Role of AtCIPK16 in Arabidopsis abiotic tolerance
Wenmian Huang
A thesis submitted for the degree of Doctor of Philosophy School of Agriculture, Food and Wine Faculty of Sciences The University of Adelaide
May 2015
Table of Contents
Table of Contents………………………………………………………..……………………i List of Figures………………………………………………………..……………………….vii List of Tables…………………………………………………………….…………………..xi List of Abbreviations……………………………………………...……………………….xiii Abstract……………………………………………………………………………………..xvii Declaration………………………………………………………………………………….xix Acknowledgments…………………………………………………………………………..xxi Chapter 1: Literature Review and Research Aims…………………………………………..1 1.1 Salinity……………………………………………………………………………. ….1 1.1.1 Impacts of salinity………………………………………………………………… ….1 1.1.2 Effects of salinity stress on plants………………………………………………… ….1 1.1.3 The plants’ tolerance mechanism to salt stress………………………………………..2 1.2 Calcium signalling pathways….……………………………………………………..7 1.2.1 Structural characterisation of CBL……………………………………………….....8 1.2.2 Structural characterisation of CIPK…………………………………………………..9 1.2.3 Specificity of the CBL-CIPK signalling pathway…………………………………..12 1.2.4 Function of the CBL-CIPK signalling pathway……..………………………………13 1.3 AtCIPK16……………………………………..……………………………………..18 1.3.1 Potential role of AtCIPK16 in salinity tolerance………………………………….19 1.4 Research aims………………………………………………………………... ……...20 Chapter 2: General materials and methods……………………………………………..21 2.1 Plant materials……………………………………………………………………..21 2.2 Plant growth facilities……………………………………………………………….21 2.3 Plant growth in soil…………………………………………………..….………….21 2.4 Plant growth in hydroponics……………………………………………………….23 2.5 Plant growth on plates containing Murashige and Skoog media………….……...…25 2.6 DNA extractions………………………………………………………………..……25 2.6.1 Phenol/chloroform/iso-amyl alcohol method………………………………….…..25 2.6.2 Edwards DNA extraction method…………………………………………… ……...26 2.7 Agarose gel electrophoresis - DNA……………………………………………….27 2.8 DNA extraction from agarose gels…………………………………………………..27 2.9 DNA sequencing…………………………………………………………….………27 2.10 RNA extractions and agarose gel electrophoresis………………………….………..28 2.11 cDNA synthesis…………………………………………………………..…………29 2.12 Polymerase chain reaction (PCR)…………………………………………...………30 2.12.1 Routine gDNA/cDNA PCR…………………………………………………...……..30
i
2.12.2 High-fidelity PCR………………………………………………………………...…31 2.12.3 Colony PCR…………………………………………………………………..……32 2.13 Cloning PCR products into entry vectors…………………………………………33 2.14 Preparation of competent cells (Escherichia coli)…………………..………………36 2.15 Transformation of plasmid DNA into E.coli cells…………………………………36 2.16 Isolation of plasmid DNA from E.coli cells…………………………………………37 2.17 Restriction enzyme digestion of plasmid DNA……………………..………………37 2.18 LR reactions…………………………………………………………………………38 2.19 Agrobacterium-mediated stable transformation of Arabidopsis………….…………40 2.19.1 Preparation of competent A. tumefaciens AGL1 cells………………………………40 2.19.2 Transformation of plasmid DNA into A.tumefaciens AGL1 cells………..…………40 2.19.3 Transformation by floral dipping……………………………………………………41 2.20 Selection of transformants………………………………………..…………………41 2.20.1 Selection in soil…………………………………………………..…………………41 2.20.2 Selection on MS plate…………………………………………….…………………41 2.21 Statistical analysis…………………………………………………..………………42 Chapter 3: Identification of upstream regulators of AtCIPK16…………………………43 3.1 Introduction……………………………………………………………………..…..43 3.2 Chapter aims…………………………………………………………………………46 3.3 Materials and methods……………………………………………………………..46 3.3.1 Yeast two hybrid assays………………………………………………………..……46 3.3.1.1 Cloning for yeast two hybrid assays…………………………………………….…..46 3.3.1.2 Preparation of yeast strain AH109 from stock………………………………..……..51 3.3.1.3 Transformation of constructs into S. cerevisiae………………………………………….51 3.3.1.4 Yeast two-hybrid assay………………………………………………………………52 3.3.1.5 Isolation of plasmid DNA from S. cerevisiae…………………………………………….53 3.3.2 Bimolecular fluorescence complementation (BiFC) assay using both transient expression and stable expression………………………………………………...….53 3.3.2.1 Cloning of AtCBLs and AtCIPK16 into BiFC assay vector for transient expression in mesophyll protoplast……………………………………………………………...…54 3.3.2.2 Cloning of AtCBLs and AtCIPK16 into BiFC assay vector for Agrobacterium-infiltration in Arabidopsis leaves, tobacco leaves and stable constitutive over-expression in Arabidopsis plants……………………………….....58 3.3.2.3 Transient expression of AtCBLs-AtCIPK16 in Arabidopsis mesophyll protoplasts...60 3.3.2.4 Transient expression of AtCBLs-AtCIPK16 in Arabidopsis leaves using Agro-infiltration……………………………………………………………………..61 3.3.2.5 Transient expression of AtCBLs-AtCIPK16 in tobacco leaves (Nicotiana benthamiana) using Agro-infiltration……………………………………………….62 3.3.2.6 Stable constitutive over-expression of AtCBLs-AtCIPK16 in Arabidopsis ecotype ii
Col-0…………………………………………………………………………………63 3.3.2.7 Fluorescence imaging by confocal microscopy……………………………………64 3.4 Results………………………………………………………………………………65 3.4.1 Vector construction for a yeast two hybrid assay…………………………………..65 3.4.2 Yeast two hybrid assay shows AtCIPK16 interacts with 6 AtCBL proteins………..67 3.4.3 Vector construction for Bimolecular Fluorescence Complementation (BiFC) assay in Arabidopsis mesophyll protoplast…………………………………………………..68 3.4.4 Bimolecular fluorescent complementation (BiFC) assay in Arabidopsis mesophyll protoplast……………………………………………………………………………71 3.4.5 Vector construction for a Bimolecular Fluorescence Complementation (BiFC) assay using either Agro-infiltration of Arabidopsis and tobacco leaves, or stable expression in Col-0………………………………………………………………………………75 3.4.6 Subcellular localization using Agro-infiltration in Arabidopsis leaves…………….78 3.4.7 Subcellular localization using Agro-infiltration in tobacco leaves……………….88 3.4.8 Localization of AtCBLs-AtCIPK16 complexes using stable expression in Arabidopsis ecotype Col-0…………………………………………………………..91 3.5 Discussion……………………………………………………………………...……93 3.5.1 Interacting partners of AtCIPK16 in yeast two hybrid assays……………………93 3.5.2 Interactions and localizations of AtCBL-AtCIPK16 in BiFC assays………………..95 3.6 Summary……………………………………………………………………..……102 Chapter 4: Identification of downstream targets of AtCIPK16…………………………103 4.1 Introduction……………………………………………………………...…………103 4.2 Materials and methods……………………………………………………………105 4.2.1 Pull-down assay……………………………………………………………………105 4.2.1.1 Peptide antigen design……………………………………………………………105 4.2.1.2 Generation of a specific rabbit IgG antibody…………………………………….106 4.2.1.3 Production of recombinant protein………………………………………………107 4.2.1.4 SDS Polyacrylamide Gel Electrophoresis…………………………………………110 4.2.1.5 Western blot for identification of the expected band on the gel……………………111 4.2.1.6 Optimization of recombinant protein synthesis.…………………………………112 4.2.1.7 Purification of denatured protein…………………………………………………113 4.2.1.8 Refolding of purified denatured protein……………………………………………114 4.2.2 Yeast two hybrid assay……………………………………………………………115 4.2.2.1 Cloning for yeast two hybrid assay ………………………………………..………115 4.2.2.2 Analysis of the protein sequences of AtHKT1;1, AtSOS1 and AtAKT1 …………115 4.4 Results…………………………………………………………………………..…117 4.4.1 Alignment of the protein sequences of AtCIPK16 with 26 AtCIPKs in Arabidopsis and peptide antigen design…………………………………………………………117 4.4.2 Construction of plasmid for protein synthesis……………………………………121
iii
4.4.3 Recombinant His-AtCIPK16 was obtain from E.coli and recognized by anti-AtCIPK16 antibody in Western blot…………………………………………121 4.4.4 Optimization of recombinant protein synthesis…………………………………123 4.4.4.1 Expression of recombinant His-AtCIPK16 in two codon bias-adjusted E. coli strains showed no improvement in protein yield………………………………………..124 4.4.4.2 Low temperature induction shows no improvement on soluble protein yield……126 4.4.4.3 Induction of His-AtCIPK16 using 0.2 % L-arabinose resulted in the maximum yield of insoluble recombinant protein…………………………………………………..126 4.4.5 Recombinant His-AtCIPK16 was successfully denatured by Guanidine-HCl and purified by using cobalt chelating resin………………………………………….128 4.4.6 Purified denatured His-AtCIPK16 was refolded using gradual dialysis…………128 4.4.7 Construction of vector for yeast two hybrid assay…………………………………129 4.5 Discussion……………………………………………………………………….…133 4.5.1 Expression of recombinant protein His-AtCIPK16………………………………133 4.5.2 Potential downstream targets of AtCIPK16………………………………………134 4.5.3 The alignment of 26 AtCIPKs shows unique regions of AtCIPK16 in functional motifs…………………………………………………………………………….…135 4.5.4 Future work…………………………………………………………………..……140 4.6 Summary……………………………………………………………………..……142 Chapter 5: Dissecting the role of AtCIPK16 in salinity tolerance……………………..143 5.1 Introduction……………………………………………………………………..…143 5.2 Chapter aims………………………………………………………………………145 5.3 Methods……………………………………………………………………………145 5.3.1 Plant materials for complementary function analysis…………………………….145 5.3.2 Cloning of AtCIPK16 into constitutive expression vector…………………………145 5.3.3 Transformation of plasmid DNA into A.tumefaciens AGL1 competent cells….…146 5.3.4 Stable constitutive over-expression of AtCIPK16 in sos2 knockout lines……….146 5.3.5 Selection of transformants of AtCIPK16-sos2……………………………………146
5.3.6 Phenotyping of T2 transgenic lines that constitutively over-expresses AtCIPK16 in sos2 knockout lines under salt stress………………………………….……………147 5.3.7 Biomass and flame photometry measurements…………………………………….148 5.3.8 Genotyping……………………………………………………………………..….148 5.3.9 RT-PCR……………………………………………………………………………149 5.3.10 Radioactive Tracer Experiments…………………………………………………149 5.4 Result………………………………………………………………………………152 5.4.1 Vector constructed for stable constitutive expression of AtCIPK16 in sos2 knockout lines…………………………………………………………………………..……152 5.4.2 Analysis of the expression level of SOS2, AtCIPK16 in sos2 knockout lines and complimentary lines………………………………………………………………153 iv
5.4.3 Constitutive expression of AtCIPK16 fails to complement the salt sensitivity phenotype of sos2 knockout lines……………………………………………….…154 5.4.4 Movement of 22Na+ through 35S:AtCIPK16 expressing Arabidopsis…………...…158 5.5 Discussion……………………………………………………………………….…161 5.5.1 AtCIPK16 and AtCIPK24 could have no functional redundancy…………….……161 5.5.2 AtCIPK16 may alter net Na+ influx in root……………………………………...…163 5.5.3 Future work……………………………………………………………………...…164 5.6 Summary………………………………………………………………………...…165 Chapter 6: Characterization of AtCIPK16 under various abiotic stresses………………166 6.1 Introduction……………………………………………………………………...…166 6.2 Chapter aims………………………………………………………………………168 6.3 Materials and methods……………………………………………………………168 6.3.1 In silico analysis of AtCIPK16……………………………………………………168 6.3.2 Selection of homozygous transgenic lines that constitutively over-expresses AtCIPK16…………………………………………………………………………168 6.3.3 Phenotyping transgenic lines constitutively over-expressing AtCIPK16 under ABA treatment………………………………………………………………………...…..17 1 6.3.4 Characterization of the phenotype of homozygous transgenic lines that constitutively over-expresses AtCIPK16 under low potassium stress……………………...……..171 6.3.5 Characterization of the phenotype of homozygous transgenic lines that constitutively over-expresses AtCIPK16 when exposed to additional KCl……………………172 6.3.6 Characterization of the phenotype of homozygous transgenic lines that constitutively over-expresses AtCIPK16 under drought stress…………………………………173 6.3.7 Characterization of the phenotype of homozygous transgenic lines that constitutively over-expresses AtCIPK16 under osmotic stress…………………………………174 6.3.8 Characterization of the phenotype of homozygous transgenic lines that constitutively over-expresses AtCIPK16 under cold stress…………………………………….174 6.3.9 Proline content measurements……………………………………………….……..175 6.3.10 Chlorophyll content measurements………………………………………………176 6.3.11 Flame photometry measurements…………………………………………………176 6.4 Result………………………………………………………………………………177 6.4.1 In silico expression profile of AtCIPK16…………………………………………177 6.4.2 Constitutive expression of AtCIPK16 resulted in lower germination rate with increasing ABA treatments……………………………………………...………….179 6.4.3 Under low potassium stress constitutively over-expressing AtCIPK16 lines have improved root K+ accumulation compared with Col-0 ……………………………186 6.4.4 Col-0 and AtCIPK16 over-expression lines behave similarly under high KCl stress……………………………………………………………………………….189
v
6.4.5 Col-0 and AtCIPK16 over-expression lines behave similarly under drought stress…………………………………………………………………….………….192 6.4.6 Col-0 and AtCIPK16 over-expression lines behave similarly during osmotic stresses…………………………………………………………………….….……194 6.4.7 Col-0 and AtCIPK16 over-expression lines behave similarly during cold stresses..197 6.5 Discussion…………………………………………………………….…………....199 6.5.1 AtCIPK16 exhibits ABA-related characteristics…………………………………199 6.5.2 AtCIPK16 exhibits K+ transport characteristics…………………………………202 6.5.3 AtCIPK16 exhibits no characteristics for drought, osmotic and cold stresses……205 6.5.4 Limitations of experimental techniques……………………………………………206 6.6 Summary…………………………………………………………….…………..…208 Chapter 7: General Discussion……………………………………………………………..209 7.1 Summary of accomplished work…………………………………………………209 7.1.1 AtCBL interacting partners and localizations of AtCIPK16……………………….209 7.1.2 Function of AtCIPK16 in Na+, K+ transport and response to ABA in Arabidopsis plants…………...... 210 7.2 Future work………………………………………………………………..……….211 7.2.1 Future directions for functionally characterising AtCIPK16 in ion transport……………………………………………………………………..….…..211 7.2.2 Future directions for identifying AtCIPK16 equivalents in different species…..….212 7.2.3 Future directions for identifying downstream targets of AtCIPK16……………….213 7.3 Conclusion…………………………………………………………………….……215 References………………………………………………………………………….…….….217 Appendix…………………………………………………………………………….………241
vi
List of Figures
Figure 1.1: The main mechanisms of salt tolerance in plants…………………………………..6 Figure 1.2: The general structure of CBL proteins contains four EF-hands. Black numbered boxes representing each EF-hand in CBLs……………………………………………………..9 Figure 1.3: The general structure of CIPKs……………………………………………………10 Figure 1.4: Sequence of the activation loops motif in all AtCIPKs…………………………. 10 Figure 1.5: Diagram showing different abiotic stresses triggering a variety of CBL-CIPK signalling pathways in Arabidopsis………………………………………………………….13 Figure 2.1: Schematic diagram of pCR8/GW/TOPO TA Gateway® entry vector…………..35 Figure 3.1: The bait vector pTOOL27 was used to express AtCIPK16 fused to GAL4 DNA binding domain for the yeast two hybrid assay…………………………………………..….49 Figure 3.2: The prey vector pTOOL28 was used to express one of the 10 AtCBL genes fused to GAL4 activation domain for yeast two hybrid assay……………………………………….50 Figure 3.3: The vector pUC-SPYNE/GW was used to express AtCIPK16 fused to the N-terminal split eYFP fragment for BiFC assay……………………………………………..56 Figure 3.4: The vector pUC-SPYNE/GW was used to express 10 AtCBLs fused to the C-terminal split eYFP fragment for BiFC assay……………………………………………..57 Figure 3.5: The vector pGPTVII was used to express 10 AtCBLs/AtCIPK16 fused to N-/C-terminal split eYFP fragment for Agrobacterium-infiltration in Arabidopsis leaves, tobacco leaves and stable constitutive over-expression in Arabidopsis plants………………59 Figure 3.6: pTOOL28 + AtCBL1 to 10 and pTOOL27 + AtCIPK16.…………………………66 Figure 3.7: Yeast two hybrid assay showing AtCIPK16 interacts with 6 AtCBL proteins…..67 Figure 3.8: The pUC-SPYCE/GW+ AtCBL1 to 10 and pUC-SPYNE/GW+ AtCIPK16 plasmids used for subcellular localization in a mesophyll protoplast expression system…………….70 Figure 3.9: Subcellular localization of AtCBLs::YC and AtCIPK16::YN interactions in Arabidopsis mesophyll protoplasts…………………………………………………………..73 Figure 3.10: pGPTVII.Hyg. AtCBL1 (to 10)::YC, pGPTVII.Hyg.YC::AtCBL1 (to 10), pGPTVII.Bar.AtCIPK16::YN and pGPTVII.Bar. YN::AtCIPK16 plasmids used for Agro-infiltration and stable expression in Col-0…………………………………………….77 Figure 3.11: YN::AtCIPK16 and AtCBLs::YC interactions in Arabidopsis leaves………….81 Figure 3.12: YN::AtCIPK16 and YC::AtCBLs interactions in Arabidopsis leaves………….83 Figure 3.13: AtCIPK16::YN and YC::AtCBLs interactions in Arabidopsis leaves………….85 Figure 3.14: AtCIPK16::YN and AtCBLs::YC interactions in Arabidopsis leaves…………..87 Figure 3.15: YN::AtCIPK16 and AtCBLs::YC interactions in tobacco leaves (Nicotiana benthamiana)…………………………………………………………………………………90 Figure 3.16: Co-expression of different AtCBLs / AtCIPK16 split YFP constructs in
vii
Arabidopsis ecotype Col-0…………………………………………………………………….92 Figure 4.1: The vector pDEST17 was used to express AtCIPK16 and AtCBL4 in E.coli…..108 Figure 4.2: Diagram of Western blot setup…………………………………………………111 Figure 4.3: Alignment of 26 AtCIPKs protein sequence using Vector NTI version 11.0……119 Figure 4.4: Hydrophilicity plot of AtCIPK16 using ExPASy ProtScale program……………120 Figure 4.5: pDEST17-AtCIPK16 and pDEST17-AtCBL4 used for production of His-tagged AtCIPK16 and His-tagged AtCBL4 (negative control) in E.coli…………………………….121 Figure 4.6: Concentration of His-AtCIPK16 in E.coli strain BL21-AI after 0-4 h induction period…………………………………………………………………………………………123 Figure 4.7: SDS-PAGE analysis of protein samples from E.coli after either a 2 h or 4 h induction……………………………………………………………………………………..124 Figure 4.8: Rare E.coli Codon analysis of the DNA sequence of AtCIPK16 using Rare Codon Calculator……………………………………………………………………………………125 Figure 4.9: SDS-PAGE analysis of protein samples extracted from various E.coli strains: BL21-CodonPlus(DE3)-RIL, BL21-CodonPlus(DE3)-RP and BL21-AI……………………126 Figure 4.10: SDS-PAGE analysis of protein samples from cultures induced at different temperatures and concentrations of L-arabinose…………………………………………127 Figure 4.11: SDS-PAGE gel of purified denatured His-AtCIPK16 extracted from E. coli and refolded His-AtCIPK16……………………………………………………………………128 Figure 4.12: Topology model of AtSOS1, AtHKT1;1 and AtAKT1 with predicted phosphorylation sites………………………………………………………………………131 Figure 4.13: Alignment of 26 AtCIPKs protein sequence using Vector NTI version 11.0…139 Figure 4.14: The vector pMDC83 will be used to express AtCIPK16 fused to GFP tag……..141 Figure 5.1: pMDC32-35S:AtCIPK16 for constitutive over-expression of AtCIPK16 in sos2 knockout lines ………………………………………………………………………………..152 Figure 5.2: Expression analysis of sos2 knockout lines and AtCIPK16-sos2 complimentary lines…………………………………………………………………………………………..153 Figure 5.3: Characterisation of sos2 knockout and sos2-AtCIPK16 complimentary lines on plates …………………………………………………………………………………………156 Figure 5.4: Characterisation of sos2 knockout and sos2-AtCIPK16 complimentary lines on soil……………………………………………………………………………………………157 Figure 5.5: The expression levels of AtCIPK16 in transgenic lines were confirmed by RT-PCR using cDNA which was synthesised from RNA extracted from root tissue…………………159 Figure 5.6: Measurement of Na+ content in 35S:AtCIPK16 over-expressing Col-0 and nulls after 5 days 50 mM NaCl treatment in the preliminary experiments……………………….159 Figure 5.7: Measurement of 22Na+ content in 35S:AtCIPK16 over-expressing Col-0 and nulls using radioactive tracer 22Na+………………………………………………………………160 Figure 6.1: pTOOL2-35S:AtCIPK16 for constitutively over-expressing AtCIPK16 in Arabidopsis…………………………………………………………………………………170 viii
Figure 6.2: The transcriptional response of AtCIPK16 to various stimuli (e.g. biotic, chemical, hormone, nutrient, photoperiod, stresses and others) in 152 microarray studies stored in Genevestigator………………………………………………………………………………178 Figure 6.3: Effect of ABA on seedling growth..…………………………………………….180 Figure 6.4: Effect of increasing ABA concentrations on germination rate of AtCIPK16 over-expression lines day 3 to day 10 after vernalization……………………………………185 Figure 6.5: AtCIPK16 over-expressing lines have improved K+ uptake under K+ deficient conditions……………………………………………………………………………………188 Figure 6.6: AtCIPK16 over-expressing Arabidopsis were not more tolerant to high concentrations of K+…………………………………………………………………………191 Figure 6.7: Over-expression of AtCIPK16 does not improve drought tolerance……………193 Figure 6.8: AtCIPK16 over-expressing lines have no significant difference in osmotic stress tolerance when compared to Col-0…………………………………………………………195 Figure 6.9: Over-expression of AtCIPK16 does not improve cold tolerance………………198
ix
x
List of Tables
Table 2.1: Nutrient solution for soil grown Arabidopsis………………………………………22 Table 2.2: Germination solution for hydroponics Arabidopsis………………………………..24 Table 2.3: Basal nutrient solution for hydroponics Arabidopsis………………………………24 Table 2.4: Primers for sequencing the entry vectors and destination vectors constructed in this project…...... 28 Table 2.5: Platinum Taq polymerase PCR solution and program used for routine PCR………………………………………………………………………….…………….31 Table 2.6: Platinum Taq polymerase high fidelity and Elongase PCR solution and program used for the routine PCR……………………………………………………………………32 Table 2.7: Platinum Taq polymerase PCR solution and program used for the colony PCR…..33 Table 2.8: Summary of destination vectors used in this thesis………………………………39 Table 3.1: Primers used to the clone coding sequences of 10 AtCBLs, AtCIPK16, AtCIPK16Nt and AtAKT1 from Arabidopsis cDNA…………………………………………………………48 Table 3.2: Primers used to clone coding sequences (without the stop codon) of 10 AtCBLs and AtCIPK16 from Arabidopsis cDNA…………………………………………………………55 Table 3.3: Primers for genotyping the BiFC stable expressed Arabidopsis……………….…..64 Table 3.4: Summary of entry vectors and destination vectors constructed for yeast two hybrid assay……………………………………………………………………………………...……65 Table 3.5: Summary of entry vectors and destination vectors constructed for transient expression of CIPK16 and CBL genes in mesophyll protoplast using BiFC assay..…………69 Table 3.6: Summary of entry vectors and destination vectors constructed for transient expression in Arabidopsis and tobacco leaves or for stable expression in Col-0……………..76 Table 3.7: Summary of AtCIPK16 – AtCBL interactions and their cellular location in Arabidopsis leaves using Agro-infiltrations with various vector pairs……………………….79 Table 3.8: Summary of AtCIPK16/AtCBL interactions as measured using yeast two hybrids and transient expression in Arabidopsis protoplasts, Arabidopsis leaves and tobacco (N.benthamiana) leaves………………………………………………………………………99 Table 4.1: Names and accession numbers of 26 AtCIPKs aligned for antibody design…….106 Table 4.2: Four elution buffers used to dissociate and elute purified protein from resin…….114 Table 4.3: Prediction of His-AtCIPK16 solubility in E.coli………………………………….124 Table 5.1: sos2 knockout lines obtained from NASC………………………………………145 Table 5.2: Primers for genotyping AtCIPK16-sos2 lines…………………………………….147 Table 5.3: Primers for examining the expression levels of AtCIPK24, AtActin2, AtHKT1;1 and AtCIPK16…………………………………………………………………………………….149 Table 5.4: Tissue concentrations of 22Na+ and % translocated from root to shoot…………160
xi
Table 6.1: Primers used for identifying homozygous transgenic lines over-expressing AtCIPK16…………………………………………………………………………………….169 Table 6.2: Medium for low stress treatment…………………………………………………172 Table 6.3: Programme used for cold treatment……….……………………………………175
xii
List of Abbreviations
Abbreviation Full term 3′ Three prime, of nucleic acid sequence 5′ Five prime, of nucleic acid sequence # Number % Percent ± Plus and minus × Times °C Degree Celsius aa Amino acid ABA Abscisic acid ACPFG Australian Centre for Plant Functional Genomics AGRF Australian Genome Research Facility Agrobacterium Agrobacterium tumefaciens AKT Arabidopsis potassium channel amiRNA Artificial micro ribonucleic acid ANOVA Analysis of variance Arg Arginine Asp Aspartic acid At Arabidopsis thaliana AVP Vacuolar H+-pyrophosphatase BLAST Basic Local Alignment Search Tool BNS Basal nutrient solution bp Base pairs, of nucleic acid BSA Bovine serum albumin C-terminal Carboxyl terminal C-terminus Carboxyl terminus Ca2+ Calcium ion
Ca(NO3)2 Calcium nitrate
CaCl2 Calcium chloride cAMP Adenosine 3’, 5’-cyclic monphophate CaMV Cauliflower mosic virus Cat.# Catalogue number CBL Calcineurin B-like proteins cDNA Complementary deoxyribonucleic acid CHX Cation/H+ exchangers CIPK CBL-interacting protein kinases Cl- Chloride ion cm Centimetre(s)
CoCl2 Cobalt chloride Col-0 Columbia-0
xiii
CuSO4 Cupric sulfate d Day(s) Da Dalton DEPC Diethylpyrocarbonate
dH2O Deionised water DNA Deoxyribonucleic acid dNTPs Mixture of equal equivalents of dATP, dTTP, dCTP and dGTP EDTA Ethylenediaminetetraacetic acid FAO Food and Agricultural Organization of the United Nations FW Fresh weight g Gram(s) g Gravity gDNA Genomic deoxyribonucleic acid GFP Green fluorescent protein
H2O water
H3BO3 Boric acid HCl Hydrochloric acid His Polyhistidine tag h Hour(s) H+ Proton K+ Potassium ion KAT Potassium Arabidopsis transporter kb Kilo base pairs, of nucleic acid KCl Potassium chloride KDa Kilo Dalton
KH2PO4 Monopotassium phosphate
KNO3 Potassium nitrate LB Luria and Bertani medium Leu Leucine LR Ligation reaction Lys Lysine M Molar 2-(N-Morpholino) ethanesulfonic acid, MES 4-morpholineethanesulfonic acid Met Methionine mg Miligram(s) Mg2+ Magnesium ion
MgSO4 Magnesium sulphate min Minute(s) mL Millilitre(s) mm Millimetre(s) mM Millimolar Mn2+ Manganese ion
MnCl2 Manganese choride xiv
mRNA Messenger RNA MS media Murashige and Skoog media mV millivolt n Sample size N-terminal Amine terminal N-terminus Amine terminus N/A Not applicable Na+ Sodium ion
Na2HPO4 Sodium phosphate dibasic
Na2MoO4 Sodium molybdate NaCl Sodium chloride NaFe(III)EDTA Sodium iron EDTA NaOH Sodium hydroxide NCBI National Centre for Biotechnology Information
NH4NO3 Ammonium nitrate NHX Na+/H+ antiporter
NiCl2 Nickel chloride nM Nanomolar No. Number NO3- Nitrate ion nosT Bacterial nopaline synthase terminator sequence ng Nanogram(s)
OD600 Optical density measured at 600 nm PAGE Polyacrylamide gel electrophoresis PBS Phosphate buffered saline PCR Polymerase chain reaction PEG Polyethylene glycol pI Isoelectric point PI Proidium iodide 3- PO4 Phosphate ion Q-PCR Quantitative real time polymerase chain reaction QTL Quantitative trait loci RNA Ribonucleic acid RO Reverse osmosis ROS Reactive oxygen species sec Second(s) SEM Standard error of the mean Ser Serine SDS Sodium dodecyl sulphate SKOR Stelar K+ outward rectifier SOS Salt overly sensitive T-DNA Transfer deoxyribonucleic acid
T1 Primary Arabidopsis transformant
T2 Progeny of T1 plant
xv
TAE Tris base, acetic acid and EDTA buffer TE Tris-EDTA Thr Threonine Tm Melting temperature, of primers Tris-HCl Tris (hydroxymethyl) aminomethane hydrochloride Trition X-100 Toctylphenoxypolyethoxyethanol Trp Tryptophan Tyr Tyrosine U Units UTR Untranslated region V voltage v/v Volume per volume w/v Weight per volume Xenopus Xenopus laevis YFP Yellow fluorescent protein Zn2+ Zinc ion
ZnSO4 Zinc sulfate
xvi
Abstract
Soil salinity is a significant environmental problem affecting agriculture around the world leading to reduced crop yield. High concentrations of Na+ affect cell metabolism and compete with K+ for the binding sites of enzymes which play important roles in cellular function. One mechanism for improving salinity tolerance of crop plants is to minimise the accumulation of Na+ in the shoot. AtCIPK16 (Calcineurin B-like-interacting protein kinase 16) has been identified as a novel candidate gene important in increasing salinity tolerance (Roy et al. 2013). Over-expression of AtCIPK16 has been shown to reduce the shoot sodium in a number of species. In both hydroponic and soil culture, Arabidopsis with constitutive over-expression of AtCIPK16 show significant reductions in Na+ concentration in shoot, compared with wild type and nulls, while Arabidopsis with amiRNA knockdown of AtCIPK16 exhibit an increase of Na+ concentration in shoot (Roy et al. 2013). While it can be clearly seen that alterations in the expression of AtCIPK16 result in increased salinity tolerance, little is known, however, about the role the protein plays in tolerance mechanisms. It is therefore important to identify its cellular location, upstream and downstream targets, and which abiotic stresses it is involved in to elucidate its function in plants.
