03 Beacham FB106(3)

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Determination of population structure and stock composition of chum salmon (Oncorhynchus keta) in Russia determined with microsatellites Item Type article Authors Beacham, Terry D.; Varnavskaya, Nataly V.; Le, Khai D.; Wetklo, Michael H. Download date 30/09/2021 07:11:24 Link to Item http://hdl.handle.net/1834/25479 245 Abstract—Variation at 14 microsat- Determination of population structure and stock ellite loci was examined in 34 chum salmon (Oncorhynchus keta) popula- composition of chum salmon (Oncorhynchus keta) tions from Russia and evaluated for its use in the determination of popu- in Russia determined with microsatellites lation structure and stock composi- tion in simulated mixed-stock fishery Terry D. Beacham (contact author) samples. The genetic differentiation Email address: [email protected] index (Fst) over all populations and loci was 0.017, and individual locus Department of Fisheries and Oceans values ranged from 0.003 to 0.054. Pacific Biological Station Regional population structure was Nanaimo, British Columbia, Canada V9T 6N7 observed, and populations from Pri- morye, Sakhalin Island, and north- east Russia were the most distinct. Nataly V. Varnavskaya Microsatellite variation provided Kamchatka Fishery and Oceanography Research Institute evidence of a more fine-scale popu- 18 Naberezhnaya Street lation structure than those that had Petropavlovsk-Kamchatsky 683000, Russia previously been demonstrated with other genetic-based markers. Analy- sis of simulated mixed-stock samples Khai D. Le indicated that accurate and precise Michael H. Wetklo regional estimates of stock composi- tion were produced when the micro- Department of Fisheries and Oceans satellites were used to estimate stock Pacific Biological Station compositions. Microsatellites can be Nanaimo, British Columbia, Canada V9T 6N7 used to determine stock composition in geographically separate Russian coastal chum salmon fisheries and provide a greater resolution of stock composition and population structure than that previously provided with In Asia, there are two distinct types for the determination of origin of in- other techniques. of chum salmon (Oncorhynchus dividuals to large geographic areas keta Walbaum). The early-matur- (Tanaka et al., 1969; Ishida et al., ing or “summer” chum salmon gen- 1989), and in some cases reportedly to erally returns to spawn from June a specific river drainage (Nikolayeva through August in streams border- and Semenets, 1983). Trace elements ing Kamchatka, the Sea of Okhotsk, in otoliths have also been reported the east coast of Sakhalin Island, to be effective for stock identification and the Amur River. Later-matur- of Korean populations (Sohn et al., ing or “autumn” chum salmon gener- 2005). Stock identification techniques ally return to spawn from September based on scale pattern analysis have through November in streams in generally been replaced by applica- Japan, the southern Kuril Islands, tions based on genetic variation, ow- the west coast of Sahkalin Island, ing to the increased resolution that is and the Amur River (Sano, 1966). In possible by applying genetic variation general, summer chum salmon spawn (see example outlined by Wilmot et al. in areas where egg incubation occurs [1998]). Analyses of genetic variation in subsurface stream flow, whereas have been demonstrated to be effec- autumn chum salmon spawn in areas tive in determining salmonid popula- of groundwater upwelling (Volobuyev tion structure, as well as determin- et al., 1990). In major river drain- ing origins of salmon in mixed-stock ages, autumn chum salmon generally fisheries. For Russian chum salmon, migrate further up the drainage to analyses of allozyme variation have spawn than do summer chum salmon, indicated differentiation among popu- and are larger, younger, and more lations on the east and west coasts Manuscript submitted 18 December 2007. Manuscript accepted 25 February 2008. fecund than the summer-run fish of Kamchatka (Winans et al., 1994), Fish. Bull. 106:233–256 (2008). (Sano, 1966). and either marignal (Salmenkova et Determination of the origin of al., 2007) or some level of differentia- The views and opinions expressed or salmon in mixed-stock fisheries is im- tion between populations on Sakhalin implied in this article are those of the portant for effective management. For Island and populations on the main- author and do not necessarily reflect the position of the National Marine chum salmon in Asia, scale pattern land Russian coast (Efremov, 2001). Fisheries Service, NOAA. variation has provided a technique Populations in the far northeastern 246 Fishery Bulletin 106(3) portions of mainland Russia were distinct from popula- satellite variation in chum salmon provides the means tions in western