DOCSLIB.ORG

Global Analysis Reveals the Complexity of the Human Glomerular Extracellular Matrix

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Global Analysis Reveals the Complexity of the Human Glomerular Extracellular Matrix BASIC RESEARCH www.jasn.org Global Analysis Reveals the Complexity of the Human Glomerular Extracellular Matrix † † Rachel Lennon,* Adam Byron,* Jonathan D. Humphries,* Michael J. Randles,* † ‡ † | Alex Carisey,* Stephanie Murphy,* David Knight, Paul E. Brenchley, Roy Zent,§ and Martin J. Humphries* *Wellcome Trust Centre for Cell-Matrix Research and ‡Biological Mass Spectrometry Core Facility, Faculty of Life Sciences, and †Faculty of Medical and Human Sciences, University of Manchester, Manchester, United Kingdom; §Division of Nephrology, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee; and |Department of Medicine, Veterans Affairs Hospital, Nashville, Tennessee ABSTRACT The glomerulus contains unique cellular and extracellular matrix (ECM) components, which are required for intact barrier function. Studies of the cellular components have helped to build understanding of glomerular disease; however, the full composition and regulation of glomerular ECM remains poorly understood. We used mass spectrometry-based proteomics of enriched ECM extracts for a global analysis of human glomerular ECM in vivo and identified a tissue-specific proteome of 144 structural and regulatory ECM proteins. This catalog includes all previously identified glomerular components plus many new and abundant components. Relative protein quantification showed a dominance of collagen IV, collagen I, and laminin isoforms in the glomerular ECM together with abundant collagen VI and TINAGL1. Protein net- work analysis enabled the creation of a glomerular ECM interactome, which revealed a core of highly connected structural components. More than one half of the glomerular ECM proteome was validated using colocalization studies and data from the Human Protein Atlas. This study yields the greatest number of ECM proteins relative to previous investigations of whole glomerular extracts, highlighting the impor- tance of sample enrichment. It also shows that the composition of glomerular ECM is far more complex than previously appreciated and suggests that many more ECM components may contribute to glomerular development and disease processes. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium with the dataset identifier PXD000456. J Am Soc Nephrol 25: 939–951, 2014. doi: 10.1681/ASN.2013030233 The glomerulus is a sophisticated organelle com- In addition to operating as a signaling platform, prisinguniquecellularandextracellularmatrix(ECM) ECM provides a structural scaffold for adjacent cells components. Fenestrated capillary endothelial cells and has a tissue-specific molecular composition.3,4 and overlying podocytes are separated by a special- ized glomerular basement membrane (GBM), and Received March 11, 2013. Accepted September 10, 2013. these three components together form the filtration Published online ahead of print. Publication date available at barrier. Mesangial cells and their associated ECM, www.jasn.org. the mesangial matrix, exist between adjacent capil- Present address: Adam Byron, Edinburgh Cancer Research lary loops and maintain the three-dimensional or- United Kingdom Centre, Institute of Genetics and Molecular ganizationof the capillary bundle.Inturn,theparietal Medicine, University of Edinburgh, Edinburgh, United Kingdom. epithelial cells and ECM of Bowman’s capsule enclose Correspondence: Dr. Rachel Lennon, Wellcome Trust Centre for this network of capillaries. Cells adhere to ECM pro- Cell-Matrix Research, Michael Smith Building, University of teins by adhesion receptors, and these interactions are Manchester, Manchester M13 9PT, United Kingdom. Email: Rachel. required to maintain intact barrier function of the [email protected] glomerulus.1,2 Copyright © 2014 by the American Society of Nephrology J Am Soc Nephrol 25: 939–951, 2014 ISSN : 1046-6673/2505-939 939 BASIC RESEARCH www.jasn.org Candidate-based investigations of glomerular ECM have fo- Therefore, to interrogate this complexity effectively, a systems- cused on the GBM and shown that it resembles the typical level understanding of glomerular ECM is required. To address basal lamina found in multicellular organisms, containing a the need for a global analysis of the extracellular environment core of glycoproteins (collagen