Downloaded from orbit.dtu.dk on: Dec 20, 2017
Unraveling the Secondary Metabolism of the Biotechnological Important Filamentous Fungus Trichoderma reesei ( Teleomorph Hypocrea jecorina)
Jørgensen, Mikael Skaanning; Larsen, Thomas Ostenfeld; Mortensen, Uffe Hasbro; Aubert, Dominique
Publication date: 2013
Document Version Publisher's PDF, also known as Version of record
Link back to DTU Orbit
Citation (APA): Jørgensen, M. S., Larsen, T. O., Mortensen, U. H., & Aubert, D. (2013). Unraveling the Secondary Metabolism of the Biotechnological Important Filamentous Fungus Trichoderma reesei ( Teleomorph Hypocrea jecorina). Kgs. Lyngby: Technical University of Denmark (DTU).
General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.
• Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
Unraveling the Secondary Metabolism of the Biotechnological Important Filamentous Fungus Trichoderma reesei (Teleomorph Hypocrea jecorina)
MJ-T-030
Mikael Skaanning Jørgensen Ph.D. Thesis November 2012 MJ-T-020
MJ-T-032 28 8 20
27 5 28 1 30 17 8 24 25 9 25 31 13 15 26 16 4 24 12 32 18 11 3 14 13 19 10 5 7 2 9 2521 22 23
Unraveling the Secondary Metabolism of the Biotechnological Important Filamentous Fungus Trichoderma reesei (Teleomorph Hypocrea jecorina)
Mikael Skaanning Jørgensen Ph.D. Thesis November 2012
I. Preface and Funding
The work regarding this thesis was primarily carried out at department 463, Fungal Gene Technology at Novozymes in Bagsvaerd. My first hands-on experience with Trichoderma reesei was acquired at the Fungal Expression I department of Novozymes, California, where I stayed for two months in the beginning of the project. All experimental work regarding Aspergillus nidulans and metabolite profiling using UHPLC-TOF-MS was carried out in building 223 and 221, respectively, at the Center for Microbial Biotechnology, Department of Systems Biology, Technical University of Denmark (DTU).
The project was funded by Novozymes, Center for Microbial Biotechnology at DTU and Research School for Biotechnology (FOBI).
Supervisors: Uffe Hasbro Mortensen Center Director, Professor DTU Systems Biology De partment of Systems Biology Center for Microbial Biotechnology Technical University of Denmark
Dominique Aubert Skovlund
Senior Scientist Department 463, Fungal Gene Technology Novozymes Mikael Skaanning Jørgensen
II. Acknowledgements
The past few years have been an incredible experience for me and include some of the most interesting times of my life and also some of the hardest. Through both I have been surrounded by magnificent people that deserve my acknowledgement.
I owe my gratitude to everyone at Novozymes department 463, Fungal Gene Technology, for making me feel so welcome and for putting their interest into my project. It has truly been a pleasure to get to know everyone in the department and I know that I will miss their great company in the future. I also greatly appreciate the help I have received from the department’s laboratory technicians when time has been sparse – and I owe them for making my long days in the laboratory a joy. I have had a tremendous degree of freedom in the laboratory and for that I can only credit 463’s Department Manager Pia Francke Johannesen who has also contributed with great input regarding my project. Special thanks go to my supervisor from Novozymes, Senior Scientist Dominique Aubert Skovlund, who I have also been so fortunate to share an office with. I thank her for always taking her time to discuss important aspects of my project and for the inputs I have received through the last couple of years. Our mutual office mate, Senior Professional Jesper Henrik Rung, also deserves to be acknowledged for making the days at the office such a good experience.
At DTU everyone at the Center for Microbial Biotechnology (CMB) has always made me feel welcome. The great expertise regarding fungal secondary metabolism at CMB has always resulted in great feedback after presentations, interesting discussions and good inputs for the project. In that regard PhD student Dorte Koefoed Holm deserves special attention – I truly admire her for her diligence. I would like to thank Associate Professor Kristian Fog Nielsen for introducing me to the world of analytical chemistry and for making this field of study much less frightening than it seemed before.
My supervisor at DTU, Center Director and Professor Uffe Hasbro Mortensen, also deserves huge credit for his unique insight into my project. Even though his time has been sparse, our meetings have always been fruitful and I am grateful for his feedback during preparation of the manuscripts included in this thesis.
I also want to thank my friends for hanging on even though I have been missing in action for several long periods during the extent of this project. I really look forward to be able to spend more time with them again.
Last, but not least, I am full of gratitude for the extraordinary family I have been rewarded with. I truly appreciate the unconditionally support that I have always been given, not just through this project, but in all aspects and I will always be grateful for having them in my life.
III. Abstract The filamentous fungus Trichoderma reesei (teleomorph Hypocrea jecorina) is one of the most important industrial production organisms, owing to its highly efficient (hemi- )cellulase synthesis and secretion machineries. These enzymes, which in nature allow the fungus to utilize energy bound in cellulosic biomass, has wide application in the pulp and paper, textile and biofuel industries. The genomic sequence for T. reesei was published in 2008 and provides the basis for introducing targeted genetic alterations that could for example increase cellulase production yields. Like all other filamentous fungi, also T. reesei synthesizes a range of small bioactive metabolites which are not required for growth, but can broaden the ecological niche of the fungus. Since these bioactive metabolites are not involved in the primary metabolism, they are often referred to as secondary metabolites. These metabolites include some of the most potent toxins of natural source and can therefore have a vast implication on human health and also on the economy if crops are contaminated or livestock affected. Luckily, the high bioactivity for these metabolites also provides a range of beneficial activities and they therefore constitute one of the most important sources for pharmaceuticals; including drugs for treatment of infections, for lowering of the cholesterol level in the bloodstream and for minimizing undesirable immune responses. The primary objective of this study was to gain more knowledge about the genetic mechanisms leading to biosynthesis of two of the most prominent types of secondary metabolites produced by T. reesei, polyketides and non-ribosomal peptides. Since the molecular tools for T. reesei are not as well-developed as for many other species, the study was initiated with creation of new genetic tools that would enable pursuance of the primary objective. The developed molecular tools were assembled into an expression system for high-throughput construction of defined integrated T. reesei mutants and combined inactivation of the non-homologous end joining pathway that facilitates ectopic integration of exposed DNA fragments, and a color maker so that the mutants, in which the substrate had been integrated correct, could be identified by their phenotype. A new bidirectional selective marker system was developed based on the pyr2 gene, involved in the pyrimidine biosynthesis pathway, and was included in the expression system. The developed expression system was subsequently utilized to overexpress several transcription factor genes located in the proximity of polyketide synthase- or non-ribosomal synthetase genes in T. reesei. Overexpression of one of these transcription factor genes led to a significantly increased production of 78 different metabolites, some of which had previously been described and belong to the polyketide derived sorbicillinoids. Genetic deletions performed subsequently, demonstrated that two polyketide synthase genes, located near the overexpressed transcription factor gene, were both essential for biosynthesis of the sorbicillinoids. Hence, genes involved in biosynthesis of this group of polyketides were identified for the first time. Comparative genomics was subsequently used to identify a highly similar polyketide synthase gene cluster in another well-known sorbicillinoid producer, Penicillium chrysogenum. Twenty three T. reesei polyketide synthase- and non-ribosomal peptide synthetase genes were selected for heterologous expression in Aspergillus nidulans, using a previously developed expression system. Several of the resulting mutants exhibited altered phenotypes and could be divided into two groups; one with mutants producing a pigment and another where the mutants had changed colony morphology. Unfortunately, no new metabolite products could be identified with the applied extraction- and analysis methods. Nevertheless, the isolated mutants could constitute an interesting source of knowledge about the T. reesei secondary metabolism after optimization of the applied methods.
IV. Resumé Den filamentøse svamp Trichoderma reesei (teleomorf Hypocrea jecorina) er en af de mest udbredte industrielle produktionsorganismer, hvilket skyldes en ekstremt veludviklet evne til at syntetisere og udskille cellulose-nedbrydende enzymer. Disse enzymer, der i naturen giver svampen mulighed for at udnytte den energi, der er bundet i plantebaseret biomasse, har industriel anvendelse ved fremstillingen af både papir og tekstiler og spiller desuden en betydelig rolle i fremstillingen af bioethanol. Genom sekvensen for T. reesei blev publiceret i 2008 og muliggør blandt andet en målrettet optimering af produktionsudbyttet af cellulaser fra denne svamp. Som andre filamentøse svampe, producerer T. reesei et arsenal af små meget bioaktive metabolitter, som ikke er krævet for at opretholde vækst, men er i stand til at udvide den producerende svamps økologiske niche. Disse bioaktive metabolitter betegnes ofte som sekundære metabolitter og produktion af disse påvirker også mennesker, da de blandt andet inkluderer nogle meget potente toksiner, som kan have både økonomiske og sundhedsmæssige implikationer. Den store bioaktivitet betyder ligeledes, at mange sekundære metabolitter bliver brugt som lægemidler til blandt andet bekæmpelse af infektioner, til at sænke kolesterolniveauet i blodet og til at minimere uhensigtsmæssige immunresponser. Det primære formål med dette studie var at få et større indblik i de genetiske mekanismer bag produktionen af to af de mest fremtrædende typer af sekundære metabolitter i T. reesei, polyketider og non-ribosomale peptider. Da de molekylære værktøjer for T. reesei ikke er så veludviklede som for mange andre arter, blev studiet indledt med initiativer for at udvide den genetiske værktøjskasse, så det primære mål kunne forfølges. De udviklede værktøjer blev samlet til et ekspressionssystem der faciliterer hurtig konstruktion af mutanter med korrekt integreret substrat. Ekspressionssystemet kombinerer inaktivering af mekanismen bag ektopisk integration af DNA fragmenter og favoriserer dermed målrettet integration og inkluderer en farvemarkør så de mutanter der har substratet korrekt integreret, udskiller sig fænotypisk fra baggrunden. Til systemet blev der ligeledes udviklet en ny effektiv dobbeltselekterbar markør baseret på pyr2 genet, som er involveret i syntesen af pyrimidiner. Det udviklede ekspressionssystem blev efterfølgende benyttet til at overudtrykke en række transkriptionsfaktor gener udvalgt med baggrund i deres placering nær polyketid syntase- eller non-ribosomale peptid syntetase gener i T. reesei´s genom. Overudtrykkelse af et enkelt af disse medførte en stærkt forøget produktion af hele 78 forskellige metabolitter, hvoraf flere tidligere er beskrevet og tilhører en polyketid- baseret gruppe af metabolitter kaldet sorbicillinoider. Efterfølgende gendeletioner demonstrerede, at syntesen af disse sorbicillinoider var afhængig af to polyketid syntese gener lokaliseret i den samme genklynge som det overudtrykte transkriptionsfaktor gen. Dette studie inkluderer dermed første rapporterede identifikation af gener involveret i syntese af sorbicillinoider. Komparativ genomisk analyse blev efterfølgende benyttet til at identificere en lignende klynge af gener i en anden producent af sorbicillinoider, Penicillium chrysogenum. Treogtyve T. reesei polyketid syntese- og non-ribosomal peptid syntese gener blev desuden udvalgt til heterolog ekspression i Aspergillus nidulans ved brug af et allerede udviklet ekspressionssystem. Flere af de resulterende mutanter udviste fænotypiske forandringer, der kunne inddeles i to grupper, pigmentproducerende og med ændret kolonimorfologi. På trods af dette kunne ingen nye metabolitter detekteres med de anvendte metoder og optimering af både metabolit oprensningsproceduren og analysemetoden er højst sandsynligt påkrævet inden dette er muligt. Når udført, udgør de allerede isolerede mutanter dog en yderst interessant kilde for yderligere indsigt ind den sekundære metabolisme for T. reesei.
V. Table of Contents I. Preface and Funding II. Acknowledgements III. Abstract IV. Resumé V. Table of Contents VI. Abbreviations VII. Objectives and Thesis Outline 1. General Background ...... 1 1.1. Filamentous Fungi ...... 1 1.1.1. Trichoderma reesei (Teleomorph Hypocrea jecorina) ...... 1 1.1.2. Aspergillus nidulans ...... 3 2. Chapter I – Tool Development ...... 5 2.1. Introduction ...... 6 2.1.1. Gene Targeting ...... 6 2.1.2. Selectable Markers ...... 7 2.1.3. Molecular Cloning ...... 9 2.2. Manuscript I. An Efficient Expression Platform for Trichoderma reesei (Teleomorph Hypocrea jecorina) ...... 11 2.3. Complimentary Research Results ...... 27 2.3.1. Selection of pyr2 as an Alternative to pyr4...... 27 2.3.2. Measurement of Growth Rates for Mutant Strains ...... 29 3. Chapter II – Unraveling the Secondary Metabolism of T. reesei ...... 33 3.1. Introduction ...... 34 3.1.1. Secondary Metabolites ...... 34 3.1.2. Secondary Metabolite Types ...... 34 3.1.3. PKS and NRPS Gene Clusters ...... 38 3.1.4. Non-Ribosomal Peptides ...... 39 3.1.5. Polyketides ...... 42 3.1.6. Regulation of PK and NRP Biosynthesis ...... 46 3.1.7. Linking SM Genes and Products ...... 47 3.1.8. HPLC and Detectors ...... 49 3.1.9. T. reesei PK and NRP Metabolites and Genes ...... 50 3.2. Manuscript II. Identification of the Sorbicillinoid Synthase Gene Cluster in Trichoderma reesei (Teleomorph Hypocrea jecorina) by Overexpression of PKS- and NRPS Gene Cluster Specific Transcription Factors...... 55 3.3. Manuscript III. Heterologous Expression of Trichoderma reesei (Teleomorph Hypocrea jecorina) Polyketide Synthase-, Non-Ribosomal Peptide Synthetase- and Hybrid Synthetase Genes in Aspergillus nidulans...... 77 3.4. Description of Appendices for Chapter II ...... 93 4. Summation and Perspectives ...... 94 5. References ...... 97 6. Appendices ...... 111 6.1. Phylogeny of T. reesei Strains Included in the Study ...... 111 6.2. pyr2 Alignment...... 112 6.3. UV Absorption Spectra for the Sorbicillinoids ...... 115 6.4. Sorbicillinoid Structures ...... 132 6.5. PKS and NRPS Alignments ...... 138 6.5.1. Alignment and Phylogeny of PKS AT Domains ...... 138 6.5.2. Alignment and Phylogeny of 23171 A Domains ...... 142 6.5.3. Alignment and Phylogeny of NRPS A Domains ...... 149
VI. Abbreviations
Abbreviation Description Abbreviation Description 5-FdOMP 5-Fluoroorotidine monophosphate KR b-Keto reductase domain 5-FdUMP 5-Fluorodeoxyuridine monophosphate KS b-Keto synthase domain 5-FOA 5-Fluoroorotic acid Leu Leucine A Adenylation domain MeCN Acetonitrile AA Amino acid MeOH Methanol Ac-Aib Acetyl-α-aminoisobutyric acid MM Minimal media (A. nidulans) ACP Acyl carrier protein MM1 Primary minimal media (sucrose based) ACV δ-(L-α-aminoadipyl)-L-cystein-D-valine MM2 Secondary minimal media (mannitol based) ACVS ACV synthetase MS Mass spectrometry Aib α-aminoisobutyric acid MS-MS Tandem MS AIR 5’-Phosphoribosylaminoimidiazole MT Methyl transferase Ala Alanine NCBI National Center for Biotechnology AT Acyl transferase domain Information AVF Averufin NHEJ Non-homologous end joining AVN Averantin NMR Nuclear magnetic resonance AVNN Averufanin NOR Norsolorinic acid C Condensation domain NRP Non-ribosomal peptide CAIR 5’-Phosphoribosyl 5-aminoimidazole carboxylate NRPS Non-ribosomal peptide synthetase CBH Cellobiohydrolase OAVN Oxoaverantin CDD Conserved Domain Database OE Overexpression CDS Coding sequence OMP Orotidine monophosphate CTP Cytidine triphosphate OMST O-Methylsterigmatocystin CYC Cyclization domain Ox Oxidase DAD Diode array detection P Probe DAHP 3-Deoxy-D-arabinoheptulosonate-7-phosphate PDA Potato dextrose agar DH Dehydratase domain PEP Phosphoenolpyruvate DHDMST Dihydrodemethylsterigmatocystin Pheol Phenylalaninol DHOMST Dihydro-O-methylsterigmatocystin PK Polyketide DHST Dihydrosterigmatocystin PKS Polyketide synthase DMST Demethylsterigmatocystin Pro Proline DSB Double stranded break PRPP 5-Phosphoribosyl-1-pyrophosphate DT Deletion test PT Product template domain dTMP Deoxythymidin monophosphate R Thioester reductase domain DTU Technical University of Denmark rv Reverse dUMP Deoxyuridine monophosphate SAICAR N-succinyl-5-aminoimidazole-4-carboxamide DW Downstream ribotide EG Endoglucanase SAT Starter unit acyl-carrier protein transacylase EIC Extracted Ion Chromatogram SDR Short-chain dehydroganase/reductase ER Enoyl reductase SM Secondary metabolite Ery4P Erythrose 4-phosphate ST Sterigmatocystin EST Expressed sequence tag T Thiolation domain / TtrpC terminator EtOAc Ethyl acetate TE Thioesterase domain FL Flank TF Transcription factor FOBI Research School for Biotechnology TOF Time-of-flight fw Forward TrF Transformation Gln Glutamine TS Thymidylate synthase Gly Glycine UHPLC Ultra-high pressure liquid chromatography GMP Guanosine 5′-monophosphate UMP Uridine monophosphate GOI Gene of interest UN Uridine nucleosidase HAVN 5′-Hydroxyaverantin UP Upstream HMM Hidden Markov model UPT Uracil phophotransferase HPLC High pressure liquid chromatography UTP Uridine triphosphate HR Homologous recombination Val Valine IMP Inosine 5′-monophosphate VAL Versiconal IOI Insert of interest VERA Versicolorin A iPKS Iterative PKS VERB Versicolorin B IT Insertion test VHA Versiconal hemiacetal acetate JGI Joint Genome Institute YPD Yeast extract peptone dextrose
VII. Objectives and Thesis Outline
The main purpose of this study was to gain more insight into the genetics behind the secondary metabolism of the important industrial filamentous fungus T. reesei (Teleomorph Hypocrea jecorina). While some of the secondary metabolites from this species have been described, none of these have previously been linked to any of the responsible genes. Recent publication of the full genome sequence of T. reesei (Martinez, Berka et al. 2008), freely available for browsing through the Joint Genome Institute (JGI) portal (http://genome.jgi- psf.org/Trire2/Trire2.home.html), now enables bioinformatic insights into the secondary metabolic potential of this species. Nevertheless, biosynthesis of secondary metabolites is extremely complex, and linkage between metabolites and genes involved in their biosynthesis can typically not be achieved without application of genetic engineering at present. Elucidation of the genetics behind two important classes of secondary metabolites, polyketides (PKs) and non-ribosomal peptides (NRPs), was commenced for T. reesei in this study. These classes of secondary metabolites are widely produced by filamentous fungi and constitute two very important sources of bioactive molecules for the pharmaceutical industry and they also include several very potent toxins with implications on human health and economy. This study was initiated by development of molecular tools for T. reesei, which were essential for pursuance of the primary objective. Development of these was followed by two approaches to gain more insight into the genetics behind the PK and NRP biosynthesis machineries. The results obtained in duration of this study are presented in three manuscripts divided into two main chapters as seen below.
Trichodermareesei
Chapter I – Tool development
Manuscript I (section 2.2)
An Efficient Expression Platform for Trichoderma reesei (Teleomorph Hypocrea jecorina)
Chapter II – Unraveling the secondary metabolism of T. reesei
Manuscript II (section 3.2) Manuscript III (section 3.3)
Identification of the Sorbicillinoid Heterologous Expression of Synthase Gene Cluster in Trichoderma reesei (Teleomorph Trichoderma reesei (Teleomorph Hypocrea jecorina) Polyketide Hypocrea jecorina) by Synthase-, Non-Ribosomal Peptide Overexpression of PKS- and NRPS Synthetase-and Hybrid Synthetase Gene Cluster Specific Genes in Aspergillus nidulans Transcription Factors
Manuscript I (section 2.2) presents an expression platform developed for use with T. reesei. The expression platform includes a new bidirectional selective marker based on the pyr2 gene, involved in the pyrimidine biosynthesis pathway, and a system for easy selection of defined integrated expression mutants. The latter was achieved by inactivating the non-homologous end joining (NHEJ) pathway, which normally facilitates random fusion of exposed DNA fragments, and use of adeB, involved in the purine biosynthesis pathway, as a specific integration site resulting in altered phenotypes of correct integrated mutants. This manuscript is in the final stage of preparation for submission to Fungal Genetics and Biology.
Manuscript II (section 3.2) describes use of the developed expression platform for overexpression of 11 selected polyketide synthase (PKS) and non-ribosomal peptide synthetase (NRPS) cluster specific transcription factors. The approach successfully led to identification of a PKS gene cluster responsible for biosynthesis of a group of PK derived metabolites referred to as sorbicillinoids. It was furthermore established that two collaborative PKSs, encoded by genes in the cluster adjacent to the over-expressed transcription factor, were both essential for biosynthesis of metabolites belonging to this group of PKs. Comparative genomics was subsequently used to estimate the cluster size and to pin-point the putative sorbicillinoid gene cluster in another sorbicillinoid producer, Penicillium chrysogenum. This manuscript is in the final stage of preparation for submission to Applied and Environmental Microbiology.
Manuscript III (section 3.3) includes a heterologous expression study of 23 T. reesei PKS-, NRPS- and hybrid synthetase genes in Aspergillus nidulans using an expression system previously developed by Bjarne Gram Hansen (Hansen, Salomonsen et al. 2011). Eight A. nidulans mutants with changed phenotypes were successfully isolated. At present this manuscript is not in preparation for publication.
A phylogenetic three of all T. reesei strains included in these studies can be seen in appendix section 6.1.
1. General Background PhD Thesis Mikael Skaanning Jørgensen
1. General Background
1.1. Filamentous Fungi
The term filamentous fungi covers numerous taxonomically diverse species which grow as multi-cellular filaments, also referred to as hyphae. Like all fungi, filamentous fungi are heterotrophs and depend on access to organic matter for energy. Most environments are dependent on filamentous fungi for decomposition of different types of biopolymers such as (hemi-)cellulose, starch, pectin and xylan from which the fungi also obtain their energy. An array of hydrolytic enzymes is typically released from the hyphal tips and breaks the adjacent biopolymers down to simple monomers which are subsequently absorbed by the hyphae. The well-developed enzyme synthesis and secretion system of filamentous fungi has let to exploitation of these as production organisms for enzymes with application in diverse industries such as the detergent-, bioenergy-, textile-, paper-, feed-, food- and beverage industries. Filamentous fungi typically also synthesizes and releases a selection of small molecular weight bioactive secondary metabolites (SMs), which are not essential for survival of the producer, but provide competitive advantages in the surrounding area and also intra- and interspecies signaling capacity (Demain, Fang 2000). The high bioactivity of these metabolites includes some very potent toxins, but also provides an interesting source of compounds with possible advantageous activities from a human point-of-view. One of the best examples is penicillin, produced by Penicillium rubens among others, which was discovered by Alexander Fleming in 1928 (Houbraken, Frisvad et al. 2011). Since the discovery of penicillin a wide range of other SMs derived from filamentous fungi and with diverse medical applications have been discovered and are currently in use as antimicrobials, immunosuppressants, cholesterol lowering agents, chemotherapeutics and siderophores (Misiek, Hoffmeister 2007). Filamentous fungi are furthermore interesting for research as model organisms since they are eukaryotic and have polarized cells and therefore resemble human cells more than yeasts. Two filamentous fungi were included in these studies, Trichoderma reesei and Aspergillus nidulans; more detailed descriptions of these can be seen in section 1.1.1 and 1.1.2, respectively.
1.1.1. Trichoderma reesei (Teleomorph Hypocrea jecorina)
The mesophilic filamentous fungus T. reesei (teleomorph Hypocrea jecorina) is the primary source of industrially produced cellulases and hemicellulases with application in the pulp and paper, textile and biofuel industries due to their ability to saccharificate plant cell wall polysaccharides. An isolate of this green ascomycete was taken from an army tent on the Solomon Islands during the Second World War after it had caused severe destruction of the cotton canvases. The isolate was added to the US army strain collection at the QuarterMaster Research and Development Center where it was named T. viride QM6a (MANDELS, REESE 1957), but were soon after recognized as a separate species from T. viride and renamed T. reesei, while the isolate ID “QM6a” was retained. Interestingly, this single isolate is the sole ancestor of all industrially applied T. reesei production strains at present. For about 50 years it was believed that T. reesei reproduced exclusively
1
1. General Background PhD Thesis Mikael Skaanning Jørgensen asexually, but in 1996 Kuhls and coworkers published molecular evidence indicating that it was a clonal derivative of the pantropic fungus H. jecorina (Kuhls, Lieckfeldt et al. 1996). This was supported by Seidl and coworkers in 2009 who identified the T. reesei Mat1-2 mating type and successfully crossed T. reesei with a H. jecorina strain of the Mat1-1 mating type (Seidl, Seibel et al. 2009). Despite the linkage to the sexually propagating fungus H. jecorina, which normally also provides the name for the holomorph, the name T. reesei is still dominating in publications due to historical reasons. The original QM6a isolate has been subjected to several rounds of classical mutagenesis and selection steps to obtain strains that excrete more protein with limited proteolytic break-down. One of the most applied high cellulose-producing clones of T. reesei, called RUT-C30, was obtained through two UV mutagenesis steps and one chemical mutagenesis step. Selection for catabolite derepression, higher extracellular protein levels and increased cellulase activity was performed (Eveleigh, Montenecourt 1979, Montenecourt, Eveleigh 1977). These steps have, together with extensive process development, resulted in strains able to produce more than 100 g/l of cellulases and hemicellulases highly feasible for commercial production (Cherry, Fidantsef 2003, Saloheimo, Pakula 2012, Schuster, Schmoll 2010). The widespread application of T. reesei as a production organism is also founded by its good properties for large scale fermentations and the fact that it is extremely easy and inexpensive to cultivate. No antibiotics or mycotoxins are produced at standard fermentation conditions and since it is also a non-pathogen for healthy humans, generally regarded as safe (GRAS) status has been appointed to several T. reesei enzyme products by the Food and Drug Administration (FDA). The protein synthesis machinery of T. reesei is highly efficient, mainly reflected by the large quantities of cellulases that are naturally produced by this species. The main protein secreted by the original T. reesei isolate is cellobiohydrolase I (CBHI) which accounts for about 50% of the total protein production, but also cellobiohydrolase II (CBHII) and endoglucanases (EGI and EGII) are secreted in significant amounts (Beguin 1990). The T. reesei genome spans 33 MB and is divided between seven chromosomes; it has been fully sequenced and made accessible by JGI (http://genome.jgi- psf.org/Trire2/Trire2.home.html) (Martinez, Berka et al. 2008). Substantial expressed sequence tag (EST) analysis has been carried out twice (Foreman, Brown et al. 2003, Diener, Dunn-Coleman et al. 2004) resulting in identifications of 5,131 and 5,429 unique ESTs estimated to cover more than 50% of the coding regions of the genome (Diener, Dunn-Coleman et al. 2004). The available sequence- and expression data for T. reesei have so far primarily been utilized to get an insight into the highly efficient cellulase and hemicellulase synthesis and secretion system of T. reesei, but has also provided information that can be used to elucidate other processes in the fungus. The available sequence data also opens up for introduction of targeted genetic modifications and identification of interesting genetic elements. T. reesei has been used for heterologous expression of several genes, most of which have been introduced to optimize the biomass saccharification properties of the fungus; including a laccase gene (lacA) from the fungal genus Trametes sp. (Zhang, Qu et al. 2012), a laccase gene from the fungus Phlebia radiata (Saloheimo, Niku-Paavola 1991), a beta-glucosidase from the fungus Penicillium decumbens (Ma, Zhang et al. 2011), and an endoglucanase from the bacteria Acidothermus cellulolyticus (Zou, Shi et al. 2012). Other gene types have also been heterologous expressed in T. reesei, spanning from a Saccharomyces cerevisiae dolicylphosphate mannose synthase gene (Perlinska-Lenart,
2
1. General Background PhD Thesis Mikael Skaanning Jørgensen
Bankowska et al. 2006), a shark antibody gene (Conference paper; Mohammed, S, Te'o, V, Nuttall, S, Nevalainen, H. 2006.) to a human derived N-acetylglucosaminyltransferase I gene (Maras, De Bruyn et al. 1999). The reporter genes for beta-glucuronidase (Liu, Wang et al. 2008) and green fluorescence protein (Zou, Shi et al. 2012) have also been utilized for expression studies in T. reesei. Even though expression of this wide selection of heterologous genes has been reported, T. reesei is still not utilized as an industrial production organism for other types of enzymes than cellulolytic enzymes; possibly due to the still relatively low expression level observed for most heterologous proteins. The secondary metabolism of T. reesei has not received much attention and only a limited number of SMs have been described for T. reesei at present. These include paracelsin A-D belonging to a group of NRPs referred to as peptaibols characterized by high α-aminoisobutyric acid content and a C-terminal 1.2-amino alcohol (Baker, Perrone et al. 2012). Other metabolites include the trichodermins belonging to the terpenes and the polyketide derived metabolite groups trichodimerols, trichodermatides and sorbicillinoids (Andrade, Ayer et al. 1996, Andrade, Ayer et al. 1992, Reino, Guerrero et al. 2008, Sun, Tian et al. 2008).
1.1.2. Aspergillus nidulans
Fungi in the genus Aspergillus have had an impact on human life through many years. Aspergillus oryzae is believed to be one of the first filamentous funguses to be domesticated and has been used for fermentation of Japanese and Chinese food products for at least 2000 years (Rokas 2009). At present A. oryzae also plays an important role as an industrial production organism and is together with Aspergillus niger, Aspergillus sojae and Aspergillus terreus responsible for production of organic acids, pharmaceuticals, enzymes and food products (Meyer 2008, Lubertozzi, Keasling 2009). Unfortunately, not all Aspergilli are beneficial from a human point of view and species like Aspergillus fumigatus and Aspergillus flavus can lead to aspergillosis and A. flavus also infects stored grain making whole crops inedible (Meyer, Wu et al. 2011). The widespread use of Aspergilli as production organisms is based on several factors; first of all the species in this genus tolerate very broad cultural conditions when it comes to temperature, pH, salinity, water activity and nutrient levels. They can also be used for both solid state- and submerged fermentations in large industrial scale. Furthermore, they are well-suited for degrading diverse polymers such as (hemi-)cellulose, starch, pectin, xylan and proteins (Meyer, Wu et al. 2011). At present eight species belonging to the Aspergillus genus have been sequenced serving an interesting foundation for comparative genomic analysis (Wortman, Gilsenan et al. 2009). The importance of Aspergillus nidulans as a model organism for eukaryotic cell biology through more than 60 years (Martinelli 1994) is based on a combination of its close relationship with all of the above mentioned Aspergilli and its qualities as a laboratory organism. One of the biggest advantages is that A. nidulans has a sexual cycle, unlike most other Aspergilli used by humans, and can easily be crossed in the laboratory, making it possible to obviate some of the laborious transformation and selection cycles. A. nidulans has been used as a model organism for such diverse processes as DNA recombination, DNA repair, cell cycle control, metabolism and secondary metabolism (David, Ozcelik et al. 2008, Goldman, Kafer 2004, Kahl, Means 2003, Brakhage, Schroeckh 2011, Bok, Noordermeer et al. 2006, Reyes-Dominguez, Bok et al. 2010). The genetic tools for A. nidulans are well-developed and there is a wide selection of different types of selective markers and both constitutive and inducible promoters at hand.
3
1. General Background PhD Thesis Mikael Skaanning Jørgensen
Previous challenges regarding low transformation- and targeting efficiency have been resolved in the last decade and strain lines with a deficient NHEJ system are now used frequently. The genome sequence was published in 2003 (http://www.broad.mit.edu/annotation/genome/aspergillus_nidulans.1/Home.html) and made public in 2005 together with annotation of genes (Galagan, Calvo et al. 2005). The intensive research conducted for A. nidulans is also reflected by the number of SMs that have been described for this filamentous fungus. At most applied laboratory conditions only few metabolites are regularly observed including sterigmacystin, asperfuranone, asperthecin, emericellamide, austinol, sclerotiorin, prenyl xanthone and the napthopyrine precursor to the spore pigment melanin (Barnes, Dola et al. 1994, Chiang, Szewczyk et al. 2009, Szewczyk, Chiang et al. 2008, Chiang, Szewczyk et al. 2008, Lo, Entwistle et al. 2012, Somoza, Lee et al. 2012, Sanchez, Entwistle et al. 2011, Fujii, Watanabe et al. 2001). Nevertheless, many more metabolites have been described for A. nidulans, to some extent enabled by approaches for activation of otherwise silent SM synthase pathways (methods discussed in section 3.1.7); these include monodictypherone, spiroanthrones, emodine derivates and a range of novel metabolites which have not yet been named (Bok, Chiang et al. 2009, Scherlach, Sarkar et al. 2011, Gerke, Bayram et al. 2012, Ahuja, Chiang et al. 2012).
4
2. Chapter I – Tool Development PhD Thesis Mikael Skaanning Jørgensen
2. Chapter I – Tool Development
Chapter I
Tool Development
5
2. Chapter I – Tool Development PhD Thesis Introduction Mikael Skaanning Jørgensen
2.1. Introduction
Genetic engineering is a corner stone for research in the field of biotechnology. It is used for a range of applications including elucidation of gene function and for unraveling metabolic pathways and in the biotech industry it is a vital tool for improving the yield of production strains and for optimization of products. Genetic engineering is highly dependent on available molecular tools and development of these is required for each new organism taken into use. The first chapter of this thesis describes the development of new molecular tools for use in T. reesei; which were combined into a system for high throughput construction of defined integrated expression mutants. While development of this new toolset was not one of the primary objectives for this thesis, it was required before the main objective could be pursued - further elucidation of the secondary metabolism of T. reesei. Some background information essential for development of the expression system for T. reesei can be seen in the following sections (2.1.1 – 2.1.3).
2.1.1. Gene Targeting
Two competing mechanisms for repairing double stranded breaks (DSBs) in DNA exist in eukaryotic organisms, homologous recombination (HR) and NHEJ. While HR includes use of a template to guide repair of the DSB, NHEJ does not require a template and simply joins two exposed DNA ends to repair a DSB (Figure 2.1). Depending on species one or the other often acts as the primary mechanism for joining DSBs. In S. cerevisiae HR dominates, and has been widely exploited to conduct gene targeting by transformation with DNA substrates flanked by sequences homologous to the insertion site of interest (Miné- Hattab, Rothstein 2013). Unlike for S. cerevisiae, the dominating mechanism in most filamentous fungi is NHEJ. Transformation with DNA substrates therefore happen primarily by ectopic integration, hampering correct gene targeting events which correspond to just 5- 10% depending on the fungus and the size of the homologous flanks (He, Price et al. 2007, Carvalho, Arentshorst et al. 2010, Wang, Yang et al. 2011). To increase the Figure 2.1. The two mechanisms of DSB repair. Only HR include use of a ratio between homologous- and template to guide repair of the DSB (Kirkman, Deitsch 2012).
6
2. Chapter I – Tool Development PhD Thesis Introduction Mikael Skaanning Jørgensen ectopic integration events, genes encoding proteins involved in NHEJ, such as ku70, are often inactivated, making HR the primary mechanism of substrate integration (Carvalho, Arentshorst et al. 2010, Choquer, Robin et al. 2008, de Boer, Bastiaans et al. 2010, Li, Du et al. 2010). As seen in Figure 2.2, inactivation of NHEJ results in a lower number of mutants after a transformation, but the frequency of correctly integrated mutants can approximate 95-100% (Carvalho, Arentshorst et al. 2010, Catalano, Vergara et al. 2011)
A B
Substrate NHEJ 90-95% FL1 GOI FL2 FL1 Marker FL2 FL1 Marker FL2
Unwanted HR 5-10% FL1 GOI FL2 FL1 Marker FL2 Target Active NHEJ Inactive NHEJ Wanted FL1 GOI FL2 Figure 2.2. Targeted gene replacement. A, transformation with a gene deletion substrate targeting the gene of interest (GOI). NHEJ results in integration of the substrate at a position outside the target, while HR integrates the substrate at the correct position. In rare events one flank can be integrated by HR while the other is integrated by NHEJ (not shown). The frequency of mutants with the substrate integrated by HR is approximately 5-10% when the NHEJ pathway is active. B, inactivation of the NHEJ pathway does not increase the number of correct integrated mutants (green), but removes the background of mutants with substrates integrated ectopic (red).
2.1.2. Selectable Markers
The frequency of genomic integration of a substrate when transforming protoplasts1 is extremely low compared to the total number of cells. Depending on method and quality of the protoplasts, approximately 10-7-10-8 cells will take up the DNA and incorporate it into their genome. To circumvent extremely cumbersome screening studies, the substrates for transformation include selectable markers which ensure that the mutants with incorporated substrate are able to survive at conditions the original host cannot. Selective markers are traditionally divided into two types, dominant and auxotrophic. The dominant selective markers do not require previous alterations of the genome of the host and is therefore well-suited for use in species that are not well-studied or with little available sequence data. Examples of dominant markers are the hygromycin phosphortransferase gene (hph) originating from E. coli, which confers resistance towards the antibiotic hygromycin B, which is toxic to most filamentous fungi, and the acetamidase gene (amdS) originating from A. nidulans (Punt, Oliver et al. 1987, Tilburn, Scazzocchio et al. 1983) which enable mutants to utilize acetamide as nitrogen source, which most wild-type filamentous fungi are unable to. Auxotrophic selective markers require inactivation of genes involved in important metabolic pathways before use. These genes or their orthologous are then included in the substrates for transformation and re-generate the interrupted pathway if inserted. Examples of auxotrophic selectable markers from two different metabolic pathways are described in more detail below.
1 Cells which have had the cell wall removed. Used for transformations since they allow DNA to cross the cell membrane.
7
2. Chapter I – Tool Development PhD Thesis Introduction Mikael Skaanning Jørgensen
Selectable marker genes from the pyrimidine biosynthesis pathway Gene orthologous of the widely used S. cerevisia selective marker genes URA3, encoding orotidine 5-phosphate decarboxylase, and URA5, encoding orotate phosphoribosyltransferase, have been used as selective markers in several species (Goosen, Bloemheuvel et al. 1987, Ballance, Turner 1985, Edman, Kwon-Chung 1990). As seen in Figure 2.3 for T. reesei, deletion Normal metabolic 5-FOA of the URA3 ortholog pyr4 or the URA5 pathways metabolism ortholog pyr2 will lead to pyrimidine deficiency and blocked RNA and DNA Uridine Orotate 5-FOA synthesis unless uridine or uracil is supplemented to the growth media UN PYR2 permitting utilization of an alternative Uracil OMP 5-FdOMP pathway. The widespread use of these genes as selectable markers is partly due to the UPT PYR4 fact that they are also counter-selectable, hence, there can be selected for both an Alternative UMP 5-FdUMP active and inactive pathway. Negative pathway selection is achieved by supplementing 5- _ Fluoorotic acid (5-FOA) to the growth media. When this compound is metabolized by PYR2 CTP UTP dUMP dTMP and PYR4, the potent suicide inhibitor of TS thymidylate synthase (TS) 5- fluorodeoxyuridine monophosphate (5- RNA RNA DNA FdUMP) is produced and synthesis of DNA is synthesis synthesis synthesis halted (Santoso, Thornburg 1998, Beck, Figure 2.3. Segment of the T. reesei pyrimidine biosynthesis pathway and the metabolic pathway of 5-FOA leading to Dingermann et al. 2002). This enables use inhibition of DNA synthesis. The enzymes that are involved in of pyr2 or pyr4 as selective markers for the reactions are marked with blue text. Abbreviations: 5- introducing consecutive genetic alterations FdOMP, 5-Fluoroorotidine monophosphate; 5-FdUMP, 5- Fluorodeoxyuridine monophosphate; 5-FOA, 5-Fluoroorotic when included in blaster cassettes where acid; CTP, Cytidine triphosphate; dTMP, Deoxythymidin the marker gene is placed in between direct monophosphate; dUMP, Deoxyuridine monophosphate; OMP, Orotidine monophosphate; TS, Thymidylate synthase; UMP, repeats so that it can be looped out by Uridine monophosphate; UN, Uridine nucleosidase; UPT, Uracil homologous recombination between these. phophotransferase; UTP, Uridine triphosphate.
Selectable marker genes from the purine biosynthesis pathway Two genes involved in biosynthesis of purines have also been utilized as selectable markers in several species as seen for S. cerevisiae in Figure 2.4. These genes encode 5’-phosphoribosyl 5-aminoimidazole carboxylase (ADE2) and N-succinyl-5- aminoimidazole-4-carboxamide ribotide synthetase (ADE1). Disruption of either ADE1 or ADE2 encoding these enzymes will result in accumulation of the precursor 5’- phosphoribosylaminoimidiazole (AIR) which polymerizes into a red product, making disruption mutants easy to pick out from the background (Zonneveld, van der Zanden 1995). Several important metabolic products are synthesized by the intact pathway, but the fatality of the ADE1 or ADE2 disruptions can be circumvented by adding adenine to the growth media. Re-insertion of the deleted ADE1 or ADE2 gene in connection with the transformation substrate will regenerate adenine prototrophy and the red polymer will not be accumulated.
8
2. Chapter I – Tool Development PhD Thesis Introduction Mikael Skaanning Jørgensen
Intact pathway Disrupted pathway
PRPP PRPP
AIR AIR Polymerization
ADE2
CAIR CAIR
ADE1
SAICAR SAICAR
HPT1 Hypoxanthine IMP GMP Guanine
AAH1
Extracellular AMP Adenine
Adenine
Figure 2.4. Segment of the S. cerevisiae purine synthesis pathway - only the reactions important for understanding the nature of the selection system is included. Adenine originating from an extracellular source is marked with green and the red polymerized product with red. Abbreviations for selected key enzymes are marked with blue. Abbreviations: AAH1, Adenine deaminase; ADE1, Phosphoribosylamino-imidazole-succinocarbozamide synthetase; ADE2, Phosphoribosylamino-imidazole-carboxylase; AIR, 5’-Phosphoribosylaminoimidiazole; AMP, Adenosine monophosphate; CAIR, 5’-Phosphoribosyl 5-Aminoimidazole carboxylate; GMP, Guanosine 5′-monophosphate;
HPT1, Hypoxanthine-guanine phosphoribosyltransferase; IMP, Inosine 5′-monophosphate; PRPP, 5-Phosphoribosyl- 1-pyrophosphate; SAICAR, N-Succinyl-5-aminoimidazole-4-carboxamide ribotide
2.1.3. Molecular Cloning
Molecular cloning has traditionally involved treatment of DNA fragments with specific restriction enzymes, forming matching overhangs, followed up with fusion of the fragments in a ligase dependent reaction. While this is still the most widespread method of molecular cloning, other more recently developed methods for molecular cloning are prevailing.
Uracil-excision cloning Uracil-excision cloning exploits the activities of uracil DNA glycosylase (Lindahl, Ljungquist et al. 1977, Abe, Yamamoto et al. 2000) and the DNA glycosylase-lyase endonuclease VIII (Jiang, Hatahet et al. 1997) to form custom designed 3’ DNA overhangs that can be used to fuse fragments of interest (Figure 2.5). The efficiency of the cloning system is underlined by its ability to fuse not just two, but several DNA fragments in a single cloning step, enabling assembly of the wanted constructs in fewer cloning steps than when using classic cloning methods. Furthermore, the ligase treatment step can be skipped and restriction enzyme digestions made redundant by amplifying the vector with primers designed for uracil-excision cloning. Use of vectors with multiple polylinkers is therefore not required and the large degree of freedom for
9
2. Chapter I – Tool Development PhD Thesis Introduction Mikael Skaanning Jørgensen designing the uracil containing primer tails deliver large plasticity for designing constructs.
