DOCSLIB.ORG

Assessment of Enteroviruses from Sewage Water and Clinical Samples During Eradication Phase of Polio in North India Sarika Tiwari1,2* and Tapan N

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Assessment of Enteroviruses from Sewage Water and Clinical Samples During Eradication Phase of Polio in North India Sarika Tiwari1,2* and Tapan N Tiwari and Dhole Virology Journal (2018) 15:157 https://doi.org/10.1186/s12985-018-1075-7 RESEARCH Open Access Assessment of enteroviruses from sewage water and clinical samples during eradication phase of polio in North India Sarika Tiwari1,2* and Tapan N. Dhole1 Abstract Background: The Enterovirus (EV) surveillance system is inadequate in densely populated cities in India. EV can be shed in feces for several weeks; these viruses are not easily inactivated and may persist in sewage for long periods. Surveillance and epidemiological study of EV-related disease is necessary. Methods: In this study, we compare the EV found in sewage with clinically isolated samples. Tissue culture was used for isolation of the virus and serotype confirmed by enterovirus neutralization tests. Results: We found positive cases for enterovirus from clinical and sewage samples and identified additional isolates as echovirus 9, 11, 25 & 30 by sequencing. Conclusion: There is a close relation among the serotypes of enterovirus shed in stools and isolated from the environment but few serotypes which were detected in sewage samples were not found clinically and the few which were detected clinically not found in sewage because some viruses are difficult to detect by the cell culture method.This study will be helpful for the researchers who are working on polio and nonpolio enterovirus especially in the countries which are struggling for polio eradication. Keywords: Acute flaccid paralysis, Environmental surveillance, Phylogenetic analysis, Sewage water Background than 100 serotypes have been identified [3] including more Enterovirus can be transported in the environment than 70 enterovirus serotypes have been identified in through groundwater, estuarine water, seawater, rivers, humans [4]. EV may cause various symptoms, varying aerosols emitted from sewage treatment plants, insuffi- from asymptomatic infection to gastroenteritis, myocarditis ciently treated water, drinking water, and private wells that and aseptic meningitis [5]. Human echovirus and coxsack- receive treated or untreated waste water either directly or ievirus display a changing pattern of dominant serotypes in indirectly. These viruses are usually transmitted via the both sewage and clinical isolates, Echovirus 6, 19, 3, and fecal-oral route and primarily infect and replicate in the coxsackievirus B4, B5, A9 have successively became the gastrointestinal tract of the host [1]. In addition to causing most common serotypes [6]. In the environment, entero- acute diseases, EV are of public health concern because of virus can survive under a wide pH range (pH 3 to 10) and the low infectious dose needed to cause disease [2]. for extended periods at low temperature [7]. Some of the Enterovirus is nonenveloped, single-stranded, EV have been isolated from sewage water, which were cox- positive-sense viruses belonging to the family Picornaviri- sackievirus types B-3, B-4, and B-5 and E1, E7, and E11 [8]. dae. They include poliovirus, coxsackievirus (CB) groups A Interestingly, these isolations are related to reports of isola- and B, echoviruses (E), and the enterovirus. Till date, more tion of the same strains during the same period in clinical samples. In general, enterovirus show great potential to be * Correspondence: [email protected] used as water quality indicators to assess the risks associ- 1Department of Microbiology (Virology Section), Sanjay Gandhi Post ated with infectious virus transmission as well as to identify Graduate Institute of Medical Sciences (SGPGIMS), Lucknow, Uttar Pradesh 226014, India the dominant source of fecal contamination in water [8]. 