Alaska (Wilmot et al., 1994). Surveys to examine fine-scale population structure (Chen et al., of allozyme variation have generally indicated regional 2005), as well as the means for fine-scale estimation of population differentiation among Russian populations. stock composition in mixed-stock fisheries (Beacham DNA-level markers have substantially increased the et al., in press). Analyses of microsatellite variation in number of polymorphic loci that are available to be Russian chum populations would likely be of value by included in analyses of genetic variation. Initial sur- providing increased resolution of population structure veys of mitochondrial (mt) DNA variation indicated compared with that provided by previous techniques, regional differentiation between Sakhalin Island and and would likely aid in increasing accuracy and preci- mainland populations (Ginatulina, 1992). Later analy- sion of estimates of stock composition in mixed-stock ses of additional mtDNA variation indicated marked fishery samples. differentiation between Japanese and Russian popula- Our objectives were to analyze the variation at 14 tions (Sato et al., 2004), and some differentiation among microsatellite loci to evaluate population structure of Russian populations (Brykov et al., 2003; Polyakova et Russian chum salmon populations from the far north al., 2006). Limited examinations of minisatellite varia- eastern coast of Russia to the more southern areas of tion have indicated some level of differentiation between Primorye and Sakhalin Island, and then to evaluate the Japanese and Russian populations, but have yielded use of these loci for the practical purpose of providing little evidence of regional structure for Russian popula- accurate and precise estimates of stock composition in tions (Taylor et al., 1994; Beacham, 1996). mixed-stock fishery samples. Stock composition evalu- Analyses of microsatellite variation have been ef- ation was accomplished by the analysis of simulated fective for determining salmonid population structure mixed-stock fishery samples. in local areas (Small et al., 1998; Banks et al., 2000; Beacham et al., 2004), as well as broad-scale differences across the Pacific Rim (Beacham et al., 2005, 2006). Materials and methods Microsatellites have also been of considerable value in estimating stock composition in mixed-stock salmon Tissue samples were collected from mature chum fisheries, on both a population-specific (Beacham et al., salmon at a number of rivers during previous analyses 2003) and regional basis (Beacham et al., 2006). Micro- of genetic variation (Winans et al., 1994). Additional tissue samples were sent to the Molecular Genetics Laboratory at the Pacific Biologi- cal Station. The geographic area of the 34 populations sampled ranged from Primorye in the south to northeastern Russia (Fig. 1) and encompassed eight geographic regions (Table 1). DNA was extracted from the tissue samples by a variety of methods, including that with chelex resin outlined by Small et al. (1998), a Qiagen 96-well Dneasy® procedure (Qiagen, Mississauga, Ontario, Canada), or a Promega Wizard SV96 Genomic DNA Puri- fication system (Promega, Madison, WI). Once extracted DNA was available, anal- yses of variation at 14 microsatellite loci were conducted: Ots3 (Banks et al., 1999), Oke3 (Buchholz et al., 2001), Oki2 (Smith et al., 1998), Oki100 (primer sequence 5ʹ to 3ʹ F: GGTGTTTTAATGTTGTTTCCT, R: GTTTCCAGAGTAGTCATCTCTG), Omm1070 (Rexroad et al., 2001), Omy 1011 (Spies et al., 2005), One101, One102, One104, One111, and One114 (Olsen et al., 2000), Ots103 (Nelson � and Beacham, 1999), Ssa419 (Cairney et al., 2000), and OtsG68 (Williamson et al., N 2002). In general, PCR DNA amplifications were conducted by using DNA Engine Cycler Tet- Figure 1 rad2 (BioRad, Hercules, CA) in 6-μL volumes Map indicating the locations in Russia where chum salmon (Oncorhyn- consisting of 0.15 units of Taq polymerase, chus keta) from 34 populations or sampling sites were collected. 1 μL (25−50 ng) of extracted DNA, 1× PCR buf- Numbers for and locations of populations are indicated in Table 1. fer (Qiagen, Mississauga, Ontario, Canada), Beacham et al: Population structure and stock identification of Oncorhynchus keta 247 Table 1 Population, sample collection years, number of fish sampled per year, and total number of fish sampled for 34 populations of chum salmon (Oncorhynchus keta) in eight geographic regions from Russia. Eight regions have been defined, and populations (numbered in brackets) were sampled in each region listed. N = population size. Region and population Years Annual sample size N 1 Primorye Narva [1] 1994 17 17 Ryazanovka [2] 1994 49 49 Avakumovka [3] 1994 35 35 2 Amur River Amur River [4] 1994, 2001, 2004 43, 97, 198 338 3 Sakhalin Island Tym [5]
Recommended publications
  • Russia): 2003–9 Results