IV, laminins, and nidogens) within the glomerulus, we used mass spectrometry (MS)-based and heparan sulfate proteoglycans (agrin, perlecan, and colla- proteomics of glomerular ECM fractions to define the human gen XVIII).5 Mesangial and parietal cell ECMs have been less glomerular ECM proteome. well investigated; nonetheless, they are also thought to contain similar core components in addition to other glycoproteins, including fibronectin.6,7 Thus, the glomerulus consists of a RESULTS combination of condensed ECM within the GBM and Bow- man’s capsule and loose ECM supporting the mesangial cells. Isolation of Glomerular ECM The ECM compartments in the glomerulus are thought to Using purified isolates of human glomeruli (Figure 1A), we be distinct and exhibit different functional roles. The GBM is developed a fractionation approach to collect glomerular integral to the capillary wall and therefore, functionally linked ECM proteins (Figure 1B). Before homogenization and solu- to glomerular filtration.5 Mutations of tissue-restricted iso- bilization, extracted glomeruli appeared acellular, suggestive forms of collagen IV (COL4A3, COL4A4,andCOL4A5)and of successful ECM enrichment (Figure 1A). Western blotting laminin (LAMB2), which are found in the GBM, cause signif- confirmed enrichment of ECM proteins (collagen IVand lam- icant barrier dysfunction and ultimately, renal failure.8,9 Less inin) and depletion of cytoplasmic and nuclear proteins is understood about the functions of mesangial and parietal (nephrin, actin, and lamin B1) in the ECM fraction (Figure cell ECMs, although expansion of the mesangial compartment 1C). Glomerular ECM fractions from three adult human kid- is a histologic pattern seen across the spectrum of glomerular neys were then extracted and analyzed by MS. disease.10 Compositional investigation of the distinct glomerular Gene Ontology Enrichment Analysis of ECM Fractions ECM compartments is limited by the technical difficulties of All proteins identified by MS were allocated to categories separation. Early investigations of GBM constituents used the according to their gene ontology (GO) assignment, and the relative insolubility of ECM proteins to facilitate separation enrichment of GO terms in the dataset was assessed using GO from cellular proteins in the glomerulus but did not separate enrichment analysis, which is described in Supplemental the GBM from mesangial and parietal cells ECMs.11,12 Re- Methods. The network of enriched GO terms clustered into cently, studies incorporating laser microdissection of glomer- three subnetworks, and the largest, most confidently identified ular sections have been coupled with proteomic analyses.13,14 subnetwork was for ECM-related GO terms (Figure 2A). A These studies report both cellular and ECM components and large majority of other proteins were included in two addi- typically require pooled material from glomerular sections to tional subnetworks representing mitochondrial and cytoskel- improve protein identification. The ability of laser microdis- etal GO terms, and the presence of these proteins in the ECM section to separate glomerular ECM compartments has not yet fractions is likely to be caused by the strength of their inter- been tested; however, this approach will be limited by the molecular interactions with ECM proteins. Spectral counting amount of protein that is possible to retrieve. To achieve was used to determine the enrichment of ECM in each of the good coverage of ECM proteins within a tissue, proteomic four fractions collected from isolated human glomeruli. There studies need to combine a reduction in sample complexity was 38% enrichment of extracellular proteins in the glomer- with maximal protein quantity. Currently, the inability to sep- ular ECM fractions (Figure 2B), and this result compares arate glomerular ECM compartments in sufficient quantity favorably with the 12%–30% enrichment of ECM proteins re- is a limitation that prohibits proteomic studies of these struc- ported in comparable proteomic studies.15 tures; however, for other tissues, proteomic analysis of ECM has been achieved by enrichment of ECM combined with sam- Relative Abundance of Glomerular ECM Proteins ple fractionation.15 To determine the relative abundance of glomerular ECM Although the composition of the ECM in other tissues has proteins, we used MS to analyze additional glomerular ECM been addressed using proteomic approaches,15 studies of glo- fractions from three human