2Department of Microbiology (Virology lab), Rajendra Institute of Medical Assessment of enterovirus plays an important role in Sciences (RIMS), Ranchi, JH, India © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Tiwari and Dhole Virology Journal (2018) 15:157 Page 2 of 8 exploring the circulation of these viruses in the commu- methods, including direct isolation, centrifugation and nity. Earlier studies from 1974 to 1977 in U.K., 1979–1981 two phase separation, and results of their study suggest in Canada, from 1994 to 2002 in Milwaukee, Wisconsin, that the two phase separation method is the best for max- USA, and 2000–2007 in Finland [6, 8–10]comparingsew- imum virus yield [13]. age and clinical EVs reported and demonstrated a similarity of clinical and sewage EV. Environmental surveillance Stool sample processing should be considered a complementary assessment tool to Stool sample processing was performed according to trace prevalent and negligible enterovirus circulating in the WHO protocol. In brief, Stool suspensions were pre- human population. pared by adding 5 ml of phosphate-buffered saline, 1 g of glass beads (Corning Inc., Corning, NY), antibiotics Methods (Penicillin and streptomycin, amphotericin B from Sewage sample collection GIBCO, USA). 1 ml chloroform (LAB CHEM) to 1 g of Sewage sample (approx one liter) was collected and stool samples, shaked the mixture vigorously for 20 min stored in sterile glass bottle from the collection site by in a mechanical shaker, and centrifuged at 1500 x g for directly dipping into the sewage effluent. The outer sur- 30 min at 4 °C [14]. Supernatant was kept at − 20 °C face of the bottle was rinsed with 2% sodium hypo chlor- until the inoculation on cell monolayer. ide solution, placed in a cool box, and transported to the laboratory within 1 h after collection from sewage treat- Cell culture ment plant, Daulatganz Lucknow, U.P., India (which was Human rhabdomyosarcoma (RD) and L20B (transgenic) almost 25 km. away from the institute, covers entire cells were obtained from the Center for Disease Control north, west and central zone of Lucknow city). It covers and Prevention, Atlanta, GA, USA. Minimum essential a population of approximately 10, 00,000 and is the main media (MEM) of Earle’s salt solution and fetal bovine serum sewage treatment plant of the area. The bottle was fro- (FBS) were purchased from (Sigma Aldrich, USA). All cell zen at − 20° c, until the process of virus isolation. culture media contained HEPES buffer, L-glutamine, so- dium bicarbonate penicillin, streptomycin, amphotericin B Clinical sample collection fromGIBCO,USA.Cellculturesweregrownat37°Cinin- Stool samples were collected from suspected AFP (Acute cubators with supply of 5% CO2. Cell cultures for virus iso- Flaccid Paralysis) patients from Sanjay Gandhi Post lation were grown in 25cm2 plastic flasks (Costar, Corning, Graduate Institute of Medical Sciences (clinical samples N.Y.) with 10% FBS (MEM) and maintained at 2% FBS come from north, west and central zone of Lucknow (MEM) containing 7 ml MEM, and tissue culture tube with city), Lucknow, Uttar Pradesh, India. 1.5 ml (2% FBS). Sewage sample processing Inoculation of sewage samples Sewage samples were processed for virus isolation as soon The extracted concentrate was inoculated on fresh as they were received in the laboratory. The sewage sam- monolayer cultures of L20B and RD cells in 50 ml ple was concentrated by two-phase concentration method (25 cm2) flasks. The cultured flasks were incubated at on the same day as described previously [11]. In brief, the 37 °C and examined at every 24 h for cytopathic effect pH of the sample was adjusted to 7.2 and the sample was (CPE). Samples which showed CPE were frozen and centrifuged at 5000 g for 30 min at 4 °C to pellet the thawed two times, then re-passaged on new cells. Sam- solids. 500 ml of clarified sewage was mixed with defined ples were observed for CPE up to 7 days before being amounts of two polymers, dextran and 15% polyethylene considered negative. Samples showed CPE were stored glycol (15% PEG6000). The homogenous mixture ob- for confirmation through serotyping. tained by vigorous shaking is left to stand overnight at 4 ° C in a separating funnel. This allows the polymers to sep- Inoculation of stool samples arate in two distinct layers (phases) in the funnel. Entero- The supernatant (0.2 ml each) of stool suspension were virus accumulates in the smaller bottom layer and/or at inoculated in both RD and L20B cell lines (90% mono- the boundary between the layers (interphase). The bottom layer with maintenance medium.). The cells after inocu- layer and interphase were collected drop-wise. The pellet lation were incubated at 36 °C and observed under an from the initial centrifugation was suspended in this con- inverted