    Russia): 2003–9 Results

    CHAPTER 6 OBSIDIAN PROVENANCE STUDIES ON KAMCHATKA PENINSULA (FAR EASTERN RUSSIA): 2003–9 RESULTS Andrei V. Grebennikov, Vladimir K. Popov, Michael D. Glascock, Robert J. Speakman, Yaroslav V. Kuzmin, and Andrei V. Ptashinsky Abstract: The results of obsidian provenance research on the Kamchatka Peninsula based on extensive study of the chemical composition of volcanic glasses from both ‘geological’ sources and archaeological sites are presented. At least 16 geochemical groups reflecting different sources of obsidian have been identified for Kamchatka using Instrumental Neutron Activation Analysis. Seven sources of archaeological obsidian have been linked to specific geologic outcrops, with the distances between sites and obsidian sources up to 550km. At least seven geochemical groups based only on artefact analysis are also described. The use of multiple obsidian sources was a common pattern during the Palaeolithic, Neolithic, and Palaeometal periods of Kamchatkan prehistory. Keywords: Obsidian, Source Identification, Palaeolithic, Neolithic, Kamchatka Peninsula, Russian Far East Introduction 6.1, A). The main geomorphic features of the Kamchatka Peninsula are two major mountain ranges, Central and Studies of the geochemistry of waterless volcanic glasses Eastern, with a sedimentary basin between them occupied (i.e., obsidians) and sources of archaeological obsidian by the Kamchatka River drainage; mountains of the in the Russian Far East have been ongoing since the southern region; and lowlands on the western coast (Suslov early 1990s,
  • Obsidian Provenance Studies on Kamchatka Peninsula (Far Eastern Russia): 2003–9 Results

    Obsidian Provenance Studies on Kamchatka Peninsula (Far Eastern Russia): 2003–9 Results