PacI Nt.BbvCI GCTGAGGTCTTAATTAATGCCTCAGC Restriction cassette CGACTCCAGAATTAATTACGGAGTCG Nt.BbvCI
3 ’ XXXXXXXXXX Vector IOI DNA fragment 1 XXXXXXXXXX 3 ’
Digestion (PacI/Nt.BbvCI)
T C T G C G A U ATTAATGCC AGACGCTT IOI UAATTAC GG
TAATGCC Uracil-excision 2 GCTGAGGTCTTAAT GGTCTTAA enzyme treatment CGACT TCAGC U TAATTACGGAGTCG ATTAATGCC CCAGAAT CCAGAATTA IOI U AATTACGG
Vector preparation PCR product preparation
Mix DNA fragments
GCTGAGGTCTTAAT CGACT ATTAATGCC 3 CCAGAATTA IOI TCAGC TAATTACGGAGTCG
Incubation and E. coli transformation
IOI 4 Vector with insert
Figure 2.5. Uracil-excision cloning of a PCR fragment into a vector. 1, the vector used includes a PacI/Nt.BbvCI restriction cassette designed to form overhangs that can be used with the uracil-excision cloning method. The insert of interest (IOI) is amplified using primers carrying custom designed tails including one uracil each. 2, the vector is prepared by digestion with PacI and Nt.BbvCI exposing 3’ overhangs. The PCR fragment is treated with uracil-excision enzyme mix which facilitates excision of the uracil (by uracil DNA glycosylase) and exposes the adjacent nucleotides (by DNA endonuclease VIII) which are complimentary to the 3’ overhangs of the vector. 3, The DNA fragments are mixed and the complimentary DNA overhangs hybridize to form stable circular products. The large size of the overhang makes a ligase reaction redundant. 4, the final ligation of the product is performed inside the E. coli cells after transformation.
In-Fusion cloning In-Fusion cloning is a cloning method similar to uracil-excision cloning. In-Fusion cloning exploits the 3’–5’ exonuclease activity of a poxvirus DNA polymerase (Hamilton, Nuara et al. 2007) to form 5’ DNA overhangs that can be used to fuse fragments of interest. The 5’ overhangs, exposed by 3’-5’ exonuclease activity, are normal distributed with a mean of 15 bp. The DNA fragments of interest are therefore designed so that the ends include 15 bp complimentary sequences with the fragments they should be fused with, enabling formation of stable hybridized circular products. The final ligation is performed inside the E. coli cells after transformation as for uracil-excision cloning.
The following manuscript describes development of new molecular tools for use with T. reesei and consolidation of these into a system for high throughput construction of defined integrated expression mutants. The system includes inactivation of the NHEJ pathway (section 2.1.1), integration into the purine pathway gene adeB (section 2.1.2) and use of the pyrimidine pathway gene pyr2 as bidirectional selective marker (section 2.1.2). Most constructs were assembled by uracil-excision cloning (section 2.1.3).
10
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen
2.2. Manuscript I
An Efficient Expression Platform for Trichoderma reesei (Teleomorph Hypocrea jecorina) Combining NHEJ Deficiency, adeB Integration and pyr2 as a new Bidirectional Marker for High Throughput Generation of Defined Integrated Expression Mutants
Mikael Skaanning Jørgensen1, Dominique Aubert Skovlund2, Pia Francke Johannesen2, Uffe Hasbro Mortensen1*
1Center for Microbial Biotechnology, Department of Systems Biology, Technical University of Denmark, Building 223, DK-2800 Lyngby, Denmark. 2Novozymes A/S, Kroghoejsvej 36, DK-2880 Bagsvaerd Denmark.
* Corresponding author. Uffe H. Mortensen, Technical University of Denmark, Department of Systems Biology, Center for Microbial Biotechnology, Building 223, 2800 Kgs. Lyngby, Denmark. Phone: +45 45252701. Fax: +45 45884148. E-mail: [email protected]
Abstract
The industrially applied filamentous fungus Trichoderma reesei (teleomorph Hypocrea jecorina) has received a lot of interest due to its highly efficient synthesis apparatus of cellulytic enzymes. The aim of this study was to introduce new genetic tools for T. reesei enabling improvement of the organism for industrial production and to pave the way to a possible expansion of the product portfolio. Deletion of tku70, leading to non-homologous end joining (NHEJ) deficiency, was combined with adeB integration in an expression system for high throughput construction of defined integrated expression mutants. It was furthermore demonstrated that the orotate phosphoribosyl transferase gene (pyr2) functions as a highly reliable bidirectional marker by deletion of wA, encoding the polyketide precursor for the spore pigment melanin, and subsequently adeB, involved in the adenine biosynthesis pathway, in the same ∆tku70 strain line. The applicability of the expression system was supported by the frequency of correctly targeted integration transformants obtained in the study: tku70 deletion required screening of sixty transformants before identification of a single correct deletion mutant (~3%); deletion of wA in the ∆tku70 strain yielded 37.9% (11/29) correct mutants while deletion of adeB in the same strain resulted in 44.4% (4/9) correct mutants. All correct ∆adeB mutants could be identified directly on plates by phenotypic characterization. Expression from the expression construct inserted into the adeB loci was confirmed by expression of a Thermomyces lanuginosus lipase as reporter protein. The combination of a high throughput system for construction of defined expression mutants and use of the bidirectional selective marker pyr2 delivers a strong tool for the T. reesei toolbox.
Keywords
Expression, pyr2, Trichoderma reesei, defined integration
11
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen
Introduction
Trichoderma reesei (teleomorph Hypocrea jecorina) is a key workhorse for commercial scale production of different enzymes used by the bioethanol, pulp, paper, and textile processing industries. This status is a consequence of its unique capability of producing and secreting large amount of enzymes, its amenability to large scale fermentation as well as its long history of safe use in industrial enzyme production, which is also recognized by the generally recognized as safe (GRAS) status of several T. reesei enzyme products by the U.S. Food and Drug Administration (FDA). Its genome has recently been sequenced, setting the stage for strain development by directed genetic engineering (Martinez, Berka et al. 2008). Importantly, T. reesei serves as a model organism for the regulation of expression and biochemistry of (hemi-)cellulose degradation enzymes and pathways (Murray, Aro et al. 2004, Kubicek, Mikus et al. 2009). There is an increasing demand for these enzymes since they are employed for the saccharification of cellulosic plant biomass to simple sugars for biofuel production. As enzymes constitute an important cost in the production of bioethanol, large research efforts as well as large government funding have aimed to continuously improve T. reesei as an enzyme production host. Unfortunately, the highly efficient protein synthesis machineries of T. reesei, enabling yields of homologous proteins in excess of 100 g/l (Saloheimo, Pakula 2012), has so far not prevailed for synthesis of heterologous proteins and yields remain low (Liu, Wang et al. 2008). The potential for improvement of synthesis of heterologous proteins in this fungus is therefore tremendous; and if successful, T. reesei could serve as a highly efficient filamentous fungus for heterologous protein production. One bottle neck towards this goal has been the low efficiency of gene targeting in this fungus. However, like in a number of other fungi, the problem of random integration of gene targeting substrates has been dramatically reduced in T. reesei by deleting a gene involved in NHEJ. Hence, the frequency of successful integration by gene targeting in a tku70 mutant strain of a DNA marker flanked by one kb targeting sequences was increased from the 5-10% obtained with wild-type strains to >95% (Guangtao, Hartl et al. 2009). Nevertheless, a recent study has demonstrated that the efficiency of homologous integration in NHEJ deficient strains can be highly site specific in T. reesei and may vary from 33 to 100% depending on insertion site (Schuster, Bruno et al. 2012). Before T. reesei can be routinely used for heterologous protein production, it is necessary to gain insights into e.g. the influence of promoter sequences, effects of codon optimized synthetic genes, or expression rates of selected orthologous genes. This type of analysis requires construction of large numbers of strains where the genes to be compared are expressed from a defined locus in isogenic strains to allow for proper comparisons. Moreover, such analysis may often include experiments that require multiple rounds of genetic engineering in the same strain. Consequently, the need for molecular tools that allow easy genetic modifications of T. reesei for industrial strain development are urgent. We have therefore developed a new expression platform in T. reesei that facilitates heterologous gene expression from a defined locus with an improved gene targeting throughput. Our expression strain includes a tku70 disruption to increase gene targeting efficiency, a color marker that facilitates identification of correctly targeted strains, even in early stages of colony development, as well as the possibility of iterative gene targeting using pyr2, which encodes orotate phosphoribosyl transferase, as a bidirectional marker. The use of pyr2 as a bidirectional marker has not previously been
12
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen reported for T. reesei, but we here demonstrate that it serves as a highly reliable alternative to pyr4. The applicability of the expression system was confirmed by expression of a Thermomyces lanuginosus lipase as reporter protein.
Materials and Methods
Strains and culture conditions The strains included in this study are listed in Table 1. A two-step selection was adopted due to the poor sporulation of transformants on the primary transformation plates. The transformants were first incubated five days on primary minimal media plates (MM1) composed of 0.1 nM Na2B4O710H2O (Merck,
Whitehouse station, USA), 1.6 nM CuSO45H2O (Merck), 2.8 nM FeSO47H2O (Merck), 3.8 nM MgSO42H2O (Merck), 3.4 mM Na2MoO47H2O (Merck), 27.8 nM ZnSO47H2O (Merck),
9.6 mM Citric acid (Merck), 2 mM MgSO47H2O (Merck), 7 mM KCl (Merck), 11.2 mM
KH2PO4 (Merck), 5 mM CaCl2 (Merck), 50 mM (NH4)2SO4 (Merck) and 2% granulated agar (BD/Difco, Franklin lakes, USA) supplemented with 0.5 M sucrose (Sigma, St. Louis, USA). After five days, the transformants were transferred to secondary minimal media plates (MM2) with the above composition, but supplemented with 55 mM mannitol (sigma) as substitute for sucrose. An overview of additional supplements for selective MM plates can be seen in Table S1. Potato dextrose agar (PDA) (BD/Difco) was used for all non-selective solid cultivations while all non-selective liquid cultivations were in YPD consisting of 1% Yeast extract (BD/Difco), 2% Peptone bacto (BD/Difco) supplemented with 2% glucose. All incubations on solid media were for five days at 28°C and all incubations in liquid media, other than for lipase assay, were for 48 hours at 30°C and 200 RPM.
Table 1. Overview of the strains used in this study. The genotypes are listed together with selected phenotypic characteristics Growth in Prototrophy Strain Genotype presence of Reference Uridine Adenine 5-FOA (Martinez, Berka et al. QM6a WT - + + 2008) MJ-T-001 tku70-::amdS+ - + + This study MJ-T-006 tku70-::amdS+ Δpyr2 + - + This study MJ-T-009 tku70-::amdS+ Δpyr2 ΔadeB::pyr2 - + - This study MJ-T-012 tku70-::amdS+ Δpyr2 ΔwA::pyr2 - + + This study MJ-T-013 tku70-::amdS+ Δpyr2 ΔwA + - + This study MJ-T-020 tku70-::amdS+ Δpyr2 ΔadeB-PgpdA-TtrpC-pyr2 - + - This study MJ-T-021 tku70-::amdS+ Δpyr2 ΔwA::Δpyr2 ΔadeB::pyr2 - + - This study MJ-T-033 tku70-::amdS+ Δpyr2 ΔadeB::PgpdA-lipase-TtrpC-pyr2 - + - This study Abbreviation: 5-FOA, 5-Fluoorotic acid
Cloning and E. coli transformation An overview of the primers used for cloning and the resulting plasmids are listed in Table S2 and S3, respectively. PCR fragments used for the clonings were purified from agarose gel using the GFX kit (GE healthcare, Little Chalfont, United Kingdom). All clonings, except two, were performed by restriction enzyme and ligase independent uracil-excision cloning (Hansen, Salomonsen et al. 2011, Geu-Flores, Nour-Eldin et al. 2007). All fragments used in the uracil-excision clonings, except for the AsiSI/Nb.BsmI digested pMJ-023 vector, were acquired by PCR with primers containing a single uracil between seven and 11 bp from the 5’-end. The PCR reactions were performed with PfuX7 polymerase, which is a phusion polymerase (New England Biolabs, Ipswich, USA), mutated to enable it to read through
13
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen uracils (Norholm 2010). The uracil-excision clonings were performed as described in the USER™ Friendly Cloning Kit protocol (New England Biolabs). All plasmids constructed by uracil-excision cloning carried a vector fragment amplified from pU1111-1 (Hansen, Salomonsen et al. 2011). TOPO® (Invitrogen) and In-Fusion® (Clontech) cloning was utilized to construct pMJ-001 and pMJ-005, respectively. The approach is described in greater detail later. Chemically competent Fusion-Blue E. coli cells (Clontech, Mountain View, USA) were used to maintain all plasmid constructs assembled by TOPO® (Invitrogen, Carlsbad, USA), In-Fusion® (Clontech) or uracil-excision cloning. All transformations were performed as described in the In-Fusion® Dry-Down PCR Cloning Kit Protocol-at-a-Glance.
T. reesei transformation Protoplastation and transformations of T. reesei was performed as described by Gruber and co-workers with minor modifications (Gruber, Visser et al. 1990). All fragments for transformation were released from the vector backbone by NotI digest facilitated by NotI sites incorporated in each end of the vector part. Approximately 10 µg linearized DNA was used for each transformation. Correct homologous integration was verified by diagnostic PCRs for all transformants; see primers in Table S4.
Genomic DNA purification and Southern blot Biomass for genomic DNA purifications was obtained by inoculating spores from plates in 10 ml YPD. After incubation, the mycelia were separated from the YPD by filtration through Miracloth (Merck) and washed with 25 ml 0.1 M MgCl2. The mycelia were transferred to eppendorf tubes and dried in a Jouan RC 1009 vacuum dryer over night (ON). The dried mycelia were crushed in the eppendorf tubes using a metal pestle and DNA extractions performed using solutions from the MasterPure™ Yeast DNA purification kit (Epicentre Biotechnologies, Madison, USA) as described in the remainder. Approximately 50 µg mycelia were transferred to two ml eppendorf tubes, 300 µl yeast cell lysis solution added and mixed by vortexing. The solution was incubated at 65°C for 20 minutes and 150 µl MPC protein precipitation reagent added and mixed by vortexing. The mix was centrifuged for ten minutes at 13.400 RPM and the supernatant transferred to a clean eppendorf tube in which 500 µl isopropanol were added for precipitation. There was centrifuged at 13.400 RPM for ten minutes and the pellet washed with 500 µl 70% ethanol. The ethanol was removed after another ten minute centrifugation at 13.400 RPM the pellet dried and dissolved in 60 µl Milli-Q water; 1.5 µl 5 µg/µl RNaseA was added and there was incubated at 37°C for 30 minutes. For Southern blots 10 µg DNA was digested for each strain. The samples were loaded on 1% agarose gels and run for two hours and 30 minutes at 160 volts. Transfer of the DNA from the gel to a Zeta-Probe® GT blotting membrane (Bio-Rad, Hercules, USA) and hybridization was performed as described in the appurtenant instruction manual for alkaline blotting. The probes used were amplified using the primers seen in Table S4, purified from gel and labelled with 32P as described in the following. Approximately 70 ng of the purified DNA was used for each probe and Milli-Q water added to a final volume of 32 µl, the mix was boiled for five minutes and put on ice. A buffer consisting of 1.6 µl Hexamer (Roche, Penzberg, Germany), 5 µl 10x klenow buffer, 0.2 µl dCTP (invitrogen), 0.2 µl dGTP (invitrogen), 0.2 µl dTTP (invitrogen) and 7.8 µl Milli-Q water was made and added to the boiled probe. Two µl fresh 32P labelled dATP (PerkinElmer, Waltham, USA) was added together with 15 U klenow polymerase (New England Biolabs) and there was incubated at 25°C for one hour. After incubation
14
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen and prior to hybridization, the probe was purified over a QIAquick spin column as described in the protocol for QIAquick Nucleotide Removal kit (Qiagen, Venlo, Netherlands). The hybridized membrane was placed in a BAS cassette2 2025 (Fujifilm, Tokyo, Japan) and exposed for at least 18 hours and developed using a Typhoon FLA 7000 laser scanner (GE healthcare).
Construction of the strain for use with the expression system tku70 truncation The tku70 gene had previously been identified by Guangtao and co-workers (JGI ID: 63200) (Guangtao, Hartl et al. 2009). The pMJ-005 construct used for truncation of tku70 was made in two cloning steps. First an intermediate plasmid construct, pMJ-001, was made by introducing a 2311 bp tku70 gene fragment amplified with primer pair tku70-fw/rv into the TOPO® vector pCR2.1 (invitrogen) by following the manufacturers TOPO® cloning protocol. The pMJ-001 construct was linearized by digestion with the blunt end restriction enzymes, StuI and SnaBI, digesting after the 1154th and the 1171th tku70 coding sequence (CDS) base pair, respectively. A 2762 bp amplicon of the Aspergillus nidulans acetamidase gene (amdS), obtained by PCR with primer pair amdS-fw/rv, was utilized as selective marker. The primers carried 15 bp sequences complimentary to each end of the linear pMJ-001 vector. The PCR product was cloned into this by In-Fusion® cloning (Clontech) by following the manufacturer’s protocol. The resulting construct, pMJ-005, contained the amdS selective marker flanked by two tku70 fragments of 1.3 and 1.0 kb in the pCR2.1 topo vector backbone. Transformation of QM6a with the tku70 truncation construct was performed as described previously and plated on MM1 plates with acetamide supplemented as the only obtainable nitrogen source. All 60 transformants appearing on the transformation plates were picked, isolated and genomic DNA purified. PCR screening of transformants was performed using primer pair tku70-DT-fw/rv and truncation of tku70 further confirmed by Southern blot. A correct tku70 truncated mutant, MJ-T-001, was used in the subsequent work. pyr2 deletion Identification of the T. reesei orotate phosphoribosyl transferase gene (pyr2), used as selective marker, was carried out using the basic local alignment search tool (BLAST) with the 250 amino acid (AA) sequence of the Aspergillus oryzae PyrF protein (/EMBL/GenBank accession number XM_001821908.2, JGI ID: 21435) in the JGI T. reesei filtered model proteins database (http://genome.jgi- psf.org/pages/blast.jsf?db=Trire2). A 237 AA protein (DDBJ/EMBL/GenBank accession number: EGR51642.1) with a sequence similarity of 44.3 % with the A. oryzae PyrF came up as a single hit. The pyr2 deletion construct (pMJ-017) was prepared by uracil-excision cloning, as described previously. The vector backbone was amplified from pU1111-1 and pyr2 flanks of 1.5 and 1.6 kb introduced to facilitate deletion of the pyr2 CDS by homologous recombination. Protoplasts were made from MJ-T-001 and transformation with pMJ-017 set up. After transformation the protoplasts were grown for five hours in 5 ml YP stabilized osmotically with sorbitol and supplemented with 2% glucose and 10 mM uridine. After incubation, the protoplasts were plated on MM1 plates supplemented with 1.5 mg/ml 5-Fluorootic
15
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen acid (5-FOA) and 10 mM uridine. After five days, agar plugs of the growing colonies were transferred to MM2 plates, also supplemented with 1.5 mg/ml 5-FOA and 10 mM uridine. After five days of growth on the MM2 plates agar plugs for 16 colonies were transferred to non-selective PDA plates for sporulation. Conidia were harvested from the PDA plates after four days and inoculated in YPD to obtain biomass for purification of genomic DNA. There were tested for uridine auxotrophy and correct deletion of pyr2 was investigated by PCR using primer pair pyr2-DT-fv/rv. The amplicon of the diagnostic PCR spanned the deletion target and yielded 3.1 kb bands for deletion transformants while presence of a wild-type gene would result in a 4.9 kb amplicon. Deletion of pyr2 was furthermore confirmed by Southern blot. A correct pyr2 deleted mutant was selected, named MJ-T- 006, and utilized in the subsequent work. pyr2 as a bidirectional marker pMJ-021 The pMJ-021 construct was made as a tool to ensure that the pyr2 gene can be used as a bidirectional marker; it carries the entire pyr2 gene together with the native promoter and terminator flanked by two direct repeats of 375 bp. Hence, a blaster cassette that enables loop out of the pyr2 gene fragment by homologous recombination between the direct repeats. The direct repeats consisted of fragments of the Aspergillus oryzae pyrG promoter sequence with low homology to the T. reesei genomic sequence. wA deletion In Aspergillus nidulans the polyketide synthase gene wA has been shown to encode a protein, called YWA1, which polyketide product (naphthopyrone) act as a precursor for the spore pigment melanine. Deletion of this gene in A. nidulans results in completely white colonies due to the absence of pigment (Watanabe, Ono et al. 1998). Several hits came up when BLASTing the 2157 amino acid sequence of the A. nidulans YWA1 protein in the JGI T. reesei filtered model proteins database. The T. reesei protein with the highest amino acid sequence A Gene FL1 R pyr2 R Gene FL2 similarity (DDBJ/EMBL/GenBank accession number: EGR44538.1, JGI ID: 82208) has a Gene FL1 GOI Gene FL2 similarity of 47% and was selected for deletion in this study. The wA deletion Homologous recombination construct (pMJ-030) was made by uracil- Gene FL1 R pyr2 R Gene FL2 excision cloning, and carried the pyr2 T. reesei selective gene fragment and direct repeats B Gene FL1 R between 1.6 and 1.4 kb wA flanks; the deletion construct was transformed into protoplasts of MJ-T-006 and integrated as R Gene FL2 demonstrated in Figure 1A. Loop out The transformed protoplasts were Gene FL1 R Gene FL2 transferred directly to MM1 plates without T. reesei supplements. After five days of growth on Figure 1. Use of pyr2 for genetic deletion and subsequent MM1 plates growing colonies were loop out. A: Deletion of an unwanted gene using pyr2 as transferred to MM2 plates. Selection of selectable marker. The upstream flank of the gene for deletion is marked with “FL1” and the downstream flank correct wA deleted transformants was with “FL2”. Notice the smaller direct repeats, marked with conducted by phenotypical characterization an “R”, flanking pyr2. B: Loop out of pyr2 by homologous recombination between the direct repeats, selected for by (white spores) followed up by PCR and subjection to 5-FOA.
16
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen
Southern blot. The PCR screening included primer pair wA-DT-fw/rv which amplicon spans the deletion target and yielded bands of 4.6 kb for deletion transformants while the wild-type gene would result in a 9.1 kb amplicon. A correct wA deletion mutant was selected, named MJ-T-012 and utilized in the subsequent work. pyr2 loop out Before deletion of the adeB gene in the wA deleted strain (MJ-T-012) the pyr2 gene used for selection had to be looped out for re-use as selective marker as demonstrated in Figure 1B. Loop out of pyr2 was selected for by plating 108 spores on a MM1 plate supplemented with 1.5 mg/ml 5-FOA and 10 mM uridine. After five days of growth, colonies were picked and transferred to MM2 plates, also supplemented with 5-FOA and uridine. After another five days of growth the transformants were transferred to non- selective PDA plates for sporulation. Confirmation of loop out was performed by PCR and Southern blot. The PCR screening was performed with the wA-DT-fw/rv primer pair as described for wA deletion. Correct loop out, facilitated by homologous recombination between the direct repeats, resulted in amplicons of 1.7 kb. A correct pyr2 looped mutant was selected, named MJ-T-013 and utilized in the subsequent work. adeB deletion The adeB gene involved in biosynthesis of purines has previously been used as a selective marker in Aspergillus oryzae (Jin, Maruyama et al. 2004, Jin, Maruyama et al. 2004). The gene corresponds to the ade2 gene of Saccharomyces cerevisiae, which encode an enzyme converting P-ribosylamino imidazolecarboxylate (CAIR) to P- ribosylsuccino carboxamide aminoimidiazole (SAICAIR). When ade2 is inactivated CAIR will not be converted to SAICAIR and the precursor P-ribosylamino imidiazole (AIR) is accumulated in the cell and polymerizes to form a red metabolite which is visible on plates (Silver, Eaton 1969). ADE2 deficient strains will furthermore be adenine auxotroph. The putative T. reesei adeB gene was identified by BLASTing the 571 AA sequence of the S. cerevisiae ADE2 protein in the JGI T. reesei filtered model proteins database. A 593 AA T. reesei protein (DDBJ/EMBL/GenBank accession number: EGR49709.1, JGI ID: 105832) with 45 % sequence similarity with the S. cereviasiae gene was identified. Deletion of adeB was performed in MJ-T-013 using the adeB deletion construct (pMJ- 031). The adeB deletion construct carried the pyr2 selective marker and direct repeats in between two adeB flanks of 1.6 kb each. The transformed protoplasts were spread on MM1 plates supplemented with 0.5 mM adenine and transformants isolated as described previously. The double deleted transformants were identified by their phenotypical characteristics (white spores, red coloration), PCR and Southern blot. The PCR screening included primer pair adeB-DT-fw/rv which amplicon spans the deletion target and yielded 4.4 kb bands for deletion transformants while the wild-type gene would result in an amplicon of 3.0 kb. A correct adeB deletion mutant was selected and named MJ-T-021.
17
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen
Expression of T. lanuginosus lipase from the adeB site
T. lanuginosus lipase The DNA fragment carrying the T. lanuginosus lipase gene (accession no. AF054513) was kindly provided by Jan Lehmbeck, Novozymes, Bagsvaerd.
Cloning of the Lipase overexpression construct The T. lanuginosus lipase gene was amplified using primer pair lipase-fw/rv. Approximately 10 µg of the pMJ-023 overexpression construct was digested with AsiSI and Nb.BsmI and the PCR amplified T. lanuginosus lipase gene inserted by uracil-excision cloning with one µl of the pMJ-023 digestion mix. The resulting construct was named pMJ-051.
Strains included in the lipase assay The expression fragment of construct pMJ-051, seen in Figure 2, was transformed into protoplasts of MJ-T-006. Several red colonies appeared on the MM1 plate supplemented with 0.5 mM adenine, three of these were isolated and genomic DNA purification carried out. Correct insertion of the expression construct was confirmed by PCR with primer pairs exp-IT-UP-fw/rv, for control of correct upstream integration, and exp-IT-DW-fw/rv for downstream integration. One primer in each primer pair targeted the genomic sequence adjacent to the flank used for targeted integration and the other a sequence specific for the insert. Correct insertion resulted in upstream amplicons of 1.7 kb and downstream amplicons of 2.2 kb. The control strain was transformed with the expression construct without the T. lanuginosus lipase gene inserted between PgpdA and TtrpC. The same approach for isolation of correct T. lanuginosus lipase expression transformants was applied for the control strain. Two Southern blots were performed to ensure correct insertion of the overexpression construct and presence of the T. lanuginosus lipase gene in the three isolated mutants (L1-L3).
FLA R pyr2 R PgpdA lipase TtrpC FLB
FLA adeB FLB
exp-IT-UP-fw Homologous exp-IT-DW-fw recombination FLA R pyr2 R PgpdA lipase TtrpC FLB T. reesei exp-IT-UP-rv exp-IT-DW-rv Figure 2. Replacement of adeB with the T. lanuginosus lipase overexpression fragment isolated from pMJ-051 by NotI digest. The substrate carries the PgpdA controlled T. lanuginosus lipase gene followed by the TtrpC terminator. The adeB flanks (FLA and FLB) were used for targeted integration and the pyr2 gene, flanked by direct repeats, as selective marker. The targets of the primers used for diagnostic PCRs are indicated in the figure.
18
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen
Lipase assay The esterase activity of the T. lanuginosus lipase was detected by measuring the rate of hydrolyses of p-nitrophenyl valerat, releasing p-nitrophenol, using an ELISA reader. p- nitrophenol has a peak absorbance at approximately 405 nm and measurements at this wavelength over time indicate the esterase activity in the samples. The amount of lipase units (LU) in the sample can be calculated using included standards. A dilution buffer solution and a stock solution were made for the lipase assays. The dilution buffer was an aquatic solution supplemented with 50 mM Tris/HCL (pH 7.5),
10mM CaCl2 and 0.075% Brij-35 (Thermo Fisher Scientific, Rockford, USA) while the substrate stock were made by dissolving 0.13 g (117µ)p-Nitrophenyl valerate (sigma N 4377) in 10 ml methanol. The substrate solution added to the microtiter plates was made by applying 100 µl of the substrate stock to 10 ml of the dilution buffer solution. The strains included in the lipase assay were inoculated in 10 ml YPD using a 10 µl inoculation loop and grown at 30°C for four days at 200 rpm. After growth, the supernatant was separated from the biomass by filtration through miracloth. From each collected sample, 10 µl of the supernatant was mixed with 20 µl dilution buffer where after 200 µl substrate solution was added. The LUs were measured as absorption at 405 nm in 30 second intervals for 40 minutes. Standard samples with the following LUs were included as reference: 0.05, 0.2, 0.4, 0.6, 0.8, 1.0, 1.5, 2.0 and 2.5.
Results and Discussion
Towards developing T. reesei into a solid host for heterologous protein production, we have developed a defined expression platform. Our system includes strains containing a tku70 disruption to increase gene targeting efficiency and a new bidirectional marker, pyr2. Genes are inserted into a defined position in the adeB gene. Disruption of adeB results in development of red pigment to facilitate easy and rapid detection of correctly targeted transformants.
Construction of a ∆tku70 ∆pyr2 strain First, the tku70 gene involved in NHEJ was disrupted in the original T. reesei QM6a isolate by transforming this strain with a gene-targeting substrate based on the amdS marker; see Materials and Methods for details. Sixty transformants were obtained and a subsequent PCR analysis (data not shown) identified only a single transformant containing the desired disruption of tku70. The correct integration of amdS into tku70 in this transformant was confirmed by Southern blotting (Figure S1) and the resulting strain was named MJ-T-001. pyr2 as a bidirectional marker Orthologous of pyr2 have been used as a bidirectional markers in several species such as Candida guillermondii, Scwanniomyces alluvius and Haloferax volcanii (Millerioux, Clastre et al. 2011, Dave, Chattoo 1997, Bitan-Banin, Ortenberg et al. 2003) based on the principle that 5-FOA is metabolized to 5-FdUMP, a suicide inhibitor of thymidylate synthase essential for DNA synthesis, in a process that depends on the orotate phosphoribosyl transferase activity of PYR2 (Santoso, Thornburg 1998, Beck, Dingermann et al. 2002). To investigate the possibility that pyr2 could also be used as a bidirectional marker, we deleted the entire coding sequence (CDS) of pyr2 in MJ-T-001.
19
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen
In this case, the gene-targeting substrate did not contain a selectable marker. Instead we hypothesized that correctly targeted strains, unlike wild-type strains, would survive exposure to 5-FOA. Eleven transformants were obtained after transformation with the pyr2 deletion construct on 5-FOA plates, but only three of these displayed normal growth rates. As expected for correctly targeted strains these three transformants were all uridine auxotroph as they required addition of uridine to the media in order to grow (de Boer, Bastiaans et al. 2010, Li, Du et al. 2010, Choquer, Robin et al. 2008). Finally, deletion of pyr2 was confirmed in one of the three transformants by PCR (data not shown) and Southern blot (Figure 3) and the resulting strain was named MJ-T-006.
8,454 7,242 6,369 5,686 4,822 4,324 3,675
2,323 1,929
1,371
1,264
pyr2 wA adeB
3.6 kb
Wildtype FLA FLB FLA wA CDS FLB FLA adeB FLB
Pyr2 CDS [QM6a, MJ-T-006] [All but MJ-T-021] [QM6a]
1.9 6.3 kb 6.7 kb Deleted FLA FLB FLA pyr2 FLB FLA pyr2 FLB
[All but QM6a] [MJ-T-012] [MJ-T-021]
Looped FLA FLB
[MJ-T-013, MJ-T-021] Probe 1 kb Figure 3. Southern blot for confirmation of correct deletion of pyr2, wA and adeB. The restriction endonuclease NcoI was used for all digestions together with a 485 bp probe targeting the pyr2 promoter/FLA amplified using primer pair pyr2prom-P-fw/rv. The arrow on the Southern blot picture points to a faint band for MJ-T-013. Visualization of the three affected loci and the expected band sizes can be seen underneath the Southern blot picture. The band sizes on the Southern blot are consistent with the expected. Marker: BstII digested λ DNA.
Two gene-targeting substrates were constructed to determine whether pyr2 could also serve as bidirectional marker. One was designed to eliminate wA, a gene that putatively encodes the polyketide synthase necessary for production of green conidial pigment; and adeB, an ortholog of the ade2 gene in Saccharomyces cerevisiae, which encodes a phosphoribosylaminoimidazole carboxylase necessary for production of purines. Lack of this enzyme in species such as S. cerevisiae, Pichia pastoris and Aspergillus oryzae (Du,
20
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen
Battles et al. 2012, Jin, Maruyama et al. 2004, Fisher 1969) results not only in adenine auxotrophy, but also in development of red colonies as the precursor AIR accumulates in the cell and polymerizes (Silver, Eaton 1969). Both gene targeting substrates were based on the pyr2 selectable marker, which was flanked by direct repeats to allow for subsequent marker excision by direct repeat recombination. Transformation of the wA gene-targeting substrate into MJ-T-006 produced 29 uracil prototroph transformants on the MM1 plates. When transferring the transformants to PDA plates for sporulation it was evident that eleven (~40%) of these lacked pigment production and were white as expected for wA deleted strains (Figure 4). PCR analysis of the white transformants confirmed that wA was indeed deleted in all of these strains. One of the white transformants was also confirmed by Southern blotting (Figure 3), named MJ-T-012 and used in the subsequent work. In this case, pyr2 therefore worked as an efficient marker for positive selection. To demonstrate that the pyr2 gene can also be counter-selected, approximately 108 spores from the wA deleted mutant (MJ-T-012) were inoculated on plates supplemented with 1.5 mg/ml 5-FOA. In this way we expected to select for spontaneous recombinants where the pyr2 gene had been looped out by recombination between the flanking direct repeats. In agreement with this, four colonies were isolated after five days of incubation and PCR- and sequencing analyses supported that the pyr2 gene was lost in all four strains as the result of recombination between the direct repeats. In agreement with these results, the four strains were also displaying a uridine auxotrophic phenotype. One of these colonies was named MJ-T-013 and used for further work. To demonstrate that our system can be used for iterative gene targeting, we transformed MJ-T-013 with the adeB deletion substrate. Nine uracil prototrophic transformants appeared on the primary transformation plates after transformation. Of these nine transformants, four developed an orange/red coloration after four days of growth, indicating successful deletion of the adeB gene. All nine colonies were tested for adenine auxotrophy and as expected the four red colonies were all adenine auxotrophs whereas the remaining five were not. Correct deletion of adeB in the four selected red transformants was confirmed by PCR (data not shown). One of the four transformants containing the wA and adeB double deletion was verified by Southern blotting (Figure 3) and named MJ-T-021. The iterative gene targeting proved that pyr2 can be used as an alternative to pyr4. Interestingly, the pyr2 CDS is 435 bp shorter than the pyr4 CDS enabling construction of smaller vectors.
21
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen
PDA MM2 -adenine MM2 +adenine
MJ-T-006
MJ-T-009 (ΔadeB) No Growth
MJ-T-012 (ΔwA)
MJ-T-021 (ΔadeB/ΔwA) No Growth
Figure 4. Phenotypical differences between selected deletion strains obtained using pyr2 as selective marker. Three media types were used, the rich media PDA, and MM2 with and without 0.5 mM adenine supplemented. It is seen that MJ-T-006 is dark green (as the wild-type) while the other mutant strains all have variations in their colorations. The ΔadeB strain has a yellow coloration and is at the same time adenine auxotroph, the ΔwA strain has a white coloration and can grow in absence of adenine while the double deleted strain has a light brown coloration and is also adenine auxotroph.
As expected, gene targeting occurs with a quite high efficiency in strains with defective NHEJ; in our case wA was deleted with an efficiency of ~40%. In some fungi even higher success rates have been reported e.g. (Guangtao, Hartl et al. 2009, Nielsen, Nielsen et al. 2008, Choquer, Robin et al. 2008, de Boer, Bastiaans et al. 2010, Li, Du et al. 2010). However, our somewhat lower integration efficiency at the wA locus is consistent with the observation that the frequency of homologous recombination in T. reesei appears to be highly locus dependent (Schuster, Bruno et al. 2012).
Expression of T. lanuginosus lipase from the adeB site The fact that adeB deletion strains rapidly developed a red color allows this site to function as a targeting site for new genes where correct transformants can be rapidly and easily identified. We decided to exploit this feature and incorporate it as a central part of our expression platform. Specifically we envisioned that by inserting genes for heterologous expression into adeB, we can select transformants that are correctly targeted rapidly and with an efficiency approaching 100%. Such efficiency will be a tremendous advantage in high throughput experiments where a high number of different genes need to be inserted in order to screen for e.g. a novel enzymatic activity. To demonstrate this concept we decided to express the T. lanuginosus lipase gene from the adeB locus. Accordingly, the T. lanuginosus lipase gene was positioned between the A. nidulans PgpdA promoter and TtrpC terminator and inserted into adeB using pyr2 as selection marker. After transformation, several red colonies appeared and correct insertion of the expression construct in these was confirmed by PCR and Southern blot (Figure S2). One of the mutants was selected for use in the further experiments. In a parallel experiment, an empty expression construct containing PgpdA::TtrpC was inserted into adeB. The two strains, MJ-T-033 and MJ-T-020, respectively, were analyzed
22
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen for T. lanuginosus lipase production using a well-developed assay for measuring lipase activity, see Materials and Methods. Six cultures of each of the two strains were grown in YPD for four days before measuring the lipase activity in lipase units (LUs). The average lipase activity for MJ-T-020 was 1.19 LU (st.dev. 0.05) pr. 10 µl supernatant and the lipase activity for MJ-T-033 was 2.00 LU (st.dev. 0.15) pr. 10 µl supernatant which indicate that expression of the PgpdA controlled T. lanuginosus lipase gene results in an amount of lipase activity corresponding to 0.81 LU.
Concluding Remarks
In summary, our developed expression system is designed for high throughput construction of defined integrated T. reesei mutants suitable for setup of large expression studies. The system furthermore allow for iterative genetic alterations in selected mutants, made possible by including pyr2 as a bidirectional selective marker.
23
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen
Supplementary Tables and Figures
Table S1. Additional media supplements. The supplements added to MM plates according to specific genotypes Nitrogen source
Genotype 5-FOA Uridine Adenine Acetamide (NH4)2SO4 (1.5 mg/ml) (10mM) (0.5mM) (10mM) (50 mM) amdS+ - - - + - pyr2+ - - - - • pyr2- + • - - • adeB- - - • - • -: not added, +: added for selection, •: needed supplement
Table S2. Oligonucleotides used for construction of plasmids Primer name Sequence (5’-3’) Used for construction of
tku70-fw CTCTCATCTTGCAAGTGAAT pMJ-001 tku70-rv CGTCCATTTCGATTCCGCAT amdS-fw AAGAGATAAAAAAGGCCTTTCTACGCCAGGACCGAGCA pMJ-005 amdS-rv GGGCGTAAAGTATACGTAATGCATCTGGAAACGCAACC Vector-fw AGGCGTGCAUCCGCATCATC pMJ-017, pMJ-021, pMJ-030, pMJ-031 Vector-rv ATCTGGGUCGTGGTCGATTGTG pyr2-fw AGGGCGUGGAGCTGGATGGATGGGC pMJ-021 pyr2-rv ACAGCCAUGCCGACGCTGCCAAGAAG pyr2-FLUP-fw ACCCAGAUAGGGCTGGACGTCCACATCG pMJ-017 pyr2-FLUP-rv ATAGTCUCAGGCTTGTGCCAGCCATG pyr2-FLDW-fw AGACTAUGCCCCGGGCTGC pMJ-017 pyr2-FLDW-rv ATGCACGCCUGTCCATGTGCCCTATCTGCCTG Repeat-UP-fw ACCCAGAUGTACCCTAAGGATAGGCCCTAATC pMJ-021 Repeat-UP-rv ACGCCCUCTAGCGCGTGCGCTGTAG Repeat-DW-fw ATGGCTGUGTACCCTAAGGATAGGCCCTAATC pMJ-021 Repeat-DW-rv ATGCACGCCUCTAGCGCGTGCGCTGTAG adeB-FLUP-fw AATTAAUGCCTCAGCGCTCAAGTGAGCGACGGCTC pMJ-023 adeB-FLUP-rv ACCCAGAUGCGGCCGCCAACCCATGGCGTAGGGAGG pyr2rep-UP-fw ATTAATUAAGACCTCAGCCGCCAGCAGTGTCACAATCGAC pMJ-023 pyr2rep-DW-rv ATGCACGCCUACGCAGTGGTCACGGTCCG PgpdA-fw ACTGCGUCGAATGCGTGCGATAATTCCC pMJ-023 TtrpC-rv ACGCGAUGGGCGCTTACACAG adeB-FLDW-fw ATCGCGUGATCTGACGCTGCGAGCCAG pMJ-023 adeB-FLDW-rv ATGCACGCCUCGGTGGTTTGAGCGTCTGCG pyr2rep-fw AAGACCUCAGCCGCCAGCAGTGTCACAATCGAC pMJ-030, pMJ-031 pyr2rep-rv AGCGACGGCUCGGTGATTTC wA-FLUP-fw ACCCAGAUGTCATTCGAGGCGACGCAAG pMJ-030 wA-FLUP-rv AGGTCTUGCCCTGGACTGAAAACGGGTG wA-FLDW-fw ACCACTGCGTUAGGCCGCCAATGCTCTTGAC pMJ-030 wA-FLDW-rv ATGCACGCCUCCGCTGGGTTGACTCGATTG adeB-FLUP-fw ACCCAGAUCAACCCATGGCGTAGGGAGG pMJ-031 adeB-FLUP-rv AGGTCTUGCTCAAGTGAGCGACGGCTC adeB-FL2-fw ACCACTGCGTUGATCTGACGCTGCGAGCCAG pMJ-031 adeB-FL2-rv ATGCACGCCUCGGTGGTTTGAGCGTCTGCG Lipase-fw AGAGCGAUATGAGGAGCTCCCTTGTGCTG pMJ-051 Lipase-rv TCTGCGAUCTAAAGACATGTCCCAATTAACCCG Red – 5’-end tails for In-Fusion® cloning, green – nucleotides for reconstruction of restriction sites, blue – uracil- containing 5’-end tails for uracil-excision cloning. Abbreviations: FL: Flank, UP: Upstream, DW: Downstream
24
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen
Table S3. Plasmids constructed in connection with this study Plasmid ID Used for Fragments Cloning method pCR2.1 pMJ-001 Tool TOPO® tku70 pMJ-001 pMJ-005 tku70 truncation In-fusion® amdS Vector pMJ-017 pyr2 deletion pyr2 FL UP uracil-excision pyr2 FL DW Vector pyr2 and direct repeats direct repeat 1 pMJ-021 uracil-excision (tool) pyr2 (gene/term/prom) direct repeat 2 Vector adeB target UP pMJ-023 Tool for overexpression pyr2 + repeats uracil-excision PgpdA/TtrpC adeB target DW Vector wA FL UP pMJ-030 wA deletion uracil-excision pyrF+repeats wA FL DW Vector adeB FL UP pMJ-031 adeB deletion uracil-excision pyrF+repeats adeB FL DW Heterologous pMJ-023 pMJ-051 expression of T. uracil-excision lipase lanuginosus lipase
Table S4. Oligonucleotides used for diagnostic PCRs and Southern blot probes Primer name Sequence (5’-3’) tku70-DT-fw TGCCTAGGCTCGTCGCGTTT tku70-DT-rv GGGAGCGGATGGTGTTGATAA tku70-P-fw GCGATGGACTGTCTCTTCTC tku70-P-rv CGGACCACTCCTCCAAGTAA pyr2-DT-fw AGGGCTGGACGTCCACATCG pyr2-DT-rv CAGGCTTGTGCCAGCCATG adeB-P-UP-fw CAACCCATGGCGTAGGGAGG adeB-P-UP-rv GCTCAAGTGAGCGACGGCTC adeB-P-DW-fw GATCTGACGCTGCGAGCCAG adeB-P-DW-rv CGGTGGTTTGAGCGTCTGCG exp-IT-UP-fw GGCCAAAGATCATCCGCAGC exp-IT-UP-rv CAGTTGCTGAGGGAAGCCGTC exp-IT-DW-fw CCGTAACACCCAATACGCCG exp-IT-DW-rv CTTGGTTCTAGACGTGGAGGGCC wA-DT-fw GGGAACTAGCTGCCTTGCGTC wA-DT-rv TAGCTTAACCGCTCACCGTGG adeB-DT-fw ACAGGGTAGTCGTGGAACGGAG adeB-DT-rv TTCAACTGCCAGTGTTATACGCC lipase-P-fw ATGAGGAGCTCCCTTGTGCTG lipase-P-rv CTAAAGACATGTCCCAATTAACCCG pyr2prom-P-fw GGAGCTGGATGGATGGGCTAAG pyr2prom-P-rv GCTTTGTGTTGGTTCTTTCCAGGC Abbreviations: DT: Deletion Test, P: Probe, IT: Insertion Test, UP: Upstream, DW: Downstream.
