyrosine kinase with two SEI2 domains and no SH3 domain, it is ahlike Src anchored to the membrane by amino terminal myristoylation. Syk kinase activity may be regulated by tyrosine phosphoryiation (Y518) and by the binding to other SH2 domains (Wan et a'. 1996). Recently, Syk hm been fond to be involved in GPy subunit signalhg to the Ras MAP kinase pathway (Fïg. 1.2)

(Wan et al. 1996). In avian B cefis, it was shown that transient expression of the Gi coupled M2 muscarinic acetylcholine receptor (mAchR) in hematopoietic Dl?'' cells can stimulate MAP kinase after treatment of the cdswith carbachol (Wan et aL. 1996). This stimulation by muswinic M.receptor was inhiibited by pretreatment of the cells with

PTX, suggesting that muscarînic M2 receptor is coupled to a Gi protein, and possibly indicating that GPy subunit is involved in this response. Moreover, muscarinic MZ receptors in Syk-deficient (Syk*) ceils failed to stimulate MEK and MAP kinase activation.

Reconstitution of Syk increased basal MEK activity and restored the stimulation of MEK in response to muswinic M2 receptor. M2 receptor stimulation increased MAPK activity in wild-type DT40 ceils, but not in the Syk-celis, indicating that Syk is required for the G protein coupled receptor to activate MEK and MAP kinase ('anet al.. 19%). More recentiy, it has been reported that the activation of Syk is the result of a Src kinase- initiated activation loop phosphoryiation chah reaction (El-Hillal et al., 1997). . Btkîïsk: Btk (ah known as Bpk Atk, and Emb) and Tsk (also known as Itk and

Emt) are members of the pleckstrin homology (PH) domain-containing tyrosine kinase 34

family. Both of these enzymes have no membrane localizing myristoylation signal. The PH

domain has been demomtnted to be able to interact with Gpy subunits and phospholipids in the membrane- Using cotransfection assays, it was shown that the kinase activities of

Tsk and Btk are stimulated by GPy subunits in B celis (Langhans-Rajasekaran e! al.,

1995). It was reporteci that the C-terminal part of the PH domain of Btk cm bind to GBy subunits (Touhara et a'. 1994). whereas the N-terminal half of the Btk PH domain was shown to interact with PKC (Yao et al.. 1994), suggesting that GPy may be involveci in the targeting of Btk tyrosine kinase to the membrane- It is presurned that after direct activation by the GPy subunit, the tyrosine kinase rnay recruït adaptor proteins (such as

Shc, or GrbZ), which in tum may trigger the Ras MAP kinase pathway just like receptor wosine kinases (Schlessinger & UUrich, 1992).

PI 3-kinase: Recentiy, the work using COS-7 celis has shown that PI 3-hase stimulation is a key step in GPy signahg via the Ras MAP kinase pathway (Lopez-Uasaca et al.. 1997). womnannin, a PI 3-kinase inhibitor (Powis et al.. 1994; Ui et al.. 1995). can biock MAP kinase activation in COS-7 cells induced by either M2 receptor stimulation or by overexpression of GPy subunits. Overexpression of the PI 3-kinase y isotype, which can be activated by GBy but which does not interaa with p85, causes an activation of

M.kinase that can be inhibiteci by wortmannin (Lopez-llasaca et al.. 1997).

Furthemore, expression ofa catalytidy inactive mutant of the PI 3-hase y isotype abolished the stimulation of MAP kinase by GPy overexpression or in response to muscarinic M2 receptor activation. It has aiso been shown that the signaling fiom PI 3- kinase y isotype to MAP kinase involves a tyrosine kinase pathway dong with the signal 35 pathway components, such as Shc, Grb2, SOS, Ras and Raf. How PI 3-kinase activates the downstream tyrosine kinase rernains unknown

1.3 -7.4, Mersignahg molecules

It has been reported that Rafmay act as a direct target for GQy to trigger the

MAP kinase cascade. By using a yeast two-hybrid screening system, a clone was identifid to encode the carboxyl-terminai halfofthe G protein GP2 subunit (hunigiia et aL, 1995).

With an Itr vitro binding assay, it has been found that the purified GQy subunits specifically bind to a GST fbsion protein encoding amho acids 1-330 of RaflRaf33O), and that a region of amino acids 136-239 in Misimportant for its interaction with GQy

(Pumigiia et al.. 1995). The &nie of this interaction is similar to that of GPy for PARK_

In addition, the complex of Raf- 1 and GQy has aiso been isolated fiom human embryonic kidney 293 cells by immuno-precipitation (Pumiglia et al., 1995). These data raise the possibility that the direct binding of GPy to Raf-1 might play a roie in the regdation of the

MAP kinase pathway by G protein coupled receptors.

GPy has been well documenteci to stimulate PEPLC-P. PI-PLC-Q isoforms have been shown to interact diredy with GPy subunits via the enzyme's amino-terminal region that contains the PH domain (Wu ef a[. 1993). Recently, the GBy binding region of PLC- p was fkrther narrowed down to 62 amino acids (residues Leu-580 to Val-641) (Kuang et al., 1996). GQy activates PLC-Q isozymes in the order of PLC-P3>B2>P 1 (Park et al.,

1993). PLC can hydrolyze PIP, to generate inositol 1.4,s-triphosphate (IP,) and diacylglycerol @AG). LP, increases the intracellular Ca" concentration by the reIease of

Ca2' fiom intracellular Ca2' stores; and DAG can activate PKC. a serindthreonine protein 36 kinase. Both increased Ca" and activated PKC have been shown to tigger Ras-dependent

MAP kinase pathway via Pyk2 in PC 12 cells as mentioned above (Dikic et al., 1996).

However, it bas been also documented that PKC can cause Ras independent-MAP kinase activation in fibroblasts (Leevers & Marshall, 1992). It is IikeIy that PKC stimdates MAP kinase via a direct interaction with Raf-1 (Kolch et al.. 1993).

It has been documented that GBy subunits have different effects on the various adenylyl cyclase (AC) isofoms (Tang & Gian, 1992). For exampie, type I AC is inhibited by GPy . However, type 2 and type 4 ACs are conditionally activated by Gpy, and type 3 AC is not affécted by GP y. (Federman et al., 1992; Taussig et al-. 2993). It has been characterized that a region ofadenylyl cyclase 2 defined by residues 956 to 982 rnay contain determinants important for interacting with GBy (Chen et al., 1995). Activation of adenylyl cyclase by GBy results in an increase of CAMP, leading to PKA activation. in

NIH 3T3 fibroblasts, it was demonstrateci that PKA activation can lead to an inhiiition of

MAP kinase (Cook & McConnick, 1993), possibiy as a result of direct inhibitory phosphorylation of Raf-1 by PKA (Hafher et al., 1994). However, in PC12 cells, PKA seerns to stimulate MAP kinase activity (Frodi et al., 1994), presumably through a Raf- independent activation of a distinct MEK kinase, which can also activate MAP kinase

(Lange-Carter & Johnson, 1994). These data suggest that GQy may have ciifferent effectors in various ceU types via the AC-PKA pathway, leading to positive or negative regulation of MAP kinase pathway.

It has been shown in some recent studies that transient overexpression of Gpy in sympathetic neurons rnimics and occludes the voltage-dependent Ca2+channel modulation produced by noradrenaluie (Ikeda, 1996; Lopez-Uasaca et aL. 1997). This effect may modulate MAP kinase activity via the Ccdependent Pyk2 as mentioned above. The F channe1 has been also reported to be regulated by GPy subunits (Logothetis et al.. 1988).

Recent studies have indicated that GPy activates the GIRKl subuait of the 1, channe1 by binding directiy to both the N-tenninal hydrophiiic domain and amho acid 273462 of the C-terminal domain of GIRKl (Huang et al.. 1995). Furthemore, it has documented - that GBy subunits can bind directiy and specifically to 1, vîa interactions with both CIR and GIRKl subunits to gate the channel (Krapivinsky et al., 1995). Since calcium influx cm induce activation of MAP kinase via Pyk2 (Rosen et ai.. 1994; Lev et al.. 1995b), the direct regulation of the K-channel by GP y may induce modulation of membrane potential and voltage-dependent ca2'channel activity, leading to the regulation of MAP kinase via

Pyk2. In addition, Caz- influx is also reported to induce EGFR tyrosine phosphorylation

(Rosen & Greenberg, 1W6), possibly by activating a Ca2- dependent cytosolic tyrosine kinase. Phosphorylated EGFR may mgger a response like that induced by EGF stimulation,

1-3.8. G protein Gq and the activation of MAP kinase

MAP kinase activation has been well characterized in GPy subunit signahg via a tyrosine kinase pathway (see Fig. 1.2). It has been documented that the alpha-q subunit can also play a role in the stimulation of MAP kinase through difrent signai transduction pathways (Hawes et al., 1995; Eguchi el al., 1996). Depletion of PKC can block the Gaq- induced activation of MAP kinase, suggesting that DAG fiom PLCP stimuiated by aq is involved in this process. A PKC advator such as phorbol ester has been fond to activate 38

MAP kinase via either a Ras dependent or a Ras independent pathway (Kolch et al., 1993;

VanRenterghem et al.. 1994; Thohm et ai-. 1994). In COS-7 ceus, it was found that the activation of MAP kinase induced by the aq-subunit was affkcted neither by the expression of RasNi 7, a Ras dominant negative mutant, nor by a protein tyrosine kinase inhibitor (Hawes et ai.. 1995), indicaîing that in this system the activation of the MAP kinase induced by the Gaq is neither Rasdependent nor tyrosine kinase dependent.

Therefore, this response of the MAP kinase activation by Gaq subunit is proposed to be induced Ma a Rafdependent pathway since this activation of MAP kinase by the Gaq subunit was found to be blocked by the expression of a dominant negative Raf(N-Raf).

However, another diierent pathway for the Gaq subunit to activate the MAP kinase was proposed fiom the observations in cultured rat vdarsmooth muscle cells. The data have suggested that the activation of MAP kinase induced by Angiotensin II through the

Gq G protein coupled AT, receptor is Ras dependent and tyrosine kinase inhibitor sensitive Iike that induced by GPy subunits (Eguchi et al.. 1996). It is thus likely that the

Gaq subunit may employ different signaling pathways to stimulate MAP kinase in various ce11 types.

1-3 -9. Tyrosine kinase pathways and smooth muscle function

Tyrosine kinase receptors for EGF and PDGF have been weli characterized to regulate smooth muscle hction (Berk et al.. 1985; Berk et ol., 1986; Holieaberg, 1994a).

It was found that both EGF and PDGF can induce contractile responses in rat aortic preparations in viiro (Muramatsu ei al.. 1985; Berk et al.. 1985; Berk et al.. 1986; Berk

& Alexander, 1989); the responses are sensitive to tyrosine kinase inhibitors. However, 39

EGF admùiistered intra-arteriaily in the dog was observeci to induce an acute d- of peripheral resistance (Gan et al.. 198%). The direct contractiie responses to EGF have been weii doçumented in gasmc smooth muscle preparations such as gastric longitudinal muscle (LM) and circular muscle (CM) (Hoiienberg, 1994b). The contraction induced in the LM by EGF has been identifieci to be blocked by treatment with tyrosine kinase inhibitors such as tyrphostin and genistein and by the cyclooxygenase inhiiitor indomethach (Hollenberg, 1994b). The signai transduction pathway for a tyrosine kinase receptor to induce a contrade response is largely unknown in the srnooth muscle systems, although a role for a tyrosine kinase component is hown to be invoived. PDGF is reported to cause an activation of voltageoperateci calcium charnels in smooth muscle celIs derived f?om rabbit ear artery, a response which is also sensitive to tyrphostin 23

(Wijetunge & Hughes, 1995a). However, it has been also suggested that in rat aorta smooth muscle, PDGF may cause Ca2&infiux via a receptor operated Ca2+channel through a tyrosine kinase pathway (Sauro & Thomas, 1993). Recently, it was found in both rat aorta and pulmonary arteries that a tyrosine kinase pathway is involved in MLCK

. activation and smooth muscle contraction (Ji et al.,1996), in which MAP kinase has been suggested to participate. MEK, an activator of MAP kinase, has been documenteci to be stimulated in the vascular smooth muscle contractile response induced by serotonin, which is inhibited by treatment with the MEK inhibitor. PD98059 (Watts, 19%). In cultureci smooth muscle, angiotensin II was reported to cause MAP kinase activation via a

Gq-mediated p2 1-dependent pathway (Eguchi et al., 1996). The activation of p2 IR"has been found to be mediated Ma pp60-Src activation stimulated by AïI (SchieEer et al., 40

1996). A tyrosine kinase pathway involved in G protein coupleci receptor-induced smooth muscle contraction has been impiicated in several smooth muscle systems activated by various agonists (Abebe & Agrawai, 1995). A tyrosine kinase pathway has been reported to be involved in the increase of intraceiiular fiee Ca2- induced by G protein wupled receptor agonists such as Aiï (Touyz & Sc- 1996). In the smooth muscle ceUs of the rabbit coIonic muscularis rnucosae, agonists such as carbacho1 and EGF can cause influx of extracellular Ca"' either via the dedipine sensitive L-type channel or via a nifedipine- insensitive Ca2' channel; these responses can be inhiibited by tyrosine kinase inhibitors

(Hatakeyama et al., 1996). Since PLC-y is reported to be activated by G protein coupled receptors, leading to an increase of intraceUdar Ca2* via production of LP,, there are two possibiiities for a tyrosine kinase constituent to regulate [ca2']i include: 1) tyrosine kinase rnay regulate directly the activity of the ca2+channel; and 2) tyrosine kinase may regulate

PLCy to modulate the production ofIP,. In rabbit ear artery cells, pp604" which can be stimulated in response to G protein coupled receptor agonists has been found to activate directly voltage-dependent Ca2' channels (Wijetunge & Hughes, 1995b). It has been weli characterized that PLC-y can be phosphorylated and stimulated in response to G protein coupled receptor activation via a tyrosine kinase dependent pathway (Marrero et al.,

1994; Marrero et al., 1996). With the electroporation of pp60cs" antibodies, it has been shown that AU-induced PLC-y activation is mediated by c-Src (Marrero ef al.. 1995).

However, there is still no direct evidence to show that Src and PLCy are involved in smooth muscle contraction. 1.4. Signal transduction pathways and the induction of rMcoxide synthase (NOS)

1.4.1. Nimc oxîde synthesis

Nitric oxide (NO) is an unstable gas that is cleariy distinct fkom nitrous oxide,

N,O, which is used as an anesthetic. The substrate for NO synthesis is the terminai

guanidino nitrogen of the amino acid L-arginine (Palmer et al.. 1988). which undergoes a

5-electron oxidation to fom Lcitrulline and the fhe radical NO (Nathan, 1992). It has

been shown that molecular oxygen and NADPH are cosubmates for this reaction

(Nathan, 1992; Leone et ai.. 1991) catalyzed by the enzyme NO synthase (NOS) which

has both flavin adenine dinucleotide (FAD)and flavin mononucleotide (Bredt et al.. 1992) and requires the binding of Ca2XaMand the presence of several oxidative

cofacton, including tetrahydrobiopte~(BH,) (Tayeh & Marletta, 1989), reduced glutathione (Stuehr et al.. 1990), and a heme complex (White & Marletta, 1992) (Fig.

1.3). The reaction is a two step redox-process, in which L-arginuie (not D-arginine) is first hydroxylated to the intermediate NG-hydroxyl-L-arme that is not released in signifiant quantities from the enzyme but immediately undergoes oxidative cleavage to yield NO and

L-citrulline. The oxygen atoms incorporated during each of the two reaaion steps are denved fiom molecular oxygen. The electrons fiom NADPH can be shunled by

FADMto heme in the presence of Ca2-KaM. It has been shown that BH4 is an important cofactor of NOS that positively modulates NO synthesis and that can be copurified with the enzyme (Mayer & Werner, 1995). The biosynthesis of BH4 can be induced by cytokines (Werner efal., 1993) through the induction of GTP cyciohydrolase

1. a rate-limithg enzyme. BH4 binds to NOS with high atnnity, causing an allosteric effect 42 on NOS (Kiatt et al., 1994). Both L-aginine and BH4 binding sites cm influence each other for the binding afhity (Giovaneiii et al.. 199 1; KIatt et al., 1994). Given the binding property of NO to heme group, NO-mediated ihiition of NOS may be important in providing a negative feedback regdation of NO synthesis. In the presence of BH4, NO can be rapidly inactivated to reduce the negative feedback of NO to NOS (Mayer &

Werner, 1995).

1.4.2. Signalhg by NO

After its production, NO readily diffùses across ceU membranes to interact with specific molecular targets. NO can regutate protein acavity by reversibly binding to available acceptor sites. including heme iron and thiol (Stamler et al., 1992). In response to an increase of intracelluiar Ca". nitic oxïde can be produced fiom either bNOS in non- adrenergic non-cholinergie nerve endings such as in the GI tract or eNOS in endotheiial ceiis in the blood vessels (see Section 1.4.3.) (Fig. 1.4). It has been well characterized that the interaction between NO and the enzyme guanylyl cyclase mediates target ceIl responses such as smooth muscle relaxation and platelet inhibition (Ignarro et al.. 1986).

After diffiising into the target ce& NO can bind to the heme moiety of guanylyl cyclase, leading to enzyme activation through inducing a conformational change to displace iron out of the plane of the porphoryrin ring (Tgnarro, 1991). Activated guanylyl cyclase then cataiyzes the production of cyciic guanosine 3',5' monophosphate (cGMP) fiom guanosine-S'-triphosphate (Wolin ef al,. 1982; Ignarro, 1989b). cGMP is believed to cause srnooth muscle relaxation through several mechanisms. Stimulation of the Ca2+activated

K+channel resuiting in hyperpolarization of the ceil membrane via nitric oxide duectly or Fig. 13The domain structure of nitric oside synthase and the process of nitric oside synthesis. NADPH LR + 0, FAD t I ,pl H4B FMN

Cit. + NO 45 via cGMP-dependent kinase indirectiy has been proposed to be responsible for the mechanisms whereby nitric oxide induces a smooth muscle relaxation (Lugnier & Komas,

1993; Bolotina et al.. 1994). MLCK phosphorylation by cGMP-dependent protein kinase has been identifiai as one of the important mechanisms (see above smooth muscle contraction) (Hathaway et a!.. 1985; Nishikawa et al., 1984). The phosphocylation decreases the binding mty of MLCK to CaM (Hathaway et al., 1985). It has been aiso suggested that cGMP may eiicit vasdar smooth muscle reiaxation by affecthg ~a'+/Ca~- exchange or perhaps by a cGMP-mediated effect on phosphodiesterase (Dinerman et ai.,

1993). In addition to a cGMP dependent pathway, NO activates a cytosolic admosine 5'- diphosphate (ADP)-ribosyi-transferase in human platelets that catalyzes the trader of

ADP niose to glyceraldehyde 3-phosphate dehydrogenase (GADPH), which is an enzyme integrally involved in glydysis @immeler et al.. 1992). The addition of an ADP ribose group to GADPH (ADP ribosylation) inactivates the enzyme and thereby slows glycolysîs and decreases adenosine S'-triphosphate formation (Dinerman et a!.. 1993), which process rnay be responsible for NO-mediated myocardial stunning or neurotoxicity (Dineman et al.. 1993).

1.4.3. NOS isoforms and distribution

There are three main isoforms of NOS, two of which are constitutive (cNOS), and one of which is inducible (SOS). AU three NOS isoforms are Werentiated by the sequences, localization, subcellular distribution and the functions (Table 1.1). Although

NOS (or NOS2) is inducible in response to various stimuli, both bNOS (or NOS 1) and eNOS (NOS3) are constitutive (Fig. 1.4). NOS 1 and NOS 3 have been found in several Fig. 1.4 The ngulation of smooth muscle function by nitric oxide reieased from endothelid celis and nare ending.

Table 1.1 Isofoms of nitric oxide synthase

Tissue or ceii NOS 1 localization 1 function 1 rnolecular mass distribution 1(bNOS) Sol. > Part. Ca2+/CaM II (iNOS) Part. > Sol. Unknown Macrophage, vascular SM IiI (eNOS) 1 Sol. > Part. 1 Ca2+/CaM 1 135,000 49 cells and tissues such as in vascular endothelial celis (eNOS or NOS3), and neuronal cells

(nNOS or NOS1) and several other cell types. The activation of cNOS can be reguiated by intracellular fke Ca2- in response to agonists such as acetylchoiine or bradykinin which can stimulate the production of IP, through activating PLC-P (Dinerman et al.. 1993). The transient increase of intraceiiuiar Cas released fiom uitracellular Ca2- store by IP, causes the cornplex formation of Ca2+/CaMwhich binds to cNOS causing conformational change and activation of enzyme (Bredt & Snyder, 1990; Mayer et al., 1989). NO produced fiom cNOS can act as a neuronal transmitter in both the central nerve system and in non- adrenergic non-chlorinergic peripheral nerve endings. In blood vessel, NO fiom the endothelium can diffuse to the underlying srnooth muscle layer to regulate smooth muscle tone and blood pressure (Fig. 1.4) (lgnarro, 1989a). The NOS kofonn (ahcailed

NOS3) which is regulated at the transcriptional level has been found in several ceil types including macrophages and neutrophils (Marletta et a'. 1988; Yui et al.. 1991), Iiver

(Gelier et al.. 1993), vasailar endothelial ceils (Kilbourn & Belloni, 1990), smooth muscle

(Fig. 1.4) (Gross & Levi, l992), chondrocytes (Charles et al.. 1993), rnyocardium (Schulz et al.. 1992), and other ceIl types, dl of which can be induced in response to severai cytokines (Clement et al., 1994). The nNOS and NOS sequences lack membrane-bound elements, so that the enrymes are maidy found in cytosol (Forstemam et al.. 1993).

However, eNOS is largely associated with the membrane of endothelial cells via N- temiinal irreversible myristoylation (Busconi & Mcheî, 1993). It has been suggested that the reversible palmitoylation of eNOS may also participate in its membrane association and hctionai regdation (Busconi & Michel 1993). nNOS originally identified in central neurons (Bredt et al.. 1990), has now been found in a variety of cdtypes hcluduig peripheral non-adrenergic non-chohergic (NANC) neurons, skeletal muscle, pancreatic islet cells, kidney macula dense celis and certain epithelial cells (Bredt & Snyder, 1994;

Forstermann et al.. 1993). eNOS that was supposed to be present ody in blood vesse1 endotheliai celis (Forsterrnann et al.. 1993) has been identifieci in kidney tubular epithelial ceUs (Tracey et al.. 1994) and CA1 neurons (O'Dell et al., 1994) in which NO plays a role in Long-term potentiation.

1-4.4. Structure of NOS

It has been found that NOS is composai of distinct reductase (C-temiinal: contains

FAD and FMN and binds NADPH) and oxygenase (N-temiinus: contains heme and binds substrate ) domains (Xie et al.. 1992). The consensus sequence for calmoduiin binding, acting as a hinge, is near the center ofNOS, separating the reductase and oxygenase domains (Fig. 1-3) (Abu-Soud & Stuehr, 1993). It has bem proposed that the reductase domain cm not supply electrons to heme ifCa2+/CaMis not bound to align the two structures, and the enzyme can be activated by aiignment of domains afîer Ca2-/CaM binding. As iNOS is tightty bound to Ca2+/CaMafter induction, the domains are aiways aligned so that enryme is comtitutively active. The head to tail dimerization of NOS which needs the coincident presence of ?HB. L-arginîne. and heme has been shown to be required for enzyme activation to generate NO (Baek et al.. 1993). It has ken suggested by some recent work that the intraceilular levels of heme and L-arginine can affect assembly of active dirneric NOS in vivo. 1.4.5. Signai transduction and NOS induction

1.4.5.1. iNOS gene

ïhe induction of NOS expression is thought to be mggered by an increased gene transcription. It has been shown that NOSis encoded by a single-copy gene comprised of

26 exons and 25 introns, located on chromosome 17 in humans (Chartrain et al.,1994).

The induction of BOS in mouse peritoneai macrophages by IFNy and LPS requires the synthesis of an intermediary protein (s) and may involve tyrosine phosphorylation (Xie et al.. 1993). From a mouse genomic Ihq, a 1749 base pair üagmmt fiom the 5' fianking region of the 240s gene has been cloned, in which the mRNA initiation site was found 30 bp downstream fiom a TATA box (Xie el aL. 1993) and in which there are at least 22 oiigonucleotide elements homo~ogousto consensus sequences for the buiding of transcription factors involved in the induciiiiity of other genes by cytokines or bacterial products. These sequences inciude ten copies of the IFNy response element (y-IRE); three copies of the y-activated site (GAS); two copies of each of the nuclear factor-kB site, IFN-a-stimuIated response eIement (RiTFRE); and one X box (Nathan, 1995). A minimal INOS promoter-reporter gene wnstruct, which conferreci inducibility by LPS, contained a single NF-kJ3 site, beginning 55 bp upstrearn of the TATA box (Xie et al.,

1993). Since NO itself can eiicit nuclear translocation of NF-kB (Lander et al., 1993), it is suggested that NO can potentiate its own synthesis via a feed-forward action on BOS gene transcription. 1.4.5.2. NOS mRNA stability

The AUCTUA consensus sequences witbin the 3'-untranslated region of NOS rnRNA fiom rodents and humans have been found to be responsible for the instabiiity of mRNA encoding inflammatoy mediators induding inteneron, TNF and interleukin- 1

(Evans et al., 1994; Asson-Batres et d,1994). The destabiiization of rnRNAs conferreci by this sequence is thought to be initiated by the binding of a labile protein, because expression of rhese niRNAs is typically enhanceci by inhiiitors of protein synthesis.

Accordingly, the treatment of either mu~emacrophage or rat vascular smooth muscle with cycloheximide increased the iNOS mRNA half-lie (6h) via preventing the breakdown of NOS mRNA induced by the cytokines (Evans et al.. 1994). Since the immunostimulants can induce the expression of each of two partiaüy characterized mRNA binding proteins with specificity for AWAsequence motifs (Bohjanen et al,,1992), it is iikely that rnRNA stability is a site for regulation of iNOS expression by cytokines.

However, the increased intracelldar Caz' has been reported to selectively suppress the mRNA stability induced by IL- 19 in human articuiar chondrocytes (Blanco el al., 1995) via an undefineci mechanism.

1.4.5.3. Functional regulation of iNOS

Once expresse& the activity of NOS protein may be regulated by covalent modification. Each of the three NOS isofonns contains consensus sequences for phosphorylation by serine or threonine protein kinases including PKA, PKC, and

Ca2+lCaM-dependentkinase (Nathan & Xie, 1994); However, the roles of NOS phosphorylation in vivo stilI remain to be elucidated. Tyrosine phosphorylation of iNOS in 53 dtured RAW 264.7 mhne macrophages induced by intenéron-y and IipopolysaCande has been suggested to participate in NOS fùnctional regulation (Pan et al,,1996), since the treatment with tyrosine kinase inhibitors such as tyrphostin and genistein that blocked

NOS tyrosine phosphorylation inhibitecl NOS activity without affecting INOS protein expression. It has been discussed in the previous section that BH4 plays a key role in regulation of NOS actîvity, for which the GTP cyciohydrolase 1, a rate limit enzyme, can be CO-inducedwith NOS by the same time course in response to immunostùnulants

(Hattori & Gross, 1993). Furthemore, the membrane transporter of L-arginine, the y' system, has also been shown to be upregdated by NO and CO-inducedwith SM)S by cytokines (Hatada et ai.. 1993; Wileman et aL, 1995), suggesthg that both GTP cyclohydrolase 1 and y' system may share the sarne promoter with the NOS gene.

1-4.5 -4. Signalling for iNOS gene transcription

It has been documented that NF-KB activation is involved in the induction of iNOS caused by various stimulants (Nunokawa et aï.. 1996; Wong et al.. 1996; Jeon et al.,

1 996;Feinstein et aL, 1996). NF-a, first identifid as a &or that regulates k-light-chah

expression in murine B-lymphocytes, is present in most ce11 types and plays a key role in * immune inflamrnatory responses (Siebenlist et ai.. 1994; Baeuerle & Baltimore, 1996).

NF43 is made up oftwo subunits which belong to Re1 fiunily, aU members of which have

Rel-homology region that contains both dimerization and DNA binding ability. The classic form of NF43 is a heterodirner of p6S (Re1 A) and p5O (NF431 ), both ofwhich have roughiy 300-amino-acid region with clear homology to the Re1 proto-oncogene; but other différent dimers also exia, which bind to distinct promoter sequences. The basis for the 54 latent nature of NF-KB and for its induciïility is the association of WE;-KB with a cytosolic inhibitory protein caiied IKB (Baeuerle & Baltimore, 1988), ofwhich several fomexist

(IKB~,B, y, 5: and E) (Baldwin, Jr. 1996). Since the release hmIKB aüows for the extraordinarily rapid appearance of NF-KB in the nucIeus, certain genes reguiated by NF-

KB can be transcriptionally activated within minutes in response to the relevant stimulus. It has been shown that a single IKB cmtarget the NF-* dimer (Hatada et al., 1993), retardmg NF-KB in the cytosol through covering the NF-KBnuclear localization sequence

(Baeuerle & Henkel, 1994; Beg & Baldwic Jr. 1993). The deletion ofits C-terminus is known to block the abiiity of IKB~to inhibit DNA binding of NF-KB. Mutations within the ankyrin repeat (205-amino-acid internai region) of IKB block the interaction with NF-

KB (Siebenlist et al., 1994; Baeuerle & Henkei, 1994). IKB phosphorylation, which resuits in its dissociation fiom NF-irB, has been characterized to parallel the appearance of NF-

KB in the nucleus. Mutation of two serines near the N-terrninus of IKB (Ser-32 and Ser-

36) blocks the inducible phosphorylation and degradation (Brown et al.. 1995; Broch et al., 1995). The constitutive phosphorylation of IKB in the C-terminal region may be required for the degradation of this protein (Barroga et d.1995). The proteasorne inhibitors such as PTCK and TLCK have been documentai to inhibit the dissociation and activation of NF-& by inhibiting the degradation of IKB in response to various stimulants

(Saldeen & Welsh 1994; Henkel et al., 1993). It was reported that the double stranded

RNA-activated kinase (PKR) can phosphorylate IKBa it~vilto; and in vivo inactivation of this kinase inhibits the ability of PKR to activate NF-KB (Kumar et al.. 1994; Maran et al..

1994). Ra£-1 kinase has been proposed to target IKB via direct NF-* translocation (Li & 5 5

Sedivy, 1993). Dominant negative experirnents as weii as direct expression experirnents have implicated PKC zeta as a reguiator of NF-KB activation (Diaz-Meco et al., 1994a).

Several phosphatases have been documented to regulate the activation of NF-KB. The

Ca2+dependent phosphatase calcineurin that can be inhibited by FK506 as weii as by cr/closporin A has ben shown to participate in NF-KB activation via an unknown target in

T cells (Frantz et al., 1994; Venkataraman et al., 1995). Inhibitors of the SerlThr phosphatase PP 1 and PP2q such as okadaic acid, potently activate NF-K.,indicating the involvement of a phosphatase in regulating some aspect of the pathway (Sun et al.. 1995).

Reactive oxygen intermediates as second messemgers in response to stimuli have also been proposed to be involved in the activation of M;-KB (Baeuerle & Baltimore, 1996). This proposai is based on the observations that treatment of some cells with H,O, can activate

NF-KB and that certain antioxidants such as N-acetyl cysteine or pyrrolidme dithiobarvamate (PDTC) cm biock activation of NF-KB by blocking the signai induced phosphorylation of kBa. Additionally, the exposure of ceiis to low oxygen concentrations results in the activation of NF-@ correIated with a loss of IKB~(Koong et al.. 1994), which is likely to be important in the situations such as angiogenesis associated with tumorigenesis, and ischemia. Tyrosine phosphorylation has been identified in the Id3 protein, which is distinct fiom that in response to ILIP or TNF (Koong et al., 1994).

However, it has also been reported haî tyrosine phosphatase inhibitors such as vanadate and pervanadate can block the activation of NF-irB induced by cytokines such as TNF and

IL- 1P, possibly through preventing the degradation of IKB (Singh & Aggarwal, 1995).

Many viral gene products have been show to activate NF-KB. The Tax protein of HTLV- 56

1 has been proposed to stimulate NF-& via at least two difEerent mechanisms: 1) through a direct physical interaction with NF-id32 lOOkDa protein; 2) by causing an inducible phosphorylation of II&. Although the activation ofNF43 in response to varÏous stimuIi such as virus, TNF, PmIL-lP, LPS and UV has been found to be iargely dependent on the phosphorylation and degradation of IKB, the exact signalling mechanisns for those stimuli to regdate the IkB processing or to induce a dissociation of NF-KBfiom Id3 have not been weii defineci so fi.Both the antioxidant PDTC and the serinekysteine protehase inhiitors such as N-a-tosyl-L-phenyldanine-chloromediyketone (TPCK) and TLCK as the inhibitors of NF-uB activation have been found to block the induction of BOS stimulated by various inducers (Schini-Kerth et al.. 1994; Diaz-Guerra et al.. 19%; Wong et al.. 1996; Kengatharan et al.. 1996; Gnscavage et al.. 1995). It is evident however, that the signal transduction pathway for the induction of BOS in one cell type might be different fiom that in another. The studies with both cuhred rat aorta srnooth muscie cells and intact rat aorta preparations have show that there are two dflerent mechanisms for

BOS induction in these two systems even in response to the same stimulant such as interferon (Sirsjo et al.. 1994).

1.4.5.5. Tyrosine kinase pathway and iNOS induction

It has been documenteci that INOS can be induced in several different celi types

(see Section 1.4.3. iNOS isoforms and distribution). The role ofa tyrosine kinase pathway in the induction of NOS has been extensively studied, but there is still no definite consensus about the role of a tyrosine kinase pathway in the induction of NOS. In the

NOS induction process, there are at Ieast two steps: (1) gene transctiption and (2) post- 57 transcriptional modification, at which a tyrosine kinase pathway may play a role. Aithough tyrosine kinase inhibitors such as tyrphostin AG 126 and AG 556 have been shown to prevent LPS-induced lethai toxïcity in rnice (Novogrodsiq et al.. 1994), it is stil1 not clear how tyrosine kinase inhibitors affect the induction ofNOS in macrophages and vascuIar smooth muscle. It is the induction of NOS that is believed to conmbute to septic shock

(Szabo, 1995). It was discussed in Section 1.4.5.3. that tyrosine phosphorylation of NOS in cultured RW 264.7 murine macrophages appears to participate in the functional regulation of NOS (Pan et ai., 1996). Tyrosine kinase inhibitors such as genistein and tyrphostin have been demonstrated to affect the induction of NOS in response to various stimuli in several ce11 types such as C6 astrocytoma cds (Gaiea et al.. 1995), J 774 macrophages (Eason & Martin, 1995), RAW 264.7 murine macrophages (Paul et al.,

1995; Dong et al.. 1993), and rat aortic smooth muscle (Marcin et al.. 1993); but it was not determined whether those tyrosine kinase inhibitors affected the appearance of fùnctional INOS or the induction of NOS messenger RNA Nonetheless, there are some data to show that treatment with tyrosine kinase inhibitors can reduce the induction of

NOS mRNA stirnulated by various inducen in severaf cultured celI syaems including rat mesangid cells (Tetsuka & Momson, 1995), human articular chondrocytes (Geng et ai.,

1995), human islets (Corbett et al.. 1996), rat brain glial celis (Feinstein et al. 1994) and astrocytes (Simmons & Murphy, 1994). Although some experîments with cultured srnooth muscle cells have shown that treatment with genistein can block the formation of cGMP stimulated by IL4 P (Marczin et al.. 1993), it is still not clear whether a tyrosine kinase pathway is hvolved in the induction of NOS in smooth muscle present in intact tissue. 1S. Reliminary observations and rationaie for the work described in the thesis

1. S. 1. Background

About ten years ago, it was found that the growth fictor, epidermal growth &or

(EGF), acting via its tyrosine kinase receptor can cause an acute response

(contraction/relaxation) in the vascular system either in virro or in vivo (Muramatsu et al.,

1985; Gan et al., 1987~Gan et al,. 198%). These results suggested a direct regdation of smooth muscle ttnction by a tyrosine kinase pathway, involving at least the receptor tyrosine kinase itself. By using the guinea stomach smooth muscle preparations, where longitudinal and circular muscle tissues are denved from the same piece of gastric tissue, it was documented that EGF or tradorming growth factor-a (TGF-a) caused &rent types of responses in the CM and LM preparations characterized on the one hand by the sersitiivity to the cyclo-oxygenase inhibitor indomethacin (LM preparation) and on the other hand by a resistance to the action of indomethach (CM preparation). Nonetheless, the contraction caused by EGF in both LM and CM preparation was sensitive to tyrosine kinase inhibitors such as genistein and tyrphostin (Muramatsu et al., 1988). The fact that

EGF-induced contraction in the LM preparation was completely blocked by treatment of the tissue with indomethacin implicated the production of a prostaglandin that might be involved in the response of LM tissue to EGF receptor stimulation. It was fiirther found that the source of arachidonic acid which served as a substrate of cyclo-oxygenase was fiom diacylgiycerol @AG), that was metaboiiied to arachidonate by DAG lipase (Yang et al., 1991). Furthemore, angiotensin II, a G protein coupled receptor agonist, was also found to induce a contractile response in guinea pig LM tissue, via a pathway that is 59 sensitive to both tyrosine kinase inhibitors and the cyclo-oxygenase uihïitor indomethacin, like the response induced by EGF (Yang et aL,1993). The hypothesis that a tyrosine kinase pathway participates in smooth muscle fùnctional regdation initiateci by the stimulation of either a tyrosine kinase receptor or a G protein coupled receptor

(Hoilenberg, 1995) was substantiakd both by the detection of a non-receptor tyrosine kinase such as Src in smooth muscle tissue (Laniyonu et al.. 1995) and by merstudies with tyrosine phosphatase inhibitors such as vanadate and pervanadate, which induced srnooth muscle contractile responses via a tyrosine kinase inhibitor sensitive pathway

(Laniyonu et al., 1994; Saifiddine et al,. 1994). More recently, the contractde responses in various smooth muscle preparations induced by thrombin receptor derived peptides which activate the G protein coupled thrombin receptor (protease-activated receptor no. 1 or PARI) have been studied extensively with regard to the stnicture-activity profile for receptor-activating peptides (PARlPAR2) (Hoiienberg et al,, 1992; Laniyonu &

Hollenberg, 1995; Tay-Uyboco el ai., 1995; Hoiienberg, 1996). The contractile responses induced by the stimulation of thrombin receptor, present in the LM preparation and in human umbilical vein, which can be coupled to either a Gi or Gq G protein, have also been found to be sensitive to tyrosine kinase inhibitors such as tyrphostin and genistein

(Tay-Uyboco et al.. 1995; Sasaki et al., 1995).

In view of the previous 6ndïmgs sumniarized above, the main aim of the studies described in this thesis was to explore in more depth the role (s) of a tyrosine kinase pathway in the reguiation of smooth musde fiuiction by using two main smooth muscle 60 targets: 1) a rat vascular aorta ring preparation (RA); and 2) gastric smooth muscle preparation (LM and CM) fiom either rats or guinea pigs.

1.5 -2. Prelirninary experiments

One question that was explored in prdiminary work related to the source of diacylglycerol @AG) that, via diacylglycerol lipase, yielded the contractile arachidonate metabolite in the guinea pig LM preparation. DAG could corne either directiy via the activation of phospholipase C; or indirectly via the activation of phospholipase D, foliowed by phosphatidate phosphohydrolase. Ethanol, which can be converted to phosphatidylethanol fiom phosphatidate wouid be expected to block the production of arachidonate via the phosphoiipase D pathway. Thus, preliminary experiments were done to see if the contractile action of EGF in an LM preparation couid be modulated by the pretreatment of tissue with ethanol. Surprisingly, ethanoi alone was found to induce an

EGF-like contractile response in guinea pig LM tissue. Thus, an unexpected goal of the thesis, related to the central hypothesis that a tyrosine kinase pathway may play a role in reguiating smooth muscle, became a study of the mechanism (s) whereby ethanol signaiiing caused an EGF-like response.