    Crossing the Straits: Prehistoric Obsidian Source Exploitation in the North Pacific Rim Edited by Yaroslav V. Kuzmin Michael D. Glascock BAR International Series 2152 2010 Published by Archaeopress Publishers of British Archaeological Reports Gordon House 276 Banbury Road Oxford OX2 7ED England [email protected] www.archaeopress.com BAR S2152 Crossing the Straits: Prehistoric Obsidian Source Exploitation in the North Pacific Rim © Archaeopress and the individual authors 2010 ISBN 978 1 4073 0694 0 Printed in England by Blenheim Colour Ltd All BAR titles are available from: Hadrian Books Ltd 122 Banbury Road Oxford OX2 7BP England [email protected] The current BAR catalogue with details of all titles in print, prices and means of payment is available free from Hadrian Books or may be downloaded from www.archaeopress.com CHAPTER 6 OBSIDIAN PROVENANCE STUDIES ON KAMCHATKA PENINSULA (FAR EASTERN RUSSIA): 2003–9 RESULTS Andrei V. Grebennikov, Vladimir K. Popov, Michael D. Glascock, Robert J. Speakman, Yaroslav V. Kuzmin, and Andrei V. Ptashinsky Abstract: The results of obsidian provenance research on the Kamchatka Peninsula based on extensive study of the chemical composition of volcanic glasses from both ‘geological’ sources and archaeological sites are presented. At least 16 geochemical groups reflecting different sources of obsidian have been identified for Kamchatka using Instrumental Neutron Activation Analysis. Seven sources of archaeological obsidian have been linked to specific geologic outcrops, with the distances between sites and obsidian sources up to 550km. At least seven geochemical groups based only on artefact analysis are also described. The use of multiple obsidian sources was a common pattern during the Palaeolithic, Neolithic, and Palaeometal periods of Kamchatkan prehistory.
  • Proteases in the Atlantic Salmon, Salmo Salar L. Physiological And

    Proteases in the Atlantic Salmon, Salmo Salar L. Physiological And

    Proteases in the Atlantic salmon,Salmo salar L. Physiological and biological aspects. Sigfus Einarsson A thesis presented for the degree of Doctor of Philosophy in the University of Glasgow, Faculty of Science, Department of Zoology. December, 1993. ©Sigfus Einarsson 1993 i ProQuest Number: 11007772 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a com plete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest ProQuest 11007772 Published by ProQuest LLC(2018). Copyright of the Dissertation is held by the Author. All rights reserved. This work is protected against unauthorized copying under Title 17, United States C ode Microform Edition © ProQuest LLC. ProQuest LLC. 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106- 1346 CrtloQ GLASGOW UNIVERSITY LIBRARY DECLARATION. I declare that this thesis represents, except where note is made to the contrary, work carried out by myself. The text was composed by myself. S. Einarsson December, 1993. ACKNOWLEDGEMENTS. First I want to thank my mother, Margret K. Petursdottir and my wife, Retno Henryati Susanti for their invaluable aid and support during this work. I will be forever indepted to them. The beginning of this work was carried out at the Freshwater Fisheries Laboratories, Pitlochry. The major part was carried out at the University of Glasgow, Department of Zoology, and at the Almond Bank rearing station, Perth. I thank all respective persons for providing research facilities.
  • Kamchatka Summer Trips 2019

    Kamchatka Summer Trips 2019

    Kamchatka Summer Trips 2019 KAMCHATKA TRAVEL COMPANY Tel: (4152) 20-10-10, 42-70-71 Mobile: +7-914-786-11-16 Fax: (4152) 42-77-41 E-mail: [email protected] Skype: sedova.ira www.kamchatintour.ru http://www.facebook.com/ VisitKamchatka https://vk.com/kamchatintour Welcome to Kamchatka! Kamchatka is called the Edge of Russia, every morning In the work of our company we pay special attention to of our unbounded Motherland begins here. the concepts of ecological tourism. We only organize such kind of activities that do not harm the unique Kamchatka Have you ever heard of Kamchatka? Have you ever had nature. We organize only „catch-and-realease“ fishing a chance to look into the crater of an active volcano or to tours and hunting with a camera trips. Some of the most TRIPS SUMMER KAMCHATKA watch a bear fishing for salmon? These and many other popular destinations among our foreign guests are flower adventurous trips can be done with the Tourist Company watching, animal and bird viewing tours. The culture „Kamchatintour“. of local Kamchatka natives, Itelmens, Koryaks, Evens, The „Kamchatintour“ tourist company can be fairly Aleutians and Chukchis are also of great interest. called a veteran of Kamchatka tourism. Our company has Amazing landscapes, volcanoes, geysers and hot springs been working since May 1990. make a great impression upon Kamchatka guests. Today dozens of specialists are engaged in work during the high season: guides and interpreters, Kamchatka is the land of unique drivers and delivery men, cooks, porters, conductors, doctors, consulting scientists, and many others.
  • Final Report and Determination