Yeast two hybrid systems were used to identify the potential upstream CBL partners of AtCIPK16. The assay revealed 6 AtCBLs (AtCBL1, AtCBL2, AtCBL4, AtCBL5, AtCBL9 and AtCBL10) could interact with AtCIPK16. Bimolecular Fluorescence Complementation (BiFC) assays were then employed to confirm the result from Y2H and showed one more interacting AtCBL partner, AtCBL3. Additionally, BiFC demonstrated possible plasma membrane localization of the complexes of AtCBL1-AtCIPK16, AtCBL4-AtCIPK16, AtCBL5-AtCIPK16 and AtCBL9-AtCIPK16; and cytoplasm localization of the complexes of AtCBL2-AtCIPK16, AtCBL3-AtCIPK16 and AtCBL10-AtCIPK16 using transient co-expression in Nicotiana benthamiana leaves. Moreover, a pull-down assay was planned to identify downstream target proteins of AtCIPK16.
The radioactive tracer 22Na+ was used to quantify net Na+ accumulation in the different part of transgenic Arabidopsis overexpressing AtCIPK16 and nulls to determine if this gene can alter Na+ influx or Na+ translocation in plants. Only one transgenic line showed lower Na+ accumulation in root compare to nulls under salt stress, while all three transgenic lines demonstrated slightly lower but not significant Na+ translocation rate and shoot Na+ accumulation compare to nulls under 50 mM NaCl treatment. Furthermore, to examine the function redundancy of AtCIPK24 and AtCIPK16 in salt stress, complementary lines of constitutively expressing AtCIPK16 in the atcipk24/sos2 knockout lines background were
xvii
generated and analysed with plate assay and soil assay. The study revealed constitutive expression of AtCIPK16 could not complement the salt sensitivity phenotype of atcipk24/sos2 knockout mutants, suggest their different functions which are non-complementary in each other’s signalling pathway.
The phenotypes of 35S:AtCIPK16 were characterized under osmotic, drought, cold, low K+ stresses and ABA treatment to examine the potential function of AtCIPK16 in other stresses. This study revealed that over-expressing AtCIPK16 plants were more sensitive to ABA and had increased K+ root accumulation when grown under low K+ stress, it appears that AtCIPK16 is involved with processes involving the transport of monovalent cations. No significant phenotypic variation was observed in cold, drought, osmotic and high KCl stresses, suggesting AtCIPK16 could be not involved in other stresses which typically require the production of compatible solutes or enzymes which mop up reactive oxygen species. However, the function of AtCIPK16 in salinity tolerance and in the response to other abiotic stresses still requires further characterization.
xviii
Declaration
This work contains no material which has been accepted for the award of any other degree or diploma in any university or other tertiary institution to Wenmian Huang and, to the best of my knowledge and belief, contains no material previously published or written by another person, except where due reference has been made in the text.
I give consent to this copy of my thesis, when deposited in the University Library, being made available for loan and photocopying, subject to the provisions of the Copyright Act 1968.
The author acknowledges that copyright of published works contained within this thesis (as listed below) resides with the copyright holder/s of those works.
I also give permission for the digital version of my thesis to be made available on the web, via the University’s digital research repository, the Library catalogue, the Australasian Digital Theses Program (ADTP) and also through web search engines, unless permission has been granted by the University to restrict access for a period of time.
………………………………………
Wenmian Huang
……………………………………….
Date
xix
xx
Acknowledgments
Firstly I would like to thank my supervisors Dr Stuart Roy and Prof. Mark Tester for their time, support, patience, understanding, encouragement and excellent guidance throughout my candidature.
I gratefully acknowledge the financial support provided from The University of Adelaide through provision of Adelaide Graduate Research Scholarship and The Australian Centre for Plant Functional Genomics during my PhD, Grain Research and Development Corporation for a travel grant to attend the IWPMB2013.
I would like to thank all people who have provided advices and technical support during my study. A special thanks to Prof. Joerg Kudla for providing advice and plasmid vectors, Dr Bettina Berger for providing advice on the project, Mr Nadim Shadiac for a lot of advice and assistance in protein experiment, Dr Matt Gilliham for providing advice and support on radioactive tracer experiments, Dr Sam Henderson for designing the experiment and providing assistance in radioactive flux assay, Dr Andrew Jacobs and Ms Jodie Kretschmer for instruction on cloning and providing plasmid vectors, Ms Natasha Bazanova for providing vectors, strains and assistance in yeast two hybrid assays, Dr Yuri Shavrukov for assistance with the flame photometer assay, Mr George Dimitroff for providing tobacco leaves in BiFC assays, Dr Gwen Mayo and Ms Lynette Waterhouse for the help with microscopy, Ms Jan Nield for assistance throughout the vectors import process, Ms. Ruth Harris for assistance and advice in English writing.
Huge thanks to all the members of the ACPFG Salt Focus Group, both past and present, for their support and help: Ms Melissa Pickering, Dr Rhiannon Schilling, Mr Gordon Wellman, Dr Sandra Schmoeckel, Dr Bo Li, Dr Aris Hairsmann, Dr Monique Shearer, Dr Nawar Shamaya, Dr Aurelie Evrard, Ms Jessica Bovill, Dr Joanne Tillbrook. Many thanks to the members of Plant Research Centre for their kind help: Ms Jiaen Qiu, Dr Bo Xu and Dr Jin Zhang.
Finally, I would like to thank my friends and parents for their support and encouragements throughout all of my studies.
xxi
xxii
Chapter 1 Literature Review and Research Aims
1.1 Salinity
1.1.1 Impacts of salinity
Soil salinity is a significant global environmental problem which severely affects agriculture and leads to a substantial reduction in crop yield (Munns and Tester 2008, Rengasamy 2010,
Roy et al. 2014, Tester and Davenport 2003). Salinity currently affects approximately 32 million hectares of dryland agriculture and 45 million hectares of irrigated agriculture in worldwide (FAO 2008, http://www.fao.org/ag/agl/agll/spush; Munns and Tester 2008,
Rengasamy 2010, Roy et al. 2014). Dryland salinity is caused both by shallow saline groundwater salts moving to the soil surface through capillary action, resulting in the accumulation of salt in the layers of the root zone in saline soil regions (Munns and Tester
2008, Rengasamy 2010). These processes are usually caused by factors such as low rainfall, high transpiration by crop plants and high water evaporation from the top soil (Munns and
Tester 2008, Rengasamy 2002, Rengasamy 2006, Rengasamy 2010). Irrigation-induced salinity can be caused by salt accumulation in soils after irrigation with poor quality water
(Rengasamy 2006, Rengasamy 2010). Australia has approximate 5.7 million hectares of land which is either at high risk of being affected or is already affected by dryland salinity
(http://lwa.gov.au/). As agriculture is one of the central components of the economy in
Australia, salinity is a significant issue which needs to be addressed. One way to achieve this is to obtain a greater knowledge and understanding of the response and tolerant mechanisms in plants under salt stress.
1.1.2 Effects of salinity stress on plants
Plant growth is reduced by salinity through two overlapping phases: shoot ion independent stress (previously called “osmotic” stress) and ion dependent stress (Roy et al . 2014).
1
During the early stages of salt stress, shoot ion independent stress affects the growth of plants immediately salt builds up around the root. Ion independent stress results in a decrease of cell expansion and leaf growth and therefore ultimately diminished yield (Munns and Tester 2008,
Roy et al. 2014, Tester and Davenport 2003). Shoot ion dependent stress occurs when ions accumulate in the shoot to toxic levels, resulting in the inhibition of photosynthesis and acceleration of leaf senescence (Munns and Tester 2008, Tester and Davenport 2003). Sodium chloride (NaCl) is usually used interchangeable with salt stress. Except for in a few species which are more sensitive to high concentration of Cl¯, such as grapevine (Bernstein et al. 1956,
Ehlig 1960), it is Na + which usually reaches toxic levels earlier than Cl¯ in the majority of cereal crop species (Munns and Tester 2008, Shah et al. 1987, Yeo 1992). High Na + concentrations of Na + in the cytoplasm of cells affects metabolism, leading to a decrease in growth and diminishment of yield. Na + competes with K + in the cytoplasm for the binding sites of many enzymes which have essential functions in cells, leading to an inhibition of those enzymes (Murguia et al. 1995, Tester and Davenport 2003, Wu et al. 1996). In addition, Na + also can interfere with the formation of ribosome complexes during translation and, as a consequence, protein synthesis is disruption (Murguia et al. 1995, Tester and Davenport 2003,
Wu et al. 1996). Due to the significant effects of Na + on plant growth this thesis will focus on the processes which affect Na + accumulation in plants.
1.1.3 The plants’ tolerance mechanism to salt stress
Plant tolerance mechanisms have been found at both the cellular and whole plant level in a wide range of plant species, including Arabidopsis rice, barley and wheat (Apse et al. 1999,
Forster 2001, Garthwaite et al. 2005, Hasegawa et al. 2000, Munns and James 2003, Ren et al.
2005, Shi et al. 2000). Plants are often cited as having three major adaptations to salinity: osmotic tolerance to the ion independent stress, which is controlled by long distance signals to maintain plant growth during the early stages of salt stress (Munns and Tester 2008, Rajendran et al. 2009, Roy et al. 2014, Roy and Tester 2012); shoot tissue tolerance of Na +; and ion exclusion from the shoot - the latter two addressing the shoot ion dependent stress (Munns et al. 2006, Munns and Tester 2008, Roy et al. 2014).
2
While the tolerance mechanism behind osmotic tolerance is still largely unknown (Roy et al.
2014) the mechanisms involved in shoot ion dependent tolerance (shoot ion exclusion and shoot ion tissue tolerance) are better understood.
The mechanisms of Na + tissue tolerance involves the sequestration of cytosolic Na + into compartments such as the vacuole (in order to avoid Na + damaging metabolic processes)
(Munns and Tester 2008, Roy et al. 2014, Roy and Tester 2012); production of compatible solutes (to balance the osmotic stresses a plant encounters) and enhancement of enzymes activity for improving reactive oxygen species (ROS) scavenging capacity (to remove dangerous oxygen containing molecules from the cell) (Apel and Hirt 2004, Gill and Tuteja
2010, Roy et al. 2014, Roy and Tester 2012). Na + sequestration into the vacuole is achieved by
Na +/H + antiporters on the tonoplast (Munns et al. 2012, Munns and Tester 2008, Roy et al.
2014, Roy and Tester 2012, Tester and Davenport 2003). Over-expression of members of the
Na +/H + antiporter NHX family has been found to improve the Na + compartmentalisation in the vacuole in shoots, reducing the concentration of cytosol Na + therefore improving plants’ continued growth in saline soil (Figure 1.1) (Apse et al. 1999, Apse et al. 2003, Bao et al. 2009,
Chen et al. 2008, Duan et al. 2007, Gao et al. 2006, Gaxiola et al. 1999, Jha et al. 2011, Leidi et al. 2010, Li et al. 2010, Pasapula et al. 2011, Qiu et al. 2004, Rodriguez-Rosales et al. 2009,
Roy et al. 2014, Yang et al. 2009, Yokoi et al. 2002, Zhang and Blumwald 2001, Zhao et al.
2006). A key component of this system is the plants ability to build up the necessary proton gradient in the vacuole using vacuolar ATPase (V-ATPase) and vacuolar pyrophosphatase
(V-PPase) proton pumps. Over-expression of V-ATPase and V-PPase has been shown to improve plant growth under salt stress (Bao et al. 2009, Duan et al. 2007, Li et al. 2010,
Pasapula et al. 2011, Zhao et al. 2006).
In addition to the accumulation of ions in the vacuoles, tissue tolerance also involves the synthesis of compatible solutes and ROS scavenging enzymes. Compatible solutes, such as proline and glycine-betaine, are found in the cytosol and can balance the osmotic difference between the cytosol and a vacuole accumulating high concentrations of Na + (Abebe et al. 2003, 3
Cortina and Culianez-Macia 2005, Garg et al. 2002, Karakas et al. 1997, Li et al. 2011,
Romero et al. 1997, Sheveleva et al. 1997, Suarez et al. 2009, Yang et al. 2008b). ROS scavenging enzymes, such as ascorbate peroxidase, glutathione S-transferase, superoxide dismutase and catalase, remove compounds with dangerous oxygen radicals and enhance the tissue tolerance in crops (Figure 1.1) (Badawi et al. 2004, Eltayeb et al. 2007, Kavitha et al.
2010, Lee et al. 2010, Moriwaki et al. 2008, Prashanth et al. 2008, Roxas et al. 1997, Sun et al.
2010).
Na + exclusion reduces the accumulation of Na + in the shoot. Na + is delivered from roots to shoots by the transpiration stream (Munns and Tester 2008). Most Na + transported to shoots accumulates in those tissues as only a small amount of Na + can be recirculated back to the roots via phloem (Munns and Tester 2008). Therefore, to minimise shoot Na + accumulation, controlling the amount of Na + loaded into the root xylem is a vital step. Four root based mechanisms are hypothesised to be involved in reducing shoot Na + accumulation (i) minimizing the influx of Na + from the soil to the cells of the outer root; (ii) maximizing the efflux of Na + from the cells of the outer root to the soil; (iii) minimizing the efflux of Na + from the cells of the inner root to the xylem; and (iv) maximizing the influx of Na + from the xylem to the cells of the inner root before transport of Na + to the shoot via the transpiration stream
(Møller et al. 2009, Munns et al. 2012, Roy et al. 2014, Roy and Tester 2012, Tester and
Davenport 2003).
The concentration of Na + in a plant is determined by the balance between passive Na + uptake from the soil and active Na + efflux back to the soil (Munns and Tester 2008, Plett and Møller
2010, Tester and Davenport 2003). The majority of Na + enters into root cells from the soil by non-selective cation channels (NSCC) (Figure 1.1) (Amtmann and Sanders 1999, Munns and
Tester 2008, Plett and Møller 2010). Transport of Na + from the root back to the soil is believed to be an essential mechanism to minimise Na + accumulation in plants during salinity stress
(Munns and Tester 2008, Plett and Møller 2010, Roy et al. 2014, Tester and Davenport 2003).
Na +/H + antiporters on the plasma membrane of epidermal cells, such as AtSOS1, are thought to be involved in this Na + efflux process (Figure 1.1) (Munns and Tester 2008, Qiu et al. 2002, 4
Quintero et al. 2002, Roy et al. 2014).
A second point for controlling the amount of Na + that reaches the shoot is the regulation of the amount of Na + that is within the xylem cells as part of the transpiration stream. Minimizing
Na + loading into the xylem and maximizing Na + retrieval from the xylem are two important processes. The high affinity potassium transporter family (HKTs) have been found to be involved in reducing the amount of Na + in the transpiration stream. Current studies indicate that OsHKT1;5, TmHKT1;5, AtHKT1;1 and TaHKT1;5-D are responsible for retrieving Na + from the xylem in the root prior to being delivered to the shoot (Byrt et al. 2007, Byrt et al.
2014, Davenport et al. 2007, Horie et al. 2009, Møller et al. 2009, Munns et al. 2012, Ren et al.
2005, Xue et al. 2011). SOS1, in addition to its role in Na + efflux from the root has also been implicated in the retrieval of Na + from the xylem (Figure 1.1) (Qiu et al. 2002, Shi et al. 2000,
Shi et al. 2002).
While numerous transporters which are involved in Na + transport in plants have been extensively investigated, the detailed processes of the initial detection of the salt stress and the activation of the appropriate tolerance mechanisms require further investigation. Plants have several signalling pathways which are used to signal to adjacent cells and tissues to activate their defensive mechanisms in response to external stress, often before these adjacent cells are exposed directly to the stress. One of these signalling mechanisms is the Ca 2+ signalling pathway.
5
Figure 1.1 The main mechanisms of salt tolerance in plants (Roy et al. 2014). Tissue tolerance involves the sequestration of cytosolic Na + into compartments (such as the vacuole) in order to avoid Na + accumulation reaching toxic levels; production of compatible solutes and enhancing the activity of enzymes for improving ROS scavenging capacity. The mechanisms behind osmotic tolerance are still largely unknown but must include sensing of the stress and long distance signalling pathways to maintain plant growth during the early stages of salt stress. Ion exclusion reduces shoot Na + accumulation by (i) minimizing the influx of Na + from the soil to the cells of the outer root; (ii) maximizing the efflux of Na + from the cells of the outer root to the soil; (iii) minimizing the efflux of Na + from the cells of the inner root to the xylem; and (iv) maximizing the influx of Na + from the xylem to the cells of the inner root before transport of Na + to the shoot via the transpiration stream.
6
1.2 Calcium signalling pathways
External stress results in Ca 2+ released from apoplastic or intracellular spaces (David et al.
2006, Mahajan et al. 2008). This calcium release produces a distinct, stress specific spatio-temporal change of cytosolic-free Ca 2+ concentration thereby generating a specific Ca 2+ signature which is passed through the plant (Batistic and Kudla 2012, Kudla et al. 2010, Webb et al. 1996). This calcium signal is perceived by Ca 2+ sensors within cells and translated into the molecular and biochemical responses necessary to tolerate the given stress (Batistic and
Kudla 2004, Batistic and Kudla 2012, Kudla et al. 2010, Luan et al. 2002, Sanders et al. 2002).
In plant cells, several Ca 2+ -sensors protein families have been identified, including calmodulin
(CaM) proteins, calmodulin-like (CML) proteins, Ca 2+ -dependent protein kinases (CDPKs), and calcineurin B-like proteins (CBLs) (Albrecht et al. 2001, Batistic and Kudla 2012,
Harmon et al. 2000, Kim et al. 2000, Luan et al. 2002). These Ca 2+ sensors can be divided into two groups, sensor responders and sensor relays (Sanders et al. 2002). Sensor responders consist of both a Ca 2+ -binding domain and a catalytic Ser/Thr kinase domain which phosphorylates a downstream target. Therefore, they can not only detect the calcium signal but also modulate their activity or function to directly regulate cell metabolism and gene expression (Kudla et al. 2010, Luan et al. 2002, Sanders et al. 2002). CDPKs are sensor responders which have both the Ca 2+ decoding function and protein kinase activity (Das and
Pandey 2010, Hrabak et al. 2003). However, most Ca 2+ sensors only contain a Ca 2+ -binding domain, so are classified as sensor relays (Kudla et al. 2010, Luan et al. 2002, Sanders et al.
2002). Due to their lack of effector domains, after detecting the calcium signal sensor relays must interact with another downstream target protein to regulate the response. The protein families CaMs, CMLs and CBLs have been classified as plant sensor relays (Batistic and
Kudla 2012, Liu and Zhu 1998). CaMs are highly conserved proteins in eukaryotes while
CMLs are found in plants and protists (DeFalco et al. 2010, Hrabak et al. 2003). CaMs and
CMLs are involved in the Ca 2+ regulation of a wide variety of target proteins, including protein kinases, metabolic enzymes and ion transporters (Batistic and Kudla 2004, Du et al. 2009, Du and Poovaiah 2005, Luan 2009, Luan et al. 2002, Reddy et al. 2002). CBLs were named due to their high similarity with calcineurin B (CNB) proteins in yeast and neuronal Ca 2+ sensors 7
(NCS) in animals (Batistic and Kudla 2004, Batistic and Kudla 2009, Li et al. 2009, Liu and
Zhu 1998, Weinl and Kudla 2009). CBLs have been identified as a family of Ca 2+ sensors which interact with a family of protein kinases, CBL-interacting protein kinases (CIPKs)
(Batistic and Kudla 2009, Batistic and Kudla 2012, Hrabak et al. 2003, Luan et al. 2002). In this pathway, a Ca 2+ signature could be first detected by CBLs which would recruit a specific
CIPK to phosphorylate a downstream protein(s) thereby controlling the stress response of cells
(Batistic and Kudla 2009, Batistic and Kudla 2012, Mahajan et al. 2008, Mahajan and Tuteja
2005) .
1.2.1 Structural characterisation of CBL
In Arabidopsis, there are 10 members in the CBL family, all of them sharing a similar protein structure (Batistic and Kudla 2004, Batistic and Kudla 2009, Batistic and Kudla 2012,
Kolukisaoglu et al. 2004).
All plant CBL proteins contain four Ca 2+ -binding motifs that are typical helix-loop-helix structural motifs (elongation factor hand, EF-hand, Figure 1.2) (Batistic and Kudla 2004,
Batistic and Kudla 2009, Batistic and Kudla 2012, Day et al. 2002, Kolukisaoglu et al. 2004,
Luan et al. 2002). However, it is unclear if all four EF-hands in each CBL are functional
(Batistic and Kudla 2004, Batistic and Kudla 2012, Kolukisaoglu et al. 2004, Kudla et al. 1999) as several studies have revealed that the first EF-hand in most CBLs appears to be incapable of binding Ca 2+ (Kolukisaoglu et al. 2004). Each EF-hand contains 12 amino acid residues.
Within this motif, two amino acids are highly conserved and are considered to be responsible for Ca 2+ -binding (Kolukisaoglu et al. 2004, Lewit-Bentley and Rety 2000). However, other sequence differences in these EF-hand structures are the possible cause of variations in
Ca 2+ -binding properties between different CBL proteins (Batistic and Kudla 2004, Batistic and
Kudla 2012, Kolukisaoglu et al. 2004). Further research of these variations in the motif is required to investigate the manipulation mechanism of the CBL proteins pathway at the
Ca 2+ -binding level.
8
Figure 1.2 The general structure of CBL proteins contains four EF-hands. Black numbered boxes representing each EF-hand in CBLs (Batistic and Kudla 2004).
Localisation studies revealed that all 10 AtCBLs harbour variable extension regions at their
N-terminus and these regions are responsible for the CBL’s subcellular localisation (Batistic and Kudla 2012). Research has shown that AtCBL1, AtCBL4, AtCBL5 and AtCBL9 harbour a lipid modification site in the N-terminal domain which targets these proteins to the plasma membrane via N-myristoylation and S-acylation of a cysteine or glycine residue (Batistic and
Kudla 2004, Batistic and Kudla 2012, Batistic et al. 2008, Batistic et al. 2010, Held et al.
2011). By contrast, CBL2, CBL3 and CBL6 lack N-myristoylation sites in their N-terminal extensions and are target to the tonoplast through as yet unknown mechanisms (Batistic and
Kudla 2009, Batistic and Kudla 2012, Batistic et al. 2010). Interestingly, CBL10 harbours a unique extended transmembrane domain at its N-terminus and the localisation of CBL10 was visualised in endosomal compartments and at the tonoplast (Batistic and Kudla 2009, Kim et al.
2007). Therefore, this feature at N-terminus could be important for the subcellular localisation of CBLs.
1.2.2 Structural characterisation of CIPK
CBL proteins specifically interact with a set of protein kinases, named CBL-interacting protein kinases (CIPKs, Halfter et al. 2000). There are 26 members in the family of CIPK gene in
Arabidopsis (Weinl and Kudla 2009). CIPK proteins possess a conserved catalytic kinase domain at their N-terminus and a regulatory domain at their C-terminus which is responsible for the mediation of the interaction of the CIPK with the correct CBL proteins and also contains sites for inhibiting its kinases activity (Figure 1.3) (Batistic and Kudla 2012, Kudla et al. 2010, Weinl and Kudla 2009).
9
Figure 1.3 The general structure of CIPKs. CIPKs consist of an N-terminal catalytic kinase domain, a junction domain and a C-terminal regulatory domain (Batistic and Kudla 2009). The kinase domain harbours an activation loop. The regulatory domain contains an NAF motif which is involved in the interaction between CBL proteins and the CIPKs. Finally, the PPI motif mediates the interaction between CIPKs and the PP2C (protein phosphatase 2C-type), ABI1 (ABA-insensitive 1) or ABI2 (ABA-insensitive 2) (Batistic and Kudla 2004, Li et al. 2009). The junction domain mediates the activation of the kinases (Batistic and Kudla 2004, Batistic and Kudla 2009).
Figure 1.4 Sequences of the activation loops motif in all AtCIPKs. Asterisks represent the three highly conserved amino acid residues, serine, threonine and tyrosine (the figure was modified from Li et al. 2009).
The catalytic kinase domain in the N-terminal contains an activation loop found between the conserved DFG and APE motifs in this region (Figure 1.3 and 1.4). The activation loop
10 harbours three conserved amino acids found in most members of CIPK gene family in
Arabidopsis (Figure 1.4) (Batistic and Kudla 2004, Li et al. 2009). These three amino acids, serine, threonine and tyrosine, have been recognised as potential phosphorylation sites by unknown protein kinases which then may improve the activity of CIPKs and may result in
CBL-independent activation of the kinases (Batistic and Kudla 2004, Fujii and Zhu 2009,
Gong et al. 2002a, Pandey 2008). This suggests that CIPKs might be regulated by other as yet unknown proteins via phosphorylation and displays a potential way CIPKs may interact with other signalling pathways.
The regulatory domain at the C-terminal contains an NAF motif, composed of twenty-four amino acids. This domain is likely to have a dual function: it is necessary for mediating the interaction of the kinase with CBL and it is involved in the inhibition of the CIPK’s kinases activity (Albrecht et al. 2001, Batistic and Kudla 2004, Batistic and Kudla 2012, Shi et al.
1999). Either the removal of the NAF motif or the binding of CBLs to the NAF motif can release the kinase domain of CIPK allowing CIPK to form a functional enzyme (Batistic and
Kudla 2012, Gong et al. 2002a, Guo et al. 2001). Some studies have demonstrated that the removal of the junction domain in front of the NAF domain leads to the inactivation of kinase activity, and thereby this domain is predicted to be important in the activation of the CIPK
(Albrecht et al. 2001, Batistic and Kudla 2009, Guo et al. 2001, Shi et al. 1999).
It has also been hypothesised that CIPKs may be regulated by both ABA-insensitive and
ABA-sensitive protein phosphatases. A protein phosphatase interaction (PPI) motif (Figure
1.3), composed of thirty-seven amino acids is responsible for the interaction of CIPKs with the protein phosphatases of the class 2C (PP2C), such as ABA-insensitive 1 (ABI1),
ABA-insensitive 2 (ABI2), ABA-insensitive 5 (ABI5) or AKT1-interacting PP2C (AIP) (Lee et al. 2007, Lyzenga et al. 2013, Ohta et al. 2003). Studies have indicated that these protein phosphatases play an important role in the regulatory of ABA signalling pathways, which are involved in plant tolerance to various abiotic stresses, including drought, cold and salinity
(Ohta et al. 2003). The analysis of protein structure showed that the PPI motif might partially overlap the domain responsible for the interaction of the CIPK with the appropriate CBL 11
(Sanchez-Barrena et al. 2007). While the regulatory and signalling pathways of the
CIPK-PP2C interaction are unclear, it is likely that both proteins reversely regulate the activity of each other and/or inversely switch the status of downstream target proteins via phosphorylation and dephosphorylation (Batistic and Kudla 2012, Kudla et al. 2010, Lee et al.
2007). Overall, these findings demonstrate the multifaceted regulation of the CIPKs activity by
CBLs and PP2C. This complicated regulatory mechanism is the core component of signalling transduction for the CBL-CIPK signalling pathway.
Localisation studies have revealed that most CIPKs exhibit a nuclear and cytoplasmic localisation (Batistic et al. 2010, D'Angelo et al. 2006), with bimolecular fluorescence complementation (BiFC) assays indicating that the localisation of CBL-CIPK complexes with a cell are determined by the CBLs which results in the different subcellular localisation of
CIPKs during the stress response (Batistic and Kudla 2012, Batistic et al. 2008, Batistic et al.
2010, Cheong et al. 2007, Ishitani et al. 2000, Waadt et al. 2008). This may further suggest specific CBLs decode different Ca 2+ signatures and recruit their preferential CIPK partners to different subcellular locations to modulate specific targets (Batistic and Kudla 2009). Analysis of the CBL-CIPK interactions, using both yeast two hybrids and BiFC assays, indicated each
CBL interacts with a set of various CIPKs, thus these techniques are important in understanding the decoding of Ca 2+ signals in plants (Albrecht et al. 2001, Batistic et al. 2010).
1.2.3 Specificity of the CBL-CIPK signalling pathway
In Arabidopsis, given there are 10 CBL proteins and 26 CIPKs, giving rise to many possible combinations in the CBL-CIPK signalling network, and factors contributing to the specificity of the CBL-CIPK signalling pathway. Studies have shown that the specificity between CIPKs and CBL proteins can be determined by the sequence variations in NAF motif and neighbouring regions (Kim et al. 2000, Sanchez-Barrena et al. 2007). This result suggests that a particular CIPK has specific interaction partners, which may belong to different signalling pathways depending on the stress encountered. However, detailed information about the mechanisms of the specificity of these CBL-CIPK interactions remains unknown. What is clear,
12 however, is that different CBL-CIPK complexes interact with specific stress responsive proteins and then regulate these proteins by phosphorylation (Batistic and Kudla 2004, Batistic and Kudla 2009, Batistic and Kudla 2012, Li et al. 2009, Luan 2009). The downstream target of the CIPK and the location of phosphorylation will depend on which CBL has bound to it
(Figure 1.5).
Figure 1.5 Diagram showing different abiotic stresses triggering a variety of CBL-CIPK signalling pathways in Arabidopsis (figure was modified from Li et al. (2009)) (Chen et al. 2013, Cheong et al. 2007, Drerup et al. 2013, Grefen and Blatt 2012, Held et al. 2011, Hu et al. 2009, Huang et al. 2011, Kim et al. 2003a, Lan et al. 2011, Lee et al. 2007, Lyzenga et al. 2013, McLachlan et al. 2009, Tripathi et al. 2009)
1.2.4 Function of the CBL-CIPK signalling pathway
CBL-CIPK signalling pathways have been shown to be involved in the plant response to a wide diverse range of abiotic stresses. The various interactions between different CBLs and
CIPKs have been extensively investigated; however the function of these CBL-CIPK interactions in many of a plant’s response to stress is often still unknown.