Apart fiom the rapid contractile response of smooth muscle, involving a tyrosine kinase pathway, it was expected that a tyrosine kinase pathway might aIso be involved in a delayed response, such as the induction of nitric oxide synthase. The induction of 30s would be expected to cause a relaxation of smooth muscle via the production of nitric oxide. Thus, preliminary work was done to see if, under the conditions of organ culture or maintenance of the tissues in the bioassay organ bath, NOS might be 61 induced. The preliminary results with rat aorta rings fiom organ dture for 24 h or 48 h showed a rapid loss of tension of the tissue in response to wntractüe agonists such as phenylephrine (1 pM). This tension loss could be prevented by pretreatment of aorta tissues with the inhibitor of nitric oxide synthase L-NAME (1 00 pM) for about 20 min before adding phenylephrine to organ bath. The the-dependent loss of tension in rat aorta rings prepared either with or without an intact endotheiium was also observed in the prolonged organ bath studies (up to 10 h). The loss of tension developed in response to contractile agonists was restored by the NOS inhibitors, L-NAME or amjnoguanidine (1 mM). Furthemore, preliminary rdtsshowed that afkmaintahhg the aorta tissues in the organ bath for 4 to 5 h, the addition to the organ bath of L-aginine (1 mM), the substrate of nitric oxide synthase, caused a relaxation in the phenylephuie-precontracted tissue. These preiiminary observations suggested there was a spontaneous induction of nitric oxide synthase in rat aorta preparation which participated in the fwctional regulation of smooth muscle. At the tirne, the question arose as to whether the induction of NOS rnight dso be observed in non-vascular smooth muscle. and work was begun with the gastric LM and CM preparations to assess NOS induction.

1.5.3. Main goals of the thesis

In view of the above disaission and the preliminary findings, the main goals of the thesis were: 1) to characterize the signal transduction pathway related to the ethanoi- induced contractile response in gastric smooth muscle; 2) to explore the signaihg pathways in gahc LM tissue for the contractile action of the G protein coupled thrombin 62 receptor as compareci with EGF; and 3) to characterize the induction of SOS in aorta and gastric smooth muscle preparations, with a focus on tyrosine kinase pathways. CHAPTER TWO: MATERIALS AND METEODS

2.1. Materials and reagents

Ethanol (reagent grade) was Erom Commercial Alcohols Inc. (Brampton, ON); reagent grade methmol, 1-propanol and butanol were fiom Fisher Scientific (Fair Lam

NJ). Human epidermal growth factor and hurnan transforming growth factor-a (TGF-a) were fiom Upstate Biotechnology Inc. (Lake Placid, NY); mepacrine, indomethach, carbachol ketoconazole, nifedipine, 4 methyl pyrozole, atropine, nordihydroguaiaretic acid (NDGA), prazosin and yohimbine were fkom Sigma (St. Louis, MO). Genistein was fiom ICN (Costa Mesa, CA); tyrphostin 47 (also designateci AG213) was fiom

Caibiochern @,a Jolia, CA). U57.908 was obtained fiom Upjohn (Kalamazoo, MI).

PD 153035 was fi-om Parke Davis (AN Arbor, MI), as was PD98059. GF109203X,

LY294002 and chelerythrine were Erom Biomol (Plymouth, Meeting PA). Pervanadate was prepared as described previously (Kadota et al., 1987) by mixing stock solutions of sodium orthovanadate with an equirnolar or molar excess of H@,. After a 15 m.period, the reaction was terminated by the addition of catalase (400 Ufrnl) to metabolite unreacted H,Oz. TLIGRL-NH, was provideci by BioChem Therapeutic, Lavai PQ,

Canada. TRI-reagent was fiom Molecular Research Centre, Cincinnati, OH. A W-strand cDNA synthesis kit was fiom Pharmacia UCB Biotechnology, Uppsala, Sweden.

Aminoguanidine, L-arginine/D-arginine, phenylephrine, LY83 5 83, sodium nitroprusside

(SM),pyrrolidine dithiobarvamate (PDTC)and N-a-tovl-L-phenylalanine-chloromethyI ketone (TPCK)were fiom Calbiochem (La Joiia, CA). Actinomycin D, cyclohexïmide and vanadate were fiom Sigma (St. Louis, MO). 2.2. Bioassay procedures

2.2.1. Gasûic srnooth musde preparation

The gastric LM and CM Preparations were prepared essentiaiiy as previously descn'bed (Fig. 2.1) (Muramatsu et al., 1988; Hoiienberg et al., 1989), using male albino guinea pigs and deSprague Dawley rats weighing approximately 350 g and 250 g respectively. Animals were cared for according to the recomrnendations of the Canadian

Council on Animai cate. Mer sacrifice by rapid cervical dislocation, the animals were exsanguinated fiom the common carotid arteries, and the stomach tissue was isolated. The stomach was opened dong the lesser curvature, and al1 of the smooth muscle element was carefutly dissected free fiom the overlying mucosa. The CM and LM strips (about 3x10 mm) were prepared by cutting either dong or at right angles to the visible LM bundles, respectively. This procedure aiIows for a measurement of contractile responses of either the LM or CM elements derived Eom the same tissue preparation (Muramatsu et al.,

1988). Each preparation, secued at the ends with a silk suture, was mounted vertically in a plastic cuvette organ bath containing 4mL of Krebs-Henseleit solution of the following composition (mM):NaCI, 118; KCL 4.7; CaCI, 2.5; MgCl, 1.2; NaHCO,, 25; KH,PO,,

1.2; and glucose, 10 in distilled deionized water. The bath medium was maintained at 37°C and was gassed with a mixture of %%OJS%CO to maintain the pH at 7.4. A resting tension of 1 g was applied initiaiIy and the tissue was dowed to equilibrate isometrically, at which tirne tension was in the range of about 0.8 g. Changes in tissue tension were monitored isomet~callyusing Grass or Statharn force transducers. Routinely, tissue response was monitored by the addition of either 50 mM KCI or 1 pikl carbacbol (Cch) to Fig. 2.1 Anatomieal structure of stomach and bioassay procedures.

67 the organ bath; &er monitoring a contractile response, tissues were washed and aiiowed

to return to baseüne tension in fiesh buffer. In experiments with rat gastric preparations

done to rnonitor the time of induction of BOS, tissues were incubateci for prolongeci time penods (up to 10 h) in the organ bath, and baer was changed at about 45 minute intervals. Guinea pig gastric smooth preparations including CM and LM were exploiteci to study the signal transduction of EGF, ethanol and thrombin receptor peptide in contractile responses. The tissues were triggered with various agonists at about 30 min intervals der washing with buffer three times. The treatment of tissues with distinct antagonists or inhibitors for 20 min was foilowed by addition of contractile agonists, compared with control responses without any treatment in each individual tissue.

2.2.2. Rat aorta preparation

Using male Sprague DawIey rats weighing approximately 250 g, as descriied above, the thoracic aorta was removed for the preparation of ring segments (2mm x 3mm) to be used for bioassay pux-poses. Rings were used either intact or after mechanical disruption of the endotheiium by rolling the interior aspect of the ring gently over the inserted end of a fine forceps. Rings were mounted in a plastic organ bath (4 ml total capacity) and were bathed at 37°C in gassed (95% O#% CO3 Krebs-Henseleit buffer

(pH7.4). An initiai tension of 1 g was applied duruig the equilibration perïod (about 1 h).

The tension was monitored with Grass force-displacement tranducers. The presence (or absence) of an intact endothehm was ascertained by monitoring the relaxation response induced by 1 pm acetylcholine in a preparation which was precontracted with 1 pM phenylephrine. The rings with 80% to 90a/o relaxation in response to acetylcholine were 68 taken as havhg intact endothehua The denuded rings havhg no relaxation responses to 1 pM acetylchohe, indicating an absence offunctiod endothdium were considered to be endothelium free preparations (Laniyonu et al., 1994; Laniyonu et al.. 1995).

2.3. Western blot analysis

Tissue strips to be used for Western blot assay were prepared exactly as for the

LM bioassay and were exposed to contrsrctile agonists (EGF,17 nM; EtOH, 170 mM) for a the corresponding to the peak of tissue contraction (from 1 to 5 min). Tissue was fiozen immediately on a solid CO,-cooled plexigiass plate, chopped with a scalpel and irnmediately solubilized in irnrnunoprecipitation buffer (1% vlv NP40, in Tris HCl pH 7.4, containhg 1 rnM sodium orthovanadate and 1 pM each of the protease inhibitors PMSF and leupeptin). Tissue extracts were clarified by centifiigation at 15,000 x g for 20 min at

4 OC. Using tissue extracts containhg the same amount of protein (Folin ragent assay), phosphotyrosyl proteins were hamested ovemight at 4" C using Sepharose bead-coupled monoclonal antiphosphotyrosine antibody @Dg), (50-60 @mL, packed beads) that had been prepared aarding to Glenney et al. (1988). Bead-bound protein was washed th= times with this buffer by centrifugation and protein in the bead peiiet was soiubied in 30 pl of boiling sample bder (Laernmli 1970) in preparation for polyacrylamide gel electrophoresis (80 mm X 50 mm x 1.5 mm, 100/o gel) and transfer to nitroceilulose (0.45 prn; BioRad, Richmond, CA) for Western blot detection of protein. Phosphotyrosyl proteins were detected using horseradish peroxidase-coupled monoclonal antiphosphotyrosine antibody @Dg), dong with cherniluminescence (ECL) detection 69

(Amersham, Oakville, Ontario, Canada). Moleailar weight markers were fkom BioRad,

(Mississauga, Ontario, Canada).

2.4. Preparation of tissue RNA, reverse transcriptase-polymerase chah rdonanalysis and nucleotide sequencing

- The totai RNA from rat gastric CM tissues and rat aorta rings with and without incubation in organ bath for spdctime periods was extracted by using TRI reagent, and reverse-transcribed with a h-strand cDNA kit (Pharmacia Biotech Inc.) using pd (N) 6 primer according to manufàctmer's re~mmendationsat 3PC for 60 min; 3 pl of each cDNA preparation was taken for PCR reaction to amplie a 578-bp NOS cDNA fiagrnent from rat aortic and gasaic RNA. The sequences of the forward

(5'CCAGGGGCAAGCCATGTC33and reverse (S'CTCCAGGCCATCTTGGTGGC3') primers were based on the published rat aorta smooth muscle NOS cDNA sequence

(Nunokawa et al., 1993). Amplification was aliowed to proceed for 35 cycles, beginning with a 45-sec denaturation period at 94°C followed by a 45-sec reannealing time at 55°C and a primer extension period of 1 min at 72°C. The PCR products were separated by

1-5% agarose gel electrophoresis and visualized with the use of ethidium bromide staining.

The signais yielded fiom rat aorta and gastric tissues by a pair of primers fiom rat aorta

NOS cDNA were norrnaiized amrding to the signals obtained by an intron-spanning actin primer pair (Watson et al.. 1992): S'CGT GGG CCG CCC-TAG GCA CCA3' and

5'YYG GCC TTA GGG TTC AGG GGG3'. The detection of a 243-bp actin PCR product using this primer pair can confirm the absence of intron-derived cDNA in the reverse- transcript products obtained ftom tissue RNAs. Sequencing of cDNq subcloned into the 70 pBIuescript SK- phagemid, was done using the dideoxynucleotide sequenchg method

(Sanger et al., 1977). Samples were loaded onto a prewarmed (approx. 50°C) 8% acrylamide 8M urea Tris-Borate-EDTA sequencing gel- Electrophoresis was conducteci at a constant power of 100 W and gels were fked in a solution in a solution of 1û% methanot and 10%glacial acetic acid (v/v) and dried for about 45 min at 80°C. Bands in the DNA sequences (labeled with a-3SS-d~TP)resolved by eIectrophoresis were detected by autoradiography at -70°C with Kodak XAR-5 film for about 36 h.

2.5. L-arginine-mediated relaxation assay

mer mounting rat gastric tissues (LM or CM preparation) and aorta rings in the organ bath, tissues were precontracted with Cch (1 pM) or phenylephrine (FE, 1 m.At the plateau of contractde response, L-arginine (1 mM) was added to the organ bath; a relaxant response upon adding L-arginine served as a pharmacological index of NOS induction. Tissues then were washed three times to remove agonist and excess L-arghhe hmin the organ bath. The time course of the induction of L-arginine-mediated relaxation was determineri by monitoring L-arginine-induced relaxation every hour during the incubation of tissue in the organ bath. Treatrnent with various reagents including tyrosine kinase inhibitors, tyrosine phosphatase inhibitors, gene transcription inhibitor and protein synthesis inhibitor was started fiom the beginning of experiment. The guanylyl cyclase inhibitor LY83583 (10 CrM) and NOS inhibitor arninoguanidie*(l mM) were added to the organ bath about 20 minutes before any contractile agonist. 2.6. Irnmunohistochemistry

CM gastric tissues before and &er 5 h incubation were fixed by overnight immersion in 4% paraformaldehyde in 0.1M phosphate bser (pH 7.4) at 4°C. They were then washed with phosphate buffered saline (PBS, pH 7.4; 3x10 min), and cryoprotected in PBS containing 20% sucrose. The tissues were seaioned (12 in a cryoaat and then processed for Uidirect irnm~~~ofluorescence.Sections were washed in PBS contaking

0.1 % Triton Xl O0 for 3 0 min at room temperature, and incubated with the prirnary antiiodies for 24-48 h at 4°C in a mois chamber. Primary anthdies used were: rabbit anti-iNOS (Transduction Laboratories, Lexington, KY; 1: 500), rabbit anti-bNOS (Santa

Cruz Biotechnology, Santa Cruz, CA; 1: 1000) and mouse anti-rat macrophage (clone

ED2, Serotec, Oxford, UK; 1: 1500) (Dijkstra et al.. 1985). To double-label NOS and macrophages the primary antibodies were rnixed prior to use as prevîously described (Parr

& Sharkey, 1994). Sections were then washed (3x10 min) in PBS and incubated with secondary antibodies (donkey anti-rabbit IgG conjugated to CY3; 1: 100; Jackson - ImmunoResearch Laboratories, West Grove, PA andfor goat anti-mouse IgG conjugated to FITC; 1: 50; Incstar, Stillwater, MN) for a Wher 1 h at room temperature. Fhally they were washed in PBS containhg 0.1% Triton XlOO (3xlOmin) and mounted in bicarbonate-buffered glycerol (pH 8.6). Sections were examined using a Zeiss Axioplan fluorescence microscope and photographs were takea with ~odakTMax 400 ASA film. 72

CHAPI'ER 'ïHREE: SIGNALLING PATHWAYS FOR TEE CONTRACTILE

ACTION OF ETHANOL, EGF AND THROMBIN RECEPTOR Ac'TIvATlNG PEPTIDE

3.1. Introduction

The growth factor, epidermal growth factor (EGF), has been hvestigated for its ability to modulate the contractile activity of a variety of srnooth muscle systems (Berk et al., 1985; Berk et ai., 1986; Berk & Alexander, 1989; Muramatsu et al.. 1985;

Muramatsu et al., 1988; Hollenberg et d,1 989; Holienberg, 1994b; Hollenberg, 1995).

The EGF receptor, one of the family of tyrosine kinase receptors, is activated by EGF binding, that induces receptor dirnerization and autophosphorylation (Schlessinger &

UUnch, 1992; Fantl et aL. 1993; Kazlauskas L Cooper, 1989). Several signalling molecules downstream of the EGF receptor have been characterized in various ce1 syaems, such as Grb2, PLCy, Src kinase, SH-PTP and PI 3-kinase (see Section 1.2.2.).

PLCy, as one of the direct targets of the activated EGF receptor was first hypothesized to participate in the contractile response to EGF in smooth muscle, since it cmproduce IP, and DAG to increase the intracellular Ca2- and to activate PKC (Meisenhelder et al..

1989; Ronnstrand et al.. 1992; Kim et al.. 1991); both of these signal mediators are key elements in the srnooth muscle contractile process (see Section 1 -2.2. and 1-2.5 .). In gastnc longitudiï muscle (LM), however, the contractile action of EGF was found to be sensitive to indomethach, a cyclo-oxygenase inhibitor (Muramatsu et al.. 1988); furthet studies have shown that the arachidonic acid responsible for EGF induced contraction redts from the metabolisnt of diaqdglycerol by diacylglycerol lipase (Muramatsu er ai., 73

1988; Yang et al.. 1991). The data obtained with the LM preparation do not support the

hypothesis that PLCy activation alone, after EGF receptor stimulation, induces a direct

smooth muscle contraction. The workuig hypothesis for EGF receptor signallin8 in the

LM preparation has been that either unknown molecules that aui be adapter proteins, or

another non-receptor tyrosine kinase that acts downstream of the EGF receptor can

mgger a process that inmeases the production ofDAG or that stimuiates DAG lipase,

leading to the production of arachidonic acid and the contractile prostaglandin

metabolites. Since diacylglycerol rnight be produced via a concurrent phospholipase D

(PLD)/phosphatidate phosphohydrolase reaction, it was proposed that PLD might play a

role in the contractile action of EGF by providing DAG lipase with its substrate, DAG.

Furthemore, the incubation of LM tissues with ethanol which is converted to

phosphatidylethanol via PLD, might attenuate the contractile action of EGF by reducing the production ofphosphatidic acid and its conversion to diacylglycerol. The working

hypothesis was, therefore, that ethanol either alone or in combination with EGF might

modulate gastnc smooth muscle contractility. It hinieci out in the prelirninary experiments that ethanol on its own (20-500 mM), in a guinea pig gastric LM preparation, induced a

reproducible contractile response which appeared to parallel the responsiveness of the tissue to EGF in each corresponding replicate gastric LM tissue preparation. For this reason, the etbol-induced contraction in the gastric smooth müscle preparations has been studied, as compared with the EGF contractile response.

The invofvement of a tyrosine kinase pathway has been donimented in the contractile responses of smooth muscle induced either by EGF (Gan et ai.. 1989; Yang et 74

al.,19926; Berk & Alexander, 1989) or by various G protein coupled receptor agonists

such as An (Yang et al.. 1993) (dso see Section 1.3.4). The contractile response to EGF

of the gastric LM preparation is sensitive to tyrosine kinase inhibitors such as genistein

and tyrphostin, which results point to the invoIvement of a receptor tyrosine kinase.

Whether or not some other tyrosine kinase is activated in response to EGF receptor

stimulation can not be excluded in the experiments with either genistein or tyrphostin.

Therefore, it was necessary to cl- the involvement of the EGF receptor tyrosine kinase

and possibly other non-receptor tyrosine kinase in the EGF induced contractile response in

the smooth muscle by using some more specitic tyrosine kinase inhibitors. By using both

genistein and tyrphostin, the involvement of a tyrosine kinase in the contractile responses

by stimulating the G protein-coupled receptor for either thrombin or angiotensin was aiso

established in the LM preparation (Yang et ai., 1993; Hollenberg, 1996). The thrombin

receptor is one member of a novel protease activated receptor farnily (Hollenberg, 1996), which can be coupled to either Gq or Gi G proteins (Vu et al.. 199 1; Rasmussen et al.,

1991). It has been reviewed in the previous sections that the agonists acting via both Gi

and Gq G proteins can induce an activation of intracellular tyrosine kinase(s). ~hrombh,a

multifLnctional protease, activates its receptor through a novel mechanism comprising the

proteolytic unmasking of an N-temiinal tethered self-activating receptor neoligand (Vu et al.,1991). It was fùrther found that the short synthetic peptides; based on the proteolytically revealed receptor advating sequence, can on their own activate the thrombin receptor so as to rnimic the action of thrombin in a variety of tissues ranging fiom platelets (Vu et al., 1991) to v~scularand gastric smooth muscle (Muramatsu et d, 1992; Simonet et ai., 1992; Yang et al,, 1992a). In addition to the sensitivity of the

contractile effect of thrombin receptor peptide to the tyrosine kinase inhibitors, it has been

also found that the contractile response in the LM preparation couid be inhiibited by the

cyclo-oxygenase inhibitor indomethach, fie the contrade action of EGF. The whole

picture in the mc LM tissue preparation, therefore, is that the contrade responses

induced by the stimulation of both the EGF tyrosine kinase receptor and the G protein

coupled receptor for thmmbin are sensitive to the tyrosine haseinhibitors such as

genistein and tyrphostin and to the cycIo0xygenase inhibitor indomethacin. Since the EGF

receptor has ben reporteci to be tramactivateci by thrombin receptor stimulation Oaub et

al., 1996), the contractile response induced by thrombin receptor activating peptide was

studied in cornparison with the EGF response.

Since the gastric longitudinal muscle preparation (LM) obtained fiom either rats or

guinea pigs is shown to be novel in its sensitivity to a variety ofagonists in that it

contracts in response to the growth factor, epiddgrowth factor (EGF)(Muramatsu et

al., 1988), ethanoi and thrombin receptor activating peptide, ginea pig gastric smooth

muscle preparations (both LM and CM) have been exploitecl to examine the si@

transduction mechanisms whereby those three agonists induce contractile responses.

3 -2. Ethanol-induced contractile response

3.2.1 . Effects of tyrosine kinase Uihiitors, indomethacin-and inIiiiitors of nerve- released agonists

In the initial work, the action of ethanoi was assessed in both in the LM and CM tissues. Ethanol-induced contractile responses without desensitiation were observai in 76

both the longitudinal (LM: Fig. 3.1, l&-hand mcings A-C) and cirdar (CM: Fig. 3.1,

right-hand tracings G-1) muscle preparations. Contractions caused by 170 mM ethanol

were equivdent to those causeci by certain concentrations of EGF or TGF-a (1 7 nM) that

were at the plateau of the EGF/TGF-a concentration efficwes (Hoilenberg et ai..

1989). TGF-a was used for cornparison in the CM preparation because its contractile

action is les desensitizing than that ofEGF (Hoilenberg et al., 1989). The contrade

aaions of ethanol in both LM and CM preparations were unaffècted by 1 @Iof each

following agent: tetrodotoxin, atropine, prazosin and yohimbine. As for EGF (Fig. 3.1, tracings E and F), the contractile action of ethanol in the LM preparation was blocked both by the tyrosine kinase inhiiitor genistein and by the cyclooxygenase inhibitor, indomethacin (Fig. 3.1 tracings B and C; Fig 3.2). The tyrosine kinase inhibitor, tyrphostin-47 (AG 21 3) also blocked ethanol-induced contractions in the LM preparation

(Fig. 3 -2). Genistein and tyrphostùi-47 also attenuated ethanol-induced contractions in the

CM preparation, albeit less than that in the LM preparation (Fig. 3.1, tracing H and Fig.

3.2). The two tyrosine kinase inhriitors did not affect contractions caused by carbachol(1 pM) in the LM and CM tissues. The concentration-effect curves for the ability of genistein and tyrphostin-47 to inhibit contractions causeci by ethanol(170 mM) in the LM and CM preparations are shown in Fig. 3 -2. Aithough a greater than 90% inhibition of the contractile response by both tyrosine kinase inhïibitors was possible in the LM preparation, the ethanol-induced contractile response in the CM pnparation appeared les aEeaed by genistein and tyrphostin (s 60% inhibition) (Fig. 3.2). In contrast with the inhihitory action of indomethacin in the LM tissue, a robust contrade response to both ethanol and Fig. 3.1 The contrrçtüe actions of ethanoletbiaol and EGF or TGF-a in gdclongitudinal

(LM) and circulu muscle (CM) sbips: effects of genistein (CS) and indometbacin

(mD0).

Either longitudinal (LM, left-hand panel) or cirdar (CM, right-hand panel) muscle strips were first exposed to etbanol (A, B, C, G, H, 1: 0, 170 mM), or EGF @, E, F: e,

17 nM) or TGF-a (J, K, L: 0 17 nM) to measure a control contractile response, followed by washuig the tissues (W, arrows). The preparations were again challengecl with either ethanol (O),EGF (a)or TGF-a(O) either without (A. D, G, J) or afler a 20 mui pretreatment with either genïstein (B, E, H, K: A, 8 pM) or indomethacin (C, F, I, L: A, 3

FM). The scaie for tirne and tension is shown beside trachg B; each tracing (A to L) shows the responses to a single tissue strip, as indicated by the breaks (/Oin the recorded trace. The data in each tracing are representative ofexperiments done with four to six individual tissue strips taken fiom 3 or more separate animals. J EGF. 17M 79

TGF-a was observed in the presence of indomethacin in the CM tissues (Fig. 3.1, tracings

1 and L). The epoxygenase inhibitor, ketoconamle (5 FM)and the lipoxygenase inhibitor,

nordihydroguaiaretic acid (30 C1M) had no effion ethan01-induced contractions in the

LM and CM preparations. To mle out any contribution of cyclooxygenase products fiom

LM tissue preparations to the contractile response of the CM preparation, aü Mher

experiments with this CM tissue were done in the presence of 3 pibl indomethacin.

3.2.2. Actions of other alcohols and concentration-efféct curves

The ethanol induceci responses were not affecteci by 4-methylpyrazol(50 pM: (Li

& Theorell, 1969)), indicating that the metaboiism of ethanol by alcohol dehydrogenase

did not play a role in the contractile effect and suggesting that other aicohoIs might be

active. Like ethanol, methanol and propanol also caused contractile responses in both the

LM and CM tissues (Fig. 3 -3). In contrast with these alcohols, butanol(50-150 mM)

caused a relaxation of the LM and CM tissue rather than a contraction. In the LM

preparation, the order of alcohol potencies as estimated fiom the concentrations causing a

contractile response SV?of maximum was: ethanol = propanoI > methanol. In the CM

preparation, the potency order was propanol > ethanol> methanol (Fig. 3.3). In both the

LM and CM preparations, the maximum contraction in response to ethanol and methanol was comparable at the plateau of their respective concentration-response curves.

However, propanol, at the plateau of its concentration-re~pon~cwyecauseci a much

srnaller contractile response than that caused by either ethanol or methanol (Fig. 3 -3). All

of the con~uingwork was focused ody on the action of ethanol in the LM and CM preparations. Fig. 3.2 The inhibition of ethanol-stimulated contractions in LM and CM tissues by

either genistein (CS) or tyrphostin 47 (TF): concentration-effect curves.

A control contractile response was first monitored by exposing each tissue to

etfimol (1 70 mM) followed by washing. A second response to ethanol was then rneasued afîer incubating tissues for 20 min with increasing concentrations of eithet genistein (GS,

A, a) or tyrphostlli47 (TP,A, O). The contractiie response in the presence of each concentration of Uihiitor was expressed as a percentage (% control) of the contractile response observeci prior to the addition of either genistein or tyrphostin-47. Data points represent the means * S.E.M. (bars) for observations made with 3 to 6 individual tissue strips taken fiom two or more Werent animals. CONTRACTION (XCONTROL] 82

Ethanoi, methanol and propanol were studied with bioassay procedures. As

butano1 caused relaxation in the gastric smooth musde preparation, it was not included in

dose-response curve studies. Dose response curves showed that in the guinea pig LM

preparation, ethanol was the most potent contrade stimulant (Fig. 3.3). The maximai

response to ethano1 was achieved at a concentration of about 450 mM.

3.2.3. Role of extracellular caIcium

In the absence of extracellular calcium, ethanol fàiled to cause a contractile

response in either the LM or CM preparations; replenishing the medium with calcium

(final concentration: 2.5 mM) in the continueci presence of ethanol resulted in a

contraction (Fig 3.4). An antagonist of the voltage-sensitive calcium channel, nifedipine (1

CrM), as expected, completely ïnhiiited contractions caused by depolarking the LM tissue

with 50 rnM KCI (Fig. 3 -5). This concentration of nifedipine also markedy attenuated (90

* 5% inhibition, n = 6) the contractile action of EGF in the LM assay'(Fig. 3 -5). In

contrast, 1 ph4 nifedipine had only a modest inhibitory effect (30 * 1% inhibition, n = 10)

on ethanol-induced contractions; upon adding the receptor-operated calcium channel

biocker, SKF96365 (30 PM)to a nifedipine-treated LM preparation, it was possiïle to

bIock completely the ethanol-induced contraction (Fig. 3.5). SKF96365 aione did not

completely block the contradie response. Comparable effects of nifedipine and - SKF96365 were observed for ethanol in the CM preparation.

3 .S.4. Effects of U57, 908 and mepacrine

The diacylgfycerollipase inhibitor, U57,908, which at a concentration of 20 pM effectively and selectively inhibits diacylglycerol lipase activity in the guinea pig gastric Fig. 3.3 The contractile responses of LM and CM muscle strips to metbanol, etbanol and propanol: concentration-cffect curves.

The responsiveness of each tissue strip was first monitored by exposure to 50 rnM

KCI, foilowed by washing- Tissues were then exposed to increasing concentrations of methanol(0) ethanoi (O)or propanol (*)followed by washing. The contrade responses to the aicohols were expressed as a percentage (% KCI) of each tissue's response to 50 rnM KCI. Each data point represents the mean k S.E.M. for 4 to 6 measurements made with individuai tissue strips taken fiom 2 to 4 different animals. -

m

- -

-

3 ô Ethanol d O Methanol * Propanol I . 1 L 1 1 1 u 1 O 200 400 600 800 1000 1200 1400 CONCENTRATION (mM)

0 Ethanol - O Methanol * Propanol 1 1 . 1 1 1 I I I . 1 150 300 450 600 CONCENTRATION (mM) 85

smooth muscle tissue without affecting either diacylglycerol kinase or phospholipase A,

activity (Yang et ai.. 1991). U57,908 was able to inhiiit (85 * 5%, n = 6) ethanol-induced

contractions in the LM preparation (Fig. 3 -6,tracing A and lower panel). The same concentration of U57,908 did not signincantly inhibit ethanol-induced contractions in the

CM preparation (Fig. 3.6, tracing C and lower panel). The phospholipase A, inhibitor, mepacrine (3 pM), which was found previously to attenuate angiotensin-II induced contractions in the gastric preparations (Yang et al.. 1993) had no &ect on ethanol- induced contractions in either the LM or CM preparation (Fig. 3.6, tracings B and D).

3.2.5. Potentid roles of protein kinase C, phosphatidylinositol3-kinase and MAP- kinase kinase (MEK)

In the LM preparation, it was possible to monitor a reproducible contraction caused by the kinase C activator, phorbol dibutyate (PDB) (Fig. 3.7, tracing A). The kinase C anîagonist, chelerytiuine was not able to block PDB-induced contractions completely; therefore 1 tumed to the use of the kinase C antagonist GF109203X (GF) which at a concentration of 1 ph4 was able to abolish completely PDB-induced contractions (Fig. 3.7, tracing A). At this concentration of GF, contractions elicited by

EGF hthe LM preparation were attenuated (70 k 19% inhibition: n = 6), whereas contractions caused by ethanol were unaffected (Fig. 3.7, tracings B and C). The contractile responses in CM tissues induced either by TGF-a or ethanol were not affecteci by the treatment with GF (1 PM).

Apart fiom kinase C-mediateci signal pathways, PI 3-kinase and MAP kinase kinase (Mm) are believed to play some roles in the action of growth factors such as EGF Fig. 3.4 The role of extracûlular calcium.

Either Iongitudinai (A, upper) or circular (B,lower) muscle strips were first exposed to ethanol(170 mM) foiiowed by washing (W, arrow) and preincubation for 20 min in a dcium-fiee Krebs-Henseleit buffer containing 0.2 mM EGTA. Tissues were again chailenged with ethanoi, foiiowed by replenishing the bder with 2.5 mM CaC12 (+).

The sale for time and tension is shown to the right of tracing B. The data are representative of experiments done with 3 or more tissue strips taken fiom at least 2 different animals.

Fig. 3.5 The role of caicium influx in the contractile actions of ethanol and EGF in longitudiaai muscle strips efferts of nifcdipine and SKF96365.

Control contractile responses in individual tissue strips were first monitored in response to KCI (50 mM), EGF (17 nM) or ethanoi, followed by washing each tissue and preincubation for 20 min with either dedipine (1 pM, hatched bars) or with nifidipine (1

PM) wmbined with 30 pM Sm96365 (solid bar) followed by re-challenging the tissues to KCI, EGF and EtOH. Data represent observations with 6 to 10 individual tissue strips taken f?om three or more different animais. Contraction (Xcontrol) Fig. 3.6 Effkcts of inhibitors of phospholipase A, and diacylglycerol lipase on

ethanoLinduceci contractions in LM and CM tissue strips.

Upper: a controi response to ethanol (O,170 mM) was first monitored in either

LM (A, B: lefi-hand panel) or CM (C, D: right-hand panel) strips followed by washing and preincubation ofeach tissue for 20 min with either the diacylglycerol lipase inhibitor U57908 (LI, 20 pM: 4 C) or the phosphoiipase A2 inhibitor, mepacrine (MP .,3 pM: B, D). Tissues were again chdienged with ethanol in the continued presence of each inhiiitor. The tracings are representative of three or more experiments with individual tissue strips taken fiom 2 or more different animals, as summarized (Lower: ) by the histograms below the tracings, wherein the inhibitory action of Li57908 in the LM preparation is compared with the lack of inhibition in the CM. **: Student's t-test, p <

0.0 1. EtOH. 170mM

O EtOH. 170m Fig. 3.7 Differentid effcet of protein kinase C inhibitor on the contractile responses in LM tissue caused by EGF.

A control LM contractile response was nnt rnonitored for phorbol dibutyrate

(PDBu 0.1 pM: tracing A), EGF (O, 17 nM: tracing B) and ethanol (O, 170 m.:tracing

C) foilowed by a tissue wash (W, arrow). Al1 tissues were then pre-incubated for 20 min with kinase C inhibitor, GF109203X (GF r, 1 pM) and were re-chaüenged with PDBu

(v), EGF (@) and ethanol (O). The tracings are representative of experiments done with 6 independent tissue smps coming fiom two separate mimals. The scaie for time and tension is show to the right of tracing C. B 1- -1 a v 0 EGF, GF, 1pM 17nM

EtOH, 170mM 94 and insulin. It was obsed bat the contractiie action of EGF in the LM preparation was attenuated by the PI 3-kinase iniiiiitors wortmannin (40-120 nM) and LY294002 (2.5 pM); and by the MEK inhibitor (Dudley et a/.,1995) PD98059 (1 FM) (Fig. 3.8, tracings

B and D). In contrast, the* inhi'bitors did not affect contractions caused by ethano1 in the

LM preparation (Fig. 3.8, tracings A and C). In the CM preparation, neither the MEK inhibitor nor the PI 3-kinase inhiiitors b1ocked the contractile actions of either EGF or ethanol. At the concentrations indicated above, these inhibitors did not affect contractions caused by carbachol(1 pM) and KCl(50 mM) in either the LM or CM preparations.

3.2.6. Role of EGF receptor kinase activation in the contractile action of ethanol

Since ethanol, depending on its concentration had been show to stimulate or inhibit the kinase activity of the EGF receptor in A43 1 membranes (Thurston, Jr. &

Shukia, 1992), one possibiIity to be considered was that the contractile activity of ethanol in the gastnc preparations mi@ be due to tram-activation of the EGF receptor. To evaluate this possibiiity, it was possible to use a potent selective EGF receptor kinase inhibitor, PD153035 (Fry et ai.. 1994). This inhiiitor at 1 pM mmpletely abolished the contractile action of EGF in the LM and of TGF-a in the CM preparation, but had no effect on the contractile action of ethanol in these tissues (Fig. 3 -9).The effects of

PD153035, dong with the actions of aH of the agents used to probe the actions of ethanol and EGF in the LM and CM tissues are summarized in Table 3.1.

3.2.7. Tyrosine phosphatase and phosphotyrosyl proteins

In keeping with the ability of genistein and tyrphostin-47 to inhibit the contractile action of ethanol, the tyrosine phosphatase inhibitor, pervanadate (1 pM), Fig. 3.8 Effects of inhibitors of PI 3 kinase and MAP kinase kinase (MEK) on longitudinal strip contractions caused by EGF and ethanol.

Mer monitoring a control contractile response to either ethano1 (O, 170 mM: tracings A and C) or EGF (a,17 nM:tracings B and D), foiiowed by wasbing (W. arrows) the tissues were pre-incubateci for 20 min with either the PI 3-kinase inhibitor, wortmannin (WMN, *, O. 1 FM)or the MEK inhibitor, PD98059 (0, 1 pM) and were then re-challenged with either ethanol (tracings A and C) or EGF (tracings B and D). The sale for time and tension is shown to the right of tracing C. The tracings are representative of experhents done with 3 to 12 independent tissue strips. 1 1

A EtOH,0 ,/.WMN,#€ 0 r170mM 0.1~~

1- 1- * /' 1 B O a i"EGF, WMN, 17nM 0.1pM

O EtOH,

O EGF, Fig. 3.9 Cross-activation of the EGF meptor dors not account for ethanol-induceâ longitudinal muscle contractions.

Mer monitoring control contractions caused by either ethanol (O) or EGF (a)in the same tissue mip, the preparation was washed (W, arrow) and pre-incubated for 20 min with the EGF receptor kinase inhibitor, PD153035 (0,1 pM). The tissue was then challengeci again sequentially with EGF (a, 17 nM) and then ethanol (O, 170 mM). The tracing is representative of three independently conducted experiments. The scale for tirne and tension is show on the right.

100 which did not cause a contractile response on its own at this concentration, potentiated the contractile action of ethanol in the LM preparation (Fig. 3.10, upper tracing). The potentiation, which resulted in lebard shifl ofthe etltanol concentration-effect cwe, was most prominent at low ethanol concentrations (Fig. 3.10, lower panel); the mawnal contractile action of ethanol was not enhanced by pewanadate. To detemine ifthe contractile action of ethanol was accompanied by changes in the phosphotyrosyl protein content of the tissue, LM preparations were coiiected frorn the organ bath between 1 and

5 minutes &er exposure to either ethanol or EGF during the development of muscle tension and were extracteci for Western blot analysis. A mail, but reproduciile increase in tyrosine phosphorylation of a number of proteins was detected (constituents A to E, Fig.

3.1 1). The protein (s) for which tyrosine phosphorylation was increased appeared to differ for the EGF and ethanol-induced responses. For instance, bands 4 B. C,D and E were increased by treatment with EGF, but ody bands B, C and E appeared to be increased by ethanol. There was aiso a rnarked EGF-mediated increase for a constituent that barely entered the separating gel; ethano1 did not appear to increase the phosphorylation of this constituent. On other hanci, densitometry ofthe bands showed that there was an approxirnately 2.2-fold increase for constituent D for EGF, but no increase for ethano1

(Fig. 3.1 1). On the other han& both EGF and ethanol caused a reproducible increase in the tyrosine phosphorylation of constituent B (about 2.2-fold foi EGF; 15-fold by densitometry for ethanol: lanes 2 and 3: (Fig-3.1 1). EGF also caused an increase in the phosphoqlation (1.5-fold by densitometry) of a constituent (position 4 Fïg. 3.1 1) migrating at a region that might be anticipated for the EGF receptor (160-1 80 kDa). Fig. 3.10 Potentisition of ethnnol-inducd contractions in longitudinai muscle by pervanadate.