25
2. Chapter I – Tool Development PhD Thesis Manuscript I Mikael Skaanning Jørgensen
M QM6a MJ-T-001
8,454 5.3 kb 7,242 6,369 5,686 QM6a tku70 4,822 4,324 3,675
8.1 kb
2,323 MJ-T-001 tku amdS tku
1,929 Probe 1 kb
Figure S1. Southern blot for confirmation of tku70 truncation. The restriction endonuclease XbaI was used for all digestions together with a 900 bp probe targeting the tku70 CDS, amplified using primer pair tku70-P-fw/rv. The band shift observed corresponds well with the expected band shift from 5.3 to 8.1 kb for truncation of tku70. Marker: BstII digested lambda DNA.
A B
3,675 8,454 7,242 6,369 5,686 2,323 4,822 4,324 1,929 3,675 1,371
adeB FLUP probe adeB FLDW probe 5.7 kb 3.7 kb T. lanuginosus lipase probe QM6a / MJ-T-006 FLA adeB FLB 1 kb
6.2 kb 2.3 kb 4.2 kb L1 / L2 / L3 FLA pyr2 PgpdA li T FLB
Figure S2. Southern blots for confirmation of correct insertion of the T. lanuginosus lipase expression construct. The restriction endonucleases BamHI and NheI were used for all digestions. A: Southern blot using two probes, one targeting the entire upstream adeB flank and the other targeting the downstream adeB flank. It is seen that the band sizes are consistent with the expected. The 1601 bp upstream adeB flank probe was amplified with primer pair adeB-P-UP-fw/rv while the 1567 bp downstream adeB flank probe was amplified using primer pair adeB-P-DW-fw/rv B: Southern blot using a probe targeting the T. lanuginosus lipase gene. It is seen that the band sizes are consistent with the expected. The 876 bp probe was amplified using the primers lipase-P-fw/rv. Marker: BstII digested lambda DNA.
26
2. Chapter I – Tool Development PhD Thesis Complimentary Research Results Mikael Skaanning Jørgensen
2.3. Complimentary Research Results
This section includes results obtained in connection with development of molecular tools for T. reesei which are not included in Manuscript I. In section 2.3.1 the rationale for substituting pyr4 with pyr2 for development of a bidirectional marker system is described and in section 2.3.2 the linear growth rates of selected mutants are presented.
2.3.1. Selection of pyr2 as an Alternative to pyr4
The initial focus for developing a bidirectional marker system for T. reesei QM6a was on the orotidine-5’phosphate decarboxylase gene (pyr4) since it had previously been used as a homologous bidirectional marker in T. reesei (Hartl, Seiboth 2005, Gruber, Visser et al. 1990). A pyr4 deletion construct targeting the full CDS of the gene was designed and used for transformation into a NHEJ deficient QM6a strain (MJ-T-001). Subsequent PCR-, Southern blot screening and sequencing of 60 5-FOA resistant and uridine auxotroph mutants, consistent with a pyr4 deletion (section 2.1.2), surprisingly revealed that all carried a full wild-type copy of pyr4. This clearly indicated that the gene was not easily deleted and that other genetic modifications must have led to a deficient pyrimidine pathway. This observation could also explain why most previous studies, using pyr4 as selective marker for T. reesei, utilize the same γ-radiation induced orotidine-5’phosphate decarboxylase deficient strain (TU-6) as recipient and not a deletion strain (Guangtao, Hartl et al. 2009, Gruber, Visser et al. 1990). Compared to the original QM6a isolate, TU- 6 is not the optimal recipient, since mutations other than the one leading to uridine auxotrophy with high probability have been introduced during the γ-radiation. Furthermore, the entire pyr4 gene is not deleted which leaves large homologous sequences that could lead to growth of false positive transformants in which pyr4 had been introduced at the original position. Another study does utilize a T. reesei strain with a deletion in connection with pyr4 (Steiger, Vitikainen et al. 2011) but the gene has only been partly deleted, leaving behind the first 294 bp of the CDS and the entire promoter. The nucleotide sequence that is still present encodes the first 98 amino acids of PYR4 which, when comparing with the orotidine-5’phosphate decarboxylase genes of A. nidulans, S. cerevisiae, Bacillus subtilis and E. coli, carries four conserved amino acids at position Asp-42, Leu-50, Lys-64 and Phe-96 (Figure 2.6). The Asp-42 and Lys-64 conserved amino acids are predicted to be active site residues forming hydrogen bonds to the 3’-OH group of the ligand’s ribosyl moiety and are not expected to be essential when uridine is present (Miller, Butterfoss et al. 2001, Hur, Bruice 2002). It is not known at present, whether this remaining part of the protein has an unknown dual function in which one is essential for growth, or if the nucleotide sequence carries hidden essential elements making it impossible to delete fully.
Figure 2.6. The first 98 amino acids of the T. reesei orotidine 5‘-phosphate decarboxylase (PYR4) and the corresponding amino acid sequences of the A. oryzae, S. cerevisiae, B. subtilis and E. coli orotidine 5‘-phosphate decarboxylases. Notice the four conserved amino acids (marked with yellow).
27
2. Chapter I – Tool Development PhD Thesis Complimentary Research Results Mikael Skaanning Jørgensen
Since no genetic alterations were observed in the pyr4 genes of the 5-FOA resistant and uridine auxotroph mutants after transformation with a pyr4 deletion construct, other spontaneous mutations leading to the same phenotype must have arisen. To elucidate this, the pyr2 gene in the pyrimidine biosynthesis pathway, previously used as a bidirectional selective marker in other species (Millerioux, Clastre et al. 2011, Dave, Chattoo 1997, Bitan-Banin, Ortenberg et al. 2003), was selected for sequencing in eight of the mutants. The gene encodes an orotate phosphoribosyltransferase and has previously been shown to have the same selectable properties as pyr4 as visualized in section 2.1.2. The sequencings revealed that several different types of spontaneous mutations had been introduced into the pyr2 genes in five of these, as seen in Figure 2.7, indicating that this gene is much more prone to inactivation than pyr4 in T. reesei. The observed mutations either result in inability to initiate correct transcription, are nonsense mutations or lead to a shift in the incorporated amino acid and therefore with high probability lead to a defective pyrimidine biosynthesis pathway.
Figure 2.7. The spontaneous mutations observed in the pyr2 genes of five of the 5-FOA resistant and uridine auxotroph mutants. The full pyr2 gene alignments can be seen in section 6.2 in the appendix.
The results indicated that pyr2 could be utilized as a bidirectional selective marker in T. reesei as a good alternative to pyr4. The counter-selectability was proven by the spontaneous mutations and positive selection for presence of the gene was demonstrated when transforming one of the pyr2 inactivated mutants with a substrate carrying pyr2 as selective marker (Figure 2.8).
Transformation plate Control
Figure 2.8. Use of pyr2 as selective marker. The protoplasts that have been transformed with a pyr2 carrying substrate were plated on the plate to the left while the plate to the right was plated with non-transformed protoplasts. Both plates have unfortunately been contaminated with a bacterium that forms small yellow colonies, but the fungal growth can luckily be distinguished from these.
After these results were obtained, work was initiated to implement pyr2 as a bidirectional marker for T. reesei as described in Manuscript I (section 2.2).
28
2. Chapter I – Tool Development PhD Thesis Complimentary Research Results Mikael Skaanning Jørgensen
2.3.2. Measurement of Growth Rates for Mutant Strains
Introduction
The growth rate experiment was set up in connection with the experimental work with pyr2 as selective marker. The growth rates were measured to investigate whether the different integration sites when using pyr2 as selectable marker, had impact on the growth of the mutants. The results also indicate whether deletion of adeB had an effect on the growth rate.
Materials and Methods
Strains and culture conditions The genotypes of all strains in the growth rate experiments can be seen in Figure 2.9 together with a phylogenetic three. Minimal media with sucrose as carbon source (MM1, Manuscript I) and supplemented with 25 mM adenine was used for incubation of all strains.
pyr2 tku70 ∆adeB loop ∆wA truncation ∆pyr2 MJ-T-009 MJ-T-010 MJ-T-022 QM6a MJ-T-001 MJ-T-006 MJ-T-012 MJ-T-013 MJ-T-021 ∆wA pyr2 ∆adeB loop
Strain Genotype MJ-T-001 tku70-::amdS+ MJ-T-009 tku70-::amdS+ Δpyr2 ΔadeB::pyr2 - + MJ-T-012 tku70 ::amdS Δpyr2 ΔwA::pyr2 - + MJ-T-021 tku70 ::amdS Δpyr2 ΔwA ΔadeB::pyr2 MJ-T-022 tku70-::amdS+ Δpyr2 ΔadeB ΔwAB::pyr2
Figure 2.9. Phylogenetic three and genotype of the mutants included in the growth experiments. The mutants included in the experiments are marked with bold in the phylogenetic three.
29
2. Chapter I – Tool Development PhD Thesis Complimentary Research Results Mikael Skaanning Jørgensen
Fabrication and inoculation of race tubes 25 ml serological pipettes (Sigma-Aldrich, St. Louis, USA) were used for the experiments. Each of the tubes were filled with 10 ml MM1 and placed on an even surface for solidification. Prior to inoculation holes were drilled in the bottom part of the tubes. The mutants were inoculated through the holes which were subsequently blocked by clear tape; all mutants were inoculated in triplicates. The filter in the top part of the pipettes enabled enough airflow to allow growth, while keeping the inside of the pipettes sterile (Figure 2.10).
Figure 2.10. The inoculated race tubes after six days of growth. Notice that that the bottom holes are blocked by tape while the top holes are only blocked by a filter that allows airflow. The white arrow point towards one of the drilled holes through which there was inoculated.
Measurements and calculations The growth distances for all replicates of the five mutants were measured once a day for seven consecutive days. To visualize the near linear growth throughout the measurement period, trend lines were drawn using the average growth distance for each of the mutant strains. The trend line slopes were calculated and depicted the growth rates in mm/h.
Results and Discussion
The growth distance measurements at the seven time points are seen in Figure 2.11. The figure includes trend lines from which the growth rates were calculated. It is seen that the growth for all of the mutants was approximately linear throughout the entire time span. Furthermore, it is seen that the total growth distance was similar for all mutant strains which is also reflected by the calculated growth rates. Slightly higher growth rates were observed for MJ-T-009 and MJ-T-022 (0.99 and 1.00 mm/h) compared to MJ-T-001, MJ-T-012 and MJ-T-021 (0.91, 0.94 and 0.91 mm/h), but this difference is not reflected by the location of pyr2 or any specific genetic deletion. These results indicate that integration of pyr2 as selective marker into the adeB- or wA genes does not have any influence on the linear growth of the corresponding mutant. The results also indicate that deletion of adeB does not affect the growth rates as long as adenine has been supplemented to the growth media.
30
2. Chapter I – Tool Development PhD Thesis Complimentary Research Results Mikael Skaanning Jørgensen
MJ-T-001 MJ-T-009 MJ-T-012 MJ-T-021 MJ-T-022
180
160 Growth distance (mm) 140
120
100
80
60
40
20
0 0 20 40 60 80 100 120 140 160 180 Time (hours)
MJ-T-001 MJ-T-009 MJ-012 MJ-021 MJ-022 Growth rates (mm/h) 0.91 (+/- 0.04) 0.99 (+/- 0.02) 0.94 (+/- 0.04) 0.91 (+/- 0.09) 1.00 (+/- 0.03)
Figure 2.11. The plot area shows the average growth distance for the five mutants at seven time points. Trend lines are drawn to visualize the linear growth. The trend line slopes indicate the growth rates for each mutant and can be seen in the appurtenant table together with their standard deviations.
31
32
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Mikael Skaanning Jørgensen
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei
Chapter II
Unraveling the Secondary Metabolism of T. reesei
OH CH3 H O O HO CH H C 3 3 HO OH O O H3C O H3C OH H3C H OH CH 3 OH CH3 O OH O O CH3 O CH3 HOH3C O H C 3 OH HO CH3 CH H C O 3 O 3 OH O
O
H3C O H3C O
HO CH3 CH3
O O
CH3 O H O HO CH3 CH3 H CHO OH H C 3 OH O CH 3 O H C 3 3 O O H H H CH3 H
O CHO3 HO CH3
HO OH
CH3 CH3
OH O HO CH H C 3 3 HO O CH3
CH3 HO CH3 H3C OH OH O
H C OH 3 OH OH O O O CH3 OH H3C CH3 H3C CH3 H3C H HO O O OH O O OH O H3C H3C OH OH O CH3 H3C CH3 HO OH O O CH3 H3C
33
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
3.1. Introduction
Filamentous fungi produce a plethora of small highly bioactive molecules denoted as secondary metabolites which are not essential for the primary metabolic pathways. These molecules include some extremely potent toxins with both economical and health implications for humans, but also constitute one of the most important sources of drugs for the pharmaceutical industry. Extensive research is therefore put into elucidating their complex biosynthesis. The second chapter of this thesis includes description of methods applied to elucidate the secondary metabolism of T. reesei and presents the results obtained in the duration of this study. Some background information about secondary metabolism and methods applied to elucidate this can be seen in the following sections (3.1.1 – 3.1.9).
3.1.1. Secondary Metabolites
The term secondary metabolites (SMs) can be endorsed to Andreas Kossel who was the first to distinguish these molecules from primary metabolites (Kossel 1891). These small and often highly bioactive metabolites, also referred to as natural products, are produced alongside the primary metabolites and are not essential for sustaining life and growth of the producing organism. The producing organism would therefore continue to grow if a secondary metabolic pathway was eliminated unlike if a primary metabolic pathway was eliminated. The secondary metabolism is tightly bound to the primary metabolism which provides the essential SM building blocks. Even though biosynthesis of SMs is not essential for the producer, these can provide benefits such as broadening the inhabitable environments or by giving competitive advantages against other organisms with overlapping resource requirements. Production of SMs is not restricted to a small group of closely related organisms, but has been reported for bacteria, fungi, plants and even animals. The high bioactivity observed for many SMs has arisen through many years of selection and provides the producing organism with different beneficial functions such as, defence/attack systems against other organisms, UV-protection and signalling capabilities. The high bioactivity of SMs is also interesting from a human point of view since it provides a tremendous source for new possible drug leads for the pharmaceutical industry (Chiang, Chang et al. 2011, Keller, Turner et al. 2005, Osbourn 2010). Especially fungi have been shown to be a remarkable source of SMs, as shown in a literature survey in which 42% out of the 23,000 included bioactive natural products were of fungal origin (Brakhage, Schroeckh 2011).
3.1.2. Secondary Metabolite Types
Based on the mode of biosynthesis, most SMs can be divided into five main groups which are discussed below. The metabolic origin of the building blocks for the different types of SMs can be seen in Figure 3.1.
34
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
Shikimate derived secondary metabolites
Proteins Shikimate Aromatic amino acids
Aliphatic amino acids Non-ribosomal peptides Alkaloids
Carbohydrate Pyruvate Acetyl-CoA TCA cycle compounds
CO2 Steroids Isoprenoids Malonyl-CoA Lipids
Polyketides
Figure 3.1. Connection between the primary metabolism and SMs. The different types of SMs are boxed and marked with bold. The figure is modified from “Secondary Metabolite biosynthesis: The First Century” (Bentley 1999).
Isoprenoids The isoprenoids, also known as terpenoids, are synthesized from products of the mevalonate pathway. Wallach propounded the so called “isoprene rule” in 1914 after his earlier observation (1887) (Bentley 1999) that many natural products could be dissected into isoprene units (C5H8); exemplified by monoterpenes (C10H16) and sesquiterpenes
(C15H24). This rule stated that terpenes were formed Isoprene unit Isoprene unit by joining isoprene units head to tail with the stoichiometric formulas (C5H8)n. The nomenclature can be seen in Table 3.1 and the monoterpenoid myrcene shown as an example in Figure 3.2. Later it was shown that some isoprene derived compounds, Figure 3.2. Myrcene consisting of two isoprene such as the 27 carbon stereoids, do not have a units stoichiometric formula that fits the head to tail principle indicating that the basic isoprenoid skeletons could be cleaved and rearranged (Barkovich, Liao 2001). Isoprenoids are found in all kingdoms and while many of the compounds are involved in essential metabolic processes it is also one of the most profound sources of SMs with more than 40.000 described compounds (http://dnp.chemnetbase.com/). The produced isoprenoids have several beneficial applications for the producing organisms and can act as for example antimicrobials, flavoring substances, hormones, insect anti-feedants or pigments. Table 3.1. Isoprenoid nomenclature Name Isoprenoid units Carbon atoms Hemiterpenoids 1 5 Monoterpenoids 2 10 Sesquiterpenoids 3 15 Diterpenoids 4 20 Sesterpenoids 5 25 Tripenoids 6 30 Tetrapenoids 8 40 Polyterpenoids 9 or more 45 or more
35
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
Shikimate derived secondary metabolites The shikimate pathway is responsible for biosynthesis of aromatic amino acids in bacteria, plants and fungi. The pathway is initiated with the condensation of phosphoenolpyruvate (PEP) and erythrose 4- phosphate (Ery4P) to 3-deoxy-D-arabinoheptulosonate-7- phosphate (DAHP) which is converted to shikimate (Figure 3.3) through three metabolic steps. Seven additional metabolic steps are carried out before the end product of the common pathway, chorismate, is synthesized (Tzin, Galili et al. 2001, Herrmann 1995). While chorismate itself is an important precursor for several SMs (Stalman, Koskamp et al. 2003) these can also be Figure 3.3. Shikimate synthesized from several branches from the pathway. The shikimate pathway is especially important in plants and it is estimated that, under normal conditions, 20% of the total fixed carbon is diverted to production of secondary products through this route (Rohr 1995). Some of the important fungal and plant secondary products originating from this pathway are pigments, phytoalexins, endole acetate and lignin (Tzin, Galili et al. 2001, Herrmann 1995). The aromatic amino acids derived from the shikimate pathway can also act as precursors for two of the other groups of SMs: the alkaloids and non-ribosomal peptides which are discussed in the next two paragraphs.
Alkaloids Most alkaloids are basic compounds derived from amino acids containing at least a single nitrogen atom in a ring structure. Alkaloids are primarily produced by plants, but are also synthesized by bacteria, fungi and animals (Mahmood, Ahmed et al. 2010). The alkaloids have great structural diversity and no uniform classification has been applied; they have been divided according to biological activity, chemical structure and, most accepted, after the origin of the metabolite as seen in Table 3.2 (Julsing, Koulman et al. 2006). The biological function of most alkaloids is basically unknown, but in plants most examined alkaloids have been shown to act as protection against herbivores. This is also supported by the fact that alkaloids often have a bitter taste. Some animals are believed to have adapted to the alkaloids and several of these compounds are now also produced by the animals themselves as neurotransmitters (Spiteller 2008). In 1804 morphine (Figure 3.4) was isolated as the first alkaloid and since then more than 12.000 alkaloids have been described with a world marked exceeding $4 billion (Julsing, Koulman et al. 2006). Figure 3.4. Morphine
Table 3.2. Division of alkaloids after origin Group Name Origin I Tropane-, pyrrolidine- and pyrrolizide alkaloids Ornithine II Benzylisoquinolone alkaloids Tyrosine III Indolequinoline alkaloids Tryptophane IV Pyridine alkaloids Nicotinic acid V Quinolizidine- and piperidine alkaloids Lysine
36
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
Non-ribosomal peptides Non-ribosomal peptides (NRPs) are small peptides produced by bacteria and fungi. The peptides are assembled non-ribosomally by multimodular enzymes referred to as non- ribosomal peptide synthetases (NRPSs). The synthases consist of modules each containing several catalytic domains catalyzing reactions such as substrate recognition, activation and condensation by peptide bond formation. The basic building blocks include non-proteinogenic amino acids in addition to the proteinogenic amino acids in both L and D configuration. NRPs achieve a high level of diversity through incorporation of a vast number of different amino acids, variations in peptide length and other possible modifications such as cyclization, oxidation, reduction or methylation. NRPSs are divided into three different types according to their modes of action as seen in Table 3.3. NRPs synthesized by type A, linear NRPSs are discussed in greater detail in section 3.1.4.
Table 3.3. Division of NRPS types by mode of action Type Synthesis mechanism A (linear) Assembly line, one reaction pr. active site B (iterative) Iterative, all active sites are re-used C (nonlinear) Some domains are re-used, others are used only once in each elongation process
Polyketides Polyketides (PKs) are a major group of SMs in both fungi and bacteria, but are also observed in plants. PKs are assembled from acetyl-CoA activated short-chain carboxylic acids, most often acetyl-CoA and malonyl-CoA, by decarboxylative Claisen condensations carried out by large polyketide synthase proteins (PKSs). The great structural diversity of PKs is primarily achieved by modifications introduced during elongation or after synthesis of the basic polyketide chain, and not by incorporation of different types of monomers, although possible. The PKSs have traditionally been divided into different types according to mode of action as seen in Table 3.4. Most fungal PKs are synthesized by the iterative type I PKS synthases, greatly resembling the mammalian fatty acid synthases. These are discussed in greater detail in section 3.1.5.
Table 3.4. Division of PKS types by mode of action Type Protein(s) Synthesis mechanism Organisms I (modular) Single protein, multiple modules Assembly line, one reaction pr. active site Bacteria I (Iterative) Single protein, one module Iterative, active sites may be re-used Fungi, few bacteria II Multiple proteins, one active Iterative, active sites may be re-used Bacteria site for each III Single protein, multiple modules Iterative, active sites may be re-used Primary plants, but also few bacteria and fungi
Hybrids The complexity of SMs is further increased by formation of hybrid products including parts of two or more of the above mentioned SM groups.
37
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
3.1.3. PKS and NRPS Gene Clusters
PKs and NRPs are two of the most abundant groups of fungal SMs. Their syntheses have large resemblance and include selection and condensation of a predetermined number of monomers by large synthase proteins. While most fungal PKSs are iterative and allow re- use of the PKS modules for elongation of the polyketide chain, fungal NRPSs are most often modular which means that each module adds just a single amino acid monomer during peptide chain synthesis. All genes involved in the processes for biosynthesis of specific PKs or NRPs are most often observed in co-regulated clusters, consistent with reports for other genes encoding enzymes for a specific pathway (Keller, Hohn 1997). The non-synthase genes in these PKS and NRPS clusters encode proteins that are involved in processes such as modifying the initial metabolites (tailoring enzymes), synthesis of unusual monomers, conferring resistance towards the produced metabolites, transportation of the metabolites and transcriptional regulation of the cluster. As an example a T. reesei PKS/NRPS gene cluster can be seen in Figure 3.5. The cluster include genes encoding enzymes with activities such as esterase, reductase, dehydrogenase and monooxygenase, which previously have been reported to contribute to modification of metabolite products. The preliminary annotations of the shown gene cluster have not yet been verified experimentally and it is therefore not certain that all shown genes are involved in the processes regarding the metabolite product(s); the cluster could though also include more genes than the ones that are shown. The widespread clustering of genes, involved in the same SM pathways, indicate that these could have been transferred through horizontal gene transfer as speculated for the fumunisin gene clusters and penicillin gene clusters (Khaldi, Wolfe 2011, Brakhage, Thon et al. 2009). The metabolite synthase clusters are also frequently surrounded by DNA repeats or fragments of transposon-like elements supporting this (Shaaban, Palmer et al. 2010). Genes encoding cluster specific transcription factors are often included in the clusters and regulate transcription of all the genes that are essential for complete metabolite biosynthesis. Another interesting observation regarding SM clusters is that these are often located near the telomeric regions of the chromosomes from where they can be co-regulated by global regulators of secondary metabolism such as LaeA (Bok, Keller 2004). Regulation of SM biosynthesis is discussed in more detail in section 3.1.6. As mentioned previously, the complexity of SMs is increased by formation of hybrid products including parts of two or more of the SM types. These hybrid products are most often produced by several independent synthases, each synthesizing a part of the SM molecules which are stitched together subsequently; but hybrid synthase enzymes assembling hybrid metabolites directly also exist (Gallagher, Fenical et al. 2010, Phonghanpot, Punya et al. 2012). In filamentous fungi especially hybrids of PKs and NRPs are widespread (Maiya, Grundmann et al. 2007, Collemare, Billard et al. 2008, Chang, Horn et al. 2009, Mukherjee, Buensanteai et al. 2012, Gerc, Song et al. 2012) and these are also observed in T. reesei as seen for the cluster in Figure 3.5 which include both a PKS-, a NRPS- and a hybrid synthetase gene.
38
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
JGI ID
T. reesei PKS/NRPS gene cluster 23 5 kb
JGI ID Gene size (bp) Predicted protein function 59315 11,824 PKS/NRPS hybrid 36822 2,399 Esterase/lipase/thioesterase 59775 1,205 Reductase (Isoflavone reductase) 105798 1,683 Transporter (Major Facilitator Superfamily) 3262 1,826 Dehydrogenase (Aldehyd dehydrogenase) 59377 1,455 Monooxygenase (p450) 59690 3,309 NRPS 105804 6,782 PKS
Figure 3.5. Section of a putative PKS-, NRPS- and hybrid synthetase gene cluster in T. reesei. The predicted protein functions can be seen in the appurtenant table. The metabolite product(s) synthesized by the proteins encoded by the genes in this cluster has not yet been appointed.
3.1.4. Non-Ribosomal Peptides
NRPs are a very diverse group of SMs provided by a biosynthesis-machinery which is not subjected to the same limitations regarding the amino acid monomers as ribosomal peptides. As previously mentioned both proteinogenic and non-proteinogenic amino acids can be incorporated into NRPs and unlike ribosomal peptides also amino acids with D- configuration can be incorporated into the peptide chains (Schracke, Linne et al. 2005). The finished peptide chains can vary greatly in length and are often subjected to further alterations, such as ring formation, oxidations or reductions, catalyzed by tailoring enzymes expressed from other genes in the NRPS gene clusters (Zhang, Ostash et al. 2010). The large NRPS enzymes, which assemble the NRPs, are in fungi most often of the type A, linear type consisting of repeated modules, each adding one amino acid monomer. All modules, involved in elongation of the peptide chain, consist of three basic catalytic domains essential for the elongation process, but can also carry modifying domains altering the growing peptide chain (Table 3.5). Some ribosomal peptides can undergo post-translationally modifications so that they resemble NRPs. One example is the polytheonamides (A/B/C) which consists of 49 monomers and has a molecular weight of a massive (in NRP respect) 5033.75 g/mol. These peptides have been observed in the coral reef sponge Theonella swinhoel, but are believed to be produced by bacterial symbionts. The initial peptide chain has been shown to undergo as many as 48 post-translational modifications, including epirimizations of L- amino acids to D-amino acids (Freeman, Gurgui et al. 2012). The fungal NRPs ACV (δ-(L-α-aminoadipyl)-L-cystein-D-valine), produced by Penicillium chrysogenum among others, and paracelsins (A-E), produced by T. reesei, are examples of very dissimilar true NRPs. ACV, the precursor for penicillins and cephalosporins, is a result of condensation of three amino acids and has a molecular weight of just 363.43 g/mol. The paracelsins, on the contrary, consist of 20 amino acids and have a molecular weight approaching 2000 g/mol. While ACV undergoes further modification steps including cyclization, before the final products are obtained, the paracelsins are not modified further and remain as an intact linear peptide chain. The structure of paracelsin A can be seen in Figure 6.4 in appendix section 6.5.2.
39
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
The penicillins are probably the most well-known example of NRPs and biosynthesis of ACV and its subsequent conversion to penicillin G are discussed in further detail in the following section to give a more thorough example of a complete biosynthesis pathway of a NRP.
Table 3.5. Overview of the possible catalytic NRPS domains and their function. The three required domains of a module are marked with “R”. Some domains can act as integral parts of other domains; C/E, A/MT and A/Ox domains have for example been observed (Finking, Marahiel 2004, Lim, Roongsawang et al. 2007). Domain name Abbreviation Function Required/Optional Selective gatekeeper for the AA. The AA is also activated by Adenylation A R the adenylation domain. Catalyzes the C-N peptide bond formation and elongation of Condensation C R the molecule Epimerization E Catalyzes epimerization of L-amino acids to D-amino acids O Transfer a formyl group to the N-terminus of the peptide Formylation F O chain Catalyzes cyclization of cysteine, serine and threonine Heterocylization Cy residues. Can catalyze C-N bond formation and thereby O replace C-domains Transfer methyl groups during NRP synthetase. Can be either Methyl transferase MT O N-methyltransferases or C-methyltransferases Oxidation Ox Oxidition of thiazole ring structures O Release the finished NRP by reducing the terminal to aldehyde Thioester reductase R O or alcohol Point of attachment of the activated monomers selected for Thiolation T elongation. Has a covalently bound 4’-phosphopantetheine R arm. Are also referred to as “PCP” Thioesterase TE Release the finished NRP by thioesterase activity O
Penicillin The penicillins were the first group of antibiotics to be exploited as chemotherapeutic agents. The first step was taken in 1928 by Alexander Fleming when he decided to investigate why a Penicillium rubens mold contamination of one of his Staphylococcus aureus plates was encircled by an inhibition zone (Houbraken, Frisvad et al. 2011, Ligon 2004). A compound excreted by the mold was later subjected to thorough studies initiated at Oxford University in 1940 which led to utilization of this compound as an antibiotic. The following success and vast spread of penicillin all over the world were possible because of some very important characteristics of this antibiotic. Most important was the relative lack of toxicity toward eukaryotic cells enabling the treatment of humans; furthermore the compound had sufficient stability to be used as a chemotherapeutic agent (Koch 2000, Livermore 1996). Another important factor was the relative ease of isolation and modification of the compound for optimization of the activity (Koch 2000). In 1943 penicillin was introduced as an antimicrobial compound for treatment of humans when it was used to treat allied soldiers during Second World War, (Demain, Elander 1999, Koch 2000). Since then an array of other antibiotics carrying the same basic beta-lactam ring structure, but other side chains, has been introduced; some exhibiting broader antibiotic activity (Donowitz 1989).
40
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
An overview of the biosynthesis of penicillin G (gold standard) by P. chrysogenum can be seen in Figure 3.6. Three distinct proteins are involved in the biosynthesis; ACV synthetase (ACVS) encoded by pcbAB, Isopenicillin N synthase encoded by pcbC and Isopenicillin N acyltransferase encoded by penDE (Weber, Bovenberg et al. 2012). ACVS is the NRPS responsible for condensation of the three amino acids of the ACV tripeptide. The module and domain organization of the ACVS protein can also be seen in Figure 3.6. The numbers indicate the five basic reactions of the enzyme which are described in the following. 1, the non-proteionogenic L-α-aminoadipic acid is selected by the adenylation domain of the first module and bound to the P. chrysogenum pcbAB pcbC penDE 4’-phosphopantetheine arm of the thiolation penicillin cluster domain. 2, L-cysteine is selected by the Isopenicillin N acyltransferase adenylation domain of the second module Isopenicillin N synthase and bound to the 4’-phosphopantetheine ACV synthetase arm of the thiolation domain, the (ACVS) condensation domain facilitate amide bond 1 2 3 4 5 formation between the amino group of L-α- A T C A T C A T E TE aminoadipic acid and the carboxyl group of ACVS L-cysteine. 3, L-valine is selected by the S S S O SH O adenylation domain of the third module and NH NH bound to the 4’-phosphopantetheine arm of O O SH NH2 the thiolation domain. Before peptide bond O HN OH O formation, catalyzed by the condensation H2N O domain, can take place L-valine must HO
NH2 undergo epimerization to D-valine which is O facilitated by the epimerization domain (4). OH The last step is release of the finished linear ACV-tripeptide catalyzed by the thioesterase domain (5). NH2 The final reactions towards biosynthesis of ACV-tripeptide penicillin G are carried out by the two Bicyclic ring formation by Isopenicillin N synthase tailoring enzymes, isopenicillin N synthase and isopenicillin N acyltransferase. NH2 Isopenicillin N synthase converts the linear ACV-tripeptide to the bicyclic penam, Isopenicillin N consisting of a β-lactam- and thiazole ring, Replacement of sidechain by isopenicillin N acyltransferase which is characteristic for all penicillins (Cooper 1993). Isopenicillin N acyltransferase catalyzes the last step of penicillin G biosynthesis in which the Penicillin G aminoadipic side chain is replaced by a Figure 3.6. Synthesis of penicillin G in P. chrysogenum, from phenylnoxacetyl group (Barredo, van genes to final product. Solingen et al. 1989).
41
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
Other important NRPs Several other NRPs than the beta-lactam antibiotics have significant pharmaceutical applications. These include other antibiotics such as daptomycin, vancomycin, teichoplanin and the capreomycins which have different modes of action and therefore hamper appearance of cross-resistant microorganisms. Medically relevant NRPs are not only antibiotics, but also include metabolites with activities such as anti-tumor (bleomycins and quinolaxines), immunosuppressive (cyclosporins) and anti-HIV (quinoxaline) (Felnagle, Jackson et al. 2008). Some NRPs also have negative implications for humans; some are toxins such as microcystin which can cause serious liver damages if ingested and other can cause negative economic implications as phytotoxins (Gilroy, Kauffman et al. 2000).
3.1.5. Polyketides
PKs constitute the most prominent group of fungal SMs. In fungi these are almost exclusively synthesized by the large multi-domain type I iterative PKSs (iPKSs) which are closely related to mammalian fatty-acid synthases. The PKSs synthesize the PKs by assembling short CoA activated carbon chains into long polymers by repetitive Claisen condensation reactions. The typical starter unit is acetyl-CoA and the typical extender unit malonyl-CoA, which adds two carbon atoms in each elongation step (Figure 3.7B); more complex carbon chains can also be incorporated. The minimal iPKS consists of three catalytic domains (β-ketoacyl synthase (KS), acyltransferase (AT) and acyl carrier protein (ACP)), but several other catalytic domains can also be included in the PKS as seen in Table 3.6 and Figure 3.7A.
A DH ER KR KS AT ACP
B
O O
O CO2 O O
n O
HO CoA S + CoA S OH n n-1 Acetyl-CoA Malonyl-CoA Polyketid chain
Figure 3.7. A, an example of the domain organization of a PKS. The dark blue domains are required for PK synthesis while the three remaining domains are optional and involved in reduction of the ketone groups. B, the basic PK synthesis with acetyl-CoA as starter unit and malonyl-CoA as extender unit. “n” depicts the number of extensions.
Traditionally type I iPKSs have been sub-divided into three different groups according to the presence or absence of the reductive domains seen in Figure 3.7A. The fully reducing iPKSs contain all three reductive domains responsible for reduction of the ketone groups that arise after each elongation step. The three domains can reduce ketones to hydroxyls (catalyzed by KR), hydroxyls to enoyls (catalyzed by DH) and enoyls to alkyls (catalyzed by ER). The rare partly reducing iPKSs contain a KR domain and possibly also a DH domain, but no ER, and are therefore not able to reduce the ketones fully to alkyls. The third group does not include any reducing domains and are
42
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen referred to as non-reducing iPKSs. It is important to note that even though reductive domains are present, reduction of the polyketide chain monomers is only optional and of variable degree, not necessary reflected by the reduction potential of the iPKS. Polyketide biosynthesis is initiated when the starter unit is loaded on the KS domain and the extender unit is selected by the AT domain and loaded on the 4’-phosphopatetheine group of the ACP domain; both as thioesters. Peptide bond formation by Claisen condensation is catalyzed by the KS domain between the two units. All movements between the catalytic domains of the iPKS are performed by the 4’-phosphopatetheine group that functions as a flexible carrier. If the ketone group is reduced in this cycle, the polyketide intermediate is presented to the corresponding reducing domains. When the reduction(s) are completed or if they are skipped the intermediate is transferred back to the KS domain and another round of elongation can take place. If the ketide chain has reached its predetermined length, it is released from the iPKS by catalytic activity of either a TE or CYC domain. The number of iterations iPKSs perform cannot be predicted at present, but newer research indicates a correlation between the size of the active site pocket of the KS domain and the size of the polyketide product (Yadav, Gokhale et al. 2009). Precise prediction of product size by in silico analysis can though be difficult to achieve since polyketide products which have undergone varying numbers of iterations can be produced by the same iPKSs (this study, described in the manuscript II, section 3.2, (Davison, al Fahad et al. 2012)). For simplicity the term iPKS is not used in the remainder of this thesis. All polyketide synthases will be referred to as PKSs.
Table 3.6. Overview of possible catalytic domains of PKSs and their function. Domain name Abbreviation Function Required/Optional Point of attachment of the activated monomers selected for Acyl carrier protein ACP R elongation. Has a covalently bound 4’-phosphopantetheine arm. Involved in loading of starter units and transfer the C or C acyl Acyltransferase AT 3 4 R groups to the ACP. Act as selective gatekeeper for monomers. β-keto reductase* KR Reduces ketones to hydroxyls O Catalyzes the C-C peptide bond formation and elongation of the β-ketoacyl synthase KS R molecule Catalyzes ring formation by Claisen reaction, release PKs Claisen cyclase CYC O produced by non-reducing PKSs Condensation CON Catalyzes condensation between two PKs O Dehydratase* DH Reduces hydroxyls to enoyls O Enoyl reductase* ER Reduces enoyls to alkyls O Transfer methyl groups during PK biosynthesis. Can be either Methyltransferase MT O C-methyltransferases or O-methyltransferases. Product template PT Control non-reducing PK folding patterns O Thioesterase TE Release the finished PK by thioesterase activity O Starter unit acyl-carrier SAT Loading of starter units O transacylase carrier *The basic reductive domains
The vast diversity of PKs synthesized by fungal PKSs is not only achieved by varying number of iterations, selection of different starter units or extent of reduction, but is also provided by many possible post-polyketide synthesis steps as demonstrated in the example below by the aflatoxin biosynthesis.
43
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
Aflatoxins Some of the most well-studied polyketide derived metabolites are the potent mycotoxins aflatoxins which pose a potential health risk for both livestock and humans. The implications of aflatoxins were first observed in 1960 where more than 100,000 turkeys in English poultry farms died of a disease later referred to as “turkey X disease”. An investigation of the outbreaks pin-pointed the feed as a source of the disease and in 1961 it was established that the toxin responsible for the deaths was produced by Aspergillus flavus which had contaminated the feed, hence the name “aflatoxin” (de, BEERTHUIS et al. 1962). Different variations of aflatoxins have since then described and are produced by several Aspergilli including Aspergillus parasiticus, Aspergillus nomius and Aspergillus ochraceus (Schroeder 1966, Kurtzman, Horn et al. 1987, Aziz, Moussa 1997). The aflatoxin biosynthesis mechanism has been subjected to extensive studies due to the possible implications these toxins have on both health and economy. The gene cluster responsible for biosynthesis of aflatoxins includes 25 genes and spans 70 kb as seen in Figure 3.8 for A. parasiticus and A. flavus (Yu, Chang et al. 2004). The highly complex biosynthesis mechanism including at least 23 enzymatic steps serves as a good example for the vast degree of modifications polyketide products can undergo before the final products are obtained. The biosynthesis mechanism diverges from the typical polyketide biosynthesis directly from the start where the fatty acid hexaonic acid is loaded as starter unit on the PKS instead of acetyl-CoA. Two fatty acid synthases (α and β) are responsible for synthesis of hexaonic acid and are encoded by genes present in the aflatoxin synthase cluster (Watanabe, Townsend 2002, Watanabe, Wilson et al. 1996). It is seen that the majority of genes in the cluster encodes enzymes that are involved in tailoring the polyketide product into the finished aflatoxins; including several reductases, oxygenases, methyl transferases and also an esterase. A. nidulans among others lacks the genes encoding the proteins for the final steps of aflatoxin biosynthesis and therefore only produces the intermediate sterigmacytosin (Yu, Chang et al. 2004).
Other important PKs As one of the most prominent groups of SMs, PKs have gained widespread utilization as pharmaceuticals. At present more than 40 such pharmaceuticals have been approved and are utilized as antibiotics (e.g. tetracyclins), anti-cancers (e.g. doxorubicin), anti- parasitics (e.g. avermectin), anti-fungals (e.g. amphotericin B), cholesterol lowering agents (e.g. lovastatin) and immunosuppressants (e.g. rapamycin) (Weissman 2004). Due to the high bioactivity most PKs possess, this metabolite group is subjected to extensive research to identify new interesting drug candidates.
44
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
Table 3.8. Aflatoxin biosynthesis. A, overview of the 25 genes in the 70 kb gene cluster encoding proteins involved in the biosynthesis of aflatoxins B1, B2, G1 and G2 in A. parasiticus and A. flavus. Both new and old gene names are included B, the proposed biosynthetic pathway of these aflatoxins including the gene names and corresponding enzyme activities responsible for each catalytic step. To the far right the genes believed to be involved in the sterigmatocystin synthesis in A. nidulans are seen. Abbreviations: NOR, Norsolorinic acid; AVN, Averantin; HAVN, 5′-Hydroxyaverantin; OAVN, Oxoaverantin; AVNN, Averufanin; AVF, Averufin; VHA, Versiconal hemiacetal acetate; VAL, Versiconal; VERB, Versicolorin B; VERA, Versicolorin A; DMST, Demethylsterigmatocystin; DHDMST, Dihydrodemethylsterigmatocystin; ST, Sterigmatocystin; DHST, Dihydrosterigmatocystin; OMST, O-Methylsterigmatocystin; DHOMST, Dihydro-O-methylsterigmatocystin (Yu, Chang et al. 2004). 3.1.1.5 Regulation of the secondary metabolism
45
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
3.1.6. Regulation of PK and NRP Biosynthesis
Biosynthesis of SMs is extremely costly for the producing organism and requires resources that could also be utilized in the primary metabolism. Production of these metabolites is therefore subjected to tight regulation so that the produced SMs are always most favorable for the present conditions, and their biosynthesis halted if they are not needed. Most PKS and NRPS gene clusters include genes encoding transcription factors (TFs) that regulate the expression of the entire cluster; transcription of these cluster specific TFs are in turn regulated by an intricate system including nutrient level dependent global regulators, external stimuli and general needs of the producer (Calvo, Wilson et al. 2002). An example of regulation of a SM gene PKS/NRPS cluster as response to external stimuli is Transcription factor seen in Figure 3.9. 1, external stimuli Tailoring enzyme activate a signal transduction inside the Transporter External stimuli cell. The initiated signal transduction Cytosol 1 can lead to activation of a single Signal transduction PKS/NRPS synthase cluster, as seen in the figure, or several clusters depending Nucleus 2 on the stimuli. Global regulators such as 5 AreA, CreA and PacC are also involved 4 in regulation and ensures that the + + + + + metabolite response are suitable for the available nitrogen and carbon sources - and the pH in the surroundings,
Transcription Dephosphorylation respectively (Calvo, Wilson et al. 2002). 3 O Some studies indicate that mitogen P O- O- activated protein (MAP)-kinases and Translation cAMP protein kinases are involved in 8 signal transduction (Brodhagen, Keller 6 OH O H3C CH3
HO 2006, Shimizu, Keller 2001, Shimizu, CH3 7 Hicks et al. 2003). 2, the signal propagates inside the nucleus and activates transcription of the cluster Figure 3.9. Regulation of a synthase gene cluster including a cluster specific TF gene. 3, the TF is specific transcription factor as a response to external stimuli. synthesized and might be phosphorylated as a step in the transcriptional regulation. Phosphorylation can act as an extra switch for adapting the response to the stimuli (Moyano, Martinez-Garcia et al. 1996, Igarashi, Ishida et al. 2001). 4, in this example only the dephosphorylated TF molecules are allowed inside the nucleus where they activate transcription of the other genes in the SM gene cluster (5). The TF often also increases the transcription of the TF gene itself creating a positive feedback system (Yu, Keller 2005). 6, the synthase protein is synthesized and assembles the basic metabolite frame which can be modified by possible tailoring enzymes. 7, some metabolite gene clusters include genes encoding specific metabolite transporters that export the metabolite product out of the cell. 8, A negative feedback loop is often observed when the metabolite product is present in the cytosol (Yu, Keller 2005).