microscope every day up to 1 week. Further- centration, and treated with chloroform, then centrifuged more, re-passaged cultures were analyzed for 1 week. at 5000 g for 30 min at 4 °C and assayed for the presence Negative cultures were examined at least for 14 days be- of virus. The concentrated virus suspension was stored at fore being discarded. The cultures positive for virus − 20 °C until used for virus isolation [12]. This method growth (showed + 3 CPE, i.e. 75% lysed cells) were was published in a study which compared three different stored at − 20 °C for further analysis. Tiwari and Dhole Virology Journal (2018) 15:157 Page 3 of 8 Identification of enteroviruses AGTAGTCGGTTCC 3′ E-2(Antisense)– 5′-TCCG Samples showed CPE in both L20B and RD were consid- GCCCCTGAATGCGGCTAATCC 3′) were used [19]. ered as positive for the polio virus (PV) [15, 16]. How- Buffer containing 100 mM Tris-HCl, 15 mM MgCl2, 500 ever, some of the non-polio enteroviruses (NPEV) were mMKCl, pH 8.3 and 1 μl of diluted samples was added those that showed CPE only in RD cells.
Load more

Recommended publications
  • Nasoswab ® Brochure
    ® NasoSwab One Vial... Multiple Pathogens Simple & Convenient Nasal Specimen Collection Medical Diagnostic Laboratories, L.L.C. 2439 Kuser Road • Hamilton, NJ 08690-3303 www.mdlab.com • Toll Free 877 269 0090 ® NasoSwab MULTIPLE PATHOGENS The introduction of molecular techniques, such as the Polymerase Chain Reaction (PCR) method, in combination with flocked swab technology, offers a superior route of pathogen detection with a high diagnostic specificity and sensitivity. MDL offers a number of assays for the detection of multiple pathogens associated with respiratory tract infections. The unrivaled sensitivity and specificity of the Real-Time PCR method in detecting infectious agents provides the clinician with an accurate and rapid means of diagnosis. This valuable diagnostic tool will assist the clinician with diagnosis, early detection, patient stratification, drug prescription, and prognosis. Tests currently available utilizing ® the NasoSwab specimen collection platform are listed below. • One vial, multiple pathogens Acinetobacter baumanii • DNA amplification via PCR technology Adenovirus • Microbial drug resistance profiling Bordetella parapertussis • High precision robotic accuracy • High diagnostic sensitivity & specificity Bordetella pertussis (Reflex to Bordetella • Specimen viability up to 5 days after holmesii by Real-Time PCR) collection Chlamydophila pneumoniae • Test additions available up to 30 days Coxsackie virus A & B after collection • No refrigeration or freezing required Enterovirus D68 before or after collection
    [Show full text]
  • Follow-Up of COVID-19 Recovered Patients with Mild Disease
    www.nature.com/scientificreports OPEN Follow‑up of COVID‑19 recovered patients with mild disease Alina Kashif1, Manahil Chaudhry2, Tehreem Fayyaz1, Mohammad Abdullah1*, Ayesha Malik2, Javairia Manal Akmal Anwer1, Syed Hashim Ali Inam1, Tehreem Fatima2, Noreena Iqbal3 & Khadija Shoaib1 COVID‑19 may manifest as mild, moderate or severe disease with each grade of severity having its own features and post‑viral implications. With the rising burden of the pandemic, it is vital to identify not only active disease but any post‑recovery complications as well. This study was conducted with the aim of identifying the presence of post‑viral symptomatology in patients recovered from mild COVID‑19 disease. Presence or absence of 11 post‑viral symptoms was recorded and we found that 8 of the 11 studied symptoms were notably more prevalent amongst the female sample population. Our results validate the presence of prolonged symptoms months after recovery from mild COVID‑19 disease, particularly in association with the female gender. Hence, proving the post‑COVID syndrome is a recognizable diagnosis in the bigger context of the post‑viral fatigue syndrome. Te SARS-CoV-2 virus has led to a global health crisis ever since the frst case of COVID-19 was reported in November 2012 in Wuhan, China1. COVID-19 primarily targets the respiratory system with variable initial symptoms including fever, sore throat, fu-like illness, and diarrhea 2. Tere is a chance that some symptoms may linger even afer the convalescence phase has subsided. Te presence of symptoms afer recovery from a viral disease is broadly recognized as a post-viral syndrome3.