kidneys, and we quantified the merular ECM to date have used candidate-based technologies. proteins using a peptide intensity approach,20 which is de- These studies have identified key molecular changes during scribed in Supplemental Methods. Using this analysis, the 10 development and disease and highlighted the compositional most abundant proteins were a combination of collagens, lam- and organizational dynamics of glomerular ECM. Nonethe- inin 521, and heparan sulfate proteoglycans (Figure 2C, Sup- less, the extracellular environment within the glomerulus is plemental Table 1), which have all previously been reported in the setting for a complex series of interactions between both the glomerulus. In addition, we found collagen VI and the structural ECM proteins and ECM-associated
Load more

Recommended publications
  • Exploring the Potential of the Platelet Membrane Proteome As a Source Of
    Donovan et al. Alzheimer’s Research & Therapy 2013, 5:32 http://alzres.com/content/5/3/32 RESEARCH Open Access Exploring the potential of the platelet membrane proteome as a source of peripheral biomarkers for Alzheimer’s disease Laura E Donovan1†, Eric B Dammer2†, Duc M Duong3, John J Hanfelt4, Allan I Levey1, Nicholas T Seyfried1,3* and James J Lah1* Abstract Introduction: Peripheral biomarkers to diagnose Alzheimer’s disease (AD) have not been established. Given parallels between neuron and platelet biology, we hypothesized platelet membrane-associated protein changes may differentiate patients clinically defined with probable AD from noncognitive impaired controls. Methods: Purified platelets, confirmed by flow cytometry were obtained from individuals before fractionation by ultracentrifugation. Following a comparison of individual membrane fractions by SDS-PAGE for general proteome uniformity, equal protein weight from the membrane fractions for five representative samples from AD and five samples from controls were pooled. AD and control protein pools were further divided into molecular weight regions by one-dimensional SDS-PAGE, prior to digestion in gel. Tryptic peptides were analyzed by reverse-phase liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS). Ionized peptide intensities were averaged for each identified protein in the two pools, thereby measuring relative protein abundance between the two membrane protein pools. Log2-transformed ratio (AD/control) of protein abundances fit a normal distribution, thereby permitting determination of significantly changed protein abundances in the AD pool. Results: We report a comparative analysis of the membrane-enriched platelet proteome between patients with mild to moderate AD and cognitively normal, healthy subjects.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Immunoglobulin G Is a Platelet Alpha Granule-Secreted Protein
    Immunoglobulin G is a platelet alpha granule-secreted protein. J N George, … , L K Knieriem, D F Bainton J Clin Invest. 1985;76(5):2020-2025. https://doi.org/10.1172/JCI112203. Research Article It has been known for 27 yr that blood platelets contain IgG, yet its subcellular location and significance have never been clearly determined. In these studies, the location of IgG within human platelets was investigated by immunocytochemical techniques and by the response of platelet IgG to agents that cause platelet secretion. Using frozen thin-sections of platelets and an immunogold probe, IgG was located within the alpha-granules. Thrombin stimulation caused parallel secretion of platelet IgG and two known alpha-granule proteins, platelet factor 4 and beta-thromboglobulin, beginning at 0.02 U/ml and reaching 100% at 0.5 U/ml. Thrombin-induced secretion of all three proteins was inhibited by prostaglandin E1 and dibutyryl-cyclic AMP. Calcium ionophore A23187 also caused parallel secretion of all three proteins, whereas ADP caused virtually no secretion of any of the three. From these data and a review of the literature, we hypothesize that plasma IgG is taken up by megakaryocytes and delivered to the alpha-granules, where it is stored for later secretion by mature platelets. Find the latest version: https://jci.me/112203/pdf Rapid Publication Immunoglobulin G Is a Platelet Alpha Granule-secreted Protein James N. George, Sherry Saucerman, Shirley P. Levine, and Linda K. Knieriem Division ofHematology, Department ofMedicine, University of Texas Health Science Center, and Audie L. Murphy Veterans Hospital, San Antonio, Texas 78284 Dorothy F.