46
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
Global regulators of secondary metabolism Several proteins have been shown to have an impact on the general level of SM biosynthesis. One of the most well-studied global regulators of the secondary metabolism in Aspergilli is LaeA (Bok, Keller 2004, Perrin, Fedorova et al. 2007) which has been shown to positively control as many as 10% of the genes in Aspergillus fumigatus; many located in 13 of the 22 SM clusters whereof seven are located in sub-telomeric regions with heavy heterochromatin (Perrin, Fedorova et al. 2007). LaeA has large sequence similarity with methyl transferases involved in modification of histones, indicating that the regulation mechanism of LaeA could be through chromatin remodeling (Hoffmeister, Keller 2007). Two other proteins, VeA and VelB, have been shown to assemble into a heterotrimeric complex together with LaeA and trigger transcription of genes involved in aflatoxin biosynthesis (Bayram, Krappmann et al. 2008). VeA has also been shown to regulate biosynthesis of other SM pathways and also sexual development in A. flavus, A. parasiticus and A. nidulans (Calvo, Bok et al. 2004, Kato, Brooks et al. 2003). The importance of chromatin remodeling in higher regulation of the secondary metabolism is also supported by a study showing that the production of SMs are altered in many different fungi when treating them with inhibitors of DNA methyltransferases or histone deacetylases (Williams, Henrikson et al. 2008).
Interestingly, the increasing number of fully sequenced fungal genomes has revealed presence of much more SM gene clusters than observed metabolites, indicating that many of these are silent at normal laboratory conditions (Bergmann, Schumann et al. 2007). The advancements in molecular biology provide the tools for further elucidation of this potential and could potentially lead to discovery of a range of new interesting drug candidates that could not have been discovered without genetic engineering.
3.1.7. Linking SM Genes and Products
The complex PK and NRP biosynthesis mechanisms which can provide a plethora of interesting bioactive molecules, at the same time make linkage of the involved genes and the final products challenging. An important step towards linkage of SMs and corresponding genes in filamentous fungi was taken in 2003 when the genomic sequence for Neurospora crassa was published as the first for a filamentous fungus (Galagan, Calvo et al. 2003). Shortly thereafter the genomic sequences for other filamentous fungi followed (Galagan, Calvo et al. 2005, Machida, Asai et al. 2005, Nierman, Pain et al. 2005) and still continue to do so in an increasing pace. The available sequence data provide a basis for targeted approaches for elucidation of SM biosynthesis, which before was only possible through random mutagenesis coupled to large mutant screening setups. The sequence data also revealed that the number of SM synthase gene clusters clearly exceeded the number of observed SMs; the SM potential for the sequenced organisms was therefore far greater than observed at laboratory conditions. More insight into the mechanisms behind PK and NRP biosynthesis is therefore important for clarifying their full potential for biosynthesis of metabolites. More knowledge of the genetic basis for SM biosynthesis could also provide a platform enabling introduction of targeted alterations resulting in products with higher activities or even new activities paving the way for synthesis of entirely new drug candidates. Several methods have been applied to link SMs to the genes encoding the proteins responsible for their biosynthesis.
47
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
Deletion and overexpression Until now the most successful approach has been systematic deletion of synthase genes coupled with metabolite profiling as performed by Chiang and co-workers for identifying the emericellamide gene cluster (Chiang, Szewczyk et al. 2008). Unfortunately, identification using this method requires that the synthase gene cluster of interest is active at the applied conditions. To circumvent this drawback several studies have included manipulation of genetic silencers or activators such as the previously described pleiotropic regulator LaeA or other chromatin/histone modulators (Reyes-Dominguez, Bok et al. 2010, Reyes-Dominguez, Boedi et al. 2012, Strauss, Reyes-Dominguez 2011, Bok, Keller 2004). Schroeckh and co-workers even identified the natural activator of orsellinic acid and lecanoric acid production by co-cultivating A. nidulans with 58 different soil dwelling bacteria (Schroeckh, Scherlach et al. 2009). Overexpression of SM cluster specific TFs have been used twice by Bergmann and co-workers for identification of both the asperfuranone- and the aspyridone gene cluster (Bergmann, Funk et al. 2010, Bergmann, Schumann et al. 2007). It is important to note that transcription of genes in the asperfuranone gene cluster was activated by a SM cluster specific TF from another SM cluster and not by a TF in the same gene cluster. TF overexpression studies must therefore always be followed up by deletion studies to ensure that the SM with increased prevalence is indeed synthesized by enzymes encoded from genes in the corresponding cluster. Nielsen and co-workers combined a genome wide deletion study of A. nidulans PKS genes with inoculation on a range of different complex media types to pin-point an austinol meropenoid gene cluster and to gain more insight into the arugosin and vioaceol biosynthesis (Nielsen, Nielsen et al. 2011).
Transcriptomics and metabolomics Expression of different SM cluster genes varies greatly with growth conditions - comparison of transcriptional data and metabolomic data obtained from different conditions can therefore indicate which genes that are involved in production of a specific SM. The extent of the SM clusters might also be estimated using this method since genes involved in production of specific SMs with high probability are co-regulated (Andersson, Andersson et al. 2009).
Heterologous expression Another method that has been applied is heterologous expression of separate synthase genes or whole SM pathways. This method has been used in several studies and has led to identification of the gliobactin A, mensacarcin and rishirilide A gene clusters among others (Dudnik, Bigler et al. 2012, Yan, Probst et al. 2012, Sakai, Kinoshita et al. 2012). This approach requires a host with a well-described SM potential and a biochemical background supporting biosynthesis of the metabolite product.
In silico prediction As the amount of collected bioinformatic and proteomic data increases, using the above methods, in silico prediction of metabolite biosynthesis becomes more and more reliable. Especially predictions of bacterial modular NRPSs products have prevailed because the modularity of these allows prediction of the specific amino acids monomer that will be added to the growing peptide chain in each elongation step (Lilien, Stevens et al. 2005, Stachelhaus, Mootz et al. 1999, Starcevic, Zucko et al. 2008). The predictions are based on alignments of a large number of adenylation (A) domains with known amino acid
48
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen specificity. The active sites of the adenylation domains which are involved in selection of the amino acid monomer are pin-pointed and can be used to predict the specificity of the NRPS domains that have not yet been linked to an NRP. The final NRP can though undergo unpredictable modifications by tailoring enzymes after synthesis of the peptide chain. Elucidation of these tailoring processes can be estimated by looking at the genes in the adjacent cluster. The amount of data collected for fungal NRPS adenylation domains do not yet provide reliable predictions of the selected amino acid monomers. Prediction of products from the fungal PKSs is hampered by their iterative mode of action. Even though each elongation is performed by the same set of catalytic domains, different monomers can be selected in each elongation cycle and the levels of reduction of the ketid units differ. A correlation between the sizes of active site pockets of KS domains and the sizes of polyketide products has been shown (Yadav, Gokhale et al. 2009), but the number of iterations performed cannot yet be predicted based on this. It can be expected that in silico prediction will become more reliable as the amount of available data increases and bioinformatics and proteomics develop. At present it though far from obliterates the other methods for linking genes and SMs.
3.1.8. HPLC and Detectors
High pressure liquid chromatography (HPLC) is one of the most widely used chromatographic techniques for separation of metabolites for subsequent analysis (Figure 3.10). The most central part of the HPLC is a column filled with tightly packed solid particles through which the sample of interest passes through - facilitated by movement of a liquid solvent. Different metabolites in the sample will have different retention times in the column as a function of their affinity to the column particles and the used solvent. Several types of HPLC exist such as normal phase, displacement and the widely used reverse-phase which together with the possibility for selection of different types of column particles and solvents allow for a high degree of optimization of the HPLC method according to the composition of the sample. While normal liquid chromatography relies on gravitational force, HPLC relies on a pump system which supplies a pressure of approximately 150 bar to facilitate flow through the column. The higher pressure allows for use of smaller particles in the columns and therefore better separation of the constituents of the loaded samples. Recently HPLCs utilizing an even higher pressure of up to 1000 bar have gained more footing; this is often referred to as ultra-high pressure liquid chromatography (UHPLC). For visualization of the separated metabolites one or more detectors are coupled to the HPLC system. Diode array detectors (DAD) detecting the metabolites’ response to a range of wavelengths from UV to visual light is often used as detectors. This detection method provides information of the chromophores of the analyzed metabolites and can also indicate the quantity of specific metabolites in a sample. Mass spectrometry (MS) is another detection method often utilized in connection with HPLC. In this method the compounds are ionized and the mass-to-charge ratio measured for the charged particles (ions) which subsequently can be used to determine the elementary composition of the metabolites of interest and also aid to elucidate their chemical structures. One type of MS is the high-resolution time-of-flight MS (TOFMS) which determines the ion’s mass-to-charge ratio by measuring the time it takes for a specific metabolite to travel a certain distance. Since large molecules travel slower than small, their masses can be estimated and a mass spectrum of metabolites according to
49
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen their mass-to-charge ratio drawn. A HPLC setup combining UHPLC with both DAD and TOFMS detectors are denominated UHPLC-DAD-TOFMS.
Data Sample
Solvent Pump Sample loading Column DAD TOFMS Detectors
Figure 3.10. An example of a HPLC setup
3.1.9. T. reesei PK and NRP Metabolites and Genes
Only a limited number of PK and NRP SMs have been described for T. reesei at present. One of the best known compounds is the paracelsins that belong to a group of NRPs called peptaibols which are often observed for species belonging to Trichoderma spp.. These are characterized by a high content of the non-proteinogenic amino acid α- aminoisobutyric acid and a C-terminal 1.2-amino alcohol (Baker, Perrone et al. 2012). A few PK derived metabolites have also been described for T. reesei and include the trichodimerols, trichodermatides and sorbicillinoids (Reino, Guerrero et al. 2008, Sun, Tian et al. 2008, Andrade, Ayer et al. 1992, Andrade, Ayer et al. 1996). An extensive search for PKS-, NRPS- and hybrid synthetase genes using basic local alignment search tool (BLAST) searches (http://genome.jgi- psf.org/pages/blast.jsf?db=Trire2) revealed presence of 11 PKS-, 11 NRPS- and four hybrid synthetase genes in the T. reesei genome (Table 3.7), which could be appointed to 23 distinct gene clusters. In contrast Mukherjee and co-workers reported presence of 11 PKS-, ten NRPS- and two hybrid synthetase genes in T. reesei (Mukherjee, Horwitz et al. 2012), reflecting differences in interpretation of when a gene is indeed a PKS-, NRPS- or a hybrid synthetase gene. Surprisingly, the number of identified synthase genes in T. reesei is significantly lower than observed for other sequenced filamentous fungi, even for closely related species. The Trichoderma virens genome has for example been reported to contain 18 PKS-, 28 NRPS- and four hybrid synthetase genes while the Trichoderma atroviride genome contain 18 PKS-, 16 NRPS- and one hybrid synthetase gene and the A. nidulans genome contains as much as 27 PKS-, 14 NRPS- and one hybrid synthetase gene (Galagan, Calvo et al. 2005, Bergmann, Schumann et al. 2007, Mukherjee, Horwitz et al. 2012). As discussed for other filamentous fungi in section 3.1.7, it is apparent that the number of identified synthase genes in the T. reesei genome also far exceeds the number of reported PK and NRP SMs, indicating that most of the SM gene clusters are silent at the applied conditions. While some T. reesei SMs have been described and all the PKS and NRPS genes in the T. reesei genome have been identified, a linkage still has not been established between
50
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen these. Based on in silico analysis it has though been speculated that the paracelsins are synthesized by the T. reesei gene with JGI ID number 23171 (Neuhof, Dieckmann et al. 2007), but it has not yet been verified by experiments. Furthermore, a gene cluster with very high similarity to the A. fumigatus gliotoxin gene cluster has been observed in the T. reesei genome (includes the NRPS gene with JGI ID number 24586) (Mukherjee, Horwitz et al. 2012). Production of gliotoxin has though not been reported for T. reesei and the smaller size of the cluster in T. reesei, compared to gliotoxin producing strains, indicates that this could be due to a deletion. The limited amount of knowledge currently obtained for T. reesei SM biosynthesis, constituted a unique starting point for this project. Luckily, the development of molecular tools for T. reesei is now at a stage that allows for more insight into the complex SM biosynthesis of this species.
51
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
Table 3.7. All PKS-, NRPS- and hybrid synthetase genes in the T. reesei genome identified by BLAST in this study. The nearest protein BLAST result obtained with the NCBI BLAST tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi) is included for all synthases. It is important to note that the BLAST results only give an indication of the protein products, due to the limited number of synthase proteins that have been linked to the corresponding metabolite products. Several of the proteins therefore have the same closest annotated hit due to few annotations in the database. BLAST results JGI ID Type Predicted protein domains Located in (cluster) Gene Size (kb) Nearest annotated hit Accession number Max identity 59482 PKS KS-AT-DH-ER-KR-ACP 1 7,042 Lovastatin nonaketide synthase XP_003710466.1 42% 60118 PKS KS-AT-DH-MT-ER-KR-ACP 2 7,889 Lovastatin nonaketide synthase XP_003710466.1 37% 65116 PKS KS-AT-DH-PT-ER-KR-ACP 3 7,608 Mycocerosic acid synthase XP_003712315.1 40% 65172 PKS KS-AT-DH-MT-ER-KR-ACP 4 8,305 Acetolactate synthase EEH44268.1 46% 65891 PKS KS-AT-DH-ER-KR-ACP 5 7,640 Phenolpthiocerol synthase EGY19840.1 41% 81964 PKS SAT-KS-AT-PT-ACP 6 5,911 Conidial yellow pigment synthase XP_002848092.1 48% 82208 PKS SAT-KS-AT-PT-ACP-TE 7 6,952 Conidial pigment synthase (Alb1) EFY88620.1 77% 106272 PKS KS-AT-DH-MT-ER-KR-ACP 8 8,996 Phenolpthiocerol synthase XP_001934016.1 35% 4117 NRPS A-T-R 9 3,774 Alpha aminoadipic acid reductase EGR48264.1 100%* 24586 NRPS A-T-C-A-T-C-T 10 6,728 Gliotoxin synthase (GliP) XP_750855.1 40% 60458 NRPS A-T-C-A-T-C-T 11 6,666 Sirodesmin synthase (SirP) AAS92545.1 34% 60751 NRPS A-T-C 12 2,720 HC-toxin synthetase XP_001932133.1 45% 67189 NRPS A-T-C-T-C 13 5,442 Surfactin synthetase EGY22526.1 58% 68204 NRPS A-Ox 14 3,567 Gramicidin S synthetase XP_003004664.1 59% 69946 NRPS A-T-C-A-T-C-T-C-A-T-C-T-C-T-C 15 14,771 Gramicidin S synthetase XP_003719607.1 44% 71005 NRPS A-T-C-A-T-C 16 5,769 Surfactin synthetase EGY22526.1 44% 71072 NRPS A-T-R-K 17 3,855 Male sterility protein CCF37266.1 58% 81014 NRPS A-T-R-SDR 18 3,909 Enterobactin synthetase EGY19303.1 73% 23171 Hybrid KS-AT-ACP-(C-A-T)×18-R 19 69,518 Syringopeptin synthetase AAO72425.1 26% 58285 Hybrid KS-AT-DH-MT-KR-ACP-C-A-T-R 20 12,156 Fusaproliferin synthase AFP73394.1 37% 123786 Hybrid KS-AT-ACP-(C-A-T)×14-R 21 50,787 Syringopeptin synthetase AAO72425.1 32% 73618 PKS KS-AT-DH-MT-ER-KR-ACP 22 8,117 Lovastatin nonaketide synthase XP_001942484.1 36% 73621 PKS SAT-KS-AT-PT-ACP-MT-TE 22 8,083 Citrinin synthase EJB11047.1 44% 105804 PKS SAT-KS-AT-PT-ACP-TE 23 6,782 6-methylsalicylic acid synthase XP_001937752.1 46% 59690 NRPS A-T-R 23 3,309 Gluconate kinase CCF32373.1 50% 59315 Hybrid KS-AT-DH-MT-KR-ACP-C-A-T-R 23 11,824 Fusaproliferin synthase AFP73394.1 53% Abbreviations: A, Adenylation; ACP, Acyl carrier protein; C, Condensation; DH, Dehydratase; ER, Enoyl reductase; KR, b-Keto reductase; KS, b-Keto synthase; MT, Methyltransferase; Ox, Oxidase; PT, Product template; R, Thioester reductase; SAT, Starter unit acyl-carrier protein transacylase; SDR, Short-chain dehydrogenase/reductase; T, Thiolase; TE, Thioesterase. *The first annotated gene appearing in the BLAST results is the T. reesei gene of interest.
52
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Introduction Mikael Skaanning Jørgensen
Chapter II includes two manuscripts.
Manuscript II (section 3.2), describes an overexpression study of T. reesei PKS and NRPS cluster specific transcription factors using the expression system presented in Manuscript I (section 2.2).
Manuscript III (section 3.3), describes a heterologous expression study of T. reesei PKS-, NRPS- and hybrid synthetase genes in A. nidulans.
53
54
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen
3.2. Manuscript II
Identification of the Sorbicillinoid Synthase Gene Cluster in Trichoderma reesei (Teleomorph Hypocrea jecorina) by Overexpression of PKS- and NRPS Gene Cluster Specific Transcription Factors
Mikael Skaanning Jørgensen1, Kristian Fog Nielsen1, Dominique Aubert Skovlund2, Pia Francke Johannesen2, Uffe Hasbro Mortensen1*
1Center for Microbial Biotechnology, Department of Systems Biology, Technical University of Denmark, Building 223, DK-2800 Lyngby, Denmark. 2Novozymes A/S, kroghoejsvej 36, 2880 Bagsvaerd Denmark.
* Corresponding author. Uffe H. Mortensen, Technical University of Denmark, Department of Systems Biology, Center for Microbial Biotechnology, Building 223, 2800 Kgs. Lyngby, Denmark. Phone: +45 45252701. Fax: +45 45884148. E-mail: [email protected]
Abstract
Filamentous fungi constitute one of the most important sources of new drug candidates through their ability to produce a plethora of natural products referred to as secondary metabolites (SMs). Despite the ever increasing amount of available sequence data and extensive research, linkage between SM genes and corresponding metabolite products are not easily established due to the complexity of the synthase machinery. To establish such links, the genome of the industrially important filamentous fungus Trichoderma reesei were mined for transcription factor (TF) genes associated with polyketide- (PKS) and non-ribosomal peptide synthetase (NRPS) gene clusters. Thirty such TF genes were identified and 11 selected for overexpression studies using the Aspergillus nidulans PgpdA promoter. Interestingly, metabolite profiling showed that overexpression of the gene encoding one of the TFs which was named SorD, led to over-production of at least 78 different metabolites. Biosynthesis of all the new metabolites required presence of two PKS synthase genes, sorA and sorB, located adjacent to sorD. Several of the over- produced metabolites could be appointed to a class of polyketides (PKs) referred to as sorbicillinoids, hence for the first time linking these metabolites to specific PKSs. Comparative genomics were subsequently used to identify a highly similar gene cluster in another well-known sorbicillinoid producer, Penicillium chrysogenum. All sorbicillinoids identified so far have been derived from hexaketides. It is therefore surprising that the pentaketide trichopyrone was also found to be dependent on sorA- B, and -D, hence, adding to the complexity of the biochemistry of this class of compounds. The wide range of metabolites produced by T. reesei by overexpression of just a single TF gene provides an interesting source of possible new drug candidates.
Keywords
Sorbicillinoids, polyketides, non-ribosomal peptides, transcription factors, Trichoderma reesei, Penicillium chrysogenum, secondary metabolites, trichopyrone.
55
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen
Introduction
Fungi produce a multitude of SMs with high bioactivity which are not essential for survival of the producer, but are believed to provide competitive advantages by providing e.g. signalling capabilities, defense systems against other microbes and protection against UV-radiation (Osbourn 2010, Chiang, Chang et al. 2011, Keller, Turner et al. 2005). A literature survey showed that 42% out of the 23,000 bioactive natural products investigated were of fungal origin; clearly underlining fungi as an important source for small molecular weight metabolites (Brakhage, Schroeckh 2011). The tremendous interest for these bioactive compounds is mainly driven by their importance as pharmaceuticals in both human and veterinarian medicine, which is supported by the fact that 48.6% of new drugs used for cancer treatment introduced from the 1940s to present, are natural products or their derivates (Newman, Cragg 2012). PKs and NRPs are two important classes of SMs produced by fungi and compounds from both classes are used, either directly or in a modified form, as important pharmaceuticals with activities such as antibiotic, antiviral, anti-hypercholesterolaemic, tumor inhibiting and immunosuppressing (Brakhage 1998, Keller, Turner et al. 2005). Importantly, the ever growing available fungal sequence data reveal that most of these PKS and NRPS genes are silent at standard laboratory conditions since the SMs identified far from coincides with the number of identified synthase clusters (Chiang, Oakley et al. 2010, Chiang, Szewczyk et al. 2008, Mukherjee, Horwitz et al. 2012). This strongly suggests that the fungal reservoir of SMs as a source of new drugs is far from being fully exploited. It is well-known that genes encoding different steps in a specific biosynthetic pathway for production of SMs are often clustered. Hence, by identifying a gene encoding a PKS or a NRPS, accompanying genes encoding tailoring enzymes or TFs that are important for the regulation of the cluster can often be identified by examination of the regions flanking the synthase genes (Khaldi, Wolfe 2011, Chiang, Szewczyk et al. 2009). This fact facilitates clarification of the individual biochemical steps from the intermediate released from the synthase to the final product(s) of the pathway. Presently, the most common strategy towards elucidating the metabolite products of orphan biosynthetic gene clusters is therefore to delete synthase- and tailoring enzyme genes followed by metabolite profiling of the resulting mutant strains (Chiang, Szewczyk et al. 2008). Moreover, several approaches have been developed to activate clusters that are silent at standard laboratory conditions. These include manipulation of genetic silencers or activators such as the pleiotropic regulator LaeA, other chromatin/histone modulators or cluster specific TFs (Chiang, Lee et al. 2009). The applicability of the latter has been demonstrated by Bergmann and co-workers that identified the asperfuranone- and aspyridone gene clusters by overexpressing cluster specific TF genes (Bergmann, Schumann et al. 2007, Bergmann, Funk et al. 2010). The filamentous fungus T. reesei is a key organism for industrial scale production of enzymes used for saccharification of cellulosic plant material. Its highly efficient enzyme synthesis and secretory machineries are capable of delivering protein yields in excess of 100 g/l to the media (Saloheimo, Pakula 2012). Perhaps it could also act as an equally efficient producer of SMs. Elucidation of the metabolic potential of T. reesei is therefore important since interesting new drug candidates might be identified in this process. The T. reesei genome has recently been sequenced, providing the necessary foundation for an investigation of its metabolic potential through directed genetic engineering (Martinez, Berka et al. 2008).
56
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen
Only a limited number of SMs has presently been described for T. reesei. These include paracelsin A-D belonging to a group of NRPs referred to as peptaibols, trichodermin belonging to the terpenes, and the PK derived metabolite groups trichodimerols, trichodermatides and sorbicillinoids (Reino, Guerrero et al. 2008, Sun, Tian et al. 2008, Andrade, Ayer et al. 1992, Andrade, Ayer et al. 1996). While production of SMs by T. reesei has been described to some extent, no SMs have so far been linked experimentally to their corresponding genes. Recently, genetic tools have been developed for T. reesei, allowing genetic dissections of SM pathways ((Guangtao, Hartl et al. 2009, Hartl, Seiboth 2005, Schuster, Bruno et al. 2012) and Manuscript I). Taking advantage of these tools, we here report successful identification of the gene cluster responsible for biosynthesis of sorbicillinoids in T. reesei QM6a by screening mutants overexpressing PKS and NRPS gene cluster specific TF genes.
57
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen
Materials and Methods
PKS and NRPS genes and cluster specific TF genes T. reesei sequence data published on the JGI genome portal (http://genome.jgi- psf.org/Trire2/Trire2.home.html) was mined for all PKS and NRPS genes and revealed presence of 26 PKS-, NRPS- and hybrid synthetase genes that were divided into 23 clusters based on their location in the T. reesei genome (Table 1). All predicted TF genes in a 50 kb radius of the synthase genes were searched for and revealed a total of 30 TF genes within this radius. Out of these TF genes 11, from eight different clusters, were selected for overexpression and amplified with the primers seen in Table S1 for insertion into overexpression constructs.
Table 1. Overview of all T. reesei PKS and NRPS genes and clusters and the TF genes within a 50 kb radius of the synthase genes Cluster Synthase Synthase TF JGI ID Distance between TF and JGI ID type nearest synthase gene (kb) 1 59482 PKS 121164 25.6 2 60118 PKS - - 3 65116 PKS - - 4 65172 PKS 122783 4.3 65070 11.0 79725 14.1 109230 15.0 26871 18.5 5 65891 PKS - - 6 81964 PKS 111742 2.5 7 82208 PKS 112129 49.0 8 106272 PKS 121310 28.0 106259 31.7 9 4117 NRPS 107858 18.2 10 24586 NRPS 103122 6.6 11 60458 NRPS 47479 9.0 106677 32.4 106706 31.8 12 60751 NRPS - - 13 67189 NRPS - - 14 68204 NRPS 111088 3.2 15 69946 NRPS 69972 8.0 16 71005 NRPS 112560 20.0 17 71072 NRPS 71080 2.9 18 81014 NRPS 123445 10.7 110689 32.0 19 23171 Hybrid 68254 18.2 20 58285 Hybrid 72993 11.6 21 123786 Hybrid 111408 31.4 22 73618 PKS 102497 5.0 73621 PKS 102499 9.0 23 105804 PKS 105805 2.7 59690* NRPS 105784 9.9 59315 Hybrid 121121 18.5 121130 44.2
Strains and plasmids All plasmidic constructs were assembled by restriction enzyme and ligase independent uracil-excision cloning that enables cloning by construction of PCR fragments with large custom designed overhangs and plasmids carrying specific restriction cassettes for easy insertion of amplicons (Hansen, Salomonsen et al. 2011, Geu-Flores, Nour-Eldin et al. 2007). PCR fragments were purified from agarose gel using the GFX kit (GE healthcare, Little Chalfont, United Kingdom) and eluted in 50 µl milli-Q water prior to cloning. Chemically competent Fusion-Blue E. coli cells (Clontech, Mountain view, USA) were used to maintain all plasmid constructs.
58
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen
Two plasmids were used to introduce and overexpress the selected TF genes by fusing the amplified TF genes to the constitutive A. nidulans PgpdA promoter. The pMJ-040 plasmid carries two different restriction cassettes for insertion of PCR fragments, PacI/Nt.BbvCI and AsiSI/Nb.BtsI, and allows for co-overexpression of two TF genes in connection with PgpdA promoters. The pMJ-023 construct (Manuscript I) only carry the AsiSI/Nb.BtsI cassette and hence one copy of the PgpdA promoter. The method for insertion of the amplified TF genes is demonstrated in Figure 1 for pMJ-040. Two pairs of TF genes were selected for co-overexpression in pMJ-040; these originated from cluster 22 and from cluster 23. They were both co-overexpressed and overexpressed alone.
PacI Nt.BbvCI AsiSI Nb.BtsI FLA TtrpC GCTGAGGTCTTAATTAATGCCTCAGC PgpdA R pyr2 R PgpdA GCAGTGAGAGCGATCGCAGACACTGC TtrpC FLB pMJ-040 CGACTCCAGAATTAATTACGGAGTCG CGTCACTCTCGCTAGCGTCTGTGACG Nt.BbvCI Nb.BtsI
Digestion (PacI/Nt.BbvCI)
T C T G C G A U ATTAATGCC AGACGCTT TF1 GTA UAATTAC GG
TAATGCC Uracil-excision GCTGAGGTCTTAAT enzyme treatment GGTCTTAA CGACT TCAGC U TAATTACGGAGTCG ATTAATGCC CCAGAATTA TF1 GTA CCAGAAT U AATTACGG
Vector preparation PCR product preparation
Incubation and E. coli transformation
AsiSI Nb.BtsI FLA TtrpC TF1 PgpdA R pyr2 R PgpdA GCAGTGAGAGCGATCGCAGACACTGC TtrpC FLB pMJ-040 + TF1 GTA CGTCACTCTCGCTAGCGTCTGTGACG Nb.BtsI
Digestion (AsiSI/Nb.BtsI) AGAGC G A U ATG ATCGCAGA TCTCGCTA TF2 UAGCGTCT
Uracil-excision CGCAGA enzyme treatment GCAGTGAGAGCGAT CGTCAC CACTGC AGAGCGA U TAGCGTCTGTGACG ATG ATCGCAGA TCTCGC TCTCGCTA TF2 U AGCGTCT
PCR product preparation Vector preparation
Incubation and E. coli transformation
FLA TtrpC TF1 PgpdA R pyr2 R PgpdA ATG TF2 TtrpC FLB pMJ-040 + TF1 + TF2 GTA
Figure 1. Insertion of TF genes into the pMJ-040 overexpression construct by uracil-excision cloning. The construct without genes inserted (pMJ-040) carry two restriction cassettes used for insertion, one with PacI- and Nt.BbvCI sites and one with AsiSI- and Nb.BtsI sites. Primers targeting the selected TF genes have a uracil incorporated which is excised when treated with uracil-excision enzyme mix (mixture of uracil DNA glycosylase and DNA glycosylase-lyase Endo VIII). Treatment leads to dissociation of the terminal oligonucleotides and reveal overhangs complimentary to the overhangs obtained by digestion of the overexpression construct. The length of the overhangs render use of ligase and PCR product treated with uracil-excision enzyme mix and digested vector can be transformed directly after incubation. The first TF gene is introduced into the PacI and Nt.BbvCI site and the resulting construct utilized for overexpression of this TF gene alone. The second TF gene is introduced into this construct by digestion with AsiSI and Nb.BtsI and uracil-excision cloning, resulting in a construct for co-overexpression of both TF genes. The constructs include flanks targeting for insertion into adeB (FLA and FLB).
59
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen
Both pMJ-040 and pMJ-023 carry 1.5 kb flanks homologous to the upstream and downstream regions of adeB (FLA and FLB) and allow for easy selection of correct integrated mutants since a red pigment will accumulate in the transformants in which adeB has been replaced by the overexpression fragment. The constructs furthermore carry pyr2 as selectable marker enabling restoration of uracil prototrophy in the pyr2 deleted MJ-T-006 strain used as recipient (Manuscript I). The pyr2 gene is flanked by 375 bp direct repeats that can facilitate loop out of the selective marker and selected for by subjection to 5-Fluorootic acid (5-FOA), reverting it to uracil autotrophy. Successive genetic alterations can thereby be introduced using only pyr2 as selectable marker. The pMJ-040 plasmid was assembled by introducing two PCR fragments into a PacI/NT.BbvCI cassette in pMJ-023 located between the adeB flank FLA and the pyr2 selective marker, by uracil-excision cloning. One of the fragments carried a copy of the PgpdA promoter and the other carried a copy of the TtrpC terminator. The primer tails of the PCR fragments for uracil-excision cloning were designed to position the new promoter and terminator copy in opposite direction of the already present copy and to introduce a PacI/Nt.BbvCI cassette in between these for easy integration of a TF gene. The primers used for amplification of PgpdA were primer pair PgpdA-PacI-fw/rv and the primers used for amplification of TtrpC were primer pair TtrpC-PacI-fw/rv. All primers utilized in this study, except the ones used to amplify the TF genes, can be seen in Table S2. A total number of 13 overexpression constructs were obtained, 11 carrying a single TF gene and two carrying two TF genes for co-overexpression. The 13 constructs were transformed into the MJ-T-006 recipient strain resulting in isolation of 13 TF gene overexpression strains. All strains included in this study can be seen in Table 2.
Table 2. Strains fabricated in this study. All strains are decedents of MJ-T-006 described in manuscript I which is tku70-::amdS+ ∆pyr2. Transformed with/ Strain Parent strain Genotype (in addition to tku70-::amdS+ ∆pyr2) pyr2 looped MJ-T-016 pMJ-033 MJ-T-006 ΔadeB::PgpdA::103122 pyr2+ MJ-T-017 pMJ-037 MJ-T-006 ΔadeB::PgpdA::47479 pyr2+ MJ-T-018 pMJ-038 MJ-T-006 ΔadeB::PgpdA::68254 pyr2+ MJ-T-019 pMJ-039 MJ-T-006 ΔadeB::PgpdA::69972 pyr2+ MJ-T-020 pMJ-023 MJ-T-006 ΔadeB::PgpdA pyr2+ MJ-T-027 pMJ-024 MJ-T-006 ΔadeB::PgpdA::105805 pyr2+ MJ-T-028 pMJ-035 MJ-T-006 ΔadeB::PgpdA::111088 pyr2+ MJ-T-029 pMJ-036 MJ-T-006 ΔadeB::PgpdA::111742 pyr2+ MJ-T-030 pMJ-041 MJ-T-006 ΔadeB::PgpdA::102497 pyr2+ MJ-T-031 pMJ-042 MJ-T-006 ΔadeB::PgpdA::102499 pyr2+ MJ-T-032 pMJ-053 MJ-T-006 ΔadeB::PgpdA::102497/102499 pyr2+ MJ-T-035 pMJ-034 MJ-T-006 ΔadeB::PgpdA::105784 pyr2+ MJ-T-036 pMJ-043 MJ-T-006 ΔadeB::PgpdA::106677 pyr2+ MJ-T-037 pMJ-054 MJ-T-006 ΔadeB::PgpdA::105784/105805 pyr2+ MJ-T-039 Looped MJ-T-031 ΔadeB::PgpdA::102499 Δpyr2 MJ-T-040 Looped MJ-T-032 ΔadeB::PgpdA::102497/102499 Δpyr2 MJ-T-043 pMJ-069 MJ-T-039 ΔadeB::PgpdA::102499 Δpyr2 Δ73618/73621 pyr2+ MJ-T-044 pMJ-067 MJ-T-040 ΔadeB::PgpdA::102497/102499 Δpyr2 Δ73618 pyr2+ MJ-T-045 pMJ-068 MJ-T-040 ΔadeB::PgpdA::102497/102499 Δpyr2 Δ73621 pyr2+
Three constructs, obtained by uracil-excision cloning, was used for deletion/disruption of the two PKS genes identified in the sorbicillinoid gene cluster (JGI ID: 73618 and 73621). The MJ-T-031 and MJ-T-032 strains overexpressing a sorbicillinoid gene cluster specific TF gene (JGI ID: 102499) were used for deletion or disruption of the PKS genes. The deletion/disruption constructs utilized pyr2 as selective marker and loop out of the pyr2 gene present in connection with the introduced overexpression fragment was performed
60
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen prior to deletion/disruption. Loop out was confirmed by PCR using primer pair pyr2-rep1- fw/rv. The loop out strains of MJ-T-031 and MJ-T-032 was named MJ-T-039 and MJ-T- 040, respectively. The primers used to amplify 1.5 kb PKS gene flanks, for disruption by homologous integration, can be seen in Table S2. The vector fragment for the deletion constructs was amplified from pMJ-023 using the primer pair vector-fw/rv and the pyr2 fragment, flanked by 375 bp direct repeats, were amplified from pMJ-023 using primer pair pyr2-rep1-fw/rv. When assembled, the pyr2 fragment and direct repeats, was flanked by sequences homologous to the PKS gene flanks. The close proximity of the two PKS genes, facing in opposite directions in the cluster, made full deletion of a single PKS gene expedient since it could affect expression of the remaining PKS gene. The flanks for homologous integration were therefore designed so that approximately 2300 bp of the promoter sequence would still be present for the remaining PKS gene, while the majority of the other gene was deleted. A construct for simultaneous deletion of both genes included the two outermost flanks used for disruption of the two PKS genes. Construct pMJ-067 was obtained for disruption of 73618 in MJ-T-040, resulting in MJ-T-044; pMJ- 068 for disruption of 73621 in MJ-T-040 resulting in MJ-T-045 and pMJ-069 for deleting both 73618 and 73621 in MJ-T-039, resulting in MJ-T-043. A phylogenetic three of these strains can be seen in Figure S1.
Culture conditions Two basic compositions of selective media were used for T. reesei, one for primary selective plates, with sucrose as carbon source and osmotic stabilizer (MM1), and one for secondary selective plates with mannitol as carbon source (MM2) as described in Manuscript I. For loop out of the pyr2 selective marker, restoring the uracil auxotrophy, MM2 plates were supplemented with 1.5 mg/ml 5-FOA and 10 mM uridine. Potato dextrose agar (PDA) (Oxoid, Hampshire, United Kingdom) was used for all non-selective solid cultivations. All incubations on solid media were for five days at 28°C. Liquid cultivations were in YPD media consisting of 1% Yeast extract (BD Difco, Franklin Lakes, USA), 2% Peptone bacto (BD Difco, Franklin Lakes, USA) and supplemented with 2% glucose. All liquid cultivations were with 10 ml YPD at 30°C and 200 rpm agitation; there was incubated for 24 hours to obtain biomass for purification of genomic DNA and for 96 hours to obtain supernatant for UHPLC-DAD-TOFMS analysis.
T. reesei transformation and loop out. Protoplastings and transformations of T. reesei were performed as described by Gruber et al. with minor modifications (Gruber, Visser et al. 1990). All plasmid constructs were linearized by NotI to release the fragment for insertion from the vector backbone exposing the flanks targeting for homologous integration prior to transformation. Digestions were set up with approximately 30 µg DNA in 200 µl restriction enzyme reactions, there was precipitated with isopropanol, washed with 70% ethanol and eluted in 30 µl Milli-Q whereof 10 µl was used for each transformation. Correct homologous integration was verified by diagnostic PCRs with the primers seen in Table S2. Loop out of the pyr2 selective gene by homologous recombination between the direct repeats flanking the gene was achieved by plating 108 spores on selective plates supplemented with 5-FOA. There was incubated for five days on MM1 where after colonies were transferred to MM2 plates for another five days of incubation. After this, the fastest growing loop out mutants were transferred to non-selective plates.
61
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen
Genomic DNA purification and Southern blot analysis DNA extractions were performed using solutions from the MasterPure™ Yeast DNA purification kit (Epicentre Biotechnologies, Madison, USA) using a modified approach (Manuscript I). All DNA purifications utilized for Southern blot were digested for at least 18 hours using the restriction endonuclease BsrGI. A 510 bp p32 labelled probe targeting a portion of the pyr2 coding sequence (CDS) was amplified using the primers: pyr2prob- fw (5’-TCCCAGCTGCCTGCCTACAA-3’) and pyr2prob-rv (5’-GAGCTTCTCCATGCGGTCCA- 3’) and used for the Southern blot as described in Manuscript I.
Metabolite extraction from supernatant The metabolite extractions were performed using strata-X polymeric reversed phase columns (part number: 00M-S033-B0-CB, Phenomenex, Torrance, USA). The columns were primed with two ml methanol followed up by one ml 2% formic acid (98% analytical grade, Sigma-Aldrich, St. Louis, USA). The sample was added to the column by transferring 500 µl of the growth media supernatant, mixing with 20 µl undiluted 98% formic acid and adding another 500 µl of the supernatant. The sample was run through the column by gravity flow and another 2 x 500 µl of the supernatant added as described above so that a total of two ml of the samples were run through each of the columns. The metabolites were eluted by adding 2 x 300 µl methanol before UHPLC-DAD-TOFMS.
UHPLC-DAD-TOFMS Extracts (0.1-2µl) were analyzed by UHPLC-DAD-TOF method on a Dionex Ultimate 3000 UHPLC system equipped with a 100 x 2.0 mm, 2.6 µm, Kinetex C-18 column, held at a temperature of 40°C and using a linear gradient system composed of A: 20 mM formic acid in water, and B: 20 mM formic acid in acetonitrile. The flow vas 0.4 ml/min: starting with 10% B which was increased to 100% B in 0-10 min, and held there for three min. Time-of-flight detection (TOF) were made using a MaXis 3G QTOF (Bruker Daltonics, Bremen, Germany), operated at a resolving power of 40.000 FWHM and a typical mass accuracy <1.5 ppm. The MS was equipped with an electrospray ionization source and samples were analysed by both negative and positive polarity, in both cases scanning m/z 100–1000. For calibration, a mass spectrum of Sodium formate (5 mM) was recorded at the beginning of each chromatogram using the divert valve (0.3-0.4 min). MS-TOFMS experiments were conducted as targeted MS/MS using four potentials, either 15, 25, 35 and 55 eV or 18, 30, 45 and 65 eV; an isolation width of m/z 4 was used to obtain a true isotope pattern of the fragment ions. MS/MS were set up for fifteen m/z values: 193, 249, 251, 265, 377, 441, 481, 497, 499, 513, 560, 692, 708, 710 and 808.
UHPLC-DAD-TOFMS data analysis All UHPLC-DAD-TOFMS data were calibrated using Compas TargetAnalysis 1.2 (Bruker Daltonics, Bremen, Germany) and the most prevalent metabolites automatically compared to a database of known metabolites produced by T. reesei and closely related species. The calibrated data was loaded in to Compas DataAnalysis 4.0 (Bruker Daltonics, Bremen, Germany) for more thorough data analysis, visualization of chromatograms and comparison of the signal intensities obtained through extracted ion chromatograms (EICs). The best predicted stoichiometric formula of the metabolites of interest were estimated by the in-build function “SmartFormula manually” using data from at least three different independent samples. To compare the metabolites with high abundance in the TF gene overexpression strains with sorbicillinoids, the database visualizer ACD/Chemfolder 12.02 (Advanced Chemistry
62
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen
Development, Inc., Toronto, Canada) was used to mine the antibase 2010 database for all previously identified sorbicillinoid metabolites (Nielsen, Mansson et al. 2011).
Sorbicillinoid gene clusters The predicted amino acid sequences of proteins from genes in vicinity of the TF gene 102499 were BLASTed using the NCBI BLAST search tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi). A highly similar gene cluster was identified in the well-known sorbicillinoid producer Penicillium chrysogenum and the BLAST data used to predict the extent of the two PKS clusters. The amino acid sequences of the predicted proteins were obtained from the Joint Genome Institute (JGI) Genome Portal for both T. reesei (http://genome.jgi-psf.org/Trire2/Trire2.home.html) and P. chrysogenum (http://genome.jgi.doe.gov/Pench1/Pench1.home.html). The amino acid sequences were loaded into AlignX (a component of Vector NTI Advance 11.0, Invitrogen, Carlsbad, USA) for sequence alignment and to investigate the consensus and identity percentage for the similar proteins.
PKS domain identification Identification of the domains of the two PKS genes 73618 and 73621 was done by using the NCBI Conserved Domain Database (CDD) (http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml) and by aligning the amino acid sequences of the two proteins with other well-characterized PKSs.