CBLs and CIPKs have been implicated in the transport of ions and nutrients. Nitrate is a primary nutrient for plant growth and development. Nitrogen uptake by plant roots can be split into two systems: the high-affinity transport system (HATS) which is used to uptake nitrate when the soil nitrate concentration is low and the low-affinity transport system (LATS) which is used to uptake large quantities of nitrate when the soil nitrate concentration is high (Aslam
13 et al. 1992, Doddema and Telkamp 1979, Hole et al. 1990, Siddiqi et al. 1989). CHL1
(NRT1.1) was found to be a dual affinity transporter which can switch between being a LATS or a HATS for nitrate uptake (Liu et al. 1999, Okamoto et al. 2006, Orsel et al. 2006, Plett et al.
2010, Wang et al. 1998). AtCIPK8 has been found to be induced by nitrate and regulate the nitrate response by turning CHL1 into a LATS (Hu et al. 2009). AtCIPK23 has also shown to phosphorylate the CHL1, this time activating its high-affinity transport and inhibiting the low-affinity transport of CHL1 in the primary nitrate response (Ho et al. 2009).
Potassium as an important macronutrient plays essential functions in a wide diverse range of physiological processes for plant growth and development (Armengaud et al. 2010, Clarkson and Hanson 1980, Kim et al. 2010, Leigh and Jones 1984, Very and Sentenac 2003, Wang and
Wu 2010). AtCBL1, AtCBL9 and AtCIPK23 were found to be involved in the regulation of the high-affinity voltage-gated K + channel AKT1 in Arabidopsis roots (Cheong et al. 2007, Li et al.
2006, Xu et al. 2006). AtCBL1 and AtCBL9 were found to interact with AtCIPK23, which resulted in the activation of AKT1, when the three genes were expressed in yeast and knockouts of cipk23, cbl1, cbl9 and akt1 in Arabidopsis were hypersensitive to K + deficiency, while constitutive expression of AtCIPK23, AtCBL1 and AtCBL9 in Arabidopsis confers a tolerant phenotype to low-K+ treatment (Xu et al. 2006). These observations were further backed up by examining the activity of AKT1 in root protoplasts isolated from wild type
Arabidopsis, Atcipk23 knockout mutant and Atcbl1 Atcbl9 double knockout mutant using patch-clamp, indicating AtCBL1/AtCBL9-AtCIPK23 could modulate the AKT activity in planta (Lee et al. 2007, Li et al. 2006).
Lee et al. (2007) identified two more kinases in the AtCIPK family which interact with AKT1,
AtCIPK6 and AtCIPK16. The AtCBLs (AtCBL1, AtCBL2, AtCBL3, AtCBL9) are able to interact with all three AtCIPKs which have been found to interact with AKT1: AtCIPK6,
AtCIPK16 and AtCIPK23. Function analysis of the 4 AtCBLs and the 3 AtCIPKs in regulation of AKT1 activity in X.Laevis oocytes revealed that the strongest channel activity was observed after the AtCBL1-AtCIPK23 complex activated AKT1 and weak channel activities were observed when AKT1 activated by other combination of AtCBL-AtCIPK (Lee et al. 2007). 14
Ren et al. (2013) revealed that AtCBL10 may also be involved in regulating AKT1 activity and could be involved in maintaining ion homeostasis in plants.
CBL-CIPK complexes have also been found to be important in regulating other K + transport processes. AtCIPK9 was found to be greatly enhanced during low-K+ stress in Arabidopsis and plants with Atcipk9 knocked out resulted in the inhibition of root and seedling growth under K + deficiency (Pandey et al. 2007). The AtCBL4-AtCIPK6 complex was found to interact with
Arabidopsis K + transporter 2 (AKT2) and mediate the translocation of the potassium channel from the endoplasmic reticulum (ER) to the plasma membrane (Held et al. 2011). VvK1.1 was identified as equivalent homologue of AtAKT1 in grape ( Vitis vinifera ) and can be activated not only by interaction with VvCBL1-VvCBL1 and VvCBL2-VvCIPK3 in X.Laevis oocytes but also by Arabidopsis CBLs and CIPKs, such as AtCBL1-AtCIPK23 (Cuellar et al. 2013).
Constitutive expression of PeCBL1 from Populus euphratica in both Col-0 and Atcbl1 and
Atcbl9 knockout mutants improve the growth of Arabidopsis in low-K+ conditions (Zhang et al.
2013b). In addition, PeCBL1 has shown to interact with PeCIPK24, PeCIPK25 and PeCIPK26 to modulate Na + and K + transport in plant roots (Zhang et al. 2013b).
CBLs and CIPKs have also been implicated in a plant’s response to cold stress (Albrecht et al.
2003, Cheong et al. 2003, Huang et al. 2011, Xiang et al. 2007). AtCBL1 was identified as a negative regulator in cold response. Constitutive over-expression of AtCBL1 results in a cold sensitive phenotype while disruption of this gene confers cold tolerance in plants (Albrecht et al. 2003, Cheong et al. 2003). AtCIPK7 was found to be an interacting partner of CBL1 and also involved in cold response in Arabidopsis (Huang et al. 2011). Moreover, a homolog of
CIPK was found in rice ( Oryza sativa ), OsCIPK3 , was highly induced by cold stress and constitutive over-expression of this gene confers tolerant phenotype in transgenic rice (Xiang et al. 2007).
Drought and high salinity stresses usually change the water potential in plants therefore resulting in osmotic stress (Bartels and Sunkar 2005, Boudsocq and Lauriere 2005, Cheong et al. 2003, Xiong et al. 2002). A number of CBLs and CIPKs in Arabidopsis were reported to be 15 involved in osmotic and drought response, including AtCBL1, AtCBL5, AtCBL9, AtCIPK1,
AtCIPK3, AtCIPK6 and AtCIPK16 (Albrecht et al. 2003, Guo et al. 2002, Kim et al. 2003a,
Pandey et al. 2004, Pandey et al. 2008, Pandey et al. 2005). AtCIPK23 was found to be involved in drought response by regulating the stomata status in ABA-dependent pathway and knockout mutants of Atcipk23 confer the tolerant phenotype to drought stress (Cheong et al.
2007). AtCBL1 and AtCBL9 interact with AtCIPK23 and recruit the kinase to the plasma membrane (Cheong et al. 2007). A number of CBLs and CIPKs in other plant species have also been implicated in a plant’s drought response. OsCBL8 is a negative regulator of a rice’s drought response with RNAi knockdowns of Oscbl8 having improved survival rate by increasing compatible solutes accumulation. Many other CBLs and CIPKs (including
GmCBL1, PeCBL10, MdCIPK6L, GhCIPK6 , HbCIPK2, OsCIPK23 and OsCIPK12 ) have been identified as positive regulators of drought tolerance and constitutive over-expression of these genes confers improved growth and biomass of transgenic plants experiencing a drought stress (Cheong et al. 2010, He et al. 2013, Li et al. 2013, Wang et al. 2012, Xiang et al. 2007).
The plant hormone abscisic acid (ABA), regulates many physiological processes during plant development, including bud dormancy, seed dormancy and maturation, abscission and closing of stomata (Arroyo et al. 2003, Fedoroff 2002, Finkelstein et al. 2002, Himmelbach et al.
2003). ABA is also used to regulate responses to external abiotic stresses, including water deficiency, salinity and low-temperature stresses (Arroyo et al. 2003, Fedoroff 2002,
Finkelstein et al. 2002, Himmelbach et al. 2003). AtCBL9 was found to be a negative regulator of ABA signalling, with disruption of this gene altering how the plant responses to ABA
(Pandey et al. 2005). Atcbl9 knockout lines demonstrated hypersensitive to ABA treatment during seed germination and seedling growth, and were more sensitive to osmotic stress when applied as either salt or mannitol (Pandey et al. 2005). AtCIPK3 has been identified as an interacting partner of AtCBL9 and appears also negatively to regulate the ABA response in plants (Krasensky and Jonak 2012, Pandey et al. 2008). A recent study found that AtCIPK3 physically interacts with ABA repressor 1 (ABR1), suggesting the possibility of an
AtCBL9-AtCIPK3-ABR1 signalling pathway to modulate the response to ABA (Pandey et al.
2014). Additionally, knockout mutations in scabp5 (Atcbl1) and pks3 (Atcipk15) lead to ABA 16 hypersensitivity in plants (Guo et al. 2002). CIPK15 was found not only to interact with ABI1 and ABI2, but also to phosphorylate AtERF7 which is a transcriptional repressor in ABA response (Song et al. 2005). In contrast, mis-expression of CIPK20/PKS18 (T169D) confers a hypersensitive phenotype of transgenic plants whereas knockout mutants result in
ABA-insensitivity (Gong et al. 2002b). Moreover, a recent study found CIPK26 is a positive regulator of the ABA response and constitutive over-expression of AtCIPK26 resulted in an
ABA hypersensitive phenotype (Lyzenga et al. 2013). AtCIPK26 can interact with both ABI5 and RING-type E3 ligase Keep on Going (KEG) which negatively regulates ABA response by targeting ABI5 and AtCIPK26 for degradation, suggesting the function of KEG is opposite to the function of CIPK26 and ABI5 therefore KEG could keep the balance of ABA response
(Lyzenga et al. 2013). CBL2 is found on the tonoplast and may be required for ABA response in the early developmental stage (Batistic et al. 2012). Moreover, BnCIPK6 from Brassica napus has been identified as an important component which is involved in abiotic stress and
ABA signalling (Chen et al. 2012). Mis-expression of BnCIPK6 confers plants insensitive to salinity stress and hypersensitive to ABA (Chen et al. 2012). Subsequently, AtCIPK6 as homolog of BnCIPK6 in Arabidopsis has been found to be up-regulated by ABA and play same functions as BnCIPK6 (Chen et al. 2013).
The function of CBLs and CIPKs in salt tolerance has been investigated extensively. The SOS signalling pathway is a well-known and important mechanism for Na + exclusion (Guo et al.
2001, Halfter et al. 2000, Ishitani et al. 2000, Ji et al. 2013, Liu et al. 2000, Qiu et al. 2002,
Shi et al. 2000, Wu et al. 1996). This pathway consists of three components: AtCBL4 (SOS3) the Ca 2+ -sensor; SOS2 (AtCIPK24) a protein kinase; and the plasma membrane Na +/H + antiporter SOS1 (Gong et al. 2002a, Guo et al. 2001, Halfter et al. 2000, Ishitani et al. 2000,
Liu et al. 2000, Qiu et al. 2002, Shi et al. 2000, Wu et al. 1996, Yang et al. 2009). During salt stress, AtCBL4 (SOS3) interacts with AtCIPK24 (SOS2) creating a AtCBL4-AtCIPK24 complex which phosphorylates the plasma membrane-localised SOS1 and results in Na + being pumped from the cell (Ishitani et al. 2000, Ji et al. 2013, Qiu et al. 2002, Qiu et al. 2004, Shi et al. 2002, Yang et al. 2009, Zhu 2003). In addition, AtCBL10 has also been shown to bind to
CIPK24 (SOS2) at the tonoplast, possibly activating a tonoplast Na +/H + antiporter, thereby 17 maintaining the Na + homeostasis by the sequestration of Na + into the vacuole of cells in the shoot (Kim et al. 2007, Luan 2009, Qiu et al. 2004). AtCBL1 as another Ca 2+ -sensor involved in the salinity stress responsive pathway, interacts with AtCIPK24 (SOS2) and the AtCBL1–
AtCIPK24 complex is localised to the plasma membrane, however, the downstream target(s) is still unknown (Kim et al. 2007, Kolukisaoglu et al. 2004). These findings imply that
CBL1-CIPK24 might phosphorylate a Na + transporting protein on the plasma membrane, such as AtSOS1, thereby improving the cell’s ability to exclude Na + and consequently maintaining the K + homeostasis in the cells. Over-expression of AtCBL5, AtCIPK6 and AtCIPK16 has also been shown to confer salt tolerance (Chen et al. 2012, Cheong et al. 2010, Roy et al. 2013), while knockout mutations in Atcipk1 or Atcipk6 result in salt sensitivity of plant (Deng et al.
2013, Tripathi et al. 2009). A number of homologous components of the SOS pathway have been found in other plants species. Co-expression of OsSOS3 (OsCBL4), OsSOS2 (OsCIPK24) and OsSOS1 suppressed the salt sensitive phenotype of yeast which had their native Na + efflux pathways disrupted (Pandey et al. 2004). MdSOS2 was reported to interact with MdSOS3 and
AtSOS3 in yeast, with constitutive over-expression of MdSOS2 in Atsos2 knockout lines conferring salt tolerance (Hu et al. 2012). Over-expression of SlSOS2, OsCBL8, OsCIPK15 or
TaCIPK29 improves salt tolerance in tomato, rice and tobacco (D'Angelo et al. 2006, Huertas et al. 2012, Xiang et al. 2007).
Overall, the CBL-CIPK signalling system has been shown to play an important role in salt tolerance and other abiotic stresses. Investigation of components in the CBL-CIPK system will not only contribute to the understanding of cellular signalling mechanisms, but also provide potential genetic modification approaches to effectively enhance the salinity tolerance in plants.
1.3 AtCIPK16
In the salinity stress responsive signalling pathway, CBL1, CBL10, CBL4 (SOS3) and CIPK24
(SOS2) have been shown to play important roles in the mechanism of plant salinity tolerance
(Batelli et al. 2007, Gong et al. 2002a, Gong et al. 2004, Halfter et al. 2000, Luan 2009,
Mahajan et al. 2008, Qiu et al. 2002, Quan et al. 2007, Shi et al. 2000, Shi et al. 2002). 18
AtCIPK16 is another kinase hypothesised to be involved in the salt responsive signalling pathway.
1.3.1 Potential role of AtCIPK16 in salinity tolerance
A novel candidate QTL for Na + exclusion was identified on Chromosome 2 of Arabidopsis in a
Bay-0 × Shahdara recombinant inbred line (RIL) mapping population (Roy et al. 2013). The loci were fine mapped to identify AtCIPK16 as the gene most likely to be involved with the plant’s Na + exclusion phenotype (Roy et al. 2013). Expression profiling demonstrated that the expression level of AtCIPK16 in lines with the Bay-0 allele of AtCIPK16 was significantly higher than in lines with Shahdara allele (Roy et al .2013), and possibly resulted from the incorporation of a TATA box into the promoter of the Bay-0 AtCIPK16 (Roy et al. 2013).
PromoterAtCIPK16:GFP constructs indicated that the gene is salt inducible and expressed in the stele of Arabidopsis’ roots. Transgenic Arabidopsis over-expressing AtCIPK16 had decreased Na + accumulation in their shoots while AtCIPK16 amiRNA knockdown had increased shoot Na + accumulation (Huang 2010, Roy et al. 2013). Similar results were observed in rice (Roy et al . unpublished) and barley (Roy et al . 2013).
These data suggest that AtCIPK16 might be involved in the processes of the Na + loading or unloading in the xylem thereby minimizing the Na + transport to shoots. However, the downstream targets of AtCIPK16 and the location of phosphorylation within the cell during salt stress remain unknown.
It has become apparent that AtCIPK16 is involved in a salt responsive signalling pathway and plays an important role in plant salinity tolerance. However, up to now, there have been only a few publications investigating the function of AtCIPK16. Kolukisaoglu et al. (2004) investigated whether AtCBL1 and AtCBL9 interacted with AtCIPK16 in yeast, but did not screen the interaction between AtCIPK16 and the other 8 AtCBLs. Lee et al. (2007) used yeast
19 two hybrids and X.Laevis oocytes to indicate that interacting partners of AtCIPK16 are
AtCBL1, AtCBL2, AtCBL3 and AtCBL9, however the subcellular localisation of these complexes still remains unknown and whether these CBLs interact with AtCIPK16 in planta remains to be seen. Moreover, the function of AtCIPK16 in K + transport was examined only in
X.Laevis oocytes (Lee et al. 2007) but phenotypic characterisation in plants is required for further understanding of the kinase function in K + transport which might be a key component in salinity tolerance.
1.4 Research aims
AtCIPK16 has been identified as a novel candidate gene responsible for a significant sodium exclusion phenotype (Roy et al . 2013). AtCIPK16 is suspected to regulate key processes involved in Na + transport in a cell, however, little is known about the function of the protein and its exact role in salinity tolerance. It is therefore important to confirm upstream interacting
AtCBLs of AtCIPK16 in yeast and then visualise the subcellular localisation of
AtCBLs-AtCIPK16 in planta and in vivo by transient transformation or stable transformation.
The identification of downstream targets of AtCIPK16 by pull-down assay and Y2H is also an important aim of this project to gain a better understanding of the AtCIPK16 signalling pathways involved in abiotic stress. Dissection of the role of AtCIPK16 in salinity tolerance will aim to examine whether AtCIPK16 behaves in a similar manner as SOS2 by generating sos2 knockout lines which over-express AtCIPK16 and to further investigate the mechanism by which AtCIPK16 reduces shoot Na +. Investigation of the function of AtCIPK16 in other abiotic stresses will aim to characterise the phenotype of 35S:AtCIPK16 Arabidopsis under low K +, additional KCl, drought, osmotic, cold and ABA treatment. Investigation of the function of AtCIPK16 will not only contribute to the understanding of the cellular signalling mechanisms in plant salinity tolerance, but also enhance genetic modification approaches to effectively enhance plant salinity tolerance.
20
Chapter 2 General materials and methods
2.1 Plant materials
Laboratory stocks of Arabidopsis ecotypes Columbia-0 (Col-0) were used as donor material for generating transgenic plants and isolating protoplasts for transient expression. Seeds of constitutive over-expressing AtCIPK16 Col-0 lines were previously generated in our laboratory (Roy et al. 2013). Seeds of Col-0 sos2 knockout lines were obtained from NASC
(The European Arabidopsis Stock Centre, NASC ID: N3863, N681147 and N6528), and these mutants were used to generate 35S:AtCIPK16 sos2 lines.
2.2 Plant growth facilities
A number of different growth facilities were used to grow the plant materials over the course of this PhD project. These growth facilities were at the Australian Centre for Plant Functional
Genomics (ACPFG), The Plant Accelerator (Australian Plant Phenomics Facility) and the
Plant Research Centre (University of Adelaide). All hydroponics experiments in Chapter 3 as well as the soil grown experiment in Chapter 3, 5 and 6, used either a short day growth room
(light/dark period: 10h/14h, temperature: 23 °C, light intensity: 100 μmol m -2 s-1, 60-75 % humidity) or a long day growth room (light/dark period: 16h/8h, temperature: 23 °C, light intensity: 100 μmol m -2 s-1, 60-75 % humidity) – details within the specific chapters.
2.3 Plant growth in soil
Seeds of Arabidopsis were grown in soil for Agrobacterium-mediated transformation, DNA infiltration, phenotyping of the transgenic lines and seed propagation. Arabidopsis Soil Mix supplied by the South Australian Research and Development Institute (SARDI) was used in all soil grown experiments. Each 100 L batch of Arabidopsis Soil Mix contained 25 L sand; 25 L perlite; 25 L peat moss; 25 L vermiculite; 100 g iron sulphate; 300 g Osmocote Plus (Scotts,
Baulkham Hills); 200 g dolomite; 50 g gypsum; 100 g agricultural lime and 40 g hydrated lime, final soil pH was 5.7-5.9. Arabidopsis Soil Mix was steam sterilised before use. 21
Plant pots (67 mm × 85 mm, PUNTPX, Garden City Plastics, Victoria, Australia) with draining holes in the bottom were filled with an aliquot of Arabidopsis soil mix and covered with a thin layer of Amgrow Seed Raising Mix (Envirogreen, Australia) on top to increase the germination rate of seeds. Soil was watered with reverse osmosis (RO) water containing 5 g L -1 VectoBac
(Valent Biosciences, USA) and 0.1 % Confidor (Bayer, Germany) to control insect larvae and fungus in the soil mix. Arabidopsis seeds were spread evenly on the surface of the moistened soil. The pots were placed into 29 × 35 cm sized trays which contained 400 mL of water and covered with a clear plastic mini greenhouse lid (Smoult, Kersbrook, SA, Australia) to maintain a high humid environment to promote seed germination. The trays were placed in a short day growth room. After approximately 10 days, the holes in the mini greenhouse lids were gradually opened and removed to allow the seedlings to adapt to the growth room conditions. Plants were watered with RO water every two or three days and with nutrient solution (400 mL per tray, Table 2.1) every two weeks. After 5-6 weeks, the plants were moved to a long day growth room to induce flowering. When the first silique ripened, a plastic bag
(microperforated bag, 25 × 40 cm, Centrapak, Australia) was placed over the plants and secured by stick tape at the bottom. Once plants had developed brown siliques, watering was stopped and the plants were moved to a dry cabinet until the siliques were completely dry for seed collection. The collected seeds were transferred into 1.5 mL microcentrifuge tubes
(Eppendorf South Pacific, North Ryde, Australia) and stored at 4 °C in the dark.
Table 2.1 Nutrient solution for soil grown Arabidopsis Macronutrients Final Concentrations
KNO 3 15 mM
NH 4NO 3 15 mM
Ca(NO 3)2.4H 2O 2 mM
MgSO 4.7H 2O 0.5 mM
NaH 2PO 4.H 2O 0.5 mM Micronutrients Final Concentrations
H3BO 3 0.2 mM NaFe(III)EDTA 25 μM
MnCl 2.4H 2O 4 μM
22
CuSO 4.5H 2O 2 μM
ZnSO 4.7H 2O 2 μM
CoCl 2.6H 2O 1 μM
Na 2MoO 4.2H 2O 1 μM
NiCl 2.6H 2O 1 μM pH with KOH to 5.7
2.4 Plant growth in hydroponics
Seeds of Arabidopsis were grown in hydroponics for mesophyll protoplast isolation and characterisation of the transgenic plants as described by Conn et al. (2013). A hypodermic needle was used to create a hole in the centre of a black 1.5 mL microcentrifuge tube (Cat. #
B74010, Astral Scientific, New South Wales, Australia) lid which had been cut from the base of its tube. The lids were inverted on adhesive tape and filled with approximately 250 μL 0.7 % agar containing germination solution (Table 2.2). Once the agar solidified, the lids were turned back up the right way and placed into the floater place racks (Cat. # 5100-43, Scientific
Specialties Inc., Hanover, Maryland, USA) above a container (included in Cat. # 5100-43,
Scientific Specialties Inc., Hanover, Maryland, USA) containing 250 mL of germination solution. Into each microcentrifuge tube cap, Arabidopsis seeds were inserted into the hole in the lid, on top of the solidified agar. This will allow the seeds to germinate and the roots of the seedling to grow through the nutrient rich agar to the nutrient solution below. The container was placed in the dark at 4 °C for 48 h to stratify. The small tank was then transferred to a short day growth room. After 1 week, the solution in the floater place racks and containers was replaced with basal nutrient solution (BNS, Table 2.3). The BNS was replaced every week to keep nutrient supplies constant. After 3 weeks from germination, plants were transferred into a
12 L hydroponics tank (432 mm × 324 mm × 127 mm, IH305-BL, Nally limited, NSW,
Australia) containing BNS, which was aerated using an aquarium pump (AAPA15L air pump,
Hydrofarm, Petaluma, California, USA). Again the BNS was replaced every week.
23
Table 2.2 Germination solution for hydroponics Arabidopsis. Macronutrients Final Concentrations KCl 1 mM
MgSO 4.7H 2O 1 mM
CaCl 2 0.75 mM
Ca(NO 3)2.4H 2O 0.25 mM
KH 2PO 4 0.2 mM Micronutrients Final Concentrations
H3BO 3 50 μM NaFe(III)EDTA 50 μM
ZnSO 4.7H 2O 10 μM
MnCl 2.4H 2O 5 μM
CuSO 4.5H 2O 0.5 μM
Na 2MoO 4.2H 2O 0.1 μM pH to 5.6 with KOH
Table 2.3 Basal nutrient solution for hydroponics Arabidopsis Macronutrients Final Concentrations
KNO 3 3 mM
NH 4NO 3 2 mM
CaCl 2 0.1 mM KCl 2 mM
Ca(NO 3)2·4H 2O 2 mM
MgSO 4·7H 2O 2 mM
KH 2PO 4 0.6 mM Micronutrients Final Concentrations
H3BO 3 50 μM NaFe(III)EDTA 50 μM
MnCl 2·4H 2O 5 μM
CuSO 4·5H 2O 0.5 μM
ZnSO 4·7H 2O 10 μM
Na 2MoO 4·2H 2O 0.1 μM pH to 5.6 with KOH
24
2.5 Plant growth on plates containing Murashige and Skoog (MS) media
Seeds of Arabidopsis were grown on MS media to determine the response of the 35S:CIPK16 lines to different abiotic stress treatments, including NaCl, low potassium, osmotic stress and
ABA treatment. Arabidopsis seeds were surface sterilised in 2 mL microcentrifuge tubes (Cat.
# T2795-500EA, Eppendorf South Pacific, North Ryde, Australia) first by the addition of 1 mL
70 % ethanol for 3 min. After centrifugation at 11,600 g, the supernatant was removed from each sample by pipetting and 1 mL of 30 % commercial bleach solution (Domestos, 49.9 g L -1 sodium hydrochloride stock concentration, Unilever Australia, North Rocks, Australia) was added into each tube. The seeds were incubated in bleach at room temperature for 10 min.
After centrifugation at 11,600 g, supernatant was removed from each sample by pipetting. To remove residual ethanol and bleach, each sample was washed with 2 mL sterile Milli Q water and centrifuged at 11,600 g to collect seeds at the bottom of the tube followed by removal of the supernatant. This wash step was repeated 4 times for each sample to remove any excess bleach. Sterilised seeds were sown on 100 × 100 × 20 mm square petri dishes (Cat.
#82.9923.422, Sarstedt Australia Pty. Ltd., Australia) containing 1/2 strength Murashige and
Skoog (MS) media (0.22 % (w/v) MS (Cat. # M5519, Sigma-Aldrich, Castle Hill, Australia),
1 % (w/v) sucrose (ChemSupply, Australia) and 0.8 % Difco TM Agar, granulated (Cat. #
214530, BD Diagnostic Systems, Australia). The pH of the MS media was adjusted to 5.6 using a 0.5 M KOH solution. The Petri dishes were sealed with parafilm (Micropore TM , 3M,
Pymble, Australia) and left in the dark at 4 °C for 48 h in order to break dormancy. After stratification, the plates were transferred to a short day growth room and placed vertically.
2.6 DNA extractions
2.6.1 Phenol/chloroform/iso-amyl alcohol method
The phenol/chloroform/iso-amyl-alcohol method was used to extract high quality and quantity
DNA from plant materials. Approximately 0.1 g of plant tissue was harvested into a 1.5 mL microcentrifuge tube (Cat. # T9661-500EA, Eppendorf South Pacific, North Ryde, Australia) and snap frozen in liquid nitrogen. Stainless steel grinding beads and a vortex (VM1 Vortex
Mixer, Ratek Instruments, Australia) were used to grind the frozen tissue samples into a fine powder. After removal of metal beads, 600 μL DNA extraction buffer (1 % sarkosyl, 100 mM 25
Tris-HCl, 100 mM NaCl and 10 mM EDTA, pH 8.5) was added into the tube and mixed with plant tissue powder. A 600 μL volume of phenol/chloroform/iso-anyl alcohol (25:24:1) was added to each tube and the tubes were mixed on a daisy wheel (RSM6 rotor, Ratek Instruments,
Boronia, Australia) for 15 min at room temperature. Samples were then centrifuged at 16,100 g for 10 min at room temperature using an Eppendorf 5415D centrifuge (Eppendorf South
Pacific, North Ryde, Australia). For each sample, 600 μL of supernatant was transferred to a fresh 1.5 mL tube and mixed with 60 μL of 3 M sodium acetate (pH 4.8) and 600 μL of 100 %
(v/v) isopropanol by gently inverting the tubes. The tubes were left for 10 min at room temperature to allow the DNA to precipitate, before centrifugation at 16,100 g for 10 min to pellet DNA. The supernatant was removed from each sample and the pellet washed with 1 mL of 70 % (v/v) ethanol. After centrifugation at 7,500 g, the ethanol was removed from the tube by pipetting and the samples were then placed in a heat block at 65 °C for 2 min to dry the
DNA. A 30 μL volume of R40 (1 × TE buffer with 40 μg mL -1 RNase A (Cat.# R4875,
Sigma-Aldrich, Australia), pH 8.0) was added to each tube for re-suspending the DNA and samples were then kept at -20 °C.
2.6.2 Edwards DNA extraction method
The Edwards DNA extraction method was used to extract DNA from plant materials when high-quality DNA was not required, such as for performing PCR to genotype plants (Edwards et al. 1991). Arabidopsis leaf samples for PCR analysis were collected in sterile 1.5 mL microcentrifuge tubes and frozen using liquid nitrogen. Each frozen sample was ground to a powder using metal beads with vortexing (VM1 Vortex Mixer, Ratek Instruments, Australia).
To each sample, a 400 μL volume of Edwards extraction buffer (200 mM Tris-HCl, 250 mM
NaCl, 25 mM EDTA, 0.5 % SDS, pH 7.5) was added and the samples were centrifuged at
16,100 g for 3 min. Approximately 300 μL of supernatant was transferred to a fresh tube and mixed with 300 μL of 100 % (v/v) isopropanol by gently inverting the tubes. The samples were left at room temperature for 30 min for DNA precipitation. Samples were centrifuged again at
16,100 g for 10 min to pellet DNA, which was then washed with 70 % (v/v) ethanol. After removal of the ethanol by pipetting, samples were left at room temperature for 10 min to dry
DNA pellets. A 20 μL volume of 1 × TE buffer (50 mM glucose, 25 mM Tris-HCl, 10 mM 26
Na 2EDTA) was added to each sample for re-suspending the DNA and samples were then kept at -20 °C.
2.7 Agarose gel electrophoresis - DNA
Agarose gel electrophoresis was used to visualise and analyse genomic DNA, plasmid DNA,
PCR products and DNA digested by restriction enzymes. Depending on the size of the DNA fragments, a 1-2 % agarose (Cat. # BIO-41026, Bioline, Alexandria, Australia) gel in 1 × TAE buffer containing SYBR ® Safe (5 μL /100 mL) was used to run the samples. A 10 μL volume of DNA was mixed with 10 × loading dye and loaded into an agarose gel in 1 × TAE buffer and run at 120 V for 25 min. The samples were visualised using a Gene Flash gel documentation system (Synoptics Ltd, USA).