    Final Report and Determination

    Marine Stewardship Council Assessment Narody Severa-Bolsheretsk Salmon Fisheries Final Report and Determination 26 April 2018 MRAG Americas, Inc. 8950 Martin Luther King Jr. Street N, Suite 202, St Petersburg, FL 33702, USA Raymond Beamesderfer Dr. Dmitry Lajus CLIENT DETAILS: Narody Severa Ltd. & Bolsheretsk Ltd Kamchatka, Russia MSC reference standards: MSC Certification Requirements (CR) Version 2.0 MRAG US1724 NSB salmon FA Final Report and Determination 1 CONTENTS 1 EXECUTIVE SUMMARY ................................................................................................. 4 2 AUTHORSHIP AND PEER REVIEWERS ............................................................................... 7 2.1 Assessment Team ............................................................................................................. 7 2.2 Peer Reviewers ................................................................................................................. 7 3 DESCRIPTION OF THE FISHERY ....................................................................................... 8 3.1 Unit(s) of Assessment (UoA) and Scope of Certification Sought ..................................... 8 3.1.1 UoA and Proposed Unit of Certification (UoC) .............................................................. 8 3.1.2 Final UoC(s) ................................................................................................................... 9 3.1.3 Total Allowable Catch and Catch Data ........................................................................
  • C S a S S C C S

    C S a S S C C S

    C S A S S C C S Canadian Science Advisory Secretariat Secrétariat canadien de consultation scientifique Research Document 2007/070 Document de recherche 2007/070 Not to be cited without Ne pas citer sans permission of the authors * autorisation des auteurs * Conservation Units for Pacific Unités de conservation du Salmon under the Wild Salmon saumon du Pacifique en vertu de Policy la Politique concernant le saumon sauvage L. Blair Holtby1 and Kristine A. Ciruna2 1Science Branch Fisheries and Oceans Canada Institute of Ocean Sciences P.O. Box 6000, 9860 W Saanich Road Sidney, BC V8L 4B2 2Acting Manager of Conservation Science and Planning Nature Conservancy of Canada 110 Eglinton Ave. West, Suite 400 Toronto, ON M4R 1A3 * This series documents the scientific basis for the * La présente série documente les bases evaluation of fisheries resources in Canada. As scientifiques des évaluations des ressources such, it addresses the issues of the day in the time halieutiques du Canada. Elle traite des frames required and the documents it contains are problèmes courants selon les échéanciers dictés. not intended as definitive statements on the Les documents qu’elle contient ne doivent pas subjects addressed but rather as progress reports être considérés comme des énoncés définitifs on ongoing investigations. sur les sujets traités, mais plutôt comme des rapports d’étape sur les études en cours. Research documents are produced in the official Les documents de recherche sont publiés dans language in which they are provided to the la langue officielle utilisée dans le manuscrit Secretariat. envoyé au Secrétariat. This document is available on the Internet at: Ce document est disponible sur l’Internet à: http://www.dfo-mpo.gc.ca/csas/ ISSN 1499-3848 (Printed / Imprimé) © Her Majesty the Queen in Right of Canada, 2008 © Sa Majesté la Reine du Chef du Canada, 2008 Table of Contents page 1.
  • Occurrence and Genetic Typing of Infectious Hematopoietic Necrosis Virus in Kamchatka, Russia

    Occurrence and Genetic Typing of Infectious Hematopoietic Necrosis Virus in Kamchatka, Russia