    [Show full text]
  • Supplemental Figure 1. Vimentin
    Double mutant specific genes Transcript gene_assignment Gene Symbol RefSeq FDR Fold- FDR Fold- FDR Fold- ID (single vs. Change (double Change (double Change wt) (single vs. wt) (double vs. single) (double vs. wt) vs. wt) vs. single) 10485013 BC085239 // 1110051M20Rik // RIKEN cDNA 1110051M20 gene // 2 E1 // 228356 /// NM 1110051M20Ri BC085239 0.164013 -1.38517 0.0345128 -2.24228 0.154535 -1.61877 k 10358717 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 /// BC 1700025G04Rik NM_197990 0.142593 -1.37878 0.0212926 -3.13385 0.093068 -2.27291 10358713 NM_197990 // 1700025G04Rik // RIKEN cDNA 1700025G04 gene // 1 G2 // 69399 1700025G04Rik NM_197990 0.0655213 -1.71563 0.0222468 -2.32498 0.166843 -1.35517 10481312 NM_027283 // 1700026L06Rik // RIKEN cDNA 1700026L06 gene // 2 A3 // 69987 /// EN 1700026L06Rik NM_027283 0.0503754 -1.46385 0.0140999 -2.19537 0.0825609 -1.49972 10351465 BC150846 // 1700084C01Rik // RIKEN cDNA 1700084C01 gene // 1 H3 // 78465 /// NM_ 1700084C01Rik BC150846 0.107391 -1.5916 0.0385418 -2.05801 0.295457 -1.29305 10569654 AK007416 // 1810010D01Rik // RIKEN cDNA 1810010D01 gene // 7 F5 // 381935 /// XR 1810010D01Rik AK007416 0.145576 1.69432 0.0476957 2.51662 0.288571 1.48533 10508883 NM_001083916 // 1810019J16Rik // RIKEN cDNA 1810019J16 gene // 4 D2.3 // 69073 / 1810019J16Rik NM_001083916 0.0533206 1.57139 0.0145433 2.56417 0.0836674 1.63179 10585282 ENSMUST00000050829 // 2010007H06Rik // RIKEN cDNA 2010007H06 gene // --- // 6984 2010007H06Rik ENSMUST00000050829 0.129914 -1.71998 0.0434862 -2.51672
    [Show full text]
  • Global Analysis Reveals the Complexity of the Human Glomerular Extracellular Matrix
    Global analysis reveals the complexity of the human glomerular extracellular matrix Rachel Lennon,1,2 Adam Byron,1,* Jonathan D. Humphries,1 Michael J. Randles,1,2 Alex Carisey,1 Stephanie Murphy,1,2 David Knight,3 Paul E. Brenchley,2 Roy Zent,4,5 and Martin J. Humphries.1 1Wellcome Trust Centre for Cell-Matrix Research, Faculty of Life Sciences, University of Manchester, Manchester, UK; 2Faculty of Medical and Human Sciences, University of Manchester, Manchester, UK; 3Biological Mass Spectrometry Core Facility, Faculty of Life Sciences, University of Manchester, Manchester, UK; 4Division of Nephrology, Department of Medicine, Vanderbilt University Medical Center, Nashville, TN, USA; and 5Veterans Affairs Hospital, Nashville, TN, USA. *Present address: Edinburgh Cancer Research UK Centre, Institute of Genetics and Molecular Medicine, University of Edinburgh, Edinburgh, UK. Running title: Proteome of the glomerular matrix Word count: Abstract: 208, main text 2765 Corresponding author: Dr Rachel Lennon, Wellcome Trust Centre for Cell-Matrix Research, Michael Smith Building, University of Manchester, Manchester M13 9PT, UK. Phone: 0044 (0) 161 2755498. Fax: 0044 (0) 161 2755082. Email: [email protected] Abstract The glomerulus contains unique cellular and extracellular matrix (ECM) components, which are required for intact barrier function. Studies of the cellular components have helped to build understanding of glomerular disease; however, the full composition and regulation of glomerular ECM remains poorly understood. Here, we employed mass spectrometry–based proteomics of enriched ECM extracts for a global analysis of human glomerular ECM in vivo and identified a tissue-specific proteome of 144 structural and regulatory ECM proteins. This catalogue includes all previously identified glomerular components, plus many new and abundant components.