2.8 DNA extraction from agarose gels
NucleoSpin ® Extract II kit (Cat. # 740609, Macherey-Nagel, Düren, Germany) was used to extract DNA from agarose gels. DNA fragment was excised from agarose gel and transferred to a fresh 1.5 mL tube. Each sample was mixed with 200 μL NT buffer and incubated at 50 °C for 10 min. All the liquid in the tubes was transferred onto a NucleoSpin ® Extract II Column which was centrifuged at 11,200 g for 1 min to bind the DNA to the silica membrane. Samples were washed with 600 μL buffer NT3 and centrifuged again at 16,100 g for 1 min. Finally,
DNA was eluted from silica membrane with 20 μL elution buffer and collected by centrifugation at 11,200 g for 1 min.
2.9 DNA sequencing
To determine the sequences of DNA samples, a BigDye® Terminator V3.1 Cycle Sequencing
Kit (Cat. # 433745, Applied Biosystem, Mulgrave, Australia) was used. Based on the manufacturer's protocol, 500 ng DNA sample was mixed with 1 µL BigDye Terminator V3.1,
3.5 µL BigDye sequencing buffer and 0.32 µL of 10 mM sequencing primers (Table 2.4).
Sterilised water was added to each sample to bring to a total volume of 10 μL. Reactions were performed in a DNA Engine Tetrad 2 Thermal Cycler (BioRad, Australia) with a sequence cycling program of 96 °C for 2 min; 35 cycles of 96 °C for 10 s, 50 °C for 10 s and 60 °C for 4 27 min. PCR product was transferred to a fresh 1.5 mL tube and combined with 75 μL fresh made solution containing 0.2 mM MgSO 4 and 70 % ethanol. Samples were left for 15 min at room temperature for DNA precipitation, followed by centrifugation at 16,100 g for 15 min. The supernatant in each tube was carefully removed by a pipette and tubes were left at room temperature for 10 min to air dry the DNA. All the samples were submitted to Australian
Genome Research Facility (AGRF) for Sanger sequencing and sequence determination.
Table 2.4 Primers for sequencing the entry vectors and destination vectors constructed in this project
Primers Sequence (5′- 3′) Tm*°C
GW1 GTTGCAACAAATTGATGAGCAATGC 50
GW2 GTTGCAACAAATTGATGAGCAATTA 50
T7 TAATACGACTCACTATAGGG 51
M13 GTAAAACGACGGCCA GTG 54
Gene-specific Listed in the relevant chapter
*Primer T m was predicted by NetPrimer (http://www.premierbiosoft.com/netprimer/index.html)
2.10 RNA extractions and agarose gel electrophoresis
RNA is an extremely sensitive and readily degraded molecule. To minimizing nuclease contamination, all tools, work surface, equipments were treated with RNase Zap (Ambion,
Austin, USA) to ensure they are RNase-free. All tubes and tips used in RNA related experiments were freshly sterilised by autoclaving.
Approximately 0.1 g plant tissue was collected into sterile 2 mL microcentrifuge tubes and snap frozen using liquid nitrogen. Stainless steel beads were used to grind frozen tissue samples into a fine powder by vortexing (VM1 Vortex Mixer, Ratek Instruments, Australia).
The metal beads were removed and 1 mL TRIZOL reagent (Cat. # 15596, Invitrogen, USA) was added. The samples were placed on a daisy wheel (RSM6 rotor, Ratek Instruments,
Boronia, Australia) for 5 min at room temperature followed by centrifugation at 13,400 g for
10 min at 4 °C. The supernatant was transferred to a fresh 1.5 mL tube with 200 μL of
28 chloroform and mixed by hand for 15 s. Samples were left at room temperature for 3 min and centrifuged again at 13,400 g for 15 min at 4 °C. The upper aqueous phase of the solution was transferred to a fresh 1.5 mL tube to which 500 μL of isopropanol was added. Samples were then incubated for 10 min at room temperature to allow the RNA to precipitate, followed by centrifugation at 13,400 g for 10 min at 4 °C to pellet RNA. After removal of the supernatant by a pipette, 1 mL 70 % (v/v) ethanol was added to wash the RNA pellet. All tubes were centrifuged at 16,100 g for 5 min at 4 °C to collect the RNA pellet at the bottom of the tube and the ethanol removed by pipetting. All samples were left at room temperature to air dry and resuspended in 25 μL RNase-free H 2O.
DNA-free kit (Cat. # AM 1906, Ambion, Austin, USA) was used to eliminate trace amounts of unwanted gDNA from the RNA samples. Based on the manufacturer's instructions, a volume of 2.5 μL 10 × DNase I buffer and 1 μL of DNase I was added to each sample, mixed gently, and incubated at 37 °C for 20-30 min. A 2.5 μL volume of DNase inactivation reagent was added into each RNA sample and mixed well. All samples were left at room temperature for 5 min, mixed every 2 min, and centrifuged at 11,600 g for 2 min. The aqueous phase containing the RNA was transferred to a fresh 1.5 mL tube. A 1.5 μL volume of each sample was used to quantify RNA with the ND-1000 Nanodrop (NanoDrop technologies Inc., USA).
In addition, approximately 400 ng of RNA was loaded onto a 2 % agarose gel, containing 1 ×
TAE buffer, 5 μL / 100 mL SYBR ® Safe and run at 90 V for 25 min to determine the quality and confirm the relative quantity of RNA in the samples. Prior to loading onto the gel, RNA samples were incubated at 60 °C for 10 min and mixed with 10 × sucrose loading dye. RNA was visualised using a GeneFlash gel documentation system (Synoptics Ltd, USA).
2.11 cDNA synthesis
After removal of gDNA, the RNA samples were used to synthesise cDNA. The reverse transcription reaction was performed by adding 2 μg of RNA with 1 μL of 50 μM oligo(dT) 20
((Cat. # 12577-011, Invitrogen, CA, USA), 1 μL 10 mM dNTP (Cat. # 18109-017, Invitrogen,
CA, USA), and nuclease-free H 2O to a total volume of 13 μL. Samples were mixed gently by 29 pipetting and incubated at 70 °C for 5 min followed by incubation on ice for 3 min. the reaction mixture was then combined with 4 μL of 5 × first strand buffer, 1 μL of 0.1 M DTT,
50 U of Super transcript III Reverse Transcriptase (Cat. # 10777, Invitrogen, CA, USA), 20 units RNaseOUT (Invitrogen, CA, USA) and nuclease-free H 2O to a total volume of 20 μL followed two incubation steps, including 50 °C for 1 h, 72 °C for 15 min.
2.12 Polymerase chain reaction (PCR)
2.12.1 Routine gDNA/cDNA PCR
For genotyping plant samples, determine whether a gene is expressed and semi-quantitative
PCR, Platinum ® Taq polymerase (Invitrogen, Cat. # 10966-018, Carlsbad, CA, USA) was used to amplify sequences of interest from either a gDNA or cDNA template. Primers designed to amplify specific regions of DNA were ordered from Geneworks (Adelaide, Australia), the sequences of which will be described in the relevant chapters. According the manufacturer's protocol, a standard mixture for the routine PCR reaction was prepared as detailed in Table 2.5.
Reactions were carried out in 200 µL thin walled microcentrifuge tubes in a DNA Engine
Tetrad 2 Thermal Cycler with following cycling parameters described in Table 2.5.
30
Table 2.5 Platinum Taq polymerase PCR solution and program used for routine PCR Solution Components Volume Final Conc. 10 × PCR Buffer minus Mg 2+ 2.5 μL 1× 10 mM dNTP mixture 0.5 μL 200 μM
50 mM MgCl 2 0.75 μL 1.5 mM Forward primer 1 μL 400 nM Reverse primer 1 μL 400 nM 20 U/ μL Taq DNA polymerase 0.1 μL 2 U Template DNA 1 μL Autoclaved distilled water To 25 μL Program Steps Temperature Duration Cycles Initiate denature 94 °C 2 min 1 cycle Denature 94 °C 30 s Anneal Primer specific 30 s 35 cycles Extend 72 °C 1 min per kb Final extend 72 °C 10 min 1 cycle
Agarose gel electrophoresis was used to examine the PCR products (Section 2.8).
2.12.2 High-Fidelity PCR
Amplification of DNA fragments for cloning purpose requires high-fidelity PCR so that sequencing errors are not introduced into the sequence, therefore High Fidelity
Platinum ® Taq DNA Polymerase (Cat. # 11304, Invitrogen, USA) and Elongase ® Enzyme Mix
(Cat. # 10480, Invitrogen, USA) were used. Following the manufacturer's protocol, a standard mixture for the high fidelity PCRs was prepared as described in Table 2.6 and the reactions were carried out with following cycling parameters described in Table 2.6.
31
Table 2.6 Platinum Taq polymerase high fidelity and Elongase PCR solution and program used for the routine PCR Solution of Platinum Taq polymerase high fidelity Components Volume Final Conc. 10 × High Fidelity PCR Buffer 2.5 μL 1× 10 mM dNTP mixture 0.5 μL 200 μM each
50 mM MgSO 4 1 μL 2 mM 10 μM Forward primer 1 μL 400 nM 10 μM Reverse primer 1 μL 400 nM 5 U/ μL Platinum Taq High 0.1 μL 0.5 U Fidelity Template DNA 1 μL Autoclaved distilled water To 25 μL Program of Platinum Taq polymerase high fidelity Steps Temperature Duration Cycles Initiate denature 94 °C 2 min 1 cycle Denature 94 °C 30 s Anneal Primer specific 30 s 35 cycles Extend 68 °C 1 min per kb Final extend 68 °C 10 min 1 cycle Solution of Elongase ® Enzyme Mix component Volume Final Conc. Mix 1 10 mM dNTP mixture 1 μL 200 μM each 10 μM Forward primer 1 μL 400 nM 10 μM Reverse primer 1 μL 400 nM Template DNA 1 μL Autoclaved distilled water To 20 μL Mix 2
5× Buffer B 10 μL 60 mM Tris-SO 4 (pH 9.1),
Elongase Enzyme Mix 1 μL 18 mM (NH 4)2SO 4 with 2
Autoclaved distilled water To 30 μL mM MgSO 4 Mix 1 and Mix 2 were prepared separately on ice and mixed in an amplification tube followed by program described as below. Program of Elongase ® Enzyme Mix Steps Temperature Duration Cycles Initiate denature 94 °C 30 s 1 cycle
32
Denature 94 °C 30 s Anneal Primer specific 30 s 35 cycles Extend 68 °C 1 min per kb Final extend 68 °C 10 min 1 cycle
2.12.3 Colony PCR Colony PCR was used to screen for plasmid inserts directly from E.coli colonies after transformation by checking for the presence of the insert, the insert’s size and confirming orientation of the DNA sequence of interest in the entry or destination plasmid. A 1 µL volume of liquid culture was used as template DNA mixed with routine PCR reaction using cycle conditions described in Table 2.7.
Table 2.7 Platinum Taq polymerase PCR solution and program used for the colony PCR Solution Components Volume Final Conc. 10×PCR Buffer minus Mg 2+ 2.5 μL 1× 10 mM dNTP mixture 0.5 μL 200 μM
50 mM MgCl 2 0.75 μL 1.5 mM Forward primer 1 μL 400 nM Reverse primer 1 μL 400 nM 20 U/ μL Taq DNA polymerase 0.1 μL 2 U Overnight liquid culture 1 μL Autoclaved distilled water To 25 μL Program Steps Temperature Duration Cycles Initiate denature 94 °C 12 min 1 cycle Denature 94 °C 30 s Anneal Primer specific 30 s 35 cycles Extend 72 °C 1 min per kb Final extend 72 °C 10 min 1 cycle
2.13 Cloning PCR products into entry vectors
Desired DNA sequences, amplified by high fidelity PCRs, were cloned into a pCR8/GW/TOPO TA Gateway ® entry vector (Cat. # K2500-20, Invitrogen, USA) (Figure 2.1) following the manufacturer's instructions. A 2 μL volume of PCR product was mixed with 0.5
33
μL salt solutions and 0.25 μL pCR8/GW/TOPO TA Gateway ® entry vector and incubated at
23 °C overnight using DNA Engine Tetrad 2 Thermal Cycler (BioRad, Australia). The entry vector in a linearised form contains single overhanging 3′ deoxythymidine (T) residues to which the single overhanging 3′ deoxyadenosine (A), produced at the end of the amplified
PCR generated by the terminal transferase activity of Taq DNA polymerase can attach. Ligated
DNA samples were used for transformation of E.coli cells.
34
Figure 2.1: Schematic diagram of pCR8/GW/TOPO TA Gateway ® entry vector
Feature Description TOPO Cloning site Insertion site of PCR product into the vector attL1 Gateway recombination sequence attL2 Gateway recombination sequence GW1 primer site Sequencing site in the sense orientation GW2 primer site Sequencing site in the anti-sense orientation M13 forward primer site Sequencing site in the sense orientation M13 reverse primer site Sequencing site in the anti-sense orientation Spn promoter Spectinomycin resistance gene promoter SpnR Spectinomycin resistance gene for selection in E.coli pUC origin pUC origin of replication
35
2.14 Preparation of competent cells ( Escherichia coli )
Bacterial competent cells are widely used in cloning because they can easily uptake foreign
DNA after a small shock. A modified rubidium chloride protocol was used to bulk up chemically competent TOP10 Escherichia coli (E. coli ) cells (Cat. # C404-10, Invitrogen,
USA). According to the protocol, TOP10 E. coli cells were inoculated in 10 mL of Luria
Betani (LB) liquid media (yeast extract 5 g L -1; tryptone 10 g L -1; NaCl 5 g L -1; pH 7.5) and incubated at 37 °C overnight with shaking. A 2.5 mL volume of overnight culture was added to
250 mL new LB liquid media and the cells grown at 37 °C with constant shaking until they reached OD 600 of 0.6. The cells were collected by centrifugation at 4,500 g for 5 min at 4 °C, using an Avanti JE series centrifuge (Beckman Coulter, USA) and resuspended in 100 mL ice-cold sterilised TFB1 buffer (30 mM KAC, 10 mM CaCl 2, 50 mM MnCl 2, 100 mM RbCl,
15 % glycerol, pH 5.8). Cells were incubated and resuspended on ice for 5 min at 4 °C. After centrifugation at 4,500 g for 5 min at 4 °C, the cells were collected and gently resuspended in
10 mL ice-cold TFB2 buffer (75 mM CaCl 2, 10 mM RbCl, 15 % glycerol, 100 mM PIPES, pH
6.5) followed incubation on ice for 30 min. A 50 μL volume of cell cultures was dispensed into
1.5 mL centrifuge tubes, quick frozen in liquid nitrogen and kept at -80 °C.
2.15 Transformation of plasmid DNA into E.coli cells
The thermal shock method was used to the transform foreign plasmid DNA into competent cells. A 50 μL volume of competent E. coli cells was thawed on ice for 30 min and mixed with
4 μL of plasmid DNA followed by incubation on ice for further 20 min. Cells were heat shocked for 30 s at 42 °C and immediately transferred to ice for 5 min. After adding 250 μL
LB liquid media, samples were incubated at 37 °C for 1 h with constant shaking. A 100 μL volume of the culture was then spread onto LB agar (yeast extract 5 g L-1; tryptone 10 g L -1;
NaCl 5 g L -1; 15 g L -1 difco agar; pH 7.5) plates containing the appropriate antibiotics which depends on the selection gene within the plasmid (50 µg mL -1 kanamycin, 50 µg mL -1 spectinomycin, 100 µg mL -1 ampicillin, or 50 µg mL -1 hygromycin). Plates were sealed and incubated at 37 °C overnight.
36
2.16 Isolation of plasmid DNA from E.coli cells
Individual colonies from transformation plates were selected with a pipette tip and inoculated in 5 mL liquid LB media (containing appropriate antibiotics), and incubated at 37 °C overnight with gentle shaking. Cells were collected by centrifugation at 9,300 g for 10 min on the next day. ISOLATE Plasmid Mini Kit (Cat. # Bio-52026, Bioline, UK) was used to isolate plasmid
DNA from E.coli cells. According to the manufacturer's instructions, the pellets of cell were resuspended in 250 μL P1 buffer by vortexing and mixed with 250 μL of Lysis Buffer P2 by inverting the tubes. After incubation at room temperature for 5 min, a 300 μL volume of
Neutralisation Buffer P3 was added and samples mixed thoroughly, followed by centrifugation at 11,200 g for 5 min. The supernatant in each tube was transferred into ISOLATE II Plasmid
Mini Spin Column and centrifuged at 11,200 g for 1 min to bind the DNA to the silica column.
Samples were then washed with 500 μL Wash Buffer PW1 and 600 μL Wash Buffer PW2, followed by centrifugation at 11,200 g for 2 min to remove residual ethanol. Finally, the plasmid DNA was eluted from the silica column by the addition of 50 μL Elution Buffer P and collected by centrifugation at 11,200 g for 1 min. An ND-1000 spectrophotometer (NanoDrop
Technologies Inc., DE, USA) was used to determine the DNA yield of all plasmid DNA.
2.17 Restriction enzyme digestion of plasmid DNA
To analyse plasmid DNA extracted from E.coli cells and to obtain DNA fragments for ligation, restriction enzyme digestions were used to cleave DNA at specific site. All restriction enzymes used in this project were supplied by Roche Diagnostics Australia Pty. Ltd. (Castle Hill,
Australia) or New England Biolabs (Ipswich, MA, USA). According to the manufacturer's instructions, approximately 200 ng of plasmid DNA was mixed with the desired 1 - 10 U of restriction enzyme, a 2 µL volume of the enzymes buffer (supplied at 10 × concentration) and the appropriate amount of sterilised H 2O to bring the solution to a final volume of 20 μL.
Samples were incubated at required temperature overnight. The digested DNA was run on agarose gels (Section 2.7) to determine the product sizes, concentrations and orientation of inserts.
37
2.18 LR reactions
Gateway ® LR Clonase II Enzyme Mix (Cat. # 11791, Invitrogen, USA) was used to catalyse the recombination between pCR8/GW/TOPO TA Gateway ® entry vectors (containing the gene of interest) and the appropriate destination vectors (Table 2.8, destination vectors kindly supplied by Dr Sergiy Lopato, Prof. Joerg Kudla, Dr Andrew Jacobs, Ms Jodie Kretschmer and
Mr Nadim Shadiac) to generate constructs for E.coli and plant transformation. According to the manufacturer's instructions, 50 ng entry vector was mixed with 75 ng destination vector, a
0.5 μL volume of LR Clonase TM II enzyme mix and TE buffer (pH 8.0) to a final volume of 4
µL and incubated at 25 °C overnight. 0.5 μL of the Proteinase K was added to samples to terminate the reaction and samples were incubated at 37 °C for 10 min. The products of LR reactions were used to transform into E.coli cells (Section 2.14) and then introduced either into plant cells or transformed into A. tumefaciens (Section 2.19.2) for floral dipping (Section
2.19.3).
38
Table 2.8 Summary of destination vectors used in this thesis Table shows the vector source, the species, the vectors are used to transform and the antibiotic resistance gene for bacteria, the resistance gene for plant transformation , and relevant chapters where the vectors were used.
Destination Species Selection in Selection Chapter Source vectors transformed Bacteria in plant Saccharomyces pTOOL27 Sergiy Lopato ACPFG Kan 3 cerevisiae Saccharomyces pTOOL28 Sergiy Lopato ACPFG Amp 3 cerevisiae Prof. Joerg Kudla pUC-SPYCE/GW plants Amp 3 Muenster University Prof. Joerg Kudla pUC-SPYNE/GW plants Amp 3 Muenster University pGPTVII.Hyg.YC- Andrew Jacobs plants Kan Hyg 3 GW ACPFG pGPTVII.Hyg. Andrew Jacobs plants Kan Hyg 3 GW-YC ACPFG pGPTVII.Bar.YN- Andrew Jacobs plants Kan Basta 3 GW ACPFG pGPTVII.Bar. Andrew Jacobs plants Kan Basta 3 GW-YN ACPFG Nadim Shadiac pDEST17 E.coli Amp 4 ACPFG Jodie Kretschmer pMDC32 plants Kan Hyg 5 ACPFG
39
2.19 Agrobacterium-mediated stable transformation of Arabidopsis
The Agrobacterium tumefaciens floral dip technique (Clough and Bent, 1998) was used to introduce DNA constructs into the Arabidopsis thaliana ecotype Col-0 to generate the genetically modified plants.
2.19.1 Preparation of competent A. tumefaciens AGL1 cells
A modified Freeze-Thaw method (Hofgen and Willmitzer, 1988) was used to multiply the number of competent cells of A. tumefaciens AGL1. A 250 μL volume of AGL1 cells was added to 5 mL of liquid LB media and incubated at 28 °C for 48 h. The culture was then added to 200 mL of sterilised YEP media (Bacto peptone 10 g L -1; yeast extract 10 g L -1; NaCl 5 g L -1; pH 7.0) and incubated at 28 °C for 5 h. After centrifugation at 800 g for 20 min at 4 °C using an Eppendorf 5810R centrifuge (Eppendorf South Pacific Pty. Ltd., Australia). The cells were washed by 1 × TE (pH 8.0) and centrifuged again at 800 g for 10 min at 4 °C before being resuspended in 5 mL of YEP. A 500 μL volume of cell cultures was dispensed into 1.5 mL centrifuge tubes, quick frozen in liquid nitrogen and kept at -80 °C.
2.19.2 Transformation of plasmid DNA into A.tumefaciens AGL1 cells
The Freeze-thaw method (Hofgen and Willmitzer, 1988) was also used to introduce the expression constructs into A. tumefaciens AGL1 for Arabidopsis transformation. Two micrograms of plasmid DNA was mixed with 500 μL of AGL1 cells and incubated on ice for 5 min. Cells were shocked by exposure to liquid nitrogen for 5 min and then incubated at 37 °C for 5 min to allow DNA to enter. Each sample was mixed with 1 mL liquid LB media and incubated for 3 h with shaking. A 50 μL volume of culture was spread onto LB agar plates containing 25 μg mL -1 rifampicin and 50 µg mL -1 kanamycin. The plates were sealed and incubated at 28 °C for 2 days using an incubator (Ratek Instruments, Australia).
Individual colonies from transformation plates were selected with a pipette tip and inoculated in 5 mL liquid LB media containing 25 μg mL -1 rifampicin, 50 µg mL -1 carbenicillin or appropriate antibiotic for selection of A. tumefaciens containing the destination vector, followed by incubation at 28 °C for 48 h with shaking. After checking the presence of plasmid 40
DNA by PCR, a volume of 5 mL culture was added into 250 mL LB media and incubated at
28 °C for 48 h. The cells were collected by centrifugation at 800 g for 10 min at 4 °C and resuspended in 250 mL 5 % sucrose solution with 0.05 % Silwet L-77 (Cat. # VIS-02,
OsiSpecialties, USA) for Arabidopsis floral dip transformation.
2.19.3 Transformation by floral dipping
Col-0 Arabidopsis plants were grown in soil as per Section 2.3. Selected plants were dipped into a sucrose and Agrobacteria cell solution (as per Section 2.19.2 and Clough and Bent
(1998)) for 30 s and covered with cling wrap (Woolworth, Australia) to keep the high humidity.
Dipped plants were kept under the same growth conditions as described in Section 2.3 but were placed in the dark for 24 h immediately after dipping. Plants were then placed back into a normal growth condition for 4 weeks to allow seed to mature for collection. Seeds were harvested as per Section 2.3.
2.20 Selection of transformants
2.20.1 Selection in soil
Transgenic plants transformed with constructs harbouring a bar gene that confers resistance to glufosinate herbicide (Basta) (Bayer Crop Science, Australia) were grown in soil. Artificial soil mix was placed in trays as described in previous Section 2.3. Seeds were spread evenly on the surface of the soil mix. When seedlings were 10 days old, glufosinate solution (100 μg mL -1) was sprayed onto the germinated seedlings every second day for 6-8 applications. Positive plants which showed herbicide tolerance were transferred into 67 mm × 85 mm sized pots with soil mix and supplied with nutrient solution (Table 2.1) every week until ready for seed collection.
2.20.2 Selection on MS plate
Transgenic plants transformed with constructs containing the Hyg gene, which confers resistance to the antibiotic hygromycin, were grown on MS plates. Plates containing MS media were prepared as described in Section 2.5, using circular petri dishes (145 diameter × 20 deep mm, Cat. # 639102, Greiner Bioone, Frickenhausen, Germany). The MS media contained 25 41
μg mL -1 hygromycin. Plant seeds were sterilised, stratified and germinated on the hygromycin media as described in Section 2.5. Positive transgenic seedlings can be identified after 2 weeks and seedlings were then transferred to pots (67 mm × 85 mm, PUNTPX, Garden City Plastics,
Victoria, Australia) with soil mix and supplied with nutrient solution (Table 2.1) every two weeks for seed collection.
2.21 Statistical analysis
Microsoft office 2010 (Microsoft Inc, USA) and GraphPad Prism 6 (GraphPad software Inc.,
USA) were used for data processing and statistical analysis.
42
Chapter 3 Identification of upstream regulators of AtCIPK16
3.1 Introduction
Calcium is an important second messenger, involved in the regulation of gene expression and various signal transduction pathways in plants. Calcium signals are produced under a variety of internal or external stimuli. Different stimuli trigger distinct spatial and temporal changes in cytosolic-free Ca 2+ concentration, and generate unique stress specific Ca 2+ signature (Kudla et al. 2010). Spatial specificity of the Ca 2+ signal is formed by different combinations of Ca 2+ released from various intracellular and extracellular storage compartments (Clapham 2007,
Kudla et al. 2010). As the calcium has a slow diffusion rate, consequently calcium concentration micro-domains are formed around Ca 2+ release sites and play an essential role in the calcium signalling processes and regulating a range of cell processes (Demuro and Parker
2006, Serulle et al. 2007). Plant physiological studies revealed that calcium signals are produced by Ca 2+ being released from either the extracellular space (apoplast) or from intracellular stores such as the vacuole, the endoplasmic reticulum (ER), mitochondria and/or chloroplasts (Sanders et al. 1999, Waadt et al. 2008, Weinl et al. 2008). Temporal specificity means the Ca 2+ is released at different times from the stores in response to abiotic and biotic stresses (Waadt et al. 2008). Some studies indicated spatial specificity is crucial in the activation of the correct signalling pathway in response to the specific stress and that the signal has to take into account the plant’s developmental growth stage to activate the correct response
(Hetherington and Brownlee 2004, MacRobbie and Kurup 2007, Scrase-Field and Knight 2003,
Trewavas and Malho 1997). A crucial consequence deduced from this observation is that calcium signal decoders have to be bound to various membranous compartments which are located close to calcium release sites (McAinsh and Hetherington 1998). In Ca 2+ signalling pathways, Ca 2+ sensors perceive the signal within the cytosol and interact with other proteins, such as kinases, to form complexes for the transduction of the signal to downstream targets
(Sanders et al. 2002). While some of these interactions are known, often the downstream targets have to be elucidated and require further investigation (Hetherington and Woodward 43
2003).
Calcineurin B-like (CBL) proteins have been identified as Ca 2+ -sensors which interact with a family of protein kinases, the CBL-interacting protein kinases (CIPKs) in plant cells; henceforth called the CBL-CIPK signalling network (Albrecht et al. 2001, Batistic and Kudla
2009, Harmon et al. 2000, Kim et al. 2000, Luan et al. 2002). As there are 10 CBLs and 26
CIPKs in Arabidopsis, there exists a large number of possible CBL-CIPK combinations which will thus contribute to the specificity of the signalling pathway in Arabidopsis (Batistic and
Kudla 2009, Kolukisaoglu et al. 2004, Kudla et al. 2010).
Previous studies have revealed that interactions between different CBLs and CIPKs are important in the various pathway in response to a diverse range of stresses (Weinl and Kudla
2009). For example, CBL4 (SOS3) has been shown to interact with CIPK24 (SOS2) in a complex localised at the plasma membrane, while CBL10 interacts with CIPK24 and forms a
CBL10-CIPK24 complex at the tonoplast (Kim et al. 2007, Shi et al. 2002). Both CBL4 and
CBL10 bind to CIPK24 to phosphorylate different target proteins when the plant is salt-stressed to maintain Na + homeostasis (Kim et al. 2007, Shi et al. 2002, Waadt et al. 2008).
CBL1 and CBL9 have been identified as plasma membrane localised proteins which can both interact with CIPK23 and form the complexes to phosphorylate the potassium transporter
AKT1 (Xu et al. 2006). However, most interaction of CIPKs with various CBLs and subcellular localisation of CBL-CIPK complexes are still unknown and remain to be investigated.
This chapter will utilise various in vitro and in planta techniques to identify the AtCBLs that interact with CIPK16’s interacting AtCBLs, and determine the subcellular localisation of those complexes. The results of these experiments will provide further evidence of the function of this kinase and identification of more components in relevant signalling pathways.
To identify interaction of AtCIPK16 with AtCBLs a yeast two hybrid assay was used. The yeast two hybrid assay is one of the most widely used genetic approach to identify 44 protein-protein interaction as it is simple, rapid, relatively inexpensive and it requires less individual optimisation compared to other conventional methods. When a bait protein (in this case AtCIPK16) interacts with a prey protein (one of the 10 AtCBLs), a DNA-binding domain and Gal4 activation domain are brought together to activate transcription of the downstream reporter genes. Therefore, a yeast two hybrid assay was performed to identify which of the 10
AtCBLs interact with AtCIPK16 and 10 AtCBLs.
The bimolecular fluorescent complementation (BiFC) assay was utilised as an alternative genetic method in planta to not only visualise the interaction between AtCBL and CIPK proteins, but also localise the site of interaction within the cell (Berendzen et al. 2012, Chen et al. 2011b, Ferro and Trabalzini 2013, Grefen et al. 2010a, Grefen et al. 2010b, Waadt et al.
2008). The BiFC assay is based on the formation of a fluorescent YFP molecule by bringing together two fragments of the YFP protein through the interaction of two proteins (in this case
AtCIPK16 and a CBL) which had two different fragments of YFP fused to them (Walter et al.
2004). This assay has been used to determine the localisation of CIPK23-AKT1,
CBL1-CIPK23, CBL9-CIPK23 (Xu et al. 2006), CBL10-CIPK24, CBL1-CIPK24,
CBL1-CIPK1 and CBL9-CIPK1 (Waadt et al. 2008). Analysis of the localisation of
CBL-CIPK complexes by BiFC assay in planta provides some evidence for understanding the mechanism of decoding calcium signals in CBL/CIPK network and regulating the various pathways in the physiological processes.