    DISEASES OF AQUATIC ORGANISMS Vol. 75: 1–11, 2007 Published March 29 Dis Aquat Org Occurrence and genetic typing of infectious hematopoietic necrosis virus in Kamchatka, Russia Svetlana L. Rudakova1,*, Gael Kurath2, Elena V. Bochkova1 1Kamchatka Research Institute of Fisheries and Oceanography (KamchatNIRO), Naberezhnaya 18, Petropavlovsk-Kamchatskii 683000, Russia 2USGS Western Fisheries Research Center, 6505 NE 65th Street, Seattle, Washington 98115, USA ABSTRACT: Infectious hematopoietic necrosis virus (IHNV) is a well known rhabdoviral pathogen of salmonid fish in North America that has become established in Asia and Europe. On the Pacific coast of Russia, IHNV was first detected in hatchery sockeye from the Kamchatka Peninsula in 2001. Results of virological examinations of over 10 000 wild and cultured salmonid fish from Kamchatka during 1996 to 2005 revealed IHNV in several sockeye salmon Oncorhynchus nerka populations. The virus was isolated from spawning adults and from juveniles undergoing epidemics in both hatchery and wild sockeye populations from the Bolshaya watershed. No virus was detected in 2 other water- sheds, or in species other than sockeye salmon. Genetic typing of 8 virus isolates by sequence analy- sis of partial glycoprotein and nucleocapsid genes revealed that they were genetically homogeneous and fell within the U genogroup of IHNV. In phylogenetic analyses, the Russian IHNV sequences were indistinguishable from the sequences of North American U genogroup isolates that occur throughout Alaska, British Columbia, Washington, and Oregon. The high similarity, and in some cases identity, between Russian and North American IHNV isolates suggests virus transmission or exposure to a common viral reservoir in the North Pacific Ocean.
  • 03 Beacham FB106(3)

    03 Beacham FB106(3)

    Determination of population structure and stock composition of chum salmon (Oncorhynchus keta) in Russia determined with microsatellites Item Type article Authors Beacham, Terry D.; Varnavskaya, Nataly V.; Le, Khai D.; Wetklo, Michael H. Download date 30/09/2021 13:11:58 Link to Item http://hdl.handle.net/1834/25479 245 Abstract—Variation at 14 microsat- Determination of population structure and stock ellite loci was examined in 34 chum salmon (Oncorhynchus keta) popula- composition of chum salmon (Oncorhynchus keta) tions from Russia and evaluated for its use in the determination of popu- in Russia determined with microsatellites lation structure and stock composi- tion in simulated mixed-stock fishery Terry D. Beacham (contact author) samples. The genetic differentiation Email address: [email protected] index (Fst) over all populations and loci was 0.017, and individual locus Department of Fisheries and Oceans values ranged from 0.003 to 0.054. Pacific Biological Station Regional population structure was Nanaimo, British Columbia, Canada V9T 6N7 observed, and populations from Pri- morye, Sakhalin Island, and north- east Russia were the most distinct. Nataly V. Varnavskaya Microsatellite variation provided Kamchatka Fishery and Oceanography Research Institute evidence of a more fine-scale popu- 18 Naberezhnaya Street lation structure than those that had Petropavlovsk-Kamchatsky 683000, Russia previously been demonstrated with other genetic-based markers. Analy- sis of simulated mixed-stock samples Khai D. Le indicated that accurate and precise Michael H. Wetklo regional estimates of stock composi- tion were produced when the micro- Department of Fisheries and Oceans satellites were used to estimate stock Pacific Biological Station compositions.
  • Translation 2784