    [Show full text]
  • Coxsackie B Virus Infection As a Rare Cause of Acute Renal Failure and Hepatitis Thapa J, Koirala P, Gupta TN
    Case Note VOL. 16|NO. 1|ISSUE 61|JAN.-MARCH. 2018 Coxsackie B Virus Infection as a Rare Cause of Acute Renal Failure and Hepatitis Thapa J, Koirala P, Gupta TN Department of Nephrology National Academy of Medical Sciences, Bir Hospital, Kathmandu, Nepal. ABSTRACT We report a 37 year female patient, admitted with complains of fever, jaundice and myalgia of seven days. There was no history of trauma, drug abuse, seizure or Corresponding Author vigorous exercise nor history of renal and musculoskeletal disease. Here we have Jiwan Thapa discussed the clinical features, biochemical derangements, diagnosis of coxsackie B virus, multi organ involvement and need of urgent hemodialysis for appropriate Department of Nephrology management of the case. National Academy of Medical Sciences, Bir Hospital, Kathmandu, Nepal. KEY WORDS E-mail: [email protected] Acute renal failure, Coxsackie B, Hemodialysis, Hepatitis Citation Thapa T, Koirala P, Gupta TN. Coxsackie B Virus Infection as a rare cause of Acute Renal Failure and Hepatitis. Kathmandu Univ Med J. 2018;61(1):95-7. INTRODUCTION CASE REPORT The Coxsackie viruses are Ribonucleic acid viruses of A previously healthy 37-year-old female was admitted to the Picornaviridae family, Enterovirus genus which also our hospital with complains of fever of 7 days, jaundice includes echoviruses and polioviruses. Infections are of 4 days, severe muscle pain, especially the lower limbs, mostly asymptomatic. They are divided into groups A and discoloured urine. She also had history of malaise, and B. Coxsackie virus A virus usually affects skin and headache, sore throat and fever recorded up to 103.2°F.
    [Show full text]
  • Coxsackie B Infection and Arthritis Arsenical Treatment for Multiple
    Br Med J (Clin Res Ed): first published as 10.1136/bmj.286.6365.605 on 19 February 1983. Downloaded from BRITISH MEDICAL JOURNAL VOLUME 286 19 FEBRUARY 1983 605 patients with febrile arthritis developing in association with Coxsackie Coxsackie B infection and arthritis infection has been reported previously4; two of those patients were clinically similar to two of ours (cases 2 and 3). The patient in case 1, The clinical manifestations of acute infection with Coxsackie B virus however, who was positive for HLA-B27 and had a history suggestive are varied and include epidemic pleurodynia, myopericarditis, of pre-existing mild sacroiliitis, did not resemble the previously meningoencephalitis, and pancreatitis. In most cases the infection is reported cases. Although he may represent an example of reactive self limiting and does not result in chronic tissue damage, but it has arthritis in response to Coxsackie infection in a patient with HLA-B27, also been associated with the development of polymyositis,l cardio- we cannot exclude the possibility that direct infection of joints by myopathy,' and diabetes mellitus.3 Arthritis is not widely recognised virus occurred. as either an acute or a chronic manifestation of infection with Coxsackie infection should be considered in the differential diagnosis Coxsackie virus, and only one series, of six patients, has been reported in patients presenting with febrile systemic illness in association with previously.4 We report on three further patients, who developed seronegative arthritis of either symmetrical or asymmetrical patterns, febrile seronegative arthritis in association with clinical and serological with or without spondarthritis. evidence of Coxsackie infection; one subsequently developed a We thank the Edinburgh and South-east Scotland Blood Transfusion progressive erosive polyarthritis.