BiFC assays can either be performed by transient expression in protoplasts isolated from mesophyll cells; transformation of leaf epidermal cells of either Arabidopsis or tobacco; or throughout the whole plant after stable transformation. Both approaches have advantages and disadvantages. Arabidopsis mesophyll protoplasts can be obtained quickly and easily by simple procedures and the signal transduction observed in mesophyll protoplast might be extended to other cell types in plants (Sheen 2001). The transient expression in Arabidopsis protoplasts with single or multiple plasmids is inexpensive and high efficiency compare with other transformation methods (Sheen 2001) and would be a good approach to quickly identify which CBLs interact with CIPK16 and where that interaction takes place in the cell. However, 45 there is the concern that the interaction which is observed in a protoplast is not what happens in a real plant cell, therefore Agro-infiltration of leaves can be used as an alternative approach for transient expression of single or multiple genes in plant tissues (Batistic et al. 2010, Waadt et al. 2008). In this PhD thesis, transient expression of BiFC-YFP constructs containing different combinations of CIPK16 and CBL genes was performed in both Arabidopsis mesophyll protoplasts and in Arabidopsis and tobacco leaves.
3.2 Chapter aims
The aims of this chapter are to use available techniques in vitro, in planta and in vivo :
1. To identify upstream interacting AtCBLs of AtCIPK16 by yeast two hybrid assays
2. To determine cellular localisation of AtCBLs-AtCIPK16 complex using BiFC assay transiently expressed in Arabidopsis mesophyll protoplast
3. To determine cellular localisation of AtCBLs-AtCIPK16 complex using BiFC assay transiently expressed in Arabidopsis leaves by Agrobacterium-infiltration
4. To determine cellular localisation of AtCBLs-AtCIPK16 complex using BiFC assay transiently expressed in tobacco ( Nicotiana benthamiana) leaves by Agrobacterium-infiltration
5. To determine cellular localisation of AtCBLs-AtCIPK16 complex using BiFC assay stably expressed in Arabidopsis by Agrobacterium-mediated floral dipping transformation
3.3 Materials and methods
3.3.1 Yeast two hybrid assays
To determine which of the 10 AtCBL proteins interacted with AtCIPK16, a yeast two hybrid assay was performed.
3.3.1.1 Cloning for yeast two hybrid assays
For identification the interactions of AtCIPK16 with 10 AtCBLs, full-length of the coding sequences of all 10 AtCBLs and AtCIPK16 were amplified from cDNA of Arabidopsis ecotype
Columbia-0 by high fidelity PCR (Section 2.12.2) with specific primers listed in Table 3.1. cDNA of Arabidopsis was synthesised (Section 2.11) from RNA sample extracted as protocol in Section 2.10. The resulting DNA fragments were cloned into the pCR8/GW/TOPO TA
46
Gateway ® entry vector (Cat. # K2500-20, Invitrogen, USA) using protocol in Section 2.13, and transformed into E.coli (Section 2.15). After overnight incubation the DNA plasmid was extracted from the E.coli cells and examined the orientation of inserted genes by colony PCR
(Section 2.12.3) using gene-specific primers (primers are listed in Table 3.1). Finally, DNA plasmids were determined by Sanger sequencing (Section 2.9) to confirm that there were no errors in cloning. An LR reaction was performed (Section 2.18) to transfer the DNA from pCR8 into the required destination vectors, the prey vector pTOOL28 (Figure 3.2) and the bait vector pTOOL27 (Figure 3.2). The sequence of the cloned gene in either pTOOL28 or pTOOL27 was again confirmed by Sanger sequencing (Section 2.9) to make sure no errors had been introduced into the product. Consequently, each AtCBLs was expressed as a fusion to
GAL4 activation domain and AtCIPK16 was expressed as a fusion to GAL4 DNA binding domain in the yeast two hybrid assay (Figure 3.1 and Figure 3.2).
47
Table 3.1: Primers used to the clone coding sequences of 10 AtCBLs, AtCIPK16, AtCIPK16Nt and AtAKT1 from Arabidopsis cDNA Information includes the names of PCR products, primer names, primer sequences, annealing temperature (Tm) and the size of PCR products. ys = with the stop codon, Nt = N-terminal domain.
Names Primers Sequence (5′- 3′) Tm* °C Size bp AtCBL1(ys) AtCBL1_For ATGGGCTGCT TCCACTCAAA 56.1 642
AtCBL1ys_Rev TCATGTGGCAATCTCATCGA 57.5
AtCBL2(ys) AtCBL2_For ATGTCGCAGTGCGTTGACGG 60.8 681
AtCBL2ys_Rev TCAGGTATCTTCAACCTGAGAAT 55.2
AtCBL3(ys) AtCBL3_For ATGTCGCAGTGCATAGACGG 59.2 681
AtCBL3ys_Rev TCAGGTATCTTCCACCTGCG 58.3
AtCBL4(ys) AtCBL4_For ATGGGCTGCTCTGTATCGAAG 59.5 669
AtCBL4ys_Rev TTAGGAAGATACGTTTTGCAATT 56.4
AtCBL5(ys) AtCBL5_For ATGGGATGTGTTTGCAGCAA 59.5 612
AtCBL5ys_Rev TTACCGGAGAAAGGTTGGGA 59.5
AtCBL6(ys) AtCBL6_For ATGATGATGCAATGTTTAGATGG 57.1 618
AtCBL6ys_Rev TCATCCATCCAGCTCACTAGGAG 60.9
AtCBL7(ys) AtCBL7_For ATGGATTCAACAAGAAATTCAGCT 59.4 645
AtCBL7ys_Rev TCAGGTATCTTCCACTTGCG 56.0
AtCBL8(ys) AtCBL8_For ATGTTGGCATTCGTGAAATG 56.7 645
AtCBL8ys_Rev CTAGTCTTCAACTTCAGAGTCGAG 55.2
AtCBL9(ys) AtCBL9_For ATGGGTTGTTTCCATTCCACGGCTGCC 55.6 642
AtCBL9ys_Rev TCACGTCGCAATCTCGTCCACCTCC 60.0
AtCBL10(ys) AtCBL10_For ATGACAACTGCCGACCAAATAATAT 61.4 771
AtCBL10ys_Rev TCAGTCTTCAACCTCAGTGTTGAATAT 60.9
AtCIPK16(ys) AtCIPK16_For ATGAAGAATCAAACCGTAGTAGTACTGTC 60.8 1410
AtCIPK16ys_Rev TCATGAAACATTATTTATTTTGTTATCATT 59.7
AtCIPK16 Nt AtCIPK16_For ATGGAAGAATCAAACCTAGTAGTACTGTC 60.9 963
AtCIPK16Nt_Rev TCAGTCTTCAACCTCAGTGTTG 55.1
AtAKT1(ys) AtAKT1_For ATGAGAGGAGGGGCTTTGTTATG 61.6 2574
AtAKT1_Rev TTAAGAATCAGTTGCAAAGATGAGATG 61.7
*Primer T m was predicted by NetPrimer (http://www.premierbiosoft.com/netprimer/index.html)
48
Figure 3.1: The bait vector pTOOL27 was used to express AtCIPK16 fused to GAL4 DNA binding domain for the yeast two hybrid assay
Feature Description attR1 Gateway recombination sequence Chlor Chloramphenicol resistance gene ccdB ccdB gene the encoded protein is toxic for the standard E. coli strains attR2 Gateway recombination sequence
T7 terminator T7 bacteriophage terminator TADH1 S. cerevisiae ADH1 terminator Kan Kanamycin resistance gene for selection in E.coli PTRP1 Tryptophan synthetase gene promoter PADH1 S. cerevisiae constitutive alcohol dehydrogenase I promoter GAL4 DNA BD GAL4 DNA binding domain c-Myc c-myc epitope tag for analysing the fusion protein
T7 promoter T7 RNA polymerase promoter
49
Figure 3.2: The prey vector pTOOL28 was used to express one of the 10 AtCBL genes fused to GAL4 activation domain for yeast two hybrid assay
Feature Description attR1 Gateway recombination sequence Chlor Chloramphenicol resistance gene ccdB ccdB gene the encoded protein is toxic for the standard E. coli strains attR2 Gateway recombination sequence TADH1 S. cerevisiae ADH1 terminator LEU2 LEU2 nutrition marker for selection in yeast Amp Ampicillin resistance gene for selection in E.coli PADH1 S. cerevisiae constitutive alcohol dehydrogenase I promoter SV40 NLS SV40 nuclear localisation sequences GAL4 AD GAL4 activation domain HA HA epitope tag for analysing the fusion protein
T7 promoter T7 RNA polymerase promoter
50
3.3.1.2 Preparation of yeast strain AH109 from stock
Frozen Saccharomyces cerevisiae strain AH109 (kindly supplied by Sergiy Lopato, ACPFG) was spread on a YPDA (tryptone 20 g L -1; yeast extract 10 g L -1; D-Glucose 20 g L -1; 0.2 % adenine 15 mL L -1 and agar 12 g L-1) plate and incubated for 3 days at 30 °C to obtain single colony yeast cells.
3.3.1.3 Transformation of constructs into S. cerevisiae
The AtCIPK16 bait vector, 10 AtCBLs prey vectors were co-transformed into the yeast strain
AH109 following manufacturer's instructions (Clontech, CA, USA). Briefly, a fresh single yeast colony from a YPDA plate was transferred into 50 mL of a YPAD medium (tryptone 20 g
L-1; yeast extract 10 g L -1; D-Glucose 20 g L -1; 0.2 % adenine 15 mL L -1) in a conical flask and incubated overnight at 30 °C with shaking at 180 rpm using orbital mixer incubator (Ratek
Instruments, Australia). The following morning, the overnight cultures were mixed with fresh
50 mL YPDA in a conical flask and shaken using orbital mixer incubator until they reached
OD 600 of 0.8, measured by an ND-1000 spectrophotometer (NanoDrop Technologies Inc.) to confirm cells in log phase growth thereby ensure the transformation with high efficiency. The cells were pelleted at the base of 50 mL tube by centrifuging the sample at 400 g for 5 min using an ROTANTA 460R centrifuge (Hettich, Germany) and the supernatant was discarded.
The pellets were washed by re-suspending in 50 mL of sterile water and mixed by vortexing, followed by another centrifugation at 400 g for 5 min to recollect the pellets at the bottom of the tube - the supernatant was again discarded. Pelleted cells were resuspended in 2 mL of
TE/LiAc solution (10 % 10 × Tris-EDTA buffer (10 mM Tris-HCl, 1mM EDTA, pH adjusted with HCl to 8.0), 10 % 1 M LiAc, pH with acetic acid to 7.5) by pipetting. Single-strand DNA
(ssDNA, Sigma-Aldrich, Cat. #D7209, Castle Hill, Australia) was boiled for 5 min and 5 μL of ssDNA was added to 100 μL of yeast cell to work as a carrier to transfer foreign DNA into the yeast cells. This mixture was suspended in 600 μL of PEG/TE/LiAc solution (10 % 10 × TE,
10 % 1 M LiAc, and 50 % PEG 3350) and 0.5 μg of the required pTOOL27:CIPK16 and pTOOL28:CBL pairs followed by incubation for 1 hour at 30 °Cwith shaking at 200 rpm using orbital mixer incubator. During this step, PEG in the solution can promote membrane fusion by changing water structure around membrane, while lithium ions can neutralise the negatively 51 charged DNA and the phospholipid bilayer of yeast cells as well aiding the introduction of the plasmid DNA into yeast cells by generating holes at the plasma membrane. Each sample was mixed with 70 μL dimethyl sulfoxide (DMSO, Sigma-Aldrich, Castle Hill, Australia) by vortexing and incubated in a water bath (GFL, Typ.1012, Germany) at 42 °C for 15 min to heat shock the cells. After heat shock, the samples were transferred immediately to ice and incubated for 2 min, followed by centrifugation at 16100 g for 2 min. The pellets were collected and the supernatant discarded. Samples were washed with 500 μL of sterile Milli Q water and centrifuged again at 16100 g for 2 min. After discarding the supernatant, each sample was mixed with 250 μL of 1 × TE by pipetting and spread on selection DDO
(SD/-Leu/-Trp) plates, followed by incubation at 30 °C for 2-3 days until colonies appeared.
The empty vectors pTOOL27 and pTOOL28 were also co-transformed into yeast with each prey or bait plasmid respectively to confirm that bait does not autonomously activate the reporter genes in the absence of the prey protein.
3.3.1.4 Yeast two-hybrid assay
For each possible combination between bait and preys the largest colonies were picked from each plate and inoculated into 5 mL selection SD QDO liquid medium (containing 2 % glucose), followed by incubation at 30 °C with shaking at 180 rpm (orbital mixer incubator,
Ratek Instruments, Australia) for 2 days. OD 600 of yeast liquid samples were determined by an
ND-1000 spectrophotometer (NanoDrop Technologies Inc.) and adjusted on OD 600 of 0.25 with sterile Milli Q water. To establish whether the bait and prey proteins interacted on the plates, 10 μL of 10-fold serial dilutions of yeast harbouring an activation domain
(AD)-AtCBLs or empty vector pTOOL28 and either DNA-binding domain (BD)-AtCIPK16 or empty vector pTOOL27 were spotted on plates containing DDO (SD/-Leu/-Trp, as a control) and QDO (SD/-Leu/-Trp/-His/-Ade, Clontech, Cat. #630323, CA, USA). DDO medium contains all the necessary amino acids except for Leu and Trp, and is utilised to screen for the presence of the prey and bait plasmids. QDO medium contains all essential amino acid except for Leu, Trp, His and Ade, so this medium is utilised to select for colonies with not only the prey and bait plasmids but also those colonies where the HIS3 and ADE2 genes have become
52 activated, confirming an interaction between AtCIPK16 and a CBL. Both the DDO and QDO selection plates were incubated at 30 °C for 5-8 days to allow the yeast to grow. The growth of yeast was observed and recorded by scanning the plates (CanoScan D646U, Canon, Melville,
USA).
3.3.1.5 Isolation of plasmid DNA from S. cerevisiae
To confirm the presence of the correct plasmids in the yeast two hybrid assay, prey and bait plasmids were isolated from the yeast and the prey/bait inserts in plasmids were verified by sequencing. To isolate plasmid DNA from the yeast, a volume of 80 μL yeast culture produced in Section 3.3.1.3 was spread on plates (SD/-Trp/-Leu) and incubated at to 30 °C for 2-3 days to obtain colonies containing plasmids (bait construct and prey construct). Colonies were then confirmed by colony PCR (Section 2.12.3) using gene-specific primers (Table 3.1) and inoculated on 4 mL selection liquid (SD/-Trp/-Leu). After incubation at 30 °C for 2 days with shaking at 200 rpm, the yeast culture was collected by centrifugation at 800 g for 3 min and resuspended in 200 μL of solution A (1 M sorbitol, 100 mM Na citrate, 10 mM MgCl 2, 0.6 g
L-1 lyticase and 1 % β-mercaptoethanol). After mixing gently, samples were incubated at 70 °C for 20 min. Once returned to room temperature, the samples were added to 800 μL of solution
B (0.5 % SDS, 100 mM Tris, pH 8.0, 50 mM EDTA, 5M KAc, 70 % ethanol). After mixing gently, samples were incubated at 70 °C for 20 min to lyse the walls and membranes in cells to release plasmid DNA. Once returned to room temperature, the samples were mixed with 200
μL of 5 M KAc and incubated on ice for 10 min to remove most of the proteins and polysaccharides in a complex with the insoluble potassium dodecyl sulphate precipitate. After centrifugation at 16100 g for 5 min, the supernatant was transferred into a fresh tube and 200
μL of isopropanol was added into samples to precipitate the DNA. The samples were incubated at room temperature for 5 min. After centrifugation at 16100 g for 1 min to collect pellets, the
DNA was resuspended in 10 μL of Milli Q water. The sequences of the plasmid DNA samples were confirmed by Sanger sequencing (Section 2.9).
3.3.2 Bimolecular fluorescence complementation (BiFC) assay using both transient expression and stable expression 53
To confirm the interaction of AtCIPK16 with 10 AtCBL proteins and to localise the interaction complex of AtCBL-AtCIPK16, a bimolecular fluorescent complementation (BiFC) assay was performed in planta by transient expression in protoplasts isolated from mesophyll cells; transformation of leaf epidermal cells of either Arabidopsis or tobacco to localise the complex in shoots; or throughout the whole plant after stable transformation to visualise the sites of interactions in root tissue.
3.3.2.1 Cloning of AtCBLs and AtCIPK16 into BiFC assay vector for transient expression in mesophyll protoplast
As the vectors for transient expression pUC-SPYNE/GW or pUC-SPYCE/GW enable the expression of the AtCIPK16 and AtCBL proteins of interest fused a YFP fragment on their
C-termini, the coding sequences of all 10 AtCBLs and AtCIPK16 from cDNA of Arabidopsis ecotype Col-0 were amplified without their stop codon using PCR as described in Section
2.12.2 with specific primers listed in Table 3.2 to generate the constructs for transient expression in mesophyll protoplast.
After obtaining the full-length coding sequences without the stop codon of all 10 AtCBLs and
AtCIPK16 , the samples were visualised using gel electrophoresis (Chapter 2, Section 2.7), extracted from the agarose gels (Section 2.8), and cloned into the pCR8/GW/TOPO TA
Gateway entry vector following the manufacturer’s instructions (Section 2.13). After confirming the orientation and sequence integrity of the inserted genes using restriction enzyme digestion (Section 2.17) and sequencing (Section 2.9), an LR reaction (Section 2.18) was performed to recombined these genes from entry vector pCR8 into the split YFP destination vectors either pUC-SPYNE or pUC-SPYCE (kindly supplied by Prof. Joerg Kudla,
Muenster University, Germany). The SPYNE and SPYCE vectors are specially designed for transient expression in plant cell (Walter et al. 2004). pUC-SPYNE/GW (Figure 3.3) and pUC-SPYCE/GW (Figure 3.4) were designated as a pair of vectors to enable the expression of proteins of interest fused to either the N-terminal 155 amino acids of YFP (YN) or the
C-terminal 86 amino acids of YFP (YC). If the proteins of interest interact, then the C- and N- terminal versions of YFP are brought together and the fluorescence will be observed. 54
Constitutive expression of the genes of interest in plant cells is ensured by the 35S promoter of the cauliflowers mosaic virus in the vectors Figure 3.3 and Figure 3.4.
Table 3.2: Primers used to clone the coding sequences without the stop codon of 10 AtCBLs and AtCIPK16 from Arabidopsis cDNA Information includes the names of PCR products, primer names, primer sequences, annealing temperature (Tm) and the size of PCR products. ns = without the stop codon.
Name Primers Sequence (5′- 3′) Tm* °C Size bp
AtCBL1(ns) AtCBL1_For ATGGGCTGCT TCCACTCAAA 56.1 639
AtCBL1ns_Rev TGTGGCAATCTCATCGACCT 58.4
AtCBL2(ns) AtCBL2_For ATGTCGCAGTGCGTTGACGG 60.8 678
AtCBL2ns_Rev GGTATCTTCAACCTGAGAATGGA 57.8
AtCBL3(ns) AtCBL3_For ATGTCGCAGTGCATAGACGG 59.2 678
AtCBL3ns_Rev GGTATCTTCCACCTGCGAGTG 59.5
AtCBL4(ns) AtCBL4_For ATGGGCTGCTCTGTATCGAAG 59.5 666
AtCBL4ns_Rev GGAAGATACGTTTTGCAATTCCA 61.2
AtCBL5(ns) AtCBL5_For ATGGGATGTGTTTGCAGCAA 59.5 609
AtCBL5ns_Rev CCGGAGAAAGGTTGGGAAAATC 63.8
AtCBL6(ns) AtCBL6_For ATGATGATGCAATGTTTAGATGG 57.1 615
AtCBL6ns_Rev TCCATCCAGCTCACTAGGAGTG 59.3
AtCBL7(ns) AtCBL7_For ATGGATTCAACAAGAAATTCAGCT 59.4 642
AtCBL7ns_Rev GGTATCTTCCACTTGCGAGTGTAA 60.5
AtCBL8(ns) AtCBL8_For ATGTTGGCATTCGTGAAATG 56.7 642
AtCBL8ns_Rev GTCTTCAACTTCAGAGTCGAGTACA 57.6
AtCBL9(ns) AtCBL9_For ATGGGTTGTTTCCATTCCACGGCTGCC 55.6 639
AtCBL9ns_Rev CGTCGCAATCTCGTCCACCT 63.1
AtCBL10(ns) AtCBL10_For ATGACAACTGCCGACCAAATAATAT 61.4 768
AtCBL10ns_Rev GTCTTCAACCTCAGTGTTGAATATA 55.5
AtCIPK16(ns) AtCIPK16_For ATGAAGAATCAAACCGTAGTAGTACTGTC 60.8 1407
AtCIPK16ns_Rev TGAAACATTATTTATTTTGTTATCATT 55.2
*Primer T m was predicted by NetPrimer (http://www.premierbiosoft.com/netprimer/index.html)
55
Figure 3.3: The vector pUC-SPYNE/GW was used to express AtCIPK16 fused to the N-terminal split eYFP fragment for BiFC assay
Feature Description attR1 Gateway recombination sequence Chlor Chloramphenicol resistance gene ccdB ccdB gene the encoded protein is toxic for the standard E. coli strains attR2 Gateway recombination sequence c-myc tag the C-terminal myc protein tag for analysing the fusion protein N-YFP The N-terminal region of the split Yellow Fluorescent Protein fragment nos-T nos-Terminator Amp Ampicillin resistance gene for selection in E.coli pBR322 ori pBR322 origin of replication Lac promoter Promoter for the E. coli lac operon
56
Figure 3.4: The vector pUC-SPYCE/GW was used to express 10 AtCBLs fused to the C-terminal split eYFP fragment for BiFC assay
Feature Description attR1 Gateway recombination sequence Chlor Chloramphenicol resistance gene ccdB ccdB gene the encoded protein is toxic for the standard E. coli strains attR2 Gateway recombination sequence c-myc tag the C-terminal myc protein tag for analysing the fusion protein C-YFP the C-terminal region of the split Yellow Fluorescent Protein fragment nos-T nos-Terminator Amp Ampicillin resistance gene for selection in E.coli pBR322 ori pBR322 origin of replication Lac promoter Promoter for the E. coli lac operon
57
3.3.2.2 Cloning of AtCBLs and AtCIPK16 into BiFC assay vectors for Agrobacterium- infiltration in Arabidopsis leaves, tobacco leaves and stable constitutive over-expression in Arabidopsis plants.
As the mesophyll protoplast system has some limitations caused by cell wall removal and the vectors ( pUC-SPYNE/GW and pUC-SPYCE/GW ) only express AtCBLs and AtCIPK16 fused to
YFP fragments at C-termini, the binary vectors pGPTVII (Figure 3.5, kindly supplied by Dr
Andrew Jacobs, ACPFG) were designated as a pair of binary vectors to enable the expression of proteins of interest fused to YFP fragments at either C-termini or N-termini of AtCIPK16 or the 10 CBLs. These vectors could be used both for Agrobacterium-mediated transformation, including transient expression by Agro-infiltration in Arabidopsis or tobacco leaves and
Agro-mediated stable constitutive over-expression in Arabidopsis plants.
Entry vectors of 10 AtCBLs and AtCIPK16 in pCR8 with the stop codon or without the stop codon were obtained in Section 3.3.1.1 and Section 3.3.2.1, respectively. An LR reaction was performed (Section 2.18) to transfer the DNA from pCR8 into the required destination vectors pGPTVII (Figure 3.5). The sequences of the cloned genes in pGPTVII were again confirmed by Sanger sequencing (Section 2.9) to make sure no errors had been introduced into the product. Consequently, each AtCBL was expressed as a fusion to C-terminal YFP fragment
(YC) and AtCIPK16 was expressed as a fusion to N-terminal YFP fragment (YN). Constitutive expression of the genes of interest in plants is ensured by the 35S promoter of the cauliflowers mosaic virus in the vectors (Figure 3.5).
58
Figure 3.5: The vector pGPTVII was used to express 10 AtCBLs/AtCIPK16 fused to N-/C-terminal split eYFP fragment for Agrobacterium-infiltration in Arabidopsis leaves, tobacco leaves and stable constitutive over-expression in Arabidopsis plants. Feature Description attR1 Gateway recombination sequence Chlor Chloramphenicol resistance gene ccdB ccdB gene, the encoded protein is toxic to standard E. coli strains attR2 Gateway recombination sequence ColEI ori ColE1-type bacterial origin of replication C-YFP the C-terminal split Yellow Fluorescent Protein fragment N-YFP The N-terminal split Yellow Fluorescent Protein fragment Ori V The origin for bidirectional replication nptIII Kanamycin resistance gene pAg7 Agropine synthase polyadenylation signal sequence bar Basta resistance gene hptII Hygromycin resistance gene Pnos The nopaline synthase promoter P35S Cauliflower mosaic virus 35S promoter MCS Multiple cloning sites
59
3.3.2.3 Transient expression of AtCBLs-AtCIPK16 in Arabidopsis mesophyll protoplasts
Isolation of mesophyll protoplasts and DNA transformation were carried out as per Yoo et al.
(2007). Fully expanded leaves of Arabidopsis from five to six week-old plants, grown with nutrient solution as described in Section 2.4, were used as plant materials for protoplast isolation. Following the protocol of Hocking (2008) and Xu (2009), 20 fully expanded leaves from five to six plants were cut into approximately 1 mm strips and dipped into a digest solution (20 mM MES, 1.5 % (w/v), Cellulase R10, 0.4 % (w/v) Macerozyme R10, 0.4M mannitol, 20 mM KCl, 10 mM CaCl 2, 0.1 % (w/v) BSA, pH = 5.7) to initiate cell wall breakdown. Vacuum infiltration was applied on samples for 30 min to ensure good penetration of the enzyme solution into the leaf strips to enhance digestion using a vacuum oven (model
5831, NAPCO Scientific Company, Oregon, USA). After vacuum infiltration, samples were left on the bench for 3 hours at room temperature for the digestion of cell walls. To stop the reaction, the digest solution was mixed with an equal volume of cold cell incubation medium
(W2) solution (4 mM MES, 0.4 M mannitol, 15 mM KCl, 10 mM CaCl 2, and 5 mM MgCl 2, adjusted to pH 5.7 with KOH). The mixture was filtered with 75 µm nylon mesh to separate released protoplasts from leaf strips. The filtered solution containing the protoplasts was collected in a fresh 50 mL falcon tube and centrifuged at 150 g for 2 min at 4 °C to pellet protoplasts. After removal of the supernatant, protoplasts were washed with 10 mL of cold W2 solution, followed by centrifugation at 150 g for 2 min at 4 °C to remove the residual digest solution.
To begin PEG mediated transformation, the protoplasts were resuspended in cold W2 buffer and 100 µL of protoplasts were mixed with 10 µg of a pair of plasmid DNA and 110 µL of 30 %
PEG solution (30 % PEG 4000, 0.2 M mannitol and 100 mM CaCl 2) at room temperature for 5 min. Since plasma membrane and DNA molecules are negative charges, divalent cations Ca 2+ in the solution are assumed to combine PEG and extracellular plasmid DNA with protoplast to improve absorption of the extracellular plasmid DNA in the plasma membrane and consequently PEG-linked plasmid DNA is taken up by endocytosis (Maas and Werr 1989,
Neumann et al. 1989). The reaction was stopped by adding of 400 μL of W2 buffer and protoplasts were collected by centrifugation at 200 g for 4 min at room temperature. 60
Transformed protoplasts were resuspended in 350 μL of W2 solution and incubated overnight
(for at least 16 hours) in the dark at 25 °C to allow the expression of the genes of interest before confocal microscopy was performed (Section 3.2.2.4).
3.3.2.4 Transient expression of AtCBLs-AtCIPK16 in Arabidopsis leaves using
Agro-infiltration
Pairs of 10 AtCBLs and AtCIPK16 in pGPTVII constructs were co-transformed into
A.tumefaciens AGL1 cells using the protocol described in Section 2.19.2. The protocol for
Agro-infiltration of Arabidopsis leaves was modified from the method described by Kim et al. (2009). Briefly, Agrobacterium cells containing pairs of pGPTVII.Bar. YN::AtCIPK16 and pGPTVII.Hyg.AtCBLx::YC or pGPTVII.Bar.AtCIPK16::YN and pGPTVII.Hyg. YC::AtCBLs vector (where x can be AtCBL1 to 10 ) were inoculated in 10 mL of YEP medium (Bacto trypton 10 g L -1, yeast extract 10 g L -1, NaCl 5 g L -1, pH 7.5), supplemented with rifampicin
(25 mg L -1) and kanamycin (50 mg L -1), and incubated at 28 °C with shaking at 200 rpm overnight. All cell cultures were diluted 10-fold with fresh YEP medium and grow at 28 °C
with shaking at 200 rpm until the cell density reached an OD 600 of 1.0. The cells were collected by centrifugation at 12000 g and resuspended in infiltration medium (0.5 % D-glucose, 10 mM
MES, 10 mM MgCl 2, 200 μM acetosyringone and 0.01 % Triton X-100) to an OD 600 of 0.6 prior to infiltration. The protocol described in Schob et al. (1997) was performed for infiltration of A.tumefaciens cell suspensions into the Arabidopsis leaves. Four-week-old hydroponics grown Arabidopsis ecotype Col-0 (as described in Section 2.4) were used as plant materials for Agro-infiltration. For co-expressing various pairs of two genes (At CIPK16 and an
AtCBL ), two Agrobacterium cell suspensions which containing the required binary constructs were mixed in equal volumes prior to infiltration. Pre-mixed 0.3 mL of Agrobacterium cell suspension was injected into the abaxial side of the fully expanded leaves of four-week-old
Arabidopsis with 1 mL needless syringe (Terumo, Tokyo, Japan). For each sample, six injections were performed on each side of the leaf vein on three leaves of individual plant.
After infiltration, the transformed plants were covered with a transparent polyethylene film and incubated at 23 °C for 24 hours in the dark to maintain high humidity. After one day, the film was removed and the transformed plants were then kept in short day growth room (light/dark
61 period: 10h/14h, temperature: 23 °C, light intensity: 100 μmol m -2 s-1, 60-75 % humidity) for
4-5 days to allow the expression of AtCBLs-AtCIPK16 before harvesting leaf material for visualisation by confocal.