Results
To initiate linkage of gene clusters in T. reesei to their corresponding metabolites, we decided to use the strategy developed by Bergman et al. (Bergmann, Schumann et al. 2007, Bergmann, Funk et al. 2010), who demonstrated that it is possible to activate silent gene clusters containing a TF gene by controlled expression of these genes. Accordingly, we examined the genome of T. reesei for TF genes potentially located in PKS or NRPS gene clusters. This analysis uncovered 30 different TF located near the 23 PKS and/or NRPS gene clusters. Eleven of these TF genes possibly located in eight different gene clusters were selected for the further work. Next, these TF genes were individually inserted into an ectopic locus using an expression platform that we had previously developed (Manuscript I). Three of the PKS and/or NRPS clusters contained two or more TF genes. In such cases it is possible that activation of the cluster depends on the presence of more than one of the TFs. We therefore made two additional mutants where TF gene pairs, originating from the same clusters, were simultaneously inserted into our ectopic expression site for constitutive expression facilitated by the A. nidulans PgpdA promoter. In summary 13 strains were constructed which potentially could produce new metabolites.
Overexpression of one of the TF genes affects the metabolite profile Metabolites were extracted from fermentation broth of the 13 strains and sampled for UHPLC-DAD-TOFMS analysis. Only two of the overexpression strains (MJ-T-031 and MJ- T-032) had significant change in the metabolite profile as compared to a reference strain (Figure 2). Both strains overexpressed the same gene (JGI ID: 102499), which is predicted to encode a Zn(II)2Cys6-type TF, and which is located in cluster 23. In MJ-T- 031 it was overexpressed alone and in MJ-T-032 it was overexpressed together with the other TF gene in the cluster, JGI ID: 102497. Specifically, the UHPLC chromatograms from these two strains contained >30 new metabolite peaks. Since no new metabolites
63
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen were detected with the strain overexpressing 102497 alone, we conclude that the novel metabolites were solely dependent on the TF encoded by 102499. Among the new peaks, some contained several metabolites, and further analysis, using the Compass DataAnalysis 4.0 software, revealed that metabolites with at least 54 different predicted stoichiometric formulas were over-synthesized (Table 3). Furthermore, several retention times were observed for 18 of the different masses, hence, indicating that these include compounds with different configuration. In total, we detected 78 different metabolites.
MJ-T-020
MJ-T-030
MJ-T-031
MJ-T-032 26 7 18
25 5 26 1 28 15 6 224 23 7 23 29 11 13 24 14 4 22 10 30 16 9 3 12 11 17 8 5 2 7 2319 20 27 21
Figure 2. Chromatograms for a control strain and strains overexpressing the 102497 and 102499 TF genes. MJ-T-020 is the control strain with the empty expression construct inserted; MJ-T-030 overexpress TF gene 102497, MJ-T-031 overexpress TF gene 102499 and MJ-T-032 overexpress both TF genes 102497 and 102499. It is seen that overexpression of 102497 alone do not result in any change of the metabolite profile while the metabolite profiles of the two strains overexpressing 102499 reveal many new peaks. The numbers depicts new peaks emerging when 102499 is overexpressed. The main metabolite for each peak can be seen in Table 3.
64
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen
Table 3. Overview of the metabolites with higher prevalence in the 102499 overexpression strains. The “peak number” depicts the corresponding metabolite peak seen in Figure 2. The signal intensities for the EICs are included for MJ-T-020, MJ-T-031 and MJ-T-039. Predicted Possible MS/MS Signal Signal Signal Monoisotopic Retention Known Peak Stoichiometric Possible metabolite(s) dimer/trimer MJ-T-020 MJ-T-031 MJ-T-039 Mass (Da) Time (min) sorbicillinoid number C5H7 Subunit III formula Subunit(s) missing fragment (10^X) (10^X) (10^X)
192.07863 5.008 C11H12O3 Trichopyrone No I 1 Yes No 4 6 ND 206.09428 5.600 C12H14O3 - - - 2 - - ND 5 ND 208.10993 5.496 C12H16O3 ------ND 5 ND 219.12592 2.371 C13H17NO2 ------ND 5 ND 220.10993 7.161 C13H16O3 Sohirnone A Yes - - - - ND 4 ND 232.10993 3.756 C14H16O3 Sorbicillin Yes II - - - ND 5 ND 248.10485 4.845, 5.067 C14H16O4 Sorbicillinol Yes III 3 Yes Yes ND 5 ND Sohirnone B Yes 250.12049 4.845 C14H18O4 Vertinolide Yes IV 4 Yes No 3 5 ND Sohirnone C Yes 264.09976 4.393 C14H16O5 Sorbimycin Yes V 5 Yes No ND 6 ND Oxosorbicillinol Yes Epoxysorbicillinol Yes 266.11541 3.867, 4.148, 5.045 C14H18O5 5-hydroxyvertinolide Yes VI - - - ND 5 ND 289.16778 4.571, 4.696 C17H23NO3 ------ND 5 ND 292.13106 5.993 C16H20O5 ------ND 5 ND 303.18343 5.134 C18H25NO3 ------ND 5 ND 311.12698 4.422, 5.378 C17H17N3O3 - - VII 6 - - 4 6 ND 313.14263 4.185 C17H19N3O3 ------5 5 ND 318.11032 5.119, 5.230 C17H18O6 ------ND 5 ND 323.15213 4.585 C20H21NO3 ------ND 5 ND 337.16778 5.141 C21H23NO3 ------ND 5 ND 358.17801 5.778, 5.904, 6.304 C21H26O5 - - - 7 - - ND 5 ND 370.15285 3.756 C20H22N2O5 - - - 8 - - ND 6 ND 375.17940 3.496 C19H25N3O5 ------ND 5 ND 376.15218* 4.689, 6.059 C20H24O7 Trichodermanone A/B Yes - - Yes Yes ND 5 ND 379.16308 4.600 C19H25NO7 - - - 9 - - ND 5 ND 388.16342 3.800 C20H24N2O6 - - - 10 - - ND 6 ND 394.14162 5.889, 5.978 C23H22O6 ------ND 5 ND 412.15218 6.282, 6.600 C23H24O7 - - - 11 - - ND 6 ND 428.14710 5.489 C23H24O8 - - - 12 - - ND 5 ND 440.18348 8.445 C25H28O7 - - I+III 13 No Yes ND 5 ND 443.16923 4.237, 4.415 C22H25N3O7 - - VIII 14 - - ND 5 ND 447.17940 5.489 C25H25N3O5 ------ND 6 ND + + ND: Not detectable, * [M-CH4O+H] adduct, ** [M-H2O+H] adduct.
65
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen
Table 3. Continued. Predicted Possible MS/MS Signal Signal Signal Monoisotopic Retention Known Peak stoichiometric Possible metabolite(s) dimer/trimer MJ-T-020 MJ-T-031 MJ-T-039 Mass (Da) Time (min) sorbicillinoid number C5H7 Subunit III formula subunits missing fragment (10^X) (10^X) (10^X)
449.19505 5.163, 5.341 C25H27N3O5 ------ND 5 ND 450.17907 5.171, 5.437 C25H26N2O6 - - - 15 - - ND 6 ND 452.19472 4.104 C25H28N2O6 - - - 16 - - ND 5 ND 456.17840 6.771 C25H28O8 - - I+V 17 - - ND 4 ND 459.20053 4.608 C23H29N3O7 ------ND 5 ND 478.19913** 6.904 C28H30O7 496.20970 - - 18 - - ND 6 ND 480.21478 7.252 C28H32O7 Sorbiquinol Yes II+III 19 Yes No 4 5 ND 482.19405 6.408, 7.459 C27H30O8 Demethyltrichodimerol Yes - 20 - - ND 5 ND Demethylbisorbibutenolide Yes ND 5 ND 489.21109 4.363 C24H31N3O8 ------ND 5 ND 496.17331 8.807 C27H28O9 Bisorbibetanone Yes - 21 Yes Yes ND 5 ND Bisorbicillino Yes III+III 22 Yes Yes ND 6 ND 6.385, 6.608, Trichodimerol Yes 496.20970 6.793, 6.904, C28H32O8 Trichotetronine Yes 7.904 Bisorbicillinolide Yes Bislongiquinolide Yes Bisvertinol Yes III+IV 23 No Yes 4 5 ND Bisvertinoquinol Yes 498.22534 7.119, 7.852 C28H34O8 Dihydrotrichodimerol Yes Dihydrotrichotetronine Yes Dihydrobislongiquinolide Yes 504.21076 4.163, 4.608 C25H32N2O9 - - - 24 - - ND 5 ND 512.20461 8.030 C28H32O9 Bisvertinolone Yes III+V 25 No Yes ND 6 ND 514.22026 7.726 C28H34O9 Dihydrobisvertinolone Yes III+VI - - - ND 4 ND 559.23183 5.963, 6.667 C31H33N3O7 - - III+VII 26 Yes Yes ND 6 ND 593.23730 4.882 C31H35N3O9 ------ND 5 ND 656.26212 8.296, 9.430 C38H40O10 - - - 27 - - ND 5 ND 691.27408 6.511 C36H41N3O11 - - III+VIII 28 No Yes ND 5 ND 707.26899 4.045 C36H41N3O12 - - V+VIII 29 No Yes ND 6 ND 709.28464 3.852, 4.022 C36H43N3O12 - - VI+VIII 30 No Yes ND 5 ND 760.30946 9.007 C42H48O13 - - III+III+V - - - ND 4 ND 776.43465 5.393 C42H64O13 ------ND 5 ND 807.33668 7.326 C45H49N3O11 - - III+III+VII - No Yes ND 5 ND + + ND: Not detectable, * [M-CH4O+H] adduct, ** [M-H2O+H] adduct.
66
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen Mikael Skaanning Jørgensen
Identification of the metabolite group synthesized by the overexpression strains Comparison of the predicted stoichiometric formulas for metabolites more prevalent in the overexpression strains with a database of possible T. reesei metabolites revealed that several of these with high probability belonged to the PK derived sorbicillinoids (Harned, Volp 2011). Out of the 54 predicted stoichiometric formulas observed, 15 were consistent with previously described sorbicillinoids (Table 3). Furthermore, the sorbicillinoid origin of four of the metabolites was supported by comparing their UV λmax with previously reports (Table S3). MS/MS conducted for 16 of the 54 metabolite masses observed, showed that at least nine of these experienced a mass loss corresponding to C5H7 consistent with the outermost part of a sorbyl side chain moiety, which is characteristic for sorbicillinoids (Figure 3, Table 3). The sorbicillinoids are polyketide derived metabolites, often with great structural complexity due to the high reactivity of the hexaketides synthesized by the polyketide synthase. Common for most sorbicillinoids is the presence of a sorbicillin skeleton, consisting of a cyclohexanone ring structure and the previously mentioned sorbyl side- chain, which both contribute to the high reactivity of the monomers (Figure 4). Members of this metabolite group are therefore most often observed as more stable dimeric compounds such as trichodimerol, bisorbicillinol, oxosorbiquinol and bisvertinolone; collectively referred to as bisorbicillinoids or as monomers subjected to further oxidation such as oxosorbicillinol and epoxysorbicillinol. These, together with the vertinolides, with a tetronic acid ring structure, comprise the most often observed monomeric sorbicillin derivates (Figure 4). Interestingly, over-production of the pentaketide trichopyrone was also observed in the 102499 overexpressing strains.
Intens. +MS2(265.1067), 15eV, 4.83min #640 x104 C H OH O 5 7 219.1013 265.1067 6 H3C CH3 O O 4 H C OH 3 197.0441 Epoxysorbicillinol 247.0962 2 151.0389 177.0904 191.1063 165.0541 205.0856 127.0391 139.0755 229.0858 0 100 120 140 160 180 200 220 240 260 m/z
Intens. +MS2(499.2332), 18eV, 8.33min #1112 x105 OH O 1.0 251.1281 H3C CH3 499.2332 OH O 0.8 H CH3 HO CH3 0.6 H3C O 249.1135 HO Bisvertinol OH 0.4 H3C 481.2222 0.2 233.1175 133.0865 177.1124 215.2007 371.2286 0.0 100 150 200 250 300 350 400 450 500 m/z Figure 3. MS/MS result examples for the metabolites with monoisotopic masses of 264.09976 Da and 498.22534 Da. The rhombi point out the metabolites for which MS/MS was conducted, the circle a fragment corresponding to the cyclohexanone fragment when C5H7 from the sorbyl side-chain moiety is lost from epoxysorbicillinol, and the triangles fragments corresponding to separated subunits of bisvertinol.
67
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen Mikael Skaanning Jørgensen
OH O O OH H3C OH H3C H3C OH O CH3 CH3 CH O 3 HO O O HO CH3 H3C OH CH3 1. Sorbicillin 3. Oxosorbicillinol 5. 5-hydroxyvertinolide
OH O OH O O H C H C 3 3 H C CH3 CH3 3 O O O O HO CH OH 3 H3C OH H3C 2. Sorbicillinol 4. Epoxysorbicillinol 8. Trichopyrone
H3C O O HO CH3 OH H3C H3C O OH H3C H CH3 O H CH3 HO CH O HO O 3 O OH HO O OH CH3 H C CH3 CH3 3
6. Bisorbicillinol 7. Trichodimerol
Figure 4. Known sorbicillinoids and trichopyrone. The four monomers 1-4 has the classic sorbicillinoid cyclohexanone ring structure and a sorbyl side-chain, while 5 carry the sorbyl side-chain, but has a tetronic acid ring structure. All these monomers are polyketide derived hexaketides. Notice the cyclohexanone ring structures and sorbyl side-chain in the two bisorbicillinoids 6 and 7. The pentaketide trichopyrone 8 are also over-synthesized in the TF gene overexpression strains.
Possible sorbicillinoid dimers and trimers The high reactivity of the sorbicillinoids was supported by the observation that 13 of the metabolite masses from this study seemed to be dimeric or trimeric compounds comprised of smaller over-synthesized metabolites (Table 3). A metabolite with a monoisotopic mass of 248.10485 Da seemed especially reactive since the results showed that it could be a constituent of dimeric or trimeric metabolites with ten different stoichiometric formulas. MS/MS results for seven of the ten indicated that this speculation was correct, since metabolite fragments corresponding to this subunit was observed in these (Table 3). An example can be seen in Figure 3 for bisvertinol, in which both proposed subunits can be pointed out in the MS/MS chromatogram. Out of the possible di/trimers observed, divided into 13 predicted stoichiometric formulas, only five were consistent with previously described bisorbicillinoids.
Two PKSs are necessary for production of sorbicillinoids The SM gene cluster containing the 102499 TF gene contains two PKS genes (JGI ID: 73618 and 73621); neither of these synthases have so far not been linked to any metabolite(s). We therefore disrupted both PKS genes individually in MJ-T-032 and deleted both simultaneously in MJ-T-031 to assess their importance for biosynthesis of sorbicillinoids induced by overexpression of the 102499 TF gene. The Southern blot made to confirm deletion of 73618 and 73621 can be seen in Figure S2. EICs for the three PKS disruption or deletion strains (MJ-T-043, MJ-T-044 and MJ-T-045) demonstrated that all large peaks observed for MJ-T-031 and MJ-T-032 were absent and their metabolite profiles closely resembled the profile obtained with the control strain (Table 3).
68
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen Mikael Skaanning Jørgensen
Accordingly, both PKSs in this cluster appear to contribute to the formation of all 78 metabolites and we therefore named 73618 for sorA and 73621 for sorB.
The sorbicillinoid genes and cluster Elucidation of the PKS domains revealed that SorA is a reducing PKS. Hence, in addition to the three basic PKS domains; ketosynthase (KS), acyl transferase (AT) and the acyl carrier protein (ACP) it also contains a keton reductase (KR) domain, a dehydrogenase (DH) domain and an enoyl reductase (ER) domain with the potential to fully reduce ketones to alkyls in three concurrent reduction steps. Furthermore, SorA also carries a methyl transferase domain (MT). The sequential order of domains in SorA is: KS-AT-DH- MT-ER-KR-ACP. SorB lacks reducing domains and can be categorized as a non-reducing PKS. In addition to the three basic PKS domains, this PKS contain four domains: a starter unit acyl-carrier protein transacylase domain (SAT), a product template domain (PT), a MT domain and a thioesterase (TE) domain. The sequential order of domains in SorB is: SAT-KS-AT-PT-ACP-MT-TE. To investigate whether other fungi contained a PKSs pair similar to the one identified above, we subjected the predicted amino acid sequence of SorA and SorB to a BLAST search using the NCBI BLAST tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi). This analysis revealed a highly similar cluster in P. chrysogenum, a known sorbicillinoid producer (Bringmann, Lang et al. 2005). Comparison of the two clusters indicated that they consist of two PKS genes, two TF genes, one monooxygenase gene, one major facilitator superfamily transporter gene and possibly also a short-chain dehydrogenase/reductase gene (Figure 5).
T. reesei Polyketide synthase sorG sorA sorB sorE sorF sorC sorD Transcription factor Scaffold 1 Monooxygenase MFS transporter P. chrysogenum SDR sorF sorC sorA sorB sorE sorD sorG Not part of cluster Scaffold 1 Scaffold 8
5 kb
Protein Size Gene JGI ID Species Function Consensus Identity (AA) sorA 73618 T. reesei Polyketide synthase 2567 75.9% 64.7% 2039 P. chrysogenum (Reducing) 2581 sorB 73621 T. reesei Polyketide synthase 2633 73.7% 62.9% 21983 P. chrysogenum (Non-reducing) 2671 sorC 102497 T. reesei TF 665 55.6% 45.2% 32109 P. chrysogenum (Zn(II)2Cys6-type) 684 sorD 102499 T. reesei TF 686 46.3% 37.1% 66895 P. chrysogenum (Zn(II)2Cys6-type) 620 sorE 73623 T. reesei Monooxygenase 457 67.9% 55.3% 69790 P. chrysogenum (Aromatic-ring hydroxylase-like) 445 sorF 43701 T. reesei Transporter 535 73.7% 62.9% 32108 P. chrysogenum (Major facilitator superfamily) 522 sorG 102492 T. reesei Short-Chain dehydrogenase/reductase 350 50.4% 31.3% 85555 P. chrysogenum 330 Figure 5. Chromosomal regions of the two sorbicillinoid gene clusters in T. reesei and P. chrysogenum. The arrows indicate direction of transcription and the colors function of the corresponding protein products. The proposed gene names are included in the arrows and their JGI IDs can be seen in the appurtenant table. The predicted protein function can be seen in the table together with comparisons of the highly similar proteins of the two putative sorbicillinoid synthase clusters. Overexpression of the TF gene sorD activated over- synthesis of the sorbicillinoids.
69
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen Mikael Skaanning Jørgensen
Discussion
Bioinformatic mining of the T. reesei genome revealed presence of 23 putative PKS and NRPS clusters, which is far from reflected in the much lower number of metabolites synthesized by T. reesei at standard laboratory conditions. A search for TFs inside a 50 bp radius of the synthase genes revealed presence of 30 possible cluster specific TF genes with numbers ranging from zero to five in vicinity of each cluster. In this study, 11 of the identified TF genes were selected for overexpression to induce over-production of the corresponding metabolite products; enabling linkage between SM clusters and their metabolite products. This approach for the first time successfully facilitated identification of a gene cluster responsible for biosynthesis of the PK derived sorbicillinoids; it is furthermore the first experimentally confirmed linkage between a SM group and the corresponding gene cluster in T. reesei. Despite the positive outcome of the TF gene overexpression approach, the drawbacks were underlined by the fact that overexpression of only one out of the 11 TF genes led to change in the metabolite profile. This approach can therefore not be applied to elucidate the full metabolic potential, but provides a good starting point for investigation of a new organism’s metabolic potential; especially if a high throughput overexpression system, as the one utilized in this study, is at hand. The surprisingly low success rate observed when overexpressing cluster specific TFs can have several explanations. A crucial factor could be that the TF genes have not been annotated correctly. Furthermore it is also important to note that a TF gene situated adjacent to PKS or NRPS genes not necessarily constitutes a part of the corresponding SM gene cluster. The selected TF could also act as a single element in a highly complex regulatory system that is not fully understood; for instance it has previously been shown that the state of phosphorylation of some TFs is involved in regulation of transcription (Igarashi, Ishida et al. 2001, Moyano, Martinez-Garcia et al. 1996). The presence of several TF genes in the same metabolite clusters, as observed for six of the 23 PKS and NRPS gene clusters in T. reesei, could in fact indicate a very intricate system possibly including regulatory complexes. Overexpression studies of these would therefore require co-overexpression of several TF genes for induction of metabolite production, as made possible for two TF genes in T. reesei by pMJ-040. Unfortunately, co-overexpression of the two TF gene pairs selected in this study did not result in biosynthesis of any new metabolite products. Overexpression of the sorD TF gene triggered over-production of as much as 78 metabolites with 54 different stoichiometric formulas. Many of the metabolites could be classified as sorbicillinoids, but the majority have not been described previously. The plethora of over-synthesized metabolites does not necessarily reflect that all of these are produced natively by T. reesei at inducing conditions in nature, but they could be an artefact of the extremely elevated biosynthesis of the highly reactive monomeric sorbicillinoid building blocks which, due to the elevated levels, react to form unusual products. This was supported by the inability to identify these new compounds in the control strain when using EICs. Occurrence of unusual metabolites was also indicated by identification of 25 different metabolite masses predicted to include nitrogen atoms, which is a trait that has only been observed for three sorbicillinoids previously (Bringmann, Lang et al. 2005, Cabrera, Butler et al. 2006). Replacement of oxygen atoms with nitrogen atoms in the ring structures of fusarubin and bostrycoidins has been observed when growth media with high nitrogen content such as YPD has been utilized (Rasmus Frandsen, personal communication), but cannot explain all the nitrogen atoms incorporated into the sorbicillinoids in this study. Instead it is more likely that the
70
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen Mikael Skaanning Jørgensen sorbicillinoid building blocks have reacted with non-ribosomal peptides to form these new products; a hypothesis which 15N labelling studies could be used to affirm. The sorbicillinoid metabolites have been linked to a few genera including Trichoderma (teleomorph Hypocrea), Verticillium, Acremonium, Paecilomyces and Penicillium (Abe, Yamamoto et al. 2000, Maskey, Grun-Wollny et al. 2005, Trifonov, Bieri et al. 1982, Trifonov, Bieri et al. 1983, Cabrera, Butler et al. 2006, KONTANI, SAKAGAMI et al. 1994) which agrees with the finding of a gene cluster in the known sorbicillinoid producer P. chrysogenum, with significant similarity to the T. reesei gene cluster from which the TF gene sorD originates from. Thus, the P. chrysogenum sorbicillinoid gene cluster has probably also been identified in this study through comparative genomics. Extensive homology searches revealed that the two clusters most likely consist of six highly similar genes and possibly a seventh gene that is placed outside the cluster in P. chrysogenum. The two PKS genes in the sorbicillinoid cluster were named sorA and sorB. The predicted domain organization of the two PKSs resemble the one reported for the asperfuranone synthases (Chiang, Szewczyk et al. 2009) and strongly indicates that both SorA and SorB are required for biosynthesis of the polyketide products. First of all SorA is lacking a TE domain, which is most often used to release the finished ketide chain from the synthase. Secondly, SorB carries a SAT domain which enables loading of unfinished ketide chains synthesized from other polyketide synthases and importantly, SorB carries a TE domain for release of the final polyketide product. The proposed biosynthesis of sorbicillin and sorbicillinol based on the knowledge of the polyketide domains and genes in the clusters can be seen in Figure 8. A review by Harned and Volp gives an excellent overview of the proposed biosynthetic pathways from sorbicillin and sorbicillinol to many of the presently known sorbicillinoids (Harned, Volp 2011). Remarkably, a previously conducted phylogenomic analysis of PKS genes in T. reesei, Trichoderma atroviride and Trichoderma virens revealed that the two PKS genes in the T. reesei sorbicillinoid synthase cluster did not have any homologous in either of the two other species despite being placed in the same taxonomic family (Baker, Perrone et al. 2012). Disruption of sorA and sorB in the 102499 overexpression strains supported that both PKSs were required for biosynthesis of sorbicillinoids since inactivation of either of the genes resulted in complete absence of all over-synthesized metabolites. Accumulation of intermediates was also not observed. The PKS gene disruptions precluded that the vast number of new metabolites synthesized, when overexpressing sorD, was due to any cross regulation of other metabolite clusters, as observed by Bergmann and co-workers when overexpressing a NRPS cluster associated TF gene (Bergmann, Funk et al. 2010). Interestingly, biosynthesis of the pentaketide trichopyrone was also halted by disruption of the PKS genes indicating that this metabolite is synthesized by the same polyketide synthases as the hexaketide sorbicillin. Biosynthesis of polyketides with different numbers of ketide units from the same PKS(s) is extremely rare, but has been observed previously (Davison, al Fahad et al. 2012). Several bioactivities with possible pharmaceutical applications such as anticancer, anti- inflammatory and anti-oxidative activity have previously been appointed to the sorbicillinoids (Balde, Andolfi et al. 2010, Lee, Lee et al. 2005, Washida, Abe et al. 2007). The numerous new sorbicillinoids synthesized in T. reesei, when sorD is overexpressed, thus provides a possible treasure chest for new interesting drug candidates. Importantly, elucidation of the genes involved in biosynthesis of sorbicillinoids could also permit for industrial scale production of metabolites from this polyketide family decreasing need for chemical synthesis steps.
71
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen Mikael Skaanning Jørgensen
SorA SorB
DH MT ER KR MT KS AT ACP SAT KS AT PT ACP TE
S O S O O MT CH3 S O O S
3 malonyl-CoA O 3 malonyl-CoA CH3 2 SAM O CH3 H3C KR DH O O MT CH3
CH3 Release as aldehyde catalyzed by TE
CH3 CH3
O H O O 2 O (-) CH3 Aldol condensation CH3 H3C H3C O O O O
Keto-enol tautmerization
CH3 H3C OH HO O
CH3 CH3 H3C Hydroxylation by H3C tailoring enzyme OH O (SorE) OH O Dehydrogenase by Sorbicillin tailoring enzyme Sorbicillinol (SorG)
Figure 6. Predicted biosynthesis of sorbicillin and sorbicillinol by SorA, SorB, SorE and SorG. The ketide units added by the reducing PKS SorA are blue and the ketid units added by the non-reducing PKS SorB are red. SorA could possibly add more than three ketide units. Alterations introduced into the ketide chain by modifying domains are marked with small arrows. The hexaketide is released from the synthase as an aldehyde by the aminoadipate semialdehyde dehydrogenase-type TE domain (TIGR01746), a domain typically known for NRPSs. Ring formation is most likely catalyzed by the PT domain.
72
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen Mikael Skaanning Jørgensen
Supplementary Tables and Figures
Table S1. TF genes selected for overexpression in T. reesei and primers used for their amplification. All primers carry a uracil adjacent to an AsiSI/Nb.BtsI (blue) or a PacI/Nt.BbvCI (red) cassette targeting sequence. TF genes Cluster Primer name Sequence (5’-3’) (JGI ID) 6 111742 111742-fw AGAGCGAUATGGCGTCCTCTTACGGCAC 111742-rv TCTGCGAUTTAGAATACTAAACTCTTCGCCGCC 10 103122 103122-fw AGAGCGAUATGACCAGCCACGAAGGAGG 103122-rv TCTGCGAUCTAATTCTCTCCGCCCTCCCTC 11 47479 47479-fw AGAGCGAUATGGGTGTGACTGGCCCAAC 47479-rv TCTGCGAUTTAGACACCATTTAAGAAATGCATCC 106677 106677-fw GGCATTAAUATGCCCAGCATCAGGCAAATC 106677-rv GGTCTTAAUGTGCACAATGCCGATGAATTCC 14 111088 111088-fw AGAGCGAUATGACCGCCAACGGAGAAGTC 111088-rv TCTGCGAUTCACGTCTCAGCAACAGTAGCCG 15 69972 69972-fw AGAGCGAUATGCAGCTCGACAATAGCGACG 69972-rv TCTGCGAUTCATTGCATAAAATTATTGTTAAAGAGC 19 68254 68254-fw AGAGCGAUATGGAAAGGATGACCTCTTCTCC 68254-rv TCTGCGAUTCAAACAGAACCGCCCTGCC 22 102497 102497-fw AGAGCGAUATGTCCGCCCGTCAAGACGAG 102497-rv TCTGCGAUGACTGGACGGAACGTGCCG 102499 102499-fw GGCATTAAUATGGGGAGCAGCGCCACG 102499-rv GGTCTTAAUGCGAGGTGCAAGTATACCCGAG 23 105805 105805-fw AGAGCGAUATGCTGCTGTTCGGTGGCC 105805-rv TCTGCGAUTCACCGATCAAGACTCCGATGG 105784 105784-fw GGCATTAAUGGCCCAATCACATGAGTAGCCC 105784-rv GGTCTTAAUCCGGCCTGGTGTTGATGAGAG
Table S2. Primers used for construction of pMJ-040, pMJ-069, pMJ-070 and pMJ-071 and for diagnostic PCRs. Primer tails designed for fusion by uracil-excision cloning are marked with blue. Primer name Used for Sequence (5’-3’) Vector construction Vector-fw AGGCGTGCAUCCGCATCATC pMJ-067, 068, 069 Vector-rv ATCTGGGUCGTGGTCGATTGTG pyr2-rep1-fw AAGACCUCAGCCGCCAGCAGTGTCACAATCGAC pMJ-067, 068, 069 pyr2-rep2-rv AACGCAGTGGUCACGGTCCG PgpdA-PacI-fw GGTCTTAAUGACCCAGATCGAATGCGTGC pMJ-040 PgpdA-PacI-rv AATGCCUCAGCGCGGTAGTGATGTCTGCTCAAGC TtrpC-PacI-fw GGCATTAAUACGCGATGGGCGCTTACACAG pMJ-040 TtrpC-PacI-rv AGGCATUAATTAAGACCTCAGCATCGCGTGCATTCGGATCC 73618-FLUP-fw ACCCAGAUGACTCTTTCCAGAGCTTGCTAATAAAG pMJ-067, 069 73618-FLUP-rv AGGTCTUGGATTTTCAGAATACGGAAGAGGATG 73618-FLDW-fw ACCACTGCGTUTTGTTGATGGAGGCACGGCG pMJ-067 73618-FLDW-rv ATGCACGCCUGGGAAGTCTCGGCCCCGATAG 73621-FLUP-fw ACCCAGAUCGGCCTCAAGTACACGCACTC pMJ-068 73621-FLUP-rv AGGTCTUCCTGATACGCTGCCTGCAGC 73621-FLDW-fw ACCACTGCGTUCAGGCGTGGAAGGATAGCGG pMJ-068, 069 73621-FLDW-rv ATGCACGCCUCTTGCGATCGAATGCCATCG Diagnostic PCR IT-adeBFL1-fw OE insert test1,3 GGCCAAAGATCATCCGCAGC IT-pyrF-rv OE insert test1 CAGTTGCTGAGGGAAGCCGTC IT-TtrpC-fw OE insert test2,3,4 CCGTAACACCCAATACGCCG IT-adeBFL2-rv OE insert test2, 4 CTTGGTTCTAGACGTGGAGGGCC 73618-∆CTRL-fw Deletion test5, 7 CCTCCTCACCGCATCCTCCTG 73618-∆CTRL-rv Deletion test5 ACCGGCTTCGTTTTCCCAGG 73621-∆CTRL-fw Deletion test6 AACCTCGTTCGCCAGCTTGC 73621-∆CTRL-rv Deletion test6,7 TGGGCGTATTGCGCTCTTGG 1Used for test of correct upstream insertion of pMJ-023 based overexpression constructs, 2used for test of correct downstream insertion of pMJ-023 based overexpression constructs, 3used for test of correct upstream insertion of pMJ-040 based overexpression constructs, 4used for test of correct downstream insertion of pMJ-040 based overexpression construct, 5used for test of correct 73618 deletion, 6used for test of correct 73621 deletion and 7used for test of correct deletion of both 73618 and 73621
73
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen Mikael Skaanning Jørgensen
Table S3. UV absorption maxima for four selected metabolites and previously reported UV absorption maxima for the proposed compounds UV(MeOH) λmax nm (logε) Metabolite This study References Epoxysorbicillinol 293 2881 Bisvertinol 236, 273, 294, 378 240, 274, 299, 3631 Trichopyrone 249, 354 249.5, 3462 Demethylbisorbibutenolide 285, 370 362, 2822 1(Abdel-Lateff 2004), 2(Washida, Abe et al. 2007)
MJ-T-006 Transformation with OE constructs
MJ-T-030 MJ-T-031 MJ-T-032 102497 OE 102499 OE 102497 OE 102499 OE
pyr2 loop
MJ-T-039 MJ-T-040
73618/73621 73618 73621 deletion deletion deletion
MJ-T-043 MJ-T-044 MJ-T-045
Figure S1. Phylogeny of the strains used for examination of the sorbicillinoid gene cluster.
74
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript II Mikael Skaanning Jørgensen Mikael Skaanning Jørgensen
M 031 043 030 M 006 032 044 045 8,454 7,242 6,369 5,686 4,822 4,324 3,675
adeB loci
Probe 1 kb MT-T-006 adeB FLA FLB
7.3 kb
MT-T-030 FLA pyr2 PgpdA 102497 T FLB
6.5 kb
MT-T-031 FLA T 102499 PgpdA pyr2 PgpdA T FLB
6.5 kb
MT-T-032 FLA T 102499 PgpdA pyr2 PgpdA 102497 T FLB
Sorbicillinoid synthase loci
MT-T-006 73618 (sorA) 73621 (sorB) FL1 FL2 FL3 FL4
4.7 kb
MT-T-043 FL1 pyr2 FL4
5.5 kb
MT-T-044 FL1 pyr2 FL2 73621 (sorB)
6.9 kb
MT-T-045 73618 (sorA) FL3 pyr2 FL4
Figure S2. Southern blot including strains used for examination of the sorbicillinoid gene cluster. The restriction endonuclease BsrGI was used for all digestions together with a 510 bp probe targeting the selectable marker pyr2. The expected hybridization bands sizes can be seen in the schematic drawings of the targeted loci. The boxes marked with “FLA” and “FLB” depict the adeB flanks that are used for homologous integration into the adeB locus and “FL1” to “FL4” the flanks that are used for disruption and/or deletion of the polyketide genes by homologous integration. Marker: BstII digested λDNA. Abbreviation: T, TtrpC terminator.
75
76
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
3.3. Manuscript III
Heterologous Expression of Trichoderma reesei (Teleomorph Hypocrea jecorina) Polyketide Synthase-, Non-Ribosomal Peptide synthetase- and Hybrid synthetase Genes in Aspergillus nidulans.
Introduction
Most microorganisms including fungi produce a multitude of highly bioactive natural products defined as secondary metabolites (SMs). These compounds are not essential for survival of the producer under normal conditions, but are believed to give competitive advantages in the immediate environment by providing signalling capabilities, protection against UV-radiation, defence systems, and even attack systems (Chiang, Chang et al. 2011, Keller, Turner et al. 2005, Osbourn 2010). A literature survey showed that 42% of the 23,000 small bioactive metabolites investigated had fungal origin, emphasizing the vast metabolic potential of fungi (Brakhage, Schroeckh 2011). The high bioactivity of these molecules constitutes an interesting source of drug candidates, supported by the fact that 34% of all small-molecules approved as drugs today are natural products or derived from natural products. Mimics of natural products or synthetic compounds with a natural product derived pharmacophore constitute another 30% (Newman, Cragg 2012). Two of the most important classes of fungal secondary metabolites are polyketides (PKs) and non-ribosomal peptides (NRPs) which have given rise to a multitude of pharmaceuticals with activities such as antibiotic, antiviral, anti-hypercholesterolaemic, tumor inhibiting and immunosuppressing (Brakhage 1998, Keller, Turner et al. 2005). Not different from other genes encoding proteins involved in specific biosynthetic pathways, also PKS- NRPS- and their appurtenant genes are clustered (Khaldi, Wolfe 2011, Chiang, Szewczyk et al. 2009). Interestingly, the ever growing available fungal sequence data reveal that most of these gene clusters are untranscribed at laboratory conditions since the number of identified SMs for a species far from coincides with the number of observed synthase gene clusters (Chiang, Oakley et al. 2010, Mukherjee, Horwitz et al. 2012). This is also coincident with data from the industrial applied filamentous fungus T. reesei in which 23 PKS- and NRPS gene clusters have been identified (nine PKS-, ten NRPS-, three hybrid- and one PKS/NRPS/hybrid) (section 3.1.9). For comparison, only few SMs have been described for T. reesei. The three PK derived SM groups: trichodimerols, trichodermatides and sorbicillinoids are presently the only PK groups that have been identified for T. reesei (Andrade, Ayer et al. 1996, Andrade, Ayer et al. 1992, Reino, Guerrero et al. 2008, Sun, Tian et al. 2008). Other SMs that have been reported for T. reesei are the NRP derived paracelsin A-D belonging to the peptaibols, characterized by high α-aminoisobutyric acid content and a C-terminal 1.2- amino alcohol (Baker, Perrone et al. 2012) and trichodermin which is a terpene. While some T. reesei SMs have been described, the true SM potential has not been clarified and only the sorbicillinoids have so far been linked experimentally to the corresponding synthase gene cluster in T. reesei (Manuscript II). To clarify the metabolite products of orphan biosynthetic gene clusters and to establish a link between these, three main approaches have been pursued: (I) prediction of the natural activator of the clustered genes, (II) prediction of the metabolite product by available bioinformatic data and (III) prediction of metabolite products by using molecular and epigenetics based methods.
77
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
The outcome of the first approach where the natural activator is identified is almost impossible to predict due to the complexity of the regulatory system. It has though been applied successfully by Schroeckh and co-workers who identified the gene cluster responsible for biosynthesis of orsellinic acid and lecanoric acid through an extensive screening study in which 58 soil dwelling bacteria were co-cultured with Aspergillus nidulans (Schroeckh, Scherlach et al. 2009). The second approach becomes more and more reliable as available data increases and bioinformatics and proteomics develops, but it still far from obliterates the other two methods. The third approach has so far been the most successful and has primarily involved deletion of synthase genes coupled with metabolite profiling (Chiang, Szewczyk et al. 2008). For this method to be applicable, it is though required that the synthase cluster of interest is active at the applied conditions. To circumvent this, deletion studies have often included manipulation of pleiotropic silencers or activators such as the regulator LaeA or other chromatin/histone modulators. Transcriptional activation of SM clusters have also been achieved successfully by overexpressing cluster specific TF genes (Bok, Keller 2004, Perrin, Fedorova et al. 2007, Bok, Hoffmeister et al. 2006, Bergmann, Funk et al. 2010, Bergmann, Schumann et al. 2007). Heterologous expression of synthase genes or whole pathways have been applied with success in several studies to investigate corresponding metabolite products (Sakai, Kinoshita et al. 2012, Hansen, Salomonsen et al. 2011, Cox, Glod et al. 2004, Halo, Marshall et al. 2008). One of the main advantages of heterologous expression is that well-known expression hosts with well-known metabolic potentials and well-developed molecular tools can be utilized; this enables easy pin-point of new metabolites and obviates development of molecular tools for every new organism included in the research. The drawbacks of the other methods such as lack of transcription of many synthase genes at the applied conditions, the inability for pleiotropic regulators to activate transcription of all synthase genes and the observation that not all synthase clusters contain TF genes, makes heterologous expression an efficient supplement for elucidating the metabolic potential and for establishing links between genes and their corresponding metabolite products. Here we report our observations when expressing 23 T. reesei PKS-, NRPS- and hybrid synthetase genes in the model organism Aspergillus nidulans using a previously developed expression system (Hansen, Salomonsen et al. 2011). Eight of the obtained mutants, corresponding to 35%, had a changed phenotype on agar plates; four of these expressed genes encoding synthases with PKS domains and produced metabolite pigments and four expressed genes encoding NRPSs and had changed colony morphologies. However, detection of new products with UHPLC-DAD-TOFMS was not successful.
Materials and Methods
Strains and culture conditions The A. nidulans strain IBT28738 (argB2 veA1 pyrG89 nkuA-trS::AFpyrG) (Nielsen, Nielsen et al. 2008) was used for all transformations with PKS-, NRPS- and hybrid synthetase gene expression constructs. As reference for metabolic profiling the IBT28738 strain transformed with the expression construct without any inserted synthase gene was included. The strains transformed with synthase genes were renamed according to the JGI ID of the synthase gene expressed; hence, the A. nidulans strain expressing the T. reesei PKS gene with the JGI ID 82208 were renamed MJ-A-82208. Minimal media (MM)
78
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen was composed of 1% glucose, 10 mM NaNO3, salt solution (Cove 1966) and 2% agar. MM was supplemented with 10 mM uridine, 10 mM uracil and 4 mM L-arginine when necessary. Incubations were for five days at 37°C if not for metabolic profiling for which incubations were for seven days at 30°C.
Annotation of coding sequences of PKS- NRPS- and hybrid synthetase genes in T. reesei To estimate the correct size of the coding sequences (CDSs) of the selected PKS-, NRPS- and hybrid synthetase genes, the prediction made by JGI were supplemented with FGeneSH analysis using the online tool developed by SoftBerry (http://linux1.softberry.com/berry.phtml). FGeneSH is a hidden Markov model (HMM) based gene structure prediction tool and has been described as the most successful gene finding program in connection with the rice sequencing projects (Yu, Hu et al. 2002). To estimate the size of T. reesei synthase CDSs by FGeneSH, Fusarium graminearum and Neurospora crassa were selected as template organisms due to their close relations with T. reesei. The results of the CDS analysis can be seen in Table S1 together with the CDSs that were selected for the studies.
PCR and cloning All PCRs were performed with the PfuX7 polymerase (Norholm 2010) with 35 cycles in 50 µl reactions. Uracil-excision cloning was utilized for all cloning steps as previously described (Manuscript I). The primers used for amplification of the synthase genes smaller than 15 kb can be seen in Table S2 and all of the T. reesei PKS-, NRPS- and hybrid synthetase genes expressed in A. nidulans can be seen in Table 1. Before insertion of the amplified synthase genes into the previously constructed pU1111-1 expression vector (Hansen, Salomonsen et al. 2011), ten µg of the vector was digested with 20 U of both AsiSI and Nb.BsmI for six hours in a 100 µl reaction. One µl of the heat inactivated restriction mix was transferred to ten µl of GFX (GE healthcare, Little Chalfont, United Kingdom) purified PCR product of the gene of interest, one µl TE buffer (100 mM Tris- HCl, 1 mM EDTA; pH 8.0) was added together with one U of uracil-excision enzyme mix (New England Biolabs, Ipswich, USA). Incubation was carried out for 20 min at 37°C, followed by 20 min at room temperature. Next, three µl of the reaction mix was used to transform chemically competent Fusion-Blue E. coli cells (Clontech, Mountain view, USA). Four constructs were assembled for expression of the 69.5 kb T. reesei PKS/NRPS hybrid gene with JGI ID 23171 in A. nidulans. The primers utilized to assemble these constructs can be seen in Table S3 and an overview of the approach can be seen in Figure 1. All constructs were designed to target a well-characterized insertion site (IS1) located between AN6638 and AN6639 in the A. nidulans genome (Hansen, Salomonsen et al. 2011).
