DOCSLIB.ORG

Full Text (PDF)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Full Text (PDF) Published OnlineFirst December 26, 2013; DOI: 10.1158/0008-5472.CAN-13-1481 Cancer Molecular and Cellular Pathobiology Research Identification of Alternative Splicing Events Regulated by the Oncogenic Factor SRSF1 in Lung Cancer Fernando J. de Miguel1, Ravi D. Sharma4, María J. Pajares1,2, Luis M. Montuenga1,2, Angel Rubio4, and Ruben Pio1,3 Abstract Abnormal alternative splicing has been associated with cancer. Genome-wide microarrays can be used to detect differential splicing events. In this study, we have developed ExonPointer, an algorithm that uses data from exon and junction probes to identify annotated cassette exons. We used the algorithm to profile differential splicing events in lung adenocarcinoma A549 cells after downregulation of the oncogenic serine/arginine-rich splicing factor 1 (SRSF1). Data were generated using two different microarray platforms. The PCR-based validation rate of the top 20 ranked genes was 60% and 100%. Functional enrichment analyses found a sub- stantial number of splicing events in genes related to RNA metabolism. These analyses also identified genes associated with cancer and developmental and hereditary disorders, as well as biologic processes such as cell division, apoptosis, and proliferation. Most of the top 20 ranked genes were validated in other adenocarcinoma and squamous cell lung cancer cells, with validation rates of 80% to 95% and 70% to 75%, respectively. Moreover, the analysis allowed us to identify four genes, ATP11C, IQCB1, TUBD1, and proline-rich coiled-coil 2C (PRRC2C), with a significantly different pattern of alternative splicing in primary non–small cell lung tumors compared with normal lung tissue. In the case of PRRC2C, SRSF1 downregulation led to the skipping of an exon overexpressed in primary lung tumors. Specific siRNA downregulation of the exon-containing variant significantly reduced cell growth. In conclusion, using a novel analytical tool, we have identified new splicing events regulated by the oncogenic splicing factor SRSF1 in lung cancer. Cancer Res; 74(4); 1105–15. Ó2013 AACR. Introduction pattern of splicing factors (9). One of these factors is serine/ Alternative splicing is the process by which different mRNA arginine-rich splicing factor 1 (SRSF1). This molecule is a isoforms are processed from a single primary transcript. In member of the serine/arginine-rich protein family, which is humans, estimates indicate that as many as 95% of multiexonic involved in constitutive and alternative splicing (10). The genes are alternatively spliced (1). Cassette exon, in which an SRSF1 protein contains 2 RNA recognition motives (RRM) at exon is either retained or spliced out of the transcript, is the the N-terminal and one arginine/serine rich domain at the C- – most common alternative splicing event in mammals, and terminal. The arginine/serine rich domain mediates protein accounts for approximately half of all events (2–4). Alternative protein interactions in the spliceosome assembly (11). The splicing has an essential role in the regulation of cell homeo- SRSF1 protein is also implicated in other functions, such as stasis. When this process becomes deregulated it can lead to nonsense-mediated RNA decay, translation and RNA trans- pathologic conditions such as cancer (5–8). Deregulation of port, genome stability, and senescence (12, 13). The expression splicing is often associated with an abnormal expression of SRSF1 is upregulated in several human neoplasias and participates in the establishment and maintenance of a trans- formed phenotype (14, 15). Consequently, the study of the Authors' Affiliations: 1Division of Oncology, Center for Applied Medical alternative splicing events regulated by this factor is of par- Research (CIMA); Departments of 2Histology and Pathology and 3Bio- ticular interest. chemistry and Genetics, Schools of Science and Medicine, University of A number of genome-wide array approaches have been Navarra, Pamplona; and 4CEIT and TECNUN, University of Navarra, San Sebastian, Spain developed to study changes in alternative splicing (16). These arrays contain probes in exons (exon arrays), probes along the Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). whole genome (tiling arrays), or probes in exons and junctions (junction arrays). The characteristics of the splicing arrays F.J. de Miguel and R.D. Sharma contributed equally to this work. developed to date are summarized in