    [Show full text]
  • Alterations in Platelet Alpha-Granule Secretion and Adhesion on Collagen Under Flow in Mice Lacking the Atypical Rho Gtpase Rhobtb3
    cells Article Alterations in Platelet Alpha-Granule Secretion and Adhesion on Collagen under Flow in Mice Lacking the Atypical Rho GTPase RhoBTB3 Martin Berger 1,2, David R. J. Riley 1, Julia Lutz 1, Jawad S. Khalil 1, Ahmed Aburima 1, Khalid M. Naseem 3 and Francisco Rivero 1,* 1 Centre for Atherothrombosis and Metabolic Disease, Hull York Medical School, Faculty of Health Sciences, University of Hull, HU6 7RX Hull, UK; [email protected] (M.B.); [email protected] (D.R.J.R.); [email protected] (J.L.); [email protected] (J.S.K.); [email protected] (A.A.) 2 Department of Internal Medicine 1, University Hospital, RWTH Aachen, 52074 Aachen, Germany 3 Leeds Institute for Cardiovascular and Metabolic Medicine, University of Leeds, LS2 9NL Leeds, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-1482-466433 Received: 8 January 2019; Accepted: 7 February 2019; Published: 11 February 2019 Abstract: Typical Rho GTPases, such as Rac1, Cdc42, and RhoA, act as molecular switches regulating various aspects of platelet cytoskeleton reorganization. The loss of these enzymes results in reduced platelet functionality. Atypical Rho GTPases of the RhoBTB subfamily are characterized by divergent domain architecture. One family member, RhoBTB3, is expressed in platelets, but its function is unclear. In the present study we examined the role of RhoBTB3 in platelet function using a knockout mouse model. We found the platelet count, size, numbers of both alpha and dense granules, and surface receptor profile in these mice were comparable to wild-type mice.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Label-Free Proteomic Methodology for the Analysis of Human Kidney Stone Matrix Composition Frank A
    Witzmann et al. Proteome Science (2016) 14:4 DOI 10.1186/s12953-016-0093-x METHODOLOGY Open Access Label-free proteomic methodology for the analysis of human kidney stone matrix composition Frank A. Witzmann1*, Andrew P. Evan2, Fredric L. Coe3, Elaine M. Worcester3, James E. Lingeman4 and James C. Williams Jr2 Abstract Background: Kidney stone matrix protein composition is an important yet poorly understood aspect of nephrolithiasis. We hypothesized that this proteome is considerably more complex than previous reports have indicated and that comprehensive proteomic profiling of the kidney stone matrix may demonstrate relevant constitutive differences between stones. We have analyzed the matrices of two unique human calcium oxalate stones (CaOx-Ia and CaOx-Id) using a simple but effective chaotropic reducing solution for extraction/solubilization combined with label-free quantitative mass spectrometry to generate a comprehensive profile of their proteomes, including physicochemical and bioinformatic analysis.` Results: We identified and quantified 1,059 unique protein database entries in the two human kidney stone samples, revealing a more complex proteome than previously reported. Protein composition reflects a common range of proteins related to immune response, inflammation, injury, and tissue repair, along with a more diverse set of proteins unique to each stone. Conclusion: The use of a simple chaotropic reducing solution and moderate sonication for extraction and solubilization of kidney stone powders combined with label-free quantitative mass spectrometry has yielded the most comprehensive list to date of the proteins that constitute the human kidney stone proteome. Keywords: Calcium oxalate, Kidney stone, Label-free quantitative liquid chromatography–tandem mass spectrometry, Matrix protein, Nephrolithiasis, Proteomics Background deposition is the primary event, at least in the formation The organic matrix within urinary stones has long been of CaOx stones over plaque.
    [Show full text]
  • Environmental Influences on Endothelial Gene Expression
    ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community.
    [Show full text]
  • The Interplay Between Dysregulated Ion Transport and Mitochondrial Architecture As a Dangerous Liaison in Cancer
    International Journal of Molecular Sciences Review The Interplay between Dysregulated Ion Transport and Mitochondrial Architecture as a Dangerous Liaison in Cancer Stine F. Pedersen 1,* , Mette Flinck 1 and Luis A. Pardo 2,* 1 Department of Biology, Faculty of Science, University of Copenhagen, 2100 Copenhagen, Denmark; mette.fl[email protected] 2 Oncophysiology Group, Max Planck Institute for Experimental Medicine, 37075 Göttingen, Germany * Correspondence: [email protected] (S.F.P.); [email protected] (L.A.P.) Abstract: Transport of ions and nutrients is a core mitochondrial function, without which there would be no mitochondrial metabolism and ATP production. Both ion homeostasis and mitochondrial phenotype undergo pervasive changes during cancer development, and both play key roles in driving the malignancy. However, the link between these events has been largely ignored. This review comprehensively summarizes and critically discusses the role of the reciprocal relationship between ion transport and mitochondria in crucial cellular functions, including metabolism, signaling, and cell fate decisions. We focus on Ca2+,H+, and K+, which play essential and highly interconnected roles in mitochondrial function and are profoundly dysregulated in cancer. We describe the transport and roles of these ions in normal mitochondria, summarize the changes occurring during cancer development, and discuss how they might impact tumorigenesis. Keywords: mitochondrial fission; mitochondrial fusion; calcium; pH; potassium; membrane potential; metabolism; apoptosis; cell cycle; metastasis Citation: Pedersen, S.F.; Flinck, M.; Pardo, L.A. The Interplay between Dysregulated Ion Transport and Mitochondrial Architecture as a 1. Introduction Dangerous Liaison in Cancer. Int. J. Since the first observation of mitochondria in the 1840s, a century had to pass until it Mol.