79
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
Table 1. Overview of the PKS-, NRPS- and hybrid synthetase genes expressed heterologous in A. nidulans. The nearest protein BLAST result obtained with the NCBI BLAST tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi) is included for all synthases. It is important to note that the BLAST results only give a rough indication of the protein products due to the limited number of synthase proteins that have yet been linked to corresponding metabolite products. BLAST results JGI ID Type Predicted protein domains Located in (cluster) Gene Size (bp) Closest annotated hit Accession number Max identity 59482 PKS KS-AT-DH-ER-KR-ACP 1 7,042 Lovastatin nonaketide synthase XP_003710466.1 42% 60118 PKS KS-AT-DH-MT-ER-KR-ACP 2 7,889 Lovastatin nonaketide synthase XP_003710466.1 37% 65116 PKS KS-AT-DH-PT-ER-KR-ACP 3 7,608 Mycocerosic acid synthase XP_003712315.1 40% 65172 PKS KS-AT-DH-MT-ER-KR-ACP 4 8,305 Acetolactate synthase EEH44268.1 46% 65891 PKS KS-AT-DH-ER-KR-ACP 5 7,640 Phenolpthiocerol synthase EGY19840.1 41% 81964 PKS SAT-KS-AT-PT-ACP 6 5,911 Conidial yellow pigment synthase XP_002848092.1 48% 82208 PKS SAT-KS-AT-PT-ACP-TE 7 6,952 Conidial pigment synthase (Alb1) EFY88620.1 77% 106272 PKS KS-AT-DH-MT-ER-KR-ACP 8 8,996 Phenolpthiocerol synthase XP_001934016.1 35% 24586 NRPS A-T-C-A-T-C-T 10 6,728 Gliotoxin synthase (GliP) XP_750855.1 40% 60458 NRPS A-T-C-A-T-C-T 11 6,666 Sirodesmin synthase (SirP) AAS92545.1 34% 60751 NRPS A-T-C 12 2,720 HC-toxin synthetase XP_001932133.1 45% 67189 NRPS A-T-C-T-C 13 5,442 Surfactin synthetase EGY22526.1 58% 68204 NRPS A-Ox 14 3,567 Gramicidin S synthetase XP_003004664.1 59% 69946 NRPS A-T-C-A-T-C-T-C-A-T-C-T-C-T-C 15 14,771 Gramicidin S synthetase XP_003719607.1 44% 71005 NRPS A-T-C-A-T-C 16 5,769 Surfactin synthetase EGY22526.1 44% 71072 NRPS A-T-R-K 17 3,855 Male sterility protein CCF37266.1 58% 81014 NRPS A-T-R-SDR 18 3,909 Enterobactin synthetase EGY19303.1 73% 23171* Hybrid KS-AT-ACP-(C-A-T)×18-R 19 69,518 Syringopeptin synthetase AAO72425.1 26% 58285 Hybrid KS-AT-DH-MT-KR-ACP-C-A-T-R 20 12,156 Fusaproliferin synthase AFP73394.1 37% 73618 PKS KS-AT-DH-MT-ER-KR-ACP 22 8,117 Lovastatin nonaketide synthase XP_001942484.1 36% 73621 PKS SAT-KS-AT-PT-ACP-MT-TE 22 8,083 Citrinin synthase EJB11047.1 44% 105804 PKS SAT-KS-AT-PT-ACP-TE 23 6,782 6-methylsalicylic acid synthase XP_001937752.1 46% 59315 Hybrid KS-AT-DH-MT-KR-ACP-C-A-T-R 23 11,824 Fusaproliferin synthase AFP73394.1 53% Abbreviations: A, Adenylation; ACP, Acyl carrier protein; C, Condensation; DH, Dehydratase; ER, Enoyl reductase; KR, b-Keto reductase; KS, b-Keto synthase; MT, Methyltransferase; Ox, Oxidase; PT, Product template; R, Thioester reductase; SAT, Starter unit acyl-carrier protein transacylase; SDR, Short-chain dehydrogenase/reductase; T, Thiolase; TE, Thioesterase.*Entire gene probably not integrated successfully.
80
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
Amplification Fragments for use in uracil-excision fusions were obtained by PCR with primers containing a single uracil designed for uracil-excision cloning. The plasmid pU1111, carrying the PgpdA promoter, TtrpC terminator, argB selective marker and sequences for homologous integration into a well characterized A. nidulans insertion sequence (IS1), were used as vector template. Gene fragments Amp(R) 23171 CDS (69.5 kb)
NotI (10515) NotI (1298)
T. reesei
IS1 target (DOWN) IS1 target (UP) 18 kb pU1111 12043 bp 20 kb
20 kb
18 kb argB PgpdA
TtrpC
Amplified vector fragments USER fusion Uracil-excision enzyme reaction removes the uracils incorporated in the PCR products and generates overhangs which allow fusion of several fragments.
Vector fragments 23171 CDS fragments
NNN························NNNACCGCAT NNN························NNNAAGCCGT NNN························NNNAGGCGTGCAT TCCGCACGTANNN························NNN TGGCGTANNN························NNN TTCGGCANNN························NNN pMJ-011
NNN························NNNACCCAGAT NNN························NNNAGGGGTGTT NNN························NNNAGGCGTGCAT TCCGCACGTANNN························NNN TGGGTCTANNN························NNN TCCCCACAANNN························NNN pMJ-012
NNN························NNNACCCAGAT NNN························NNNATCACCTTCT NNN························NNNAGGCGTGCAT TCCGCACGTANNN························NNN TGGGTCTANNN························NNN TAGAGGAAGANNN························NNN pMJ-013
NNN························NNNACCCAGAT NNN························NNNAGTGCCCCT NNN························NNNAGCGCCCAT TCGCGGGTANNN························NNN TGGGTCTANNN························NNN TCACGGGGANNN························NNN pMJ-014
Transformation The four constructs obtained were NotI digested to obtain linear fragments for transformation. The digestion mixes were pooled and precipitated to gain a high DNA concentration before transformation. There are homologous overlaps of approximately 1.6 kb between each fragment and with the IS1 sequence of the A. nidulans genome.
IS1 FL1 PgpdA 23171 fragment 1
23171 fragment 2 23171 fragment 3 TtrpC argB IS1 FL2
23171 fragment 4
A. nidulans IS1
IS1-Ins-UP-fw Fr1-Ins-fw Fr2-Ins-fw Fr3-Ins-fw Fr4-Ins-fw IS1-Ins-DW-fw IS1 FL1 PgpdA TtrpC argB IS1 FL2 23171 CDS (69.5 kb) A. nidulans IS1-Ins-UP-rv Fr1-Ins-rv Fr2-Ins-rv Fr3-Ins-rv Fr4-Ins-rv IS1-Ins-DW-rv Figure 1. Approach for introducing the 69.5 kb PKS/NRPS hybrid gene with JGI ID 23171 into A. nidulans IS1. Four constructs were fabricated, each one carrying a fragment of the gene with overlapping regions of approximately 1.6 kb. The pMJ-011 construct carrying the first part of the gene also carried the IS1 FL1 targeting sequence and the PgpdA promoter and the pMJ-014 construct carrying the last part of the gene also carried the TtrpC terminator, the argB selective gene and the IS1 FL2 targeting sequence. If correctly integrated, a full 23171 gene expression construct would be integrated into IS1 as seen in the bottom of the figure. Primers used for diagnostic PCRs are included in the drawing.
81
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
Protoplasting and transformation Protoplasting and integration of the expression fragments were performed as described previously (Johnstone, Hughes et al. 1985, Nielsen, Albertsen et al. 2006). Before transformation, ten µg of the plasmids carrying synthase genes of less than 15 kb were digested with NotI to separate the fragments for insertion from the vector backbones. If a NotI site was present in the synthase gene sequence, another restriction enzyme with a single digestion site in the vector backbone was chosen for linearization of the construct before transformation. The four plasmids that were constructed for heterologous expression of the 23171 gene were digested with NotI prior to transformation to release the fragments for insertion from the vector backbones. The digestions were set up as four separate 100 µl reactions each with 25 µg DNA and 20 U NotI and digested ON at 37°C where after another 20 U of NotI were added before another four hours of digestion. Twenty µl from each digestion were pooled, ethanol precipitated and eluted in 25 µl Milli-Q water. Before the DNA fragments were used for transformation they were subjected to heat treatment in a thermal cycler as described in the following; the first temperature step was at 98°C for five minutes where after the temperature was dropped to 95°C for five minutes, from this step the temperature dropped 5°C each five minutes until a temperature of 25°C was reached. Ten µl of the heat treated DNA fragment mix was used for transformation.
Integration of the expression IS1 FL1 PgpdA GOI TtrpC argB IS1 FL2 constructs into IS1 can be seen in Figure 1 for the synthase gene with JGI ID 23171 and Figure 2 for the IS1 FL1 IS1 FL2 A. nidulans remaining synthase genes. All Homologous IS1-Ins-UP-fw recombination IS1-Ins-DW-fw targeting events were verified by IS1 FL1 PgpdA GOI TtrpC argB IS1 FL2 two diagnostic PCRs using genomic A. nidulans IS1-Ins-UP-rv IS1-Ins-DW-rv DNA purifications as template. Figure 2. Introduction of expression constructs into the A. nidulans IS1. Correct upstream insertion was Primers used for diagnostic PCRs are included in the drawing verified using the primers IS1-Ins-UP-fw, targeting a genomic sequence just upstream of IS1 FL1, and IS1-Ins-UP-rv targeting PgpdA. Correct downstream insertion was verified using primer pair IS1-Ins-DW-fw, targeting argB and IS1-Ins-DW-rv, targeting a genomic sequence just downstream of IS1 FL2. Four additional diagnostic PCRs, each targeting one of the four 23171 gene fragments, were set up for verification of correct insertion of the entire gene as seen in Figure 1. The sequence of all primers used for diagnostic PCRs can be seen in Table S4.
Metabolite extraction and UHPLC-DAD-TOFMS Strains selected for metabolic profiling were inoculated in three-point stabs on MM plates and grown for seven days at 30°C. Six plugs with a diameter of 6 mm were picked for each strain from different parts of the growing colonies. The plugs were transferred to 4 ml vials and one ml extraction solvent (one part Methanol, two parts Dichloromethane, three parts Ethyl acetate and 0.5% formic acid) added. The vials were ultrasonicated for 45 minutes where after the extraction solvent was decanted to new vials. The solvent was evaporated using N2 flow at 33°C and the dried metabolites resuspended in 200 µl methanol and released from the glass-surface by 45 minutes of ultrasonication. The solution was filtered through filters with a pore size of 0.22 µm prior to UHPLC-DAD- TOFMS.
82
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
The UHPLC-DAD-TOFMS was carried out on a Dionex Ultimate 3000 UHPLC and data analysis performed with Compas Target Analysis 1.2 and Compas DataAnalysis 4.0 (Bruker Daltonics, Bremen, Germany), as previously described (Manuscript II).
Results
Twenty three A. nidulans mutants expressing T. reesei PKS-, NRPS- or hybrid synthetase genes were isolated and analyzed.
Isolation of correct transformants All diagnostic PCRs targeting the upstream and downstream points of integration into IS1 were positive, indicating that A. nidulans mutants with correct integrated expression constructs could be isolated for all introduced synthase genes of less than 15 kb. The diagnostic PCRs targeting both IS1 integration points of the 23171 gene expression fragments were also positive, but surprisingly only one of the additional diagnostic PCRs that were set up to ensure presence all four 23171 gene fragments was positive (Table 2). Altered phenotypes could be observed directly on the transformation plates after transformation with eight of the T. reesei synthase/synthetase gene expression substrates. The new phenotypes could be divided into two basic types; one with mutants producing a pigment and one with mutants that had changed colony morphology. Examples of both can be seen in Figure 3 and an overview of the mutants with changed phenotypes can be seen in Table 3. Interestingly, the mutant transformed with the 23171 gene expression constructs had a changed phenotype even though the diagnostic PCRs indicated that the entire gene was not integrated.
Table 2. Diagnostic PCRs for verification of correct insertion of 23171 PCR # 1 2 3 4 5 6 Primers IS1-Ins-UP-fw/rv Fr1-Ins-fw/rv Fr2-Ins-fw/rv Fr3-Ins-fw/rv Fr4-Ins-fw/rv IS1-Ins-DW-fw/rv PCR result + - - - + +
Pigment Limited growth / rough surface Figure 3. Selection plates with transformants expressing synthase genes that result in changed phenotype. The blue arrows point out colonies in which the introduced expression construct is active and affect the phenotype. The green arrows point to colonies in which the expression construct has not been introduced correctly and which phenotype resemble the one of the control.
83
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
Table 3. Phenotypical traits for selected A. nidulans strains expressing T. reesei PKS-, NRPS- or hybrid synthetase genes. Only mutants with a change in the phenotype are included. The different phenotypes can be seen in Figure 4 and 6. Strain ID Synthase type Gene size (bp) Phenotype MJ-A-65891 PKS 7,640 Pigment MJ-A-82208 PKS 6,952 Pigment MJ-A-106272 PKS 8,996 Pigment MJ-A-67189 NRPS 5,442 Limited growth / rough surface MJ-A-68204 NRPS 3,567 Limited growth / rough surface MJ-A-81014 NRPS 3,909 Limited growth / rough surface MJ-A-23171 Hybrid 69,518 Rough surface MJ-A-59315 Hybrid 11,824 Pigment
Mutants producing a pigment Transformation with four of the expression constructs resulted in pigment producing mutants (Figure 4). Common for all four synthase genes that led to pigment production was presence of PKS domains. Two of the genes encode highly MJ-A-65891 MJ-A-106272 reducing PKSs while one encodes a non-reducing PKS. The last pigment producer expressed a gene encoding a PKS/NRPS hybrid with a highly MJ-A-59315 / 82208 Control reducing PKS moiety. The Figure 4. Reverse of the plates with A. nidulans strains expressing T. reesei observed pigmentation differed synthase genes that lead to pigment production. Expression of both 59315 and from bright orange for MJ-A- 82208 results in production of a bright yellow pigment and only the plate for MJ- 65891 to light reddish for MJ-A- A-59315 are therefore shown as an example. 106272 to bright yellow for both MJ-A-59315 and MJ-A-82208. The pigments seemed to be restricted to the mycelia and were not released into the growth media. UHPLC-DAD-TOFMS metabolite chromatograms for all pigment producing mutants can be seen in Figure 5. It is seen that the chromatograms for all the strains were highly similar and that no new apparent peaks were present for any of the mutants. Thorough examination of potentially interesting metabolites by Extracted Ion Chromatograms (EICs) supported that no new metabolites could be detected in any of the metabolite samples for the pigment producing mutants.
84
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
MJ-A-59315
MJ-A-65891
MJ-A-82208
MJ-A-106272
Control
Figure 5. UHPLC-DAD-TOFMS metabolite profiles for mutants expressing synthase genes resulting in production of pigments. Some variations are seen between the different chromatograms, but none of the metabolite extractions for the pigment producing mutants seem to have any new metabolite peaks not observed for the control.
Mutants with changed morphology Transformation with four of the expression constructs resulted in changed colony morphology when grown on plates (Figure 6). Two new colony morphologies were observed, both with a rough brownish surface. While the growth rates were negatively affected for both morphologies when compared to the control strain, this was much Rough surface Limited growth / rough surface Control more pronounced for Figure 6. Phenotypes of the A. nidulans strains expressing T. reesei synthetase genes affecting three of the mutants. the colony morphology. Two new phenotypes were observed, one for MJ-A-23171 with a rougher surface with a relatively high growth rate, and one for MJ-A-67189, MJ-A-68204 and Common for all four MJ-A-81014 with severe negatively affected growth rate. synthase genes leading to changed morphology was the presence of NRPS domains. UHPLC-DAD-TOFMS metabolite chromatograms for mutants with changed colony morphology can be seen in Figure 7. It is evident that the metabolite profiles for all four mutants expressing a synthase gene which affects the colony morphology differ from the profiles for the two controls. The number of metabolites produced by MJ-A-23171, MJ-A-
85
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
68204 and MJ-A-81014 seems to be lower than observed for the two controls while MJ-A- 67189 on the contrary seems to produce a higher number of metabolites. The profound changes in the metabolite profiles hamper identification of metabolite products originating from the expressed synthase genes and none of the observed metabolites could be appointed to the T. reesei synthases that were expressed heterologous. An interesting observation is that the three mutants with the limited growth and rough surface morphology all produce the same two metabolites not observed for the control (Figure 7).
MJ-A-23171
MJ-A-67189
MJ-A-68204
MJ-A-81014
Control 1
Control 2
Figure 7. UHPLC-DAD-TOFMS metabolite profiles for mutants expressing synthetase genes resulting in changed colony morphology. It is seen that all of the metabolite profiles are heavily affected; some metabolites seem to be produced in higher amounts and some in lower amounts while some are completely absent. Two chromatograms are included for the control strain to visualize the low variation normally observed between two independent metabolite extractions. The red box encircles two metabolites which are synthesized in large amounts in three of the mutants overexpressing a NRPS.
The two metabolites observed for the mutants with limited growth and rough surface have a mass of m/z 741.5512 [M+H]+ and m/z 757.5464 [M+H]+. EICs for these masses show that these two metabolites are not synthesized by the control strain (Figure 8). The mass difference of 15.9952 Da indicates that just one oxygen atom separates the two metabolites and that they therefore highly likely are synthesized by the same synthase. All stoichiometric formulas predicted by the “SmartFormula manually” function in Compas DataAnalysis include nitrogen atoms and indicate that they are both NRPs consisting of seven amino acids.
86
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
MJ-A-81014 2 1
MJ-A-67189
MJ-A-68204
Control
Figure 8. EICs for the masses between m/z 742.5543 [M+H]+ (peak 2) and m/z 758.5397 [M+H]+ (peak 1) for strains with limited growth and rough surface. It is seen that the two metabolites are produced only by the strains with changed colony morphology. Notice that the scale of signal-intensity for the control strain is different than for the others.
Mutants with no new phenotype UHPLC-DAD-TOFMS metabolite chromatograms for the 15 remaining mutants expressing T. reesei synthase genes without phenotypical changes did not reveal biosynthesis of any new metabolites.
Discussion
The results show that all expression constructs, except the ones for the 23171 gene, were successfully inserted into IS1. Phenotypical changes were observed for eight of the 23 obtained mutants confirming that these T. reesei PKS-, NRPS- or hybrid synthetase genes were indeed expressed in A. nidulans. The mutants with changed phenotype could be divided into two basic groups, one expressing genes encoding PKS domains, resulting in pigmentation, and one expressing genes encoding NRPS domains, resulting in changed colony morphology. Surprisingly, the UHPLC-DAD-TOFMS metabolite chromatograms for the four mutants producing a pigment did not reveal presence of any new metabolite peaks despite the obvious presence of chromophores in these. The inability to pin-point any new metabolites in the chromatograms are therefore probably due to absence of these metabolites in the extractions and not caused by limitations of the detection method. The extraction method utilized was developed to release as broad a range of metabolites as possible from A. nidulans; unfortunately the great structural diversity of metabolites makes it impossible to extract all using just one method. The failure of the applied method to extract the metabolites of interest was supported by the observation that the new pigments seemed to be retained in the biomass when extracting. These metabolites might be tightly embedded in the mycelium in the heterologous host due to absence of the corresponding transporters and are therefore not extracted using the standard approach. Further investigation revealed that genes encoding transporters are indeed present in all four T. reesei gene clusters from which the heterologous expressed PKS genes originated from. The observation that all four pigment producing mutants carried synthase genes with PKS domains agrees with previous reports showing that pigments
87
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen are often derived from PKs (Fujii, Watanabe et al. 2001, Mapari, Thrane et al. 2010, Gao, Qin et al. 2010). While the metabolite chromatograms for the mutants producing pigments resembled the one for the control strain, large changes were observed in the chromatograms for the strains with altered colony morphology. The changes included both appearance of several new metabolite peaks, but also disappearance of numerous peaks. Production of SMs have previously been shown to be dependent of the growth phase in fungi (Calvo, Wilson et al. 2002) and the highly affected colony morphology and limited growth observed for the four mutants not surprisingly also affected their metabolite profiles heavily. The large alterations in the metabolite profiles hampered identification of new metabolite peaks appearing due to expression of the T. reesei synthase genes. As also observed for the pigment producing synthases, genes encoding transporters are present in three of the T. reesei clusters for the morphology changing synthetases, only the cluster with the synthetase gene 68204 did not include a transporter gene in T. reesei. Presence of the NRP metabolites possibly synthesized by the heterologous synthetases was therefore not certain in the extractions. The severely affected phenotypes when expressing the synthetase genes with NRPS domains are consistent with numerous previous reports of the antifungal activity of NRPs (Manavalan, Murugapiran et al. 2010, Wiest, Grzegorski et al. 2002, Silva-Stenico, Silva et al. 2011, Tincu, Taylor 2004). Expression of these synthetase genes in a heterologous host could therefore affect the fitness of the producer since it is a possible natural target of the foreign NRP metabolites. Heterologous expression of just the synthetase genes also entails that possible resistance genes, that might be present in the original host, are not expressed in the heterologous producer. Two new NRP metabolites were produced in the three mutants with limited growth and rough surface. Both of these are most likely products of a single A. nidulans NRPS and could be a part of a stress response induced by the presence of foreign NRPs which affect the overall fitness of the mutants. These two NRPs could possibly act as antifungals and be synthesized by A. nidulans as a part of a defense system. The metabolites have not previously been reported for A. nidulans and as seen in Figure 8, the control strain does not synthesize these. Co-cultivation of T. reesei and A. nidulans coupled with metabolite profiling could enlighten if these metabolites are indeed produced to gain competitive advantages, as observed previously when co-cultivating A. nidulans and soil dwelling bacteria (Schroeckh, Scherlach et al. 2009). The new phenotype with rough surfaced colonies observed for MJ-A-23171 was surprising since diagnostic PCRs showed that only some of the first part and the last part of the gene were present in the mutant. The results of the diagnostic PCRs indicate that homologous recombination could have happened between fragment one and four of the 23171 gene; possibly facilitated by the large sequence homology between these due to the repeated nature of NRPS domain encoding genes. The changed phenotype indicates that a new product could be synthesized by the mutant, which would be possible if the two gene fragments had combined so that the domain sequences fit each other. If this is indeed the case a new smaller NRP, than produced originally by T. reesei, will be synthesized by the smaller synthetase. The altered phenotype could also be caused by insertion of the large DNA fragments, but integration of the other expression construct with genes of up to 14.8 kb into IS1 did not confer the same phenotypical change. Sequencing of the inserted fragment could enlighten whether the two outermost 23171 gene fragments had fused and expression studies could indicate whether the inserted gene fragment is indeed expressed.
88
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
The unaltered phenotype for the 15 remaining mutants transformed with PKS-, NRPS- or hybrid synthetase gene expression constructs, does not necessarily reflect that the inserted genes are not expressed in the heterologous host. If the synthase products are not pigments or do not affect the colony morphology, their presence will not be visible directly on the plates. Nevertheless, several factors could result in failed biosynthesis of the metabolite product. Correct annotations of the synthase genes are extremely important and even though automatic in silico predictions of genes are usually very efficient, it sometimes fails to provide correct results. Other factors that can influence metabolite biosynthesis are presence of elements such as thioesterases or thioester reductases which are often involved in release of the metabolite product from the synthase. If this is not a part of the synthase itself, but dependent on other enzymes, the product might not be released from the synthase in the heterologous host and biosynthesis will be halted. Another possible limitation in heterologous hosts could be availability of unusual subunits required for biosynthesis of specific products. One example is the previously mentioned group of NRPs synthesized by T. reesei referred to as peptaibols which contain a high proportion of the non-proteinogenic α-aminoisobutyric acids. This group of NRPs has not been appointed to any Aspergilli which may therefore not synthesize the α-aminoisobutyric acid subunit. The results of this study underline both the advantages and drawbacks when using heterologous expression to link genes and metabolites. Phenotypical changes were observed for a high proportion (35%) of the isolated mutants supporting that the method can be applied for PKS-, NRPS- and hybrid synthetase genes of even distantly related filamentous fungi. Unfortunately, no conclusions can yet be drawn from the results since the products of the heterologous synthases could not be identified. Nevertheless, a range of mutants expressing PKS-, NRPS- and hybrid synthetase genes has been obtained and optimization of the extraction method and possibly also the analytical methods could in the near future provide interesting insights into the T. reesei PK and NRP biosynthesis.
89
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
Supplementary Tables
Table S1. The location of estimated PKS-, NRPS-, and hybrid synthetase gene CDSs in the T. reesei genome. The location predicted by JGI and by SoftBerry FGeneSH using Fusarium graminearum and Neurospora crassa as template organisms are included. The CDSs that were chosen are black while the predictions that were not used are faded. SoftBerry FGeneSH JGI Fusarium graminearum Neurospora crassa Gene ID Scaffold Start End Start End Start End 59482 6 489709 496750 489709 496750 489709 496750 60118 7 961671 969559 961671 969559 961671 969559 65116 15 578930 571323 578930 571323 578930 571323 65172 15 76106 84410 76097 84410 76097 84410 65891 17 631535 639174 631484 639174 631484 639174 81964 29 42489 36579 44305 36579 44305 36579 82208 33 15745 8794 15766 8878 15766 8878 106272 7 215526 224521 215526 224521 215526 224521 24586 1 2715208 2721935 2715190 2721980 2715190 2721980 60458 7 1346092 1352757 1346092 1352757 1346092 1352757 60751 8 526840 524121 526840 523434 526840 523434 67189 20 536612 542053 536612 542053 536612 542053 68204 24 269353 272919 269317 272919 269551 272919 69946 31 54649 39879 51286 39879 54649 39879 71005 46 32532 26764 33077 26764 33892 23176 71072 50 14095 10241 14095 10241 14095 10241 81014 22 51332 47424 51332 47424 51332 47424 23171 24 123560 193077 123560 193077 123560 193077 58285 5 37773 25618 37773 25644 37773 25618 73618 1 490277 482161 490277 482236 490277 482236 73621 1 491045 499127 491045 499083 491045 499083 105804 6 69489 62708 69489 62708 68710 62708 59315 6 46569 34746 46569 34746 46569 34746
90
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
Table S2. Primers used for amplification of T. reesei PKS-, NRPS- and hybrid synthetase gene CDSs for heterologous expression in A. nidulans. Primer tails used for integration into the overexpression constructs by uracil-excision cloning are marked with blue. Synthase gene Primer Name Sequence (5’-3’) (JGI ID) 60118-fw AGAGCGAUATGGCTTCGACGAACGGGATTG 60118 60118-rv TCTGCGAUTTACTTCTTCTCCTCCGCAACCC 65172-fw AGAGCGAUATGGCTACAATGGAGCCGCTC 65172 65172-rv TCTGCGAUCTAACTGCTGGCCGCAATTTGAAC 73621-fw AGAGCGAUATGGCGGCCTCAAGTACACGC 73621 73621-rv TCTGCGAUTCATCGCAAAAAGCCGCTATCC 81964-fw AGAGCGAUATGGCTTCAACCACCAAACCC 81964 81964-rv TCTGCGAUCTATTTGCTCAGCCACTCCGTCAAC 82208-fw AGAGCGAUATGCTGGATTCAACGTCTGCCATG 82208 82208-rv TCTGCGAUTTACTTTGAGAAAGCACTCTTGATAAACTC 105805-fw AGAGCGAUATGCTATCAGCCATGGCCAATGTATC 105805 105805-rv TCTGCGAUCTACGTGTCGATGTCCCGCATAC 106272-fw AGAGCGAUATGTCTCAGCCCGCGACTGTAG 106272 106272-rv TCTGCGAUTTACGCCTTGCCAACCGTGC 58285-fw AGAGCGAUATGGATCAACAAAGACAGCAGGATG 58285 58285-rv TCTGCGAUTTAATCGCTTCCCATATAAGGGAAAATC 59315-fw AGAGCGAUATGGCGCACAATCCTGCGG 59315 59315-rv TCTGCGAUCTAAAGTAGGCTCGGTAAAATCGCC 59482-fw AGAGCGAUATGTCGTCCTCGAAGCAGGACATG 59482 59482-rv TCTGCGAUTCACTCCTTCGTCCAGACTCCCTC 60458-fw AGAGCGAUATGGCTCAAACCAGGAGAGGCC 60458 60458-rv TCTGCGAUTCATGAGAACATCCAAGCAATGTCTC 65116-fw AGAGCGAUATGTTCACTCTTGAACCCGCTCTAG 65116 65116-rv TCTGCGAUTCAACCAGACCAGCTGGCAATAAG
65891-fw AGAGCGAUATGTGTGAACAACCACCAGGAGACG 65891 65891-rv TCTGCGAUTCACTGCGACTTGTCTCCCCC 73618-fw AGAGCGAUATGGGAAGTCTCGGCCCCG 73618 73618-rv TCTGCGAUTCATGAAGACTTTGCAAATTTGGC 81014-fw AGAGCGAUATGAGCATCATCGATACGACAAAGG 81014 81014-rv TCTGCGAUTCAAATAGGCTCATCCCGCG 103032-fw AGAGCGAUATGTGCGAATCCATTCATCCAAG 103032 103032-rv TCTGCGAUTTAATAGTTCCACTGGTCGCACC 24586-fw AGAGCGAUATGACATCCCTACCAACCAATCTCTG 24586 24586-rv TCTGCGAUCTATACTATGATATGCTTCACCAGTTCGG
55306-fw AGAGCGAUATGAGCTCTCTACAGACCCCGTCAG 55306 55306-rv TCTGCGAUTCAATGAGTCGCTGCTCGCTTC 60751-fw AGAGCGAUATGGACAACCCCATAACGCCAG 60751 60751-rv TCTGCGAUTCACAACGAAGCAACTACACCAAAAG 67189-fw AGAGCGAUATGGCTATTGACGGGGATGGATATG 67189 67189-rv TCTGCGAUTCAGCCCTCGAGCTGGTCCTC 68204-fw AGAGCGAUATGGAAATGTCAAGTCCAAGCTGG 68204 68204-rv TCTGCGAUTTAGCTGTCCCAGATGGCACCG 69946-fw AGAGCGAUATGGAGAAACTCGATGACCTATCCG 69946 69946-rv TCTGCGAUTCATGTCTTTTTCCCATTCCCAATC 71005-fw AGAGCGAUATGAACGGAACGCCAAAACTTCC 71005 71005-rv TCTGCGAUCTAATACACCTCAAGCAGAGTCTGCTCC 71072-fw AGAGCGAUATGCCTGCGACGATATACATTCC 71072 71072-rv TCTGCGAUTTAGAGCCATCCAACAGCGTCATC
91
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Manuscript III Mikael Skaanning Jørgensen
Table S3. Primers used for amplification of fragments for construction of plasmids for introducing the PKS/NRPS hybrid gene 23171 into the A. nidulans genome. 5’ primer tails for use with uracil-excision cloning are marked with blue. Primer name Construct Sequence (5’-3’) Amplicon size (bp)
Frag1-PT1-fw ACCGCAUATGGCGCCGAACACTACGTACG pMJ-011 8,568 Frag1-PT1-rv ACGGCTUGGGTCGTTTGGCT Frag1-PT2-fw AAGCCGUCTTGTGCCCATCG pMJ-011 9,456 Frag1-PT2-rv ATGCACGCCUCGAAAACGAACGCAGCGAATTG Frag4-PT1-fw ACCCAGAUCACTCGTCACATCTGGCAAGC pMJ-014 9,037 Frag4-PT1-rv AGGGGCACUACCGAGGCGTTC Frag4-PT2-fw AGTGCCCCUGCCTTCATGAGC pMJ-014 8,988 Frag4-PT2-rv ATGGGCGCUTCAGCCATGGCGCTGGAAAG Vector-fw AGGCGTGCAUCCGCATCATC pMJ-011 7,309 PgpdA-rv ATGCGGUGCGGTAGTGATGTCTGCTCAAGC Vector-fw AGGCGTGCAUCCGCATCATC pMJ-012/013 3,058 Vector-rv ATCTGGGUCGTGGTCGATTGTG TtrpC-fw AGCGCCCAUCGCGTGCATTCGGATCCAC pMJ-014 7,780 Vector-rv ATCTGGGUCGTGGTCGATTGTG Frag2-PT1-fw ACCCAGAUATTGGTGGTGACTCAATCGCTGC pMJ-012 10,124 Frag2-PT1-rv AACACCCCUTGGCAGCTGATAGAC Frag2-PT2-fw AGGGGTGTUGACGTTGCTCGC pMJ-012 9,898 Frag2-PT2-rv ATGCACGCCUCCGCGTTCGTAGGATATCACG Frag3-PT1-fw ACCCAGAUTGAGAAGCAAGCCGCTGCC pMJ-013 9,932 Frag3-PT1-rv AGAAGGTGAUGGGCAAGCTTGTTAG Frag3-PT2-fw ATCACCTTCUCAACGCCGGC pMJ-013 10,061 Frag3-PT2-rv ATGCACGCCUGACAGTTGCACATCGAGCTGAG
Table S4. Primers used for diagnostic PCRs. Primer name Sequence (5’-3’) Target Amplicon size (bp)
IS1-Ins-UP-fw GGTCTACTCCCCTGCGTCTA IS1 upstream 2,318 IS1-Ins-UP-rv TTCCAAGCGGAGCAGGCTCG Fr1-Ins-fw TTTTTCGTGTCTGTTATTGCTG 23171 fragment 1 4,901 Fr1-Ins-rv AGAGCAACCTTTGACAATCG Fr2-Ins-fw CTCTGTTGGCGAGATATATGGC 23171 fragment 2 5,066 Fr2-Ins-rv TGATGGCGTAGTTGATGAAGCG Fr3-Ins-fw GTCCAGCATCTTGCGCACTC 23171 fragment 3 5,011 Fr3-Ins-rv ATCGAAGACGTATGCGGCGA Fr4-Ins-fw GTCTGGCCTCATGGACATGC 23171 fragment 4 5,040 Fr4-Ins-rv CGTCCCAGGTATTCGAGCTT IS1-Ins-DW-fw CGCCTTGGAGGGTTTCGTTG IS1 downstream 2,595 IS1-Ins-DW-rv GTTCAGGGTGACGGTGAGAG
92
3. Chapter II – Unraveling the Secondary Metabolism of T. reesei PhD Thesis Mikael Skaanning Jørgensen
3.4. Description of Appendices for Chapter II
UV absorption spectra for the sorbicillinoids UV absorption spectra were made for all of the sorbicillinoid metabolites that were observed in larger quantities when the sorbicillinoid cluster specific transcription factor (JGI ID 102499) was overexpressed (Manuscript II). The entire collection of spectra can be seen in appendix section 6.3.
Structures of known sorbicillinoids The molecular weights of some of the sorbicillinoid metabolites that were observed in larger quantities when the sorbicillinoid cluster specific transcription factor (JGI ID 102499) was overexpressed are consistent with previously described sorbicillinoids. Structural drawings of these can be seen in section 6.4.
Alignment and phylogeny of PKS AT domains The acyltransferase (AT) domains of PKSs are responsible for selection of the correct short-chain carboxylic acids monomers for incorporation into the PK chain. Alignments of these, seen in appendix section 6.5.1, might indicate the relation of the PKSs and whether they utilize the same monomers.
Alignments and phylogeny of 23171 A domains Based on the predicted number of domains in the NRPS encoded by the gene with JGI ID 23171, this is highly likely involved in biosynthesis of paracelsins. The amino acid sequences of some paracelsins have been described and alignments of the NRPS A domains, responsible for selection of the amino acid for incorporation, could therefore indicate whether this NRPS do in fact assemble the paracelsins. Alignment of the A domains and the phylogeny of these are compared to the known amino acid sequences of paracelsins in appendix section 6.5.2.
Alignments and phylogeny of all T. reesei NRPS A domains As described above the A domains are gatekeepers for amino acid specificity of NRPSs. Alignments of these therefore indicate which amino acids they incorporate and could also indicate the relations between the included NRPSs. All identified T. reesei NRPS A domains are aligned and a phylogenetic three drawn in appendix section 6.5.3.
93
4. Summation and Perspectives PhD Thesis Mikael Skaanning Jørgensen
4. Summation and Perspectives
The main objective of this study was to aid to unravel the secondary metabolism of the biotechnological important filamentous fungus T. reesei. Despite being a widespread production organism, surprisingly little of its secondary metabolism had previously been described. This study was initiated with development of new molecular tools for T. reesei which was subsequently used to pursue the primary objective by genetic engineering.
Manuscript I (An efficient expression platform for Trichoderma reesei (teleomorph Hypocrea jecorina) (section 2.2)) described development of a system enabling high throughput construction of defined integrated T. reesei expression mutants. It was shown that NHEJ deficiency (section 2.1.1) in combination with targeted integration into adeB (section 2.1.2) constituted a highly efficient system for achieving a frequency of correctly integrated mutants approaching 100%. The expression system included pyr2 as selective marker (section 2.1.2), which provided an extremely reliable bidirectional selective system. The applicability of the entire expression system was supported by expressing a Thermomyces lanuginosus lipase as reporter protein. An interesting side note is that one of the two genetic deletions performed to substantiate that pyr2 could be used as a bidirectional marker was the PKS gene with JGI ID 82208. The amino acid sequence of the predicted protein of this gene bears great similarity to the A. nidulans PKS YWA1, encoded by wA, that synthesizes the PK precursor for the spore pigment melanine (Watanabe, Ono et al. 1998). As for the wA gene in A. nidulans, deletion of the PKS gene with JGI ID 82208 in T. reesei resulted in formation of white spores.
To pursue the primary goal – elucidation of the secondary metabolism of T. reesei - two concurrent approaches were followed.
Manuscript II (Identification of the sorbicillinoid gene cluster in Trichoderma reesei (teleomorph Hypocrea jecorina) by overexpression of PKS and NRPS cluster specific transcription factors (section 3.2)) described overexpression of 11 putative PKS-, NRPS- and hybrid synthetase gene cluster specific TFs and identification of the PKS cluster responsible for biosynthesis of the PK derived sorbicillinoids. As speculated, the expression system described in Manuscript I proved to be a valuable tool in the quest for elucidating the secondary metabolic potential of T. reesei. Out of the 30 TF genes that were identified within a 50 kb radius of the PKS-, NRPS- or hybrid synthetase genes in the T. reesei genome, 11 were overexpressed using the expression system. Two mutants, both overexpressing the same TF gene (JGI ID 102499), were shown to over-produce as many as 78 independent metabolites; of which several could be appointed to the previously described group of PKs, sorbicillinoids. A subsequent deletion study showed that all of the over-produced metabolites were products of two collaborative PKSs encoded by genes adjacent to the overexpressed TF gene. Hence, the genes involved in biosynthesis of sorbicillinoids were pin-pointed for the first time. Comparative genomics furthermore led to identification of a highly similar gene cluster in the well-known sorbicillinoid producer P. chrysogenum, indicating that the sorbicillinoid gene cluster was identified in two separate species in connection with this study.
94
4. Summation and Perspectives PhD Thesis Mikael Skaanning Jørgensen
Manuscript III (Heterologous expression of Trichoderma reesei (teleomorph Hypocrea jecorina) polyketide synthase-, non-ribosomal peptide synthetase and hybrid synthetase genes in Aspergillus nidulans (section 3.3)) described heterologous expression of 23 of the 26 PKS-, NRPS- or hybrid synthetase genes identified in the T. reesei genome in A. nidulans using a previously developed expression system (Hansen, Salomonsen et al. 2011). Interestingly, eight of the isolated mutants had changed phenotypes, indicating that the inserted genes were indeed overexpressed in the A. nidulans background. Subsequent metabolite analysis unfortunately failed in pin-pointing presence of any new metabolites synthesized by the proteins encoded by the inserted T. reesei PKS-, NRPS- or hybrid synthetase genes. The results indicate that the limitation of the applied method was connected to the extraction and/or analysis method and not expression of the T. reesei PKS-, NRPS- or hybrid synthetase genes. Four of the obtained A. nidulans heterologous expression mutants were more pigmented in the reverse than the control strain; one of these overexpressed the PKS gene with JGI ID 82208, which led to formation of white spores when deleted in T. reesei (Manuscript I). The pigment production when the gene is overexpressed in A. nidulans further supports that this gene could encode the PKS involved in formation of the PK precursor of the spore pigment melanine, as speculated. The remaining four mutants with altered phenotypes, all showed changed colony morphology. Three of these overexpressed NRPSs that had severe negative effect on the growth rates of the mutants which all produced two NRPs which had not previously been observed for A. nidulans. Biosynthesis of these two NRPs in three different mutants indicated that they were not products of the inserted T. reesei NRPSs, but could be a part of an A. nidulans defense response towards other fungi; initiated when subjected to foreign NRPs. The remaining mutant with changed colony morphology had been transformed with four overlapping fragments of the 69.5 kb putative paracelsin synthase gene with JGI ID 23171. The changed phenotype for this mutant was surprising since diagnostic PCRs showed that only fragment one and four of the gene was present in the mutant, indicating that homologous recombination could have happened between these; possibly facilitated by the repeated sequences of the NRPS gene. Whether the changed phenotype was caused by production of a new smaller NRP or by insertion of the large gene fragments was not established in the duration of the study.
This study provides an interesting initial insight into the genetics of the secondary metabolism of T. reesei. For the first time a linkage was established between a T. reesei PKS cluster and the corresponding metabolites; it also serves as the first reported identification of a sorbicillinoid synthase gene cluster in any organism. Interestingly, some sorbicillinoids have previously been reported to exhibit beneficial activities such as anticancer, anti-inflammatory and anti-oxidative (Balde, Andolfi et al. 2010, Lee, Lee et al. 2005, Washida, Abe et al. 2007) and the plethora of sorbicillinoids produced by the transcription factor overexpressing strains could therefore constitute an interesting source for new drug leads. The results of the A. nidulans heterologous expression study enlighten the need for optimization of the applied extraction and/or analysis method before providing a feasible source of insights into the secondary metabolism of T. reesei. The different phenotypes observed for several mutants indicate that the system could provide highly interesting information after implementation of optimizations.
95
4. Summation and Perspectives PhD Thesis Mikael Skaanning Jørgensen
The developed system for defined integration of T. reesei expression mutants constitutes a unique tool for further elucidation of the T. reesei secondary metabolism. Also important, the system is not limited to unravel the secondary metabolism, but can be utilized for expression of all genes of interest. The utilized A. nidulans PgpdA promoter does not serve as a strong promoter in T. reesei, but this can easily be replaced by another promoter of interest by uracil-excision cloning (section 2.1.3). Furthermore, the highly efficient bidirectional selection system, based on pyr2, could gain wide usage for all genetic engineering performed in T. reesei.