Supplementary Table S1. Corresponding Authors: Luis M. Montuenga, CIMA Building, Pio XII The analytical process for the evaluation of differential splicing Avenue 55, 31008 Pamplona, Spain. Phone: 34-948-194700; Fax: 34- 948-194714; E-mail: [email protected], or Angel Rubio, CEIT, Paseo events is a key aspect to consider when using these arrays. A Mikeletegi 48, San Sebastian, Spain. Phone: 34-943-212800; Fax: 34-943- serious limitation of exon arrays is that the exclusion of an exon 213076; E-mail: [email protected] must be inferred by the absence of a signal. In contrast, a doi: 10.1158/0008-5472.CAN-13-1481 microarray design that includes junction probes indicates the Ó2013 American Association for Cancer Research. exclusion of an exon by the hybridization of probes to the www.aacrjournals.org 1105 Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2014 American Association for Cancer Research. Published OnlineFirst December 26, 2013; DOI: 10.1158/0008-5472.CAN-13-1481 de Miguel et al. skipping junction. Consequently, the current trend is to work Mini Kit (Qiagen). The efficiency of the SRSF1 siRNA knock- with arrays that include probes in annotated junctions. Unfor- down was determined by real-time PCR, using SYBR Green tunately, there are very few algorithms that take advantage of PCR Master Mix and the following primers: 50-GGAACAAC- the redundancy provided by junction probes (17–25). GATTGCCGCATCTA-30 (forward); 50-CTTGAGGTCGGATG- In this study we have developed an algorithm, named TCGCGGATA-30 (reverse). ExonPointer, which combines data from exon and junction probes and was optimized to identify annotated cassette Microarray hybridization exons. We used the algorithm to identify differential alternative Samples from 3 independent experiments using lipofecta- cassette events in lung adenocarcinoma A549 cells after the mine alone, scramble siRNA, or SRSF1 siRNA (i.e., a total of nine downregulation of SRSF1. Expression data were generated samples) were labeled and hybridized in 2 different platforms: using 2 platforms: Oryzon custom arrays (Agilent technology) Agilent custom-built microarrays from Oryzon Genomics and and GeneSplice arrays (Affymetrix technology). Validation Affymetrix GeneSplice arrays. The former were developed by rates were 60% and 100% for Agilent and Affymetrix platforms, Oryzon Genomics in collaboration with our group, and have respectively, which demonstrate the effectiveness of this pro- been previously described (27). These arrays contain exon cedure in finding alternative splicing events. In addition, most probes and thermodynamically balanced junction probes. The of these events were validated in other lung cancer cell lines noncommercial Human GeneSplice Arrays were obtained and, more importantly, allowed us to identify genes with through a Technology Access program with Affymetrix. These significant differences in splicing between primary lung high-density arrays contain an average of 8 probes per probe- tumors and normal lung tissue. Finally, functional studies set. RNA labeling and hybridization on the Agilent microarrays demonstrated the implication of one splicing isoform of pro- were performed by Oryzon Genomics, as previously described line-rich coiled-coil 2C (PRRC2C), one of the SRSF1-regulated (27). Labeling and hybridization on the Affymetrix GeneSplice genes, in cell proliferation. In conclusion, we have developed a microarrays were performed by the Proteomics, Genomics and useful tool for the analysis of alternative splicing and have Bioinformatics Core Facility of the Center for Applied Medical identified new splicing events regulated by the oncogenic Research (CIMA) following manufacturer's instructions. The splicing factor SRSF1. microarray data from this study have been submitted to Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) under Materials and Methods accession number GSE53410. Biological material Primary lung tumors were obtained from patients with non– ExonPointer algorithm small cell lung cancer who had been treated with resectional The ExonPointer algorithm was used to process and analyze surgery at the Clinica Universidad de Navarra (Pamplona, the microarray data. The aim in the design of ExonPointer was Spain). Clinicopathologic characteristics of the patients are to identify differential alternative splicing, i.e. genes that show shown in Supplementary Table S2. Nontumor lung specimens different relative concentrations of their isoforms, under dif- were sampled at a distance from the tumor to guarantee that ferent conditions. Fig. 1 illustrates the summarized steps of the tissues were free from cancerous cells. Tissue samples were ExonPointer. The mathematical definition of differential alter- immediately frozen in liquid nitrogen and stored at À80C native splicing and the analytical steps are described in detail until extraction of RNA. Samples were included in the study if in Supplementary Methods. Probes that did not indicate greater than 70% of their cells were tumor cells. The study expression levels greater than