    Translation 2784

    l' r.,'•) .: _ ^^'- FISHERIES RESEARCH BOARD OF Cé%,N.FiYA J Translation Series No. 2784 The stoneflies.(Plecoptera) of,Kamchatkà.(an ècological-fauni.stical:otitline) Orj.,c3inal, title : Vesnyaki Kamchatskovo polyostrova ( ekologo-zoo-- gëogràficheskii.ocherk) From: Izvéstiya Tikhookeanskogo Naûchno-Isslcdovatel'skogo. Insti^uta , Ry^nogo Yhozyaistva i Okeanôgrafii (TINRO) (Proceedings of the Pacific.Scientific ResearcYi.Institute of Marine Fisheries and Oceanography), 78 : 203-=224 ÿ ,,19.7.0. Translated by the Translation Büreau(LGP) Mu].tilingual Services Divisiôn. Department.of the Secretary of. Staté_ of. Canada Departnient of the Environment' Fishéries Research Boàrd of Canada Biological Station Nanaimo, B.C. 1973 65 pages typescript f y i SECRÉTARIAT D'ÉTAT DLPA{2'{M[NT OF THE SECRETARY OF STATE :SUREAU DES TRADUCTIONS TRANSLATION BUREAU MULTII,INGUAL SERVICES DIVISION DES SERVICES CANADA DIVISION MULTILINGUES INTO --,- EN TRAHSLATED FR0^1- TRADUCTION DE English l'`ti.i s s :i an--- AUTHOR - AUtEUR I. M. Levanidova ?I7LE IN ENGLiSH - TITRE ANGLAIS The stoneflies (Ylecoptera) of Kamchatka (an(-.ecological-faunistical outlizle) . TITLE IN FOREIGN LANGUAGE (TRANSLITERATE FOREIGN CIIARACTERS) TITRE EN LANGUE ETRANGERE ( TRANSCRIRE EN CARACTÉRES ROMAINS) Vesnf,aki Kamchatskovo polyostrova ( ekologo--zoogeograficheslt.ii ocl--.erk) NAME OF BOOK OR PUBLICATION) IN FULL. TRANSLITERATE-FOREIGN CHARACTERS. REFER»NCE IN FOREIGN LANGUAGE ( NOM DU LIVRE OU PUBLICATION), AU COMPLET, TRANSCRIRE EN CARACTÈRES ROMAINS. P,EF•ERENCEi EN C.ANGUE ETRANGERE ( Izvestiya Tikhookeanskova Nauchno•-issleaovatel'skovo Instituta Rybnovo z<hozyaistva i Okeanografii 78:203-224, 1970 REFERENCE IN ENGLISH - REFERENCE EN ANGLAIS Reports of the Pacific Research Institute of Fisheries and. Oceanography 78:203-224, 1970 PAGE NUt.4FiERS IN ORIGINAL - EDITEUR PUBLISHER DATE OF PUBLICATION NUMEROS DES PAGES DANS DATE DE PUBLICATION L'ORIGINAL YEAR ISSUE N0.
  • Pre-Assessment of the Narodysevera and Bolsheretsksalmon Fishery Prepared for “Narodyseveraco” Ltd and “Bolsheretsk” Lt

    Pre-Assessment of the Narodysevera and Bolsheretsksalmon Fishery Prepared for “Narodyseveraco” Ltd and “Bolsheretsk” Lt

    10051 5th Street N., Suite 105 St. Petersburg, Florida33702-2211 Tel: (727) 563-9070 Fax: (727) 563-0207 Em a il: MRAG.Am ericas@mragam ericas.com President: Andrew A. Rosenberg, Ph.D. Pre-Assessment of the NarodySevera and BolsheretskSalmon Fishery Prepared for “NarodySeveraCo” Ltd and “Bolsheretsk” Ltd [Obschestvo s ogranichennoiotvetstvennostiu “Rybolovetskayaartel “NarodySevera” and obschestvo s ogranichennoiotvetstvennostiu “Bolsheretsk”]. Prepared by MRAG Americas, Inc. Assessment Team: Robert J. Trumble, Ph.D., MRAGAmericas Dmitry Lajus, Ph.D., St. PetersburgStateUniversity October 2011 1 INTRODUCTION The Marine Stewardship Council (MSC), an independent, global, non-profit organization, works to enhance responsible management of seafood resources and to ensure the sustainability of global fish stocks and the health of the marine ecosystem. It is supported by a broad coalition of those with a stake in the future of the global seafood supply. The MSC harnesses consumer power by identifying sustainable seafood products through an eco-label. The MSC has identified the following mission statement: To safeguard the world’s seafood supply by promoting the best environmental choice. This report is on results of preassessment of salmon fisheries of “Rybolovetskaya artel Narody Severa” Ltd and “Bolsheretsk” Ltd which are fishing for Pacific salmon: pink salmonOncorhynchusgorbuscha, chum salmon O. keta, sockeye salmonO. nerka, coho salmon O. kisuth,chinook salmon O. tschawytscha, char Salvelinus sp (S.malma, S. leucomonas and S. alpinus) in the Sea of Okhotsk, Western coast of Kamchatka peninsula, Ust-Bolsheretsk district, Bolshaia and Kikhchik riversarea, according to standards of Marine Stewardship Council. This report may provide only recommendations; full certification will be conducted completely independently of results of pre-assessment.
  • Vityaz-Avto, Delta, Kamber, Pymta West Kamchatka Salmon Fisheries Public Comment Draft Report