3.3.2.5 Transient expression of AtCBLs-AtCIPK16 in tobacco leaves ( Nicotiana benthamiana) using Agro-infiltration
Although the effort was spent on optimizing the plant growth conditions of Arabidopsis for high efficiency transformation, the results of Agro-infiltration in Arabidopsis were quite variable from one experiment to another. Therefore, tobacco leaves ( Nicotiana benthamiana) was employed as plant materials for transient expression of AtCBLs-AtCIPK16.
Pairs of 10 AtCBLs and AtCIPK16 in pGPTVII constructs were co-transformed into
A.tumefaciens AGL1 cells using the protocol adapted from Kapila et al .(1997) and Wydro et al.
(2006). Briefly, Agrobacterium cells containing a variety of pairs of pGPTVII.Bar.YN::
AtCIPK16 and pGPTVII.Hyg.AtCBLx::YC or pGPTVII.Bar.AtCIPK16::YN and pGPTVII.Hyg.
YC::AtCBLs vector (where x can be AtCBL1 to 10) were respectively inoculated in 2 mL of LB media, supplemented with rifampicin (25 mg L -1) and kanamycin (50 mg L -1), and incubated at
28 °C with shaking at 200 rpm for 48 h. A volume of 200 μL of each culture was spread on a different plate (LB agar supplemented with 25 mg L -1rifampicin and 50 mg L -1 kanamycin) and incubated at 28 °C for 48 h. Agrobacterium cells on the various plates was harvested by
-1 -1 adding 4 mL MMA solution (10 mM L MgCl 2, 10 mM L MES (2-[N-morpholino] ethanesulfonic acid, Cat.# M5287, Sigma-Aldrich, Castle Hill, Australia) and 100 μM L-1 acetosyringone) and scrapped with a p1000 pipette tip. The liquid culture from each plate was poured into a 10 mL tube respectively. Each collected mixture was measured by an ND-1000
spectrophotometer (NanoDrop Technologies Inc.) and diluted with MMA solution to an OD 600 of 1.0 and followed by incubation at room temperature for 3 h without shaking.
The mixtures containing pairs of AtCBLs-AtCIPK16 were aspirated into a 1 mL needless syringe (Terumo, Tokyo, Japan) and injected into the abaxial side of the third and fourth leaves of different six-week-old tobacco until saturated. After infiltration, the transformed tobacco 62 plants were then kept in short day growth room (light/dark period: 10h/14h, temperature:
23 °C, light intensity: 100 μmol m -2 s-1, 60-75 % humidity) for 3-4 days to allow the expression of AtCBLs-AtCIPK16 before harvesting leaf material for visualisation by confocal.
3.3.2.6 Stable constitutive over-expression of AtCBLs-AtCIPK16 in Arabidopsis ecotype Col-0 The limitation of mesophyll protoplast system and the leaf Agro-infiltration method is that it can be used to investigate the localisation of AtCBLs-AtCIPK16 in leaf tissue instead of root tissue where AtCIPK16 is mainly expressed. The interactions seen between AtCIPK16 and other CBLs may not therefore reflect what is happening in root tissue. Therefore, to eliminate the artefact pairs of AtCBLs-AtCIPK16 were constitutively over-expressed in Arabidopsis ecotype Col-0 using the pGPTVII vector (Figure 3.5) and Agrobacterium-mediated floral dipping method.
Pairs of constructs containing AtCBLs/AtCIPK16 were transformed into ecotype Col-0 by
Agrobacterium-mediated floral dipping (Section 2.19). Ecotype Col-0 plants were grown in soil as per Section 2.3. Selected plants were dipped into the floral dipping mixture for 30 s and covered with cling wrap (Woolworth, Australia) to maintain a high humidity. Dipped plants were kept in the same growth condition but in the dark for 24 h and then placed back in a long day growth room (light/dark period: 16h/8h, temperature: 23 °C day/21 °C night, light intensity: 100 μmol m -2 s-1, 60-75 % humidity) for 4 weeks to allow seed to mature for collection. Seeds were harvested as per Section 2.3.
For screening the positive transgenic plants, the protocol described in Section 2.20 was used for antibiotic selection. To select for plants containing the pGPTVII.Bar.YN::AtCIPK16 or pGPTVII.Bar. AtCIPK16::YN constructs, which harbour a bar gene that confers resistance to the glufosinate herbicide (Basta), selection was performed in soil (Section 2.20.1). Genomic
DNA was extracted from the leaves of positive transgenic plants (Section 2.6) and a PCR
(Section 2.12.1) was performed using the primers listed in Table 3.3 to confirm the presence or absence of the transgene ( YN::AtCIPK16 or AtCIPK16::YN ) had been inserted. Once the
63 presence of the inserted AtCIPK16 was confirmed, transgenic plants were grown for seed collection. As plants co-transformed with other constructs ( pGPTVII.Hyg.YC::AtCBLs or pGPTVII. Hyg. AtCBLs::YC ) harbouring a hptII gene that confers resistance to the antibiotic
Hygromycin. Seeds were then screened on MS plates (Section 2.20.2). Genomic DNA was extracted from leaves of positive transgenic plants (Section 2.6) and a PCR (Section 2.12.1) was performed using the primers listed in Table 3.3 to genotype the plants and confirm the presence of the inserted genes ( YC::AtCBLs or AtCBLs::YC ). Once the presence of the insertions was confirmed, the transgenic plants were used for visualisation the YFP in root tissue by confocal and grown for seed collection.
Table 3.3: Primers for genotyping the BiFC stable expressed Arabidopsis
Primers Sequence (5′- 3′) Tm*°C
N-YFP For ACGTAAACGGCCACAAGTTC 57.7
N-YFP Rev AAGTCGTGCTGCTTCATGTG 56.8
C-YFP For ACTTCAAGATCCGCCACAAC 57.3
C-YFP Rev GAACTCCAGCAGGACCATGT 56.9
*Primer T m was predicted by NetPrimer (http://www.premierbiosoft.com/netprimer/index.html)
3.3.2.7 Fluorescence imaging by confocal microscopy To determine the location of the interaction of fluorescently tagged AtCIPK16 and the different
AtCBLs in transiently expression in protoplasts, transiently expression in leaf cells or stably expressing Arabidopsis plants, confocal laser scanning microscopy was used. A Zeiss
Axioskop 2 MOT plus LSM5 PASCAL , equipped with an argon laser (Carl Zeiss, Jena,
Germany) was used to identify the cellular location of YFP in the cell, using the following settings: YFP fluorescence (excitation: 514 nm; emission bandpass: 570-590 nm) and propidium iodide/chlorophyll autofluorescence (excitation: 543 nm; emission longpass: 560 nm). The false colour images were analysed using LSM5 Image Examiner (Carl Zeiss, Jena,
Germany).
64
3.4 Results
3.4.1 Vector construction for a yeast two hybrid assay
To identify which of the 10 AtCBLs interact with AtCIPK16, a large number of vectors (Table
3.4 and Figure 3.6) were constructed to perform yeast two hybrid assays. The bait, AtCIPK16 , was expressed in the construct ( pTOOL27 ), fused to a sequence encoding a DNA-binding domain. The 10 AtCBL prey genes were expressed in the prey construct ( pTOOL28 ) fused to a sequence encoding a Gal4 activation domain.
Table 3.4: Summary of entry vectors and destination vectors constructed for yeast two hybrid assay. Information includes the vector source, species the vectors are used to transform and antibiotic resistance gene for bacterial transformation. ys = with the stop codon
Entry vectors/ Destination Selection in Species transformed vectors Bacteria pcR8/GW/TOPO TA + E.coli Spec AtCIPK16 (ys) pcR8/GW/TOPO TA + AtCBL1 (ys) E.coli Spec pcR8/GW/TOPO TA+ AtCBL2 (ys) E.coli Spec pcR8/GW/TOPO TA + AtCBL3 (ys) E.coli Spec pcR8/GW/TOPO TA + AtCBL4 (ys) E.coli Spec pcR8/GW/TOPO TA + AtCBL5 (ys) E.coli Spec pcR8/GW/TOPO TA + AtCBL6 (ys) E.coli Spec pcR8/GW/TOPO TA + AtCBL7 (ys) E.coli Spec pcR8/GW/TOPO TA + AtCBL8 (ys) E.coli Spec pcR8/GW/TOPO TA + AtCBL9 (ys) E.coli Spec pcR8/GW/TOPO TA + AtCBL10 (ys) E.coli Spec pTOOL28 + AtCBL1 (ys) S. cerevisiae Amp pTOOL28 + AtCBL2 (ys) S. cerevisiae Amp pTOOL28 + AtCBL3(ys) S. cerevisiae Amp pTOOL28 + AtCBL4(ys) S. cerevisiae Amp pTOOL28 + AtCBL5(ys) S. cerevisiae Amp pTOOL28 + AtCBL6(ys) S. cerevisiae Amp pTOOL28 + AtCBL7(ys) S. cerevisiae Amp pTOOL28 + AtCBL8(ys) S. cerevisiae Amp pTOOL28 + AtCBL9(ys) S. cerevisiae Amp pTOOL27 + AtCIPK16(ys) S. cerevisiae Kan
65
A B
Figure 3.6: pTOOL28 + AtCBL1 to 10 and pTOOL27 + AtCIPK16 A, the destination vector containing 1 of 10 AtCBL genes fused to a sequence containing the Gal4 activation domain. B, plasmids constructed for fusion of the DNA-binding domain to AtCIPK16. For detail description of pTOOL27 and pTOOL28 vectors see the legend of Figure 3.1 and Figure 3.2.
66
3.4.2 Yeast two hybrid assay shows AtCIPK16 interacts with 6 AtCBL proteins To determine which of the 10 AtCBL proteins AtCIPK16 interacts with, a yeast two hybrid assay was performed. AtCIPK16 was found to interact with 6 of the 10 AtCBL proteins.
AtCIPK16 was found to interact strongly with AtCBL4 and AtCBL5; moderately with
AtCBL2 and AtCBL9; and weakly with AtCBL1 and AtCBL10 (Figure 3.7). In contrast,
AtCIPK16 did not interact with AtCBL3, AtCBL6, AtCBL7 and AtCBL8 (Figure 3.7). Similar growth of all yeast samples were observed on the control SD (-Leu/-Trp) plates (Figure 3.7).
Figure 3.7: Yeast two hybrid assay showing AtCIPK16 interacts with 6 AtCBL proteins -1 -2 -3 10-fold serial dilutions (OD 600 =1, 10 , 10 , 10 ) of yeast sample harbouring a DNA-binding domain (BD)-AtCIPK16 and either an activation domain (AD)-AtCBLs or an empty vector (AD) were grown on selection DDO (SD/-Leu/-Trp) and QDO (SD/-Leu/-Trp/-His/-Ade) media. Both DDO and QDO selection plates were incubated at 30 °C for 6 days to allow the yeast to grow.
67
3.4.3 Vector construction for Bimolecular Fluorescence Complementation (BiFC) assay in
Arabidopsis mesophyll protoplast
To verify the interaction between the 10 different AtCBLs and AtCIPK16, as well as identify the subcellular localisation of the interaction, the full-length coding sequences of AtCBL1 to 10
(without their stop codons) were cloned into the Gateway entry vector pCR8/GW/TOPO-TA
(Table 3.5). After confirming sequence integrity and orientation, the transgene was transferred by LR to the expression vector pUC-SPYCE/GW , which places the CBL gene in front of a sequence encoding the C-terminal fragment of the fluorescent protein YFP (Table 3.5, Figure
3.8 A). The full-length coding sequence of AtCIPK16 (without the stop codon) was cloned into the Gateway entry vector pCR8/GW/TOPO-TA . After confirming sequence integrity and orientation, the transgene was transferred by LR to pUC-SPYNE/GW fusing the AtCIPK16 sequence with a sequence encoding the N-terminal fragment of YFP (Table 3.5, Figure 3.8 B).
68
Table 3.5: Summary of entry vectors and destination vectors constructed for transient expression of CIPK16 and CBL genes in mesophyll protoplast using BiFC assay. Information includes the species the vectors are used to transform and antibiotic resistance gene for bacteria (Bact.) transformation. ns = without the stop codon
Entry plasmids/ Destination plasmids Species transformed Selection in Bacteria
pcR8/GW/TOPO TA + AtCIPK16 (ns) E.coli Spec pcR8/GW/TOPO TA + AtCBL1 (ns) E.coli Spec pcR8/GW/TOPO TA+ AtCBL2 (ns) E.coli Spec pcR8/GW/TOPO TA + AtCBL3 (ns) E.coli Spec pcR8/GW/TOPO TA + AtCBL4 (ns) E.coli Spec pcR8/GW/TOPO TA + AtCBL5 (ns) E.coli Spec pcR8/GW/TOPO TA + AtCBL6 (ns) E.coli Spec pcR8/GW/TOPO TA + AtCBL7 (ns) E.coli Spec pcR8/GW/TOPO TA + AtCBL8 (ns) E.coli Spec pcR8/GW/TOPO TA + AtCBL9 (ns) E.coli Spec pcR8/GW/TOPO TA + AtCBL10 (ns) E.coli Spec
pUC-SPYCE/GW + AtCBL1 (ns) plant Amp pUC-SPYCE/GW + AtCBL2 (ns) plant Amp pUC-SPYCE/GW + AtCBL3 (ns) plant Amp pUC-SPYCE/GW + AtCBL4 (ns) plant Amp pUC-SPYCE/GW + AtCBL5 (ns) plant Amp pUC-SPYCE/GW + AtCBL6 (ns) plant Amp pUC-SPYCE/GW + AtCBL7 (ns) plant Amp pUC-SPYCE/GW + AtCBL8 (ns) plant Amp pUC-SPYCE/GW + AtCBL9 (ns) plant Amp pUC-SPYCE/GW + AtCBL10 (ns) plant Amp pUC-SPYNE/GW + AtCIPK16 (ns) plant Amp
69
A B
Figure 3.8: The pUC-SPYCE/GW+ AtCBL1 to 10 and pUC-SPYNE/GW+ AtCIPK16 plasmids used for subcellular localisation in a mesophyll protoplast expression system A, plasmids constructed for fusion of the C-terminal fragment of YFP to the C-terminus of the 10 different AtCBL proteins B, plasmids constructed for fusion of the N-terminal fragment of YFP to the C-terminus of AtCIPK16; pUC-SPYNE+ AtCIPK16 For detail description of pUC-SPYCE/GW and pUC-SPYNE/GW vectors see the legend of Figure 3.3 and Figure 3.4.
70
3.4.4 Bimolecular fluorescent complementation (BiFC) assay in Arabidopsis mesophyll protoplast
Yeast two hybrid assays are a well-established technique for identifying protein-protein interactions in a high-throughput screen (Chini 2014, Fang et al. 2002, Singh et al. 2012).
Yeast two hybrid assays, however, can produce a high rate of false positives and negatives, therefore verification of results by a different technique is required (Berendzen et al. 2012,
Ferro and Trabalzini 2013). The bimolecular fluorescent complementation (BiFC) assay was utilised as an alternative in planta approach to visualise of the interaction between AtCIPK16 and the 10 AtCBLs (Berendzen et al. 2012, Ferro and Trabalzini 2013, Waadt et al. 2008).
Transient co-expression of individual AtCBLs::YC with AtCIPK16::YN was carried out in
Arabidopsis mesophyll protoplasts isolated from 4 weeks old leaves. Representative images of protoplast transformed with each combination of AtCBL::YC+AtCIPK16::YN are shown in
Figure 3.9. YFP fluorescence was observed mainly in the nucleus, the cytoplasm and possibly on the plasma membrane of protoplasts co-expressing AtCBL1::YC+AtCIPK16::YN (Figure
3.9 A), AtCBL2::YC+AtCIPK16::YN (Figure 3.9 B), AtCBL3::YC+AtCIPK16::YN (Figure 3.9
C), AtCBL5::YC+AtCIPK16::YN (Figure 3.9E). The protoplasts co-expressing
AtCBL4::YC+AtCIPK16::YN (Figure 3.9 D), AtCBL9::YC+ AtCIPK16::YN (Figure 3.9 I),
AtCBL10::YC+AtCIPK16::YN (Figure 3.9 J) showed strong fluorescence in the cytoplasm and possibly on the plasma membrane. However, no fluorescence was observed from protoplasts co-expressing other combinations of AtCBLs::YC+AtCIPK16::YN (Figure 3.9 F, G, H).
Protoplasts which co-expressed AtCBL1::YC+AtCIPK16::YN, AtCBL2::YC+AtCIPK16::YN,
AtCBL3::YC+AtCIPK16::YN and AtCBL5::YC+AtCIPK16::YN showed much higher fluorescence in the nucleus (Figure 3.9 A, B, C and E) than other pairs of AtCBLs-AtCIPK16
(Figure 3.9 D, I and J).
71
A
AtCBL1::YC+AtCIPK16::YN Bright Field Merged
B
AtCBL2::YC+AtCIPK16::YN Bright Field Merged
C
AtCBL3::YC+AtCIPK16::YN Bright Field Merged
D
AtCBL4::YC+AtCIPK16::YN Bright Field Merged
E
AtCBL5::YC+AtCIPK16::YN Bright Field Merged
72
F
AtCBL6::YC+AtCIPK16::YN Bright Field Merged
G
AtCBL7::YC+AtCIPK16::YN Bright Field Merged
H
AtCBL8::YC+AtCIPK16::YN Bright Field Merged
I
AtCBL9::YC+AtCIPK16::YN Bright Field Merged
J
AtCBL10::YC+AtCIPK16::YN Bright Field Merged Figure 3.9: Subcellular localisation of AtCBLs::YC and AtCIPK16::YN interactions in Arabidopsis mesophyll protoplasts. Images of Arabidopsis mesophyll protoplasts co-transformed with Agrobacterium carrying different AtCBLs::YC (C-terminal fragment of YFP fused to C-terminus of AtCBLs) and AtCIPK16::YN (N-terminal fragment of YFP fused to C-terminus of AtCIPK16) constructs.
73
Co-transformed protoplasts were visualised using confocal microscopy and YFP fluorescence was captured using the wavelengths: excitation, 514 nm; emission, 525–538 nm. (A-J) Representative protoplast transformed with each combination of AtCBL::YC+AtCIPK16::YN . The images in the first column show YFP fluorescence in the cell, the images in the second column show the bright field image of the cell and the third column is a merged image of the YFP fluorescence and bright field of the cell, scale bar = 10 µM.
74
3.4.5 Vector construction for a Bimolecular Fluorescence Complementation (BiFC) assay using either Agro-infiltration of Arabidopsis and tobacco leaves, or stable expression in
Col-0
To further confirm the subcellular localisation of AtCBL-AtCIPK16 complexes, the full-length coding sequences of AtCBL1 to 10 (with and without the stop codon) were cloned into the
Gateway entry vector pCR8/GW/TOPO-TA . An LR was used to transfer the AtCBLs (with the stop codon) into pGPTVII.Hyg.YC::GW which generates protein with the C-terminal fused to
N-terminus of AtCBLs (Figure 3.10 B) or transfer the AtCBL (without the stop codon) into the destination vectors pGPTVII.Hyg.GW::YC which generates a CBL protein with the C-terminal of YFP fused to it (Figure 3.10 A). By using same process, the full-length coding sequence of
AtCIPK16 (either with or without the stop codon) was used to generate the protein with the
N-terminal of YFP fused to either N-terminus or C-terminus of AtCIPK16 (Figure 3.10 C, D).
Construction of both N-terminal and C-terminal YFP fusion constructs not only allows the confirmation and location of AtCIPK16 and AtCBL interactions but can also be used to observe whether the addition of a YFP fragment at C-terminal or N-terminal of protein, blocks either the interaction of the two proteins or it affects the signalling region which result in incorrect location of CBL-CIPK complexes. The entry plasmids and destination plasmids listed in Table 3.6 were constructed for transient expression in Arabidopsis and tobacco leaves, using Agro-infiltration, and for stable expression in ecotype Col-0.
75
Table 3.6: Summary of entry vectors and destination vectors constructed for transient expression in Arabidopsis and tobacco leaves or for stable expression in Col-0. Table shows the species the vectors are used to transform and the antibiotic resistance gene for bacteria, the antibiotic resistance gene for plant transformation. Ys = with the stop codon, ns = without the stop codon.
Entry plasmids/ Destination Species Selection in Selection in plasmids transformed Plant Bacteria Entry plasmids were listed in Table 3.4 and Section Table 3.5 pGPTVII.Hyg.YC::AtCBL1(ys) plants Hyg Kan pGPTVII.Hyg.YC::AtCBL2(ys) plants Hyg Kan pGPTVII.Hyg.YC::AtCBL3(ys) plants Hyg Kan pGPTVII.Hyg.YC::AtCBL4(ys) plants Hyg Kan pGPTVII.Hyg.YC::AtCBL5(ys) plants Hyg Kan pGPTVII.Hyg.YC::AtCBL6(ys) plants Hyg Kan pGPTVII.Hyg.YC::AtCBL7(ys) plants Hyg Kan pGPTVII.Hyg.YC::AtCBL8(ys) plants Hyg Kan pGPTVII.Hyg.YC::AtCBL9(ys) plants Hyg Kan pGPTVII.Hyg.YC:: AtCBL10(ys) plants Hyg Kan pGPTVII.Hyg. AtCBL1(ns)::YC plants Hyg Kan pGPTVII.Hyg. AtCBL2(ns)::YC plants Hyg Kan pGPTVII.Hyg. AtCBL3(ns)::YC plants Hyg Kan pGPTVII.Hyg. AtCBL4(ns)::YC plants Hyg Kan pGPTVII.Hyg. AtCBL5(ns)::YC plants Hyg Kan pGPTVII.Hyg. AtCBL6(ns)::YC plants Hyg Kan pGPTVII.Hyg. AtCBL7(ns)::YC plants Hyg Kan pGPTVII.Hyg. AtCBL8(ns)::YC plants Hyg Kan pGPTVII.Hyg. AtCBL9(ns)::YC plants Hyg Kan pGPTVII.Hyg. AtCBL10(ns)::YC plants Hyg Kan pGPTVII.Bar.YN::AtCIPK16(ys) plants Basta Kan pGPTVII.Bar. AtCIPK16(ns)::YN plants Basta Kan
76
Figure 3.10: pGPTVII.Hyg. AtCBL1 (to 10)::YC, pGPTVII.Hyg.YC::AtCBL1 (to 10), pGPTVII. Bar.AtCIPK16::YN and pGPTVII.Bar. YN::AtCIPK16 plasmids used for Agro-infiltration and stable expression in Col-0 (A) Plasmids constructed for fusion of the C-terminal fragment of YFP to the C-terminus of one of the 10 AtCBL proteins; pGPTVII.Hyg.AtCBL1ns (to 10ns)::YC (B) Plasmids constructed for fusion of the C-terminal fragment of YFP to the N-terminus of one of the 10 AtCBL proteins respectively; pGPTVII.Hyg. YC::AtCBL1ys (to 10ys) (C) Plasmids constructed for fusion of the N-terminal fragment of YFP to the C-terminus of AtCIPK16; pGPTVII.Bar. AtCIPK16ns::YN (D) Plasmids constructed for fusion of the N-terminal fragment of YFP to the N-terminus of AtCIPK16; pGPTVII.Bar. YN::AtCIPK16ys For detail description of pGPTVII.Hyg.GW::YC, pGPTVII.Hyg.YC::GW, pGPTVII.Bar.GW::YN and pGPTVII.Bar.YN::GW vectors see the legend of Figure 3.4
77
3.4.6 Subcellular localisation using Agro-infiltration in Arabidopsis leaves
Due to a number of issues with the protoplast system, such as working with isolated protoplasts which have had their cell walls digested and that YFP was only fused to the
C-terminus of the proteins, potentially blocking the signalling region of AtCIPK16, a BiFC assay was performed in intact plant cells. These cells were either transformed directly by injecting Agrobacteria on to the leaf surface or by generating plants stably expressing split
YFP CIPK16/CBL constructs. Four binary vectors ( pGPTVII.Hyg.GW::YC, pGPTVII.Hyg.
YC::GW, pGPTVII.Bar.GW::YN and pGPTVII.Bar.YN::GW were used for Agro-infiltration and stable expression to confirm the subcellular localisation of AtCBLs-AtCIPK16 complexes.
A total of 40 combinations of 10 AtCBLs and AtCIPK16 were transiently co-transformed in
Arabidopsis leaves by Agro-infiltration. Figure 3.11-3.14 showed YFP complex formation of various combinations of YC::AtCBLs/AtCBLs::YC and YN::AtCIPK16/AtCIPK16::YN. For comparison of the interaction and location of various CBL-CIPKs, all results are summarised in Table 3.7. The leaves co-transformed with AtCBL1-AtCIPK16, AtCBL2-AtCIPK16,
AtCBL4-AtCIPK16 and AtCBL9-AtCIPK16 showed high fluorescence in different cellular locations (Table 3.7, Figure 3.11-3.14).
The formation AtCBL1::YC+AtCIPK16::YN complex (Figure 3.14A) showed fluorescence in the cytoplasm while other three combinations between AtCBL1 and AtCIPK16 were negative
(Figure 3.11A, 3.12A, 3.13A). Leaves co-transformed with AtCBL2-AtCIPK16 showed high fluorescence in the cytoplasm and possibly on the plasma membrane (Figure 3.11 B, 3.12 B,
3.13 B and 3.14 B). Arabidopsis leaves inoculated with AtCBL4::YC+YN::AtCIPK16,
AtCBL4::YC+AtCIPK16::YN and YC::AtCBL4+AtCIPK16::YN exhibited YFP fluorescence in the cytoplasm and possibly at the plasma membrane (Figure 3.11 D, 3.12D, 3.14D). The leaves co-expressing combinations of AtCBL9 and AtCIPK16 (AtCBL9:: YC+YN:: AtCIPK16,
YC::AtCBL9+AtCIPK16::YN and AtCBL9::YC+AtCIPK16::YN) exhibited fluorescence in the cytoplasm and possibly at the plasma membrane (Figure 3.11 I, 3.13 I and 3.14 I), while the leaves co-expressing of YC::AtCBL9 and YN::AtCIPK16 showed fluorescence at possibly on the plasma membrane (Figure 3.12 I). No clear fluorescent signal was observed in the leaves 78 co-expressing other 28 combinations.
Table 3.7 Summary of AtCIPK16–AtCBL interactions and their cellular location in Arabidopsis leaves using Agro-infiltrations with various vector pairs Information includes the pairs of vectors were used for Agro-infiltration, cellular location and figures. YC= the C-terminal fragment of YFP; YN= the N-terminal fragment of YFP, PM= plasma membrane. Table was summarised from Figure 3.11-3.14.
AtCBL-YC+ YC-AtCBL+ YC-AtCBL+ AtCBL-YC+ combination YN-AtCIPK16 YN-AtCIPK16 AtCIPK16-YN AtCIPK16-YN
AtCIPK16 with negative negative negative cytoplasm AtCBL1
AtCIPK16 with cytoplasm cytoplasm, PM PM cytoplasm, PM AtCBL2
AtCIPK16 with negative negative negative negative AtCBL3
AtCIPK16 with PM, cytoplasm cytoplasm negative PM, cytoplasm AtCBL4
AtCIPK16 with negative negative negative negative AtCBL5
AtCIPK16 with negative negative negative negative AtCBL6
AtCIPK16 with negative negative negative negative AtCBL7
AtCIPK16 with negative negative negative negative AtCBL8
AtCIPK16 with PM, cytoplasm PM cytoplasm, PM PM, cytoplasm AtCBL9
AtCIPK16 with negative negative negative negative AtCBL10
79
YFP Bright Field Merged A YN::AtCIPK16+AtCBL1::YC
B YN::AtCIPK16+AtCBL2::YC
C YN::AtCIPK16+AtCBL3::YC
D YN::AtCIPK16+AtCBL4::YC
E YN::AtCIPK16+AtCBL5::YC
F YN::AtCIPK16+AtCBL6::YC
G YN::AtCIPK16+AtCBL7::YC
H YN::AtCIPK16+AtCBL8::YC
80
YFP Bright Field Merged I YN::AtCIPK16+AtCBL9::YC
J YN::AtCIPK16+AtCBL10::YC
Figure 3.11 YN::AtCIPK16 and AtCBLs::YC interactions in Arabidopsis leaves Images of Arabidopsis leaf with co-infiltration of different pairs of YN::AtCIPK16 and AtCBLs::YC constructs. Leaves were visualised using confocal microscopy and YFP fluorescence was captured using the wavelengths: excitation, 514 nm; emission, 525–538 nm. (A-J) Images of Arabidopsis leaves with co-transformed with each pair of AtCBLs::YC and YN::AtCIPK16 . The images in the first column show YFP fluorescence in leaves, the images in the second column show the bright field of leaves and the third column is a merged image of the YFP fluorescence and bright field of leaves. Scale bar = 20 µM.
81
YFP Bright Field Merged A YN::AtCIPK16+YC::AtCBL1
B YN::AtCIPK16+YC::AtCBL2
C YN::AtCIPK16+YC::AtCBL3
D YN::AtCIPK16+YC::AtCBL4
E YN::AtCIPK16+YC::AtCBL5
F YN::AtCIPK16+YC::AtCBL6
G YN::AtCIPK16+YC::AtCBL7
H YN::AtCIPK16+YC::AtCBL8
82
YFP Bright Field Merged I YN::AtCIPK16+YC::AtCBL9
J YN::AtCIPK16+YC::AtCBL10
Figure 3.12 YN::AtCIPK16 and YC::AtCBLs interactions in Arabidopsis leaves Images of Arabidopsis leaf with co-infiltration of different pairs of YN::AtCIPK16 and YC::AtCBLs constructs. Leaves were visualised using confocal microscopy and YFP fluorescence was captured using the wavelengths: excitation, 514 nm; emission, 525–538 nm. (A-J) Images of Arabidopsis leaves with co-transformed with each pair of YC::AtCBLs and YN::AtCIPK16 . The images in the first column show YFP fluorescence in leaves, the images in the second column show the bright field of leaves and the third column is a merged image of the YFP fluorescence and bright field of leaves. Scale bar = 20 µM.