Load more

Recommended publications
  • Mutations in Diphosphoinositol- Pentakisphosphate Kinase PPIP5K2 Are Associated with Hearing Loss in Human and Mouse
    RESEARCH ARTICLE Mutations in Diphosphoinositol- Pentakisphosphate Kinase PPIP5K2 are associated with hearing loss in human and mouse Rizwan Yousaf1, Chunfang Gu2, Zubair M. Ahmed3, Shaheen N. Khan4, Thomas B. Friedman5, Sheikh Riazuddin6, Stephen B. Shears2, Saima Riazuddin1* a1111111111 1 Laboratory of Molecular Genetics, Department of Otorhinolaryngology-Head & Neck Surgery, School of Medicine University of Maryland, Baltimore, MD, United States of America, 2 Signal Transduction Laboratory, a1111111111 National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, a1111111111 NC, United States of America, 3 Laboratory of Neurogenetics and Regenerative Medicine, Department of a1111111111 Otorhinolaryngology-Head & Neck Surgery, School of Medicine University of Maryland, Baltimore, MD, United a1111111111 States of America, 4 National Center for Excellence in Molecular Biology, University of the Punjab, Lahore, Pakistan, 5 Section on Human Genetics, Laboratory of Molecular Genetics, National Institute on Deafness and Other Communication Disorders, National Institutes of Health, Bethesda, MD, United States of America, 6 Shaheed Zulfiqar Ali Bhutto Medical University, Pakistan Institute of Medical Sciences, Islamabad, Pakistan * [email protected] OPEN ACCESS Citation: Yousaf R, Gu C, Ahmed ZM, Khan SN, Friedman TB, Riazuddin S, et al. (2018) Mutations Abstract in Diphosphoinositol-Pentakisphosphate Kinase PPIP5K2 are associated with hearing loss in Autosomal recessive nonsyndromic hearing loss is a genetically heterogeneous disorder. human and mouse. PLoS Genet 14(3): e1007297. https://doi.org/10.1371/journal.pgen.1007297 Here, we report a severe-to-profound sensorineural hearing loss locus, DFNB100 on chro- mosome 5q13.2-q23.2. Exome enrichment followed by massive parallel sequencing Editor: Karen B. Avraham, Tel Aviv University, ISRAEL revealed a c.2510G>A transition variant in PPIP5K2 that segregated with DFNB100-associ- ated hearing loss in two large apparently unrelated Pakistani families.
    [Show full text]
  • Transcriptome Analyses of Rhesus Monkey Pre-Implantation Embryos Reveal A
    Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Transcriptome analyses of rhesus monkey pre-implantation embryos reveal a reduced capacity for DNA double strand break (DSB) repair in primate oocytes and early embryos Xinyi Wang 1,3,4,5*, Denghui Liu 2,4*, Dajian He 1,3,4,5, Shengbao Suo 2,4, Xian Xia 2,4, Xiechao He1,3,6, Jing-Dong J. Han2#, Ping Zheng1,3,6# Running title: reduced DNA DSB repair in monkey early embryos Affiliations: 1 State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 2 Key Laboratory of Computational Biology, CAS Center for Excellence in Molecular Cell Science, Collaborative Innovation Center for Genetics and Developmental Biology, Chinese Academy of Sciences-Max Planck Partner Institute for Computational Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China 3 Yunnan Key Laboratory of Animal Reproduction, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223, China 4 University of Chinese Academy of Sciences, Beijing, China 5 Kunming College of Life Science, University of Chinese Academy of Sciences, Kunming, Yunnan 650204, China 6 Primate Research Center, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650223, China * Xinyi Wang and Denghui Liu contributed equally to this work 1 Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press # Correspondence: Jing-Dong J. Han, Email: [email protected]; Ping Zheng, Email: [email protected] Key words: rhesus monkey, pre-implantation embryo, DNA damage 2 Downloaded from genome.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press ABSTRACT Pre-implantation embryogenesis encompasses several critical events including genome reprogramming, zygotic genome activation (ZGA) and cell fate commitment.