96
5. References PhD Thesis Mikael Skaanning Jørgensen
5. References
ABDEL-LATEFF, A., 2004. Secondary Metabolites of Marine Derived Fungi: Natural Product Chemistry and Biological Activity. ABE, N., YAMAMOTO, K. and HIROTA, A., 2000. Novel fungal metabolites, demethylsorbicillin and oxosorbicillinol, isolated from Trichoderma sp. USF-2690. Bioscience, biotechnology, and biochemistry, 64(3), pp. 620-622. AHUJA, M., CHIANG, Y.M., CHANG, S.L., PRASEUTH, M.B., ENTWISTLE, R., SANCHEZ, J.F., LO, H.C., YEH, H.H., OAKLEY, B.R. and WANG, C.C., 2012. Illuminating the diversity of aromatic polyketide synthases in Aspergillus nidulans. Journal of the American Chemical Society, 134(19), pp. 8212-8221. ANDERSSON, J.A., ANDERSSON, C.A. and FRANDSEN, R.J., 2009. Applying Parallel Factor Analysis models to HPLC diode array detector datasets reveals strain dependent regulation of polyketide biosynthesis in Fusarium graminearum, Fusarium culmorum and Fusarium pseudograminearum. Analytica Chimica Acta, 647(2), pp. 243-248. ANDRADE, R., AYER, W.A. and MEBE, P.P., 1992. The metabolites of Trichodermalongibrachiatum. Part 1. Isolation of the metabolites and the structure of trichodimerol. Canadian Journal of Chemistry, 70(10), pp. 2526-2535. ANDRADE, R., AYER, W.A. and TRIFONOV, L.S., 1996. The metabolites of Trichoderma longibrachiatum. Part II The structures of trichodermolide and sorbiquinol. Canadian Journal of Chemistry, 74(3), pp. 371-379. AZIZ, N.H. and MOUSSA, L.A., 1997. Influence of white light, near-UV irradiation and other environmental conditions on production of aflatoxin B1 by Aspergillus flavus and ochratoxin A by Aspergillus ochraceus. Die Nahrung, 41(3), pp. 150-154. BAKER, S.E., PERRONE, G., RICHARDSON, N.M., GALLO, A. and KUBICEK, C.P., 2012. Phylogenomic analysis of polyketide synthase-encoding genes in Trichoderma. Microbiology (Reading, England), 158(Pt 1), pp. 147-154. BALDE, E.S., ANDOLFI, A., BRUYERE, C., CIMMINO, A., LAMORAL-THEYS, D., VURRO, M., DAMME, M.V., ALTOMARE, C., MATHIEU, V., KISS, R. and EVIDENTE, A., 2010. Investigations of fungal secondary metabolites with potential anticancer activity. Journal of natural products, 73(5), pp. 969-971. BALLANCE, D.J. and TURNER, G., 1985. Development of a high-frequency transforming vector for Aspergillus nidulans. Gene, 36(3), pp. 321-331. BARKOVICH, R. and LIAO, J.C., 2001. Metabolic engineering of isoprenoids. Metabolic engineering, 3(1), pp. 27-39. BARNES, S.E., DOLA, T.P., BENNETT, J.W. and BHATNAGAR, D., 1994. Synthesis of sterigmatocystin on a chemically defined medium by species of Aspergillus and Chaetomium. Mycopathologia, 125(3), pp. 173-178. BARREDO, J.L., VAN SOLINGEN, P., DIEZ, B., ALVAREZ, E., CANTORAL, J.M., KATTEVILDER, A., SMAAL, E.B., GROENEN, M.A., VEENSTRA, A.E. and MARTIN, J.F., 1989. Cloning and characterization of the acyl-coenzyme A: 6-aminopenicillanic-acid- acyltransferase gene of Penicillium chrysogenum. Gene, 83(2), pp. 291-300. BAYRAM, O., KRAPPMANN, S., NI, M., BOK, J.W., HELMSTAEDT, K., VALERIUS, O., BRAUS-STROMEYER, S., KWON, N.J., KELLER, N.P., YU, J.H. and BRAUS, G.H., 2008. VelB/VeA/LaeA complex coordinates light signal with fungal development and secondary metabolism. Science, 320(1095-9203; 5882), pp. 1504-1506. BECK, P., DINGERMANN, T. and WINCKLER, T., 2002. Transfer RNA gene-targeted retrotransposition of Dictyostelium TRE5-A into a chromosomal UMP synthase gene trap. Journal of Molecular Biology, 318(2), pp. 273-285. BEGUIN, P., 1990. Molecular biology of cellulose degradation. Annual Review of Microbiology, 44, pp. 219-248. BENTLEY, R., 1999. Secondary metabolite biosynthesis: the first century. Critical reviews in biotechnology, 19(1), pp. 1-40. BERGMANN, S., FUNK, A.N., SCHERLACH, K., SCHROECKH, V., SHELEST, E., HORN, U., HERTWECK, C. and BRAKHAGE, A.A., 2010. Activation of a silent fungal polyketide biosynthesis pathway through regulatory cross talk with a cryptic nonribosomal peptide
97
5. References PhD Thesis Mikael Skaanning Jørgensen synthetase gene cluster. Applied and Environmental Microbiology, 76(24), pp. 8143- 8149. BERGMANN, S., SCHUMANN, J., SCHERLACH, K., LANGE, C., BRAKHAGE, A.A. and HERTWECK, C., 2007. Genomics-driven discovery of PKS-NRPS hybrid metabolites from Aspergillus nidulans. Nature chemical biology, 3(4), pp. 213-217. BITAN-BANIN, G., ORTENBERG, R. and MEVARECH, M., 2003. Development of a gene knockout system for the halophilic archaeon Haloferax volcanii by use of the pyrE gene. Journal of Bacteriology, 185(3), pp. 772-778. BOK, J.W., CHIANG, Y.M., SZEWCZYK, E., REYES-DOMINGUEZ, Y., DAVIDSON, A.D., SANCHEZ, J.F., LO, H.C., WATANABE, K., STRAUSS, J., OAKLEY, B.R., WANG, C.C. and KELLER, N.P., 2009. Chromatin-level regulation of biosynthetic gene clusters. Nature chemical biology, 5(7), pp. 462-464. BOK, J.W., HOFFMEISTER, D., MAGGIO-HALL, L.A., MURILLO, R., GLASNER, J.D. and KELLER, N.P., 2006. Genomic mining for Aspergillus natural products. Chemistry & biology, 13(1074-5521; 1), pp. 31-37. BOK, J.W. and KELLER, N.P., 2004. LaeA, a regulator of secondary metabolism in Aspergillus spp. Eukaryot.Cell, 3(1535-9778; 2), pp. 527-535. BOK, J.W., NOORDERMEER, D., KALE, S.P. and KELLER, N.P., 2006. Secondary metabolic gene cluster silencing in Aspergillus nidulans. Molecular microbiology, 61(0950-382; 6), pp. 1636-1645. BRAKHAGE, A.A., 1998. Molecular regulation of beta-lactam biosynthesis in filamentous fungi. Microbiology and molecular biology reviews : MMBR, 62(3), pp. 547-585. BRAKHAGE, A.A. and SCHROECKH, V., 2011. Fungal secondary metabolites - strategies to activate silent gene clusters. Fungal genetics and biology : FG & B, 48(1), pp. 15-22. BRAKHAGE, A.A., THON, M., SPROTE, P., SCHARF, D.H., AL-ABDALLAH, Q., WOLKE, S.M. and HORTSCHANSKY, P., 2009. Aspects on evolution of fungal beta-lactam biosynthesis gene clusters and recruitment of trans-acting factors. Phytochemistry, 70(15-16), pp. 1801-1811. BRINGMANN, G., LANG, G., GULDER, T.A.M., TSURUTA, H., MÜHLBACHER, J., MAKSIMENKA, K., STEFFENS, S., SCHAUMANN, K., STÖHR, R., WIESE, J., IMHOFF, J.F., PEROVIĆ-OTTSTADT, S., BOREIKO, O. and MÜLLER, W.E.G., 2005. The first sorbicillinoid alkaloids, the antileukemic sorbicillactones A and B, from a sponge-derived Penicillium chrysogenum strain. Tetrahedron, 61(30), pp. 7252-7265. BRODHAGEN, M. and KELLER, N.P., 2006. Signalling pathways connecting mycotoxin production and sporulation. Molecular plant pathology, 7(4), pp. 285-301. CABRERA, G.M., BUTLER, M., RODRIGUEZ, M.A., GODEAS, A., HADDAD, R. and EBERLIN, M.N., 2006. A sorbicillinoid urea from an intertidal Paecilomyces marquandii. Journal of natural products, 69(12), pp. 1806-1808. CALVO, A.M., BOK, J., BROOKS, W. and KELLER, N.P., 2004. veA is required for toxin and sclerotial production in Aspergillus parasiticus. Applied and Environmental Microbiology, 70(8), pp. 4733-4739. CALVO, A.M., WILSON, R.A., BOK, J.W. and KELLER, N.P., 2002. Relationship between secondary metabolism and fungal development. Microbiology and molecular biology reviews : MMBR, 66(1092-2172; 3), pp. 447-59, table. CARVALHO, N.D., ARENTSHORST, M., JIN KWON, M., MEYER, V. and RAM, A.F., 2010. Expanding the ku70 toolbox for filamentous fungi: establishment of complementation vectors and recipient strains for advanced gene analyses. Applied Microbiology and Biotechnology, 87(4), pp. 1463-1473. CATALANO, V., VERGARA, M., HAUZENBERGER, J.R., SEIBOTH, B., SARROCCO, S., VANNACCI, G., KUBICEK, C.P. and SEIDL-SEIBOTH, V., 2011. Use of a non-homologous end-joining-deficient strain (delta-ku70) of the biocontrol fungus Trichoderma virens to investigate the function of the laccase gene lcc1 in sclerotia degradation. Current genetics, 57(1), pp. 13-23. CHANG, P.K., HORN, B.W. and DORNER, J.W., 2009. Clustered genes involved in cyclopiazonic acid production are next to the aflatoxin biosynthesis gene cluster in Aspergillus flavus. Fungal genetics and biology : FG & B, 46(2), pp. 176-182.
98
5. References PhD Thesis Mikael Skaanning Jørgensen
CHERRY, J.R. and FIDANTSEF, A.L., 2003. Directed evolution of industrial enzymes: an update. Current opinion in biotechnology, 14(4), pp. 438-443. CHIANG, Y.M., CHANG, S.L., OAKLEY, B.R. and WANG, C.C., 2011. Recent advances in awakening silent biosynthetic gene clusters and linking orphan clusters to natural products in microorganisms. Current opinion in chemical biology, 15(1), pp. 137-143. CHIANG, Y.M., LEE, K.H., SANCHEZ, J.F., KELLER, N.P. and WANG, C.C., 2009. Unlocking fungal cryptic natural products. Natural product communications, 4(11), pp. 1505-1510. CHIANG, Y.M., OAKLEY, B.R., KELLER, N.P. and WANG, C.C., 2010. Unraveling polyketide synthesis in members of the genus Aspergillus. Applied Microbiology and Biotechnology, 86(1432-0614; 0175-7598; 6), pp. 1719-1736. CHIANG, Y.M., SZEWCZYK, E., DAVIDSON, A.D., KELLER, N., OAKLEY, B.R. and WANG, C.C., 2009. A gene cluster containing two fungal polyketide synthases encodes the biosynthetic pathway for a polyketide, asperfuranone, in Aspergillus nidulans. Journal of the American Chemical Society, 131(8), pp. 2965-2970. CHIANG, Y.M., SZEWCZYK, E., NAYAK, T., DAVIDSON, A.D., SANCHEZ, J.F., LO, H.C., HO, W.Y., SIMITYAN, H., KUO, E., PRASEUTH, A., WATANABE, K., OAKLEY, B.R. and WANG, C.C., 2008. Molecular genetic mining of the Aspergillus secondary metabolome: discovery of the emericellamide biosynthetic pathway. Chemistry & biology, 15(6), pp. 527-532. CHOQUER, M., ROBIN, G., LE PECHEUR, P., GIRAUD, C., LEVIS, C. and VIAUD, M., 2008. Ku70 or Ku80 deficiencies in the fungus Botrytis cinerea facilitate targeting of genes that are hard to knock out in a wild-type context. FEMS microbiology letters, 289(2), pp. 225-232. COLLEMARE, J., BILLARD, A., BOHNERT, H.U. and LEBRUN, M.H., 2008. Biosynthesis of secondary metabolites in the rice blast fungus Magnaporthe grisea: the role of hybrid PKS-NRPS in pathogenicity. Mycological Research, 112(Pt 2), pp. 207-215. COOPER, R.D., 1993. The enzymes involved in biosynthesis of penicillin and cephalosporin; their structure and function. Bioorganic & medicinal chemistry, 1(1), pp. 1-17. COVE, D.J., 1966. The induction and repression of nitrate reductase in the fungus Aspergillus nidulans. Biochimica et biophysica acta, 113(1), pp. 51-56. COX, R.J., GLOD, F., HURLEY, D., LAZARUS, C.M., NICHOLSON, T.P., RUDD, B.A., SIMPSON, T.J., WILKINSON, B. and ZHANG, Y., 2004. Rapid cloning and expression of a fungal polyketide synthase gene involved in squalestatin biosynthesis. Chemical communications (Cambridge, England), (20)(20), pp. 2260-2261. DAVE, M.N. and CHATTOO, B.B., 1997. A counter-selectable marker for genetic transformation of the yeast Schwanniomyces alluvius. Applied Microbiology and Biotechnology, 48(2), pp. 204-207. DAVID, H., OZCELIK, I.S., HOFMANN, G. and NIELSEN, J., 2008. Analysis of Aspergillus nidulans metabolism at the genome-scale. BMC genomics, 9, pp. 163. DAVISON, J., AL FAHAD, A., CAI, M., SONG, Z., YEHIA, S.Y., LAZARUS, C.M., BAILEY, A.M., SIMPSON, T.J. and COX, R.J., 2012. Genetic, molecular, and biochemical basis of fungal tropolone biosynthesis. Proceedings of the National Academy of Sciences of the United States of America, 109(20), pp. 7642-7647. DE BOER, P., BASTIAANS, J., TOUW, H., KERKMAN, R., BRONKHOF, J., VAN DEN BERG, M. and OFFRINGA, R., 2010. Highly efficient gene targeting in Penicillium chrysogenum using the bi-partite approach in deltalig4 or deltaku70 mutants. Fungal genetics and biology : FG & B, 47(10), pp. 839-846. DE, I.O.N.G.H., BEERTHUIS, R.K., VLES, R.O., BARRETT, C.B. and ORD, W.O., 1962. Investigation of the factor in groundnut meal responsible for "turkey X disease". Biochimica et biophysica acta, 65, pp. 548-551. DEMAIN, A.L. and ELANDER, R.P., 1999. The beta-lactam antibiotics: past, present, and future. Antonie van Leeuwenhoek, 75(1-2), pp. 5-19. DEMAIN, A.L. and FANG, A., 2000. The natural functions of secondary metabolites. Advances in Biochemical Engineering/Biotechnology, 69, pp. 1-39. DIENER, S.E., DUNN-COLEMAN, N., FOREMAN, P., HOUFEK, T.D., TEUNISSEN, P.J., VAN SOLINGEN, P., DANKMEYER, L., MITCHELL, T.K., WARD, M. and DEAN, R.A., 2004.
99
5. References PhD Thesis Mikael Skaanning Jørgensen
Characterization of the protein processing and secretion pathways in a comprehensive set of expressed sequence tags from Trichoderma reesei. FEMS microbiology letters, 230(2), pp. 275-282. DONOWITZ, G.R., 1989. Third generation cephalosporins. Infectious disease clinics of North America, 3(3), pp. 595-612. DU, M., BATTLES, M.B. and NETT, J.H., 2012. A color-based stable multi-copy integrant selection system for Pichia pastoris using the attenuated ADE1 and ADE2 genes as auxotrophic markers. Bioengineered bugs, 3(1), pp. 32-37. DUDNIK, A., BIGLER, L. and DUDLER, R., 2012. Heterologous expression of a Photorhabdus luminescens syrbactin-like gene cluster results in production of the potent proteasome inhibitor glidobactin A. Microbiological research, . EDMAN, J.C. and KWON-CHUNG, K.J., 1990. Isolation of the URA5 gene from Cryptococcus neoformans var. neoformans and its use as a selective marker for transformation. Molecular and cellular biology, 10(9), pp. 4538-4544. EVELEIGH, D.E. and MONTENECOURT, B.S., 1979. Increasing yields of extracellular enzymes. Advances in Applied Microbiology, 25, pp. 57-74. FELNAGLE, E.A., JACKSON, E.E., CHAN, Y.A., PODEVELS, A.M., BERTI, A.D., MCMAHON, M.D. and THOMAS, M.G., 2008. Nonribosomal peptide synthetases involved in the production of medically relevant natural products. Molecular pharmaceutics, 5(2), pp. 191-211. FINKING, R. and MARAHIEL, M.A., 2004. Biosynthesis of nonribosomal peptides1. Annual Review of Microbiology, 58, pp. 453-488. FISHER, C.R., 1969. Enzymology of the pigmented adenine-requiring mutants of Saccharomyces and Schizosaccharomyces. Biochemical and biophysical research communications, 34(3), pp. 306-310. FOREMAN, P.K., BROWN, D., DANKMEYER, L., DEAN, R., DIENER, S., DUNN-COLEMAN, N.S., GOEDEGEBUUR, F., HOUFEK, T.D., ENGLAND, G.J., KELLEY, A.S., MEERMAN, H.J., MITCHELL, T., MITCHINSON, C., OLIVARES, H.A., TEUNISSEN, P.J., YAO, J. and WARD, M., 2003. Transcriptional regulation of biomass-degrading enzymes in the filamentous fungus Trichoderma reesei. The Journal of biological chemistry, 278(34), pp. 31988- 31997. FREEMAN, M.F., GURGUI, C., HELF, M.J., MORINAKA, B.I., URIA, A.R., OLDHAM, N.J., SAHL, H.G., MATSUNAGA, S. and PIEL, J., 2012. Metagenome mining reveals polytheonamides as posttranslationally modified ribosomal peptides. Science (New York, N.Y.), 338(6105), pp. 387-390. FUJII, I., WATANABE, A., SANKAWA, U. and EBIZUKA, Y., 2001. Identification of Claisen cyclase domain in fungal polyketide synthase WA, a naphthopyrone synthase of Aspergillus nidulans. Chemistry & biology, 8(2), pp. 189-197. GALAGAN, J.E., CALVO, S.E., BORKOVICH, K.A., SELKER, E.U., READ, N.D., JAFFE, D., FITZHUGH, W., MA, L.J., SMIRNOV, S., PURCELL, S., REHMAN, B., ELKINS, T., ENGELS, R., WANG, S., NIELSEN, C.B., BUTLER, J., ENDRIZZI, M., QUI, D., IANAKIEV, P., BELL- PEDERSEN, D., NELSON, M.A., WERNER-WASHBURNE, M., SELITRENNIKOFF, C.P., KINSEY, J.A., BRAUN, E.L., ZELTER, A., SCHULTE, U., KOTHE, G.O., JEDD, G., MEWES, W., STABEN, C., MARCOTTE, E., GREENBERG, D., ROY, A., FOLEY, K., NAYLOR, J., STANGE-THOMANN, N., BARRETT, R., GNERRE, S., KAMAL, M., KAMVYSSELIS, M., MAUCELI, E., BIELKE, C., RUDD, S., FRISHMAN, D., KRYSTOFOVA, S., RASMUSSEN, C., METZENBERG, R.L., PERKINS, D.D., KROKEN, S., COGONI, C., MACINO, G., CATCHESIDE, D., LI, W., PRATT, R.J., OSMANI, S.A., DESOUZA, C.P., GLASS, L., ORBACH, M.J., BERGLUND, J.A., VOELKER, R., YARDEN, O., PLAMANN, M., SEILER, S., DUNLAP, J., RADFORD, A., ARAMAYO, R., NATVIG, D.O., ALEX, L.A., MANNHAUPT, G., EBBOLE, D.J., FREITAG, M., PAULSEN, I., SACHS, M.S., LANDER, E.S., NUSBAUM, C. and BIRREN, B., 2003. The genome sequence of the filamentous fungus Neurospora crassa. Nature, 422(6934), pp. 859-868. GALAGAN, J.E., CALVO, S.E., CUOMO, C., MA, L., WORTMAN, J.R., BATZOGLOU, S., LEE, S., BASTURKMEN, M., SPEVAK, C.C., CLUTTERBUCK, J., KAPITONOV, V., JURKA, J., SCAZZOCCHIO, C., FARMAN, M., BUTLER, J., PURCELL, S., HARRIS, S., BRAUS, G.H., DRAHT, O., BUSCH, S., D'ENFERT, C., BOUCHIER, C., GOLDMAN, G.H., BELL-PEDERSEN,
100
5. References PhD Thesis Mikael Skaanning Jørgensen
D., GRIFFITHS-JONES, S., DOONAN, J.H., YU, J., VIENKEN, K., PAIN, A., FREITAG, M., SELKER, E.U., ARCHER, D.B., PENALVA, M.A., OAKLEY, B.R., MOMANY, M., TANAKA, T., KUMAGAI, T., ASAI, K., MACHIDA, M., NIERMAN, W.C., DENNING, D.W., CADDICK, M., HYNES, M., PAOLETTI, M., FISCHER, R., MILLER, B., DYER, P., SACHS, M.S., OSMANI, S.A. and BIRREN, B.W., 2005. Sequencing of Aspergillus nidulans and comparative analysis with A. fumigatus and A. oryzae. Nature, 438(7071), pp. 1105-1115. GALLAGHER, K.A., FENICAL, W. and JENSEN, P.R., 2010. Hybrid isoprenoid secondary metabolite production in terrestrial and marine actinomycetes. Current opinion in biotechnology, 21(6), pp. 794-800. GAO, J.M., QIN, J.C., PESCITELLI, G., DI PIETRO, S., MA, Y.T. and ZHANG, A.L., 2010. Structure and absolute configuration of toxic polyketide pigments from the fruiting bodies of the fungus Cortinarius rufo-olivaceus. Organic & biomolecular chemistry, 8(15), pp. 3543-3551. GERC, A.J., SONG, L., CHALLIS, G.L., STANLEY-WALL, N.R. and COULTHURST, S.J., 2012. The Insect Pathogen Serratia marcescens Db10 Uses a Hybrid Non-Ribosomal Peptide Synthetase-Polyketide Synthase to Produce the Antibiotic Althiomycin. PloS one, 7(9), pp. e44673. GERKE, J., BAYRAM, O., FEUSSNER, K., LANDESFEIND, M., SHELEST, E., FEUSSNER, I. and BRAUS, G.H., 2012. Breaking the Silence: Protein Stabilization Uncovers Silenced Biosynthetic Gene Clusters in the Fungus Aspergillus nidulans. Applied and Environmental Microbiology, 78(23), pp. 8234-8244. GEU-FLORES, F., NOUR-ELDIN, H.H., NIELSEN, M.T. and HALKIER, B.A., 2007. USER fusion: a rapid and efficient method for simultaneous fusion and cloning of multiple PCR products. Nucleic acids research, 35(7), pp. e55. GILROY, D.J., KAUFFMAN, K.W., HALL, R.A., HUANG, X. and CHU, F.S., 2000. Assessing potential health risks from microcystin toxins in blue-green algae dietary supplements. Environmental health perspectives, 108(5), pp. 435-439. GOLDMAN, G.H. and KAFER, E., 2004. Aspergillus nidulans as a model system to characterize the DNA damage response in eukaryotes. Fungal genetics and biology : FG & B, 41(4), pp. 428-442. GOOSEN, T., BLOEMHEUVEL, G., GYSLER, C., DE BIE, D.A., VAN DEN BROEK, H.W. and SWART, K., 1987. Transformation of Aspergillus niger using the homologous orotidine-5'- phosphate-decarboxylase gene. Current genetics, 11(6-7), pp. 499-503. GRUBER, F., VISSER, J., KUBICEK, C.P. and DE GRAAFF, L.H., 1990. The development of a heterologous transformation system for the cellulolytic fungus Trichoderma reesei based on a pyrG-negative mutant strain. Current genetics, 18(0172-8083; 0172-8083; 1), pp. 71-76. GUANGTAO, Z., HARTL, L., SCHUSTER, A., POLAK, S., SCHMOLL, M., WANG, T., SEIDL, V. and SEIBOTH, B., 2009. Gene targeting in a nonhomologous end joining deficient Hypocrea jecorina. Journal of Biotechnology, 139(0168-1656; 2), pp. 146-151. HALO, L.M., MARSHALL, J.W., YAKASAI, A.A., SONG, Z., BUTTS, C.P., CRUMP, M.P., HENEGHAN, M., BAILEY, A.M., SIMPSON, T.J., LAZARUS, C.M. and COX, R.J., 2008. Authentic heterologous expression of the tenellin iterative polyketide synthase nonribosomal peptide synthetase requires coexpression with an enoyl reductase. Chembiochem : a European journal of chemical biology, 9(4), pp. 585-594. HAMILTON, M.D., NUARA, A.A., GAMMON, D.B., BULLER, R.M. and EVANS, D.H., 2007. Duplex strand joining reactions catalyzed by vaccinia virus DNA polymerase. Nucleic acids research, 35(1), pp. 143-151. HANSEN, B.G., SALOMONSEN, B., NIELSEN, M.T., NIELSEN, J.B., HANSEN, N.B., NIELSEN, K.F., REGUEIRA, T.B., NIELSEN, J., PATIL, K.R. and MORTENSEN, U.H., 2011. Versatile enzyme expression and characterization system for Aspergillus nidulans, with the Penicillium brevicompactum polyketide synthase gene from the mycophenolic acid gene cluster as a test case. Applied and Environmental Microbiology, 77(9), pp. 3044- 3051. HARNED, A.M. and VOLP, K.A., 2011. The sorbicillinoid family of natural products: isolation, biosynthesis, and synthetic studies. Natural product reports, 28(11), pp. 1790- 1810.
101
5. References PhD Thesis Mikael Skaanning Jørgensen
HARTL, L. and SEIBOTH, B., 2005. Sequential gene deletions in Hypocrea jecorina using a single blaster cassette. Current genetics, 48(0172-8083; 0172-8083; 3), pp. 204-211. HE, Z.M., PRICE, M.S., OBRIAN, G.R., GEORGIANNA, D.R. and PAYNE, G.A., 2007. Improved protocols for functional analysis in the pathogenic fungus Aspergillus flavus. BMC microbiology, 7, pp. 104. HERRMANN, K.M., 1995. The shikimate pathway as an entry to aromatic secondary metabolism. Plant Physiology, 107(1), pp. 7-12. HOFFMEISTER, D. and KELLER, N.P., 2007. Natural products of filamentous fungi: enzymes, genes, and their regulation. Natural product reports, 24(0265-0568; 2), pp. 393-416. HOUBRAKEN, J., FRISVAD, J.C. and SAMSON, R.A., 2011. Fleming's penicillin producing strain is not Penicillium chrysogenum but P. rubens. IMA fungus, 2(1), pp. 87-95. HUR, S. and BRUICE, T.C., 2002. Molecular dynamic study of orotidine-5'- monophosphate decarboxylase in ground state and in intermediate state: a role of the 203-218 loop dynamics. Proceedings of the National Academy of Sciences of the United States of America, 99(15), pp. 9668-9673. IGARASHI, D., ISHIDA, S., FUKAZAWA, J. and TAKAHASHI, Y., 2001. 14-3-3 proteins regulate intracellular localization of the bZIP transcriptional activator RSG. The Plant Cell, 13(11), pp. 2483-2497. JIANG, D., HATAHET, Z., MELAMEDE, R.J., KOW, Y.W. and WALLACE, S.S., 1997. Characterization of Escherichia coli endonuclease VIII. The Journal of biological chemistry, 272(51), pp. 32230-32239. JIN, F.J., MARUYAMA, J., JUVVADI, P.R., ARIOKA, M. and KITAMOTO, K., 2004. Adenine auxotrophic mutants of Aspergillus oryzae: development of a novel transformation system with triple auxotrophic hosts. Bioscience, biotechnology, and biochemistry, 68(3), pp. 656-662. JIN, F.J., MARUYAMA, J., JUVVADI, P.R., ARIOKA, M. and KITAMOTO, K., 2004. Development of a novel quadruple auxotrophic host transformation system by argB gene disruption using adeA gene and exploiting adenine auxotrophy in Aspergillus oryzae. FEMS microbiology letters, 239(1), pp. 79-85. JOHNSTONE, I.L., HUGHES, S.G. and CLUTTERBUCK, A.J., 1985. Cloning an Aspergillus nidulans developmental gene by transformation. The EMBO journal, 4(5), pp. 1307- 1311. JULSING, M.K., KOULMAN, A., WOERDENBAG, H.J., QUAX, W.J. and KAYSER, O., 2006. Combinatorial biosynthesis of medicinal plant secondary metabolites. Biomolecular engineering, 23(6), pp. 265-279. KAHL, C.R. and MEANS, A.R., 2003. Regulation of cell cycle progression by calcium/calmodulin-dependent pathways. Endocrine reviews, 24(6), pp. 719-736. KATO, N., BROOKS, W. and CALVO, A.M., 2003. The expression of sterigmatocystin and penicillin genes in Aspergillus nidulans is controlled by veA, a gene required for sexual development. Eukaryotic cell, 2(6), pp. 1178-1186. KELLER, N.P. and HOHN, T.M., 1997. Metabolic Pathway Gene Clusters in Filamentous Fungi. Fungal genetics and biology : FG & B, 21(1), pp. 17-29. KELLER, N.P., TURNER, G. and BENNETT, J.W., 2005. Fungal secondary metabolism [mdash] from biochemistry to genomics. Nat Rev Micro, 3(12), pp. 937-947. KHALDI, N. and WOLFE, K.H., 2011. Evolutionary Origins of the Fumonisin Secondary Metabolite Gene Cluster in Fusarium verticillioides and Aspergillus niger. International journal of evolutionary biology, 2011, pp. 423821. KIRKMAN, L.A. and DEITSCH, K.W., 2012. Antigenic variation and the generation of diversity in malaria parasites. Current opinion in microbiology, 15(4), pp. 456-462. KOCH, A.L., 2000. Penicillin binding proteins, beta-lactams, and lactamases: offensives, attacks, and defensive countermeasures. Critical reviews in microbiology, 26(4), pp. 205-220. KOCH, A.L., 2000. Penicillin binding proteins, beta-lactams, and lactamases: offensives, attacks, and defensive countermeasures. Critical reviews in microbiology, 26(4), pp. 205-220.
102
5. References PhD Thesis Mikael Skaanning Jørgensen
KONTANI, M., SAKAGAMI, Y. and MARUMO, S., 1994. ChemInform Abstract: First ?-1,6- Glucan Biosynthesis Inhibitor, Bisvertinolone, Isolated from Fungus Acremonium strictum and Its Absolute Stereochemistry. ChemInform, 25(33), pp. no-no. KOSSEL, A., 1891. Ueber Abkömmlinge der Phenylamidoessigsäure. Berichte der deutschen chemischen Gesellschaft, 24(2), pp. 4145-4156. KUBICEK, C.P., MIKUS, M., SCHUSTER, A., SCHMOLL, M. and SEIBOTH, B., 2009. Metabolic engineering strategies for the improvement of cellulase production by Hypocrea jecorina. Biotechnology for biofuels, 2, pp. 19. KUHLS, K., LIECKFELDT, E., SAMUELS, G.J., KOVACS, W., MEYER, W., PETRINI, O., GAMS, W., BORNER, T. and KUBICEK, C.P., 1996. Molecular evidence that the asexual industrial fungus Trichoderma reesei is a clonal derivative of the ascomycete Hypocrea jecorina. Proceedings of the National Academy of Sciences of the United States of America, 93(15), pp. 7755-7760. KURTZMAN, C.P., HORN, B.W. and HESSELTINE, C.W., 1987. Aspergillus nomius, a new aflatoxin-producing species related to Aspergillus flavus and Aspergillus tamarii. Antonie van Leeuwenhoek, 53(3), pp. 147-158. LEE, D., LEE, J.H., CAI, X.F., SHIN, J.C., LEE, K., HONG, Y.S. and LEE, J.J., 2005. Fungal metabolites, sorbicillinoid polyketides and their effects on the activation of peroxisome proliferator-activated receptor gamma. The Journal of antibiotics, 58(10), pp. 615-620. LI, Z.H., DU, C.M., ZHONG, Y.H. and WANG, T.H., 2010. Development of a highly efficient gene targeting system allowing rapid genetic manipulations in Penicillium decumbens. Applied Microbiology and Biotechnology, 87(3), pp. 1065-1076. LIGON, B.L., 2004. Penicillin: its discovery and early development. Seminars in pediatric infectious diseases, 15(1), pp. 52-57. LILIEN, R.H., STEVENS, B.W., ANDERSON, A.C. and DONALD, B.R., 2005. A novel ensemble-based scoring and search algorithm for protein redesign and its application to modify the substrate specificity of the gramicidin synthetase a phenylalanine adenylation enzyme. Journal of computational biology : a journal of computational molecular cell biology, 12(6), pp. 740-761. LIM, S.P., ROONGSAWANG, N., WASHIO, K. and MORIKAWA, M., 2007. Functional analysis of a pyoverdine synthetase from Pseudomonas sp. MIS38. Bioscience, biotechnology, and biochemistry, 71(8), pp. 2002-2009. LINDAHL, T., LJUNGQUIST, S., SIEGERT, W., NYBERG, B. and SPERENS, B., 1977. DNA N-glycosidases: properties of uracil-DNA glycosidase from Escherichia coli. The Journal of biological chemistry, 252(10), pp. 3286-3294. LIU, T., WANG, T., LI, X. and LIU, X., 2008. Improved heterologous gene expression in Trichoderma reesei by cellobiohydrolase I gene (cbh1) promoter optimization. Acta biochimica et biophysica Sinica, 40(2), pp. 158-165. LIVERMORE, D.M., 1996. Are all beta-lactams created equal? Scandinavian journal of infectious diseases.Supplementum, 101, pp. 33-43. LO, H.C., ENTWISTLE, R., GUO, C.J., AHUJA, M., SZEWCZYK, E., HUNG, J.H., CHIANG, Y.M., OAKLEY, B.R. and WANG, C.C., 2012. Two separate gene clusters encode the biosynthetic pathway for the meroterpenoids austinol and dehydroaustinol in Aspergillus nidulans. Journal of the American Chemical Society, 134(10), pp. 4709-4720. LUBERTOZZI, D. and KEASLING, J.D., 2009. Developing Aspergillus as a host for heterologous expression. Biotechnology Advances, 27(1), pp. 53-75. MA, L., ZHANG, J., ZOU, G., WANG, C. and ZHOU, Z., 2011. Improvement of cellulase activity in Trichoderma reesei by heterologous expression of a beta-glucosidase gene from Penicillium decumbens. Enzyme and microbial technology, 49(4), pp. 366-371. MACHIDA, M., ASAI, K., SANO, M., TANAKA, T., KUMAGAI, T., TERAI, G., KUSUMOTO, K., ARIMA, T., AKITA, O., KASHIWAGI, Y., ABE, K., GOMI, K., HORIUCHI, H., KITAMOTO, K., KOBAYASHI, T., TAKEUCHI, M., DENNING, D.W., GALAGAN, J.E., NIERMAN, W.C., YU, J., ARCHER, D.B., BENNETT, J.W., BHATNAGAR, D., CLEVELAND, T.E., FEDOROVA, N.D., GOTOH, O., HORIKAWA, H., HOSOYAMA, A., ICHINOMIYA, M., IGARASHI, R., IWASHITA, K., JUVVADI, P.R., KATO, M., KATO, Y., KIN, T., KOKUBUN, A., MAEDA, H., MAEYAMA, N., MARUYAMA, J., NAGASAKI, H., NAKAJIMA, T., ODA, K., OKADA, K., PAULSEN, I., SAKAMOTO, K., SAWANO, T., TAKAHASHI, M., TAKASE, K., TERABAYASHI, Y.,
103
5. References PhD Thesis Mikael Skaanning Jørgensen
WORTMAN, J.R., YAMADA, O., YAMAGATA, Y., ANAZAWA, H., HATA, Y., KOIDE, Y., KOMORI, T., KOYAMA, Y., MINETOKI, T., SUHARNAN, S., TANAKA, A., ISONO, K., KUHARA, S., OGASAWARA, N. and KIKUCHI, H., 2005. Genome sequencing and analysis of Aspergillus oryzae. Nature, 438(7071), pp. 1157-1161. MAHMOOD, Z.A., AHMED, S.W., AZHAR, I., SUALEH, M., BAIG, M.T. and ZOHA, S., 2010. Bioactive alkaloids produced by fungi. I. Updates on alkaloids from the species of the genera Boletus, Fusarium and psilocybe. Pakistan journal of pharmaceutical sciences, 23(3), pp. 349-357. MAIYA, S., GRUNDMANN, A., LI, X., LI, S.M. and TURNER, G., 2007. Identification of a hybrid PKS/NRPS required for pseurotin A biosynthesis in the human pathogen Aspergillus fumigatus. Chembiochem : a European journal of chemical biology, 8(14), pp. 1736-1743. MANAVALAN, B., MURUGAPIRAN, S.K., LEE, G. and CHOI, S., 2010. Molecular modeling of the reductase domain to elucidate the reaction mechanism of reduction of peptidyl thioester into its corresponding alcohol in non-ribosomal peptide synthetases. BMC structural biology [computer file], 10(1472-6807; 1472-6807), pp. 1. MANDELS, M. and REESE, E.T., 1957. Induction of cellulase in Trichoderma viride as influenced by carbon sources and metals. Journal of Bacteriology, 73(2), pp. 269-278. MAPARI, S.A., THRANE, U. and MEYER, A.S., 2010. Fungal polyketide azaphilone pigments as future natural food colorants? Trends in biotechnology, 28(6), pp. 300-307. MARAS, M., DE BRUYN, A., VERVECKEN, W., UUSITALO, J., PENTTILA, M., BUSSON, R., HERDEWIJN, P. and CONTRERAS, R., 1999. In vivo synthesis of complex N-glycans by expression of human N-acetylglucosaminyltransferase I in the filamentous fungus Trichoderma reesei. FEBS letters, 452(3), pp. 365-370. MARTINELLI, S.D., 1994. Aspergillus: 50 years on. Progress in industrial microbiology, 29, pp. 1-851. MARTINEZ, D., BERKA, R.M., HENRISSAT, B., SALOHEIMO, M., ARVAS, M., BAKER, S.E., CHAPMAN, J., CHERTKOV, O., COUTINHO, P.M., CULLEN, D., DANCHIN, E.G., GRIGORIEV, I.V., HARRIS, P., JACKSON, M., KUBICEK, C.P., HAN, C.S., HO, I., LARRONDO, L.F., DE LEON, A.L., MAGNUSON, J.K., MERINO, S., MISRA, M., NELSON, B., PUTNAM, N., ROBBERTSE, B., SALAMOV, A.A., SCHMOLL, M., TERRY, A., THAYER, N., WESTERHOLM-PARVINEN, A., SCHOCH, C.L., YAO, J., BARABOTE, R., NELSON, M.A., DETTER, C., BRUCE, D., KUSKE, C.R., XIE, G., RICHARDSON, P., ROKHSAR, D.S., LUCAS, S.M., RUBIN, E.M., DUNN-COLEMAN, N., WARD, M. and BRETTIN, T.S., 2008. Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina). Nature biotechnology, 26(1546-1696; 5), pp. 553-560. MASKEY, R.P., GRUN-WOLLNY, I. and LAATSCH, H., 2005. Sorbicillin analogues and related dimeric compounds from Penicillium notatum. Journal of natural products, 68(6), pp. 865-870. MEYER, V., 2008. Genetic engineering of filamentous fungi--progress, obstacles and future trends. Biotechnology Advances, 26(2), pp. 177-185. MEYER, V., WU, B. and RAM, A.F., 2011. Aspergillus as a multi-purpose cell factory: current status and perspectives. Biotechnology Letters, 33(3), pp. 469-476. MILLER, B.G., BUTTERFOSS, G.L., SHORT, S.A. and WOLFENDEN, R., 2001. Role of enzyme-ribofuranosyl contacts in the ground state and transition state for orotidine 5'- phosphate decarboxylase: a role for substrate destabilization? Biochemistry, 40(21), pp. 6227-6232. MILLERIOUX, Y., CLASTRE, M., SIMKIN, A.J., MARAIS, E., SIBIRNY, A.A., NOEL, T., CRECHE, J., GIGLIOLI-GUIVARC'H, N. and PAPON, N., 2011. Development of a URA5 integrative cassette for gene disruption in the Candida guilliermondii ATCC 6260 strain. Journal of microbiological methods, 84(2), pp. 355-358. MINÉ-HATTAB, J. and ROTHSTEIN, R., 2013. Gene Targeting and Homologous Recombination in Saccharomyces cerevisiae. In: S. RENAULT and P. DUCHATEAU, eds, Springer Netherlands, pp. 71-89. MISIEK, M. and HOFFMEISTER, D., 2007. Fungal genetics, genomics, and secondary metabolites in pharmaceutical sciences. Planta Medica, 73(2), pp. 103-115.