Upper: the responsiveness ofthe tissue to a comparatively low concentration of ethanol(o.34 mM) was 6rst monitored foiiowed by washing (W, arrow). mer re- equilibration, the tissue was first exposed to a non-contractile concentration of pervanadate (PV v, 1 CrM) foIlowed in 5 min by the addition of the previoudy monitored concentration of ethanol (O, 34 mM). Lower: the effect on the ethanol concentration- effect cuve caused by prior exposure of the tissue to 1 pMpervanadate as shown in the upper tracing was evaluated, as outiïned in the Iegend to Fig. 3.3, for preparations exposed to ethanol either in the absence (O) or presence (a)of 1 pM pewanadate. Data points represent the mean * S.E.M. (bars) for measurements done with 3 to 6 individual tissue strips. The scde for tirne and tension is shown beside the top tracing. *

Pervanadate-treated, significantly greater than control (p < 0.05). E tOH, PV, IpM 34mM

ETHANOL (m~) Fig. 3.11 The stimulation of protein tyrosine pbosphorylation by EGF and tthanol

in longitudinal mus& strîps

Tissues mounted in an organ bath as for a bioassay were either untreated (control) or were exposed for 1 min to either EGF (17 nM) or ethanol(2 70 mM). During the course of tension development, tissues were harvested, quick-fiozen and prepared for immunoabsorption and Western blot analysis as oufineci in Methods. Eqdamounts of protein extract were processed for each gel lane; the luminescent bands observed were elhinateci by preincubation of the antiphosphotyrosine antibody with 25 mM paranitrophenyl phosphate. Molecular mass (kD) marker positions are shown on the left; constituents (A to E), for which increased Iuminescence was observed for either EGF

(iane 2) or etlumoi-treated (lane 3) tissues, compared with controi tissues (Iane 2) are denoted (right) with a dot. The incrase in phosphorylation of a constituent that may represent the EGF receptor is observed at position A in lane 2. Migration towards the anode is indicated by the arrow.

IO5

3.2.8. Su-

The main finding in this section was that ethanol caused a contractile response in

guinea pig gastric longitudinal and circular muscle preparations that in many ways

reflected the contraction caused in these tissues by EGF. The responses inducd by

ethanol like those by EGF in both LM and CM tissues can be inhibited by tyrosine kinase

inhibitors such as genistein and tyrphostin, suggesting the involvement of tyrosine kinase

pathway in the ethano1 induced contraction That a tyrosine kinase pathway was involved

in the contractiie response causeci by ethanol was substantiated ftrther by two findïngs: 1) the potentiation of the ethanol response by pretreatment of tissue with a tyrosine phosphatase inhibitor pervanadate (1 p.M) at a concentration that done did not induce a contractile response; 2) the appearance ofincreased phosphotyrosine protein aerthe stimulation of the tissues with ethanol. Additionally, the ethanol response in the LM tissues was found, Iike the EGF response to be sensitive to the cyclooxygenase inhibitor indomethacin and the DAG lipase inhibitor U57908, which did not show any effèct on the contractile responses induced by either KCI or carbachol. In CM tissue, the ethanol response was less sensitive to tyrosine kinase infü'bitors than the responses in LM preparation. Lie EGF, the ethano1 induced contractiie response in CM tissue was resistant to indomethacin. However, a number of differences between the EGF and ethanol-induced responses were also observed (Table 3.1). Fustiy, EGF contraction was inhibited by a voltage operated calcium channel blocker, nifedipine (2 pM), in both LM and CM tissues. However, the contraction caused by ethanol was found to be inhibited by a receptor cdcium channei blocker SKF96365 in LM tissue, and was relatively insensitive 106

to nifedipine. Furthemore, the ethanol responses in both LM and CM tissues, wilike EGF

responses, were insensitive to protein kinase C inhibitor GF109203, the PI 3-kinase

inhibitors wortmannin and LY294002, and the MEK inhibitor PD98059.

3 -3. Contraction caused by thrombii receptor activating peptide

3-3.1. The contraction caused by TFUR-NH2(T,P5-NHJ and the effects of

tyrosine kinase inhibitors, indomethacin and inhi'bitors of nerve-released agonists

In guinea pig LM gastric tissue, the selective thrombin (PARI)receptor achvathg

peptide, TFLLR-NH2 (T,PS-NH3, was observed to induce a concentration- dependent

contractile response (Fig. 3.12). There was no desensitization for the T,PS-NH, induced

contraction after washing the tissue and replenishing the bder at 20 min intervals. The contractile &ect induced by 5 pM T,PS-NH, almost reaches the maximal response, which was substantially greater than the contractile response to 50 rnM KC1. The submaximai concentration of TlP5-NH, at 1 pMwas chosen for Merexperiments done to evaluate

signalling pathways. Although TIP5-NH, caused a contractile response in the LM preparation, unlike EGF or TGF-a,it did not induce any efféct in the CM preparation that was treated with the cyclooxygenase inhibitor, indomethacin. Like EGF,the contrade response in the LM preparation (Fig. 3.13, A and D), caused by T,PS-NH, was inhiiited both by indomethacin and by the tyrosine kinase inhibitors, tyrphostin 47 (AG213) (Fig.

3.13, B and E) and genistein. Since arachidonic acid can be seen'as an essential intermediate molecule for the indomethacin-sensitive contractile responses caused by both

EGF and TlP5-NH, the contractile effects induced by adding arachidonic acid (10 $4) to the organ bath was also studied. As expected, indomethacin aiso blocked the contraction Figo 3.12 Contractile action of T,P5-NE, peptide in grstrie LM tissues: concentration-effkct cuwe.

LM tissue preparations were triggered with different concentrations of T,PS-NH, peptide fiom 0.05 to 12 pM as shown on the X-axis. Each tissue was standardized by the reponse to 50 mM KCl. The contractile responses to T,P5-NH, peptide were expressed as a percentage ofthe response to 50 mM KCl in the same tissue preparation (Y-axk).

Tissues were exposed to increasing concentrations ofT,PS-NH, peptide, followed by washing and fiesh buffer replacement. Each data point represents the mean S.E.M.for 4 to 6 measurements made with individuai tissue stnps taken fiom 2 to 4 Werent anirnds. CONCENTRATION OF T 1 P5-NH2 (PM) Fig. 3.13 Eff'ts of the tyrosine kinase inhibitor tyrphostin 47/AG 213 (TP) and the

cyclo-oxygenase inhibitor indometbacin (LND) on contractik responses in phea pig

LM tissue.

The effects of indomethacin (IND, 3 pM, ) on the contractile responses causeci by T,PS-NH, (1 pM, ), EGF (17 nM, 0)and arachidonic acid (AA) (10 pM, t)are shown on the left side (tracings A, B and C). The nght panel shows the effis of TP (20

CLM, m) on the responses of T,PS-NE& peptide, EGF and arachido~cacid (tracings D, E and F). The treatment of the LM tissue with either IND (3 pM) or tyrphostin (TP) (20

ILh

TP or IND.W (Arrow) indicates the tissue wash and the replacement offiesh bder after each exposure. The sdefor time and tension is show in the nght lower corner of the figure. The data in each trachg are representative of experiments done with four to six individual tissue strips taken fiom 3 or more separate animais. E J O EGF,

F #% 111 of LM tissue caused by arachidonic acid, the presumed cyclwxygenase substrate (Fig-

3.13, tracing C); however, tyrphosth 47 (AG2 13) did not block the contraction causeci by the metabolites of arachidonic acid (Fig. 3-13, tracing F). nie epoxygenase inhibitor, ketoconazole (5 IiM) and the lipoxygenase inhibitor, nordihydroguaiaretic acid (30 pM) had no effects on the contractions caused by either T,PS-NI-& or arachidonic acid in the

LM preparation. The contractile actions of T,PS-NH,in the LM preparation were unaffected by 1 @f of each following agent: tetrodotoxin, atropine, prazosin and yohimbine. In the absence of extfaceIIuiar calcium, T,PS-NH, faiied to cause any contractile response in the LM preparation. However, the re-addition of calcium (W concentration: 2.5 mM) into the calcium-fiee buffer in the contïnued presmce of T,P5-

NH, resulted in a contraction (Fig 3.14, upper tracing). The contractile respoase induced by T,PS-NH, in the LM preparation was blocked by the inhibitor of the voltage-sensitive calcium charnel, nifeâipine (1 CiM) (Fig. 3.14, lower tracing), which also blocked the contractile responses caused by KCl and EGF (Fig. 3 -5).

3 -3-2. Effects of U57, 908 and mepacrine

The diacylglycerol lipase inhibitor, U57,908, which at 20 pM blocked the contractile response of EGF in LM preparation, was shown to inhibit speci6ically the

T,PS-Nb-induced contraction by 90% * 5% (n = 7) (Fig. 3.15). Both the EGF and

T,PS-NH, responses were not affected by the PLA2 inhibitor mepacrine (3 IiM). The response induced by arachidonic acid that was ïnhibited by indomethacin (Fig. 3.13, traclng C) was not affecteci by either U57,908 or mepacrine, which also did not inhibit the responses caused by carbachol(1 CIM) and KCI (50 mM). Fïg. 3.14 The dependence of the contrade respoase on extracdlulv caïcium.

The longitudinal muscle preparations were first exposed to T,PS-NH,peptide (1

@f, @) foilowed by washing (W, arrow) and resuspension in a calcium-fke Krebs-

Henseleit buffer containing 0.2 mM EGTA (upper tracing). The tissue was pre-incubated with calcium free buffer for about 20 min, followed by a challenge with same concentration of T,PS-NH, peptide. The replenishent of the b&er with 2.5 mM CaCl,

(f) reactivated the contractile response to T,PS-NH, peptide. In the lower trachg the tissue was pre-incubated with the voltage-dependent calcium charnel blocker nifedipine

(NF,1 IiM, Q) instead of calcium free baer for 20 min, foiiowed by the exposure of the tissue to T,P5-Wpeptide. The scde for tune and tension is show to the right of the lower tracing. The data are representative of expeximents done with 3 or more tissue smps taken fiom at least 2 different animals.

Fig. 3.15 Effects of the diacyigtycerol lipase inhibitor US7908 on EGF and T,P5-

NH,-induced contraction in LM tissue strips.

AI1 LM tissue strips were first exposed to KCI 50 mM to rnonitor the contractile

sensitivity of the tissues, foliowed by tissue washing. The responses to EGF and T,PS-NHS peptide were subsequentfy measured and recorded (empty bar). The second responses to

EGF and T,PS-NH, were obtained derthe pretreatrnent of each tissue with U57908 (20

FM)for 20 min (solid bar); these reponses were expressed as the percentage of the response before any trament (Y-axis). Data represent the mean S.E.M.(error bars) for measurements doue with 7 individual tissue strips for each experimentai group. **:

Student's t-test, p

3 -3-3. Potentid roles of protein kinase C, phosphatidyiinositol3-kinase and MAP- kinase kinase (MM)

In the LM preparation, it was observed îhat the EGF respowe was inhibiîed by treatment with the kinase C antagonist GF109203X (GF) at a concentration of 1 pM (90

5% inhibition: n = 8). This concentration of the kinase C inhibitor also attenuated the contrade response (56 * 7% n = 8) caused by T,PS-NH, In con- the contractile actions of arachidonic acid (10 pM), carbachol(1 CLM) and KCI (50 mM) were not affected by the sarne concentration of GF1 O9ZO3X (1 IiM) (Fig. 3.16).

The stimulation of a G protein coupled receptor has been reported to stimulate PI

3-kinase and MAP kinase pathways (Lopez-llasaca er al.. 1997) with or without the activation of protein kinase C. The contractile response caused by T,PS-NH, was explored by using both the PI 3-kinase inhibitors &Y294002 and wortmannin) and the MEK inhibitor (PD98059). The EGF induced contractile response in LM tissue was inhibited dose dependentiy by the pretreatment of the tissue with a PI 3-kinase inhibitor wortmannin

(Fig. 3.17). wortmannin at O. 1 pM, that inhibited more than 90% of the EGF response, was also observed to attenuate T,PS-NH, induced response (58 * 5% inhibition: n = 7).

Another PI 3-kinase inhibitor LY 294002 at 2.5 pM that like worimannin inhibited more than 90% of the EGF elicited contraction in LM tissue partiaîly attenuated the response induced by T,PS-NH, (5 7 * 7% inhibition; n = 7) (Fig. 3.1 8). ~0thwortmannin (0.1 pMJ and LY 294002 (2.5 pM) did not affect the contractile responses induced by KCl(50 mM), carbachol(1 IiM) and arachidonic acid (1 0 IiM) (Fig. 3.18, and Fig. 3.19, tracing D,

E and F). Fig. 3.16 Effects of the protein kinase C inhibitor GF109203X on the contractile responses of LM tissue.

LM tissue strips were first exposed to KCI (50 mM), carbacho1 (Cch, 1 pM), EGF

(17 nM), T,PS-Ni-&(1 eiM) and arachidonic acid (AA, 10 pM) (empty bars). The control responses were recorded, followed by a tissue wash and incubation of each tissue with I pM GF109203X for 20 min. The tissue responses to the same contractile agonists were subsequently recorded in the presence of 1 @f GFlO9203 (solid bar);' these responses were expressed as the percentage of the previous contraction observeci in the absence of inhibitor (Y-axis). Data represent the mean * S.E.M.(error bars) for measürements done with 7 individual tissue strips for each experimental group. Student's t-test, **: P<0.01. CONTRACTION (XCONTROL) Fig. 3.17 Effeet of wortmannin on the contrade response to EGF: concentration- eff~tcurve.

LM tissue dpswere first contracted with KCI 50 mM to test the tissue sensitMty, foliowed by a tissue wash. The stable contractile responses of the tissues to

EGF (17 nM, O), KCI (50 mM, a) and carbachol (Cch) (1 CiM, A) were obtained bdore they were incubated with the indicated concentrations of womnannin (20 min). The responses to EGF, KCl and carbachol at the same concentrations as the previous ones were then recorded in the presence of various concentration of wortmamh (fiom 10 nM to 120 nM) (X-axis). The responses in the presence of wortmannin were expressed as the percentage of the contractile responses in the absence of worunannin (Y-axis). Data points represent the mean * S.E.M. (error bars) for rneasurements done with 7 individuai tissue strips for each experimental group. CONTRACTION (XCONTROL] Fig. 3.18 Effects of inhibitors of PI 3 kinase on agonist induced contractions in the

longitudinai muscle prcparation

After monitoring the control contractile responses (empty bars) in LM tissues to

KCI (50 mM), carbachd (1 pM), EGF (1 7 nM), T,PS-NI2 (1 CtM) and arachidonic acid

(Aq 10 @VI)(shown on X-axis), followed by a tissue wash, the tissues were pre-

incubated for 20 min with the PI 3-kinase idi'bitors either wortmannin, WMN, solid bar,

0.I w; or LY294002, hatched bar, 2.5 pM. The contractile responses to various agonists

obtained in the presence of the PI 3-kinase inhiitors were standardized as the percentage

of the control responses (Y-axis). Data represent the mean S.E.M. (error bars) for measurements done with 7 individual tissue strips for each experimental group. Studem's t-test, **: p<0.01. CONTRACTION (XCONTROL) Fig. 3.19 Inhibition of contractile nsponscs by the MEK inhibitor, PD98059 and the

PI Skinase inhibitor, wortmannin (WM).

A control response in each tissue was monitored fint for each agonis: EGF (O,

O. 1 CM, tracings A and D), T,PS-NH, (O, 1 pM, tracings B and E) and carbachol (Cch,

A, 1 pM, tracings C and F). After a wash (W,arrows) the tissues were treated for 20 min with either PD98059 (m, 1 pM trachgs A-C)or wortmannin (WM v, 0.1 pM, tracings

D-F), and were then re-challengeci with each of the three contrade agonists. The scale for time and tension is shown between tracings A and B.

125

The MEK inhiiitor PD98059 at a concentration of 1 completely blocked the contrade responses caused by both EGF and T,PS-NH, whereas the actions of KCI, carbachol, and arachidonic acid were not aEécted (Fig. 3.19). This inhibition by PD98059 of both the EGF and T,P5-NH, induced responses was dosedependent (fiom 0.01 to 1 pM) 4than IC50 of O. 1-0.2 pM (Fig. 3.20).

3.3.4. Role ofthe EGF receptor kinase in the T,PS-NH, response

In previous work, it has been show that activation of G protein coupled receptors including the thrombin receptor can induce phosphorylation and transactivation of the

EGF receptor tyrosine kinase @aub et ai.. 1996). Since the response induced by T,PS-

NH, in the LM preparation was shown to parallel in rnany ways to the contractile reponse triggered by EGF, the possibility that thrombin receptor activation leads to a transactivation of EGF receptor in this systern was tested by using the EGF receptor antagonist PD 153035 (Fry et ai.. 1994). PD 153035 inhibited the EGF response dose- dependentiy with an ICSO of O.OS pM (Fig. 3.21). A concentration of PD153035 that completely blocked the response induced by EGF (1 IrM) did not afièct the contractile response caused by T,PS-M&(1 pM) in LM preparation (Fig. 3.21 and 3.22). The inhibition by PD153035 at 1 pM was not observed for the contractile responses hduced by KCl(S0 mM), carbachol(1 ILhl) and arachidonic acid (10 W.

3 -3.5. Potentiai role of c-Src kinase in T,PS-Nb-induced contractions

In addition to trans-activation of the EGF receptor as a possible mechanisrn leading to the contraction caused by T,P5-NH, the possibility that a non-receptor tyrosine kinase such as c-Src might be involved in the T,P5-N& was tested with c-Src kinase Fig. 3.20 Concentration-effect curvts for the MEK inbibitor, PD98059.

The gastric Iongitudinal muscle (LM) preparations were exposed to arachidonic acid (AA, 10 CiM, a), EGF (1 7 nM, O) and T, P5-NH, (1 pM, O) to obtain the controI responses, foiiowed by a tissue wash. The tissues were then pre-incubated with various concentrations of the MEK inhibitor, PD98059 (X-axis), for 20 min, &er which the responses to the same concentrations of A& EGF and TS were recorded and expressed as the percentage of the corresponding control responses (Y-axis). Data represent the mean

S.E.M.(error bars) for measurements done with 9 individual tissue strips for each concentration point. CONTRACTION (XCONTROU Fig. 3.21 Concentration-dependent efféct ofPD1 53035 on the contrrctiie response

The responses of longitudinal muscle (LM)preparations to EGF (17 nM, 0)and

T,PS-NH,(1 pM, a)were fkst obtained and recorded as the control. The tissues were washed and pre-incubated with various concentrations of PD15303 5 O(-ais), foliowed by exposure to the same concentrations of EGF and T,PS-NH,. The contractile responses obtained in the presence of PD 153035 were expressed as the percentage of the control response observeci in the absence of this inhibitor (Y-axis). Data represent the mean

S .E.M. (error bars) for measurements done with 8 individual tissue strips for each concentration point. CONTRACTION (XCONTROL) Fig. 3.22 Lack of efftct of the EGF kinase inhibitor, PD153035 on contraction caused by thrombin receptor activation.

A control response to either EGF (O,0-1 pM, lower tracing) or T,PS-NH,(a, 1

PM, upper tracing) was monitored, foiiowed by a tissue wash (W, arrows). Tissues were then pre-treated for 20 min with the EGF-kinase inhibitor, PD153035 (II,1 CrM) and were re-challenged with the same agonists. The scaie for time and tension is shown between the two tracings. O EGF, 17nM 132 selective inhibitors, CPll8,SS6 (PP 1) and PD89828. CP 1 18,556 was found to concentration-dependentiy inhibit both EGF (17 nM) and T,PS-NH, (1 1iM)inducd responses with an ICSO of0.05-0.06 pM (Fig. 3.23). Both contractile responses elicited by EGF and T,PS-NH, were completely blocked at 1 pM ofCP 1 18,s 56, which at this concentration did not affect the contractions caused by arachidonic acid (10 IiM), KCL (50 mM), carbachol(1 pM) (Fig. 3-23, Fig 3-24). Additionally, both contractile responses induced by EGF and T,P5-NH, were inhibiteci concentration-dependentiyby PD89828 with an ICSO of 0.1-0.1 1 (Fig. 3 -25). Like CP 1 18,556 (Fig. 3-24), PD89828 at 1 pM completely blocked the contractile responses caused by both EGF and T,PS-NH, without afEecting responses causeci by KCI (50 mM) and carbachol(1 $4) and arachidonic acid

(10 pM) (Fïg. 3.25).

3 -3-6. Summary

The main finding in this section was that the G protein coupled thrombin receptor agonis T,PS-NH2 could induce a contractile response in guinea pig LM preparation via a signalling pathway similar to that for EGF. The effects of CP 11 8,s 56 and PD 1 53035 suggested the involvement of a presumed non-receptor tyrosine kinase. Both the EGF and

T,PS-NI&-induced responses were sensitive not only to the voltage-operateci Ca2* channel blocker nifedipine, cyclo-oxygenase inbitor indomethach, and DAG lipase inhibitor

U57,908, but dso to the MEK inhibitor PD98059, the protein kinase C inhibitor

GF109203X, the PI 3-kinase inhibitors wortmannin and LY294002, and the Src fdy kinase inhibitors, CP 11 8.556 and PD89828 (Table 3 -2).nie contractile response induced by T,PS-MI, was not affecteci by the EGF receptor tyrosine kinase inhibitor PD1 53035, 133 which seIhve1y inhibiteci the EGF response in the LM tissue. Unlike EGF, T,PS-W& did not induce any contractile response in the CM preparations in the presence of indomethach, a cyclo-oxygenase inhiiitor. The activation of both G protein couplai receptor such as thrombin receptor and tyrosine kinase receptor such as EGF receptor appeared to induce a contractile response in guinea pig LM tissue via a camrnon signahg pathway. Fige 3.23 Concentration-effat curve for CP118,556, a Sre-famüy kinase inhibitor, on the contractile nsponses of LM tissue.

The contractile responses induced by EGF (1 7 nM, O), T,PS-NH, (1 PM, a)and arachidonic acid (h4, 10 IiM, i)in gasmc longitudinal muscle preparations were first recorded, and the tissues were washed, foiiowed by the pre-incubation with various concentrations of CP 1 18.556 (X-axis). The contractions in the presence of CP ll8,SS6 were recorded in response to the same concentrations of agonists and were expressed as the percentage of the control respDnses (Y-axis). Data represent the mean S.E.M. (error bars) for measurements done with 7 individuai tissue strips for each concentration of

CP 1 18,556.. CONTRACTION (XCONTROL) Fig. 3.24 Inhibition of contractiîe responses by the Sm-famüy kinase inhibitor,

CP1 l8,SS.

Mermonitoring a control contractile response to EGF (O, 0.1 IiM, trachg A),

T,PS-NH, (m. 1 pM, tracing B) or wbachol (Cch, A, 1 pM, tracing C)folowed by a wash (arrow, W), tissues were pre-treated for 20 min with 1 pM CP 1 18,556 (O), and were then re-challenged with the same agonists. The scaie for time and tension is shown in tracing C. O EGF; 17n'~

A Cch, WM Fig. 3.25 Concentration-effect cuwe for the tyrosine kinase inhibitor, PD89828 on the contractiie responses of LM tissue.

The longitudinal muscle preparabons were exposed to the contractile agonists

EGF (17 nM. O), T,PS-NH, (1 a) and arachidonic acid (AA, 10 ~LM,i) to obtain the wntrol responses, followed by a tissue wash and the pre-incubation of each tissue with various concentrations ofPD89828 (X-axis). The contractile responses induced by EGF,

AA and T,P5-NH, in the presence ofCPlI8.556 were recorded and were expressed as the percentage of the control responses (Y-axis). Data represent the mean * S.E.M. (error bars) for measurements done with 7 individuai tissue strips for each concentration of

PD89828. CONTRACTION (XCONTROL) Tabk 3.2 Signnlling pathways shad by both EGF and thrombin receptor activatin eptide in the contractile rrs oase of LM re arations. 1- SIGNALLING EGF T,PSNH, Arachidonate (10 PROBES @M) (17 nm) (1 pM) Indomethacia (3) Block Block Block TP47/AG2 13 (20) 1 Block 1 Block ( O CP1l8,556/PP1(1) 1 Block 1 Block 1 O PD89 828 (1) 1 Block 1 Block 1 O 1 Block 1 Block 1 Wortmanin (0.1) 1 ~lock 1 ~lock 1 O LY294002 (2.5) 1 Block 1 Block 1 O 1 Block 1 Block 7 NKedipine (1) Block Block N.D- Ca2+-freebuKer 1 Biock 1 Block 1 ND. - 1 Block: the treatment of the tissue with a signahg probe inhibited the contractile responses induced by any agonist; 0:the response induced by a agonist was not affecteci by the treatment of a inhibitor for sorne specific signalling molecule. ND.: il not done. 141

CHAPTER FOUR. TYROSINE KINASE PATHWAYS AND iNOS INDUCTION

IN SMOOTH MUSCLE PREPARATIONS

4.1. Introduction

A preliminary working hypothesis for the studies descriied in this thesis was that smooth mude function might be changeci afkr the treatment for some the of smooth muscle tissues such as rat aorta with various hormones or growth Gctors in vitro by using an organ culture system. Prelimuiary resdts showed that, compared with fksh rat aorta preparations, the rat aorta rings &er being cultured at 37°C for 48 h, even without any treatment, demonstrateci an attenuated contractile response to KCl(50 mM) and phenylephrine (1 jM). The attenuation of the response could be reverseci by the pretreatment of the tissue with the nitric oade synthase inhiiitor L-nitroarginine methyl ester (L-NAME), Subsequently, the attenuated contractile responses to various agoaists were also noticed for the tissues &er a prolonged incubation (up to 10 h) in an organ bath without the requirement for prolonged (24-48 h) organ culhire. The loss of tension of the tissue induced dunng the organ bath incubation, iike that in the cultured tissues, codd be blocked by L-NAME. Therefore, the spontaneous induction of nitric oxide synthase in the smooth muscle was proposed to participate in smooth muscle functional regdation during a short term incubation in the organ bath. It was ftrther hypothesized that tyrosine kinase pathways rnight be involved in the induction of the iNOS gene. At the tirne the studies described in this thesis were started, the signal transduction pathways reguiating BOS induction had not been characterized in an intact smooth muscle tissue, although a tyrosine kinase pathway was proposed to play an important roie in iNOS gene transcription in 142

various cultured ce11 systems (see Section 1.4.5.5. Tyrosine kinase pathway and %OS

induction) (Eason & Martin, 1995; Paul et al,,1995; Dong el ai., 1993; Tetsuka &

Momson, 1995; ûmg et ai.. 1995; Cocbett et al., 1996; Simrnons & Murphy, 1994;

Feinsîein er al,. 1994). The induction ofan induciile form of nitric oxide symbase (NOS)

in the intact rat aorta tissue during organ bath saidies had been documenteci with various

pharmacological tools such as NOS inhibitors by sorne laboratories (Jovanovic et al,,

1994; Moritoki et al., 1992; Schott et al., 1993; Goid et aL, 1990). Howwer, the presence of an induciile NOS in rat gastnc smooth muscle preparations such as LM and

CM tissues was still unknown at that the. Since the induction of NOS in blood vessel smooth muscle during sepsis or endotoxic shock tias been found to play a crucial role in the development of hypotension (Szabo. 1995; Payen ez al.. 1996; Wong & Biliiar, 1995), through the production of an excess of NO to relax blood vessel smooth muscle, it was hypothesized that the presence of XOS in gastric smooth muscle preparations would undoubtedly contribute to the pathophysiology of gastrointestinal t'unction. The NOS is thought to be constitutively active after its induction in contrast to the endothelid NOS that is constitutively present, but is regulated by an elevation of intraceiiu1a.r calcium via a complex of Ca2+lCaM.in the case of the induced iNOS, it cm be suggested that the production of NO could be dependent on the ambient concentration of the precursor substrate L-arginhe (ER). At the outset of my studies, it was su@ected that the stores of

L-arginine in tissues maintaineci for a prolongeci period in an organ bath might be depleted, since the arginase responsible for LR synthesis has been shown to be present specifically in certain tissues (Morris,1992; Dhanakoti et al.. 1990; Levillain el al.. 1990; Pastor et al., 143

1995). Since the LR transporter y* system in rat aorta smooth muscle has been reported to be CO-inducedwith NOS in response to some cytokines (Hatada et al., 1993), and since iî was suspecteci that LR stores rnight be depleted in the organ bath, it was tberefore hypothesized that the addition of LR to an organ bath in which the BOS "induced"rat aorta ring had been precontracted with a contractile agonis&such as phenylephrine, might cause a relaxation response through an increased synthesis of NO via NOS. Indeed, prebaryexperirnents showed that LR could cause a rapid relaxation when added to the organ bath at the plateau of a phenylephrine-induced contractile response. At that time, the contractile agonists (phenylephrine/PE or carbachoVCch) were still able to cause a sustained contraction prior to the addition of LR It therefore appeared that the relaxation induced by the addition of LR could be used as a pharmacological tool to monitor NOS induction in the smooth muscle preparation. It was surprishg to fhd nonetheless that although in preliminary work the LR relaxation assay suggestd an induction of NOS in the rat aorta ring and in the gastric circular muscle (CM) preparation, no such induction

(absence of LR-induced relaxation) appeared to occur &et prolonged incubation ofthe gastnc longitudinal muscle (LM).

A tyrosine hase pathway has been documented to play a role in the induction of

NOS in some ceil systems (see Section 1.4.5 S.), in response to the stimulation by cytokines such as IL-1 P. As outlined in the Introduction sectio~--NF43has been characterized to play a major role in NOS induction. Therefore, the induction of NOS mediated via NF-@ activation probably involves a signalIing mechanism that, in part, employs a tyrosine hase. In view of one of the working hypotheses in this thesis that the 144 tyrosine kinase pathways play an important role in reguiating smooth muscle hctions. it was of interest to evaiuate a potential role for a tyrosine kinase pathway in the induction of NOS in the RA and CM gastnc srnooth muscle preparations.

in view of the preliminq work described above, the main objectives for the work desaibed in this chapter were therefore: 1) to characterize pharmacologically the induction of NOS in both the rat aorta and gastnc tissue preparations; 2) to monitor the induction process biochernically, using a reverse-transcriptasdpolymerase chah rdon

(RT-PCR) approach; 3) to monitor the induction of NOS in aorfa and gastric tissue with irnmunohistochernid approaches; 4) to test the potential roles of tyrosine kinase pathways in iNOS induction in both gasmc and aorta tissues; and 5) to explore other mechanisms for SIOS induction in rat aorta tissue compared with that in gastric preparations.

4.2. Methods

The generai methodologies have been outlined in Chapter 2. Those procedures specific for the studies described in this Chapter are outlined in the following sections.

4.2.1. Characterization of NOS induction using the LR relaxation assay

For the LR relaxation assay, LR (final concentration, 1 mM)was added to the organ bath to monitor the loss of tension by using force transducers and recorders. nie tissue was first precontracted with either phenylephrïne (1 pM) or carbachol(1 jM) during the LR relaxation assay. At the plateau of the contractile responses in either the rat aorta (with or without intact endothelium) or gastnc smooth muscle (LM or CM) preparations, LR (1 mM) was added, and the relaxation response was recorde4 followed by washing three times and replacing with fiesh bdk.The iNOS inhibitor arninoguanidine (1 mM) or the inhibitor for guanylyl cycIase LYS3583 (20 CLM) were added to the tissue bath 20 min prior to triggering with the contractile agonists and then adding LR to monitor the relaxation responses. To harvest tissue for RT/PCR analysis and immunohistochemistry, tissues were incubated for tinied intervais and were then harvested either for preparation of tissue RNA or for fixation and section@ prior to immunohistochernical dysis. The details of the RTiPCR nucleotide sequencing and immunohistochemistry procedures are described in Chapter 2.

4.3. Results

4.3.1. L-arginine induced relaxation as an index of NOS induction

The L-arguiine (LR)relaxation assay (Fig. 4.1) took advantage of the fact that after incubation in the organ bath there appears to be an insufiicient store of LR, the substrate for NOS in the tissue, to cause nitric oxide (NO) production and relaxation even when NOS is induced after a prolongeci incubation of the tissue. Thus, the addition of exogenous LR metabolized to NO by iNOS, when induced, resulted in a relaxation response. In the fresh rat aorta tissues precontracted with phenylephrine (1 pM), the addition of LR (1 mM) did not cause any relaxation in either endothehum intact (Fig. 4.1, tracing A) or endotheiium fiee (Fig. 4.1, tracing B) preparations. The presence of an intact endotheliwn in rat aorta rings was assesseci by the addition of wkh acetylcholine (1 pM), which caused a relaxation response (about 80% relaxation compareci with the contractile response induced by 1 pM phenylephrine, Fig. 4.1, tracing A). Afier the initial test of each tissue, recording a relaxation response to acetylchohne (endotheiium intact), but not to Fig. 4.1 Induction of Larginine relaxation in rat aorta preparations.

Rat aortic rings with (tracing A) and without (tracing B) an intact endothehm were incubated in an organ bath at 37°C. Both sets of rings were precontracted with phenylephrine (PE,1 pM, 0 ) and were then chdenged with 1 mML-arginine (LR, 0)or

1 phd acetylchohe (Ach, v), followed by washing the tissues (W, arrows) and repIacing the buffer. The presence of endotheiium was ascertaineci by showing a rapid relaxation response upon the addition of Ach (1 plbf) in the tissue precontracted with PE (1 CLM)

(tracing A). LR faiied to cause any relaxation in tiesh tissues with or without an intact endotheiium or (tracings A and B). Mer a 5 h incubation in the organ bath at 3 TC, LR induced a relaxation response in the PE precontracted rat aorta preparations either with or without an intact endothelium. The tracings are representative of 8 to 10 experiments independently conducted with tissues fiom 6 difFerent animals. The desfor time and tension are shown between tracing A and B.

148

1 m.LR the tissue was washed four times to remove the reagents fiom organ bath,

followed by a 5 h incubation of the tissue at 37 OC in the organ bath. Mer 5 h of tissue

incubation, the addition of LR (1 mM) was show to cause a rapid relaxation response

after incubation of either endothelium fiee (Fig. 4.1, trachg B; no initial relaxation by 1

@lacetylcholiw) or endotheliurn intact (Fig. 4.1, tracing A) aorta preparations. This

relaxation in the aorta tissue induced by the addition of 1 mM LR was time-dependent,

appearuig clearly &er about 3 h incubation and reached a maximal response &er 5 h-

Using the sarne assay for the rat aorta preparations, both rat gastric LM and CM

preparations were tested for the induction ofLR relaxation. The addition of 1 mM LR to the organ bath in which the LM and CM tissues were precontracted with carbachol(1

pM) did not cause any relaxation response in the fiesh LM and CM tissue preparations.

However, the addition of LR (1 rnM) caused a relaxation response in CM preparations

after about 5 h incubation in the organ bath (Fig. 4.2, upper trachg). In coatrast, a relaxation response upon addition of LR (1 mM) to the organ bath was not observed with

LM tissue despite its relaxation response to treatment with the NO donor sodium nitroprusside (SM,O. 1 pM, Fig. 4.2, lower ûacing). In the CM preparation, an LR- induced relaxation became apparent after approximately 2 h of incubation in the organ bath and appeared to be maximal at about 4-5 h of incubation (Fig. 4.2, upper tracing and

Fig. 4.3, also see Fig. 4.6). Since the relaxation dfect by LR wai only observed in CM tissues (but not in the LM) precontracted by either carbachol (Cch) ( 1 pM) or phenylephrine (PE)(1 PM), it appeared that there was an induction of INOS in the CM 149 but not in the LM preparation. For this reason, aii fùrther studies were focused on the CM preparation, compareci with the rat aorta ring preparation.

4.3.2. Miibition of L-argïnine-indu4 relaxation by arninoguanidine and LY83 583

In both endothelium-fk aorta ring (Fig. 4.4, tracing A) and CM preparations (Fig.

4.4, tracing B) that had been incubated in the organ bath for 4-5 h, LR caused reproduçible reiaxation responses (Fig. 4.4) that were attenuated by the STOS inhibitor, aminoguanidine (AG); the tissues were, nonetheless stiU sensitive to the relaxant actions of sodium nitroprusside (SNP) in the continued presence of AG (Fig. 4, ri& portion). Both the relaxation responses to LR in rat aorta and CM preparations were unaitered in the presence of 1 pM tetrodoto* which would be expected to inhiiit a neme-mediateû relaxation effct. Since the NO produced in response to the addition of LR would be expected to cause its relaxant efFect via the stimulation of soluble guanylyl cyclase, the ability of the guanylyl cyclase inhibitor, LY83583, to affect the L-arginine induced relaxation responses in both rat aorta and CM tissues was evaluated, as show in trachg C

(rat aorta) and D (rat CM) of Fig. 4.4. LY83583 completely blocked LR-induced relaxation responses in these two different tissues that had been pre-incubated in the organ bath for 4-5 h. The experiment also showed that LYS3583 inhibited the relaxant responses to the NO donor, sodium nitroprusside (SNP)(right-hand position of tracing C and D,

- Fig. 4.4).

4.3.3. The induction of SOS mRNA

To dehe further the iNOS induction suggested by the finding of fiuictionaI BOS induction in rat aorta tissue and gastric CM preparation through using the LR relaxation Fig. 4.2 Larginine (LR) responses in the gastric circular (CM) and longitudinai

muscle preparations

The CM (top tracings) and LM (lower tracings) preparations were precontracted with 1 pM carbachol (Cc4. ) and were then exposed to 1 mM L-arginine (LR,0 ), foîiowed by washing the tissue (W, arrows) and replacing the buffer. The response to LR was monitored both before (lefi-hand tracings) and after (right-hand tracings) a 5h incubation period at 37°C.The LM tissue, whkh unlike the CM tissue did not relax upon the addition of LR, did nonetheless relax in response to the NO donor, sodium nitroprusside (SNP 0.01 pM, * ). The tracings are representative of 8 to 10 independently conducted experiments done with tissues denved fiom 5 different animals. The seale for time and tension is shown beside the top tracings.

Fig. 4.3 Time-dependent Larginine (LR)-induccd relaxation in the CM preparation

CM preparations were incubateci in the organ bath at 37°C for a prolongeci time period. At houriy intervals, tissues were precontracted with 1 pM phenylephrine and a relaxation in response to the addition of 1 mM L-arginine was monitored. The relaxation response was expressed as the percentage (%) relaxation relative to the maximum tension developed in response to FE in each tissue [O?=100x(maximum tension-tension in the presence of LR)maxïmm tension]. Values at each time point represent the averaget

S.E.M.(bar) for results obtained with 5 or more independently conducted experirnents using 10 to 15 tissues deiveci kom 5 or more different animals. LR relaxation (%Contraction) Fig. 4.4 Effeck of the iNOS inbibitor, aminoguanidine (AG)(Id portion) and the

guaoylyl cydase inbibitor, LYS3583 &Y) (right portion) on Larginine &Rb

induced relaxation in the rat aorlri witbout endothelium (-endo) and rat gastric CM

(RGCM) preparations

Mer a 5 h incubation at 37°C in the organ bath, the tissues were precontracted

with 1 pM phenyIephrïne (O ) and a relaxation in response to the addition of 1 mM L-

arginine CR,U ) was monitored, fbllowed by washing the tissues and replacing the biiffer

(arrow, //), A relaxant respoase in a PE precontracted tissue due to the addition of the NO

donor, sodium nitroprusside (SNP 0.0 1 CLM, +# ) was also measured. The abiiity of 1 mM

aminoguanidine (AG, A ) to bIock the relaxation caused by LR but not by SNP is show

in either the rat aorta (tracing A on left portion) or RGCM preparation (tracing B). The

ri&-hand set of tracings C (aorta) and D (RGCM) shows the ability of 20 pM LY83 583

(A ) to abolish relaxation caused by both LR and SNP.Each set of tracings showing the

&is of AG and LY83583, illustrates the response of a single tissue strip of either rat aorta or CM tissue. The data are representative of 8 to ten independently conducteci experiments with tissue preparations derived fiom 4 or 5 different animals. The sale for tirne and tension is shown to the tight of the right set oftracings.