    [Show full text]
  • A 1.37-Mb 12P11.22-P11.21 Deletion Coincident with a 367-Kb 22Q11.2
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Taiwanese Journal of Obstetrics & Gynecology 53 (2014) 74e78 Contents lists available at ScienceDirect Taiwanese Journal of Obstetrics & Gynecology journal homepage: www.tjog-online.com Short Communication A 1.37-Mb 12p11.22ep11.21 deletion coincident with a 367-kb 22q11.2 duplication detected by array comparative genomic hybridization in an adolescent girl with autism and difficulty in self-care of menstruation Chih-Ping Chen a,b,c,d,e,f,*, Shuan-Pei Lin b,g,h,i, Schu-Rern Chern b, Peih-Shan Wu j, Jun-Wei Su a,k, Chen-Chi Lee a, Wayseen Wang b,l a Department of Obstetrics and Gynecology, Mackay Memorial Hospital, Taipei, Taiwan b Department of Medical Research, Mackay Memorial Hospital, Taipei, Taiwan c Department of Biotechnology, Asia University, Taichung, Taiwan d School of Chinese Medicine, College of Chinese Medicine, China Medical University, Taichung, Taiwan e Institute of Clinical and Community Health Nursing, National Yang-Ming University, Taipei, Taiwan f Department of Obstetrics and Gynecology, School of Medicine, National Yang-Ming University, Taipei, Taiwan g Department of Medicine, Mackay Medical College, New Taipei City, Taiwan h Department of Pediatrics, Mackay Memorial Hospital, Taipei, Taiwan i Mackay Junior College of Medicine, Nursing, and Management, Taipei, Taiwan j Gene Biodesign Co. Ltd, Taipei, Taiwan k Department of Obstetrics and Gynecology, China Medical University Hospital, Taichung, Taiwan l Department of Bioengineering, Tatung University, Taipei, Taiwan article info abstract Article history: Objective: To present an array comparative genomic hybridization (aCGH) characterization of a 12p11.22 Accepted 21 October 2013 ep11.21 microdeletion and 22q11.2 microduplication in an adolescent girl with autism, mental retar- dation, facial dysmorphism, microcephaly, behavior problems, and an apparently balanced reciprocal Keywords: translocation of t(8;12)(q24.3;p11.2).
    [Show full text]
  • Evidence for Differential Alternative Splicing in Blood of Young Boys With
    Stamova et al. Molecular Autism 2013, 4:30 http://www.molecularautism.com/content/4/1/30 RESEARCH Open Access Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders Boryana S Stamova1,2,5*, Yingfang Tian1,2,4, Christine W Nordahl1,3, Mark D Shen1,3, Sally Rogers1,3, David G Amaral1,3 and Frank R Sharp1,2 Abstract Background: Since RNA expression differences have been reported in autism spectrum disorder (ASD) for blood and brain, and differential alternative splicing (DAS) has been reported in ASD brains, we determined if there was DAS in blood mRNA of ASD subjects compared to typically developing (TD) controls, as well as in ASD subgroups related to cerebral volume. Methods: RNA from blood was processed on whole genome exon arrays for 2-4–year-old ASD and TD boys. An ANCOVA with age and batch as covariates was used to predict DAS for ALL ASD (n=30), ASD with normal total cerebral volumes (NTCV), and ASD with large total cerebral volumes (LTCV) compared to TD controls (n=20). Results: A total of 53 genes were predicted to have DAS for ALL ASD versus TD, 169 genes for ASD_NTCV versus TD, 1 gene for ASD_LTCV versus TD, and 27 genes for ASD_LTCV versus ASD_NTCV. These differences were significant at P <0.05 after false discovery rate corrections for multiple comparisons (FDR <5% false positives). A number of the genes predicted to have DAS in ASD are known to regulate DAS (SFPQ, SRPK1, SRSF11, SRSF2IP, FUS, LSM14A). In addition, a number of genes with predicted DAS are involved in pathways implicated in previous ASD studies, such as ROS monocyte/macrophage, Natural Killer Cell, mTOR, and NGF signaling.