83
YFP Bright Field Merged AtCIPK16::YN+YC::AtCBL1 A
B AtCIPK16::YN+YC::AtCBL2
C AtCIPK16::YN+YC::AtCBL3
D AtCIPK16::YN+YC::AtCBL4
E AtCIPK16::YN+YC::AtCBL5
F AtCIPK16::YN+YC::AtCBL6
G AtCIPK16::YN+YC::AtCBL7
H AtCIPK16::YN+YC::AtCBL8
84
YFP Bright Field Merged I AtCIPK16::YN+YC::AtCBL9
J AtCIPK16::YN+YC::AtCBL10
Figure 3.13 AtCIPK16::YN and YC::AtCBLs interactions in Arabidopsis leaves Images of Arabidopsis leaf with co-infiltration of different pairs of AtCIPK16::YN and YC::AtCBLs constructs. Leaves were visualised using confocal microscopy and YFP fluorescence was captured using the wavelengths: excitation, 514 nm; emission, 525–538 nm. (A-J) Images of Arabidopsis leaves with co-transformed with each pair of YC::AtCBLs and AtCIPK16::YN . The images in the first column show YFP fluorescence in leaves, the images in the second column show the bright field of leaves and the third column is a merged image of the YFP fluorescence and bright field of leaves. Scale bar = 20 µM.
85
YFP Bright Field Merged A AtCIPK16::YN+AtCBL1::YC
B AtCIPK16::YN+AtCBL2::YC
C AtCIPK16::YN+AtCBL3::YC
D AtCIPK16::YN+AtCBL4::YC
E AtCIPK16::YN+AtCBL5::YC
F AtCIPK16::YN+AtCBL6::YC
G AtCIPK16::YN+AtCBL7::YC
H AtCIPK16::YN+AtCBL8::YC
86
YFP Bright Field Merged I AtCIPK16::YN+AtCBL9::YC
J AtCIPK16::YN+AtCBL10::YC
Figure 3.14 AtCIPK16::YN and AtCBLs::YC interactions in Arabidopsis leaves Images of Arabidopsis leaf with co-infiltration of different pairs of AtCIPK16::YN and AtCBLs::YC constructs. Leaves were visualised using confocal microscopy and YFP fluorescence was captured using the wavelengths: excitation, 514 nm; emission, 525–538 nm. (A-J) Images of Arabidopsis leaves with co-transformed with each pair of AtCBLs::YC and AtCIPK16::YN . The images in the first column show YFP fluorescence in leaves, the images in the second column show the bright field of leaves and the third column is a merged image of the YFP fluorescence and bright field of leaves. Scale bar = 20 µM.
87
3.4.7 Subcellular localisation using Agro-infiltration in tobacco leaves
Previous studies indicated that the transient expression by Agro-infiltration in Arabidopsis is not as efficient as in Nicotiana benthamiana (Kim et al. 2009, Wroblewski et al. 2005, Xu et al.
2014). Therefore, tobacco leaves were used for transiently transforming with split YFP constructs to further observe the subcellular localisation of AtCBLs-AtCIPK16 complexes.
Due to time constraint, only 10 combinations of AtCBL::YC and YN::AtCIPK16 were transiently co-expressed in tobacco leaves for BiFC. YFP fluorescence in the nucleus and possibly at the plasma membrane was observed for AtCBL1-AtCIPK16, AtCBL4-AtCIPK16,
AtCBL5-AtCIPK16 and AtCBL9-AtCIPK16 (Figure 3.15A, D, E and I). AtCBL2-AtCIPK16 and AtCBL10-AtCIPK16 complexes were observed in the cytoplasm and nucleus (Figure 3.15
B and J), while AtCBL3-AtCIPK16 was observed in the cytoplasm (Figure 3.15 C). No clear fluorescent signal was observed for AtCBL6-AtCIPK16, AtCBL7-AtCIPK16 and
AtCBL8-AtCIPK16 complexes (Figure 3.15 F, G and H).
88
YFP Bright Field Merged A YN::AtCIPK16+AtCBL1::YC
B YN::AtCIPK16+AtCBL2::YC
C YN::AtCIPK16+AtCBL3::YC
D YN::AtCIPK16+AtCBL4::YC
E YN::AtCIPK16+AtCBL5::YC
F YN::AtCIPK16+AtCBL6::YC
G YN::AtCIPK16+AtCBL7::YC
H YN::AtCIPK16+AtCBL8::YC
89
YFP Bright Field Merged
YN::AtCIPK16+AtCBL9::YC I
J YN::AtCIPK16+AtCBL10::YC
Figure 3.15 YN :: AtCIPK16 and AtCBLs :: YC interactions in tobacco leaves (Nicotiana benthamiana) Images of tobacco leaf with co-infiltration of different pairs of YN::AtCIPK16 and AtCBLs::YC constructs. Leaves were visualised using confocal microscopy and YFP fluorescence was captured using the wavelengths: excitation, 514 nm; emission, 525–538 nm. (A-J) Images of tobacco leaves with co-transformed with each pair of AtCBLs::YC and YN::AtCIPK16 . The images in the first column show YFP fluorescence in leaves, the images in the second column show the bright field of leaves and the third column is a merged image of the YFP fluorescence and bright field of leaves. Scale bar = 50 µM.
90
3.4.8 Localisation of AtCBLs-AtCIPK16 complexes using stable expression in
Arabidopsis ecotype Col-0
AtCIPK16 is predominately found in root tissue (Roy et al. 2013), therefore transient expression of AtCIPK16 with different AtCBLs in leaf protoplasts or in leaf cells may not be the best system to confirm which AtCIPK16/CBL interactions occur naturally and at what intracellularlocation. To eliminate this potential artefact, stable expression of different combinations of AtCBLs and AtCIPK16 fused to split YFP constructs were stably expressed in
Arabidopsis. All 10 AtCBLs were fused with a C-terminal fragment of YFP on either the
CBL’s C-terminus or N-terminus (pGPTVII.Hyg.AtCBL::YC, pGPTVII.Hyg.YC::AtCBL ) and were stably over expressed along with AtCIPK16 which had the N-terminal fragment of YFP fused to either AtCIPK16’s C-terminus or N-terminus (pGPTVII.Bar.AtCIPK16::YN, pGPTVII.Bar.YN::AtCIPK16 ). The 35s promoter was used to drive constitutive expression of both constructs. Roots of double transformed plants were examined for the subcellular localisation of CBL-CIPK complexes. Unfortunately, observation of distinct signal of YFP fluorescence in the roots T1 plants for all combinations was unsuccessful during the available time (Figure 3.16). Given more time a thorough characterisation of T 2 plants would have been performed.
91
Figure 3.16: Co-expression of different AtCBLs / AtCIPK16 split YFP constructs in Arabidopsis ecotype Col-0 Images of Arabidopsis roots with stable co-expression of different AtCBLs::YC (pGPTVII.Hyg. AtCBL::YC)/YC::AtCBL(pGPTVII.Hyg.YC::AtCBL) with AtCIPK16::YN (pGPTVII.Bar. AtCIPK16::YN)/YN::AtCIPK16 (pGPTVII.Bar.YN::AtCIPK16). The roots of plants co-transformed with two plasmids were visualised using confocal microscopy. Fluorescence of YFP (excitation: 514 nm; emission BP: 525–550 nm) and propidium iodide (excitation: 534 nm, emission LP: 560 nm) which is red and is staining the cells of the root. Scale bar = 10 µM.
92
3.5 Discussion
The capability of cells to transmit signals after perceiving an external stress thereby activating the appropriate response mechanism depends on sophisticated signalling networks. While some stress signalling pathways have been identified and characterised, such as the salt overly sensitive (SOS) pathway which is important in salt stress (Qiu et al. 2002, Quintero et al. 2011,
Shi et al. 2000, Yang et al. 2009); the CBL1/CBL9-CIPK23-AKT1 pathway important during low-K+ stress (Li et al. 2006, Xu et al. 2006); and the high pH-responsive signalling pathway
(Fuglsang et al. 2007), our current understanding of the mechanisms of other signal transduction pathways is poor and requires further investigation. For the CBL/CIPK signalling pathways, distinct cytosolic Ca 2+ signatures, which are generated by different abiotic and biotic stresses (Luan et al. 2002, Tracy et al. 2008), are perceived by a specific CBL which then recruits the required CIPK, forming a CBL-CIPK complex which targets the specific downstream effectors (Geiger et al. 2009, Held et al. 2011, Ho et al. 2009, Kudla et al. 2010,
Luan et al. 2002, Quintero et al. 2011, Quintero et al. 2002, Scrase-Field and Knight 2003, Xu et al. 2006). As AtCIPK16 has been found to be important during salt stress (Roy et al. 2013), this project investigated the interactions of AtCIPK16 with the 10 potential AtCBL partners to determine the upstream regulator of AtCIPK16 and the cellular localisation of the
AtCBL-AtCIPK16 complex. Knowledge of the location of these complexes will be the first step to explore the AtCIPK16 signalling pathway and its role in plant salinity tolerance.
3.5.1 Interacting partners of AtCIPK16 in yeast two hybrids
A yeast two hybrid assay showed that AtCIPK16 interacted moderately/strongly with AtCBL2,
AtCBL4, AtCBL5, AtCBL9 and interacted very weakly with AtCBL1 and AtCBL10 (Figure
3.7). In contrast, AtCIPK16 did not interact with AtCBL3, AtCBL6, AtCBL7 and AtCBL8
(Figure 3.7). AtCBL1 is a stress inducible gene and shown to be involved in salt, mannitol, K + transport, drought and cold stress (Cheong et al. 2003, Cheong et al. 2007). Over-expression of
AtCBL1 confers salt and drought tolerant but cold sensitive phenotype, while the loss-of-function mutations in AtCBL1 resulted in significant reduction in expression levels of
RD29A and RD29B under drought stress and cold tolerant but osmotic sensitive phenotype
(Cheong et al. 2003). AtCBL1 also has been implicated in interacting with AtCIPK23, 93 resulting in the phosphorylation of AKT1 (Arabidopsis K + Transporter 1) to regulate K + uptake in roots and K + transport in stomatal guard cells (Cheong et al. 2007). Co-expression of
AtCBL1 , AtCIPK23 and AKT1 can activate AKT1-mediated K + inward currents in oocytes
(Cheong et al. 2007), while an absence of AtCBL1 or AtCIPK23 led to inactivation of AKT1 and loss-of-function mutation confers K + deficiency sensitive phenotype in Arabidopsis
(Cheong et al. 2007). AtCBL4 is essential for tolerance to low-K+ by interacting with CIPK6 to mediate endoplasmic reticulum (ER)-plasma membrane (PM) translocation and activation of potassium channel AKT2 (Held et al. 2011); AtCBL4, also known as SOS3, which interacts with AtCIPK24 (SOS2) to phosphorylate SOS1 consequently to regulate the Na + efflux at the plasma membrane during salt stress (Guo et al. 2001, Halfter et al. 2000, Ishitani et al. 2000,
Kim et al. 2007, Kim et al. 2003b, Liu et al. 2000, Liu and Zhu 1998, Mahajan et al. 2008, Qiu et al. 2002, Qiu et al. 2004). Like AtCIPK16 both AtCBL1 and AtCBL4 are expressed in the root (Albrecht et al. 2001, Cheong et al. 2003, Guo et al. 2001, Halfter et al. 2000, Liu et al.
2000), suggesting AtCIPK16 may interact in planta with AtCBL1 and/or AtCBL4 as part of signalling pathways for AtCBL1- or AtCBL4-associated stresses.
AtCBL5 and AtCBL10 were also found to interact with AtCIPK16 in the Y2H system.
AtCBL5 has been shown as a positive regulator during salt or drought stresses (Cheong et al.
2010) and AtCBL10 has been implicated in controlling vacuolar loading of Na + during salt stress (Kim et al. 2007, Quan et al. 2007). However, as AtCBL5 and AtCBL10 are mainly expressed in shoots (Cheong et al. 2010, Kim et al. 2007) and AtCIPK16 is predominately expressed in roots (Roy et al. 2013), it is unlikely that interactions between AtCIPK16 and either AtCBL5 or AtCBL10 occur in the plant.
AtCBL2 is reported to be involved in the regulation of the pH homeostasis (Fuglsang et al.
2007), and AtCBL9 is involved in low-K+ (Cheong et al. 2007, Pandey et al. 2004). AtCBL9 has been implicated to interact with AtCIPK23 to phosphorylate the plasma membrane localised AKT1 (Cheong et al. 2007). As both AtCBL2 and AtCBL9 are expressed in whole plants (Hruz et al. 2008), it is possible that AtCBL2 and AtCBL9 can form an interaction with
AtCIPK16 in the roots, thereby potentially forming the AtCBL2/AtCBL9-AtCIPK16 94 complexes to regulate the pH homeostasis by phosphorylation of PM H +-ATPase or to control the K + uptake by phosphorylation of AKT1.
While the Y2H results here provide evidence for the potential AtCIPK16 and AtCBL interactions within a plant, they do not fully agree with previous studies which have reported some of the interactions of AtCIPK16 with some AtCBLs. Yeast two hybrid assays performed by Lee et al ., (2007) found AtCIPK16 moderately interacts with the AtCBL1, AtCBL2,
AtCBL3 and AtCBL9, weakly interacts with AtCBL4, while no interactions were observed with AtCBL5 and AtCBL10 (Lee et al. , 2007). Thus, both interacting partners and the intensity of interactions observed by Lee et al. , (2007) are inconsistent with the result shown in Figure
3.7. However a second study (Kolukisaoglu et al. 2004), using Y2H to examine the interaction of AtCIPK16 with AtCBL1 and AtCBL9, found AtCIPK16 did interact weakly with AtCBL1 and moderately with AtCBL9 as shown here, but not in Lee et al. (2007). The difference between these studies is likely to be due to differences in experimental conditions. A number of different experimental conditions can affect the outcomes of yeast two hybrid assays, including differences in destination vectors resulting in differences in plasmid copy number and therefore expression levels, and differences in yeast strains (Braun et al. 2009, Rajagopala et al. 2009). Lee et al .(2007) used different yeast strains and different vectors which may explain the differences in interactions observed in this study and theirs. Compared to the prey vector ( pGADGH ) used in Lee's (2007), the prey vector used in this study pTOOL28 contains a
T7 promoter and Gateway attB1 adapter in the linkage region between Gal4 AD and the ORF which may cause the differences in the flexibility and structure of the fusion proteins
(Rajagopala et al. 2009). While the interactions of AtCIPK16 with different CBLs observed in the Y2H system are informative, it is possible that the artificial nature of the Y2H system can give misleading results. Therefore, to backup the Y2H results, the interaction of AtCIPK16 with AtCBLs was further investigated in plants.
3.5.2 Interactions and localisations of AtCBL-AtCIPK16 in BiFC assays
Since yeast two hybrid assays can produce a high rate of false positive and negative interactions, due to them being an in vivo genetic approach (Chini 2014, Fang et al. 2002, 95
Singh et al. 2012), BiFC assays were employed as an alternative in planta experimental system to verify interactions between AtCIPK16 and the difference AtCBL proteins (Berendzen et al.
2012, Ferro and Trabalzini 2013, Waadt et al. 2008). For easy comparison of the interaction and location of various CBL-CIPKs, all the results of Y2H and BiFC were summarised in
Table 3.8. Similar results were observed in BiFC assay with transient expression in mesophyll protoplasts at to those in the Y2H, except for the interactions between AtCIPK16 and AtCBL3, suggesting a full agreement between both methods (Figure 3.9). To determine whether the interaction between AtCIPK16 and AtCBL3 was the result of a false positive in the Y2H assay or mis-expression in protoplasts, the sequence of AtCBL3 in the destination plasmids used for yeast two hybrid and the protoplasts assays were re-sequenced to confirm there were no sequence differences between the constructs which could lead to alterations in the binding efficiency of AtCBL3 to AtCIPK16. Therefore, the difference between Y2H and BiFC could be due to an Y2H false negative, caused by the low expression level of prey or/and bait proteins (Boruc et al. 2010, Braun et al. 2009). As Figure 3.2 shows, the bait vector pTOOL28 contains a truncated ADH promoter which may reduce the expression level and thus affect the sensitivity of the assay (Stellberger et al. 2010). Another potential reason might be the interaction of AtCIPK16 with AtCBL3 requires other plant regulators. AtCIPK16 as a protein kinase harbours phosphorylation sites at N-terminal activation loop and C-terminal regulatory domain (Gong et al. 2004, Kolukisaoglu et al. 2004, Lee et al. 2007), alteration of which may affect the activity of the kinase. Plant specific regulators might phosphorylate AtCIPK16 altering its properties and facilitating the interaction of AtCIPK16 with AtCBL3. As the Y2H is performed in a heterologous system, those plant specific regulators may not be present thereby leading to no interaction of AtCIPK16 with AtCBL3 seen in yeast. Moreover, some studies reported that posttranslational modifications and suboptimal localisations of heterologous proteins were limited by the physiology of yeast strains or/and the inherent restriction of the
Y2H system, resulting in false positive or false negative in Y2H assay (Boruc et al. 2010,
Brueckner et al. 2009, Walhout et al. 2000).
96
Table 3.8: Summary of AtCIPK16/AtCBL interactions as measured using yeast two hybrids and transient expression in Arabidopsis protoplasts, Arabidopsis leaves and tobacco ( N.benthamiana ) leaves. CBL/CIPK Agro-infiltration Agro-infiltration Y2H Vector pairs Protoplast combinations Arabidopsis tobacco
AtCBL1::YC+ AtCIPK16::YN nucleus, cytoplasm, cytoplasm N/A AtCBL1::YC+ YN::AtCIPK16 N/A negative nucleus, PM AtCBL1+AtCIPK16 + YC::AtCBL1+ AtCIPK16::YN N/A negative N/A YC::AtCBL1 +YN::AtCIPK16 N/A negative N/A
AtCBL2::YC+ AtCIPK16::YN nucleus, cytoplasm, cytoplasm, PM N/A AtCBL2::YC+ YN::AtCIPK16 N/A cytoplasm nucleus, cytoplasm AtCBL2+AtCIPK16 ++ YC::AtCBL2+ AtCIPK16::YN N/A PM N/A YC::AtCBL2+ YN::AtCIPK16 N/A cytoplasm, PM N/A
AtCBL3::YC+ AtCIPK16::YN nucleus, cytoplasm, negative N/A AtCBL3::YC+ YN::AtCIPK16 N/A negative cytoplasm AtCBL3+AtCIPK16 - YC::AtCBL3+ AtCIPK16::YN N/A negative N/A YC::AtCBL3 +YN::AtCIPK16 N/A negative N/A
AtCBL4::YC+ AtCIPK16::YN cytoplasm, PM PM, cytoplasm N/A AtCBL4::YC+ YN::AtCIPK16 N/A PM, cytoplasm nucleus, PM AtCBL4+AtCIPK16 +++ YC::AtCBL4+ AtCIPK16::YN N/A negative N/A YC::AtCBL4 +YN::AtCIPK16 N/A cytoplasm N/A AtCBL5::YC+ AtCIPK16::YN nucleus, cytosol, PM negative N/A AtCBL5::YC+ YN::AtCIPK16 N/A negative nucleus, PM AtCBL5+AtCIPK16 +++ YC::AtCBL5+ AtCIPK16::YN N/A negative N/A YC::AtCBL5 +YN::AtCIPK16 N/A negative N/A AtCBL6::YC+ AtCIPK16::YN negative negative N/A AtCBL6::YC+ YN::AtCIPK16 N/A negative negative AtCBL6+AtCIPK16 - YC::AtCBL6+ AtCIPK16::YN N/A negative N/A YC::AtCBL6 +YN::AtCIPK16 N/A negative N/A
AtCBL7::YC+ AtCIPK16::YN negative negative N/A AtCBL7::YC+ YN::AtCIPK16 N/A negative negative AtCBL7+AtCIPK16 - YC::AtCBL7+ AtCIPK16::YN N/A negative N/A YC::AtCBL7+YN::AtCIPK16 N/A negative N/A
AtCBL8::YC+ AtCIPK16::YN negative negative N/A AtCBL8::YC+ YN::AtCIPK16 N/A negative negative AtCBL8+AtCIPK16 - YC::AtCBL8+ AtCIPK16::YN N/A negative N/A YC::AtCBL8 +YN::AtCIPK16 N/A negative N/A
AtCBL9::YC+ AtCIPK16::YN cytoplasm, PM PM, cytoplasm N/A AtCBL9::YC+ YN::AtCIPK16 N/A PM, cytoplasm nucleus, PM AtCBL9+AtCIPK16 ++ YC::AtCBL9+ AtCIPK16::YN N/A cytoplasm, PM N/A
YC::AtCBL9 +YN::AtCIPK16 N/A PM N/A
AtCBL10::YC+ AtCIPK16::YN cytoplasm, PM negative N/A
AtCBL10::YC+ YN::AtCIPK16 N/A negative cytoplasm AtCBL10+AtCIPK16 + YC::AtCBL10+ AtCIPK16::YN N/A negative N/A
YC::AtCBL10 +YN::AtCIPK16 N/A negative N/A Table shows: CBL/CIPK combinations, the pairs of vectors were used for transient expression, plant materials used in transient expression. YC = the C-terminal fragment of YFP; YN = the
97
N-terminal fragment of YFP, PM= plasma membrane, N/A = not available, - = no interaction, + = weak interaction, ++ = moderate interaction, +++ = strong interaction.
In addition, the BiFC assay is more sensitive for detecting weak and transient interactions than
Y2H assays, as fluorescence is detected (Hu et al. 2002). This could be the reason why
AtCBL3-AtCIPK16 and AtCBL10-AtCIPK16 interaction were observed as same strong signal as other AtCBLs-AtCIPK16 in BiFC (in protoplast, Figure 3.9; and in tobacco leaves, Figure
3.15) while the interaction of AtCIPK16 with AtCBL3 and with AtCBL10 in yeast was negative or weak, respectively (Figure 3.7). Moreover, it has other advantages, including low background noise and the spatial localisation of protein complexes (Kerppola 2008, Ohad et al.
2007).
An interesting result of all BiFC assays was that some AtCIPK16/CBL complexes were localised in the nucleus. As shown in Figure 3.9, protoplasts transient transformed with
AtCBL1-AtCIPK16, AtCBL2-AtCIPK16, AtCBL3-AtCIPK16 and AtCBL5-AtCIPK16 exhibited stronger fluorescent signal in the nucleus compared to the formation of
AtCBL4-AtCIPK16, AtCBL9-AtCIPK16 and AtCBL10-AtCIPK16 complexes. This may suggest that AtCIPK16 has a role in regulating gene expression during stress treatment.
Previous study examining the sequences of 26 AtCIPKs using bioinformatics analyses revealed that none of these kinases contain any recognizable lipid modification site or localisation motif for targeting a downstream protein (Kolukisaoglu et al. 2004). YFP fusions of both N and
C-terminal of AtCIPK16 expressed in protoplasts demonstrated the fluorescence was distributed throughout the cytoplasm and the nucleus (Huang 2010). CBL proteins, however, harbour structural features which determine the subcellular localisation of the CBL-CIPK complexes in vivo (Batistic et al. 2008, Batistic et al. 2010, Ho et al. 2009, Resh 1999, Waadt et al. 2008, Xu et al. 2006). Studies have shown that AtCBL1, AtCBL4, AtCBL5 and AtCBL9 contain the N-terminal motifs for lipid modification, including myristoylation (Batistic et al.
2008, Ishitani et al. 2000) and palmitoylation (Batistic et al. 2008), suggesting that they are found on membranes within the plant cell. In contrast, AtCBL2, AtCBL3 and AtCBL6 were
98 classified into another group of proteins without any recognizable lipid modification site but carry an extended N-terminus which is responsible for the tonoplast targeting (Batistic et al.
2008). Aside from the fluorescence observed in the nucleus, all the positive AtCBL –
AtCIPK16 complexes were observed in the cytoplasm and at the plasma membrane of the protoplast cells. Therefore, the results presented here is different with the evidence of CBL localisation which has previously been described. It is possible that the observed fluorescent patterns may be artefacts due to several potential causes. Firstly, plasmids used for transient expression carry 35S promoter to drive over-expression of AtCBLs and At CIPK16 and thus may result in excess amounts of the protein being present in the cell which may lead to mis-localisation of the YFP fusion protein in protoplasts. Secondly, as some AtCBLs (and
AtCIPK16) are mainly found in root tissues (Kim et al. 2007, Shi 2007), transient expression of these genes in mesophyll protoplasts may form complexes at locations not usually found in leaf cells. Thirdly, protoplasts have had their cell wall removed, which is a disruptive process and will stress the plant cell. The cells therefore may be reacting differently due to these unnatural stresses. Taken together, transient expression in mesophyll protoplast system has its limitation to investigate various proteins localisation.
Agro-infiltration in Arabidopsis leaves and N. benthamiana leaves with four binary vectors were used to eliminate the artefact caused by vector issue which is YFP fragments only fused to C-terminal of protein, and to eliminate protoplast limitation about cell wall removal.
Table 3.8 summarised all these results of yeast two hybrids, BiFC in protoplast, Arabidopsis leaves and tobacco leaves. From all the results presented here, conserved results were observed across all four different experimental systems for some specific AtCBL-AtCIPK16 interactions.
As it is known that AtCIPK16 is predominately found in root tissue (Roy et al. 2013), while
AtCBL5 and AtCBL10 is mainly expressed in shoots (Cheong et al. 2010, Kim et al. 2007,
Quan et al. 2007), the AtCBL5 and AtCBL10 is unable to interact with AtCIPK16 naturally in planta . The strong interaction between AtCIPK16 and AtCBL4 were observed in all systems tested, suggesting that the interaction could occur in root tissue and recruit AtCIPK16 from nucleus to the plasma membrane for phosphorylation of downstream targets which could be 99 transporters or channels during salt stress which AtCBL4 is involved in. A similar hypothesis could be speculated for AtCBL1 and AtCBL9. While the interaction of AtCIPK16 with
AtCBL1 or AtCBL9 is not as strong as that with AtCBL4, these two AtCBLs still could interact with AtCIPK16 in root tissue and then target to the plasma membrane to mediate the activity of transporter or channels by phosphorylation during certain external stresses. AtCBL2 also was observed to interact with AtCIPK16 in all systems tested. The complex formed between AtCBL2-AtCIPK16 was observed in the nucleus and cytoplasm, suggesting AtCBL2 binds to AtCIPK16 and interacts with some unknown transcription factors in the nucleus.
While AtCBL3 could interact with AtCIPK16 in BiFC assay, the complex of
AtCBL3-AtCIPK16 exhibited exclusive cytoplasmic localisation in transiently transformed
N.benthamiana leaves, suggesting AtCBL3-AtCIPK16 might be involved in other unknown regulatory mechanism which can regulate the complex translocation.
As Table 3.8 shown, there were differences in some interactions between protoplasts,
Arabidopsis leaf cells and tobacco leaf cells. This may be due to low transient efficiency of
Agro-infiltration in Arabidopsis leaves. Previous studies indicated that the transient expression by Agro-infiltration in Arabidopsis is not as efficient as in N. benthamiana (Kim et al. 2009,
Wroblewski et al. 2005, Xu et al. 2014). Consequently, a large number of repetitions are required for achieving reliable results.
The positioning of the YFP fragment on the fusion protein may also affect binding and interfere with the subcellular location of AtCBL-AtCIPK16, resulting in the same
AtCBL-AtCIPK16 complex (but with YFP attached to different ends of the protein) having different localisations.
Since both the transient expression in mesophyll protoplast and Agro-infiltration of
Arabidopsis leaves use leaf material, there are still issues with looking at the interactions of
CBLs with AtCIPK16 in a tissue where AtCIPK16 is not normally present. With AtCIPK16 being most predominately found in the root, use of experiment procedures which use leaf material may result in mis-localisation of AtCIPK16-AtCBL protein complexes. Visualisation 100 of AtCIPK16-AtCBL interactions in root tissues using stable expression of split YFP constructs to visualise protein combinations would eliminate these problems. While stable expression of split YFP AtCIPK16-AtCBL complexes was attempted in this project, observation of distinct signal of YFP fluorescence in roots was unsuccessful during the time available. To generate plants with stable expression, a pair of plasmids containing both halves of YFP has to be transformed into Arabidopsis one after another using
Agrobacterium-mediated floral dip in different generations. Single transformed plants were screened by antibiotics and the presence of the transgene confirmed by PCR, however,
RT-PCR was not applied for examining the expression of genes in these plants. As successful observation of BiFC instable transformation plants requires the expressions of both YFP fragments are at high but similar levels, in future both northern and western blot analysis will be used for examining the expression levels of each construct in the transformed plants in the future (Maqbool and Christou 1999) to obtain positive transgenic plants which can be used for visualisation.
While several approaches were employed in this study to investigate the interaction of
AtCIPK16 with AtCBLs, there are other methods which in the future could be used to verify the results presented here. These include GST pull-down assay (Hashimoto et al. 2012, Huang et al. 2011) and the mating-based split-ubiquitin system (Grefen and Blatt 2012, Grefen et al.
2010a) to confirm the interacting partners; and immunolocalisation (Sunarpi et al. 2005, Toda et al. 2012) to examine the localisation of AtCIPK16.
3.6 Summary
AtCIPK16 interacts with AtCBL1, AtCBL2, AtCBL3, AtCBL4 and AtCBL9 in planta . The complexes of AtCBL1-AtCIPK16, AtCBL4-AtCIPK16 and AtCBL9-AtCIPK16 were observed in the nucleus and plasma membrane, suggesting AtCBL1, AtCBL4 and AtCBL9 interact with
AtCIPK16 in roots and recruit AtCIPK16 from nucleus to the plasma membrane for phosphorylation of downstream targets. The complex formed between AtCBL2-AtCIPK16 was observed in the nucleus and cytoplasm, suggesting AtCBL2 binds to AtCIPK16 and interacts with some unknown transcription factors in the nucleus. The complex of AtCBL3-AtCIPK16
101 exhibited exclusive cytoplasmic localisation, suggesting AtCBL3-AtCIPK16 might be involved in other unknown regulatory mechanism which can regulate the complex translocation.
102
Chapter 4 Identification of downstream targets of AtCIPK16
4.1 Introduction
There are many studies which have successfully revealed interactions between CIPKs and
CBLs using approaches like yeast two hybrid assays and BiFC. However, only a few studies have identified the downstream targets of these CIPK/CBL complexes. This is due to the difficult nature of identifying the downstream target, which may often be membrane based.
Only a few studies have reported identifying downstream targets of CIPKs (Halfter et al. 2000,
Hashimoto et al. 2012, Ho et al. 2009, Liu and Zhu 1998, Qiu et al. 2002, Quintero et al. 2011,
Quintero et al. 2002).