156

assay, an RT-PCR approach was used with a pair of primers designed fkom the NOS

cDNA sequence ofnit aorta smooth muscle. RT-PCR was first used to detea the

induction of MAin rat aorta tissue after a prolonged incubation in organ bath, as

described for the LR relaxation assay. Rat aorta tissues with and without incubation for 5

h were processed for total RNA isolation foiiowed by the ktcDNA strand synthesis with

reverse-transcriptase. Using PCR amplification with primers targeted both to NOS aiid to

actin (as control) it was fomd that there was an appearance of NOS signal with an

expected fiagrnent size of 578 bp fiom the induced aorta tissue (verified by the LR

relaxation assay), but not fiom the fiesh tissue (Fig. 4.5). Furthemore, CM tissue

preparations for RT-PCR were incubated as for the bioassay measwements, and the

appearance with theof an L-arginine induced relaxation was also monitored (Fig. 4.6).

At the times indicated, the CM tissue preparations were withdrawn fiom the organ bath

and rapidly processed for RT-PCR,as for the rat aorta tissue. As shown in Fig. 4.6, the

time course of the appearance of the 578 bp PCR product, corresponding to NOS

detected in the induced rat aorta tissue, was pafaUe1 to the relaxation responses caused by

L-arginine (1 mM) in phenylephruie (1 IiM) precontracted CM preparations. The NOS

(PCR) signal was clearly increased over the 4 h time period, relative to the control of the actin signals which were comparable in ail samples tested.

4.3.4. Cloning and sequencing of the SlOS PCR fhgm&t

The primers for the PCR amplification of iNOS mRNA fiom rat gastric CM tissue were designed to target a 578 bp fiagment fiom the rat aorta smooth muscle SIOS cDNA sequence (Nunokawa et al.. 1993) (Fig. 4.7). The PCR fiagrnent fiom rat gastric Fig. 4.5 The induction of iNOS mRNA in rat aorta tissue.

Mer the detection of L.R-induced reiaxation in rat aorta tissue incubated in the organ bath at 37°C for 5 h, the tissues were processed for RT-PCR analysis with the primers deriveci fiom the pubiished NOS cDNA nucleotide sequence to amplifil a fiagrnent of 578 bp. The appearance of BOS messenger (578 bp) relative to the actin signai (243 bp) is shown in the upper panel after a 5 h incubation, compared with the control (fiesh tissue). The l& arrows indicate the positions of the actin and NOS PCR products; the positions of standard markers (bp) are shown to the right of each gel.

Fig. 4.6 Comlation of the deveiopment of an L-arginine (LR)-induced relaxation

(lower panel) nith the appurpnce of NOS mRNA (upper panels).

Replicate CM tissue preparations were incubated at 37°C in the organ bath for the times indicated (O to 4 h). At hourly intervals, the ability of L-arginine (LR, 1 mM, ) to cause a relaxation in a phenylephrùie (PE, 1 pM, 0 ) precontracted tissue was monitored, followed by a tissue wash (W. arrows, II).At the indicated times, replicate tissues were also harveaed for the preparation of RNA, which was then andyzed by RT-PCR ushg primer pairs targeted to either acth or SIOS. The PCR products were separated by agarose gel electrophoresis (top panel). The top left arrows indicate the positions of the a& and NOS PCR products; the positions of standard markers @p) are showto the right of each gel. The sale for time and tension is shown to the right of the contractile tracings (lower right). - 700 iNOS+ -500

- 300 Actin + - 200 Fig. 4.7 Nucleotide sequence of the PCR fragment amplificd from gastric CM tissue. S1..GACATGGCTTGCCCCTGGAAGTTTCTCTTCAGAGTCMTCCTACCMWT GACCTGAAAGAGGAAAAGGACATTAACAACAACGTGGAGAAAACCCCAGGTG CTATT'CCCAGCCCAACAACACAGGATGACCCTAAGAGTCACAAGCATCMAAT

GGmCCCCAGTTCCTCACTGGGACTGCACAGAATGTTCCAGAATCCCTGGA CAAGCTGTATGTGACTCCATCGACCCGCCCACAGCACGTGAGGATCAAA4ACT GGGGCAATGGAGAGATTTTTCACGACACCCTTCACCACAAGGCCACCTCGGAT ATCTCTTGC AAGTCC AAATTATGCATCAT GACCAGAGGACCCAGAGACAAGCCCACCCCAGTGGAGGAGCTTCTGCCTCAA GCCATTGMnCAnAACCAGTATTATGGCTCCTTCAAAGAGGCAAAAATAGA GGAACATCTGGCCAGGCTGGAAGCCGT AACAAAGGAAATAGMCMCAWA ACCTACCAGCTCACTCTGGATGAGCTCATCTTTGCCACCAAGATGGCCTGGAG-

... 3' 163

"induceci"CM tissue was cut out fiom the agarose gel and purifie& followed by clonhg

into the T7 vector for sequencing. The nucleotide sequence and the size of the Went

were demonstrated to be identicai with that in rat aorta NOS cDNA (Fig- 4.7).

4.3.5. Locaiization of NOS in gastric tissue

Pharmacologicai characterization and RT-PCR anaiysis together with the

sequencing of the PCR hgment indicated that the induction of BOS in rat aorta smooth

muscle ceUs occurred spontaneously during a prolonged period of incubation in the organ bath, and that the NOS appeared to be hduced only in the gasmc CM tissue, but not in the LM preparation. Since the induaion and location of NOS in rat gastric smooth muscle preparations had not been identified at that the, unlike the iNOS in rat aorta tissue that had been welI characterized in the smooth muscle cells, the fbrther localization of NOS in rat gamic CM tissue was determined by using an irnrnunohistochemical approach employing SIOS directed antibodies. Because bNOS is present in non-adrenergic non- cholinergie (NANC)nerve endings and is known to participate in the fiinctional regdation of the rat gastrointestinal tract via releasing NO (Nkhols et al.. 1993), the presence of bNOS was also analyzed in the tissues before and after incubation in the organ bath. As expected, bNOS was detected, using bNOS targeted antibody (Fig. 4.8, panel A) without any differentid staining between the fkesh tissue preparations (panel 4 Fig. 4.8) and the

"induced"CM tissues that had been incubated for 5 h in the orgin bath (labeiing was comparable to panel A ofFig. 4.8). In contrast, there was no stainïng for iNOS observed in the fresh tissue preparations with anti-NOS antibody (panel B, Fig. 4.8). However, afler pre-incubation of the CM tissue in the organ bath, it was reproduciily observed that 164

there was a prominent appearance of immunoreactivity which, surpriçingiy, was found not

in the smooth muscle elements, but in a subset of cells that were underneath the gastric

mucosa and closely apposed to the CM elements (nght panel of Fig. 4.8). Since the

presence of macrophage-like cells with some unidentifieci fiinctions have been reported in

the submucod iayer of mouse smaii intestine, it was hypothesized that the celis containing

positive NOS immunoceactivity might be the macrophage-like celis descnied in mouse

intestinal tissue. For this reason, the double-staining of induced rat gasaic CM tissues with

both anti-macrophage anti'body (ED2) (Dijkstra et al.. 1985) and NOS antibody was done

to detect the correlation of iNOS and macrophage-related celis. As shown in Fig. 4.9, the immunoreactivities of both iNOS antiiody and the ad-macrophage antiiody stainings were detected in the same ceLi population.

4.4. Effects of actinomycin D and cycloheximide on iNOS induction

Mer the induction of ïNOS was characterized pharmacologically and moledar biologically as well as immunohistochernicaliy in the smooth muscle tissue, expiments were done to determine if the induction occurred at the level of transcription or traaslation

(or both). Treatment of the tissue during the time period required for iNOS induction in the organ bath with the transcription inhibitor actinomycin D (1 pkf) W~Sshown to abolish the relaxation responses induced by the addition of LR (1 rnM) in both rat aorta rings

(without endothelium) (tracing A and B, Fig. 4.10) and rat CM preparations (tracing E and F, Fig. 4.10). Induction was stiii observeci in the control tissue maintaineci in the absence of actinomycin D (tracing A and E of Fig. 4.10). It was also found (Fig. 4.1 1) using RT-PCRwith the NOS primer pairs (targeting a 578 bp product) and a& primer Fig. 4.8 Immunobistochtmicd detection of iNOS and bNOS.

Either fieshiy dissected CM tissue (iefi-hand and middle panels) or tissues that had been "induced" by incubation in the organ bath at 37OC for 5 h (ight-hand panel) were ked and processed for immunohistochernicai detection of NOS and bNOS. The lefi-hand panel @NOS) is representative of either fiesh or "induced" tissue that was shedwith anti-bNOS antibody. The middle panel (ïNOS-F) shows fiesh tissue stained with anti-

NOS antibody; the right-hand panel shows the "induced" CM tissue stained with the sarne anti-INOS ant~bdy.The panels are representative of four independently conducted experiments with tissues fiom dEerent animals.

Fig. 4.9 Co-localhation of iNOSpositive immuaoructivity with macrophage-nlated ceHs in "induced" CM tissue

CM tissue preparations were "induced"by încubation for 5 h at 37°C in the organ bath and sections were then processed for double labeling immunohistochemistry using both the anti-BOS anabody (upper panel) and the macrophage specinc ED2 antibody

(iower panel). The pattern of fluorescence labeling was virtudy superimposable (compare the upper and lower staining patterns). The panels are representative of the three independently conducted experùnents.

Fig. 4.10 Enects of actinomycin D (ACTD)and cydoheximide (CHX)on the induction of Larginine (LR) mcdiated etionin both rat aor& without eodotbelium (left) and rat gastric CM (RGCM) (right).

Neither fiesh aorta tissue nor fiesh gastric CM relaxecl in response to the addition of i mM LR after being precontracted by 1 ph4 phenytephfine (PE,0 ). Both in rat aorta tissue (tracing A) and in rat gastric CM tissue (tracing E), 1 mM LR (0) induced a relaxation response &er a 5 h incubation at 37°C in the organ bath. The incubation of rat aorta tissue (tracing B) and the rat gastric CM preparation with 1 gii4 ACTD, a transcription inhibitor, abolished the relaxation responses induced by LR (1 mM). The cyclohexirnide (CHX,20 pM) treated rat aorta (tracing D) and CM (tracing H) tissues failed to relax upon the addition of 1 mM LR to the organ bath, even &er a 5 h of incubation, compared with those tissues incubated without CEOC (trachg C and G).W and arrow: tissue wash. The tracings are representative of 7 ta 9 independentiy conducted experiments with the tissues derived hm5 Werent anirnals. The scaies for tirne and tension are shown in the right lower corners of two sets oftracings. RAI-EC RGCM

ACTD, 'PM

5h, CHX, OCiM Fig. 4.11 Effects of actinomycin D (ACTD)and cydohesîmide (CHX)on the induction of NOS mRNA,

Both rat aorta and CM tissues were prepared as describeci in Fig. 4.10. Mer 5 h incubation, when a relaxant response to 1 rnM LR was detecteâ, tissues were harvested for RTPCR analysis with primers targeted to NOS (upper part) and actin (lower part).

The positions ofthe INOS (578bp) and actin (250) PCR products separated by agarose gel electrophoresis are shown by arrows at the left. The positions of the size markers (bp) are shown on the right side of the gels. Treatment with ACTD (1 IiM) was shown to abolish the appearance of BOS signal in either rat aorta or gastnc CM. CKX (10 pM) treatrnent attenuated the induction of iNOS messenger in rat gastric CM tissue, but had no effect on that in rat aorta tissue. The results are representative of 3 independently conducteci experiments. RA RGCM 173 pairs (targeting a 243 bp product) that actinomycin D (1 CLM) treatment blocked the appearance of ïNOS mRNA bath in rat aorta (ieft portion of Fig. 4.1 1) and in rat CM tissue (right portion of Fig, 4.1 1) after a 5 h incubation. The lack of appearance of BOS mRNA correlated with the inabiiity of L-arginine to cause relaxation (Fig. 4.10, tracings B and F). The pre-incubation of the rat aorta ring and CM preparations with the protein synthesis iuhibitor, cycloheximide (10 ~LM),was also dernonstrated to attenuate the LR induced relaxation responses in rat aorta (tracing D, Fig. 4.20) and rat CM (tracing H, Fig.

4.10) preparations fier a 5 h incubation in the organ bath. Control tissues without any treatment by cycloheximide showed a relaxation response (tracings C and G, Fig. 4.10).

As expected in rat aorta tissues, cycloheximïde treatment did not block the induction of

BOS mRNA (lefi portion of Fig. 4.1 1) compareci with the untreated rat aorta tissue, despite the inhibition by cyclohexhide of LR-mediated relaxation (trackg D, Fig. 4.10). It was surprisingly found that the pre-incubation of the CM tissue with cyclohexirnide (1

PM)significantly attenuated the appearance of NOS rnRNA (right portion of Fig. 4.1 1) in addition to blocking the LR induced relaxation response (tracing H, Fig. 4.10). This result was quite distinct fiom the hdiigs with rat aorta tissue. The result indicated that the synthesis of a new intermediate transcription factor such as inducible c-fos protein rnight be required for the transactivation of ïNOS gene transcription. By using a specific antibody targeted to inducible c-fos, it was possible to show thai there was an appearance of a positive immunoreactivity for c-fos in the submucosal layer of CM preparations afler a prolonged incubation in the organ bath (Fig. 4-12), compared with the fiesh preparaîion in which no Unmunoreactivity was observeci. Fig. 4.12 Induction of c-fos pmteia in gastric CM preparation.

Either fkeshly dissecteci CM tissue or tissues that had been "induces" dera 5 h incubation in the organ bath at 37OC were fixed and processed for immunohistochemical detection of c-fos protein. The positive immunoreactivity stained with a specific antiiody for the inducible c-fos is show in the subrnucosal layer close to the CM elements, but not in the fresh tissue. The panel is representative of two independently conducted experiments using tissues from two different animals.

4.5. Effkts of NF-ICBinhiiitors on NOS induction

NF-KB, a nuclear transcription fâctor, has been found to play a key roIe in the induction of NOS in various cuitured cells (Nunokawa et al., 1996; Wong et al., 1996;

Jeon et al., 1996; Feinstein et al., 1996) in response to the cytokines. N-a-tosyi-L- phenyIalanine-chioromethykeîone (TPCK), a protease inhibitor, has been fomd to inht'bit the activation of NF-KB presumably by blocking the proteolytic processing of IKB,the inhibitory regdatory protein of NI;-ICB (Griscavage et al.. 1995)- The antioxidant pyrrolidine dithiocarbamate (PDTC)was also reported as a NF-KB inhiiitor to inhibit the induction of NOS in rat aorta (Schini-Kerth et al., 1994). The treaiment of rat aorta

(without endotheIium) tissue with either TPCK (20 CiM) (tracing B of Fig. 4.13) or PDTC

(20 @) (tracing C of Fig- 4.13) was found to inhibit the appearance of LR-induced relaxation after 5 h incubation compared with the LR relaxation response in the control tissue without any treatment by these NF-KB inhibitors (tracing A Fig. 4.13). In wntrast, neither TPCK (20 phd) nor PDTC (20 ZrM) pre-incubation of rat gastric CM tissues caused an inhibition of the relaxation response in response to the addition of LR to the organ bath (tracings D, E and F in Fig. 4.13). In the induced rat aorta tissues, in which both TPCK and PDTC inhibited LR induced relaxation effects, it was found that the appearance of the PCR signai corresponding to the induction of iNOS mRNA had been aiso inhibited by the preincubation of the tissues with either 20 &f PDTC or 20 phi

TPCK (Fig. 4.14). In contrast, neither TPCK nor PDTC blocked the appearance of the

NOS messenger and LR-induced relaxation in the CM tissue (Fig. 4.16b). Fig. 4.13 Effects of the inbibitors of NF-KBactivation on the induction of Larginine

(LR)relaxation.

Both rat aorta without an intact endotheliurn (iefl set of tracings) and gastric CM tissue (right set of tracings) were mounted in the organ bath. The tissues were precontracted with 1 pM phenylephrine (PE, 0)and then challenged by 1 mM LR (0)-

After, but not before, a 5 h incubation in the organ bath, a rapid relaxation response was induced upon the addition of 1 mM LR either in rat aorta tissue (tracing A) or in the rat gastric CM preparation (tracing D), Compared with the LR induced relaxation in untreated rat aorta tissue (tracing A), the pretreatment of rat aorta tissue with the NF-KB inhibitors TPCK (20 pM, tracing B) or PDTC (20 pM, tracing C) prevented the induction of LR-induced relaxation. In contrast, neither TPCK (20 pM, tracing D and E) nor PDTC

(20 CLM, tracing D and F) was observed to block the appearance of LR-induced relaxation in the rat gastric CM preparations &er a 5 h incubation. The tracings are representative of

8 to 10 independently conducted experiments with tissues derived fkome 6 different animals. ïhe scales for tirne and tension are shown in the right iower corners of both sets of tracings for the rat aorta and gastric CM preparations.

Fig. 4.14 Effeet of TPCK on NOS mcssenger RNA induction in rat aorta tissue.

The rat aorta tissues which were incubated for 5 h in the presence and absence of

TPCK (20 IiM), were assesseci for LR-induced relaxation as desmieci in Fig. 4.13.

Tissues were then processed for RT-PCR analysis using two pairs of primers to target

NOS (upper panel) and sain (lower panel). The PCR signal amplified nom TPCK-treated tissue was attenuated, compared with the indu& tissue (induced) incubated in the organ bath without TPCK treatment. The arrows on the left side of the agarose gel show the positions of the NOS (578bp) and actin (243bp) RT-PCR products separated by electrophoresis. The positions of standard markers (bp) are shown on the right ofeach gel.

18 l

4.6. Effects of tyrosine kinase inhibitors on NOS induction

Since tyrosine kinase pathways have been reporteci to participate in the inducbon

of WOS gene in several cultureci ce11 systems (Mard et al., 1993; Paul et d,1995;

Dong et al.. 1993; Geng et al., 1995) (dm see Section 1.4.5.5.), tyrosine haseinhiiitors

such as genistein and tyrphostin were exploited to test the role of tyrosine kinase in iNOS

induction in both rat intact aorta tissue and macrophage-related cds in the CM

preparation (Fig. 4.15). It was found that treatment of rat aorta tissues with either

genistein (1 50 pM, tracing B of Fig. 4.15) or tyrphostin 47 (Ag21 3) (80 pM) (tracing D

of Fig. 4.15) could block the induction of the LR-induced relaxation response afler 5 h

incubation compareci with tissues not treated with either genistein or tyrphostin (tracings

A and C in Fig. 4.15). Importantly, neither genistein (1 50 CiM) nor tyrphostin 47 (80 pMj

treatment affecteci the ability of LR to cause relaxation in the rat CM preparations

(tracings F and H of Fig. 4.15). The appearance of NOS messenger RNA in the rat aorta tissue in which both genistein and tyrphostin 47 inhibited the LR-induced relaxation mg.

4.15) was not blocked by the pre-incubation of tissues with these two tyrosine kinase inhibitors (Fig. 4.16a). In CM tissue, treatment with tyrosine kinase inhibitors such as

TP47/AG213 inhibited neither LR induced relaxation (Fig. 4.15, tracings F and If) nor the appearance of BOS messenger RNA (Fig. 4.16b). It appeared that the attenuation of LR induced relaxation by genistein and tyrphostin in the induced rataorta preparations was mainly due to the inhibition of tyrosine kinase involved at some event after the induction of iNOS mRNk Tyrphosth 47 (80 PM)treatment of rat aorta tissue after LR relaxation Fig. 4.15 Effects of the tyrosine kinase inhibiton genistein (CS) and tyrphostin

47/AG 213 (TP 47) on the appruince of L-arginine (LR) iaduced relaxation.

Rat aorta prepafations without an intact endothehm Oeft set of tracings) and gastric CM tissue (right set of tracings) were incubateci in the organ bath for 5 h at 37°C in the absence (tracings 4 C and E, G)and presence of either GS (150 pM, tracings B and

F) or TP 47 (80 IiM, tracing D and H). Each tissue was preconaacted with phenylephrine

(1 PM, 0)and chdenged with 1 MM LR foiiowed by washg the tissue (W, mows) and replenishing the buffer. In the rat aorta preparations (left set of tracings), treatment with either 150 p.hl GS (tracing B vs trachg A) or 80 pMTP 47 (tracing D vs tracing C)was shown to block the relaxation response induced by 1 mM LR (O) in the precontracted tissue. In contrast, the LR (1 mM)-induced relaxation responses in the gastric CM prepmtions (ri& set of tracings) a€ter a 5 h incubation in organ bath were not affiected by preincubation with either GS (150 pM, tracing F vs tracing E) or TP 47 (80 pM, tracing H vs tracing G). The tracings are representative of5 to 7 independently conducted experiments with the tissues obtained fiom 5 different animais. The desfor tirne and - tension are shown in the right lower corner of each set of tracings. RGCM Fig. 4.16 Appeamce of iNOS mRNA: (a) Effects of the tyrosine kinase inbibitors genistein (GS) and tyrphostin 47/AG 213 (TP) in rat aorta tissues and (b) effect of tyrophostin 47/AG 213 and TPCK in the CM preparations.

Rat aorta tissues (Fig- 4.16a) after a 5 h incubation in the organ bath at 37°C either with or without GS (150 pM) or TP (80 pM) were monitored with the L-arme (1 niM) relaxation assay as describeci in Fig. 4.15, and were then processed for RT-PCR with primers targeted to the spdcnucleotide sequences in NOS (upper panel) and actin

(lower panel). Treatment of tissues witb either GS (150 pM) (ffiS) or TP 47 (80 IrM)

(+TP)did not block the appearance of NOS messager RNA after incubation with either tyrosine kinase inhibitor, wmpared with the tissue induced in the absence of any inhibitor during the 5 h incubation. With the same procedures, the appearance of NOS mRNA in rat gastric CM (Fig. 4.16b) was not affected by the treatment with either the tyrosine kinase inhibitor tyrphostui 47fAG 213 (80 CiM) (second lane fiom left) or NF-KBinhiMor

TPCK (20 CLM) (third lane fiom left). The positions of SJOS (578bp) and actin (243bp)

PCR fragments separateci by agarose gel electrophoresis are shown on the left side of each gel. On the right side are shown the fies of standard markers (bp).

186

had been induced did not affect the relaxation response causeci by LR (tracing A ofFig-

4.17).

4.7. Effect of tyrosine phosphatase inbiiitor vanadate on the NOS induction

Tyrosine phosphatases Wre tyrosine kinases have been found to play a role in the

regdation of gene transcription (Champion-Arnaud et al.. 1991; Metd. 1997; Singh et al.. 1996; Imbert et cd. 1996). Since tyrosine phosphatase inhibitors, sudi as vanadate and pervanadate, were reported to modulate gene trauscrïption via uihîiting NF-* activation by an undehed mechanism (Singh & Aggarwai, 1995), it was anticipated that tyrosine phosphatase inhibitor such as vanadate rnight inhibit the spontaneous induction of

NOS in the tissue mahtained in the organ bath. The treatment of rat aorta tissue for 5 h in the organ bath with the tyrosine phosphatase inhibitor vanadate (100 pM) was found to abolish the induction of LR-mediated relaxation (lefi-hand panel tracing B, Fig. 4.18) cornpared with tissue that was not exposed to vanadate during the incubation (5 h) (lefi hand panel, tracing A in Fig. 4.18). Furthemore, it was found that the appearance of iNOS messenger RNA, monitored using RT-PCR, was completely Uihibited by the preincubation (5 h) of the rat aorta tissue with vanadate (100 CiM) (upper panel Fig.

4.19). Although vanadate, a tyrosine phosphatase inhibitor, was able to attenuate the induction of the LR relaxation and the induction of NOS messenger RNA in the rat aorta tissue (Fig -4.19), the treatment of rat CM tissue with vanadate (1 00 IiM) did not affect the induction of the LR relaxation response (Fig. 4.18). Fig. 4.17 Effkct of tyrpbostin 47/AG 213 (TP 47) on Garginine (LR) indueed relaxation in rat aorta preparation after the induction of the LR relaxation response,

Rat aorta rings without au intact endothelium were monitored for fùnctional NOS induction using the LR relaxation test before and after a 5 h incubation in the organ bath at

3 7°C. foiiowed by a tissue wash and replacement of fresh buffer. LR (1 mM, 0)caused a relaxation response in the phenytephrine (1 pM, 0)precontracted tissue after but not before a 5 h incubation of the same tissue in the organ bath (lefi pomon of tracing A). In the TP 47 (80 C1M) treated tissue (tracing B) LR failed to cause a relaxation. However, in

'induced' tissue, showing a reproducible LR-induced relaxation, subsequent incubation with TP 47 (80 pM, O) for 0.5 to 1 h did not affect the relaxant response to the addition of LR (right hand portion of tracing A). The trachgs are representative of 4 independently conduaed experiments with the tissues from 4 Mirent animals. The scaie for time and tension is show on the right side oftracing B.

Fig. 4.18 Differentiai effects of vanadate (VAN)on the induction of Larginine (LR)

induced relaxation responses in rat siorta tissue (RA) and the gastric CM

prepamtion @(;CM).

Botb rat aona tissues (iefi set of traMg) and gastric CM preparations (right set of tracings) were tested for LR (1 mM, 0)induced relaxation before and after a 5 h incubation. Tissues were precontracted with 1 pM phenylephrine (O), before the addition of LR, foiiowed by tissue wash (W, arrow). In rat aorta preparations, 1 rnM LR fded to cause any &8ct in fiesh tissue (left portion of tracing A) but induced a relaxation response dera 5 h incubation. The appearance of the relaxation response caused by LR was compietely inhibited in the tissue (iefi portion of tracing B) maintaineci in the presence of

100 pM vanadate. In contrasi, the incubation of gastric CM tissue with vanadate (100

PM) for 5 h did not affect the appearance of the LR (1 rnM) induced relaxation response in the precontracted CM tissue (right portion of tracing B). The response of vanadate- treated tissue was the same as the control tissue maintaineci in the absence of vanadate

(1 00 PM) during the incubation (right portion of tracing A). The tracings are representative of 5 independently conducted experinents with the tissues derived fiom 5 - dserent anids. The scales for tirne and tension are shown in the right corners of the lefi set of tracings (RA) and the right set of tracings (RGCM).

Figm 4.19 Effect of vanadate (VAN)on the induction of NOS messenger in rat aorta

tissue.

The rat aorta tissues incubated for 5 h in presence or absence of VAN 100 pM as described in Fig. 4.18 were processed for RT-PCR anaiysis in which two pain of primers were used to target NOS (upper panel) and actin (lower panel). PCR signal of NOS in

VAN (100 pM) treated tissue did not appear (second lane), compared with the SOS signal fkom the control tissue (inaibated) in the absence of VAN (first lane). The positions of xNOS (578bp) and actin (243bp) are labeled with arrows on the lefi side of agarose gels. The sizes of standard markers (bp) are positioned on the right side of each gel.

4.8. Induction ofiNOS by interleukin-lp

4.8.1. Potentiation of NOS induction in the presence of interleukin-1 0

Interleukin-1 p (IL4P) has been wel characterized to cause the induction of NOS in cultured rat aorta-derived smooth muscle ceiis (Beasley et al.. 199 1; Durante et al..

1994). The treatment of rat gastric CM tissue with LIP 10 nghl for 2 h did not affect the time course of appearance of L-arginine (1 rnM)-induced relaxation (Fig. 4.20b) and did not lead to a reduction in the contractile responses induced by phenylephrine (1 pM)

(Fig. 4.21b). However, incubation of the rat aorta preparation (without endothelium) with

IL-1 B (1 0 ng/ml) for 2 h resulted in a significant potentiation of the induction of L- arginuie-induced relaxation compared with the time course of spontaneous induction of

LR relaxation in the RA tissue with the absence of IL4P (10 ng/rnl) (Fig. 4.20a). In the

RA tissues exposed to IL-1P (10 ngM) for 2 h, there was aiso a reduction in the contrade response to phenyiephruie (1 pM) that refieaed the appearance of L-arghine

(1 mM)-induced relaxation. This reduction in the response to 1 pM PE caused by IL49 was reversed by incubahg the tissue with the NOS inhibitor, aminoguanidine (AG) (Fig.

2 1). The LR-induced relaxation responses in ILIP treated RA tissues were also inhibiteci by the guanylyl cyclase inhibitor LY83583 (10 m.The spontaneous induction of 30s in the RA tissue without IL1P treatment did not result in a marked change in the response to 1 pM PE, nor was there a change in the response to PE of the gastric CM preparations with or without IL-1P treatment during the incubation in the organ bath. The treatment of the "induceù" CM tissue (in the presence or absence of LIS)with aminoguanidine did not potentiate the contractile response to 1 pJM PE @g. 4.21b). When the RA tissues Fig. 4.20 Effkcts of LGlP on Garginine (LR) induced daxation in rit aorta (RA)

and gastric circutar muscle (CM)preparations.

(a) (upper) RA rings without endothetium were incubated with (0)or without (0) 10

ng/d IL-I P for 2 h, and were monitored at time intends for bctional lPJOS induction

using the L-arginine (LR) (1 mM) relaxation assay. (b) (lower) The CM tissue

preparations were incubated with (m) and without (O) 10 ng/mi IL-1p and the appearance

of hnctional NOS was monitored as for the RA tissues. Al1 tissues with and without IL-

1P treatment were precontracted with 1 pM phenylephrine, followed by a test of LR (1

mM) induced relaxation at the plateau of the PE-induced contractile.response.The Y-axis

shows the percentage of LR (1 mM) induced relaxation: %= the loss of tension aer

addition of LR (1 mM) + the tension induced by phenylephrine (1 pM) before adding LR x

100. The relaxation induced by 1 mM LR in both RA and CM tissues hbated in the absence of IL4 P (1 0 agM) can be compared with the LR (1 m.)induced relaxations in the IL4 P (10 @mi) treated RA and CM preparations. The values present the average

S.E.M. (bar) for the results obtained with 7 to 10 tissues derived fiom 5 different animais. a. rat aorta

TlME (h)

b. rat gastiic CM

TlME (h) Fig. 4.21 Effects of aahoguanidine on the tension loss of phenylephrine Uiductd contractile response in untreated and IL-lfbtrcated smooth muscle preparations.

The fialcontrade responses of both KCl(50 mM) and phenylephrine (PE) (1 pM)

(empty bars) were recorded as control in the rat aorta (RA) without endothelium (a and b) and gastric cirdar muscle (CM) tissues (b), foliowed by incubation in the organ bath with and without the presence of IL-IP (10 ng/rnl) for 2 h- Mer incubation, the tissues were washed and precontracted with 1 pMphenylephrine (PE)(b: empty bars), foliowed by the exposure to LR (1 mM). ïhe rapid loss of tension developed in the presence of PE (1 p.M) was observed in the ILIP treated RA tissue (a) (b: solid bar) but not in the IL1P treated

CM tissue (b: solid bar). Treabnent of the tissues with the INOS inhibitor aminoguanidine

(1 mM)for 20 min (a and b: hatched bars) reversed the loss of tension triggered by PE (1

@l)in the RA tissue treated with IL-@ (IO ng/mi), but not in the IL-1 p-treated CM tissue. The Y-axis presents the contractile responses of PE in the RA and CM tissues as percentage of KCl(50 mM) induced contraction in each tissue. The values presents the average k SEM. (bars) for the redts obtallied with 4 or more independently conducted experiments using 6 to 8 tissues derived tiom 4 different animals. b. rat aorta and CM 198 were incubated for 2 h with the different concentrations (O, 1,s and 10 ng/ml) of IL1p, foiiowed by totai RNA preparation and RT-PCR procedures, it was found that the appearance of iNûS messenger RNA was dependent on the concentration of IL-1 P present in the organ bath (Fig. 4.22a). In wntrast, the appearance of NOS messenger

RNA in CM tissue was not affecteci by incubation with IL- 1P (1 0 ngM) (Fig. 4.22b). tissue 4 4.8.2. Signalling and IL-lpstimulated SOS induction Ui the rat aorta

The CO-incubation of rat aorta (RA) tissues with IL-1P (10 nglml) and the tyrosine kuiase inhibiton genistein (1 50 pM) and tyrphostin (80 IiM) blocked the appearance of L- arginine (1 mhl)-induced relaxation and the reduction in the contractile response to 1 pM phenylephe. However, the appearance of NOS messenger RNA was not affecteci by the tyrosine kinase inhibitor TP471AG2 13 (80 IiM) (Fig. 4.23). Treatment of the RA tissue with the transcription inhibitor actinomycin D (1 CiM) blocked both the appearance of the relaxation induced by L-arginine (1 mM) and the appearance of NOS messenger RNA induced by IL1P (10 ng/m.i). Treatment ofthe RA tissue with the protein synthesis inhibitor cydoheximide (10 phd) uihibited the induction of L-arginine (1 mM)-mediated relaxation but not the appearance of NOS messenger RNA caused by IL-1P (10 ng/ml).

Both the appearance of L-arginine relaxation and the induction of NOS messenger RNA caused by the matment of the tissues with IL-1 P (10 ng/ml) for 2 h were inhibiteci by the

CO-incubationof the RA tissue with either the NF-& inhibitor T;I'CK (20 IiM) or the tyrosine phosphatase inhibitor vanadate (1 00 CLM) (Fig. 4.24). Fig. 4.22 Efftcts of IGlP on the appearrnce of NOS messenger RNA in the rat

aorta (RA)and gastric cireular muscie (CM)tissues.

The RA tissues (Fig. 4.22a) were incubated in the organ bath for 2 h with different

concentrations of LI P (ng/rnl) as indicated, followed by a tissue wash and the

preparation of RNA for the RT-PCR analysis using two pairs of primers to target NOS

(upper panel) and aain (lower panel). The appearance of iNOS messenger RNA increased with inmeashg IL-1f3 concentrations, compared with the control tissue (fht lane fiom the lefi) incubated in the absence of IL4 p. With same procedures, the appearance of NOS messenger RNA in the CM tissue (Fig. 4.22b) was not affected by the addition of ILlP

(10 ng/m.i) to the organ bath. The positions of SiOS (578 bp) and actin (243 bp) are labeled with arrows on the left side of each agarose gel. The sizes of standard markers

(bp) are positioned on the right side of agarose gels.

Fig. 4.23 Effect of tyrphostin 47 (TP)/AG 213 on the induction of iNOS messenger

RNA by LlP (10 ng/ml) in rat rortri (RA) tissue.

The RA tissues after 2 h incubation in presence of IL-lp (10 ngld) in the organ bath at

37°C either with or without TP/AG 213 (80 CiM) were monitored with the LR-relaxation assay as describeci in the text, and were then processed for RT-PCR andysis with primers targeted to the spec5c nucleotide sequences in BOS (upper panel) and actin (lower panel). The treatment of tissue with TP/AG 2 2 3 (80 CrM) (second lane fiorn lek IL- I p +

TP) did not affect the appearance of NOS messenger RNA induction stimulated by IL-!

(1 0 ng/d) (fust lane from Mt). The positions of the BOS (578 bp) and actin (243 bp)

PCR fragments separated by agarose gel electrophoresis are shown on the lefi side of the each gel. On the right side are shown the sizes of standard markers (bp).

Fig. 4.24 Effect of tbe NF-KB inhibitor TPCK and the tyrosine phosphatase

inhibitor vanadate (VAN)on the induction of iNOS messenger stirnulated by ILlP

(10 nghl) in the rat aorta (RA) tissue.

The RA tissues afier 2 h incubation at 37 OCin the organ bath in the presence of IL- 1P (10 ng/ml) with or without VAN (100 ph4J or with and without TPCK (20 p.M) were monitored with the LR-relaxation assay as describeci in the text, and were then processed for RT-PCR with primers targeted to the specific nucleotide sequences in NOS (upper panel) and actin (Iower panel). Treatment of the tissue with either VAN (100 irM) (second

Iane fiom lefk IL-1 P + VAN) or TPCK (20 CLM) (third lane fkom left, IL1Q + TPCK) blocked the appearance of NOS messenger RNA stimulated stirnulated by IL-1P (10

@mi) (first lane hmIeft: IL-1 B). The positions of the INOS (578 bp) and actin (243 bp)

PCR fragments separateci by agarose gel electrophoresis are show on the left side of the each gel. On the right side are show the sizes of standard markers (bp).

4.9. Su-

In this chapter, the induction of iNOS both in rat intact aorta rings (without

endotheliurn) and in the rat gastric CM smooth muscle preparation was characterized

using both a pharmacologie approach (I,R relaxation assay that was blocked by the iNûS

inhibitor aminoguanidine) and using RT-PCRto monitor the induced NOS mRNA (Table

4.1). Further, iNOS in the gastric CM preparations was IOcalized immunohistochernically

in macrophage-relateci ceUs instead of in the smooth muscle elements, as was the case for

the aorta tissue. The induction of LR relaxation in both rat aorta and gastric CM tissue

was show to correlate with the appearance of iNOS messenger RNA in a thedependent

rnanner. The block of both LR relaxation and the appearance of WOS messenger by the transcription inhibitor, actinornycin D, has substantiated that both processes involve gene transcription. The resuIts with the protein synthesis inhibitor, cycloheximide, suggested that a new transcription factor needs to be synthesized before the NOS gene transcription machinery is tumed on in the rat macrophage-related cells in the gastrïc CM preparation.