    [Show full text]
  • DNA Replication Stress Response Involving PLK1, CDC6, POLQ
    DNA replication stress response involving PLK1, CDC6, POLQ, RAD51 and CLASPIN upregulation prognoses the outcome of early/mid-stage non-small cell lung cancer patients C. Allera-Moreau, I. Rouquette, B. Lepage, N. Oumouhou, M. Walschaerts, E. Leconte, V. Schilling, K. Gordien, L. Brouchet, Mb Delisle, et al. To cite this version: C. Allera-Moreau, I. Rouquette, B. Lepage, N. Oumouhou, M. Walschaerts, et al.. DNA replica- tion stress response involving PLK1, CDC6, POLQ, RAD51 and CLASPIN upregulation prognoses the outcome of early/mid-stage non-small cell lung cancer patients. Oncogenesis, Nature Publishing Group: Open Access Journals - Option C, 2012, 1, pp.e30. 10.1038/oncsis.2012.29. hal-00817701 HAL Id: hal-00817701 https://hal.archives-ouvertes.fr/hal-00817701 Submitted on 9 Jun 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial - NoDerivatives| 4.0 International License Citation: Oncogenesis (2012) 1, e30; doi:10.1038/oncsis.2012.29 & 2012 Macmillan Publishers Limited All rights reserved 2157-9024/12 www.nature.com/oncsis ORIGINAL ARTICLE DNA replication stress response involving PLK1, CDC6, POLQ, RAD51 and CLASPIN upregulation prognoses the outcome of early/mid-stage non-small cell lung cancer patients C Allera-Moreau1,2,7, I Rouquette2,7, B Lepage3, N Oumouhou3, M Walschaerts4, E Leconte5, V Schilling1, K Gordien2, L Brouchet2, MB Delisle1,2, J Mazieres1,2, JS Hoffmann1, P Pasero6 and C Cazaux1 Lung cancer is the leading cause of cancer deaths worldwide.
    [Show full text]
  • Análise Integrativa De Perfis Transcricionais De Pacientes Com
    UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas.
    [Show full text]
  • A CRISPR-Based Screen for Hedgehog Signaling Provides Insights Into Ciliary Function and Ciliopathies
    ARTICLES https://doi.org/10.1038/s41588-018-0054-7 A CRISPR-based screen for Hedgehog signaling provides insights into ciliary function and ciliopathies David K. Breslow 1,2,7*, Sascha Hoogendoorn 3,7, Adam R. Kopp2, David W. Morgens4, Brandon K. Vu2, Margaret C. Kennedy1, Kyuho Han4, Amy Li4, Gaelen T. Hess4, Michael C. Bassik4, James K. Chen 3,5* and Maxence V. Nachury 2,6* Primary cilia organize Hedgehog signaling and shape embryonic development, and their dysregulation is the unifying cause of ciliopathies. We conducted a functional genomic screen for Hedgehog signaling by engineering antibiotic-based selection of Hedgehog-responsive cells and applying genome-wide CRISPR-mediated gene disruption. The screen can robustly identify factors required for ciliary signaling with few false positives or false negatives. Characterization of hit genes uncovered novel components of several ciliary structures, including a protein complex that contains δ -tubulin and ε -tubulin and is required for centriole maintenance. The screen also provides an unbiased tool for classifying ciliopathies and showed that many congenital heart disorders are caused by loss of ciliary signaling. Collectively, our study enables a systematic analysis of ciliary function and of ciliopathies, and also defines a versatile platform for dissecting signaling pathways through CRISPR-based screening. he primary cilium is a surface-exposed microtubule-based approach. Indeed, most studies to date have searched for genes that compartment that serves as an organizing center for diverse either intrinsically affect cell growth or affect sensitivity to applied Tsignaling pathways1–3. Mutations affecting cilia cause ciliopa- perturbations16–23. thies, a group of developmental disorders including Joubert syn- Here, we engineered a Hh-pathway-sensitive reporter to enable drome, Meckel syndrome (MKS), nephronophthisis (NPHP), and an antibiotic-based selection platform.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • Prioritization of Metabolic Genes As Novel Therapeutic Targets in Estrogen-Receptor Negative Breast Tumors Using Multi-Omics Data and Text Mining