    [Show full text]
  • Required Chlorination Doses to Fulfill the Credit Value for Disinfection of Enteric Viruses in Water: a Critical Review
    Required chlorination doses to fulfill the credit value for disinfection of enteric viruses in water: A critical review Item Type Article Authors Rachmadi, Andri Taruna; Kitajima, Masaaki; Kato, Tsuyoshi; Kato, Hiroyuki; Okabe, Satoshi; Sano, Daisuke Citation Rachmadi, A. T., Kitajima, M., Kato, T., Kato, H., Okabe, S., & Sano, D. (2020). Required chlorination doses to fulfill the credit value for disinfection of enteric viruses in water: A critical review. Environmental Science & Technology. doi:10.1021/ acs.est.9b01685 Eprint version Publisher's Version/PDF DOI 10.1021/acs.est.9b01685 Publisher American Chemical Society (ACS) Journal Environmental Science & Technology Rights This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes. Download date 02/10/2021 21:39:20 Item License http://pubs.acs.org/page/policy/authorchoice_termsofuse.html Link to Item http://hdl.handle.net/10754/661375 This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes. pubs.acs.org/est Critical Review Required Chlorination Doses to Fulfill the Credit Value for Disinfection of Enteric Viruses in Water: A Critical Review Andri Taruna Rachmadi, Masaaki Kitajima, Tsuyoshi Kato, Hiroyuki Kato, Satoshi Okabe, and Daisuke Sano* Cite This: https://dx.doi.org/10.1021/acs.est.9b01685 Read Online ACCESS Metrics & More Article Recommendations *sı Supporting Information ABSTRACT: A credit value of virus inactivation has been assigned to the disinfection step in international and domestic guidelines for wastewater reclamation and reuse.
    [Show full text]
  • The Medical and Public Health Importance of the Coxsackie Viruses
    806 S.A. MEDICAL JOURNAL 25 August 1956 it seems that this mother's claim cannot be upheld, Dit lyk dus of hierdie moeder se eis nie gestaaf kan word and we must still look for further evidence of human nie en ons moet nog steeds soek na verdere bewyse van parthenogenesis. menslike partenogenese. 1. Editorial (1955): Lancet, 2, 967. 1. Van die Redaksie (1955): Lancet, 2, 967. 2. Pincus, G. and Shapiro, H. (1939): Proc. Nat. Acad. Sci., 2. Pincus, G. en Shapiro, H. (1939): Proc. Nat. Acad. Sci., 26,163. 26, 163. 3. Balfour-Lynn, S. (1956): Lancet, 1, 1072. 3. Balfour-Lynn, S. (1956): Lancet, 1, 1072. THE MEDICAL AND PUBLIC HEALTH IMPORTANCE OF THE COXSACKIE VIRUSES JA.\1ES GEAR, V.MasRoCH M'D F. R. PRINSLOO Poliomyelitis Research Foundation, South African Institute for Medical Research The Coxsackie group of viruses derived their name paralytic poliomyelitis infected also with poliovirus. from the Hudson River Town, Coxsackie, in New York As a result of more recent studies their pathogenicity State, where the first two members of this group were has now been more clearly defined. 2 The group-A identified by Dalldorf and Sickies in 1947.1 Both these viruses have been incriminated as the cause of herp­ viruses were isolated in suckling mice from the faeces angina and, as the present studies show, are possibly of children acutely ill with paralytic poliomyelitis. The related to a number of other illnesses. Coxsackie-B pathogenicity for suckling mice is one of the distinguish­ viruses have been incriminated as the cause of Bornholm ing features of this group of viruses, and their relative disease and, as the present studies show, in parts of lack of pathogenicity for adult mice and other experi­ Southern Africa are important causes ofaseptic meningo­ mental animals accounts for their escape from recogni­ encephalitis and of myocarditis neonatorum.