This induction process is quite distinct fiom that in rat aorta smooth muscle. The results with the NF-- inhibitors, TPCK and PDTC,which blocked SiOs induction in the rat aorta tissue, but not in the CM tissue (Le. in the macrophage-reiated ceHs ), also point ta a marked difference in the mechanisms whereby NOS is induced in the two distinct smooth muscle preparations. The apparent inhibition of iNOS induction at the transcriptiond level in rat aorta tissue by the tyrosine phosphatase inhibitors vanadate and pervanadate may possibly have been due to the modulation of NF-KB fùnction. A tyrosine kinase pathway has ben donunented to participate in NOS gene transcription in cultured cell systems in Table 4.1 Differential induction of iNOS in rat aorta and CMtissues

Rat Aorta Rat Gastric CM Compounds Functional NOS Functional NOS NOS messenger NOS messenger RNA RNA GENETEIN (150) BLOCK* O** O O TP47/AG213 (80) 1 BLOCK 1 O 1 0 1 O TPCK (20) 1 BLOCK 1 BLOCK 1 0 1 O PDTC (20) VANADATE (100) BLOCK BLOCK O O ACTINOMYCIN D (1) BLOCK BLOCK BLOCK BLOCK CYCLOHEXIMIDE (10) 1 BLOCK 1 O 1 BLOCK 1 BLOCK *BLOC= iobibited eitùer the LR-iaduced relaxation (fuactiond iNOS) or the appeanace of iNOS mRNA; **O: no effets on either functionaî NOS or the induction of NOS mRNA 207 response to the incubation with the cytokines (Tetsuka & Monison, 1995; Gaget al.,

1995; Corbett et ai.,1996; Simmons & Murphy, 1994; Feinstein et al., 1994) (se Section

1-4.5 S.). However ,in the rat aorta tissue, the tyrosùie kinase inhibitor TP47/AG 2 13 did not block the appearance of 240s mRNA but did block the appearance of fünctiod

*OS, as monitored by the LR relaxation assay in the intact rat aorta tissue. Thus, in the

RA tissue, a tyrosine kinase step may be involved at a pst-transcriptionai level to affect enzyme activity (Pan et af-,1996). In addition, the lack of ability of TP47/AG 213 to block either tiincîional ïNOS induction (LR ReIaxation assay) or the appearance of NOS mRNA in the rat gastric CM preparation, wodd appear to question seriously a role for a tyrosine kinase pathway in the induction of BOS in the macrophage-related ceiis present in rat gastric CM tissue (Table 4.1). IL-@ was shown to potentiate the induction of L- arginine-mediateci relaxation and NOS messenger RNA in the endothelium fiee aorta tissue without changing the tirne course ofiNOS induction either in the RA or CM preparations. The signalling pathways for iNOS induction stunulated by IL-1P appeared to be the same as those for the spontaneous induction of BOS in the aorta tissue. The L- arguiine relaxation and the appearance of NOS messenger RNA induced by the treatment with IL-1 P (10 @mi) would be bIocked by co-incubation with actinomycin D, vanadate or TPCK (Table 4.2). Further, the tyrosine kinase inhibitors and cyclohede inhibiteci the IL-1 ~-stimulateciinduction of L-arginine-mediated relaxation without blocking the appearance of iNOS messenger RNA (Summanzed in Table 4.2). Table 4.2 Induction of iNOS in rat aom tissue

Spontancous Induction Induction with ILIB Functional NOS Functional NOS NOS messager BOS messenger RNA RNA BLOCK* BLOCK BLOCK BLOCK BLOCK O** BLOCK O BLOCK O BLOCK O BLOCK 1 O O I I m TPCK (20) BLOCK 1 BLOCK 1 BLOCK 1 BLOCK - PDTC (20) BLOCK BLOCK BLOCK BLOCK VANADATE (100) BLOCK BLOCK BLOCK BLOCK *BLOCK:inhibited either the LR-hduced relaxation (functional iNOS) or the appearance of BOS mRNA; **O:no &êcts on either fûnctional NOS or the induction CaGPTER FIVE DISCUSSION

5.1. Integration

In this thesis, al1 work has focused on the fiuictionai regulation of smooth muscle systems including vascular smooth rnuscIe (aorta preparation) and non-vascular -00th muscle systems (gastric preparations). Since the fiuictiod regdation includes both the contractile and relaxation processes of smooth muscle, work in the thesis explored extensively the signal transduction pathways both for the contrade responses and for the induction of the enzyme &OS that results in a relaxation of smooth muscle in the presence of its substrate L-arginine. One main goal was to evaluate the roles of tyrosine kinase pathways for the contractile responses induced by ethanol, EGF and thrombin receptor activating peptide, using a variety of pharmacological signal pathway probes. These contractile agonists potentially represented three distinct "receptor" families in that EGF as a growth fàctor stimulates a tyrosine kinase receptor, thrombin receptor activating peptide triggers cellular responses via a G protein coupled receptor and ethano1 exerts its action by activating a target that has yet to be identified. Al1 of the three agonists studied in this thesis have been show to regulate smooth musde fhction by causing contrade responses via different initial events. in contrast with the contractile regulation of smooth muscle, the time dependent appearance of a relaxation response was docunented to be caused by nitric oxide produced fiom either constitutive or inducibie nitric oxide synthase.

In keeping with the studies of the contractile responses in which a role fbr a tyrosine kinase pathway was assessed, the roie of a tyrosine kinase pathway in the induction of iNOS was also evaluated in the intact smooth muscle tissues. With this aim in the second 210 part of the thesis the time course and localization ofthe induction of NOS in the gastnc smooth muscle preparations was ctiaracterized before the studies of signal transduction for iNOS induction were done. Therefore, the roles of tyrosine kùiase(s) in the signal transduction pathways connected the two different parts of the thesis, which deals with the

"Ytn and Yang" balance of smooth muscle mch as the contractile regdation by various agonists and the relaxant regulation caused by NOS induction. in the foliowing sections of this chapter, the experimental results obtained in Chapter 3 and 4 are discussed in great er detail.

5.2. Signal transduction pathways and smooth muscle contraction

5.2.1. The contractile response caused by ethanol

It was found that ethanol causeci a contractile response in guinea pig gastric lon@tudinal and circular muscle preparations that in many ways reflected the contraction caused in these tissues by EGF. The results implied the involvement of a tyrosine kinase pathway for the action of ethanol in both the LM and CM tissues. The Merences in the sensitivity of EGF-mediated contractions to several inhibitors (e.g. genistein, indomethacin, U57,908) in the distinct LM and CM preparations were also padleled by dserences in the sensitivïty of ethanol induced contractions to the sarne inhibitors. The two tyrosine kinase inhibitors, genistein and tyrophostin 47, used in ethanol -dies are stnicturally different and are proposeci to act via different mechakms (Akiyarna et al..

1987; Levitzki, 1992; Levitzki & Gazit, 1995). The advantages and Liabilities of using these tyrosine kinase inhibitors to assess a role for tyrosine kinase pathways in biological processes are weU appreciated in other studies (Laniyonu et aL,1994; Wolbring et al., 21 1

1994; Levitzki, 1992; Young et aL. 1993). It has been documenteci elsewhere, that both inhibitors block protein tyrosine phosphorylation and tyrosine Ianase activity in extracts of smooth muscle tissues (Yang et aL. 1992b; Laniyonu et al.. 1994). Since the ability of genistein and tyrphostin to Skct enzymes other than tyrosine kinases is wel) known

(Young et al.. 1993), the data obtained with these reagents rnust be interpreted with caution. The tyrosine phosphorylation of a signahg protein is dynamically regulated not ody by kinases, but also by tyrosine phosphatases which maintain a physiological level of phosp hotyrosine on target proteins in the cds. From this point of the view, a second piece of evidence to substantiate a role for tyrosine kinases in the ethanol-induced contractile responses was obtained with a tyrosine phosphatase inhibitor, pewanadate. This reagent, at a concentration that did not done muscle tension, potentiated the contractile action of ethanol in the LM preparation (Fig. 3.10). Additionally, it was found that a contractile concentration of ethanol on its own was able to increase the phosphotyrosyl protein content of the gastric tissue (Fig. 3.1 1). The identities of the phosphotyrosyl proteins involved in t his process still rernain to be determineci. Therefore, the involvement of a tyrosine kinase pathway in the ethanol-induceci contractile response has been characterized fiom three Werent aspects.

The contrade action of ethanoi was show to be rnimicked by other alcohols

(methano4 propanol), and was shown not to be due to the metaliolism of ethanol by alcohol dehydrogenase. Since the ethanol concentration range (20-500 mM) required to induce a contractile response in the smooth muscle system cmbe achieved either in the gastric tissues or in the circulation during the course of modenite ethanol consumption by 212

humans (Win,1980), the role of a tyrosine kinase in the ethanol-induceci regdation

of smooth muscle fbnction might demoastrate a novel mode1 for the pathophysiologicaI

actions of ethanol in the humans. The order of alcohol potencies in the CM tissue

(propanol > ethimol> methanol) refiected the oiVwater partition coefficients for these

aicohols, but the potency order in the LM preparation (ethanol = propanol > methanol)

did not correlate with their lipid safubility. Furthemore, the relaxant actions of butanol in

both LM and CM tissues have indicated that the alcohols rnay affect the tissues via

multiple mechanisms, only some of which might be related to the alcohol carbon chah

length.

Ethanol has been reported to cause a contraction in permeablized rabbit fernoral

artery by inducing a calcium sensitization by an undetennid mechanism (Somlyo &

Somlyo, 1994). In the intact smooth muscle tissues, the contractions elicited by either

EGF or ethanol required extraceiluiar calcium, which result fierindicated that the

combined actions of released inositol trisphosphate and diacylglycerol (potentially

generated by phospholipase C-y) to elevate intracellular calcium and activate kinase C

(Bemdge, 1993) were evidentiy not sufEcient to cause the contractile response. in

addition ta the inhibition ofthe contractile action of both EGF and ethanol by tyrosine

kinase inhibitors in the LM preparation, both responses were blocked by the

cyclooxygenase inhibitor, indomethacin and by the diacylglycerol Lipase inhibitor US?,

908, whereas in the CM preparation, the contractile responses to EGF and ethanol

persisted in the presence of these two enzyme inhibitors. Although the EGF receptor tyrosine kinase has been shown to be modulated by ethanol these similarities between 213 EGF and ethanol in the smooth muscle contractile responses of both LM and CM tissues codd not be explaineci by the direct stimulation of the EGF receptor by ethano1 (Thurston,

Jr. & Shukla, 1992; Wang et al.,1992), since the potent and selecîive EGF receptor kinase inhibitor, PD 153035 (Fry et al.. 1994), did not affectethanol-induced contractions

(Fig. 3.9). By using a number of signal pathway probes in addition to the tyrosine kinase inhibitors, indomethacin and U57,908, it was found that there are some significant clifferences between the signal transduction pathways initiateci by these two contrade agonists. The signai pathway mediators that have been Werevaluated include the calcium channei, protein kinase C, MAP kinase kinase (or MEK) and PI 3-kinase, al1 of which have been shown to play some roles in the actions of both growth fàctors and G protein-coupled agonists (see Chapter 1, introduction). Although both ethanol and EGF required the presence of extracellular calcium to cause a contractile effkct (Fig. 3.4), the mode of calcium entry triggered by EGF and ethanol appeared to difFer, sînce the inhibitor of the voltage-regulated calcium chamel, nifidipine, caused a substantial inhibition (=

90%) of EGF-induced contractions, but only partially (about 30% inhibition) attenuated the ethanol-induced contraction; the antagonist of the 'receptor-operated' calcium channel,

SK.96365 was required in addition to nifedipine to block completely ethanol-contractions elicited by ethanol (Fig. 3.5). Differential roles of kinase C were observed in EGF and ethanol induced contractions. It was found that ethanol-induced-respoms in the LM tissue were refiactory to the inhibitor of the a, P and y-isoforms of kinase C,

GF109203Y whereas this kinase C antagonist inhiiited EGF-induced contractions by about 70%. The roles of MEK (MAPK kinase) and PI 3-kinase was also explored dong 214

with the MEK inhiiiitor, PD98059 (Dudley et aL, 1995) and the PI 3-kinase inhibiton,

wortmannin (Roland et al.. 1996) and LY294002, all of whicb selectiveiy intiiiited the

contrade responses to EGF in the LM preparation without affecthg the contractions

caused by ethanol (Fig. 3.8). Thus, the signai pathway activated by ethanol to cause a

contrade response in the LM preparation would appear not to involve the MAP kinase/PI 3-kinase pathways that have been documented for growth factors such as innilin and EGF(see Introduction Section).

In the CM preparation, neither the PI 3-kinase inhibitors nor the MEK inhibitor blocked contractions caused by either EGF or ethanol. Thus, in keeping with the previous observations with EGF and angïotensin-LI (Yang et aL. 1992b; Yang et al.. 1993)- the CM tissue would appear to employ signal transduction pathways, both for ethanol and for

EGF, that dïer fiom the pathways mediating a contractile response in the LM tissue. The lack of effi of the PI 3-kinase înhii'bitors and the MEK Uihibitor in the CM tissue can be seen to highlight the specificity of action of these inhibitors in the LM tissue.

It has been observed that there are some sirnilaritîes and differences between the signal pathways activated by ethanol and EGF, both of which employ a tyrosine kinase pathway and share a final common pathway in the contractile responses. In a number of ways, the contractile action of ethanol in the LM preparation (blocked by indomethacin, genistein and U57, 908) also reflected the contractile actions ofG protein-coupled agonias, such as thrombin receptor activating peptide (see the following section for discussion) and angiotensin (Yang et al.. 1993). The contractile actions of both these agonists are blocked by the same set of entyme inhibitors in this tissue. The fiindonal 215

modulation of G proteins by ethaaol has been aiso reported elsewhere (Hatta et al., 1994;

Klinker et al., 1996; Mdikin-Kilpatrick et a'. 1995). But the action of ethanol in the LM

preparation was not only distinct fiom the effect of some G protein-coupled agonists, such

as carbachol, which was not blocked by indomethach, genistein or U57,908 in the gastric

tissue (Yang et al.. 199 1; Yang et d,1992b), but was dm distrina fiom the actions of

the thrombin receptor peptide, which can be attenuated by several inhibitors such as those

for PI 3-kinase and MEK However, in some tissues, such as iiver and platelets,

phospholipase C has been identifieci as a target for ethami, as indicated by ethanol-

induced increases in phosphoinositide turnover, increases in htraceiiular calcium and the

breakdown ofphosphatidylcholuie (Pittner & Fain, 1992; Rubin & Hoek, l988a; Rubin &

Hoek, 1988b; Hoek et al., 1987; Hoek et al.. 1992). These disof ethan01 on

phospholipase C activation have been amibuted to a modulation by ethanol of G protein

fùnction (Hoek et al.. 1992; Rubin & Hoek, 1988a; Rubin & Hoek, 1988b). This ability of

ethanol to activate either phosphatidyIcholine or phosphoinositide-specinc phospholipase

C directly can not be excluded in the presented studies and may in part account for some

of the data. Whether phospholipase D plays a role in the contractile response induced

either by EGF or by ethanol still r&s an open question. However, in view ofthe results implicating a tyrosine kinase pathway in the contrade action of ethanol in gastnc tissue, and in keeping with ment data pointing to the abüity of the G gotein By-subunit to regulate ceii hction via various tyrosine kinase pathways (Touhara et al., 1995), an alternative hypothesis to consider, apart fiom a phosphotyrosyl-induced activation of phospholipase C-y, via SH2-dohinteractions (Pawson, 1995b), is that ethanol, by 216

tiberating G-protein py-subunits may activate a tyrosine base pathway that could

regulate calcium infiux (Blay & Hollenberg, 1989; Hollenberg, 1994~Lee et al.. 1993),

thereby caushg some of ethanors cellular eects.

The action of ethanol in the smooth muscle system involved a tyrosine kinase

pathway and a requirement for extracellular calcium. These data raise at least one

possibility that ethanol may also exert some of its action in part via a tyrosine kinase

pathway on target tissues other than gastric smooth muscle. Since in several tissues such

as brain and heart a calcium activated tyrosine kinase (Pyk2 or CAKB) has been

characterized (Sasaki et aï.. 1995; Dicet al.. 1996), it is possible for ethanol by

inducing an influx of calcium to reguiate the activity of an intracellular non-receptor tyrosine kinase. Alternatively, ethanol can also affect intracellular ca1ciu.m concentrations in a variety of organs without causing an infiux of extracellular calcium. It is important to point out that the calcium-sensitive cytoplasrnic tyrosine kinase Pyk2, has been show to able to reguiate ion channel hction (Lev er al.,1995a). Therefore, some of the pathophysiologic effects of ethanol might be due to the activation of a comparable non- receptor tyrosine kinase pathway in target tissues. Whether or aot ethanol may activate tyrosine kinase pathways in human gastric tissue or in other human organs, so as to play a role in the pathophysiological action of ethanol in humans, is an inmguing question that - merits furîher study.

In a summary, ethanol has been characterimi to induce a contract.de response in gastxic smooth muscle preparations via a tyrosine kinase pathway through the stimulation of an unidentifieci target(s). The phasic contractile action of ethanol, iike EGF, may reflect 217

one of the characteristics of the tissue which has been discussed in the htroductïon

Chapter (Section 1.2.3. Myosin regulation). It is also likely that ethano1 causes a transient

increase of intracellular Ca2+via the stimuiation of some non-voltage-operateci Ca2+

channel such as a receptor activated Ca2+channel. In addition, ethanol may either directly

or indirectly regulate the contractile machinery, for example, by modulating myosin MgZ"-

ATFase activity, myosin light chah kinase or phosphatase etc.

There was a ciifference in the characteristics of the contractile response to ethanol

dependiig on whether calcium was present either before the addition of ethanoi (e.g.

phasic contraction, tracings A and G of Fig. 3.1) or was added derexposing the tissue to

ethanol (tonic contraction, Fig. 3 -4). This diference reflects fùrther the cornplexity of the

mechanism whereby ethanol causes the contractile response of smooth muscle. It is

possible that Caz+itseif rnay participate in the regulation of ethanol action via an unknown

mechanism. Therefore, the receptor operated ca2+channel might be able to keep its active

conformation after the stimulation by ethanol in the absence of extracellular Ca2+,leading

to a sustained influx of calcium and thus a sustaind contractile response. The exact

mechanism for ethanol to induce contractile response has yet been defïned, although a tyrosine kinase pathway , cyclo-oxygenase pathway and DAG lipase have been identifiai to play important roles in the contractile action of ethanol (Fig. 5.1). It can be speculated that the direct target(s) for ethanol rnay be some signalling moldes at the upstream of

DAG lipase. Therefore, both PLC and PLD, which catdyze the production of DAG fiom phospholipids, might be indirectly regulated via a tyrosine kinase pathway by ethanol. It has not been determined whether or not ethanol is able to cause a direct stimulation of 218

some non-receptor tyrosine kinase which might regulate the actïvity of a phospholipase.

From the information provided in Section 1.3. of the Introduction Chapter, several

possibilities were mentioned for ethanol to cause an indirect activation of some tyrosine

kinase pathway. Briefly, a Ca2' activated protein tyrosine kinase such as Pyk2 mi@ be

indirectly stimulateci by ethanol through the stimulation of a receptor activateci Ca2'

charnel to increase the intraceiiular concentration of Ca2+.In addition to the possibility for

ethanol to regulate the activities of a G protein coupled receptor, it is also possible for

ethanol to modulate the fùnctions of the G protein thernselves. Thus, ethanol might cause the dissociation of py subunits fiorn the heterotrimenc a-GDP/Py wmplex (such as

subunit) resulting in an increase of* py subunits. The py subunits in tissue could lead to various ceiIular actions such as the stimulation ofa tyrosine kinase pathway (see

Section 1-3.7.) (Fig. 5.1). Further work wiil be required to idenethe spdctarget(s) that lead to an ethanol-induced contractile response in the gastric smooth muscle.

5.2.2. Thrombin receptor activating peptide induced contraction

Thrombin receptor can be coupled to at least two G proteins, such as Gi and Gq.

Like angiotensin, another G protein coupled receptor agonist, the thrombin receptor activating peptide induced a contractile response in LM preparation via a signai pathway that shares a nnal wmmon pathway with EGF, such that the contraaile responses caused by both agonists were sensitive to the DAG iipase inhibitor ~57,908and the cyclo- oxygenase inhibitor, indomethacin. Unlike EGF for which a response persists in the presence of indomethacin in the CM tissue, the thrombîn receptor activating peptide caused no contractile response in the presence of this cyclo-oxygeaase inhibitor, Fig. 5.1 Possible targets for ethano1 to cause a contractile nspoase in smooth musde Ca2+ 1 CaM

DAC Phosphatidote IJIbASB- 4 = Voltage operated Ca2+channel AA = G protein coupled receptor = "Receptor operated Ca2+channel Icox = non-receptor tyrosine kinase +? +PGs 22 1 indicating either that there is no fùnctional thrombin receptor presem on the smooth

muscle cells in CM tissue or that the thrombin receptor present in the CM preparation

induces a contractile response also via cyclo-oxygenase pathway. The contraction induced

by the thrornbin receptor activating peptide in the LM tissues was aiso blocked by two

srnicturely diierent tyrosine kinase inhibitors, genistein and tyrphostin 47/AG 2 13. The

contractile respoases caused by both EGF and thrombin receptor activathg peptide

required the preseace of extracellular calcium The calcium influx was mediated at least in

part via the activation of a voltage-dependent calcium channe4 since nifidipine atîenuated

both the EGF and thrombin receptor-mediated contractile responses. It is still

undetermiwd whether the activity of the voltage-operated calcium charme1 in the LM

smooth muscle cm be modulated by the direct phosphorylation of the channel protein in

addition to its regdation by changes in the membrane potentiai. In this regard, it can be pointed out that the voltage-dependent calcium channel at presynaptic nerve terminais has been shown to be stimulated by the phosphorylation of its aipha-subunits by protein kinase

C (Zamponi el al.. 1997). Mer demonstrating some similarities between the contraaile response to EGF and thrombin receptor activating peptide such as the sensitivity to tyrosine kinase inhibitors, the cyclo-oxygenase inhibit or, the DAG iipase inhibitor and the requirement for extraceUu1a.r dcium, both contractile actions were explored with several signding probes, such as the EGF receptor antagonist (PD1 53O%), the PKC inhibitor

GF10923OX, PI 3-kinase inhibitors (wortmannin and LY294002), Src kinase inhibitors

(CP118556 and PD89828) and the MEK inhibitor (PD98059). EGF receptor phosphotylation and trans-activation by the stimulation of G protein coupled receptor 222 agonists has been reported in a cultureci ce1 system (Daub et uL,19%), but the contractile response induced by the thrombin receptor-actbating peptide was not due to the tramactivation of the EGF receptor tyrosine kinase, shce the selective EGF receptor tyrosine kinase Uihibitor, PD 153O3 5, did not afEkct the thrombin receptor-activathg peptide response. Thus, the tyrosine kinase involved in îhrombin receptor activation appeared to be an enzyme other than the EGF receptor tyrosine kinase. By using two c-

Src Mly-targeted kinase inhibitors (CP118556 and PD89828), it was found that the contractile responses to both EGF and thrombin receptor activating pepeîide were completely blocked. The data suggest that the non-receptor tyrosine kinase, c-Src, might be involved in both G protein coupled receptor and tyrosine kinase receptor signalhg in this smooth muscle system. Since the EGF receptor tyrosine kinase has been shown to be sensitive to high concentrations of these two Src kinase inhibitors, the role of Src in EGF receptor signalling in the smooth muscle preparation must be interpreted with don, although Src kinase can be a direct downstream target of the EGF receptor via the interaction of the Src SH2 domain and an EGF receptor phosphotyrosine residue. The stimulation of c-Src in the course of thrombin receptor stimulation is undoubtedly through a G protein dependent mechanism, but the G protein (Gq or Gi) that mediates the stimulation of Src kinase has yet to be detefmined. Thus, ftrther work will be required to establish whether or not PAR, stimulation in the LM tissue leadi to Src-family kinase activation, as appears to be the case for the action oflysophosphatidic acid on ts receptor in dtured ce11 systems. Furthemore, two stnrcturally diff'erent PI 3-kinase inhibitors

(wortmannin and LY294002), that are supposed to inhibit PI 3-kinase Ma two distinct mechanisms were found to attenuate seledvely both EGF and thrombïm receptor activating peptide responses. Myosin light chah kinase (MLCK) can aiso be a target for wortmannin; this inhibition of MLCK at a high concentration of wormiannin ('10 pM) would explain the inhriition of the KCl-Uiduced contraction. However, since wortmaninn at the concentations used for the signalhg studies did not affect the contractile respollses to both KCl and carbachol, its inhibition of the EGF and thrombin receptor activating peptide responses were most likely due to the effect of wortrnannin on PI 3-kinase (Chung et al., 1994; Cheatham et al.. 1994). Both the EGF and thrombi receptor activating peptide elicited contractile actions were attenuated by the protein kinase C inhibitor

GFl O92O3X (Toullec el aï., 199 1; Gekeler et ai.. 1995; Heikkila et al., 1993). The protein kinase Czeta isoform has been reported to be a downstream target of PI 3-hase, but

GF109203X is beiieved to inhibit only the classical PKC isoforms. In the LM preparation, however, the PKC isozymes have not yet been characterized. The classical isoforms of

PKC that have been identified cm be activatecl by phobol ester, which can be shown in a rat aorta ring preparation to induce a slow increase of tension which cannot be reverseci by tissue washing due to the tight binding of phorbol ester to the PKC. In the LM tissue preparation, work described in this thesis showed that PMA as weil as phorbol dibutyrate induced a phasic contractile response that was completely inhibited by GF 109203]5 and that did not desensitize aller washing the tissue at 20 minute intexvals. These data may indicate the presence of a novel PKC isofonn or a dEerent activation mechanism by PKC in this type of smooth muscle. Since the PKC inhibitor GF 109203X was able to block phorbol dibutyrate induced contraction as well as the contractions caused by EGF and 224 thrombin receptor activating peptide, it can be concludeci that PKC is most likely involved in the contraction responses of al1 these agonists. The MEK inhibitor PD98059 was showun to bIock selectively and completely both EGF and thrombin receptor-activahg peptide induced contractile responses in the LM preparation Since both EGF and thrornbin receptor-activating peptide eiicitated contractile responses were sensitive to the cydo- oxygenase inhibitor indomethacin, aracbidonic acid waq added to the organ bath to contract the smooth muscle tissue. As expected, the contractile response caused by added arachidonate was also blocked by indomethacin. Thus, it was possible to compare the inhibitor profles for contractions caused by the presumed cyclooxygenase product(s) of arachidonate with contractions caused by EGF and the thrombin receptor-activating peptide. As seen hmthe data surnmarized in Table 3 -2, many of the signal pathway probes (e.g.GF109203X, PD98059, wortmannin) did not Séct arachidonate-induced contraction, and therefore must have inhibited contractions caused by EGF and thrombin receptor-activating peptide at point upstrearn of diacylgiycerol Lipase.

Overall, by using various signalling probes, it was shown that the G protein- coupled receptor for thrombin in the gastric LM tissue activates a growth factor- associateci signalling pathway (Fig. 5.2), that in many respects reflects the pathway activated by EGF. In Chapter One Section 1.3., data were reviewed indicaihg that @y subunits coming from either Gi or Gq dissociation could cause the stimuIation of MAP kinase via a tyrosine base-dependent pathway. Either Gi or Gq could in theory be involved in thrombin receptor activation in LM tissues. The involvernent of Gi codd be tested by the treatment of the tissue or the animal with pertussis toxin in vitro or in vivo. 225

The contraaile responses induced by both EGF and the thrombin receptor-

activating peptide in the LM preparation were apparaitly due to the production of

prostaglandin(s) (blocked by indomethach). The G protein-coupled receptor that is

presumed to be activated by the arachidonate metabolite(s) induced a contraction, Iike

carbachol, that was insensitive to ali inbibitors used for EGF and the thrombin receptor-

activating peptide. One possiiility to wnsider is that prostaglandin or arachidonic acid

itself may induce a contractile response via activating an unidentified intraceNular receptor.

This possibility was not evaluated. Nonetheless, the data obtained iadicated that the

endogenous arachidonic acid was fiom the enzyrnatic action of DAG lipase on

diacylglycerol instead fkom the activation of PLA, that rnight have been stimulateci by

MAP kinase (Shimini et al., 1996; Clark & Hyms, 19%; Clark et a', 1995). Since the

specific inhibitor for MEK blocked both EGF and thrombin receptor-activatirtg peptide elicited responses, MAP kinase appears to play a role in the signaüing pathway for the contractile response. MAP kinase activation could increase smooth muscle tension by a direct phosphorylation of CaD, an inhiibitory regdatory protein of the contractiie machinery, or by aaivating the myosin light chah kinase, via a direct phosphorylation. it is also possible for MAP kinase to regulate contractile machinery directly by cooperating with other contractile stimuli, such as an increase of intracellular calcium, or by mggering an unidentified pathway, that might Iead to the production of DAG, via the stimulation of

PC-PLC or PLD. Several possibilities can be considered for the comection between MEK and the activation of both PKC and PI 3-kinase to cause a contractile response. There are several pieces of evïdence pointing to a the relationship between PI 3-kinase and MAP 226

kinase activation (Urich et al., 1 995; Uehara et al.. 1995). However, the intemediate

signaihg molecules involved in the PI Ekùÿise-mediated activation ofMAP kinase have

not yet been identifieci. Some isotypes of protein kinase C, such as delta and zeta kinase C,

can be activated by the stimulation of PI 3-kinase via an as yet unknown mechanism

(Ettinger et ai-.1996; Mosthaf et ai., 1996). PhosphatidylinoStol 3,4 5-trisphosphate

(PIP3), one of the products of PI 3-kuiase, has also been shown to cause activation of

PKC(s) (Toker et ai.. 1994). In the LM tissue, it is thus possible for protein kinase C to

act as a downstream target ofPI 3-kinase in the contractile response. There are at least

two possible pathways for PKC in the LM tissue to mgger the activation of MEK, which

was implicated in the contractile response by the use of the MEK-selective inhibitor

PD98059. One group has propused that protein kinase C zeta, can be activated by PIP, and can then interact with the Ras protein both in vitro and it~vivo (Diaz-Mm el ai-.

1994b). In a cell-fiee system, it was also shown that PKC can activate MAP kinase in a

Ras-dependent pathway (VanRenterghem et al.. 1994). Aitematively, there is an increasing evidence to dernonstrate that the activation of Rafcan be induced by the direct serine phosphorylation of Raf kinase by protein kinase C (Carroll & May, 1994; Kolch et al., 1993; Arai & Escobedo, 1996; Momson, 1995; ûoldring et ai.. 1995; Eberhardt et al.. 1994; Hetu & Joly, 1979;Bem et ai., 1995; Cai et al., 1997; Ueda et ai.. 1996;Arai

& Escobedo, 1996; Carel et aL,19%; Cacace et ai., 1996; Cai ët al.. 1997). It is therefore likely that in the LM tissue, the stimulation of PI 3-kinase may- activate the MEK-MAP kinase pathway through activating PKC and Rafkinase, so as to result in a contractile response induced either by a G protein-coupled receptor or by a tyrosine kinase receptor. 227

The upstream signailhg molecule for PI 3-kinase activation via EGF receptor signahg in

the smooth muscle tissue could be either the activated EGF receptor itself(Hu et aL,

1992; Mani& Bradshaw, 1992) or c-Src kinase that is stimulateci by activation of the tyrosine kinase receptor (Oude Weemink et al.. 1994; Alonso et al., 1995; Pomerance et al.. 1994). Since the inhibitors for the c-Src fdykinase that were used in the shidies describeci in this thesis rnay also inhibit the EGF receptor tyrosine kinase at a relatively hi& concentration, it could not be concludeci unequivodly whether or not c-Src activation is involved in the EGF receptor signahg pathway that resuhs in a contractile respoase. In the contractile response induced by the thrombùi receptor-activating peptide, the activation ofeither a tyrosine kinase pathway or PI 3-kinase could occur through the

y subunits released fiom the Gi or Gq alpha subunit (Luttreil et al.. 1996; Dikic et al..

1 996; Wan et al.. 19%; Hawes et al.. 1995; Eguchi et al., 1996; Lopez-ilasaca et al.,

1997). Both Gi and Gq G proteins could be coupled to the thrornbin receptor in the smooth muscle. The contraction induced by the thrombin receptor-activating peptide in the LM tissue, however, was found to be sensitive both to the c-Src kinase inhiiiitors and to the PI 3-kinase inhibitors. The c-Src fdykinases such as p60" and p5pas weU as

PI 3-kinase have been found to participate in thrombin-induced responses in human platelets (Gutkind et al.. 1990). It has been documented in the other systems that PI 3- kinase can be activated by the Src family kinases (Fukui et al., 199 1; Prasad et al., 1993a;

Prasad et al., 1993b; Liu et al.,1993; Pleiman et al., 1994; Mak et al., 19%) through a highly specific bindlng ofthe SH3 domain in Src kinase to the prolule rich region within the 85-kilodalton subunit of PI 3-kinase. From the signalhg map (Fig. 5.2) for the Fig. 5.2 Signaiiing map for G protein coupled tbrombin receptor and EGF tyrosine kinase receptor in the contractile response of smooth musde

230 thrombin receptor-activating peptide-induced contraaile response, irnplying roles for PI 3- kinase and Src, it is likely that Src activation is upstrearn of PI 3 -kinase, although mer biochemical characteriaion will be required to cohtbis Iikelihood.

5.3. Induction of NOS in srnwth muscle preparations

The roles of tyrosine kinase pathways in the contractile response of smooth muscle were document& for ethanoz thrombin receptor-activatïng peptide and EGF in the previous sections. Since smooth muscle bction can be regulated by niaic oxide, which causes a relaxant response of smooth muscle, inducible nitric oxide synthase that can produce an excess of nitric oxide appears as an extremely important factor for the regdation of srnooth muscle fùnction. In this sectioa the induction of NOS and the differential signaihg pathways for its induction, including a tyrosine kinase pathway as described in Chapter 3, are discussed in fùrther detail.

5.3.1. Characterization of iNOS induction

The main finding described in Chapter 4 was that during the prolonged incubation of a gastric circular muscle preparation and a rat aorta ring in vi~o,there was a time- dependent spontaneous induction of iNOS in both muscle preparations. In rat aomc smooth muscle, the induction ofiNOS has been weil docurnented either in cultureci ceU systems or in the aoria of animals subject to endotoxic shock and sepsis (Szabo, 1995;

Payen er al.. 1996; Wong & Billiar, 1995). Since SOS induction has also been found in endothelial ceus (Iwashina et al.. 1996; Singh et al.,1996; Kanno et aL. 1994), the endothelium fiee aorta preparations were exploited to mdy the induction of STOS in the smooth muscle cells within the intact tissues. The spontaneous induction of NOS was 23 1 detected both by the appearance of L-arginine induced relaxation and by the detection of

iNOS mRNA usuig RT-PCR procedures. In the organ bath studies, the loss of contractile responses in aorta tissue has been observed in the presence of L-arginine by other laboratories (Jovanovic et al.,1994; Moritoki et al,, 1992). The appearance of L-arginine

(a substrate of NOS) induced relaxation (but not by D-arginine) was taken as a monitor of the induction of XOS, which is constitutive1y active unlike the eNOS in the endotheid ceUs that needs to be activated by an increase of intracelluiar calcium. The fiinctionai activity of induced SOS appears to depend largely on the presence of its substrate L- arginine and the feedback inhibition of NO to enzyme itseif. In the aorta tissue, the appearance of the L-arginine induced relaxation response may indicate not only the induction of iNOS but also the co-induction of both the L-arginine transporter and GTP cyclohydrolase, a rate limiting enzyme for tetrahydrobiopterin (a key cofactor for iNOS) synthesis. The tirnedependent induction of NOS in the aorta tissue was Merconfhned by the appearance of iNOS messenger RNA, using RT-PCR procedures, but the co- induction of the L-araginine transporter and GTP cyclohydrolase in the intact tissues was not characterized. The L-arginine reIaxation assay was exploited to monitor BOS induction in both gastric LM and CM tissues. It was show in CM tissue but not in LM tissue that there was a tirne-dependent induction of LR relaxation, like that observed in aorta tissue. In the gastrointestinai tract, the presence of bNOS iÏi nerve enâings and NOS in the myenteric plexus and the intestinal mucosa has been documented (Miller et al.,

1995). The L-arginine induced relaxation responses in the CM tissue were previously shown to be due to the production of nitric oxide through an inducible nitric oxide 232 synthase, since the selective STOS inhibitor, aminoguanidine, and the potent inhibitor for guanylyl cyclase, a main target of nitric oxide in the smooth muscle relaxation, blocked the relaxation effect of L-arginine both in the CM tissue and in the aorta preparation. The LM tissue did not show any response to L-arginioe &er a prolonged incubation in organ ba* but amitric oxide donor sodium nitroprusside could stili cause a relaxation response which was sensitive to the guanylyl cyclase inhibitor LY83583, but not to the NOS inhibitor aminoguanidie. It appeared that the induction of SiOS can only afFect the tùnction of CM tissue, but ngt the fûnction of LM. ïhere are at least two mechanisms whereby nitric oxide cari induce a relaxation response in the smooth muscle cells. It was reported that nitnc oxide cmcause membrane hyperpolarization of the smooth muscle celis via either the direct stimulation of a calcium activated K" channe1 or via indirect activation of this channel through cGMP dependent protein kinase (Lugnier & Komas, 1993; Bolotina et al., 1994). The relaxant response to L-arginine after the induction of NOS in both aorta and CM tissues was mainly due to the NO-mediated activation of guanylyl cyclase, in which the heme group specifically binds nitric oxide. The elevation of cGMP through the stimulation of guanylyl cyclase may activate the cGMP-dependent protein kinase, leading to the stimulation of the calcium activated K' channel and membrane hyperpolarization so as to induce the relaxation of the smooth muscle tissue. Although the induction of %OS in the rat aorta smooth muscle had been well documented in the litkature, the STOS induction in either longitudinal or ciradar muscle, which may participate in the smooth muscle fbnctional regulation, had not been documented when the thesis work was starteci.

It was evident that the iNOS either in the intestinal mucosa or in the nerve end'igs could 233 not account for the induction of fiuictional NOS in the CMtissue, since the L-arghine- induced relaxation response was evident both in mucosa-fke preparation and in tetrodotoxin (TTX)-treated tissue in which nerve conduction was blocked- By using an immunohistochernical approach with the specinc antriodies targeted to bNOS, BOS and macrophages, it was found that the NOS in the CM tissue was not in the smooth muscle elements, but in the macrophage-relate. cds. The conclusion that bNOS did not play a role in the fiuictional NOS induction was tiirther substantiated by the immunohistochernid detection of bNOS in the tissue both pnor to and &er the appearance of the relaxant response caused by L-arginine. The RT-PCR data, demonstrating an induction of a PCR product of the correct iNOS nucleotide sequence, in step with the appearance of an L-arginùie reIaxation added Merevidence to document the spontaneous appearance of BOS in the macrophage-related ceils within the CM tissue. Such macrophage-related ceils have been detected previoudy in the muscdaris externa of mouse smaii intestine without any identified function, These cells appear not to be involved in the infiammatory response tike the typical macrophages in the bIood

(Mikkelsen et al., 1985; Mikkelsen et ai-, 1988). This macrophage-related ce11 was not yet reported to be present in rat or guinea pig gastric or intesid tissue. Given the localition of the macrophage-related ceiis wherein NOS was induced, in close proximity to the circular muscle layer, but physicaily quite rernote Rom thelongitudùial muscle layer, it is possible to rationalie the selective fùnctional e&ct ofiNOS induction on the mechanical properties of CM preparation, but not the LM preparation. Because of the physical distance and tissue barrier between the macrophage-related ceüs and the LM 234 elernents, it is kely that the NO produced by the macrophage-related celis upon the

addition of L-arpinine was not able to diffuse fhr enough to &éct LM fhction. Wh*

the induction NOS in such macrophagerelateci cells in the submucosal layer of the

gastro-intestinal tract hl vivo might play a pathophysiologicai role in intestid motiiïty

remains an intriguing question tbat merits fkher studies. As is preswned to be the case

for the appearance of iNOS in aorta tissue during the course oforgan bath experiments

(Rees et ai.. 1990). it is possible that endotoxin or a comparable stimulus rdting fiom

the tissue dissection procedure and fiom the organ bath conditions may have been

responsible for NOS induction in the CM tissue. Under the same conditions for the CM

tissue as for the rat aorta, there was no spontaneous induction of SlOS observeci in the

CM smooth muscle elernents. The induciiility of NOS in the gastric smooth muscle cells

has yet to be documented. Whether or not a comparable induction of NOS obmed in

the macrophage-related ceiIs close to CM elements may occur in vivo in response to an

infiammatory stimulus or other inducers remains to be determined; the inducibility of

BOS in these macrophage-related ceils points to one possible role (the regulation of

smooth muscle fhction) that the ceus might play in some pathophysiolgical processes in

vivo.