    [Show full text]
  • The Spectraplakin Dystonin Antagonizes YAP Activity and Suppresses Tumourigenesis Praachi B
    www.nature.com/scientificreports OPEN The spectraplakin Dystonin antagonizes YAP activity and suppresses tumourigenesis Praachi B. Jain1,2,3, Patrícia S. Guerreiro1,2,3, Sara Canato1,2,3 & Florence Janody 1,2,3* Aberrant expression of the Spectraplakin Dystonin (DST) has been observed in various cancers, including those of the breast. However, little is known about its role in carcinogenesis. In this report, we demonstrate that Dystonin is a candidate tumour suppressor in breast cancer and provide an underlying molecular mechanism. We show that in MCF10A cells, Dystonin is necessary to restrain cell growth, anchorage-independent growth, self-renewal properties and resistance to doxorubicin. Strikingly, while Dystonin maintains focal adhesion integrity, promotes cell spreading and cell-substratum adhesion, it prevents Zyxin accumulation, stabilizes LATS and restricts YAP activation. Moreover, treating DST- depleted MCF10A cells with the YAP inhibitor Verteporfn prevents their growth. In vivo, the Drosophila Dystonin Short stop also restricts tissue growth by limiting Yorkie activity. As the two Dystonin isoforms BPAG1eA and BPAG1e are necessary to inhibit the acquisition of transformed features and are both downregulated in breast tumour samples and in MCF10A cells with conditional induction of the Src proto-oncogene, they could function as the predominant Dystonin tumour suppressor variants in breast epithelial cells. Thus, their loss could deem as promising prognostic biomarkers for breast cancer. Breast cancer progression depends on cell autonomous regulatory mechanisms, driven by mutations and epi- genetic changes, and on non-cell autonomous interactions with the surrounding tumour microenvironment1,2. During this multistep process, normal breast epithelial cells acquire various cellular properties arising from dereg- ulated cellular signalling3,4.
    [Show full text]
  • Protein Expression Analysis of an in Vitro Murine Model of Prostate Cancer Progression: Towards Identification of High-Potential Therapeutic Targets
    Journal of Personalized Medicine Article Protein Expression Analysis of an In Vitro Murine Model of Prostate Cancer Progression: Towards Identification of High-Potential Therapeutic Targets Hisham F. Bahmad 1,2,3 , Wenjing Peng 4, Rui Zhu 4, Farah Ballout 1, Alissar Monzer 1, 1,5 6, , 1, , 4, , Mohamad K. Elajami , Firas Kobeissy * y , Wassim Abou-Kheir * y and Yehia Mechref * y 1 Department of Anatomy, Cell Biology and Physiological Sciences, Faculty of Medicine, American University of Beirut, Beirut 1107-2020, Lebanon; [email protected] (H.F.B.); [email protected] (F.B.); [email protected] (A.M.); [email protected] (M.K.E.) 2 Arkadi M. Rywlin M.D. Department of Pathology and Laboratory Medicine, Mount Sinai Medical Center, Miami Beach, FL 33140, USA 3 Herbert Wertheim College of Medicine, Florida International University, Miami, FL 33199, USA 4 Department of Chemistry and Biochemistry, Texas Tech University, Lubbock, TX 79409, USA; [email protected] (W.P.); [email protected] (R.Z.) 5 Department of Internal Medicine, Mount Sinai Medical Center, Miami Beach, FL 33140, USA 6 Department of Biochemistry and Molecular Genetics, Faculty of Medicine, American University of Beirut, Beirut 1107-2020, Lebanon * Correspondence: [email protected] (F.K.); [email protected] (W.A.-K.); [email protected] (Y.M.); Tel.: +961-1-350000 (ext. 4805) (F.K.); +961-1-350000 (ext. 4778) (W.A.K.); +1-806-834-8246 (Y.M.); Fax: +1-806-742-1289 (Y.M.); 961-1-744464 (W.A.K.) These authors have contributed equally to this work as joint senior authors.
    [Show full text]