    [Show full text]
  • H1N1 Influenza Causing Fulminant Myocarditis Requiring Extracorporeal Membrane Oxygenation
    Open Access Case Report DOI: 10.7759/cureus.4665 H1N1 Influenza Causing Fulminant Myocarditis Requiring Extracorporeal Membrane Oxygenation Ali Hamoudi 1 , Dana Vais 2 , Vian Taqi 3 1. Internal Medicine, Chicago Medical School / Rosalind Franklin University of Medicine and Science, Chicago, USA 2. Infectious Disease, AMITA Saints Mary and Elizabeth Medical Center / Rosalind Franklin University of Medicine and Science, Chicago, USA 3. Internal Medicine, University of Baghdad, Baghdad, IRQ Corresponding author: Ali Hamoudi, [email protected] Abstract Influenza infection is a known cause of global morbidity and mortality. Most cases of influenza A (H1N1) influenza infection are mild and do not require hospitalization. Although the most common presentation is with upper respiratory tract symptoms, hemodynamic instability requiring vasoactive drugs and ventilatory support use is unusual. We present a case of acute fulminant myocarditis that presented with dyspnea, which was confirmed with laboratory tests, chest X-ray, and echocardiogram. The test for H1N1 in nasopharyngeal secretions was positive. The patient evolved to refractory cardiogenic shock despite the clinical measures applied. Categories: Cardiology, Internal Medicine, Infectious Disease Keywords: h1n1, myocarditis, ecmo, vasopressors Introduction Acute myocarditis is defined as an inflammation of the myocardial muscle, causing myocytes necrosis and inflammatory infiltrate of the heart muscle. The most common etiology is attributed to viral infections like Coxsackie B virus and adenovirus. Many people are affected by seasonal influenza every year, causing symptoms that are limited to the respiratory system. Myocardial involvement by seasonal influenza virus seems to be low [1-2]. The frequency of myocarditis secondary to seasonal influenza virus infection ranges from 0%-11%, depending on the criteria used to diagnose myocarditis, however, the prevalence of influenza A (H1N1) myocarditis remains unclear [3].
    [Show full text]
  • HUMAN ADENOVIRUS Credibility of Association with Recreational Water: Strongly Associated
    6 Viruses This chapter summarises the evidence for viral illnesses acquired through ingestion or inhalation of water or contact with water during water-based recreation. The organisms that will be described are: adenovirus; coxsackievirus; echovirus; hepatitis A virus; and hepatitis E virus. The following information for each organism is presented: general description, health aspects, evidence for association with recreational waters and a conclusion summarising the weight of evidence. © World Health Organization (WHO). Water Recreation and Disease. Plausibility of Associated Infections: Acute Effects, Sequelae and Mortality by Kathy Pond. Published by IWA Publishing, London, UK. ISBN: 1843390663 192 Water Recreation and Disease HUMAN ADENOVIRUS Credibility of association with recreational water: Strongly associated I Organism Pathogen Human adenovirus Taxonomy Adenoviruses belong to the family Adenoviridae. There are four genera: Mastadenovirus, Aviadenovirus, Atadenovirus and Siadenovirus. At present 51 antigenic types of human adenoviruses have been described. Human adenoviruses have been classified into six groups (A–F) on the basis of their physical, chemical and biological properties (WHO 2004). Reservoir Humans. Adenoviruses are ubiquitous in the environment where contamination by human faeces or sewage has occurred. Distribution Adenoviruses have worldwide distribution. Characteristics An important feature of the adenovirus is that it has a DNA rather than an RNA genome. Portions of this viral DNA persist in host cells after viral replication has stopped as either a circular extra chromosome or by integration into the host DNA (Hogg 2000). This persistence may be important in the pathogenesis of the known sequelae of adenoviral infection that include Swyer-James syndrome, permanent airways obstruction, bronchiectasis, bronchiolitis obliterans, and steroid-resistant asthma (Becroft 1971; Tan et al.