5.3.2. Differential signaihg in the induction of NOS

The time-dependent induction of NOS in the CM prepaktion was substantiated by using three sets of data: (a) pharmacologie (L-arghineinduced relaxation), (b) biochemical (RT-PCRanalysis and sequencing) and (c) immunohistochemical. The bctional regdation of smooth muscle either in the gastric CM tissue or in rat aorta by Fig. 53 Differentirl induction of NOS in rat aortic smooth musde ceiIs and macrophage-reiated ceils in gastric CM tissue

23 7 nitnc oxide released from the induced BOS was evaluated with the iNOS inhiiitor, aminoguanidine, and the guanylyl cyclase inhibitor LY83583. The induction of an enzyme or a protein such as NOS in the studies wodd be expeaed to include processes such as the intracellular signalling to the nucleus, the initiation of transcription, mRNA processin& mRNA translation to the protein and post-translationai modification (Kg. 5.3). In the induction of NOS within the CM preparation and rat aorta, a widely used transcription inhibitor actinomycin D that inhibits DNA-primed RNA polymerase by cornplexhg with

DNA Ma deoxyguanosine residues was found to block the spontaneous induction of both

NOS rnessenger RNA and L-arginine-induced relaxation, suggesting that NOS induction in these tissues was et the level of gene transcription, not through regulathg mRNA stability or protein translation. The transcription of an inducible target gene can be initiated by the activation of the constitutiveIy present transcription Eictors or by removing the inhibitory protein(s) from the transcription machinery. In other cases, an intermediate transcription factor, such as c-fos, must be induced to initiate the transcription of yet another gene. In such a case, the inhibition of protein synthesis that blocks the induction of the intermediate transcription factor (Le. c-fos) may inhibit the induction of the second target gene. In rat aorta tissue, the protein synthesis inhibitor cycloheximide was found to block the induction of L-arginine induced relaxation without affecting the appearance of

NOS mRNA. In the CM tissue, however, this protein synthesis :uihibitor not only blockd the induction of L-arginine induced relaxation but also significantly attenuated the appearance of ïNOS messenger RNA monitored by RT-PCR This decrease of NOS messenger RNA in the CM tissue wuld not be aantbuted to direct action ofcycloheximide 238 on mRNA itseK since it has been reported that cycloheximide can iacrease NOS mRNA haKlife by inhibithg NOS mRNA degradation (Evans et d.1994). The presence of inducible c-fos in the macrophage-related cells within CM tissue points to the requirement of an inducible intermediate tmscription factor for the activation of NOS gene transcription (Fig. 5.2). This hding is correlated with the observation of NOS induction in murine macrophages wherein NOS induction requires the synthesis of a novel protein

(Xie et ol.. 1993). The transcription factor, M-KBhas been found to play a major role in the induction of NOS in several ce1 systems(Nu11okawa et ul.. 1996; Wong et al.. 19%) in response to various stimuli such as interleukin-lp. Two ciBiirent NF43 inhibitors, the protease inhibitor TPCK and the antioxidant PDTC have been observeci to Uihibit NOS induction, via inhibiting the activation of NF-KB (Griscavage et (11.. 1995; Schini-Kerth et al., 1994). Protease inhibitors such as TPCK attenuate NF-* activation by inhibiting the protease-induced degradation of IkB, an inbibitory protein of NF-KB; The PDTC-induced inhibition of NF-KB is thought to occur by its supression of a reaction required for the release of IKBfrom NF-- in the cytoplasm (Schreck et al.. 1992). Data presented in

Chapter 4 showed that in aorta tissue both ofthese inhibitors not only prevented the induction of L-arginine induced relaxation but also blocked the appearance of SlOS messenger RNA in the intact tissue. In wnnast, neither NF-KB inhibitor blocked the appearance of either L-arghhe-induced relaxation or iNOS meiienger RNA in the CM preparation. These findings have indicated that NF-KB very likely plays a role for BOS induction in aona smooth muscle celis, but not in the macrophage-related cells in the CM preparation Thus, aithough both in aorta tissue and in the macrophage-related ceils of the 239

CM preparation, NOS was found to be spontaneously induced under the same organ bath conditions, there were merences between the signalhg pathways for NOS induction as shown by uskg the two NF-KB inhibitors and the protein synthesis inhiiitor cycloheximide.

In addition to the involvernent of NF-KB in the induction of NOS, a role for a tyrosine kinase pathway was probed by the tyrosine kinase inhibitors genistein, tyrophostin

47 (AG213) and herbimycin A (see Section 1.4.5.5.). In rat aorta tissue, it was found that these three tyrosine kinase inhiiitors blocked the induction of L-arginine induced relaxation, but did not affect the appearance of SlOS messenger RNA. In contrast, in the

CM tissue, these inhtiitors did not affect either the induction of L-arginine mediated relaxation or the appearance of BOS messenger RNA. These findiigs indicated that a tyrosine kinase pathway may play some role in a process after BOS gene transcription in rat aorta tissue. The tyrosine phosphorylation of SJOS has been shown to play an important roIe to maintain the activity of iNOS (Pan et al., 1996). In the rat aorta tissue, whether or not tyrosine kinase inhibitors blocked the induction of functional iNOS activity by Uihibiting the tyrosine phosphorylation of SIOS itselfis a question that requires Mer study. Altftough the induction of STOS messenger RNA in bath rat aorta and CM tissues was not affecteci by the tyrosine kinase inhibitors, the inhibition of L-aginine induced rdaxation in the rat aorta but not in the CM preparation by thes6 inhibitors has pointed to one more difference between the smooth muscle ceiis in the aorta and the macrophage- related cells in CM preparatioq in tenns of the post-transcriptional processes that regdate iNOS activity. Given that tyrosine kinase activity may be involveci in the induction of 240

STOS either by modulating gene transcription or by regulating a pcist-translational

modification tyrosine phosphatase is also LikeIy to participate in the induction of NOS. An

&ect of tyrosine phosphatase on NOS induction had not been documented at the time the

studies describai in this thesis were begun- In rat aorta tissue, the tyrosine phosphatase

inhibitor vanadate was found to biock not oniy the induction of GarginUie induced

relaxation but dso the induction ofiNOS messager RNA; in contrast, no such efEm was

observed in the CM preparation Thus, in the aorta tissue, the data obtained with the

tyrosine kinase inhibitors and with the tyrosine phosphatase inhibitor indicated a cornplex

roIe for tyrosine kindtyrosine phosphatase in the course of SlOS induction. In terms of the involvement of NF-& activation in iNOS induction in the rat aorta tissue, it may be speculated that the tyrosine phosphatase inhibitor vanadate inhibited NOS gene transcription by blocking the activation of NF-KB. Tbis specdation is supporteci by the observation in human myeloid ML-la ceUs that tyrosine phosphatase inhi'bitors such as vanadate and pervanadate cmblock the activation of NF-KBinduced by several stress stimuli such as IL-1 and PMA (Singh & Aggarwai, 1995). Whether or not this inhibition of NF-- activation by vanadate was respom'ble for the block of NOS induction in the intact aorta tissue remaùrs to be determinecl.

In paraiiel with the ability of the cytokine IL19 to cause the induction of NOS in the cultureci celis, it was found that, in the rat aona tissue but not in CM tissue, IL-I Q treatment, in a concentrationdependent manne, induced a marked increase in the induction of iNûS shown by both L-arme induced relaxation and by the appearance of

NOS messenger RNA. The signalling pathways for iNOS induction caused by IL-1P in 241

the aorta tissue was characterïzed merwith the sarne signal pathway probes as those

used for the characterization of the spontaneous induction of NOS: the tyrosine kinase

inhibitors genistein and tyrphosth 47 (AG213), the tyrosine phosphatase inhibitor

vanadate, and the two NF-KB inhitors. The data indicated that the signal transduction pathways for the induction of NOS by IL-IP in the intact tissue appeared to be in common with those invoived in the spontaneous induction of NOS in the tissue. Since IL

i P has been documenteci to be synthesized in vascular smooth muscle (Libby et ai-. 1995;

Beasley et al-, 1995, Forreca et al., 1995; Wdcox et al.. 1994), it is thus possible that IL-

1P may have been responsible for an autocrine induction of NOS in the rat aorta tissue.

In contrast with the aorta tissue, IL4 B did not appear to cause an uicrease in the induction of BOS in the CM tissue. Since the dects of IL-1P on transcription ean be mediated via NF-- (Schindler, 1995; Kishimoto et al., 1994), the inability of the NF43 inhi'bitors to affect ïNOS induction in the CM tissue also argueci against ILlp acting as an autocrine factor for the induction of NOS in the CM tissue. The data indicated that NOS induction in the CM tissue proceeds via a mechanism that does not involve NF-kB.

5.3.3. Summary

The induction of NOS in both the rat aorta and the gastric CM preparation has been document& in this thesis, with the Merlocalization of 1NOS in the macrophage- related ceUs within the CM tissue and in the smooth muscle ehents of the aorta. It was shown by the L-arginine relaxation assay, that the induaion of NOS with the absequent production of nitric oxide can affkct srnooth muscle function. The signalhg by nitric oxide to induce a relaxation response is due to its stimulation of guanylyi cyclase in the intact 242

tissues such as the aorta and gasmc CM preparations. The induction of NOS in the

macrophage-related cells ofthe CM tissue appears to require the synthesis ofa novel

protein to initiate the traascnption of the SOS gene. Although the transcriptional

activator NF-* may not be involved in NOS induction in the macrophage-related ceils, it does appear to-play a role in iNûS induction in the rat aorta smooth muscle cens. The tyrosine phosphatase inhiiitor, vanadate, blocked the induction of NOS in rat aorta, possibly via its inhibition of NF-KB in the cytoplasm. In the BOS induction process, a tyrosine kinase pathway appears not to play a role for BOS induaion in the macrophage celis, but appears to be involved in a post-translational modification of NOS in the rat aorta tissue, wherein the fimaional advity of the enzyme is afEécted. The potentiation of the spontaneous induction of NOS by ILIP in the rat aorta tissue was not observed in the macrophage-reiated cells in the gastric CM. Al1 the differences between the NOS induction in the rat aorta and the CM tissue irnply a unique signalhg pathway for the induction of NOS in the macrophage-related ceils. The exact role of such a macrophage- reIated cell and the stimuli for the induction ofiNOS in these cells remain to be detennined. Nonetheless, the nitnc oxide reieased hmthe induced NOS in such ceiis could potentiaily play a role in regulating gastric smooth muscle f'unction, like the induction of iNOS in the rat aorta tissue wherein the induction of iNOS is thought to play a role in regulating vascular smooth muscle f'unction. ABEBE, W.AND AGRAWAL, D. K. RoIe of tyrosine kinases in norepinephnne-induced contraction of vascular smooth muscle. Journal of Cardiovascular Pharrnacology 26: 153-159, 1995.

ABU-SOUD, H. M. AND STUEHR, O. J. Nicoxide synthases reved a role for calmodulin in controllhg electron transfer. Pmxdhgs of the Nationai Academy of Sciences of the United States of Arnerica 90: 10769-10772, f 993.

ADAM, L. P., HAEBERLE, J. R AND HATHAWAY, D-R Phosphorylation of caldesmon in arterial smooth muscle. Journal of BioIogical Chemistry 264: 7698-7703, 1989.

ADAM, L. P. AND HATHAWAY,D. R Iddcation of mitogen-activated protein kinase phosphorylation sequences in madanh-Caldesmon. FEBS Letters 322: 56-60, 1993.

AKIYAMA, T., ISHiDA, J., NAKAGAWA, S., OGAWARA, H., WATANABE, S., ITOH, N., SHLBUYA, M. AND FUKAMI, Y. Genisteh, a specific inhibitor of tyrosine-specific protein kinases. Joumai of BioIogicaI Chemistry 262: 5592-5595, 1987.

ALESSI, D., MACDOUGALL, L. K., SOLA, M. M., IKEBE, M. AND COHEN, P. The control of protein phosphatase-1 by targetting subunits. The major myosin phosphatase in avian smooth muscle is a novel form of protein phosphatasel. European Journal of Biochemistry 210: 1023-1035, 1992.

ALONSO, G., KOEGL, M., -0, N. AND COURTNEIDGE, S. A Sequence requirements for binding of Src family tyrosine kinases to activated gowth factor receptors. Journal of Biological Chernistry 270: 9840-9848. 1995.

ANDERSON,N. G., MALLER, J. L., TONKS, N. K. AND STURGIU, T-W. Requirement for integration of signals &om two distinct phosphorylation pathways for activation of MAP kinase. Nature 343: 65 1-653, 1990.

ARAI, H. AND ESCOBEDO, J. A. Angiotensin II type 1 recepwr signals through Raf-1 by a protein kinase C-dependent. Ras-independent mechanism. Motecular PharmacoIogy 50: 522-528, 1996.

ARIAS, J., ALBERTS, A. S., BRINDLE, P., CLARET, F. X., SMEAL, T., KATUN, M., FERNSCO, J. AND MONTMINY, M. Activation ofcAMP and mitogen responsive genes relies on a common nuclear factor. Nature 370: 226-229, 1994. ARVIDSSON, A K., RWP, E., NANBERG, E., DOWNWARD, J., RONNSTRAND, L., WENNSTROM, S., SCHLESSINGER, J., HELDIN, C. H. AM) CLAESSON-WELSH, L. Tyr-716 in the plateletderïved growth factor beta-receptor kinase insert is involved in GRB2 binding and Ras activation. Molecular & Cellular Biology 14: 671 5-6726, 1994.

ASSON-BATRES, M A, SPURGEON, S. L., DIAZ, J., DELOUGHERY, TT.G. AND BAGBY, G. C., IR. Evolutionary conservation of the AU-rich 3' untranslateci region of messenger RNA_ Proceedings of the National Academy of Sciences of the United States of America 91: 1318-1322. 1994.

BAEK, K. J., T',B. A., LUCAS, S. AND STUEHR, D. J. Macrophage nitric oxide synthase subunits. Purification, characterization, and role of prosthetic groups and substrate in regulating their association into a dimeric enzyme. Journal ofBiologicaI Chemimy 268: 2 1120-21 129,1993.

BAEUERLE, P. A AND BALTIMORE, D. 1 kappa B: a specific inhi'bitor of the NF-kappa B transcription factor. Science 242: 540-546, 1988.

BAEUERLE, P. A. AND BALTIMORE, D. NF-kappa B: ten years after. Cell87: 13-20, 1996.

BAEUERLE, P. A AND HENKEL, T. Function and activation of NF-kappa B in the immune system. Ipeview] [19 1 refs]. Annual Review of lmmunology 12: 141-1 79, 1994.

BALDWIN, A S., JR The NF-kappa B and 1 kappa B proteins: new discoveries and insights. [Review] [180 refs]. Annual Review of Irnrnunology 14: 649-683, 2996.

BARROGA, C. F., STEVENSON,J. K., SCHWARZ, E. M. AND VERMq 1. M. Constitutive phosphorylation of 1 kappa B alpha by casein kinase iI. Proceedings of the NationaI Academy of Sciences of the United States of Arnerica 92: 7637-7641, 1995.

BEASLEY, D., SCHWARïZ, J. H. AND BRENNER, B. M. Interleukin 1 induces prolonged L-arginine-dependent cyclic guanosine monophosphate and nitrite production in rat vascular smooth muscle celis. Journal of Clinical Investigation 87: 602-608, 1991.

BEASLEY, D., MCGUIGGIN, M. E. AND DINARELLO. C. A. Human vdarsmooth muscle cells produce an intracellular form of interleukin-1 receptor antagonist. American Journa1 of Physiology 269: Pt 1):C961-8, 1995.

BEG, A A AND BALDWIN, A S., JR The 1 kappa B proteins: multilünctional regulators of Rem-kappa B transcription factors. [Review] [52 refs]. Genes & Development 7: 20W-2070, 1993. BENHAM, C. D., HESS, P. AND TSLEN, R W. Two types of calcium channeIs in single smooth muscle cells fiom rabbit ear artery studied with whole-celi and single-channel recordings. Circulation Research 61: Pt 2):1106, 1987.

BEMIAU, C. D. AND TSm,R W. A novel receptor-operated Ca2+-permeablecharme1 adivated by ATP in smooth muscle. Nature 328: 275-278, 1987.

BERK, B. C., BROCK, T. A-, WEBB, R C.,TAUBMAN, M. B.. ATKINSON, W. J., GIMBRONE, M. k AND ALEXANDER R W. Epidermal growth factor, a vascular smooth muscle mitogen, induces rat aomc contraction Journal of Clinid Investigation 75: 1083-2086, 1985.

BERK, B. C., ALEXANDER, R W., BROCK, T. A., GIMBRONE, M. A, X AND WEBB, R C. VasocoIlStriction: a new activity for platelet-derived growth factor. Science 232: 87-90, 1986.

BERK, B. C. AND ALEXANDER, R W. Vasoaaive effects of growth factors. [Review] [77 refs] . Biochernicd Pharmacology 38: 2 19-225, 1989.

BERNER, P. F., SOMLYO, A V. AND SOMLYO,A P. Hypertrophy-induced increase of intermediate £ilamentsin vascuiar smooth muscle. Journal of Ceil Biology 88: 96- 100, 1981,

BERRA, E., DIAZ-MECO, M. T., LOZANO, J., FRUTOS, S., MUNICIO, M. M-, SANCHEZ,P., SN,L. AND MOSCAT, J. Evidence for a role of MEK and MAPK during signal transduction by protein kinase C zeta. EMBO Journal 14: 6 15 7-6163, 1995.

BERRIDGE, M. J. Inositol trisphosphate and calcium signalling. peview] 11 59 refs]. Nature 361 : 3 1 5-325, 1993.

BLANCO,F. J., GENG, Y. AM)LOTZ, M*Differentiation-dependent effects of IL4 and TGF-beta on human articular chondrocyte proliferation are related to inducible nitnc oxide synthase expression. Journal of Immunology 154: 40 18-4026, 1 995.

BLAUSTEIN, M. P. Physiological effects of endogenous ouabain: control of intracellular Ca" stores and ce11 responsiveness. [Review] [283 refs]. Amen- Journal of Physiology 264: Pt 1):C 1367.87, 1993.

BLAY, J. AND HOLLENBERG, M. D. The nature and fiinction of polypeptide growth factor receptors in the human placenta meview]. Journal of Developmental Physiology 12: 237-248, 1989. BLENIS, J. Signal transduction via the MAP kinases: proceed at your own RSK. [Review] [72 refs]. Proceedcrngs of the National Academy of Sciences of the United States of Arnerica 90: 5889-5892, 1993.

BOGUSKI, M S. AND MCCORMICK, F. Roteins regulating Ras and tsrelatives. meview] [128 refs]. Nature 366: 643-654, 1993.

BOHJANEN, P. R,PETRYNLAK, B., JUNE, C. H-,THOMPSON, C. B. AND LNDSTEN, T. AU RNA-binding factors Mer in their binding specificities and fities. Joumal of Biological Chemisw 267: 63 02-6309, 1992.

BOLEN, J. B. Nonreceptor tyrosine protein kinases. meview] [IO2 refs]. Oncogene 8: 2025-203 1, 1993,

BOLOTTNq V. M., NAWI, S., PALACINO, J. J., PAGANO, P. J. AND COHEN,R A. Nitric oxide directly activates calcium-dependent potassium channels in vascuIar smooth muscle*Nature 368: 850-853, 1994.

BOULTON, T. G., YANCOPOULOS, G. D., GREGORY,J. S., SLAUGER. C., MOOMAW, C., HSU, J. AND COBB, M. H. An insulin-stimulated protein kinase similar to yeast kinases Uivolved in ce11 cycle control. Science 249: 64-67, 1990.

BOWTELL, D., RI, P., SIMON,M- AND SENIOR, P. Identification of murine homologues of the Drosophila son of sevenless gene: potential activators of ras. Proceedings of the National Academy of Sciences of the United States of America 89: 6511-6515, 1992.

BREDT,D. S., HWANG, P. M. AND SNYDER, S. H. Localkation of nhic oxide synthase indicating a neural role for nitric oxide. Nature 347: 768-770, 1990.

BREDT, D. S., FERRIS, C. D. AND SNYDER, S. H. Nitric oxide synthase regdatory sites. Phosphorylation by cyclic AMP-dependent protein kinase, protein kinase C, and caicium/caimodulin protein kinase; identification of flavin and calmodulin binding sites. Journal of Biological Chemistry 267: 1097640981, 1992.

BREDT,D. S. AND SNYDER S. H- Isolation of aihic oxide synthetase, a calmodulin-requinng enzyme. Proceedings of the National Academy of Sciences of the United States of America 87: 682-685, 1990.

BREDT, D. S. AND SNYDER, S. H. Nitric oxide: a physiologie messenger molecuie. [Review] [1 63 refs] . Annual Review of Biochemistry 63: 175- 1 95, 1994. BROCKMAN, J. A., SCHERER,D. C., MCKZNSEY, T. A, HALL, S. M., QI, X-, LEE, W. Y. AND BALLARD, D. W. Coupling of a signai response domain in 1 kappa B alpha to multiple pathways for NF-kappa B activation- Molecular & Cellular Biology 15: 2809-28 18, 1995.

BROWN, K., GERSTBERGER, S., CARLSON, L., FRANZOSO, G. AND SIEBENLIST, U. Control of I kappa B-alpha proteolysis by site-specific, signai-induced phosp horylation. Science 267: 1485-1488, 1995.

BURGERiNG, B. M. T. AND COFFER, P. J. Protein kinse B (c-Akt) in phosphatidyihositoI3-OH-kinase signai transduction Nature 376: 599-602, 1995.

BUSCONI, L. AND MICHU, T. Endotheiial nitric oxide synthase. N-terminal myristoylation detemu-nes subceüular localizatio~Journal of Biological Chemistry 268: 8410-8413, 1993.

CACACE, A M., UEFFING, M., PHILIPP, A., HAN, E. K., KOLCH, W. AND WEINSTEIN, 1. B. PKC epsilon bctions as an oncogene by enhancing activation of the Raf kinase. Oncogene 13: 25 17-2526, 1996.

CAI, H,, SMOLA U., WIXLa V., EISENMANN-TAPPE, I., DM-MECO, M. T,, MOSCAT, I., RAPP, U. AND COOPER G. M. Role of diacylglycerol-regtilated protein kinase C isotypes in growth Mar activation of the Raf-1 protein kinase. Molecuiar & Cellular BioIogy 17: 73 2-74 1, 1997.

CAREL, K., KUMMER J. L., SCHUBERT, C., LEI= W., HEJDENREICH, K.. A AND DRAZNIN, B. Insulin stimuiates mitogen-activated protein kinase by a Ras-independent pathway in 3T3-L1 adipocytes. Journal of Biological Chemisûy 271: 30625-30630, 1996.

CARROLL, M. P. AND MAY, W. S. Protein kinase C-mediateci senne phosphorylation directly activates Raf-1 in murine hemtopoietic cells. Journal of Biological Chemistry 269: 1249- 1256, 1994.

CASEY, P. J. Lipid modifications of G proteins. [Review]. Current Opinion in Ce11 Biology 6: 219-225, 1994.

CHAMPION-ARNAUD, P., GESNEL, M. C., FOULKES, N., RONSIN, C., SASSONE-CORSI, P. AND BREATHNACH, R Activation of transcription via AP-I or CREB regdatory sites is blocked by protein tyrosine phosphatases. Oncogene 6: 1203-1209, 1991. CHARLES, 1. G., PALMER R M., HICKERY, M. S., BAYLISS, M. T., CHUBB, A P., HALL, V. S., MOSS, D. W. AND MONCADq S. Cloning, characterization, and expression of a cDNA eacoding an inducible nitric oxide synthase f?om the human chondrocyte. Proceedings of the National Academy of Sciences of the United States of America 90: 11419-1 1423, 1993.

CHARTRAIN, N. A, GELLER, D. A, KOTY, P. P., SITEUN, N. P., NUSSLER, A K-, HOFFMAN, E. P., BIUIAR, T. R, HUTCHINSON, N. 1. AND MUMJETT, J. S. Molecdar clonin& structure, and chromosod localization of the human induàble nitric oxide synthase gene. Journal of Biological Chemistry 269: 67654772, 1994.

CHEATHAM, B., VLAHOS, C. J., CHEATHAM, L., WANG, L., BLENIS, J. AND KAHN, C. R Phosphatidylinositol3-kinase activation is required for insulin stimuiation of pp70 S6 kinase, DNA synthesis, and glucose transporter translocation. Molecular & Cellular Biology 14: 4902-49 11, 1994.

CHEN, J., DEMVO, M., DINGUS, J., HARRY, A, LI, J., SUI, J., CARTY, D. J., BLANK, J. L., EXTON, J. H.,STOFFEL, R H. AND et al: A region of adenylyl cyctase 2 critical for regdation by G protein beta gamma subunits. Science 268: 1 166-1 169, 1995.

CHEN, W.,LAK, M., ROBINSON, P. J. AND KEMP, B. E. Phosphorylation of phospholamban in aortic smooth muscle cells and heart by caicium/calmodulin-dependent protein base II. Cellular Signalluig 6: 61 7-630, 1994.

CHUNG, J., GRAMMER, T. C., LEMON, K. P., KAZLAUSKAS, A AND BLENIS, J. PDGF-and insulin-dependent ~~70'~activation mediated by phosphatidylinositol3-OH kinase. Nature 370: 71-75, 1994.

CLAPHAM, D. E. AND NEER, E. J. New roles for G-protein beta gamma-dimers in transmembrane signding. meview]. Nature 365: 403406, 1993.

CLARK,E. A. AND HYNES,R O. Ras activation is necessary for integrinmediateci activation of extracellular signai-regulated kinase 2 and cytosolic phosphoiipase A, but not for cytoskeletai organization. Journal of Biological Chemistry 27 1: 14814- 148 18, 1996.

CLARK, J. D., SCHIEVELLA, A. R,NALEFSKI, E. A AND LIN, L. L. Cytosolic phosp holipase A2. peview] [ 13 9 refs]. Joudof Lipid ~ediat&s& Ce11 Signalling 12: 83-1 17, 1995.

CLEMENT, B., SCHULTZE-MOSGAU, M. H., RICHTER, P. H. AND BESCH, A. Cytochrome P4504ependent N-hydroxylation of an amùioguanidine (amidinohydrazone) and microsoma1 retroreduction of the N-hydroxylated product. Xenobiotica 24: 67 1688, 1994. CONTI, M. A AND ADELSTEIN, R S. The relationship between calmodului binding and phosphorylation of smooth muscle myosin kinase by the catalytic subunit of 3'5' CAMP-dependentprotein kinase. Journal of Biological CheMstry 256: 3 178-3 18 1, 198 1.

COOK, S. J. AM) MCCORMICK, F. Inhibition by CAMP of Kasdependent activation of Raf Science 262: 1069-1 072, 1993.

CORBETT,J. A, KWON, G., TURK, I. AND MCDANIEL, M. L. [LI beta induces the coexpression of both Ntric oxide synthase and cyclooxygenase by islets of Langerhans: activation of cyclooxygenase by nitric oxide. Biochemistry 32: 13767-13 770, 1993.

CORBETT,J. A, KWON, G, h4ARINO. M H., RUDI, C. P., SULLIVAN, P. M., TURK, I. AND MCDANIEL, M. L. Tyrosine haseinhibitors prevent cytokine-induced expression of iNOS and COX-2 by human islets. American Journal of Physiology 270: Pt 1):C1581-7, 1996.

COUGMLIN, S. R, ESCOBEDO, J. A AM) WILLIAMS. L. T. Role of phosphatidylinositol kinase in PDGF receptor signal transduction Science 243: 1191-1 194, 1989,

CRESPO, P., XU, N., SIMONDS, W. F. AND GUTKMD, J. S. Ras-dependent activation of MAP kinase pathway mediateci by G-protein beta gamma nibunits Nature 369: 418-40, 1994.

DAUB, H.,WEISS, F. U., WALLASCH, C. AND ULLRICH, A. Role of tramactivation of the EGF receptor in signalling by G-protein-coupled recepton. Nature 379: 557-560, 1996.

DE VRIES-SMITS, A. M., BURGERING, B. M.,LEEVERS, S. J., MARSHALL, C. J. AND BOS,J. L. Involvement of p2 in activation of extracellular signal-regulated kinase 2. Nature 357: 602-604,1992.

DWAKOTT, S. N., BROSNAN,J. T.,HERZBERG, G. R AND BROSNAN, M. E. Rend arginine synthesis: studies in vitro and in vivo. American Journal of Physiology 259: Pt 1):E437-42, 1990.

DIAZ-GUERRA,M. I., BODELON, O. G., VELASCO. M.. ~LAN,R. PARKER, P. J. AND BOSCq L. Up-regdation of protein kinase C-epsilon promotes the expression of cytokine-inducible Ntric oxide synthase in RAW 264.7 cells. Journal ofBiologica1 Chemisw 271: 32028-32033,1996. DIAZ-MECO, M. T., DOMINGUEZ, 1.. SM,L., DENT, P., LOZANO,J., MUNICIO, M. M., BERRA, E., HAY, R T., STURGILL, T. W.AND MOSCAT, J. zeta PKC induces phosphorylation and inactivation of I kappa B-alpha in *o. EMBO Joud 13: 2842-2848, 1994a

DIAZ-MECO, M T., LOZANO,J., MUNlCI.0, M. M, BERRA, E., FRUTOS, S., SANZ,L. AND MOSCAT, J. Evidence for the in vitro and in vivo interaction of Ras with protein hase C zeta Journal of Biological Chemistry 269: 3 1706-3 1710, 1994b.

DIXSTRA, C. D., DOPP, E. A, JOLWG, PP.AND KRAAL, G. The heterogeneity of mononuclear phagocytes in lymphoid organs: distinct macrophage subpopulations in the rat recognized by monoclonal antiïodies ED 1, ED2 and ED3. Immunology 54: 589-599, 1985.

DWC, L, TOKIWA, G., LEV, S., COURTNEIDGE, S. A. AND SCHLESSINGER, J. A role for PykZ and Src in linking G-protein-coupled recepton with MAP kinase activation. Nature 383: 547-550, 1996.

DIMMELER, S., LOTTSPEICH, F. AND BRUNE, B. Nimc oxide causes ADP-ribosylation and inhibition of glyceraldehyde-3-phosphate dehydrogenase. Journal of Biological Chernistry 267: 1677 1- 16774, 1992.

DINERMAN, J. L., LOWENSTEIN, C. J. AND SNYDER S. H. Moledar mechanisrns of nitric oxide regdation- Potential relevance to cardiovascular disease. [Review]. Circulation Research 73: 2 17-222, 1993.

DONG,Z., QI, X., XE, K AND FIDLER 1. I. Protein tyrosine kinase inhibitors decrease induction of nitric oxide synthase activity in lipopolysaccharide-responsive and lipopolysaccharide-nonresponsive murine macrophages. Journal of Immunology 151: 27 17-2724, 1993.

DUDLEY, D. T., PANG, L., DECKER, S. J., BRIDGES, A J. AND SALTEL, k R A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proceedings of the National Acaderny of Sciences of the United States of America 92: 7686-7689, 1995.

DUFF, J. L., QUINLAN, K. L., PAXTON,L. L., NAIK, S. M. -ANDCAUGHMAN, S. W. Pervanadate mirnics IFNgamma-mediated induction of ICAM-1 expression via activation of STAT proteins. Journal of Investigative Dennatology 108: 295-301, 1997.

DURANTE, W.,CHENG, K. AND SC- A 1. Cyclic nucleotide regdation of interleukin-1 beta induced aitnc oxide synthase expression in vwular smooth muscle cells. Thrombosis Research 75: 63-7 1, 1994. EASON, S. AM) MARTIN, W. Involvement of tyrosine kinase and protein kinase C in the induction of nitric oxide synthase by iipopolysaccharide and interferon-gamma in J774 macrophages. Archives Internationales de Pharmacodynamie et de Therapie 330: 225-240, 1995.

EBERHARDT, W., KUNZ, D. AND PFEILSCHIFïER, J. Pyrrolidine dithiocarbamate diEerential1y afZects interieukin I beta- and CAMP-inducednitric oxide synthase expression in rat rend mesangid celis. Biochemical & Biophysicd Research Communications 200: 163-1 70, 1994.

EGAN, S. E., GIDDINGS, B. W.,BROOKS, M. W., BUDAY, L., SEELAND, A M. AND WEINBERG, R A Aciation of SOSRas exchange protein with Grb2 is implicated in tyrosine kinase signal transduction and transformation. Nature 363: 45-5 1, 1993.

EGUCHI, S., MATSUMOTO, T., MOTLEY, E. D., UTSUNOMIYA, H. A. INAGAMI, 1,Identification of an essentid signalling cascade for mitogen-activated protein kinase activation by angiotensin II in cultureci rat vasdar smooth muscle ceUs. Possible requirement of Gq-mediateci p2 1" activation coupled to a Ca2*/&odutin-sensitive tyrosine kinase. Journal of Biological Chemistry 271 : 14169-14175,1996.

EL-HILLAL, O., KUROSAKI,T., YAMAMURA, H.,KINET, J. P. AND SCHARENBERG, A MM.Syk kinase activation by a src kinase-initiated activation loop phosphorylation chain reaction. Proceedings of the National Acaderny of Sciences of the United States of Amenca 94: 19 19- 1924, 1997.

ETTINGER, S. L., LAUENER R W. AND DURONIO, V. Protein kinase C delta specifically associates with phosphatidylinositol3-kinase following cytokine stimulation. Journal of BiologicaI Chemistry 271: 145 14-145 18, 1996.

EVANS, T., CARPENTER, A. AND COHEN,J. Inducible nitric-oxide-synthase mRNA is transiently expresseci and destroyed by a cycloheximide-sensitive process. European Journal of Biochemistry 219: 563-569, 1994.

FANTL, W.J., JOHNSON, D. E. AND WIUIAMS, L. T. Signalling by receptor tyrosine kinases. [Review] [Z3 1 refs]. Annuai Review of Biochemistry 62: 453-48 1,1993-

FANTL,W. J., MUSLIN, A I., KMUCHi, A, MARTIN,J. A, MACNICOL, A M., GROSS, R, W. AM) WIUiAMS, L. T, Activation of Raf-1 by 14-3-3 proteins. Nature 371: 612-614, 1994. FEDERMAN, A D., COMLIN, B. R. SCHRADER., K. A., RED, R R AM) BOURNE, H. R Hormonai stimulation of adenylyl cyclase through Gi-protein beta gamma subunits. Nature 356: 159-1 6 1, 1992.

FEIG, L. A AND SCHAFFHAUSEN, B. Signai transduction. The hunt for Ras targets [news; comment]. Nature 370: 508-509, 1994.

EINSTEIN, D. L., GALE4 E., CERMAK, J., CHUGH, P., LYANDVERT,L. AND REIS, D. J. Nitric oxide synthase expression in glial cells: suppression by tyrosine kinase inhibitors. Journal of Neurochemistry 62: 8 11-8 14, 1994.

FEINSTEIN, D, L., GALE4 E., AQUINO, D. A,, LI, G. C., Xü, H. AND REIS, D. J. Heat shock protein 70 suppresses astroglial-inducible nitic-oxide synthase expression by decreasing NFkappaB activation. Journal of Biological Chemistry 271: 17724-17732, 1996.

FINGAR, D. C.. HAUSDORFF, S. F., BLENIS, J. AND BIRNBAUM, M. J. Dissociation of ppïO niosornai protein S6 kinase fiom insulin-stimuiated glucose transport in 3T3-LI adipocytes. Journal of Biological Chemistry 268: 3005-3008, 1993.

FORSTERMANN, U-, NAKANE, M., TRACEY, W. R AND POLLOCK, J. S. Isoforms of nitnc oxide synthase: tùnctions in the cardiovascular system. [Review]. European Heart Journal 14: Suppl 1: 10-5, 1993.

FR-, T-F., YANG, S.-L., CHAN, T. O., DATTA, K., KAZIAUSKAS, A., MORRISON, D. K., KAPLAN, D. R AND TSICHLIS, P. N. The protein kinase encoded by the Akt prto-oncogene is a target of the PDGF-activated phosphoatidylinosito1 3-kinase. CeU 81: 727-736, 1995.

FRANKE, T. F., KAPLAN, D. R, CANTLEY, L. C. AM) TOKER, A Direct regdation of the Akt proto-oncogene product by phosphatidylinositol-3,4bisphosphate. Science 275: 665-668,1997.

FRANTZ, B., NORDBY, E. C., BREN, G., STEFFAN, N., PAYA C. V., K.INCAID, R L., TOCCI, M. J., O'KEEFE, S. J. AND O'NEILL, E. A. Calcineurin acts in synergy with PMA to inactivate 1 kappa B/MAD3, an inhibitor of NF-kappa B. EMBO Journai 13: 86 1-870, 1994.

FREED,E., SYMONS, M., MACDONALD, S. G., MCCORMICK, F. AND RUGGIERI,R Binding of 14-3-3 proteins to the protein kinase Raf and effects on its activation. Science 265: 1723-1716, 1994. FRODM, M.,PERALDI, P. AND VAN OBBERGEEN, E. Cyclic AMP activates the mitogen-activateci protein kinase cascade in PC12 cells. Journal of Biological Cheniistry 269: 6207-6214,1994.

FRY, D. W.,KRAKER, A J., MCMICHAEL, A, AMBROSO, L. A, NELSON,J. M., LEOPOLD, W. R,CONNORS, R W. AM)BRIDGES, k I. A specinc inhibitor of the epidermai growth factor receptor tyrosine kinase. Science 265: 1093- 1095, 1994.

Y., SALTEL, A R AND HANAFUSA, H-Phosphatidylinosito13-kinase is activated in v-src, v-yes, and v-fps transformed chicken embryo fibroblasts. Oncogene 6: 407-41 1, 1991.

FURUKAWA, K-,TAWADA-IWATA, Y. AND SHIGEKAWA, M. Modulation of plasma membrane ca2+pump by membrane potential in cultured vascular smooth muscle cells. Journal of Biochernistry 106: 1068- 1073, 1989.

GALE& E., REDDI, J. AND FEINSTEIN, D. L. Differentiai suppression of glial nitnc oxide synthase induction by stnicturaily related tyrosine kinase inhibiton. Neuroscience Letters 200: 195-198, t 995.

GAN, B. S., HOLLENBERG,M. D., MACCANNELL, K. L., LEDERIS, K., WiN'KLES M. E. AND DERYNCK, R Distinct vdaractions of epidedgrowth factor-urogastrone and transforming growth factor-alpha- Journal of Pharmacology & Experimental Therapeutics 242: 3 3 1-3 37, l987a.

GAN, B. S., MACCANNELL, K. L. AND HOLLENBERG, M. D. Epided growth factor-urogastrone causes vasodilatation in the anesthetized dog. Journal of Chcal Investigation 80: 199-206. 198%

GAN, B. S., HOLLENBERG, M. D. AND LEDERIS, K. Epidemal growth factor-urogastfone (EGF-URO) causes contraction of porcine coronary artenal strips: inhibition by indomethacin. Proceedings of the Western Pharmacoiogy Society 32: 269-271. 1989.

GEKELER, V., BOER, R,ISE, W.,SANDERS, K. H.. SCHACHIELE, C. AND BECK, J. The specific bisindolylmaleimide PKC-inhibitor GF 1O92O3X efficiently modulates MRP-associated multiple dmg resistance. ~iochemicd& Biophysicai Research Communications 206: 1 19- 126, 1995. GELLER, D. A, LOWENSTEIN, C. J., SHAPIRO, R A, NUSSLER, A K., DI SILVIO, M., WANG, S. C., NAKAYAMA, D. K., SIMMONS, R L.. SNYDER, S. H. AND BLLWT. R Molecula.cioning and srpression of inducible Rime oxide synthase fiom human hepatocytes. Proceedings of the National Academy of Sciences of the United States of America 90: 349 1-3 495, 1993.

GENG, Y.,MAIER, R AM) LOTZ, M. Tyrosine kinases are involveci with the expression ofinducible nimc oxide synthase in human articular chondrocytes. Journal of Cellular Physiology 163: 545-554, 1995.

GIOVANELLI,J., CAMPOS,K L. AMI KAUFMAN, S. Tetrahydrobiopterin, a cofacctor for rat cerebellar nitnc oxide synthase, does not hction as a reactant in the oxygenation of arginine. Proceedings of the National Academy of Sciences of the United States of Arnerica 811: 709 1-7095, 1991.

GLENNEY, J. R-,JIL, ZOKAS, L. AM)KAMPS, M. P. Monoclonal antibodies to phosphotyrosine. Journal of Immunologicai Mahods 109: 277-285, 1988.

GOLD. M.E., WOOD, K. S., BYRNS, R E., BUGA, G. M. AND IGNARRO, L. J. L-arghhe-dependent vascular smooth muscle relaxation and cGMP formation. American Journal of Physiology 259: Pt 2):H18 13-21, 1990.