    www.oncotarget.com Oncotarget, 2019, Vol. 10, (No. 39), pp: 3894-3909 Research Paper Prioritization of metabolic genes as novel therapeutic targets in estrogen-receptor negative breast tumors using multi-omics data and text mining Dinesh Kumar Barupal1,*, Bei Gao1,*, Jan Budczies2, Brett S. Phinney4, Bertrand Perroud4, Carsten Denkert2,3 and Oliver Fiehn1 1West Coast Metabolomics Center, University of California, Davis, CA, USA 2Institute of Pathology, Charité University Hospital, Berlin, Germany 3German Institute of Pathology, Philipps-University Marburg, Marburg, Germany 4UC Davis Genome Center, University of California, Davis, CA, USA *Co-first authors and contributed equally to this work Correspondence to: Oliver Fiehn, email: [email protected] Keywords: set-enrichment; ChemRICH; multi-omics; metabolic networks; candidate gene prioritization Received: March 12, 2019 Accepted: May 13, 2019 Published: June 11, 2019 Copyright: Barupal et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Estrogen-receptor negative (ERneg) breast cancer is an aggressive breast cancer subtype in the need for new therapeutic options. We have analyzed metabolomics, proteomics and transcriptomics data for a cohort of 276 breast tumors (MetaCancer study) and nine public transcriptomics datasets using univariate statistics, meta- analysis, Reactome pathway analysis, biochemical network mapping and text mining of metabolic genes. In the MetaCancer cohort, a total of 29% metabolites, 21% proteins and 33% transcripts were significantly different (raw p <0.05) between ERneg and ERpos breast tumors.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name importin 8 Gene Symbol IPO8 Organism Human Gene Summary The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. This protein binds to the nuclear pore complex and along with RanGTP and RANBP1 inhibits the GAP stimulation of the Ran GTPase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Gene Aliases FLJ21954, FLJ26580, RANBP8 RefSeq Accession No. NC_000012.11, NT_009714.17 UniGene ID Hs.505136 Ensembl Gene ID ENSG00000133704 Entrez Gene ID 10526 Assay Information Unique Assay ID qHsaCED0005354 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000256079, ENST00000544829, ENST00000545286 Amplicon Context Sequence TTTTTTCTGATAATTCATGTACAACAGAAGGCACTGTTATCCGCATAAATCCATTG ATTCTGCATGGCAAAAACCTGAGACGTGCAAGTCTATCCAATCCTC Amplicon Length (bp) 72 Chromosome Location 12:30783406-30783507 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 0.9998 cDNA Cq 21.24 cDNA Tm (Celsius) 79.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 24.52 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report IPO8, Human Amplification Plot Amplification of cDNA generated from
    [Show full text]
  • Mouse Ipo8 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Ipo8 Knockout Project (CRISPR/Cas9) Objective: To create a Ipo8 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Ipo8 gene (NCBI Reference Sequence: NM_001081113 ; Ensembl: ENSMUSG00000040029 ) is located on Mouse chromosome 6. 25 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 25 (Transcript: ENSMUST00000048418). Exon 2~4 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 2.81% of the coding region. Exon 2~4 covers 13.14% of the coding region. The size of effective KO region: ~6522 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 25 Legends Exon of mouse Ipo8 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 1322 bp section downstream of Exon 4 is aligned with itself to determine if there are tandem repeats.
    [Show full text]