    [Show full text]
  • Viral Infections Enterovirus Infections Following T-Cell Depleted Allogeneic Transplants in Adults
    Bone Marrow Transplantation (2004) 33, 425–430 & 2004 Nature Publishing Group All rights reserved 0268-3369/04 $25.00 www.nature.com/bmt Viral infections Enterovirus infections following T-cell depleted allogeneic transplants in adults S Chakrabarti1, H Osman2, KE Collingham2, CD Fegan1 and DW Milligan1 1Departments of Haematology, Birmingham Heartlands Hospital, Birmingham, UK; and 2Public Health Laboratory, Birmingham Heartlands Hospital, Birmingham, UK Summary: kingdom, 40 366 confirmed enterovirus isolates were reported in a 20-year period (1975–1994), with 60% of Anecdotally, enteroviruses have been reported to cause the isolates being from children less than 5 years old.3 serious complications post BMT, but the exact impact of Given the fact that patients undergoing allogeneic stem cell these viruses in the post transplant period has not been transplantation are deficient in both cellular and humoral reported. We prospectively evaluated stool, urine and immunity for a prolonged period and are susceptible to a throat samples for enteroviruses by viral culture together number of endogenous and exogenous viral infections with relevant body fluids by RT-PCR in 64 allograft during this period, there is scanty data on the incidence of recipients receiving grafts T-cell depleted by Campath- enterovirus infections in this setting. Anecdotal reports 1H, following both conventional and reduced-intensity have implicated that enteroviruses might be responsible for conditioning. Seven patients (10.4%) developed nine serious complications in the post transplant period.4–8 Some episodes of enterovirus infections at a median of 146 days stool surveillance studies have reported on the isolation of post transplant. Four episodes were associated with these viruses in post transplant patients with diarrhoea, but symptomatic illnesses, which could be attributable to none have investigated the incidence and outcome of enteroviruses.
    [Show full text]
  • Various Phenotypes of Diabetes Mellitus As Ultimate Outcome of Acutely Developed Diabetic State Induced by Viral Infection
    Endocrinol.Japon. 1982, 29 (1),87-94 Various Phenotypes of Diabetes Mellitus as Ultimate Outcome of Acutely Developed Diabetic State Induced by Viral Infection KYOHEI NONAKA, HIROYUKI TOYOSHIMA*, MITSUYOSHI NAMBA AND SEIICHIRO TARUI The Second Department of Internal Medicine, Osaka University Medical School, Osaka 553 *Minoo City Hospital , Osaka 562 Abstract For 4 to 8years we followed up 3 diabetic patients in whom the onset of diabetes seemed to be closelyrelated to the well-documented Epstein-Barr virus infection(Case 1) or Coxsackie B4 virus infection(Case 2, 3). Although all developed acute ketosis-prone diabetes in the convalescent stage of the viral infections,the subsequent clinicalcourses were quite differentfrom each other. Case 1 has remained consistentlyinsulin-dependent and associatedwith positiveislet cell antibody, gastricparietal cell antibody, thyroglobulin hemoagglutinating antibody and thyroidal microsomal hemoagglutinating antibody. Case 2 restored normal glucose tolerance. Case 3 has become noninsulin-dependent diabetes mel- litusafter a 6year interval.Thus, it is reasonably presumed that viruses could be respons- iblefor the occurrence of differentphenotypes of diabetes. In at leastsome cases of acute-onsetinsu- logicalattack on the isletstriggered by a viral lin-dependentdiabetes (IDDM), an etiologicalinfection. Therefore, it is particularlyim- role of viralinfections has recentlybeen sug- portant at presentto accumulate data on long- gested by epidemiological,clinical, and ex- term clinicalobservations on acute diabetes perimental research. We have, however, as preceded by or associated with well-docu- yet, littleinformation on the ultimate clinical mented viralinfections. outcome of the virus-inducedketosis-prone For 4 to 8years we have been able to ob- diabeticstate after the acute phase in man.