    Vityaz-Avto, Delta, Kamber, Pymta West Kamchatka Salmon Fisheries Public Comment Draft Report

    MRAG-MSC-F13-v1.1 May 2021 8950 Martin Luther King Jr. Street N. #202 St. Petersburg, Florida 33702-2211 Tel: (727) 563-9070 Fax: (727) 563-0207 Email: [email protected] President: Andrew A. Rosenberg, Ph.D. Vityaz-Avto, Delta, Kamber, Pymta West Kamchatka Salmon Fisheries Public Comment Draft Report May 2021 Conformity Assessment Body (CAB) MRAG Americas, Inc. Assessment team Raymond Beamesderfer and Dmitry Lajus Fishery client Vityaz-Avto Co Ltd, Delta Co Ltd, Pymta Co Ltd, Kamber Co Ltd Assessment Type First reassessment MRAG Americas—VA-Delta Kamchatka salmon fisheries PCDR 1 MRAG-MSC-F13-v1.1 May 2021 Document Control Record Document Draft Submitted By Date Reviewed By Date ACDR RB, DL 28 August 2020 ASP 22 Sept 2020 CDR/PRDR RB, DL 23 February 2021 MC 2 March 2021 PRD RB, DL 10 May 2021 MC 13 May 2021 MRAG Americas—VA-Delta Kamchatka salmon fisheries PCDR 2 MRAG-MSC-F13-v1.1 May 2021 Contents 1 Executive summary ........................................................................................... 5 2 Report details .................................................................................................... 6 2.1 Authorship and peer review details ................................................................................. 6 2.2 Version details ................................................................................................................ 7 3 Unit(s) of Assessment and Certification, and Results Overview .......................... 7 3.2 Assessment results overview..........................................................................................11
  • Public Certification Report

    Public Certification Report

    Marine Stewardship Council Assessment VA-Delta Kamchatka Salmon Fisheries Public Certification Report September 2016 MRAG Americas, Inc. 10051 5th St N, Suite 105, St Petersburg, FL 33702, USA Raymond Beamesderfer Dr. Dmitry Lajus CLIENT DETAILS: Vityaz-Avto Co Ltd and Delta Co Ltd Kamchatka, Russia MSC reference standards: MSC Certification Requirements (CR) Version 2.0 CONTENTS 1 AUTHORSHIP AND PEER REVIEWERS .......................................................................... 6 1.1 Assessment Team ........................................................................................................ 6 1.2 Peer Reviewers ............................................................................................................ 6 2 DESCRIPTION OF THE FISHERY .................................................................................. 7 2.1 Unit(s) of Assessment (UoA) and Scope of Certification Sought ................................ 7 2.1.1 UoA and Proposed Unit of Certification (UoC) ........................................................ 7 2.1.2 Final UoC(s) ............................................................................................................. 8 2.1.3 Total Allowable Catch and Catch Data ................................................................... 8 2.1.4 Scope of Assessment in Relation to Enhanced Fisheries ......................................... 9 2.1.5 Scope of Assessment in Relation to Introduced Species Based Fisheries (ISBF) ...... 9 2.2 Overview of the fishery ..............................................................................................