104
5. References PhD Thesis Mikael Skaanning Jørgensen
MONTENECOURT, B.S. and EVELEIGH, D.E., 1977. Preparation of mutants of Trichoderma reesei with enhanced cellulase production. Applied and Environmental Microbiology, 34(6), pp. 777-782. MOYANO, E., MARTINEZ-GARCIA, J.F. and MARTIN, C., 1996. Apparent redundancy in myb gene function provides gearing for the control of flavonoid biosynthesis in antirrhinum flowers. The Plant Cell, 8(9), pp. 1519-1532. MUKHERJEE, P.K., BUENSANTEAI, N., MORAN-DIEZ, M.E., DRUZHININA, I.S. and KENERLEY, C.M., 2012. Functional analysis of non-ribosomal peptide synthetases (NRPSs) in Trichoderma virens reveals a polyketide synthase (PKS)/NRPS hybrid enzyme involved in the induced systemic resistance response in maize. Microbiology (Reading, England), 158(Pt 1), pp. 155-165. MUKHERJEE, P.K., HORWITZ, B.A. and KENERLEY, C.M., 2012. Secondary metabolism in Trichoderma--a genomic perspective. Microbiology (Reading, England), 158(Pt 1), pp. 35-45. MURRAY, P., ARO, N., COLLINS, C., GRASSICK, A., PENTTILA, M., SALOHEIMO, M. and TUOHY, M., 2004. Expression in Trichoderma reesei and characterisation of a thermostable family 3 beta-glucosidase from the moderately thermophilic fungus Talaromyces emersonii. Protein expression and purification, 38(2), pp. 248-257. NEUHOF, T., DIECKMANN, R., DRUZHININA, I.S., KUBICEK, C.P. and VON DOHREN, H., 2007. Intact-cell MALDI-TOF mass spectrometry analysis of peptaibol formation by the genus Trichoderma/Hypocrea: can molecular phylogeny of species predict peptaibol structures? Microbiology (Reading, England), 153(Pt 10), pp. 3417-3437. NEWMAN, D.J. and CRAGG, G.M., 2012. Natural products as sources of new drugs over the 30 years from 1981 to 2010. Journal of natural products, 75(3), pp. 311-335. NIELSEN, J.B., NIELSEN, M.L. and MORTENSEN, U.H., 2008. Transient disruption of non- homologous end-joining facilitates targeted genome manipulations in the filamentous fungus Aspergillus nidulans. Fungal genetics and biology : FG & B, 45(1096-0937; 3), pp. 165-170. NIELSEN, K.F., MANSSON, M., RANK, C., FRISVAD, J.C. and LARSEN, T.O., 2011. Dereplication of microbial natural products by LC-DAD-TOFMS. Journal of natural products, 74(11), pp. 2338-2348. NIELSEN, M.L., ALBERTSEN, L., LETTIER, G., NIELSEN, J.B. and MORTENSEN, U.H., 2006. Efficient PCR-based gene targeting with a recyclable marker for Aspergillus nidulans. Fungal genetics and biology : FG & B, 43(1087-1845; 1), pp. 54-64. NIELSEN, M.L., NIELSEN, J.B., RANK, C., KLEJNSTRUP, M.L., HOLM, D.K., BROGAARD, K.H., HANSEN, B.G., FRISVAD, J.C., LARSEN, T.O. and MORTENSEN, U.H., 2011. A genome-wide polyketide synthase deletion library uncovers novel genetic links to polyketides and meroterpenoids in Aspergillus nidulans. FEMS microbiology letters, 321(2), pp. 157-166. NIERMAN, W.C., PAIN, A., ANDERSON, M.J., WORTMAN, J.R., KIM, H.S., ARROYO, J., BERRIMAN, M., ABE, K., ARCHER, D.B., BERMEJO, C., BENNETT, J., BOWYER, P., CHEN, D., COLLINS, M., COULSEN, R., DAVIES, R., DYER, P.S., FARMAN, M., FEDOROVA, N., FEDOROVA, N., FELDBLYUM, T.V., FISCHER, R., FOSKER, N., FRASER, A., GARCIA, J.L., GARCIA, M.J., GOBLE, A., GOLDMAN, G.H., GOMI, K., GRIFFITH-JONES, S., GWILLIAM, R., HAAS, B., HAAS, H., HARRIS, D., HORIUCHI, H., HUANG, J., HUMPHRAY, S., JIMENEZ, J., KELLER, N., KHOURI, H., KITAMOTO, K., KOBAYASHI, T., KONZACK, S., KULKARNI, R., KUMAGAI, T., LAFON, A., LATGE, J.P., LI, W., LORD, A., LU, C., MAJOROS, W.H., MAY, G.S., MILLER, B.L., MOHAMOUD, Y., MOLINA, M., MONOD, M., MOUYNA, I., MULLIGAN, S., MURPHY, L., O'NEIL, S., PAULSEN, I., PENALVA, M.A., PERTEA, M., PRICE, C., PRITCHARD, B.L., QUAIL, M.A., RABBINOWITSCH, E., RAWLINS, N., RAJANDREAM, M.A., REICHARD, U., RENAULD, H., ROBSON, G.D., RODRIGUEZ DE CORDOBA, S., RODRIGUEZ-PENA, J.M., RONNING, C.M., RUTTER, S., SALZBERG, S.L., SANCHEZ, M., SANCHEZ-FERRERO, J.C., SAUNDERS, D., SEEGER, K., SQUARES, R., SQUARES, S., TAKEUCHI, M., TEKAIA, F., TURNER, G., VAZQUEZ DE ALDANA, C.R., WEIDMAN, J., WHITE, O., WOODWARD, J., YU, J.H., FRASER, C., GALAGAN, J.E., ASAI, K., MACHIDA, M., HALL, N., BARRELL, B. and DENNING, D.W., 2005. Genomic sequence
105
5. References PhD Thesis Mikael Skaanning Jørgensen of the pathogenic and allergenic filamentous fungus Aspergillus fumigatus. Nature, 438(7071), pp. 1151-1156. NORHOLM, M.H., 2010. A mutant Pfu DNA polymerase designed for advanced uracil- excision DNA engineering. BMC biotechnology [computer file], 10(1472-6750; 1472- 6750), pp. 21. OSBOURN, A., 2010. Secondary metabolic gene clusters: evolutionary toolkits for chemical innovation. Trends in genetics : TIG, 26(10), pp. 449-457. PERLINSKA-LENART, U., BANKOWSKA, R., PALAMARCZYK, G. and KRUSZEWSKA, J.S., 2006. Overexpression of the Saccharomyces cerevisiae RER2 gene in Trichoderma reesei affects dolichol dependent enzymes and protein glycosylation. Fungal genetics and biology : FG & B, 43(6), pp. 422-429. PERRIN, R.M., FEDOROVA, N.D., BOK, J.W., CRAMER, R.A., WORTMAN, J.R., KIM, H.S., NIERMAN, W.C. and KELLER, N.P., 2007. Transcriptional regulation of chemical diversity in Aspergillus fumigatus by LaeA. PLoS.Pathog., 3(1553-7374; 4), pp. e50. PHONGHANPOT, S., PUNYA, J., TACHALEAT, A., LAOTENG, K., BHAVAKUL, V., TANTICHAROEN, M. and CHEEVADHANARAK, S., 2012. Biosynthesis of xyrrolin, a new cytotoxic hybrid polyketide/non-ribosomal peptide pyrroline with anticancer potential, in Xylaria sp. BCC 1067. Chembiochem : a European journal of chemical biology, 13(6), pp. 895-903. PUNT, P.J., OLIVER, R.P., DINGEMANSE, M.A., POUWELS, P.H. and VAN DEN HONDEL, C.A., 1987. Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli. Gene, 56(1), pp. 117-124. REINO, J., GUERRERO, R., HERN├ÍNDEZ-GAL├ÍN, R. and COLLADO, I., 2008. Secondary metabolites from species of the biocontrol agent Trichoderma. 7(1), pp. 89-123. REYES-DOMINGUEZ, Y., BOEDI, S., SULYOK, M., WIESENBERGER, G., STOPPACHER, N., KRSKA, R. and STRAUSS, J., 2012. Heterochromatin influences the secondary metabolite profile in the plant pathogen Fusarium graminearum. Fungal genetics and biology : FG & B, 49(1), pp. 39-47. REYES-DOMINGUEZ, Y., BOK, J.W., BERGER, H., SHWAB, E.K., BASHEER, A., GALLMETZER, A., SCAZZOCCHIO, C., KELLER, N. and STRAUSS, J., 2010. Heterochromatic marks are associated with the repression of secondary metabolism clusters in Aspergillus nidulans. Molecular microbiology, 76(6), pp. 1376-1386. ROHR, J., 1995. Shikimic Acid. Metabolism and Metabolites. Von E. Haslam. Wiley, Chichester, 1993. 387 S., geb. 75.00 £. ? ISBN 0-471-93999-4. Angewandte Chemie, 107(5), pp. 653-653. ROKAS, A., 2009. The effect of domestication on the fungal proteome. Trends in genetics : TIG, 25(2), pp. 60-63. SAKAI, K., KINOSHITA, H. and NIHIRA, T., 2012. Heterologous expression system in Aspergillus oryzae for fungal biosynthetic gene clusters of secondary metabolites. Applied Microbiology and Biotechnology, 93(5), pp. 2011-2022. SALOHEIMO, M. and PAKULA, T.M., 2012. The cargo and the transport system: secreted proteins and protein secretion in Trichoderma reesei (Hypocrea jecorina). Microbiology (Reading, England), 158(Pt 1), pp. 46-57. SALOHEIMO, M. and NIKU-PAAVOLA, M., 1991. Heterologous Production of a Ligninolytic Enzyme: Expression of the Phlebia Radiata Laccase Gene in Trichoderma Reesei. Nat Biotech, 9(10), pp. 987-990. SANCHEZ, J.F., ENTWISTLE, R., HUNG, J.H., YAEGASHI, J., JAIN, S., CHIANG, Y.M., WANG, C.C. and OAKLEY, B.R., 2011. Genome-based deletion analysis reveals the prenyl xanthone biosynthesis pathway in Aspergillus nidulans. Journal of the American Chemical Society, 133(11), pp. 4010-4017. SANTOSO, D. and THORNBURG, R., 1998. Uridine 5'-Monophosphate Synthase Is Transcriptionally Regulated by Pyrimidine Levels in Nicotiana plumbaginifolia. Plant Physiology, 116(2), pp. 815-821. SCHERLACH, K., SARKAR, A., SCHROECKH, V., DAHSE, H.M., ROTH, M., BRAKHAGE, A.A., HORN, U. and HERTWECK, C., 2011. Two induced fungal polyketide pathways converge into antiproliferative spiroanthrones. Chembiochem : a European journal of chemical biology, 12(12), pp. 1836-1839.
106
5. References PhD Thesis Mikael Skaanning Jørgensen
SCHRACKE, N., LINNE, U., MAHLERT, C. and MARAHIEL, M.A., 2005. Synthesis of linear gramicidin requires the cooperation of two independent reductases. Biochemistry, 44(23), pp. 8507-8513. SCHROECKH, V., SCHERLACH, K., NUTZMANN, H.W., SHELEST, E., SCHMIDT-HECK, W., SCHUEMANN, J., MARTIN, K., HERTWECK, C. and BRAKHAGE, A.A., 2009. Intimate bacterial-fungal interaction triggers biosynthesis of archetypal polyketides in Aspergillus nidulans. Proceedings of the National Academy of Sciences of the United States of America, 106(1091-6490; 0027-8424; 34), pp. 14558-14563. SCHROEDER, H.W., 1966. Effect of corn steep liquor on mycelial growth and aflatoxin production in Aspergillus parasiticus. Applied Microbiology, 14(3), pp. 381-385. SCHUSTER, A., BRUNO, K.S., COLLETT, J.R., BAKER, S.E., SEIBOTH, B., KUBICEK, C.P. and SCHMOLL, M., 2012. A versatile toolkit for high throughput functional genomics with Trichoderma reesei. Biotechnology for biofuels, 5(1), pp. 1. SCHUSTER, A. and SCHMOLL, M., 2010. Biology and biotechnology of Trichoderma. Applied Microbiology and Biotechnology, 87(3), pp. 787-799. SEIDL, V., SEIBEL, C., KUBICEK, C.P. and SCHMOLL, M., 2009. Sexual development in the industrial workhorse Trichoderma reesei. Proceedings of the National Academy of Sciences of the United States of America, 106(33), pp. 13909-13914. SHAABAN, M., PALMER, J.M., EL-NAGGAR, W.A., EL-SOKKARY, M.A., HABIB, E.E. and KELLER, N.P., 2010. Involvement of transposon-like elements in penicillin gene cluster regulation. Fungal genetics and biology : FG & B, 47(5), pp. 423-432. SHIMIZU, K., HICKS, J.K., HUANG, T.P. and KELLER, N.P., 2003. Pka, Ras and RGS protein interactions regulate activity of AflR, a Zn(II)2Cys6 transcription factor in Aspergillus nidulans. Genetics, 165(3), pp. 1095-1104. SHIMIZU, K. and KELLER, N.P., 2001. Genetic involvement of a cAMP-dependent protein kinase in a G protein signaling pathway regulating morphological and chemical transitions in Aspergillus nidulans. Genetics, 157(2), pp. 591-600. SILVA-STENICO, M.E., SILVA, C.S.P., LORENZI, A.S., SHISHIDO, T.K., ETCHEGARAY, A., LIRA, S.P., MORAES, L.A.B. and FIORE, M.F., 2011. Non-ribosomal peptides produced by Brazilian cyanobacterial isolates with antimicrobial activity. Microbiological research, 166(3), pp. 161-175. SILVER, J.M. and EATON, N.R., 1969. Functional blocks of the ad-1 and ad-2 mutants of Saccharomyces cerevisiae. Biochemical and biophysical research communications, 34(3), pp. 301-305. SOMOZA, A.D., LEE, K.H., CHIANG, Y.M., OAKLEY, B.R. and WANG, C.C., 2012. Reengineering an azaphilone biosynthesis pathway in Aspergillus nidulans to create lipoxygenase inhibitors. Organic letters, 14(4), pp. 972-975. SPITELLER, P., 2008. Modern Alkaloids. Structure, Isolation, Synthesis and Biology. Edited by Ernesto Fattorusso and Orazio Taglialatela-Scafati. Angewandte Chemie International Edition, 47(15), pp. 2730-2731. STACHELHAUS, T., MOOTZ, H.D. and MARAHIEL, M.A., 1999. The specificity-conferring code of adenylation domains in nonribosomal peptide synthetases. Chemistry & biology, 6(8), pp. 493-505. STALMAN, M., KOSKAMP, A.M., LUDERER, R., VERNOOY, J.H., WIND, J.C., WULLEMS, G.J. and CROES, A.F., 2003. Regulation of anthraquinone biosynthesis in cell cultures of Morinda citrifolia. Journal of Plant Physiology, 160(6), pp. 607-614. STARCEVIC, A., ZUCKO, J., SIMUNKOVIC, J., LONG, P.F., CULLUM, J. and HRANUELI, D., 2008. ClustScan: an integrated program package for the semi-automatic annotation of modular biosynthetic gene clusters and in silico prediction of novel chemical structures. Nucleic acids research, 36(21), pp. 6882-6892. STEIGER, M.G., VITIKAINEN, M., USKONEN, P., BRUNNER, K., ADAM, G., PAKULA, T., PENTTILA, M., SALOHEIMO, M., MACH, R.L. and MACH-AIGNER, A.R., 2011. Transformation system for Hypocrea jecorina (Trichoderma reesei) that favors homologous integration and employs reusable bidirectionally selectable markers. Applied and Environmental Microbiology, 77(1), pp. 114-121.
107
5. References PhD Thesis Mikael Skaanning Jørgensen
STRAUSS, J. and REYES-DOMINGUEZ, Y., 2011. Regulation of secondary metabolism by chromatin structure and epigenetic codes. Fungal genetics and biology : FG & B, 48(1), pp. 62-69. SUN, Y., TIAN, L., HUANG, J., MA, H.Y., ZHENG, Z., LV, A.L., YASUKAWA, K. and PEI, Y.H., 2008. Trichodermatides A-D, novel polyketides from the marine-derived fungus Trichoderma reesei. Organic letters, 10(3), pp. 393-396. SZEWCZYK, E., CHIANG, Y.M., OAKLEY, C.E., DAVIDSON, A.D., WANG, C.C. and OAKLEY, B.R., 2008. Identification and characterization of the asperthecin gene cluster of Aspergillus nidulans. Applied and Environmental Microbiology, 74(24), pp. 7607-7612. TILBURN, J., SCAZZOCCHIO, C., TAYLOR, G.G., ZABICKY-ZISSMAN, J.H., LOCKINGTON, R.A. and DAVIES, R.W., 1983. Transformation by integration in Aspergillus nidulans. Gene, 26(2-3), pp. 205-221. TINCU, J.A. and TAYLOR, S.W., 2004. Antimicrobial peptides from marine invertebrates. Antimicrobial Agents and Chemotherapy, 48(10), pp. 3645-3654. TRIFONOV, L., BIERI, J.H., PREWO, R., DREIDING, A.S., RAST, D.M. and HOESCH, L., 1982. The constitution of vertinolide, a new derivative of tetronic acid, produced by Verticillium intertextum. Tetrahedron, 38(3), pp. 397-403. TRIFONOV, L.S., BIERI, J.H., PREWO, R., DREIDING, A.S., HOESCH, L. and RAST, D.M., 1983. Isolation and structure elucidation of three metabolites from verticillium intertextum: sorbicillin, dihydrosorbicillin and bisvertinoquinol. Tetrahedron, 39(24), pp. 4243-4256. TZIN, V., GALILI, G. and AHARONI, A., 2001. Shikimate Pathway and Aromatic Amino Acid Biosynthesis. eLS. John Wiley & Sons, Ltd, . WANG, N., YANG, S., LIN, C. and CHUNG, K., 2011. Gene inactivation in the citrus pathogenic fungus Alternaria alternata defect at the Ku70 locus associated with non- homologous end joining. World Journal of Microbiology and Biotechnology, 27(8), pp. 1817-1826. WASHIDA, K., ABE, N., SUGIYAMA, Y. and HIROTA, A., 2007. Novel DPPH radical scavengers, demethylbisorbibutenolide and trichopyrone, from a fungus. Bioscience, biotechnology, and biochemistry, 71(4), pp. 1052-1057. WATANABE, A., ONO, Y., FUJII, I., SANKAWA, U., MAYORGA, M.E., TIMBERLAKE, W.E. and EBIZUKA, Y., 1998. Product identification of polyketide synthase coded by Aspergillus nidulans wA gene. Tetrahedron letters, 39(42), pp. 7733-7736. WATANABE, C.M. and TOWNSEND, C.A., 2002. Initial characterization of a type I fatty acid synthase and polyketide synthase multienzyme complex NorS in the biosynthesis of aflatoxin B(1). Chemistry & biology, 9(9), pp. 981-988. WATANABE, C.M., WILSON, D., LINZ, J.E. and TOWNSEND, C.A., 1996. Demonstration of the catalytic roles and evidence for the physical association of type I fatty acid synthases and a polyketide synthase in the biosynthesis of aflatoxin B1. Chemistry & biology, 3(6), pp. 463-469. WEBER, S.S., BOVENBERG, R.A. and DRIESSEN, A.J., 2012. Biosynthetic concepts for the production of beta-lactam antibiotics in Penicillium chrysogenum. Biotechnology journal, 7(2), pp. 225-236. WEISSMAN, K.J., 2004. Polyketide biosynthesis: understanding and exploiting modularity. Philosophical transactions.Series A, Mathematical, physical, and engineering sciences, 362(1825), pp. 2671-2690. WIEST, A., GRZEGORSKI, D., XU, B.W., GOULARD, C., REBUFFAT, S., EBBOLE, D.J., BODO, B. and KENERLEY, C., 2002. Identification of peptaibols from Trichoderma virens and cloning of a peptaibol synthetase. Journal of Biological Chemistry, 277(0021-9258; 23), pp. 20862-20868. WILLIAMS, R.B., HENRIKSON, J.C., HOOVER, A.R., LEE, A.E. and CICHEWICZ, R.H., 2008. Epigenetic remodeling of the fungal secondary metabolome. Organic & biomolecular chemistry, 6(11), pp. 1895-1897. WORTMAN, J.R., GILSENAN, J.M., JOARDAR, V., DEEGAN, J., CLUTTERBUCK, J., ANDERSEN, M.R., ARCHER, D., BENCINA, M., BRAUS, G., COUTINHO, P., VON DOHREN, H., DOONAN, J., DRIESSEN, A.J., DUREK, P., ESPESO, E., FEKETE, E., FLIPPHI, M., ESTRADA, C.G., GEYSENS, S., GOLDMAN, G., DE GROOT, P.W., HANSEN, K., HARRIS,
108
5. References PhD Thesis Mikael Skaanning Jørgensen
S.D., HEINEKAMP, T., HELMSTAEDT, K., HENRISSAT, B., HOFMANN, G., HOMAN, T., HORIO, T., HORIUCHI, H., JAMES, S., JONES, M., KARAFFA, L., KARANYI, Z., KATO, M., KELLER, N., KELLY, D.E., KIEL, J.A., KIM, J.M., VAN DER KLEI, I.J., KLIS, F.M., KOVALCHUK, A., KRASEVEC, N., KUBICEK, C.P., LIU, B., MACCABE, A., MEYER, V., MIRABITO, P., MISKEI, M., MOS, M., MULLINS, J., NELSON, D.R., NIELSEN, J., OAKLEY, B.R., OSMANI, S.A., PAKULA, T., PASZEWSKI, A., PAULSEN, I., PILSYK, S., POCSI, I., PUNT, P.J., RAM, A.F., REN, Q., ROBELLET, X., ROBSON, G., SEIBOTH, B., VAN SOLINGEN, P., SPECHT, T., SUN, J., TAHERI-TALESH, N., TAKESHITA, N., USSERY, D., VANKUYK, P.A., VISSER, H., VAN DE VONDERVOORT, P.J., DE VRIES, R.P., WALTON, J., XIANG, X., XIONG, Y., ZENG, A.P., BRANDT, B.W., CORNELL, M.J., VAN DEN HONDEL, C.A., VISSER, J., OLIVER, S.G. and TURNER, G., 2009. The 2008 update of the Aspergillus nidulans genome annotation: a community effort. Fungal genetics and biology : FG & B, 46 Suppl 1, pp. S2-13. YADAV, G., GOKHALE, R.S. and MOHANTY, D., 2009. Towards prediction of metabolic products of polyketide synthases: an in silico analysis. PLoS.Comput.Biol., 5(1553-7358; 4), pp. e1000351. YADAV, G., GOKHALE, R.S. and MOHANTY, D., 2009. Towards prediction of metabolic products of polyketide synthases: an in silico analysis. PLoS computational biology, 5(4), pp. e1000351. YAN, X., PROBST, K., LINNENBRINK, A., ARNOLD, M., PAULULAT, T., ZEECK, A. and BECHTHOLD, A., 2012. Cloning and heterologous expression of three type II PKS gene clusters from Streptomyces bottropensis. Chembiochem : a European journal of chemical biology, 13(2), pp. 224-230. YU, J., CHANG, P.K., EHRLICH, K.C., CARY, J.W., BHATNAGAR, D., CLEVELAND, T.E., PAYNE, G.A., LINZ, J.E., WOLOSHUK, C.P. and BENNETT, J.W., 2004. Clustered pathway genes in aflatoxin biosynthesis. Applied and Environmental Microbiology, 70(0099-2240; 0099-2240; 3), pp. 1253-1262. YU, J., HU, S., WANG, J., WONG, G.K., LI, S., LIU, B., DENG, Y., DAI, L., ZHOU, Y., ZHANG, X., CAO, M., LIU, J., SUN, J., TANG, J., CHEN, Y., HUANG, X., LIN, W., YE, C., TONG, W., CONG, L., GENG, J., HAN, Y., LI, L., LI, W., HU, G., HUANG, X., LI, W., LI, J., LIU, Z., LI, L., LIU, J., QI, Q., LIU, J., LI, L., LI, T., WANG, X., LU, H., WU, T., ZHU, M., NI, P., HAN, H., DONG, W., REN, X., FENG, X., CUI, P., LI, X., WANG, H., XU, X., ZHAI, W., XU, Z., ZHANG, J., HE, S., ZHANG, J., XU, J., ZHANG, K., ZHENG, X., DONG, J., ZENG, W., TAO, L., YE, J., TAN, J., REN, X., CHEN, X., HE, J., LIU, D., TIAN, W., TIAN, C., XIA, H., BAO, Q., LI, G., GAO, H., CAO, T., WANG, J., ZHAO, W., LI, P., CHEN, W., WANG, X., ZHANG, Y., HU, J., WANG, J., LIU, S., YANG, J., ZHANG, G., XIONG, Y., LI, Z., MAO, L., ZHOU, C., ZHU, Z., CHEN, R., HAO, B., ZHENG, W., CHEN, S., GUO, W., LI, G., LIU, S., TAO, M., WANG, J., ZHU, L., YUAN, L. and YANG, H., 2002. A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science (New York, N.Y.), 296(5565), pp. 79-92. YU, J.H. and KELLER, N., 2005. Regulation of secondary metabolism in filamentous fungi. Annual Review of Phytopathology, 43(0066-4286), pp. 437-458. ZHANG, J., QU, Y., XIAO, P., WANG, X., WANG, T. and HE, F., 2012. Improved biomass saccharification by Trichoderma reesei through heterologous expression of lacA gene from Trametes sp. AH28-2. Journal of bioscience and bioengineering, 113(6), pp. 697- 703. ZHANG, W., OSTASH, B. and WALSH, C.T., 2010. Identification of the biosynthetic gene cluster for the pacidamycin group of peptidyl nucleoside antibiotics. Proceedings of the National Academy of Sciences of the United States of America, 107(39), pp. 16828- 16833. ZONNEVELD, B.J. and VAN DER ZANDEN, A.L., 1995. The red ade mutants of Kluyveromyces lactis and their classification by complementation with cloned ADE1 or ADE2 genes from Saccharomyces cerevisiae. Yeast (Chichester, England), 11(9), pp. 823-827. ZOU, G., SHI, S., JIANG, Y., VAN DEN BRINK, J., DE VRIES, R.P., CHEN, L., ZHANG, J., MA, L., WANG, C. and ZHOU, Z., 2012. Construction of a cellulase hyper-expression
109
5. References PhD Thesis Mikael Skaanning Jørgensen system in Trichoderma reesei by promoter and enzyme engineering. Microbial cell factories, 11, pp. 21.
110
6. Appendices PhD Thesis Mikael Skaanning Jørgensen
6. Appendices
6.1. Phylogeny of T. reesei Strains Included in the Study
Chapter I MJ-T-033 pyr2 loop MJ-T-009 MJ-T-010 MJ-T-022 ∆wA TrF with lipolase ∆adeB OE construct
∆wA QM6a MJ-T-001 MJ-T-006 MJ-T-012 MJ-T-013 MJ-T-021 pyr2 ∆adeB tku70 ∆pyr2 loop truncation TrF with empty OE construct MJ-T-020 Both chapters Chapter II
TrF with TF gene OE constructs
MJ-T-029 MJ-T-016 MJ-T-017 MJ-T-036 MJ-T-028 MJ-T-019 MJ-T-018 MJ-T-030 MJ-T-031 MJ-T-032 MJ-T-035 MJ-T-036 MJ-T-037 111742 OE 103122OE 47479 OE 106677 OE 111088 OE 69972 OE 68254 OE 102497 OE 102499 OE 102497 OE 105784 OE 105805 OE 105784 OE Cluster 6 Cluster 10 Cluster 11 Cluster 11 Cluster 14 Cluster 15 Cluster 19 Cluster 22 Cluster 22 102499 OE Cluster 23 Cluster 23 105805 OE Cluster 22 Cluster 23
pyr2 loop MJ-T-039 MJ-T-040
∆73618/ ∆73621 ∆73618 ∆73621
MJ-T-043 MJ-T-044 MJ-T-045
Figure 6.1. Phylogeny of all T. reesei strains included in this study. Notice that some are included in both chapter I and II. The five digit numbers are JGI gene IDs. Abbreviations: OE, Overexpression; TF, Transcription factor; TrF, Transformation.
111
6. Appendices PhD Thesis pyr2 Alignment Mikael Skaanning Jørgensen
6.2. pyr2 Alignment
The following pyr2 sequences were obtained from mutants included in the pyr4 deletion experiments described in section 2.3.1. Several transformations were set up with pyr4 deletions constructs and several uridine auxotroph mutants were isolated. Further elucidation revealed that the pyr4 gene had not been deleted in any of these, instead mutations were observed in the pyr2 genes in five out of eight of the mutants that were selected for sequencing. The sequence alignments for these can be seen below together with the full wild-type pyr2 CDS.
112
6. Appendices PhD Thesis pyr2 Alignment Mikael Skaanning Jørgensen
113
6. Appendices PhD Thesis pyr2 Alignment Mikael Skaanning Jørgensen
114
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
6.3. UV Absorption Spectra for the Sorbicillinoids
UV absorption spectra were made for all 78 metabolites that were synthesized in higher amounts when the sorbicillinoid cluster specific transcription factor (JGI ID 102499) was overexpressed. These spectra are seen in the following pages. The monoisotopic masses are included in the top right of every spectra together with the retention time of the compound for which the UV absorption are measured. All samples have an extra absorption peak at approximately 220 nm which is an artifact caused by use of formic acid in the extraction procedure (Figure 6.2). These large peaks could potentially mask absorption peaks for the metabolites of interest.
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 7.170min #2152, [mAU] Artifact caused by presence of
150 formic acid in the sample
100
50
0 Figure 6.2. An example of a UV absorption curve with heavy absorption at approximately 220 nm facilitated by presence of formic acid in the sample.
115
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.015min #1506, [mAU] 192.07863 150 RT: 5.008
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.593min #1679, [mAU] 206.09428 125 RT: 5.600 100
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.482min #1645, [mAU] 150 208.10993 RT: 5.496
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 2.363min #710, [mAU] 219.12592 400 RT: 2.371
300
200
100
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 7.170min #2152, [mAU] 220.10993 150 RT: 7.161
100
50
0
116
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 3.785min #1137, [mAU] 232.10993 250 RT: 3.756
200
150
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.837min #1452, [mAU] 248.10485
150 RT: 4.845
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.067min #1521, [mAU] 248.10485 125 RT: 5.067 100
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.845min #1454, [mAU]
150 250.12049 RT: 4.845
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.393min #1319, [mAU] 264.09976 400 RT: 4.393
300
200
100
0
117
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 3.867min #1161, [mAU] 266.11541 250 RT: 3.867 200
150
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.148min #1246, [mAU] 266.11541 150 RT: 4.148
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.045min #1514, [mAU] 150 266.11541 RT: 5.045
100
50
0 200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.563min #1370, [mAU] 289.16778
100 RT: 4.571
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.696min #1410, [mAU]
125 289.16778
100 RT: 4.696
75
50
25
0
118
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.985min #1797, [mAU] 292.13106 150 RT: 4.571
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.156min #1548, [mAU] 303.18343 125 RT: 5.134 100
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.408min #1323, [mAU]
400 311.12698 RT: 4.422 300
200
100
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.378min #1614, [mAU] 150 311.12698 RT: 5.378
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.185min #1257, [mAU] 313.14263 150 RT: 4.185
100
50
0
119
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.111min #1534, [mAU]
125 318.11032 RT: 5.119 100
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.593min #1379, [mAU] 125 318.11032
100 RT: 5.230
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.585min #1377, [mAU] 125 323.15213
100 RT: 4.585
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.156min #1548, [mAU] 337.16778 125 RT: 5.141 100
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.778min #1734, [mAU] 150 358.17801 125 RT: 5.778
100
75
50
25
0
120
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.904min #1772, [mAU] 358.17801 125 RT: 5.904 100
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 6.296min #1890, [mAU] 358.17801 150 RT: 6.304
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 3.756min #1128, [mAU]
300 370.15285 RT: 3.756
200
100
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 3.489min #1048, [mAU] 400 375.17940 RT: 3.496 300
200
100
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.689min #1408, [mAU]
125 376.15218
100 RT: 4.689
75
50
25
0
121
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 6.074min #1823, [mAU] 150 376.15218 RT: 6.059
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.600min #1381, [mAU] 125 379.16308
100 RT: 4.600
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 3.800min #1141, [mAU] 388.16342 250 RT: 3.800 200
150
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.874min #1763, [mAU] 394.14162 125 RT: 5.889 100
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.985min #1797, [mAU] 394.14162 150 RT: 5.978
100
50
0
122
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 6.059min #1819, [mAU] 150 412.15218 RT: 6.282
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 6.585min #1977, [mAU] 412.15218 150 RT: 6.600
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.600min #1381, [mAU] 125 428.14710
100 RT: 5.489
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 8.437min #2532, [mAU] 440.18348 200 RT: 8.445 150
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.230min #1270, [mAU] 443.16923 125 RT: 4.237 100
75
50
25
0
123
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.422min #1328, [mAU] 250 443.16923
200 RT: 4.415
150
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.482min #1645, [mAU] 150 447.17940 RT: 5.489
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.171min #1552, [mAU] 449.19505 125 RT: 5.163 100
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.348min #1605, [mAU] 449.19505 125 RT: 5.341 100
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.171min #1552, [mAU] 450.17907 125 RT: 5.171 100
75
50
25
0
124
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.430min #1630, [mAU] 450.17907 200 RT: 5.437
150
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.097min #1230, [mAU] 452.19472 150 RT: 4.104
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 6.771min #2032, [mAU] 456.17840 150 RT: 6.771
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.600min #1381, [mAU] 125 459.20053
100 RT: 4.608
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 6.889min #2068, [mAU] 478.19913
300 RT: 6.904
200
100
0
125
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 7.252min #2177, [mAU] 480.21478 150 RT: 7.252
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 6.393min #1919, [mAU] 482.19405 150 RT: 6.408
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 7.459min #2239, [mAU] 482.19405 150 RT: 7.459
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.371min #1312, [mAU] 489.21109
150 RT: 4.363
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 8.807min #2643, [mAU] 496.17331 200 RT: 8.807 150
100
50
0
126
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 6.385min #1917, [mAU] 496.20970 150 RT: 6.385
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 6.608min #1983, [mAU] 496.20970 150 RT: 6.608
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 6.808min #2043, [mAU] 496.20970 150 RT: 6.793
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 6.904min #2072, [mAU] 496.20970 500 RT: 6.904 400
300
200
100
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 7.904min #2372, [mAU]
200 496.20970 RT: 7.904 150
100
50
0
127
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 7.111min #2134, [mAU]
100 498.22534 RT: 7.119 75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 7.852min #2357, [mAU] 200 498.22534 RT: 7.852 150
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.163min #1250, [mAU] 504.21076 150 RT: 4.163
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.608min #1383, [mAU] 125 504.21076
100 RT: 4.608
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 8.037min #2412, [mAU] 250 512.20461
200 RT: 8.030
150
100
50
0
128
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 7.726min #2319, [mAU] 514.22026
150 RT: 7.726
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.963min #1790, [mAU]
150 559.23183 RT: 5.963
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 6.667min #2001, [mAU] 559.23183 200 RT: 6.667
150
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.882min #1466, [mAU] 593.23730 125 RT: 4.882 100
75
50
25
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 8.289min #2488, [mAU] 200 656.23212 RT: 8.296 150
100
50
0
129
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 9.430min #2830, [mAU] 656.26212 200 RT: 9.430
150
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 6.496min #1950, [mAU] 691.27408
150 RT: 6.511
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.037min #1212, [mAU] 200 707.26899 RT: 4.045 150
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 3.859min #1159, [mAU] 709.28464 250 RT: 3.852 200
150
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 4.022min #1208, [mAU] 200 709.28464 RT: 4.022 150
100
50
0
130
6. Appendices PhD Thesis UV Absorption Spectra for the Sorbicillinoids Mikael Skaanning Jørgensen
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 9.007min #2703, [mAU] 760.30946 200 RT: 9.007
150
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 5.393min #1619, [mAU]
150 776.43465 RT: 5.393
100
50
0
200 250 300 350 400 450 500 550 600 650 Wavelength [nm] Intens. UV, 7.326min #2199, [mAU] 807.33668 150 RT: 7.326
100
50
0
131
6. Appendices PhD Thesis Sorbicillinoid Structures Mikael Skaanning Jørgensen
6.4. Sorbicillinoid Structures
The structure of known sorbicillinoids with monoisotopic masses corresponding to some of the metabolites observed in higher quantities when the sorbicillinoid cluster associated transcription factor (JGI ID: 102499) was overexpressed can be seen in the following pages. The shown metabolites might not be present in the samples obtained in this study. Each of the metabolites is located under their corresponding monoisotopic mass. If the metabolite is a possible dimer, the monoisotopic masses of the possible monomers are also included under the main monoisotopic mass.
132
6. Appendices PhD Thesis Sorbicillinoid Structures Mikael Skaanning Jørgensen
192.07863 220.10993 O H3C
H3C O O
CH3 HO CH3 O O Trichopyrone ButenolideII
OH O
232.10993 CH3 OH O HO H C 3 CH CH3 3 Sohirnone A HO
CH3 Sorbicillin
248.10485 250.12049 OH O H3C OH H3C CH3 CH 3 CH3 O O O O H3C OH
Sorbicillinol Vertinolide
OH O OH O
H3C H C CH 3 3 CH3
HO CH 3 HO CH3 OH OH Sohirnone B Sohirnone C
133
6. Appendices PhD Thesis Sorbicillinoid Structures Mikael Skaanning Jørgensen
264.09976 266.11541
O OH H3C OH H3C OH O CH3 CH O 3 HO O O CH3 H3C OH Oxosorbicillinol 5-hydroxyvertinolide
OH O
H3C CH3 O O OH H3C Epoxysorbicillinol 376.15218 OH CH3 HO CH H 3 O HO O H3C HO O O O H3C OH CH3 H3C OH OH O Trichodermanone A Sorbimycin OH CH3 CH3 H O H3C HO O O O H3C OH 480.21478 OH
O TrichodermanoneB CH3 H3CHO H3C OH CH H 3 H H CH3
O CHO3
HO OH
CH3
Sorbiquinol
134
6. Appendices PhD Thesis Sorbicillinoid Structures Mikael Skaanning Jørgensen
482.19405 496.17331
HO O O OH O O H3C HO CH3 H3C O OH CH3 H3C CH H 3 HO O O OH O HO O OH CH H C 3 CH3 3 H3C Demethyltrichodimerol Bisorbibetanone
H3C OH CHH3 OH O O CH3 O CH3 H C 3 OH O 514.22026 O 248.10485 266.11541
Demethylbisorbibutenolide H C OH 3 OH O O CH3 OH
H3C CH3 H3C H OH O O OH H3C 512.20461 248.10485 Dihydrobisvertinolone 264.09976 O HO CH3
H3C H OH CH3 O
HOH3C O HO CH3 H C O 3 OH
Bisvertinolone
135
6. Appendices PhD Thesis Sorbicillinoid Structures Mikael Skaanning Jørgensen
496.20970 248.10485 248.10485
H3C OH H3C O
H CH3 O H HO CH HO O 3 OH OHO O CH3 O CH H3C 3 OH CH3 CH3 Bisorbicillinol CH3 HO OH O O CH3 H3C Trichodimerol CH3 O H HO CH OH 3 O CH O H C 3 3 O O H
HO CH3 H C 3 OH O Trichotetronine H3C O H CH3 CH3 HO O CH3 O OH CH3
O CH3 Bisorbicillinolide O HO CH O 3 H3C O OH H C 3 H H CH3 HO H CH3 O
H3C O
Bislongiquinolide
136
6. Appendices PhD Thesis Sorbicillinoid Structures Mikael Skaanning Jørgensen
498.22534 248.10485 250.12049 OH O
H3C CH3 H OH O CH3 HO CH3 H3C O HO O HO O CH OH H C 3 H3C 3 Bisvertinol OH CH3
CH3 O O HO OH CH3 H3C Dihydrotrichodimerol CH3 O H HO CH OH 3 O CH O H C 3 3 O O H
HO CH3
Dihydrotrichotetronine OH CH H C O 3 3 O CH3 H3C CH3 OH O HO O CH3 HO CH3 Bisvertinoquinol O HO CH O 3 H3C O OH H C 3 H H CH3 HO H CH3 O
H3C O Dihydrobislongiquinolide
137
6. Appendices PhD Thesis Alignment and Phylogeny of PKS AT Domains Mikael Skaanning Jørgensen
6.5. PKS and NRPS Alignments
6.5.1. Alignment and Phylogeny of PKS AT Domains
The acyltransferase (AT) domains of PKSs are the gatekeepers of specificity for the short- chain carboxylic acids that will be incorporated into the growing PK chain. Drawing of their phylogenetic relations can indicate whether they utilize the same monomers (Figure 6.3). The full alignment of the PKS AT domains can be seen in the following pages.
105804 AT Domain (0.3117) 73621 AT Domain (0.2964) 81964 AT Domain (0.3065) 82208 AT Domain (0.3022) 123786 AT Domain (0.2600) 23171 AT Domain (0.1958) 106272 AT Domain (0.3192) 65172 AT Domain (0.2663) 65891 AT Domain (0.3183) 58285 AT Domain (0.2189) 59315 AT Domain (0.2341) 59482 AT Domain (0.3085) 60118 AT Domain (0.2901) 65116 AT Domain (0.3306) 73618 AT Domain (0.2783) Figure 6.3. Phylogeny of the AT domains of all PKSs identified in the T. reesei genome.
138
6. Appendices PhD Thesis Alignment and Phylogeny of PKS AT Domains Mikael Skaanning Jørgensen
139
6. Appendices PhD Thesis Alignment and Phylogeny of PKS AT Domains Mikael Skaanning Jørgensen
140
6. Appendices PhD Thesis Alignment and Phylogeny of PKS AT Domains Mikael Skaanning Jørgensen
141
6. Appendices PhD Thesis Alignment and Phylogeny of 23171 A Domains Mikael Skaanning Jørgensen
6.5.2. Alignment and Phylogeny of 23171 A Domains
The adenylation (A) domains of NRPSs are the gatekeepers for selection of the correct amino acids for incorporation into the growing peptide chain. Based on the predicted number of domains in the NRPS encoded by the gene with JGI ID 23171 it is highly likely involved in biosynthesis of the paracelsins. The amino acid sequence of some paracelsins has been described (Figure 6.4), drawing of the phylogenetic relations of the A domains could therefore indicate whether this NRPS in fact assemble the paracelsins (Figure 6.5). The following pages show the full alignment of the A domains of the NRPS encoded by 23171. (B) Leu (D) Leu (C) Aib (E) Leu (D) Aib (G) Leu (I) Aib (H) Leu acetyl Aib Ala Aib Ala Aib (A) Ala Gln Aib (A) Val Aib O O CH H C CH3 CH CH CH CH3 3 3 CH3O 3 O 3 O 3 NH H3C NH NH NH NH NH NH NH NH NH NH O CH O O CH3O 3 CH3 CH3 O CH3 O H3C CH3
H N O 2 Gly H2N O
H3C CH3 CH H3C O 3 O O O CH CH3 3 NH NH NH N NH NH NH NH NH HO O O O OH3C O CH3 CH3 CH3
(A) Aib Aib Val Pro (A) Aib Aib
H2N O (F) Val (E) Ala (G) Ala Pheol Gln Gln (H) Val (I) Val
Figure 6.4. Structure of Paracelsin A. The amino acid sequence is indicated by three letter abbreviations. The letters in brackets depicts the different paracelsins and what amino acids they have incorporated at the corresponding positions; only the amino acids that differ from paracelsin A are included. Abbreviations: Aib, 2-Aminoisobutyric acid; Ala, Alanine; Gln, Glutamine; Gly, Glycine; Leu, Leucine; Pheol, Phenylalanine; Pro, Proline; Val, Valine. 23171 A domain 01 (0.1716) Ac-Aib 23171 A domain 02 (0.2211) Ala 23171 A domain 14 (0.2282) Pro 23171 A domain 07 (0.1871) 23171 A domain 18 (0.1870) Gln 23171 A domain 19 (0.1875) 23171 A domain 20 (0.2793) Pheol 23171 A domain 09 (0.2536) Leu/Val 23171 A domain 15 (0.2048) Val 23171 A domain 04 (0.1671) Ala 23171 A domain 11 (0.1631) Gly 23171 A domain 06 (0.2353) Aib/Ala 23171 A domain 17 (0.2133) Aib/Ala/Val 23171 A domain 03 (0.1629) 23171 A domain 08 (0.1616) 23171 A domain 05 (0.1498) 23171 A domain 16 (0.1328) Aib 23171 A domain 10 (0.1700) 23171 A domain 12 (0.1970) 23171 A domain 13 (0.1727) Aib/Ala Figure 6.5. Phylogeny of the A domains of the NRPS encoded by the gene with JGI ID: 23171. It is seen that some A domains with the same AA specificity is clustered, supporting that the NRPS protein encoded by the gene with JGI ID 23171 indeed synthesize the paracelsins.
142
6. Appendices PhD Thesis Alignment and Phylogeny of 23171 A Domains Mikael Skaanning Jørgensen
143
6. Appendices PhD Thesis Alignment and Phylogeny of 23171 A Domains Mikael Skaanning Jørgensen
144
6. Appendices PhD Thesis Alignment and Phylogeny of 23171 A Domains Mikael Skaanning Jørgensen
145
6. Appendices PhD Thesis Alignment and Phylogeny of 23171 A Domains Mikael Skaanning Jørgensen
146
6. Appendices PhD Thesis Alignment and Phylogeny of 23171 A Domains Mikael Skaanning Jørgensen
147
6. Appendices PhD Thesis Alignment and Phylogeny of 23171 A Domains Mikael Skaanning Jørgensen
148
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
6.5.3. Alignment and Phylogeny of NRPS A Domains
The adenylation (A) domains of NRPSs are responsible for selection of the correct amino acids for incorporation into the growing peptide chain. Alignments of these can therefore indicate which domains that are specific for the same amino acids and could also indicate the relations between the included NRPSs. A phylogenetic three of all identified T. reesei NRPS A domains are seen in Figure 6.6 and the full alignment of these can be seen in the following pages.
123786 A domain 01 (0.1919) 23171 A domain 01 (0.1652) 23171 A domain 17 (0.2160) 23171 A domain 12 (0.2056) 123786 A domain 02 (0.2736) 23171 A domain 07 (0.1875) 23171 A domain 18 (0.1865) 23171 A domain 19 (0.1880) 123786 A domain 14 (0.2186) 23171 A domain 20 (0.2325) 123786 A domain 05 (0.1911) 123786 A domain 09 (0.1632) 123786 A domain 13 (0.1446) 23171 A domain 14 (0.1406) 23171 A domain 02 (0.2302) 24586 A domain 01 (0.3470) 60458 A domain 01 (0.3421) 58285 A domain (0.3278) 59315 A domain (0.3065) 68204 A domain (0.3572) 24586 A domain 02 (0.3484) 60458 A domain 02 (0.3387) 4117 A domain (0.3988) 55306 A domain (0.4019) 59690 A domain (0.4226) 71072 A domain (0.3865) 71005 A domain 02 (0.4855) 81014 A domain (0.3772) 69946 A domain 01 (0.3389) 69946 A domain 02 (0.3427) 69946 A domain 03 (0.3267) 60751 A domain (0.3308) 67189 A domain (0.2396) 71005 A domain 01 (0.2377) 123786 A domain 07 (0.2371) 23171 A domain 09 (0.2361) 123786 A domain 03 (0.2335) 23171 A domain 15 (0.1785) 123786 A domain 10 (0.2468) 123786 A domain 06 (0.2325) 23171 A domain 04 (0.1655) 23171 A domain 11 (0.1646) 23171 A domain 06 (0.2324) 123786 A domain 11 (0.2270) 123786 A domain 04 (0.2075) 123786 A domain 08 (0.1783) 23171 A domain 10 (0.1641) 123786 A domain 12 (0.1583) 23171 A domain 16 (0.1343) 23171 A domain 05 (0.1519) 23171 A domain 03 (0.1618) 23171 A domain 08 (0.1627) 23171 A domain 13 (0.1714)
Figure 6.6. Phylogeny of the A domains of all NRPSs identified in the T. reesei genome.
149
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
150
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
151
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
152
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
153
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
154
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
155
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
156
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
157
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
158
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
159
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
160
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
161
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
162
6. Appendices PhD Thesis Alignment and Phylogeny of NRPS A Domains Mikael Skaanning Jørgensen
163
164
CMB is an Engineering Center of Excellence funded by the Danish Research Agency. It is a collaboration between an acknowledged research manager, his/her institute and university, and the Research Agency. An Engineering Center of Excellence is a research institute of first-class quality with tradition for coorporation with industry.
Center for Microbial Biotechnology Department of Systems Biology Technical University of Copenhagen
Building 223 DK-2800 Kgs. Lyngby Denmark
Phone: +45 4525 2693 Fax: +45 4588 4148
www.cmb.dtu.dk