    [Show full text]
  • Acute Respiratory Distress Syndrome and Myocarditis Caused by Human
    Case Report DOI: 10.14235/bas.galenos.2020.3919 Bezmialem Science 2020;8(2):212-4 Acute Respiratory Distress Syndrome and Myocarditis Caused by Human Metapneumovirus in a Child Çocukta İnsan Metapneumovirüs’ün Neden Olduğu Akut Solunum Sıkıntısı Sendromu ve Miyokardit Kahraman YAKUT, Birgül VARAN, İlkay ERDOĞAN, Kürşad TOKEL Başkent University Faculty of Medicine, Department of Pediatric Cardiology, Ankara, Turkey ABSTRACT ÖZ Human metapneumovirus (hMPV), a recently described Son yıllarda tanımlanan bir paramiksovirüs olan insan paramyxovirus, has commonly been associated with upper and metapnömovirüsü (hMPV), küçük çocuklarda genellikle üst ve alt lower respiratory tract infections in young children. Severe solunum yolu enfeksiyonları ile ilişkilendirilmiştir. hMPV ile ilişkili infections including cardiovascular disease associated with hMPV kardiyovasküler hastalık dahil olmak üzere şiddetli enfeksiyonlar have been particularly reported in older and immunocompromised özellikle yaşlı ve immün yetmezliği olan hastalarda bildirilmiştir. patients; however, there has been no previous report of hMPV Literatürde çocuklarda miyokarditle seyreden bildirilmiş hMPV causing myocarditis in a child. In this article, we present a rare case olgusu yoktu. Bu yazıda, hMPV’ye bağlı akut solunum sıkıntısı with acute respiratory distress syndrome and myocarditis associated sendromu ve miyokardit birlikteliği bulunan nadir bir çocuk hasta with hMPV in a child. sunulmuştur. Keywords: Human metapneumovirus, myocarditis, child Anahtar Sözcükler: İnsan metapneumovirus, miyokardit, çocuk Introduction Case Report Human metapneumovirus (hMPV), a recently described A previously healthy 2.5-month-old boy was hospitalized because paramyxovirus, is a non-segmented, negative-sense RNA virus (1). of nonproductive cough lasting ten days. On the third day in Since its discovery in the Netherlands in 2001, hMPV has been this hospital, his clinical condition and breathing worsened and recognized as one of the most commonly causes of upper and lower cardiomegaly was detected.
    [Show full text]
  • Antiviral Activity Exerted by Natural Products Against Human Viruses
    viruses Review Antiviral Activity Exerted by Natural Products against Human Viruses Maria Musarra-Pizzo 1, Rosamaria Pennisi 1,2 , Ichrak Ben-Amor 1,3, Giuseppina Mandalari 1,* and Maria Teresa Sciortino 1,* 1 Department of Chemical, Biological, Pharmaceutical and Environmental Sciences, University of Messina, Viale SS. Annunziata, 98168 Messina, Italy; [email protected] (M.M.-P.); [email protected] (R.P.); [email protected] (I.B.-A.) 2 Shenzhen International Institute for Biomedical Research, 1301 Guanguang Rd. 3F Building 1-B, Silver Star Hi-Tech Park Longhua District, Shenzhen 518116, China 3 Unit of Biotechnology and Pathologies, Higher Institute of Biotechnology of Sfax, University of Sfax, Sfax 3029, Tunisia * Correspondence: [email protected] (G.M.); [email protected] (M.T.S.); Tel.: +39-090-6767-5217 (G.M. & M.T.S.) Abstract: Viral infections are responsible for several chronic and acute diseases in both humans and animals. Despite the incredible progress in human medicine, several viral diseases, such as acquired immunodeficiency syndrome, respiratory syndromes, and hepatitis, are still associated with high morbidity and mortality rates in humans. Natural products from plants or other organisms are a rich source of structurally novel chemical compounds including antivirals. Indeed, in traditional medicine, many pathological conditions have been treated using plant-derived medicines. Thus, the identification of novel alternative antiviral agents is of critical importance. In this review, we summarize novel phytochemicals with antiviral activity against human viruses and their potential application in treating or preventing viral disease. Citation: Musarra-Pizzo, M.; Pennisi, R.; Ben-Amor, I.; Mandalari, G.; Keywords: viral infections; natural bioactive compounds; novel antiviral drugs; drug resistance Sciortino, M.T.
    [Show full text]