GOLDRING, C. E., NARAYANAN, R,LAGADEC, P. AND JEANNIN,J. F. Transcriptional inhibition of the inducible Nmc onde synthase gene by cornpetitive binding of NF-kappa B/Rel proteins. Biochemid & Biophysical Research Communications 209: 73-79, 1995.

GONG, M. C., KINTER, M. T.. SOMLYO, A. V. AND SOMLYO, A. P. Arachidonic acid and diacylglycerol release associated with inhibition of myosin light chah dephosphorylation in rabbit smooth muscle. Joud of Physiology 486: 113- 122, 1995.

GRISCAVAGE, J. M., WILK, S. AND LGNARRO, L. J. Serine and cysteine proteinase inhibitors prevent nitrïc oxide production by activated macrophages by interfenng with transcription of the inducible NO synthase gene. Biochemical & Biophysical Research Communications 2 15: 72 1-729, 1995.

GROSS, S. S. AND LEVI, R. Tetrahydrobiopterin synthesis. A;; absolute requirement for cytokine-induced nitric oxide generation by vascular smooth muscle. Journal of Biological Chemistry 267: 25722-25729, 1992.

GUTKIND, J. S., LACAL, P. M. AND ROBBINS, K. C. Thrombin-dependent association of phosphatidylinositol3-kinase with p60- and p5gbn in human platelets. Molecular & Cellular Biology 10: 3806-3809, 1990. HAEBERLE,J. R, SUTTON, T. A AND TROCKMAN, B. A Phosphorylation of two sites on smooth muscle rnyosin. Effects on contraction of glycerinated vascdar srnooth muscle. Journal of BioIogicd Chemistry 263: 44244429, 1988.

HAFNER,S., ADLER H. S., MISCHAK, H., JANOSCH, P., HEIDECKER,G., WOLFMAN, A. PIPPIG, S., LOHSE, M. UEFFING, MM.AND KOLCH, W. Mechanism of inhibition of Rat-1 by protein kinase A Molecular & Cellular Biology 14: 6696-6703, 1994.

HALL, A A biochemical fiinction for ras-at last [comment]. Science 264: 1413-1414, 1994.

HANKS,S. K., QUWN, A M. AND HUNTER, T. The protein kinase family: conserveci features and deduced phylogeny of the catdytic domains. [Review] [Il9 refs] . Science 241: 42-52, 1988.

HATADA, E. N., NAUMANN, M AM) SCHEIDEREIT, C. Common structural constituents confer 1 kappa B activity to NF-kappa B pl05 and 1 kappa B/MAD-3. EMBO Journal 12: 278 1-2788, 1993.

HATAKEYAMA, N,,MUKWOPADfIYAY, D., GOYAL, R K. AND AKBARALI, H. 1. Tyrosine kinase-dependent modulation of calcium entry in rabbit colonic muscularis mucosae. American Journal of Physiology 270: Pt 1):C 1780-9, 1 996.

HATHAWAY,D. R,KONICKI, M. V. AND COOLICAN, S. A. Phosphorylation of myosin Iight chah kinase fiom vasdar smooth muscle by CAMP-and cGMP-dependent protein kinases. Journal of Molecular- & Cellular Cardiology 17: 84 1-850, 1985. HATTA, S., SAITO, T. AND OHSHMA, H. EEisof ethanol on the fbnction of G proteins in rat cerebrai cortex membranes. Alcohol & Aicoholism 29: Suppl 1:45-5 1, 1994.

HATTORI, Y. AND GROSS, S. S. GTP cycIohydrolase 1 mRNA is induced by LPS in vascular smooth muscle: characterization, sequence and relationship to nitric oxide synthase. Biochemicai & Biophysicai Research Communications 195: 43 5-441, 1993.

HAWES, B. E.. BIESEN, T. v., KOCH, W. I.. LUTTRELL, L-M. AND LEFKOW~TZ, R. J. Distinct pathways of Gi- and Gq-mediated mitogen-activated protein kinase activation. Journal of Biological Chemistry 270: 1 7148-1 7 153, 1995.

HAWKINS, P. T., JACKSON, T. R AND STEPHENS, L. R Plateletderived growth factor stimulates synthesis of PtdIns(3, 4,5)P3 by activatïng a PtdIns(4,5)P2 3-OHkinase. Nature 358: 157-1 59, 1992. HEIKKILA, J., JALAVA A. AND ERIKSSON, K. The selective protein kinase C inhibitor GF 1 O92O3X inhibits phorbol ester-induced morphoiogical and fùnctiond diierentiation of SH-SY5Y human neuroblastorna cells. Biochernicai & Biophysicai Research Communications 197: 1 185-1 193, 1993.

HELDIN, CC.-H.Dimerization of ceii surtàce receptors in signal transduction. Ce1 80: 2 13-223, 1995.

HEMNC, M.E. AND CHALOVICH, J. M. Effect of ddesrnon on the ATPase activity and the binding of smooth and skeletai myosin subfiagments to actin. Journal of Biological Chemistry 263: 1878-1 885, 1988.

EEJMEL, T., MACHLEIDT, T., ALKALAY, I., KRONKE, M, BEN-NERIAH, Y. AM) BAEUERLE, P. A. Rapid proteolysis of 1 kappa B-alpha is necessary for activation of transcription factor NF-kappa B. Nature 365: 182-1 85, 1993.

HETU, C. AND JOLY,J. G. Effects of chronic ethanol administration in the rat: relative dependency on dietary lipids-III. In vivo tolerance to hexobarbital. Biochemical Pharmacology 28: 84 1-847, 1979.

HIMPENS, B., MATTHIJS, G., SOMLYO, A V., BUTLER, T-M. AM) SOMLYO,A P. Cytoplasmic fiee calcium, myosin light chah phosphorylation, and force in phasic and tonic smooth muscle. Journal of General Physiology 92: 713-729, 1988.

HOAR,P. E., KERRICK, W. G. AND CASSIDY, P. S. Chicken @nard: relation between calcium-advated phosphorylation and contraction. Science 204: 503-506, 1979.

HOEK, J. B., THOMAS,A P., RUBIN, R AND RUBIN, E. Ethanol-induced mobilization of calcium by activation of phosphoinositide-specific phospholipase C in intact hepatocytes. Journai of Biologicai Chernistry 262: 682-69 1, 1987.

HOEK, J. B., THOMAS, A. P., ROONEY, T, A., HIGASm K. AND RUBIN. E. Ethanol and signal transduction in the liver. [Review] [71 refs]. FASEB Journal 6: 2386-2396, 1992.

HOLLENBERG, M. D., MURAMATSU, 1.. ITOH, H., PATEL, P., YANG, S. G. AND LEDERIS, K. Contractile actions of epidermai growth factor-wogastrone in irolated smooth muscle preparations fiom guinea pig stomach: structure-activity relationships and cornparison with the effects of human transforming growth tàctor-alpha. Journal of Pharmacology & Experimental Therapeutics 248: 384-390, 1989. HOLLENBERG,M D., YANG, S. G., LAN[YONU, k A, MOORE, G. J. AND SAEEDDINE, M. Action of thrombin receptor polypeptide in gasfnc smooth muscle: identification of a wre pentapeptide retaining fidl thrombin-mimetic *sic activity. Molecular Pharrnawlogy 42: 186-191, 1992.

HOLLENBERG,M D. Tyrosine kinase pathways and the regdation of smooth muscle contractility. wevîew]. Trends in Pharmacologicai Sciences 15: 108-1 14, 1994a

HOLLMBERG, M. D. The acute actions of growth factors in smooth muscle systems. [Review]. Lifé Sciences 54: 223-235, 1994b.

HOUENBERG,M. D. Tyrosine kinase-mediated signal transduction pathways and the actions of polypeptide growth tactors and G-proteinaupled agonists in smooth muscle. peview] [77 refs] . Molecuiar & Cellular Biochemistry 149-150: 77-85, 1995.

HOLLENBERG,M. D. Protease-mediated signalling: new paradigrns for ce11 regdation and dmg development. [Review] [28 refk]. Trends in Phmacological Sciences 17: 3-6, 1996.

Hü, P., MARGOLIS, B., SKOLNM, E. Y., LAMMEES, R,ULLRICH, A. AND SCHLESSINGER J . Interaction of phosphatidylinositol3 -kinase-associateci p85 with epidermal growth factor and platelet-derived growth factor receptors. Molecular & Cellular Biochemistxy 12: 98 1-990, 1992.

HUANG. C. L., SLESINGER P. A, CASEY, P. J., JAN, Y. N. AND JAN, L. Y. Evidence that direct binding of G beta gamma to the GE1G protein-gated inwardly rectimg K+ channel is important for channel activation. Neuron 15: 1 133-1 1 43, 1995.

HLTIZINGA. J. D., FARRAWAY, L. AND DEN HERTOG, A. Generation of slow-wave-type action potentials in canine colon smooth muscle involves a non-L-type Ca2- conductance. Journal of Physiology 442: 15-29, 199 1.

IGNARRO, L. J., ADAMS, J. B., HORWITZ, P. M. AND WOOD,K. S. Activation of soluble guanylate cyclase by NO-hemoproteins involves NO-heme exchange. Cornparison of heme-containing and heme-deficient enzyme fonns. Joumal of Biological Chemistry 261: 4997-5002,1986. -

IGNARRO, L. J. Biological actions and properties of endothelium-derived Nmc oxide formed and released from artery and vein. [Review]. Circulation Research 65: 1-2 1, 1989a.

IGNARRO, L. J. Endothelium-derived nitric oxide: actions and properties. meview]. FASEB Journal 3: 3 1-36,l989b. IGNARRO, L. J. Signal transduction mechanisms involvïng nitric oxïde. meview]. Biochemical Pharmacology 41 :485-490, 199 1.

IINO, M. AM) TSUKIOKA, M. Feedback control ofinositol trisphosphate signahg bycalcium meview] [30 refs]. Molecular & Cellular Endocrinology 98: 141 - 146, 1994.

IKEBE, M. AND REARDON, S. Phosphoqdation of srnooth myosin light chah kuÿise by smooth muscle Ca2+/calmodulin-dependentmultifhctional protein kinase. Joumai of Biological Chemistry 265: 897508978. 1990.

MEDA, S. R Voltage-dependent modulation of N-type calcium charnels by G-protein beta gamma subunits. Nature 380: 255-258, 1996.

MAMOTO, A. AND SORIANO, P. Disniption of the csk gene, encodhg a negative regulator of Src hlytyrosine kinases, Ieads to neural tube defects and ernbryonic Iethality in rnice. Cell73: 11 1 7- 1124, 1993.

IMBERT, V., RUPEC, R A, LIVûLSl A, PAHL, H L., TIWENCKNER, E. B.. MUULER-DIECKMANN, C., FARAHIFAR, D.,ROSSI, B., AUBERGER, P., BAEUERLE, P. A AND PEYRON, J. F. Tyrosine phosphorylation of 1 kappa B-alpha activates NF-kappa B without proteolytic degradation of 1 kappa B-alpha CeN 86: 787-798, 1996.

INGLESE, J., KOCY W.J., TOU- K AND LEFKOWITZ, R J. G beta gamma interactions with PH dom& and Ras-MAPK signalling pathways. [Review]. Trends in Biochemicd Sciences 20: 15 1- 156, 1995.

IWASHINA, M.,HIRATA Y.,iMAI, T., SATO,K. AND MARUMO, F. Molecular cloning of endothelid, inducible nitnc oxide synthase gene fiom rat aoNc endothelid ceIl. European Journal of Biochemistry 237: 668-673, 1996.

JEON, Y.J., YANG, K. H.,PULASKI, J. T. AND KAMINSKI, N. E. Attenuation of inducible nimc onde synthase gene expression by delta 9-tetrahydrocannabinol is mediated through the inhibition of nuclear factor- kappa B/Rel activation. Molecular Pharmacology 50: 334-34 1, 1996.

JIANG, M. J. AND MORGAN, K. G. Agonist-specific myosin ~hosphorylationand intracellular calcium during isomeaic contractions of arterial smooth muscle. Pfiugers Archiv - European Journal of Physiology 413: 63 7-643,1989.

JIN, N., SIDDIQUI, R. A, ENGLISH, D. AND RHOADES, R. A Communication between tyrosine kinase pathway and myosin light chain kinase pathway in smooth muscle. American Journal of Physiology 271: Pt 2):H1348-55, 1996. JOVANOVIC, A., GRBOWC, L. AND TüLIC, 1. L-arginine induces relaxation of human uterine artery with both intact and denuded endothelium. European Journai of Pharmacology 256: 103-1 07, 1994.

JUHASZOVA, M., AMBESI, A, LINDENMAYER G. E., BLOCH, R J- AND BLAUSTEIN, Ad. P. Nat-Ca'" exchanger in arteries: identification by immunoblotting and irnmunofluorescence microscopy. American Journal of Physiology 266: Pt 1):C234-42, 1994.

KADOTA, S., FANTUS, 1. G., DERAGON, G., GUYDA, H. J., HERSH, B. AND POSNER, B. 1. Peroxide(s) of vanadium: a novel and potent insulin-mimetic agent which activates the insulin receptor kinase. Biochemical & Biophysicai Research Communications 147: 259-266, 2987.

KANNO, K., HIRATA, Y., MAI, T., WASHiNA, M. AND MARüMO, F. Regdation of inducible nitric oxide synthase gene by intedeukin-1 beta in rat vascular endotheiial ceils. American Journal of Physiology 267: Pt 2):H23 18-24, 1994.

KAPELLER, R AND CAM'LEY,L. C. Phosphatidylinositol3-kinase.meview] [81 refs]. Bioessays 16: 565-576, 1994.

KARCZEWSKI, P., KELM, M.,HARTMANN, M. AND SCHRADER, J. RoIe of phosphoiamban in NOIEDRF-induced relaxation in rat aorta. Life Sciences 51: 1205-12 10, 1992.

KARGACIN, G. AND FAY, F. S. Cazymovernent in smooth muscle ceUs studied with one- and two-dimensional difision models. Biophysical Journal 60: 1088-1 100, 199 1.

KAUFFMANN-ZEF&A, RODRIGUEZ-VICIANA, P., ULRICH, E., GILBERT, C., COFFER P., DOWNWARD, J. AND EVAN, G. Suppression of c-Myc-induced apoptosis by Ras signailing through PI(3)K adn PKB. Nature 385: 544-548, 1997.

KAZLAUSKAS, A., ELLIS, C., PAWSON, T, AND COOPER, I. A. Binding of GAP to activated PDGF receptors. Science 247: 1578-1 58 1, 1990.

KAZLAUSKAS, A AND COOP= J, A. Autophosphorylation of the PDGF receptor in the kinase insert region regulates interactions with ceIl proteins. Ce11 58: 1 121-1 133, 1989.

KENGATHARAN, M.. DE KIMPE, S. J. AND THIEMERMANN, C. Analysis of the signal transduction in the induction of nitric oxide synthase by lipoteichoic acid in macrophages. British Journal of Pharmacology 117: 1163- 1170, 1996. KHALIL, R. A., LAJOIE, C., RESNICK, M. S. AND MORGAN, K. G. Ca2--independent isoforms of protein kinase C diieretidy translocate in smooth muscle. American Journal of Physiology 263: C714C719, 1992.

KHALIL, R A. AND MORGAN, K. G. Phenylephrine-induced translocation of proteh kinase C and shortenhg of two types of vascular ceUs of the ferret- Joudof PhysioIogy 455: 585-599, 1992.

KILBOüRN, R G- AND BELLONI, P. Endothelid celi production of nitrogen oxides in response to interferon gamma in combination with tumor necrosis factor, interieukin- 1. or endotoxin. Jownal of the National Cancer institute 82: 772-776, 1990.

KIM, D., LEWIS, D. L., GRAZIADEI, L., NEER, E. J., BAR-SAGI, D.AND CLAPHAM, D. E, G-protein beta gamma-subunits activate the cardiac rnuscarinic K+-channel via p hospholipase A2Nature 337: 557-560, 1989.

KIM, H. K., KIM, J. W., ZILBERSTEIN, A, MARGOLIS, B., KIM, J. G., SCHLESSINGER, J. AND RHEE, S. G. PDGF stimulation of inositol phospholipid hydrolysis requires PLC-gamma 1 phosphoxylation on tyrosine residues 783 and 1254. Ce11 65: 435-441, 1991.

KISHIMOTO, T., TAGA, T. AND AKIRq S. Cytokine signal transduction. mevie4 [92 refs]. Cell76: 253-262, 1994.

KITAZAWA, T., GAYLINN, B. D., DENNEY, G. H. AND SOMLYO,A P. G-protein-rnediated Ca2' sensitization of smooth muscle contraction through myosin light chah phosphorylation. Journal of Biologicd Chemistxy 266: 1708-1 7 15, 1991.

KLATT, P., SCHMID, M., LEOPOLD, E., SCHMIDT,K., WERNER E. R AM) MAYER, B. The pteridine binding site of brain nitric oxide synthase. Tetrahydrobiopterin buiding kinetics, specificity, and aiiosteric interaction with the substrate domain. Joud of Biological Chemistry 269: 1386 1-13866, 1994.

KLWR J. F., LICHTENBERG-KRAAG,B., DAMM, H. AND ROMMELSPACm H. Activation of pertussis toxin-sensitive G-proteins in membranes of SH-SYSY human neuroblastoma cells and bovine transducin by ethanol. Neuroscience Letters 213: 25-28, 19%.

KNTGHTON, D. R,PEARSON, R B., SOWADSKI, J. M., MEANS, A R, TEN EYCK, L. F., TAYLOR, S. S. AND KEMP, B. E. Structural basis of the intrastenc regdation of myosin light chah kinases. Science 258: 130-135, 1992. KOCH, W. J., HAWES, B. E., ALLEN, L, F. AND LEFKOWTZ, R J. Direct evidence that Gi-coupled receptor stimulation of mitogen-activateci protein kinase is mediated by G beta gamma activation of p2 1". Proceedings of the National Academy of Sciences of the United States of America 9t : 12706- 127 1 0, 1994.

KOLCH, W.,HEIDECKER, G.,LLOYD, P. AND RAPP, U. R Ra61 protein kinase is required for growth of induced NW3T3 ceiis. Nature 349: 426-428, 1991.

KOLCH, W.,HELDECm G-,KOCHS, G-,HUMMEL, R, VAHIDI, K. MISCHAK, H. F.,G., MARME, D. AND RAPP, U. R Protein kinase Ca activates RAF-1 by direct phosphorylation. Nature 364: 249-252, 1993.

KOONG,A. C., CHEN, E. Y., MIVECNI, N. F., DE-, N. C., STAMBROOK, P. AND GIACCIq A J. Hypoxic activation of nuclear factor-kappa B is mediated by a Ras and Raf signalling pathway and does not involve MAP kinase (ERICI or ERTU). Cancer Research 54: 5273-5279, 1994.

KRAPIVINSKY, G., KRAPMNSKY, L., WICKMAN, K AND CLAPHAM, D. E. G beta gamma binds directly to the G protein-gated K+ channei, IKACh. Joudof Biological Chemistry 270: 29059-29062, 1995.

KUANG, Y., WU, Y., SMRCKA, A, JIANG, HRAND WU, D. Identification of a phospholipase CP2 region that interacts with GPy - Proceedings of the National Academy of Sciences of the United States of America 93: 2964-2968, 1996.

KUMAq A, HAQUE,J., LACOSTE, J., HISCOTT, J. AND WILLIAMS, B. R Double-stranded RNA-dependent protein kinase activates transcription factor NF-kappa B by phosphorylating 1 kappa B. Proceedings of the National Academy of Sciences of the United States of Amerka 91: 6288-6292, 1994.

KWOK, R P. S., LUMIBLD, J. R,CHRIVlq J. C., RICHARDS, J. P., BACHNGER, H. P., BRENNAN,R G., ROBERTS, S. G. E., GREEN, M. R AND GOODMAN, R H. Nuclear protein CBP is a coactivator for the transcription Gctor CREB. Nature 370: 223-226, 1994.

KYPTq R M., GOLDBERG, Y., ULUG, E. T. AND COURWIDGE, SS.A Association between the PDGF receptor and members of the src fblyof tyrosine kinases. Ce11 62: 481-492, 1990.

LAEMh4LI, U. K. Cleavage of structurai proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685, 1970. LANDER, H. M., SEHAJPAL, P., LEVINE, D. M. AND NOVOGRODSKY, A Acti*vationof human peripheral blood mononuclear celis by nitric oxide-generating compounds. Joumai of Immunology 150: 1509- 15 16, 1993.

LANGE-CARTER, C. A AND JOHNSON, G. L. Ras-dependent growth factor regdation of MEK kinase in PC 12 cells. Science 265: 1458-1461, 1994.

LANGHANS-RAJASEKARAN, S. A, WAN, Y. AND HUANG,X. Y. Activation of Tsk and Btk tyrosine kinases by G protein beta gamma subunits. Proceedings of the NationaI Academy of Sciences of the United States of America 92: 860 1-8605, 1995.

LANIYONU, A, SAIFEDDINE, M., AHMAD, S. AND HOLLENBERG, M. D. Regdation of vascular and gastric smooth muscte contractiIity by pmanadate. British Journal of Pharmacology 113: 403-410, 1994.

LANIYONU, A, ETO, S., WANG, J. H AND HOLLENBERG,M. D. Detedon of sarcoma virus family tyrosine kinase activity in coronary artenai tissue, Canadian Journal of Physiology & Pharmacology 73: 1552-1560, 1995.

LANlYONU, A A, SAIFEDDINE, M., YANG, S. G. AND HOLLENBERG,M. D. Tyrosine kinase inhibitors and the wntractiie action of G-protein-linked vascdar agonists. Canadian Journal of Physiology & Phannacology 72: 1075- 1085, 1994.

LANIYONU, A A AND HOUENBERG, M. D. Vascular actions of thrombin receptor-derived polypeptides: structure-activity profiles for contractile and relaxant efEects in rat aorta British Journal of Pharmacology 114: 1680-1686, 1995.

LASSEGUE, B., ALEXANDER,-R W., CLARK, M., AKERS, M. AND GRIENDLING, K. K. Phosphatidylcholine is a major source of phosphatidic acid and diacylglycerol in angiotensin II-stimulatecl vascular smooth-muscle ceUs. Biochemical Journal 292: 509-5 17, 1993.

LECHLEIDER R J., SUGKMOTO, S., BENNETT,A. M., KASHISHIAN, A S., COOPER, J. A, SHOELSON, S. E., WALSH, C. T. AND NEEL, B. G. Activation of the SH2-containing phosphotyrosine phosphatase SH-PTP2 by its binding site, phosphotyrosuie 1009, on the human plateletderiveci growth factor receptor P. Journal of Biological Chernistry 268: 2 1478-2148 1, 1993.

LEE, K. M., TOSCAS, K. AM) VILLEREAL, M. L. Inhibition of bradykinin- and thapsigargin-induced Ca2' entry by tyrosine kinase inhibitors. JoumaI of Biologid Chernisby 268: 9945-9948, 1993. LEEVERS, S. J., PATERSON, H. F. AM) MARSHALL, C. J. Requirement for Ras in Rafactivation is overcome by targeting Rafto the plasma membrane. Nature 369: 411-414, 1994.

LEEVERS, S. J. AND MARSHALL, C. J. Activation of extracellular signai-regulated kinase, ERK.2, by p21m oncoproteui. EMBO Joud 11: 569-574, 1992.

LEONE, A M., PALMER,R M.,KNOWLES, R. G., FRANCIS, P. L., ASHTON, D. S. AND MONCADA, S. Constitutive and inducible nitric oxide synthases incorporate molecular oxygen into both nitric oxide and citrulline. Jounial of Biological Chemistry 266: 23 79û-23'?95, 199 1.

LEV, S., MORENO, H.,MARTINEZ, R, CANOLL, P., PELES, E., MUSACCHIO, J. M., PLOWMAN, G-D., RUDY, B. AND SCHLESSINGER, I. Protein tryosine kinase Pyk2 involved in Ca2+-induceciregulation of ion channei and MAP kinase ftnctions. Nature 376: 73 7-745, 1995a.

LEV, S., MORENO, H.,MARTiNEZ, R., CANOLL, P., PELES, E,, MUSACCHIO, J. M., PLOWMAN, G. D., RUDY, B. AND SCHLESSINGER, J- Protein tyrosine kinase Pyk2 involved in CaZZ-inducedregulation of ion channe! and MAP kinase functions. Nahire 376: 737-745, 1995b.

LEMLLAiN, O., HUS-CITHAREL,A, MOREL, F. AND BANIUR, L. Localkation of arginine synthesis dong rat nephron. American Journal of Physiology 259: Pt 2):F9 16-23, 1990.

LEVIN, D. E. AND ERREDE, B. The protiferation of MAP kinase signalhg pathways in yeast. [Review] [44 refs]. Current Opinion in CeU Biology 7: 197-202, 1995.

LEVITZKI, A Tyrphostins: tyrosine kinase blockers as novel antiproliferative agents and dissectors of signal transduction. [Review] [68 refs]. FASEB Journal 6: 3275-3282, 1992.

LEVITZKI, A AND GAZIT, A. Tyrosine kinase inhibition: an approach to drug development. [Peview] [87 refs]. Science 267: 1 782- 1788, 1995.

LI, S. AND SEDXVY, J. M. Raf-1 protein kinase activates the --kappa B transcription factor by dissociating the cytoplasrnic NF-kappa B-1 kappa B cornplex. Proceedings of the Nationai Academy of Sciences of the United States of America 90: 9247-925 1, 1993.

LI, T. K. AND THEORELL, H. Human Iiver aIcohoI dehydr0genase:inhibition by pyrazole and pyrazole analogs. Acta Chemica Scandinavica 23: 892-902, 1969. LIBBY, P., SUKHOVA, G., LEE, R T. AND GALIS, 2. S. Cytokines regulate vascular fùnctions related to stability of the atherosclerotic plaque. peview] [23 refk]. Jodof Cardiovascular Pharmacology 25: Suppl2:Sg- 12, 1995.

LINDER, M. E. AND GILMAN, A G. G proteins. Scientific American 267: 56-61, 1992.

LIU, X., MARENGERE, L. E., KOCH, C. A.. AM)PAWSON, T. The v-Src SH3 domain binds phosphatidySiosito13'-kinase. Molecuiar & CeUular Biology 13: 52254232, 1993.

LOGOTHETIS, D. E., KIM, D. H., NORTHUP, 3. K., NEER E. J. GNll CLAPHAM, D. E. SpecScity of action of guanine nudeotide-binding regdatory protein subunits on the cardiac muscarhic K+ chamel, Proceedings of the National Academy of Sciences of the United States of America 85: 5814-5818, 1988.

LOMPRE, A M., ANGER, M. AND LEVITSKY, D. Sarco(endo)plasmic reticulum calcium pumps in the cardiovascular system: tùnction and gene expression. mevie4 [IO6 rets]. Joudof Molecular & Cellular Cardiology 26: 1 1 09- 1 12 1, 1994.

LOPEZ-LLASACA, M., CRESPO, P., PELLICI, P. G., GUTKIND, J. S. AND WETZKER, R Linkage of G protein-coupled receptors to the MAPK signalhg pathway through PI 3-kinase y. Science 275: 394-397, 1997.

LOWENSTEIN, E. J., DALY, R J., BATZER, A. G., LI, W., MARGOLIS, B., LAMMERS, R, ULLRICH., A, SKOLNIK, E. Y., BAR-SAGI, D. AND SCHLESSINGER, J. The SHî and SH3 domain-containing protein GRB2 links receptor tyrosine kinases to ras signalling. Ce11 70: 43 1-442, 1992.

LUGNIER, C. AND KOMAS, N. Modulation of vascuIar cyclic nucleotide phosphodiesterases by cyclic GMP:role in vasodilatation. European Hem Journal 14: Suppl 1: 14 1-8, 1993.

LUKAS, T. J., BURGESS, W. H., PREMIERGAST, F. G., LAU, W. AM) WATTERSON,D. M. Caimodulin binding domains: characterization of a phosphorylation and dmodulin binding site fiom myosin light chah kinase. Biochemistry 25: 1458-1464, 1986. -

LUTTRELL, L. M., HAWES,B. E., VANBTESEN, T., LUTTRELL, D. K., LANSING, T. J. AND LEFKOWITZ, R. J. Role of c-Src tyrosine kinase in G protein-couple- receptor- and GPy subunit-mediated activation of mitogen-activateci protein kinases. Journal of Biological Chemistry 271: 19443- l!MSO, 1996. MAHONEY, C. W. AND HUANG, K. P. Selective phosphorylation of cationic polypeptide aggregated with phosphatidylse~e/diacyIgiyceroUCa~+/detergentmixed micelles by Ca"-independent but not Ca2'-dependent protein kinase C isozyines. Biochemistry 34: 3446-3454, 1995.

MAK, P., HE, 2. AND KUROSAICI, T. Identification of amino acid residues required for a specific interaction between Src-tyrosine kinase adproline-rich region of phosphatidyhositol3-kinase. FEBS Letters 397: 183-1 85, 1996.

MALMQVIST, U. AM) ARNER, A Correlation between isofom composition ofthe 17 kDa myosin hght chah and maxinuil shortening velocity in smooth muscle. Pflugers Archiv - European Journal of Physiology 418: 523-530, 199 1.

MARAN, A, MAITRA, R K., KUMAR, A, DONG, B., XIAO, W.,LI, G., WILLIAMS, B. R-,TORRENCE, P. F. AND SILVERMAN, R H. Bfockage of NF-kappa B signalling by selective ablation of an mRNA target by 2-5A antisense chimeras. Science 265: 789-792, 1994.

MARCZIN, N., PAPAPETROPOULOS, k AND CATRAVAS, J. D. Tyrosine kinase inhibitors suppress endotoxin- and IL1 beta-induced NO synthesis in aortic srnooth muscle cells. Amencan Journal of Physiology 265: Pt 2)s10 14-8, 1993.

MARLETTA M. A, YOON,P. S., MNGaR, LEM, C. D. AND WISHNOK. J. S. Macrophage oxïdation of Larginine to nitrite and nitrate: nitric oxide is an intermediate. Biochemistry 27: 8706-87 1 1, 1988.

MARRERO, M. B., PAXTON, W. G., DUFF, J. L., BERK, B. C. AND BERNSTEIN, K. E. Angiotensin LI stimulates tyrosine phosphorylation of phospholipase C-gamma 1 in vascular srnooth muscle cells. kudof Biological Chemistry 269: 1093 5- 10939, 1994.

MARRERO, M B., SCHIEFFER, B., PmON,W. G., SCHIE- E. AND BERNSTEIN, K. E. Electroporation ofpp6OC* antiodies inhibits the angïotensin II activation of phospholipase C-gamma 1 in rat aortic smooth muscle cells. Journal of Biological Chemistry 270: 15734- 1573 8, 1995.

MARRERO, M. B., PAXTON,W. G., SCHIEFFER, B., LING, B. N. AND BERNSTEIN, K. E. Angiotensin II signaüing events mediateci bi tyrosine phosphorylation. [Review] [30 refs]. Cellular Signaihg 8: 2 1-26, 1996.

MARSTON, S. B. AND REDWOOD,C. S. The essentiai role of tropomyosin in cooperative regulation of smooth muscle thin filament activity by caldesmon. Joudof Biological Chemistry 268: 123 17-12320, 1993. MARX, J. Two major signal pathways Wed. Science 262: 988-989, 1993.

MAYER, B., SCHMIDT, K., HUMBERT, P. AND BOHME,E. Biosynthesis of endothehum-derived relaxing factor: a cytosolic eiizyme in porcine aortic endotheliai ceiis Caz'-dependentl~converts L-arghhe into an activator of soluble guanylyl cyclase. Biochemicai & Biophysical Research Communications 164: 678-685, 1989.

MAYER, B. AND WERNER. E. R In search of a fiindon for tetrahydrobiopterin in the biosynthesis of aimc oxide. meview] [106 refis]. Naunyn-Schmiedebergs Archives of Phamüiwlogy 351: 453-463, 1995.

MCCARRON, J. G., MCGEOWN, I. G., REARDON, S., IKEBE, M.,FAY, F. S. AND WALSH, J. V., IR Calcium-dependent enhancement of caicium ment in smooth muscle by calmodulin-dependent protein kinase II. Nature 357: 74-77, 1992.

MCCORMICK, F. Signal transduction. How receptors turn Ras on [news; comment]. Nature 365: 15- 16, 1993.

MCDONALD, T. F., PELZER S., TnAUTWEIN, W. AND PELZER, D. J. Regdation and modulation of calcium channels in cardiac, skeletai, and smooth muscle cek [Review] [1868 refis]. Physiological Reviews 74: 365-507, 1994.

MEISENHELDER, J., SUI& P. G., RHEE, S. G. AND HUNTER, T. Phospholipase C-gammais a substrate for the PDGF and EGF receptor protein-tyrosine kinases in vn>o and in vitro. CeIl 57: 1109- 1 122, 1989.

MWCUSEN, H. B., THLMEBERG,L., RUMESSEN. I. J. AND THORBALL, N. Macrophage-like ceils in the muscularis extema of mouse small intestine. Anatomical Record 213: 77-86,1985.

MW(ELSEN, H. B., MIRSKY, R,ESSEN, K. R AND THLMEBERG, L. Macrophage-like cells in muscularis externa of mouse smaii intestine: Immunohistochemical locafization of F4/8O, M1170, and Ia-antigen. Ce11 & Tissue Resezrch 252: 301-306, 1988.

MMOSHIBA. K., FURUCHI., T. AND MIYAWAKI, A. Stnicjure and function of lP3 receptors. [Rwiew] [93 refs]. Seminars in Cell Biology 5: 273-28 1, 1994.

MILLER, M. I., THOMPSON, J. H.,ZKANG, X. J., SADOWSKA-KROWCKA, H., KAKKIS, J. L., MUNSHI, U. K., SANDOVAL, M.. ROSSI, J. L.. ELOBY-CHILDRESS, S., BECKMAN, J. S. AND et al: Role of inducible nitrïc oxide synthase expression and peroxynitrite formation in pinea pig ileitis. Gastroenterology 109: 1475-1483, 1995. MORI, S., RONNSTRAM), L., YOKOTE,K., ENGSTROM, A, COURTNEIDGE, S. A, CLAESSON-WELSS L. AND HELDiN, C. H. Identification of two jwtamembrane autophosphorylation sites in the PDGF beta-receptor, involvement in the interaction with Src famiIy tyrosine kinases. EMBO Journal 12: 2257-2264, 1993.

MORITOKI, H., TAKEUCHI, S. AND KONDOH, W. Formation of muscle-derived nitric oxide (MDNO) is mediated by an induciile nitnc oxide synthase. Japanese Journal of Pharmacology 58: Suppl2:3 15P1992.

MORRIS, S. M., JR. Regulation of enzymes of urea and arginine synthesis. peview] 1147 refs]. Annual Review of Nutrition 12: 8 1- 101, 1992.

MORNSON, D. K. Mechanisms regulating Raf-1 activity in signal transduction pathways. [Review] [27 refs]. Molecular Reproduction & Development 42: 507-5 14, 1995.

MOSTHAF, L., KELLERER M., MüHLHOFER, A, MUSHACK, J., SEFFER, E- AND HARING, H. U. Insulin Ieads to a parailel translocation of PI-~-kinaseand protein baseC zeta. Experimentd & Clinical Endocrinology & Diabetes 104: 19-24? 1996.

MULLIKIN-KILPATRJCK, D., MEHTA, N. D., HILDEBRANDT, J. D. AND TREISTMAN, S. N. Gi is involved in ethanol inhibition of L-type calcium channels in undiferentiated but not diierentiated PC-12 cells. MolecuIar PharmacoIogy 47: 997-1005, 1995.

MURAMATSU, L, HOLLENBERG, M. D. AND LEDERIS, K. Vascular actions of epidermal growth factor-urogastrone: possible relationship to prostagiandin production. Canadian Journal of Physiology & Pharmacology 63: 994-999, 1985.

MLTRAMATSU, L, ITOH, H., LEDERIS, K. AND HOLLENBERG, M. D. Distinctive actions of epidermal growth factor-urogastrone in isolated smooth muscle preparations fiom guinea pig stomach: differential inhibition by indomethacin. Journal of Pharmacology & Experimental Therapeutics 245: 625-63 1, 1988.

MURAMATSU, I., LANIYONU, A, MOORE, G. J. AND HOLLENBERG, M. D. Vascular actions of thrombin receptor peptide. Canadian Journal of Physiology & Pharrnacology 70: 996-1 003, 1992. -

NAGAI, R., KURO-O, M., BABIJ, P. AND PERIASAMY, M. Identification of two types of smooth muscle myosin heavy chah isoforms by cDNA cbning and immunoblot analysis. Journal of Biological Chemistry 264: 9734-9737, 1989. NAHORSKI, S. R, WILCOX, R. A, MACKRILL, J. J. AND CHALLISS, R k Phosphoinositide-derived second messengers and the regulation of Ca2+in vascular smooth muscle. [Review] [l29 refs]. Journal of Hypertension - Supplement 12: S 133-43, 1994.

NAKA, M., KUREISHI, Y., MUROGA, Y., TAKAHASHI, K., ITO, M AND TANAKA, T. Modulation of smooth muscle calponin by protein kinase C and calmodulin. Biochemical & Biophysicai Research Communications 171: 933-93 7, 1990.

NA- F., h4IN0, T., YAMAMOTO, J., NAKA, M. AND TANAKA, T. Identification of the regdatory site in smooth muscle caiponin that is phosphorylated by protein kinse C. Journal of BioIogical Chemistry 268: 6 294-620 1, 1993.

NATHAN, C. Nitric oxide as a secretory product of mammalian ceus. mew]. FASEB Journal 6: 3051-3064, 1992.

NATHAN, C. InducibIe nitnc oxide synthase: regulation subserves fùnction. [Review] [13 refs]. Current Topics in Microbiology & Immunology 196: 1-4, 1 995.

NATHAN, C. AND XIE, Q. W. Regulation of biosynthesis of nitric oxide. meview] [IO3 refs] . Joumai of Biologicai Chemistry 269: 13 725- 13 728, 1 994.

NEER E. J., SCHMIDT, C. J., NAMBUDRIPAD, R AND SMITH, T. F. The ancient regulatory-protein family of WD-repeat proteins [published erratum appears in Nature 1994 ûct 27;371(6500):8 121. [Peview]. Nature 371: 297-300, 1994.

E. J. Heterotrimeric G proteins: organizers of transmembrane signals. weview]. Cell80: 249-257, 1995.

NECHOLS, K., STAINES, W. AND KRANTIS, A Nitric oxide synthase distnïution in the rat intestine: a histochemical analysis. Gastroenterology 105: 165 2- 166 1, 1 993.

NISH.TKAWA M., DE LANEROLLE,P., LINCOLN, T. M. AND ADELSTEN, R S. Phosphorylation ofmammaiian myosin light chah kinases by the catalytic subuait of cyclic AMP-dependent protein kinase and by cyclic GMP-dependent protein kinase. Journa1 of Biological Chemistry 259: 8429-8436, 1984. - NOACK, T., DEITMER P. AND LAMMEL, E. Characterization of membrane currents in single smooth muscle ceUs fiom the guinea-pig gastric antrum. Journal of PhysioIogy 451: 387-417, 1992. NODA S., ITO, M., WATANABE, S., TAKAHASHITK. AND MARUYAMA, K. Conformational changes of actin induced by calponin. Biochemical & Biophysical Research Communications 185: 48 1-487, IWS.

NOVOGRODSKY, A, VANICHICIN, A., PATYA, M., GAZIT, A, OSHEROV, N. AND LEVITZKI, A Prevention of lipopolysaccharide-ùiduced lethal toxicity by tyrosine kinase inhibitors. Science 264: 1 3 19- 13 22, 1994.

NUNOKAWA, Y., ISHIDA. N. AM) TANAKA, S. Cloning of inducible nitnc oxide syntbase in rat vascular smooth muscle celis. Biochemical & Biophysical Research Communications 191 : 89-94,1993.

NUNOKAWA, Y., OIKAWA, S. AND TANAKA, S. Human inducible nitnc oxide synthase gene is tnnscriptionally regulated by nuclear factor-kappaB dependent mechanism. Biochemid & Biophysical Research Communications 223: 347-352, 1996.

ODELL, T. J., HUANG, P. L., DAWSON, T. M., DINERMAN, J. L., SNYDER, S. H-, KANDEL, E. R AND FISHMAN, M. C. Endothelial NOS and the blockade of LTP by NOS inhibitors in mice lacking neuronal NOS. Science 265: 542-546, 1994.

O'DONNELL, M. E. AM) OWEN,N. E. Regulation of ion pumps adcarriers in vasailar smooth muscle. meview] [350 refs]. Physiological Reviews 74: 683-721, 1994.

OHYA, Y., KIT- K AND KURIYAMA, H. Regulation of calcium mentby intracellula.calcium in smooth muscle cells of rabbit portal vein. Circulation Research 62: 375-383, 1988.

OKUBO, S., ITO, M., TAKASHIBA, Y.,ICHIKAWA K., MIYWM., SHIMIZU, H.,KONISH, T.. SHLMA, R,NAGAO, M.. HARTSHORNE,D. J. AND et al: A regulatory subunit of smooth muscle myosin bound phosphatase. Biochemical & Biophysical Research Communications 200: 429-434, 1994.

OUDE WEERMNK, P. A, OTTENHOFF-KALFF, A. E., VENDRIG, M. P., VAN BEURDEN,E. A, STAAL, G. E. AND RUKSEN, G. Functional interaction between the epiderrnal growth factor receptor and c-Src kinase activity. FEBS Letters 352: 296-300, 1994.

PALMER, R M.. ASHTON. D. S. AND MONCADA S. Vascuiar endothelid cells synthesize nitric oxide fiom L-arginine. Nature 333: 664-666, 1988.

PAN,J., BURGHER, K. L., SZCZEPANK, A M. AND RINGHEM G. E. Tyrosine phosphorylation of inducibie nitric oxide synthase: implications for potential post-translational regulation. Biochemical Journal 314: 889-894, 1996. PARK, D., MN,D. Y., LEE, C. W.,LEE, K. H. AND RHEE, S. G. Activation of phospholipase C isozymes by G protein beta gamma subunits. Journal of Biologicaf Chemistry 268: 45734576, 1993.

PmE. I. AND SHARKEY,K A The use ofconstmitive nuclear oncoproteins to count neurons in the enteric nervous system of the guinea pig. Ceil & Tissue Research 277: 325-33 1, 1994.

PASTOR, C. M., MORRIS, S. M, IR AM)BILLIAR, T. R Sources of arginine for induced nitric oxide synthesis in the isolated perfirsed Iiver. American Journal of Physiology 269: Pt 1):G86 1-6, 1995.

PAUL,A, PENDREIGH, R H. AND PLEVIN,R Protein kinase C and tyrosine kinase pathways regulate lipopolysaccharide-induced nitric oxide synthase activity in RAW 264.7 munne macrophages. British Joudof Pbarmacology 114: 482-488, 1995.

PAWSON,T. Protehtyrosine kinases. Geaing down to spec5cs [news;comment]. Nature 373: 477-478, 199Sa.

PAWSON, T. Protein modules and signalling networks. [Review] [13 1 refs]. Nature 373: 573-580, 1995b.

PAYEN,D., BERNARD, C. AND BELOUCIF, S. Nitric onde in sepsis. Mew][169 refs] . Clinics in Chest Medicine 17: 33 3-3 50, 1996.

PEARSON, R B., WETTENHALL, R E., MEANS, A. R. HARTSHORNE, D.J. AM) KEMP,B. E. Autoregulation of enzymes by pseudosubstrate prototopes: myosin Iight chah kinase. Science 241: 970-973, 1988.

PELECH,S. L. Networking with proline-directed protein kinases implicated in tau phosphorylation. [Review] [ 135 refs] . Neurobiology of Aging 16: 247-256, 1995.

PELECH, S. L. Kinase connections on the cellular intranet. Signalhg pathways. Feview] [ 19 refs] . Current Biology 6: 55 1-5 54, 1996.

PITTNER, R A. AND Fm,J. N. Ethanol is a potent stimulator of phosphatidylcholine breakdown in cultureci rat hepatocyîes. Biochimica et Biophy sica Acta 1133: 3 16-3 20, 1992.

PLEMAN, C. M., HERTZ, W.M. AND CAMBER J. C. Activation of phosphatidylinositol-3' kinase by Src-faniily kinase SH3 binding to the p85 subunit. Science 263: I6O9- 16 12, 1994. POMERANCE, M, GAVARET, J. M,BRETON, M. AND PIERRE, M. Growth factor-regulated phosphatidylinosito1-3-kinasem astrocytes. Involvement of pp60c-src. Cellular & Molecular Biology 4û: 653-664, 1994.

PORRECA E., DI FEBBO,C., REALE, M., BARBACANE, R, MEZZETTI, A, CUCCURULLO, F. AND COWP. Modulation of rat vascular smooth muscle ceii (VSMC) proliferation by cysteinyl leuicotriene D4: a role for mediation of interleukin 1. Atherosclerosis 113: 11-18, 1995.

POWIS, G., BONJOüKLiAN, R, BERGGREN, M. M., GALLEGOS, A, ABWUAM, R, ASHENDEL,C., ZALXOW, L., MATTER W. F., DODGE, J., GRINDEY, G. AND et al: Wortrnannin, a potent and selective inhibitor of phosphatidylinositol-3-kinase. Cancer Research 54: 241 9-2423, 1994.

PRASAD, K. V., JANSSEN. O., KAPELLER, R, RAAB, M., CANTL.EY, L. C. AND RUDD, C. E. Src-homology 3 domain of protein kinase mediates binding to phosphatidylinositol3-kinase in T cells. Proceedings of the National Academy of Sciences of the United States of Amenca 90: 7366-7370, I993a.

PRASAD,K- V., KAPELLER, R, JANSSEN, O.. REPKE, H., DUKE-COHAN, J. S., CANTLEY, L. C. AM) RUDD, C. E. Phosphatidyliositol (PI) 3-kinase and PI 4-kinase binding to the CD4-~56~'cornplex: the p56= SH3 domain binds to PI 3-kinase but not PI 4-kinase. Molecular & Ceiiular BioIogy 13: 7708-771 7, 1993b.

PRONIN, A. N. AND GAUTAM, N. Interaction between G-protein beta and gamma subunit types is selective. Proceedings of the National Academy of Sciences of the United States of Amenca 89: 6220-6224, 1992.

PULVERER, B.J., KYRIAKIS, J. M., AVRUCH, J., NKOLAKAKI, E. AM) WOODGETT, J. R. Phosphorylation of c-jun mediated by MAP kinases. Nature 353: 670-674, 1991.

PUMIGLIA, K. M, LEMNE, H.,HASKE, T., HABIB, T., JOVE, R AND DECKER, S. 5. A direct interaction between G-protein beta gamma subunits and the LC-1 protein kinase. Journal of BiologicaI Chemistry 270: 1425 1-14254, 1995.

QUILLIAM, L. A., KHOSRAVI-FAR, R, m,S. Y. AND DER, C. J. Guanine nucleotide exchange factors: activators of the ras superfàmily of proteins. Bioessays 17: 395-404, 1995.

RAEYMAEKERS, L. AND WUYïACK, F. Ca" pumps in smooth muscle cells. [Review] [153 refs]. Journal of Muscle Researcb & Cell Motility 14: 141-1 57, 1993. LWFIONT, S. AND BRADSHAW, R A Activation of phosphatidyiinositol3-kinaseby epidermal growth factor, basic fibroblast growth factor, and nene growth factor in PCl2 pheochromocytoma ceus. Proceedings of the National Academy of Sciences of the United States of Amerka 89: 912 1-9125, 1992.

RASMUSSEN,U. B., VOURET-CRAVIARI, V., JALLAT, S., SCHLESING- Y., PAGES, G., PAVXRANI, A, LECOCQ,J. P., POWSSEGUR, J. AND VAN OBBERGHEN-SCHILLING, E. cDNA cloning and expression of a hamster alpha-thrombin receptor coupled to Ca2' mobilization. FEBS Letters 288: 123-128, 1991.

REES, D. D., CEUEK, S., PALMER, R M. J. AND MOKADA S. Dexamethasone prevents the induction by endotoxin of a Nmc oxide synthase and the associated eEects on vdartone. An insight into endotoxin shock. Biochemical & Biophysical Research Communications 173: 54 1-547, 1990.

RESH, M. D. Myristylation and palmitylation of Src famly members: the fats of the matter. CeIl 76: 411-413, 1994.

RODRIGUEZ-WC- P., WARNE, P. H.,DHAND, R, VANHAESEBROECK, B., GOUT, L, FRY, M. J., WATERFELD, M. D. AND DOWNWARD, J. Phosphatidylinositol-3-OH kinase as a direct target of Ras. Nature 370: 527-532, 1994.

ROLAND, C. R,NAZIRUDDN, B., MOHANAKUMAR, T. AND FLYE, M. W. Gadolinium chloride inhibits Kupffer ceIl nitric oxide synthase (NOS) induction. Joud of Leukocyte Biology 60: 487-492, 1996.

RONNSTRAM), L., MORI, S., ARRIDSSON, A. K., ERIKSSON, A,WERNSTEDT, C., HELLMAN,U., CLAESSON-WELSH, L. AND HELDIN, C. H. Identification of two C-temiinal autophosphoryiation sites in the PDGF beta-receptor: involvement in the interaction with phospholipase C-gamma EMBO Journal 11: 39 11-39 19, 1992.

ROSEN,L. B., GIMY, D. D., WEBER, M. J. AND GREENBERG, M. E. Membrane depolarkation and calcium influx aïmulate MEK and MAP kinase via activation of Ras. Neuron 12: 1207-122 1, 1994.

ROSEN, L. B. AND GREENBERG, M. E. Stimulation of gow_thfactor receptor signal transduction by activation of voltage-sensitive calcium charnels. Proceedings of the National Academy of Sciences of the United States of America 93: 11 13-1 118, 1996.

RUBIN, R AND HOEK, J. B. Ethanol-induced stimulation of phosphoinositide turnover and calcium influx in isolated hepatocytes. Biochemical Pharmacology 37: 2461-2466, 1988a. RUBN, R AND HOEK, J. B. Alcohol-induced stimulation of phosphotipase C in human platelets requires G-protein activation Biochemical Journal 254: l4ï-lS3, l988b.

SAaDDINE, M.,LANIYOW, A, AHMAD,S. AND HOLLENBERG, M. D. Bi-direaional control of smooth muscle tension: regulation by tyrosine kmase and tyrosine phosphatase. Proceedings of the Western Pharrnacology Society 37: 21-24, 1994.

SALDEEN,J. AND WELSH, N. ïnterleukin-l beta mduced activation of NF-kappa B in insulin producing RINm5F ceUs is prevented by the protease UIhriitor N aipha-p-tosyl-L-lysine chloromethylketone. Biochemical & Biophysical Research Communications 203: 149-1 55, 1994.

SANG- P., MCKLEN, S. AND COULSON, A. R DNA sequencing with chain-terniinating inbibitors. Proceedings of the National Academy of Sciences of the United States of Amerka 74: 5463-5467, 1977.

SASAKI, H., NAGURq K., ISHINO, M., TOBIOKA, R,KOTANI, K. AND SASAKI, T. Cloning and characterization of ceil adhesion kjnase beta, a novel protein-tyrosine kinase of the focal adhesion kinase subfamily- Journal of Biological Chemistry 270: 21206-21219, 1995.

SAURO,M. D. AND THOMAS, B. Tyrphosth attenuates platelet-derived growth factor-induced contraction in aortic smooth muscle through inhiition of protein tyrosine kinase(s). Joumal of Pharmacology & Experirnental Therapeutics 267: 11 19-1 125, 1993.

SCHLEFFER, B., PAXTON, W. G., CHAI, Q.,MARRERO, M. B. AND BERNSTEIN, K. E. Angiotensin II controls p2 1- activity via pp60". Journal of Biological Chemistry 271: 10329-10333, 1996.

SCHINDLEEt, C. Cytokine signal transduction. [Review] [22 refs]. Receptor 5: 51-62, 1995.

SCHINI--TH, V., BARA, A, MüLSCH, A AND BUSSE, R Pyrrolidine dithiocarbamate selectively prevents the expression of the inducible nitric oxide synthase in the rat aorta European Journal of Pharmacology 265: 83-87, 1994.

SCHLESSINGER, J. AND ULLRICK A. Growth factor signalkg by receptor tyrosine kinases. pevïew]. Neuron 9: 383-39 1, 1992.

SCHOTT, C. A, GRAY,G. A AND STOCLET,J. C. Dependence of endotoxin-induced vascular hyporeactivity on extracellular L-arginhe. British Journal of Pharmacology 1011: 38-43, 1993. SCHRECK, R,MEIER, B., MANNEL, D. IV., DROGE, W. AND BAEUERLE, P. A Dithiocafbamates as potent inhibitors of nuclear factor kappa B activation in intact celis. Journal of Experimentai Medicine 175: 118 1-1 194, 1992.

SCHULZ,R, NAVA E. AND MONCADA, S. Induction and potential biological relevance of a Ca23.ndependentnitric oxide synthase in the myocardiumumBritish Joud of Pharmacology 105: 575-580, 1992.

SEGaR, SEGm D., LOZEMAN, F. J., AHN, N. G., GRAVES, L. M., CAMPBELL, J. S., ERICSSON, L., HARRYLOCK, M., JENSEN, A M. AM)KREBS, E. G. Human T-cell mitogen-activated protein kinase kinases are related to yeast signal transduction kinases. Journal of Biological Chemistry 267: 25628-25631, 1992.

SEGEK R AND KREBS, E. G. The MAPK signalling cascade. FASEB Journal 9: 726-735, 1995.

Sm,T., MORI, M., BïïO, H.. SAKANAKA, C., TABUCHI, S., AIHARA, M. AND KUME, K Platelet-activahg factor and somatosmtin activate Mtogen-activateci protein kinase (MAP kinase) and arachidonate release. peview] [22 refk]. Journal of Lipid Mediators & Cell Signalhg 14: 103-108, 1996.

SIEBENLIST. U., FRANZOSO,G. AND BROWN, K. Structure, regulation and fùnction of NF-kappa B. [Review] [366 refs]. Annual Review of Cell Biology 10: 405-455, 1994.

SIMMONS, M. L. AND MURPHY, S. Roles for protein kinases in the induction of nitric oxide synthase in astrocytes. GLU 11: 227-234, 1994.

SIMONET, S., BONHOMME, E., LAUBE, M., THüREAU, C., FAUCHERE, J. L. AND VERBEUREN,T. J. Venous and arterial endothelial cells respond differently to thrombin and its endogenous receptor agonist. European Journal of Phannawlogy 216: 135-137, 1992.

SINGH, K., BALLIGAND, L L., FISCHER T. A., SMITH, T. W. AND -Y, R A Regdation of cytokine-inducible riitric onde synthase in cardiac myocytes and microvascular endothelial ceils. Roie of extracellular signal-regulated kinases 1 and 2 (ERKl/ERK2) and STAT 1 alpha Joud of Biological Chemistg 271: 1 11 1-1 117, 1996.

SINGH, S., DARNAY,B. G. AND AGGARWAL, B. B. Site-specific tyrosine phosphoq4ation of IKB~negatively regulates its inducible phosphoryiation and degradation. Journal of Biological Chemistry 271: 3 1049-31 054, 1996. SINGH, S. AND AGGARWAL, B. B. Protein-tyrosine phosphatase inhibitors bIock tumor necrosis factor-dependent activation of the nuclear transcription &or NF-KB. Journal of Biologicai Chemistry 270: 1063 1-10639, 1995.

SIRSJO, A, SODERKVIST, P., SUNDQVIST, T., CARLSSON, M., OST, M, AND GIDLOF, A Merent induction mechanisms of mRNA for induciile nitnc olade synthase in rat smooth muscle ceus in culture and in aortic strips. FEBS Letters 338: 191-196, 1994.

SMITH, C. W.,PRITCHARD, K. AND MARSTON, S. B. The mechanism of Ca2' regulation of vascular smooth muscle thin filaments by caldesmon and calmodulin. Joumal of Biologicai Chemistry 262: 1 16-1 22, 1987.

SOMLYO, A. P. AND SOMLYO, A. V. Smooth rnuscle:excitation-~~ntractioncoupling, contrade regdation, and the cross-bridge cycle. Alcohotism, Clinid & Experïmental Research 18: 13 8-143, 1994.

SONDEK, J., BOHM, A, LAMBRIGHT, D. G., HAMM, H, E. AND SIGLER, P. B. Crysîai structure of a G-protein beta gamma dimer at 2.1A resolution [conected] [published erratum appears in Nature 19% Feb 29;379(6568):847]. Nature 379: 3 69-374, 1996.

STAMLER, J. S., SINGEL, D. J. AND LOSCALZO, J. Biochemistry of nitric oxide and its redox-activated forms. [Review]. Science 258: 1898-1 902, 1992.

STEPHENS, L. R, HUGHES,K. T. AND IRVINE, R F. Pathway of phosphatidylinositol(3,4,5)-trisphosphate synthesis in activated neutrophiis. Nature 351: 33-39, 1991.

STOKOE, D.,MACDONALD, S. G., CADWALLADER, K, SYMONS, M. AND HANCOCK, J. F. Activation of Raf as a result of recruitment to the plasma membrane [published erratum appears in Science 1994 Dec l6;266(5 192): 1 792-31.Science 264: 1463-1467, 1994.

STOYANOV, B., VOLiNiA, S., HANCK, T., RUBIO, L, LOUBTCHENKOV,M., MALEK, D., STOYANOVA, S., VANHAESEBROECK, B., DHAND,R, NURNBERG, B. AND et al: Clonuig and chaacterization of a G protein-anivated human phosphoinositide 3-kinase. Science 269: 690493, 1995.

STüEHR, D. J., KWON, N. S. AND NATHAN, C. F. FAD and GSH participate in macrophage synthesis of nitric oxide. Biochemical& Biophysical Research Communications 168: 558-565, 1990. STUU,J. T., TANSEY,M. G., TANG, D. C., WORD, R A. AND KAMM, K. E. Phosphorylation of rnyosh Iight chain kinase: a cellular mechanism for CaZ' desensitization. [Review] [35 refis]. Molecuiar & Ceiiular Biochemistq 127428: 229-237, 1993.

SUN, S. C., MAGGIRWAR, S. B. AND HGRHAJ, E. Activation of NF-kappa B by phosphatase inhibitors involves the phosphorylation of 1 kappa B alpha at phosphatase ZA-sensitive sites. Journal of Biologicai Chemistry 270: 18347-183 5 1, 1995.

SUPERTI-FURGA,G., FUMAGALLI, S., KOEGL, M., COURTNEIDGE, A AND DRAETTA, G. Csk inhibition of c-Src activity requires both the SHZ and SH3 domains of Src. EMBO Journal 12: 2625-2634, 1993.

SZABO, C. Alterations in nitric onde production in various foms of circulatory shock. [Review] . New Horizons 3: 2-32, 1995.

TADA, M. Molecular structure and hction of phospholamban in reguiaîing the calcium pump fkom sarcoplasmic retidum. [Review] [38 refs]. Annals of the New York Academy of Sciences 671: 92-1 02, 1992.

TAKAHASI, K., BARDHAN, S., KAMBAYASHI, Y., SHIRAI, H AND INAGAMi, T. Protein tyrosine phosphatase inhibitioon by angiotensin II in rat pheochromocytoma ceils through type 2 receptor, AT2. Biochemical & Biophysical Research Communications 198: 60-66, 1994.

TANAKA,T., OHTA, a,KANDA, K.,HIDAKA, H. AND SOBUE,K. Phosphorylation of high-Mr caldesmon by protein kinase C modulates the regulatory hction of this protein on the interaction between actin and myosin. European Journal of Biochemistry 188: 495-500, 1990.

TANG, W.J. AND GILMAN, A. G. Adenylyl qclases. [Review]. Cell70: 869-872, 1992.

TANSEY,M. G., WORD, R A., HIDAKA, H., SINGER, H. A, SCHWORER, C. M., KAMM, K. E. AND STULL, J. T. Phosphotylation of myosin light chah kinase by the multifùnctionai calmodulin-dependent protein kinase II in smooe muscle cds. Journal of Biologicd Chemistry 267: 1251 1- 125 16, 1992.

TAUSSIG, R., QUARMBY,L. M. AND GILMAN, A G. Regulation of purified type 1 and type 11 adenylyl cyclases by G protein beta gamma subunits. Journal of Biological Chernistry 268: 9- 12, 1993. TAY-UYBOCO, J., POON, M-C., AHMAD,S. AND HOUENBERG, M. D. Contractile actions of thrombin receptor-derived polypeptides in human ~biiidand placentai vasdature: evidence for distinct receptor systems. British Joumai of Phamiacology 115: 569-578, 1995.

TAYEH, M. A. AND MARLETTA, M. A Macrophage oxideation ofL-arginine to niait oxide, nitrite, and nitrate. Tetrahydrobiopterin is required as a cofactor. Jodof Biological Chemistry 264: 19654-1 9658, 1989.

TAYLOR, C. W. AND TRAYNOFt, D. Calcium and inositol trisphosphate receptors. [Review] [108 rds]. Journal of Membrane Biology 145: 109-1 18, 1995.

TETSUKA, T. AND MORRISON, A R Tyrosine kinase activation is necessary for inducible nitric oxide synthase expression by interleukin-1 beta. Amerïcan Journal of Physiology 269: Pt 1):CSS-9, 1995.

THOMAS, S. M.,DEMARCO, M-, D'ARCANGELO. G., HALEGOUA, S. AND BRUGGE, J. S. Ras is essential for nerve growth factor- and phorbol ester-induced tyrosine phosphorylation of MAP kinases. Ce11 68: 1O3 1- 1040, 1992.

THORBURN, J., MCMAHON, M. AND THORBURN, A Raf-1 kinase activity is necessary and sufiïcient for gene expression changes but not dcient for cellular morphology changes associated with cardiac myocyte hypertrophy. Journal of Biological Chemistry 269: 30580-30586, 1994.

THURSTON,A W.,IR AND SHUKLA, S. D. Ethanol modulates epidermal growth factor-stimulateci tyrosine hase and phosphorylation of PLC-gamma 1. Biochemicai & Biophysical Research Communications 185: 1062-1068, 1992.

TOKEK A, MEYER M., REDDY, K. K., FALCK, J. R,ANEJq R,ANHA, S., PARRq A, BURNS, D. J., BALLAS, L. M.AND CANTLEY, L. C. Activation of protein kinase C family members by the novel polyphosphoinositides PtdIns-3,4-P2 and PtdIns-3,4,5-P,.Joud ofBiologica1 Chemistry 249: 323 58-32367, 1994.

TOU- K., INGLESE, J-, PITCHER, J- A, SHAW, G-AND LEFKOWJTZ, R J. Binding of G protein beta gamma-subunits to pieckstrin homology domains. Journal of Biologicai Chemktry 269: 102 1740220, 1994.

TOU- K., HAWES. B. E., BIESEN, T. V. AND LEFKOWITZ, R J. G protein Pr subunits stimulate phosphorylation of Shc adapter protein. Proceedings of the National Academy of Sciences of the United States of Arnerica 92: 9284-9287, 1995.

TOULLEC, D., PMNETTI, P., COSTE, H., BELLEVERGUE, P., GRAND-PERRET, T., AJAKANE, M., BAUDET, V., BOISSIN, P., BOUM- E., LORIOLLE, F-AND et al: The bisindolylmaeunide GF 109203X is a potent and selective infiibitor of protein keC-Journal of Biological Chemistry 266: 15771-15781, 1991.

TOUYZ, R. M. AND SCHIFFRIN, E. L. Tyrosine kinase signalling pathways modulate angiotensin II-induced calcium ([Ca2+]i)transients in vascular smooth muscle cells. Hypertension 27: 1097-1 103, 1996.

TRACEY, W. R,POLLOCK, J. S., MURAD, F., NAKANE, M. AND FORSTERMANN, U. Identification of an endotheliai-like type III NO syntbase in

LLC-PIC1 kidney epithelial cells. American Journal of Physiology 266: Pt 1):C22-8, 1994.

TRAHEY, M. AND MCCORMICK, P. A cytoplasmic protein stimulates normal N-ras p21 GTPase, but does not affect oncogenic mutants. Science 238: 542-545, 1987.

TRWKLE-MULCAW L., ICHIKAWA, K., HARTSHORNE, D. J., SIEGMAN, M. J. AND BUTLER, T. M. Thiophosphorytation of the 130-kDa subunit is associated with a decreased activity of myosin light chah phosphatase in alpha-toxin- permeabiiized smooth muscle. Journal of Biological Chemistry 270: 18 19 1- 18 194, 1995.

TROPPWJ., BRUDER J. T., APP, H.,CAI, H..LIPTAK, L., SZEBERENYI, J., COOPER, G. M. AND RAPP, U. R Ras wntrols couphg ofgrowth factor receptors and protein kinase C in the membrane to Ra51 and B-Raf protein serine Iaaases in the cytosol. OncogeneRaf 7: 18674873, 1992.

TRYBUS, K. M- Regdation of expresseci tmncated smooth muscle myosins. Role of the essential light chah and tail length. Journal of Biologicai Chemistry 269: 208 19-20822, 1994.

UEDA, Y., HIRAI S, OSADA S, SUZUKZ, A, MIZUNO, K. AND OHNO, S. Protein kinase C activates the MEK-ERK pathway in a manner independent of Ras and dependent on Journal of Biological Chemistry 271: 235 12-23519, 1996.

UEHARA, T., TOKUMITSU,Y. AND NOMURA, Y. Womkinhibits insulin-induced Ras and rnitogen-activateci protein kinase activation related to adipocyte differentiation in 3T3-L 1 fibroblasts. Biochemical & ~io~h~sid~esearch Communications 210: 574-580, 1995.

UI, M., OKADA, T., HAZEKI, K. AND HAZEKI, O. Wortmannin as a unique probe for an intraceiluiar signahg protein, phosphoinositide 3-kinase. [Review] [49 refs]. Trends in Biochemical Sciences 20: 303-307, 1995. ULLRICH, A AND SCHLESSDlGER, J. Signa1 transduction by receptors with tyrosine kinase activity. [Review]. CeU 61: 203-212,1990.

URICH., M., EL SHEMERLY, M. Y., BESSER, D., NAGAMINE, Y. AND BALLMER-HOFER, K Activation and nuclear translocation of mitogen-activated protein kinases by polyornavirus rniddle-T or semdepend on phosphatidylinosito13-kinase. Journal of Biological Chemistry 270: 29286-29292, 1995.

VAN BESEN, T., HAWES, B. E., LUTTRELL, D. K., KRUEGm K M, TOU' K., PORFIRI, E., SAKALE, M-, LuTrRELL, L. M- AND LEFKOWITZ, R J. Receptor-tyrosine-küiase- and G beta garnma-mediaieci MAP kinase activation by a common signalhg pathway. Nature 376: 78 1-784, 1995.

VANRENTERGHEM, B., BROWNING,M. D. AND MAUER, J. L. Regdation of mitogen-activateci protein kinase activation by protein kinases A and C in a ceU-fFee system. Journal of Biological Chemistry 269: 24666-24672, 1994.

VELAZ, L., TNGRAHAM, R H. AND CHALOVICH, J. M. Dissociation of the effect of caldesmon on the ATPase activity and on the binding of smwth heavy meromyosin to actin by partial digestion of caldesmon. Joudof Biologicai Chemistry 265: 2929-2934, 1990.

VENKATARAMAN,Le, BURAKOFF, S. J. AND SEN,R K506 inhibits antigen receptor-mediated induction of c-rel in B and T lymphoid celis. Journal of Experimental Medicine 181: 1091-1099, 1995.

VILLA A, PODINI, P., NON, A, PANZERI, M. C..MARTINI, A, MELDOLESI, J. AND VOLPE, P. The endoplasmic reticulum-sarcoplasmicreticulum connedon. II. Postnatal differentiation of the sarcoplasmic reticulum in skeletal muscle fibers. Experimentd Ce1 Researcti 209: 140-148, 1993.

VOGEL, W., LAMMERS, R, WANG, J. AND ULLRICH, A. Activation of a phosphotyrosine phosphatase by tyrosine phosphorylation. Science 259: 161 1-1 6 1 4, 1993.

VOJTEK, A B., HOLLENBERG, S. M. AND COOPER, J. A- Mammalian Ras interacts duectly with the serüidthreonine kinase Raf Ceil 74: 205-214, 1993.

VU, T. K., H'WG, D. T., WHEATON, V. 1. AND COUGHLIN, S. R Molecular cloning of a iknctional thrombin receptor reveals a novel proteolytic mechanism of receptor activation. Cell64: 1057-1068, 1991.

WALSH, M. P. Calmodulin and the regdation of smooth muscle contraction. [Reviewj [287 refs]. Molecular & Cellular Biochemistry 135: 21-41, 1994. WAN, Y., KUROSAEU, T. AND HUANG, X Y. Tyrosine kinases in activation of the MAP kinase cascade by G-protein-coupled receptors. Nature 380: 541-544, 1996.

WANG, S. L., JACOBER, L., WU-WGNG, C. Y., SLOMIANY, A AND SLOMIANY, B. L. Ethanol-induced structural and fünctional alterations of epidermal growth factor receptor in buccal rnucosa International Jourd of Biochemistry 24: 85-90, 1992.

WATSON, A J., HOGAN, A, HAHNEL,A, WIEMER K. E. AND SCHULTZ,G. A Expression of growth factor ligand and receptor genes in the preimplantation bovine embryo. Molecular Reproduction & Development 31: 87-95, 1992.

WATTS, S. W. Serotonin activates the mitogen-activated protein kùiase pathway in vascular smooth muscle: use of the mitogen-activated protein kinase kinase inhibitor PD098059. Journal of Pharmacology & Experhentai Therapeutics 279: 1541- 1550, 1996.

WENNSTROM, S., SlEGBAHN, A, YOKOTE, K., ARWDSSON, A. K., HELDIN, C. H., MORI, S. AND CLAESSON-WELSH, L. Membrane ndliing and chernotaxis transduced by the PDGF beta-receptor require the binding site for phosphatidyhositol3' kinase. Oncogene 9: 65 1-660, 1994.

WERNER, E. R, WERNER-FELMAYER, G. AND WACHTER, H. Tetrahydrobiopterin and cytokines. Experimental Biology and Medicine 203: 1-1 2, 1993.

WHITE, K. A AND MARLETTA, M. A. Nitric oxide synthase is a cytochrome P-450 type hemoprotein. Biochemistry 31: 66276631, 1992.

WHITESIDE, S. T. AND GOODBOUN, S. Signai transduction and nuclear targerting: regulation of transcription factor activity by subcellular localisation. Journal of Celi Science 104: 949-955.1993-

WUETUNGE, S. AND HUGHES, A. D. Effect of platelet-derived growth factor on voltage-operated calcium channels in rabbit isolated ear artery cells. British Journal of Pharmacology 115: 534-53 8, 1995a

WIJETUNGE, S. AND HUGHES, A D. pp6OC- increases vol-ge-operated calcium channel currents in vascular smooth muscle ceiis. Biochemical & Biophysical Research Communications 217: 1039- 1OU, 1995b.

WILCOX, B. D.,DUMIN, J. A. AND JEFFREY, J. J. Serotonin regdation of interleukin-1 messenger RNA in rat uterine smooth muscle cells. Relationship to the production of interstitiai collagenase. Journal of Biologicai Chemistry 269: 29658-29664, 1994. WILEMAN, S. M., MANN, G. E. AND BAYDOUN, k R Induction of L-ar-e transport and nitric oxide synthase in vdarsmooth muscle ceils: synergistic actions of pro-inflammatory cytokines and bacterial 1ipopoIysaccharide. British Journal of Phannacology 116: 3243-3250, 1 995.

WILKINSON, P. K. Pharmacokinetics ofethanol: a review. [Review] [80 refs]. Alcoholism, Clinid & Experimental Research 4: 6-21, 1980.

UrINDER, S. I., PATO, M. D. AND WALSH, M. P. Purification and characterization of caiponin phosphatase fkom smooth muscle. Effect of dephosphorylation on calponin fiinctioa Biochemical Journal 286: 197-203, 1992.

WINDER S. J. AND WALSH, M. P. Smooth musde calponin Inhibition of actomyosin MgATPase and regulation by phosphorylation. Journal of Biological Chemistry 265: 10148-10155, 1990.

WOLBRING, G., HOLLENBERG, M. D. AND SCHNETKAMP, P. P. Inhibition of GTP-utiliting enzymes by tyrphostuis. Journal of Biological Chemistry 269: 22470-22472, 1994.

WOLIN, M. S., WOOD,K S. AND IGNARRO, L. J. GuanyIate cyclase fiom bovine lung. A kinetic analysis of the regulation of the purifieci soluble enzyme by protoporphyrin IX, heme, and Ntrosyi-heme. Journal of Biological Chemistry 257: 133 12-13320, 1982.

WONG, H. R., FINDER, J. D., WASSERLOOS, K., LOWENSTEIN, C. J., GELLER, D. A., BILLIAR, T. R,PITT, B. R AND DAWES, P. Transcriptional regdation of NOS by IL-1 beta in cultured rat pulmonary artery smooth muscle cells. Amencan Journal of Physiology 271 : Pt 1):L 166-71, 1996.

WONG, J. M. AND BILLW T. R Regdation and function of inducible nitric oxide synthase during sepsis and acute uinammation. peview] [68 refs]. Advances in Phamawlogy 34: 155- 170, 1995.

WOOD, K. W.,SARNECKI, C., ROBERTS, T. M. AM) BLENIS, J. ras mediates nerve growth factor receptor modulation of three signal-transducing protein kinases: MAP kinase, Raf-1, and RSK. Ce11 68: 1041-1050, 1992.

WU, D., KATZ, A AND SIMON, M.1. Activation of phospholipase C beta 2 by the alpha and beta gamma subunits of trimeric GTP-binding protein. Proceedings of the National Academy of Sciences of the United States of America 90: 5297-530 1, 19%. XIE, Q.W., CHO, H. J., CALAYCAY, I., MUMFORD, R A, SWIDEREK, K-M., LEE, T. D., DING, A, TROSO, T. AND NATHAN, C. Cloning and characterization of inducible nitric oxide synthase fiorn mouse macrophages. Science 256: 225-228,1992.

ME, Q. W., WHISNANT, R AND NATHAN, C. Promoter of the mouse gene encoding calcium-independent nitric oxide synthase confers inducibility by interferon gamma and bacterial lipopolysaccharide. Joumai of Experimental Medicine 177: 1779- 1784, 1993-

YAN,M. AND TEMPLETON, D. J. Identification of 2 se~eresidues of MEK-1 that are difirentially phosphorylated during activation by raf and MEK kinase. Journal of BioIogical Chemistry 269: 19067- 19073, 1994.

YANG,S. G., SAIFEDDINE, M., CHüANG, M., SEVERSON, D. L. AND HOLLENBERG, M. D. Diacylgiycerol lipase and the contractile action of epidermd growth factor-urogastrone: evidence br diict signai pathways in a singie strip of gastric smooth muscle. European Joumai of Pharmacology 207: 225-230, 199 1.

YANG, S. G., LANIYONU, A., SAEEDDINE, M., MOORE, G. J. AND HOLLENBERG, M. D. Actions of tiirombin and thrombin receptor peptide analogues in gastric and aortic smooth muscle: deveIopment of bioassays for structure-activity studies. Life Sciences 51: 1325-1332, 1992a

YANG, S. G., SAIFEDDINE, M. AND HOLLENBERG, M. D. Tyrosine kinase inhibitors and the contractile action of epidermal gowth factor-urogastrone and other agonists in gastric smooth muscle. Canadian Journal of Physiology & Pharmacology 70: 85-93, 1992b.

YANG, S. G., SAIFEDDINE,M., LANTYONU, A. AND HOLLENBERG, M. D. Distinct signal transduction pathways for angiotensin-II in guinea pig gastric srnooth muscle: differential blockade by indornethacin and tyrosine kinase inhibitors. Journai of Phannadogy & Experimental Therapeutics 264: 958-966, 1993.

YAO, L., KAWAKAMI, Y. AND KAWAKAMI, T. The pleckstrin homology domain of Bruton tyrosine kinase interacts with protein kinase C. Proceedings of the Nationai Academy of Sciences of the United States of Amerka 91 : 91 75-9 179, 1994.

YOUNG,S. W., POOLE, R c.. HUDSON, A T., HALESTR~P.A P., DENTON, R M. AND TAVARE, J. M. Effects of tyrosine kinase inhiiitors on protein kinase-independent systems [published erratum appears in FEBS Lett 1993 Mar 22;3 19(3):292]. FEBS Letters 316: 278-282, 1993. YU, Y., HATTORI, R,KOSUGA, K., EIZAWA, H., HIKZ, K, OHKAWA, S., OHNISHI, K., TERAO, S. AND KAWAI, C. Calmodulin-hdependent nitric oxide synthase f?om rat polymorphonuclear neutrophils. Journal of Biological Chemistry 266: 3369-3371, 1991.

ZAMPONI, G. W-,BOURINET, E., NELSON, D., NARGEOT, J. AND SNUTCH, T. P. Crosstalk between G proteins and protein kinase C mediated by the calcium channel alpha1 subunit. Nature 385: 442-446,1997.

ZHANG, F., STRAND,A, ROBBiNS, D., COBB, M. H AM) GOLDSMITH,E- J. Atomic structure of the MAP kinase ERK;! at 2.3 A resolution. Nature 367: 704-71 1, 1994.

ZHANG, J., KING, W. G., DILLON, S., HALL,A, FEIG, L. AND RITTENHOUSE, S. E. Activation of platelet phosphatidylinositide 3-kinase requires the small GTP-biding protein Rho. Journal of Biological Chemistry 268: 2225 1-22254, 1993.

ZHENG, C. F. AM) GUAN, K. L. Clonhg and characterization of two distinct human extracellular signai-regulated base activator kinases, MEKl and MEK2. Journal of Biological Chemistry 268: 1 1435-1 1439, 1993.

ZHENG, C. F. AND GUAN, K. L. Cytoplasmic IocaIization of the mitogen-activated protein kinase advator MEK. Journal of Biological Chernistry 269: 19947-19952, 1994a

ZHENG, C. F. AND GUAN, K. L. Activation of MEK family kinases requires phosphorylation of two conserveci SertTh residues. EMBO Journal 13: 1 123-1 t 3 1, 1994b.

ZHENG, X.M., WANG, Y. AND PALLEN, C. J. Cell transformation and activation of pp60c* by overexpression of a protein tyrosine phosphatase. Nature 359: 336-339, 1992.

ZHOU, M. M, RAWCHANDRAN, K. S., OLEJNiCZAK, E. F., PETROS, A M., MEADOWS, R P., SATTLER, M., HARLAN, J. E., WADE, W. S., BURAKOFF, S. J. AND FESïK, S. W. Structure and ligand recognition of the phosphotyrosine binding domain of Shc. Nature 378: 584-592, 1995. 686SâBU9LL =-- 00EDZBPBCL :euoild =-- vsn mtAN '~elçeipou ?=- IWS u.w >se3s9L w ' 39bZ/VI y 03llddV