Protein pull-down assays have been widely utilised to identify and confirm interactions between proteins during the last decade (Hashimoto et al. 2012, Huang et al. 2011, Lyzenga et al. 2013, Yuasa et al. 2012). For example, Geriger et al., (2010) found the Arabidopsis guard cell anion channel SLAC1 can interact with CPK23 (calcium-dependent protein kinase 23) by co-expression both genes and using a Strep-tag-based in vivo pull-down. In addition, Huang et al. , (2011) performed a GST-pull-down assay to identify the interaction between CBL1 and
CIPK7 in vitro and demonstrated that CBL1 is only associated with a GST-CIPK7 complex but not with GST on its own, indicating an exclusive interaction between CBL1 and CIPK7 in vitro . Moreover, they utilised affinity chromatography to retrieve CIPK7 from Arabidopsis protein extract by CBL1 to further confirm the interaction between CBL1 and CIPK7 (Huang et al. 2011). Pull-down assays have also indicated CBL3 physically associates with CIPK11
(Jeong et al. 2005), CIPK24/SOS2 associates with SOS3 (Quan et al. 2007) and CBL10 (Kim et al. 2007) in vitro .
As protein pull-down assays have identified proteins which interact with other CIPKs, a pull-down assay was attempted to identify the upstream and downstream targets of AtCIPK16.
For a pull-down assay to work, an antibody is required which is specific for the protein of 103 interest, in this case AtCIPK16. To generate an antibody which is specific to AtCIPK16, unique regions in the protein sequence have to be identified and used as templates to synthesised highly specific peptides. These peptides are employed as antigens for immunisation to animals which then develop polyclonal antibodies to the protein of interest.
When these antibodies and the protein of interest (AtCIPK16) are immobilised to the resin in a pull-down column as bait, they can capture their interacting partners from a total protein extract of Arabidopsis. When this technique is combined with two-dimensional SDS-PAGE and mass spectrometry (MS), this technique can lead to the identification of both upstream and downstream interacting partners. Examples of the use of this technique include identification of amyloid precursor protein intracellular domain (AICD)-interacting proteins (Chakrabarti and Mukhopadhyay 2012), binding partners of cytoplasmic loop of Connexin43 (Chakrabarti and Mukhopadhyay 2012) and Huntingtin Yeast Two-Hybrid Protein K (HYPK)-interacting proteins (Choudhury et al. 2012).
A pull-down assay using an antibody developed to AtCIPK16 would allow the identification of the downstream target of AtCIPK16 and contribute to a better understanding of the function and mechanisms of the AtCIPK16 signalling pathways.
As a protein pull-down assay is a very complicated technique and takes time to develop and optimise, so a second strategy was employed to identify potential downstream proteins which
AtCIPK16 interacts with. As shown in Chapter 3, a yeast two hybrid assay is an alternative technique to investigate the interacting partners of a protein. The observation that stable expression of promoterCIPK16::GFP resulted in strong GFP fluorescence in stelar cells (Roy et al. 2013), suggested that AtCIPK16 might be involve in the processes of the Na + and K + loading or retrieval in the xylem, thereby regulating their movement to the shoot. AtHKT1;1 and AtSOS1 are stelar transporters which are responsible for Na + efflux and retrieval from the xylem under salt stress (Davenport et al. 2007, Horie et al. 2009, Munns and Tester 2008, Qiu et al. 2004, Shi et al. 2002, Xue et al. 2011) and so may be potential interacting partners of
AtCIPK16. In addition, AtCIPK16 has previously been shown to interact with the potassium transporter AKT1 (Lee et al. 2007). Therefore, these three transporters were considered as the 104 potential interacting partners of AtCIPK16 for yeast two hybrids. However, the yeast two hybrid systems cannot be used to detect the interaction of membrane localised transporters due to proteins harbouring transmembrane domains which are unable to move to the nucleus where the interactions take place in the Y2H system (Auerbach 2005). Therefore, a strategy was developed where short cytoplasmic domain of AtHKT1;1 and AtSOS1 would be cloned and used in the yeast two hybrid prey vectors. As a fragment of AtAKT1 has been previously shown to interact with AtCIPK16 in a yeast two hybrid assay (Lee et al. 2007) this was used as a positive control.
The aim of this chapter is to use two different techniques, a pull-down assay and a yeast two hybrid assay, to identify downstream target proteins of AtCIPK16.
4.2 Materials and methods
4.2.1 Pull-down assay
To identify the downstream targets of AtCIPK16 using a pull-down assay, a unique antibody which can recognise the AtCIPK16 protein in situ is required to bind the protein to an affinity column, thereby removing AtCIPK16 from the solution passing through the column. If the kinase is currently interacting with another protein then that interactor will also be isolated.
Due to AtCIPK16 being found in small concentrations within plant cells, AtCIPK16 was also expressed in E. coli to produce a large volume of protein which could be fixed in the column to retrieve the interacting partners from Arabidopsis root extract. Therefore, a key step in the process of generating a recombinant protein is confirming that it can be refolded into a working, kinase, therefore having the ability to bind to AtCIPK16's partners.
4.2.1.1 Peptide antigen design
The protein sequences of 26 AtCIPKs (Table 4.1) were acquired from the National Centre for
Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov). These sequences were aligned by using Vector NTI version 11.0 (Invitrogen, CA, USA) to identify unique amino acid regions which were specific to AtCIPK16. These unique regions were used to generate synthetic antigens. Hydrophobicity plots of protein sequence was obtained using ExPASy 105
ProtScale Kyte & Doolittle model (Kyte and Doolittle 1982).
Table 4.1: Names and accession numbers of 26 AtCIPKs aligned for antibody design. Information includes protein name, Arabidopsis genome Initiative Identification (AGI) No., Universal Protein Resource (UniProt) Accession No. and the number of amino acids of the predicted protein. Name AGI No. UniProt Accession Amino Acid AtCIPK1 At3g17510 Q8RWC9-2 444 AtCIPK2 At5g07070 Q9LYQ8 456 AtCIPK3 At2g26980 Q2V452 441 AtCIPK4 At4g14580 Q9SUL7 426 AtCIPK5 At5g10930 Q9LEU7 431 AtCIPK6 At4g30960 O65554 441 AtCIPK7 At3g23000 Q9XIW0 429 AtCIPK8 At4g24400 Q9STV4 445 AtCIPK9 At1g01140 Q9MAM1 449 AtCIPK10 At5g58380 Q9C562 479 AtCIPK11 At2g30360 O22932 435 AtCIPK12 At4g18700 Q9SN43 489 AtCIPK13 At2g34180 O22971 502 AtCIPK14 At5g01820 Q9LZW4 442 AtCIPK15 At5g01810 P92937 421 AtCIPK16 At2g25090 Q9SEZ7 469 AtCIPK17 At1g48260 Q94C40 432 AtCIPK18 At1g29230 Q9LP51 520 AtCIPK19 At5g45810 Q9FJ55 483 AtCIPK20 At5g45820 Q9FJ54 439 AtCIPK21 At5g57630 Q94CG0 416 AtCIPK22 At2g38490 O80902 445 AtCIPK23 At1g30270 Q93VD3 482 AtCIPK24 At5g35410 Q9LDI3 446 AtCIPK25 At5g25110 Q8W1D5 488 AtCIPK26 At5g21326 Q84VQ3 439
4.2.1.2 Generation of a specific rabbit IgG antibody
To generate rabbit IgG antibodies which specifically recognised a part of the AtCIPK16 protein, artificial peptides of the two unique amino acid regions were synthesised by
106
Mimotopes Pty Ltd. (Australia). One mg each highly specific peptide were dissolved in 200 μL of phosphate-buffered saline solution (PBS, 137 mM NaCl, 2.7 mM KCl, 10 mM Na 2HPO 4 and 2 mM KH 2PO 4, pH with HCl to 7.4) and mixed with 80 μL of dimethyl sulfoxide (DMSO,
Sigma-Aldrich, Castle Hill, Australia) to improve the solubility of peptides. For the conjugation of peptides, 2 mg of keyhole limpet hemocyanin (KLH, Cat. # H7017-20MG,
Sigma-Aldrich, Castle Hill, Australia) was dissolved in 200 μL of MilliQ water and mixed with 200 μL of peptide solution, followed by incubation at room temperature for 2 hours. As these peptides are only 15-30 aa long, they are not large enough in size to be immunogenic on their own, therefore, conjugation to the carrier protein (KLH) can make the peptide antigen adequately large enough to be immunogenic. The volume of sample was adjusted to 1 mL with additional distilled H 2O and aliquoted into four tubes for four immunisations with a 3-week interval. Generation of polyclonal antibody was performed by Institute of Medical and
Veterinary Science (IMVS, South Australia, Australia).
4.2.1.3 Production of recombinant protein
As the concentration of AtCIPK16 in Arabidopsis is expected to be quite low, recombinant
AtCIPK16 was planned to be used as an affinity reagent to improve the chance to retrieve the interacting partners from Arabidopsis root extract. Therefore, pDEST17 vector (Figure 4.1) harbouring an N-terminal 6 × histidine tag was used as destination vector for production of an
AtCIPK16 recombinant proteins with a histidine tag in E.coli .
pCR8-AtCIPK16 and pCR8-AtCBL4 (as a negative control for protein expression) have been constructed in Chapter 3 for Y2H and BiFC, thereby they were available for the ligation to the destination vector for protein production. An LR reaction was performed (Section 2.18) to transfer the DNA from pCR8 into the pDEST17 destination vector (Figure 4.1). The sequence of the cloned gene in pDEST17 was again confirmed by Sanger sequencing (Section 2.9) to make sure no errors had been introduced into the product.
pDEST17-AtCIPK16 was then transformed into TOP10 competent cell (Invitrogen, CA, USA) as described in Section 2.15. After plasmid DNA isolation and analysis of restriction digestion, the 107 sequence of plasmid was determined by Sanger sequencing (Section 2.9). Once the sequence of
AtCIPK16 was confirmed, the expression vector was transformed into the BL21-AI E.coli strain
(Invitrogen, CA, USA).
Figure 4.1: The vector pDEST17 was used to synthesise AtCIPK16 and AtCBL4 in E.coli Feature Description attR1 Gateway recombination sequence Chlor Chloramphenicol resistance gene ccdB ccdB gene the encoded protein is toxic to the standard E. coli strains attR2 Gateway recombination sequence T7 terminator Bacteriophage T7 terminator Amp Ampicillin resistance gene for selection in E.coli pBR322 ori pBR322 origin of replication ROP Repressor of primer
T7 promoter T7 RNA polymerase promoter RBS Ribosome binding site 6 × His polyhistidine tag for analysing the fusion protein
Recombinant protein expression was performed as per the manufacturer's instructions. Briefly, three colonies were picked from plates of pDEST17-AtCIPK16 harbouring BL21-AI growing
108 under ampicillin selection and inoculated into 5 mL of Luria Betani (LB) liquid medium (yeast extract 5 g L -1; tryptone 10 g L -1; NaCl 5 g L-1; pH 7.5) containing 100 μg mL -1 ampicillin.
Cultures were incubated with shaking overnight at 37 °C. Each overnight culture was diluted
-1 20-fold with fresh LB liquid medium containing 100 μg mL ampicillin until an OD 600 between 0.05-0.1 was achieved. Such a density of cells will allow them to quickly proceed into a logarithmic growth phase. Each culture was incubated with shaking at 37 °C until an OD 600 of 0.6 (mid-log phase) was reached, before being aliquoted into two equal volume. Inducer
(L-arabinose) was added into one of two cultures (to a final amount of 0.1 %) and both cultures (induced and uninduced) were incubated at 37 °C with shaking.
Different proteins have specific optimal expression temperatures, optimal inducers and optimal lengths of expression. Therefore, a time course experiment was performed to determine the optimal time to express the protein of interest. 500 μL of each culture was collected after 0, 1,
2, 3 and 4 hours growth at 37 °C from both induced and uninduced samples, followed by centrifugation at 11,000 g for 1 min. The pellets were snap-frozen and kept at -80 °C for further analysis.
To determine protein yield from each sample, cell pellets collected from the various time points were thaw and resuspended in 500 μL of lysis buffer (50 mM potassium phosphate, pH
7.8, 400 mM NaCl, 100 mM KCl, 10 % glycerol and 0.5 % Triton X-100). Samples were sonicated on ice for 3 × 30 s using a probe sonifier B-12 (Branson Consolidated Ultrasonic
PTY. LTD, Australia) (at 40 % power, 20 s pulse interval), followed by centrifugation at 12000 g for 1 min to pellet the insoluble proteins. The soluble protein supernatant was transferred into a fresh tube and mixed with equivalent volume of 2 × SDS-PAGE loading buffer (80 mM
Tris-HCl, pH 6.8, 4 % (w/v) SDS, 4 mM dithiothreitol, 8 % (w/v) glycerol and 0.02 % bromophenol blue). The insoluble protein samples were mixed with 25 μL of 1 × SDS-PAGE loading buffer (40 mM Tris-HCl, pH 6.8, 2 % (w/v) SDS, 2 mM dithiothreitol, 4 % (w/v) glycerol and 0.01 % (w/v) bromophenol blue) and all samples (insoluble and soluble protein samples) were incubated at 85 °C for 5 min. Extracted proteins were visualised by SDS polyacrylamide gel electrophoresis. 109
4.2.1.4 SDS Polyacrylamide Gel Electrophoresis
SDS Polyacrylamide gel electrophoresis was used to separate and visualise the recombinant
AtCIPK16-His fusion protein. The percentage of acrylamide in SDS-PAGE gel depends on the size of the protein samples. As recombinant AtCIPK16 is 54 kDa, 12 % separating gels (which is recommended for 20-150 kDa proteins) were made. A 20 ml 12 % separation gel was prepared by mixing 8.6 mL distilled H 2O, 5 mL of 1.5 M Tris-HCL buffer (pH 8.8), 6 mL of
40 % araylamide/Bis, and 200 μL of 10 % SDS, 200 μL of fresh made 10 % ammonium persulphate was added into solution and mixed with 20 μL of TEMED by gentle inversion. The mix was immediately poured into an empty 1.0 mm thick mini gel cassette (Novex, Cat. #
NC2010, Carlsbad, CA, USA) and covered with 1 mL of isopropanol to eliminate oxygen and to keep a flat interface surface. The cassette was left in a vertical position for approximately 1 hour to polymerise. Once the interface became more distinct, the isopropanol was removed by pipette and the gel was rinsed with distilled H 2O to remove residue isopropanol. 5 mL of 5 % stacking gel solution was prepared by mixing with 0.625 mL of 40 % acrylamide/Bis, 0.63 mL of 1 M Tris (pH 6.8), 50 μL of 10 % SDS, 3.645 mL H2O, 50 μL of 10 % ammonium persulphate and 5 μL of TEMED. The solution was poured into an empty 1.0 mm thick mini gel cassette and mini 1.5 mm 15 wells gel cassette comb (Novex, Cat. # NC3515, Carlsbad,
CA, USA) was inserted into the top of the cassette. The gel was left for another 1 hour to polymerise completely.
After removing the comb, the gel was placed into electrophoresis tank (XCellSureLock
Mini-Cell, Invitrogen, Cat. # EI0001, CA, USA) containing running buffer (25 mM Tris-HCl,
192 mM glycine and 0.1 % SDS). A 5 μL volume of insoluble protein sample and 20 μL of soluble protein sample were loaded onto the gel and run at 90 V for approximately 3 hours, until the marker was close to the end of the gel. The gel was removed from the cassette and placed into a Coomassie brilliant blue staining solution (0.1 % Coomassie Brilliant Blue, 50 % ethanol and 10 % glacial acetic acid) overnight with gentle agitation. The gel was rinsed with distilled H 2O and placed into destaining solution (50 % ethanol and 10 % glacial acetic acid) with gentle agitation until bands were clear. 110
4.2.1.5 Western blot for identification of the expected band on the gel
An SDS gel containing the soluble and insoluble protein samples was prepared as described in
Section 4.3.1.5 and the wells were removed from the stacking gel with a clean blade. A pre-cut
8 cm × 7 cm nitrocellulose membrane (Thermo scientific, Cat. # 88018, IL, USA), two pre-cut
8 cm × 7 cm Grade 1 sheet Pore size 11 µm Whatman filter papers (GE healthcare Whatman,
Cat. # 09-927-826, Piscataway, NJ, USA) and two fibre pads (Woolworth, Australia) were soaked in transfer buffer (25 mM Tris, 102 mM glycine and 20 % methanol, pH 8.3) for 5 minutes. The gel cassette was removed from the transfer apparatus. A transfer sandwich was made by placing one fibre pad, one Whatman filter paper, SDS gel, nitrocellulose membrane, one Whatman filter paper and one fibre pad in order on the black panel (cathode) (Figure 4.2).
Before the sandwich was covered with a clear panel (anode), air bubbles were removed from the nitrocellulose membrane by using a roller, thus ensuring the SDS gel is tightly attached to nitrocellulose membrane. The transfer cassette was tightly fastened together with a latch and inserted into a tank. All these steps ensure the gel was tightly contacted with the membrane which the proteins are transferred from the gel to the nitrocellulose membrane. The tank was placed in ice and 80 V applied for 90 min.
Figure 4.2 Diagram of Western blot setup The transfer gel sandwich was assembled with the cathode, one fibre pad, one Whatman paper,
111
SDS gel, transfer membrane, one filter paper, one fibre pad and anode. The direction of transfer is from to cathode towards the anode. (The figure was modified from http://www.leinco.com/general_ wb)
After transferring the proteins to the nitrocellulose membrane, the membrane was dried at
37 °C for 5 min, before a blocking buffer (5 % milk powder in PBS) was added to the membrane to block non-specific binding sites. The blocked membranes were incubated for 2 hours at room temperature with slowly shaking. The membrane was washed twice with TBS-T buffer (50 mM Tris, 0.9 % NaCl and 0.05 % Tween 20, pH 8.4) for 10 min at room temperature to remove the residue of blocking buffer. The membrane was then incubated at
4 °C with slowly shaking overnight in 1 × PBS with anti-AtCIPK16 rabbit antibody (Section
4.3.1.2) at a 1:1000 dilution. This allowed the antibody attach to its specific antigen. After primary antibody incubation, the membrane was washed three times with TBS-T to remove the residue of antibody, before being incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody (Goat anti-rabbit IgG-HRP, Cat. # 65-6120, Invitrogen, CA, USA) at a
1:4000 dilution for 4 hours at 4 °C. This allowed the secondary antibody to attach to the first antibody. After washing for 3 times, the membrane was dried with tissue and soaked in chemiluminescent substrate reagent (Novex ECL Chemiluminescent Substrate Reagent Kit,
Cat. #WP20005, Invitrogen, CA, USA) for 2 minutes to detect the HRP-conjugated secondary antibody. After removing excess substrate by blotting, the membrane was visualised and photographed using a Clinx Imager (Clinx Science Instruments, China).
4.2.1.6 Optimisation of recombinant protein expression
Since different recombinant proteins have different properties, the expression conditions needed to be optimised for the AtCIPK16 recombinant protein to improve yield and solubility.
Experimental conditions, including temperature, induction duration and the concentration of inducer were optimised for expression of pDEST17-AtCIPK16 The induction duration was determined as described in Section 4.2.1.3 with the recombinant protein induced for four hours under different ranges of L-arabinose concentrations (0.01%, 0.02%, 0.05%, 0.1% and 0.2%).
Once the optimal concentration of inducer was confirmed, the reaction was performed at different temperatures (28 °C, 30 °C, 33 °C, 35°C and 37 °C) to identify the best temperature 112 to improve soluble-expression of recombinant protein.
4.2.1.7 Purification of denatured protein
To purify the recombinant AtCIPK16 protein, cell sample was harvested by centrifugation at
12000 g for 10 min at 4 °C from 50 mL culture and washed twice with 50 mL of 50 mM
Tris-HCl (pH 7.4). Cells were resuspended in 8 mL extraction buffer (6M guanidine-HCl, 400 mM NaCl, 35 mM NaH 2PO 4, 1 mM β-Mercaptoethanol, 10 mM imidazole, 1 mM phenylmethanesulfonyl fluoride (PMSF), 2 % protease inhibitors (PI) and 0.1 % benazase, pH8.0) and sonicated three times on ice for 30 s intervals using a probe sonifier (at 40 % power, 20 s pulse interval) until the cloudy cell suspension became translucent indicating the completion of lysis. Samples were centrifuged at 12000 g for 15 min at 4 °C and the supernatant containing the denatured protein was collected for SDS-PAGE.
BD TALON metal affinity resins (BD Bioscience, Cat. # 8901, USA) were used for AtCIPK16 protein purification. Following the manufacturer's protocol, 2 mL of resin slurry was resuspended and transferred into a 10 mL purification column. The column was held vertically and tapped until the resin settled to the bottom. The storage buffer was then removed from the column. 10 mL of equilibration buffer (6M guanidine-HCl, 400 mM NaCl, 35 mM NaH 2PO 4, 1 mM β-mercaptoethanol and 10 mM imidazole, pH 8.0) was loaded into the column and mixed briefly to pre-equilibrate the resin to the initial buffer conditions before loading protein samples. After the resin settled to the bottom, the supernatant was aspirated from the column and the equilibration step was repeated to remove any residual ethanol in resin. The denatured protein sample was loaded into the column and mixed with the resin using gentle agitation at
4 °C overnight to allow the His-tagged AtCIPK16 to bind the cobalt resin. The supernatant in the column was collected for further analysis. The resin was washed with 5 mL wash buffer
(6M guanidine-HCl, 400 mM NaCl, 35 mM NaH 2PO 4, 1 mM β-Mercaptoethanol and 50 mM imidazole, pH8.0) using gentle agitation for 10 min and supernatant was collected for
SDS-PAGE. The resin was washed with four times to eliminate any remaining non-specific proteins prior to eluting the protein of interest, which was eluted by adding a series elution buffers (elution buffer1-4, listed in Table 4.2). In the order of low to high concentration, each 113 elution buffer was added into the column and the eluted sample was collected for each buffer to determine which concentration is the best one for the protein of interest. All steps were performed at 4 °C in order to keep protein stability and improve yield.
Table 4.2: The four elution buffers used to dissociate and elute purified protein from resin. Buffer Recipe
Elution Buffer 1 6M guanidine-HCl and 100 mM imidazole, pH 7.0
Elution Buffer 2 6M guanidine-HCl and 150 mM imidazole, pH 7.0
Elution Buffer 3 6M guanidine-HCl and 200 mM imidazole, pH 7.0
Elution Buffer 4 6M guanidine-HCl and 250 mM imidazole, pH 7.0
As guanidine-HCl can form a precipitation in SDS-PAGE, guanidine-HCl was removed from the denatured protein samples, following the protocol described in Pepinsky (1991), before performing SDS-PAGE. Briefly, 25 μL of denatured protein sample was mixed with 225 μL of pre-cold 100 % ethanol by vortexing and kept at -20 °C for 1 hour to aid precipitation of the protein, followed by centrifugation at 12,000 g for 15 min at 4 °C to collect the pellet. After removal of the supernatant, the pellet was resuspended in 225 μL of 90 % ethanol, followed by centrifugation at 12,000 g for 15 min at 4 °C to collect the pellet again. The pellet was dissolved in 25 μL of 1× SDS loading buffer and incubated at 85 °C for 5 min and checked by polyacrylamide gel electrophoresis (Section 4.3.1.5).
4.2.1.8 Refolding of purified denatured protein
Since pDEST17-AtCIPK16 is expressed in inclusion bodies, 6 M guanidine-HCl buffer were used to solubilise the protein for purification by cobalt resin. After purification, the denatured protein was refolding to recovering the kinase activity of the recombinant protein. Following the protocol by Umetsu et al., (2003), the denatured protein samples was transferred into a dialysis tube and immersed in dialysis buffer (50 mM Tris-HCl with 4 M guanidine-HCl, pH
7.4) with stirring for 2 hours at 4 °C to exchange the denaturing buffer by dilution with refolding dialysis buffer to remove Gu-HCl (Cat. # G3272, Sigma-Aldrich, Castle Hill,
114
Australia) and imidazole in protein samples. The protein sample in the dialysis tube was transferred to another dialysis buffer (50 mM Tris-HCl with 2M guanidine-HCl, pH 7.4) and stirred for 2 hours at 4 °C. Finally, the sample was placed in the 50 mM Tris-HCl buffer (pH
7.4) with stirring at 4 °C overnight to finish the total exchanging procedure.
4.2.2 Yeast two hybrid assays
As a secondary strategy, yeast two hybrid assays were used to determine whether a constitutively active form of AtCIPK16 could interact with two proteins known to be expressed in stellar tissue and shown to be important in regulating shoot Na + accumulation –
AtHKT1;1 and AtSOS1. As the yeast two hybrid systems cannot be used to detect the interaction of membrane localised transporters the nucleotide sequences of cytoplasmic fragments of AtHKT1;1 and AtSOS1 were cloned. As a fragment of AtAKT1 has been previously shown to interact with AtCIPK16 (Lee et al. 2007), this was used as a positive control.
4.2.2.1 Cloning for yeast two hybrid assay
Removal of C-terminal NAF region has been shown to make CIPKs constitutive active (Gong et al. 2002a, Guo et al. 2001, Hashimoto et al. 2012). Therefore, a construct called
AtCIPK16Nt (lacking the last remaining 470 nucleotides corresponding to Ser 321 to Ser 469 , but containing a stop codon) was cloned for use in a yeast two hybrid assay. After predication of the topology model of transporters, attempts were made to clone potential cytosolic fragments of each transporter.
4.2.2.2 Analysis of the protein sequences of AtHKT1;1, AtSOS1 and AtAKT1
For cloning the potential regions of three transporters for interacting with AtCIPK16, full-length proteins sequences of AtHKT1;1, AtSOS1 and AtAKT1 were analysed by TopPred
1.10 (Mobyle portal Institut Pasteur: http://bioweb.pasteur.fr/seqanal/interfaces/toppred.html)
(Claros and Vonheijne 1994) to predict transmembrane segments, cytosolic loops and extracellular loops. Phosphorylation sites in the protein sequences were predicted by NetPhos
2.0 (www.cbs. dtu. dk/ services/NetPhos/) (Blom et al. 1999). The topology models were 115 drawn using TOPO2 (Johns S.J., TOPO2, Transmembrane protein display software http://www.sacs. ucsf. edu/ TOPO2/).
116
4.4 Results
4.4.1 Alignment of the protein sequences of AtCIPK16 with 26 AtCIPKs in Arabidopsis and peptide antigen design
For a pull-down assay to work, two conditions need to be taken into consideration. One, specific antigens corresponding to a unique region of the AtCIPK16 protein, have to be designed which allows the generation of AtCIPK16 specific antibodies. Secondly, the ideal regions on a protein to design an antigen are hydrophilic and on the surface of the protein
(Drake et al. 2002, Kim et al. 2011). In most proteins, hydrophobic residues tend to be buried in the interior, whereas hydrophilic part has a high propensity toward surface of protein (Rees et al. 1989, Scarsi et al. 1999). In order to maximise the probability that antibody can only recognise a region of AtCIPK16 which is unique from all the other CIPKs in Arabidopsis, the amino acid sequences of the 26 AtCIPKs were aligned and unique regions of AtCIPK16 identified. Two highly unique AtCIPK16 regions (at 300-320 and 440-469 amino acids) were identified (Figure 4.3). To determine the hydrophilicity of these two regions, the hydrophilicity of the AtCIPK16 protein sequence determined using ExPASy ProtScale and the Kyte &
Doolittle model (Kyte and Doolittle 1982). A total of three hydrophilic regions (negative values) were identified in the protein sequence of AtCIPK16 amino acids 300, 380 and 440 respectively (Figure 4.4). As the unique amino acid regions identified by sequence comparison
(300-314 and 441-469 aa) were in two of these three highly hydrophilic regions, it was decided that these areas would be a good site for an antibody to bind to. The amino acid sequences which were used to generate synthetic antigens that would allow the specific binding of an antibody to AtCIPK16 were AtCIPK16_C: H-CWSWQGDDDEDDVTTND
NVNTNDNKINNVS-OH (C-terminal end of AtCIPK16) and AtCIPK16_I: H-CPPTKKKKK
DLNEKED-NH2 (in the middle of the protein). The artificial peptides of the two unique amino acid regions were synthesised by Mimotopes Pty Ltd. (Australia). The peptides were used for four rabbit immunisations with a 3-week interval by Institute of Medical and Veterinary
Science to generate polyclonal antibodies. When polyclonal antibodies arrived, they were used in Western blot to determine whether they could bind to AtCIPK16.
117
118
Figure 4.3: Alignment of 26 AtCIPKs protein sequences using Vector NTI version 11.0 The alignment of 26 AtCIPKs protein sequences was generated using Vector NTI version 11.0 with the AlignX program. Amino acid residues were labelled as yellow for identical, blue for conserved and green for similar. Two highly unique regions (amino acid 300-314 and amino acid 441-469) identified by anti-AtCIPK16 antibodies are marked (violet).
119
Figure 4.4 Hydrophilicity plot of AtCIPK16 using ExPASy ProtScale program Kyte-Doolittle hydrophobicity analysis of AtCIPK16 was performed using ExPASy ProtScale. Positive values indicate hydrophobicity and negative values indicate hydrophilicity. Red triangles indicate the positions of two the two amino acid sequences that are unique in AtCIPK16 and not found in the other 25 CIPKs.
120
4.4.2 Construction of plasmid for protein synthesis
To express a recombinant AtCIPK16 protein in E.coli , the full-length of the coding sequence of
AtCIPK16 was ligated from the pCR8 entry vector into pDEST17 vectors (Figure 4.1). The pDEST17 plasmid allows the expression of the gene in E. coli using a T7 promoter to generate a recombinant protein. The vector will also allow the addition of a 6 × His tag fused to the N-terminus of the protein in question (Figure 4.5). An His-tagged AtCBL4 was also transformed for use as a negative control to compare with target protein band in SDS-PAGE analysis and Western Blot .
Figure 4.5 pDEST17-AtCIPK16 and pDEST17-AtCBL4 used for production of His-tagged AtCIPK16 and His-tagged AtCBL4 (negative control) in E.coli Plasmids constructed for the fusion of polyhistidine (6 × His) affinity tag to the N-terminus of the AtCIPK16 and AtCBL4 for expression in E.coli. His-tagged AtCBL4 was used as a negative control in SDS-PAGE analysis and Western Blot . For detail description of pDEST17 vector see the legend of Figure 4.1.
4.4.3 Recombinant His-AtCIPK16 was obtained from E.coli and is bound by the anti-AtCIPK16 antibody in Western blot
To determine whether the two anti-AtCIPK16 antibodies produced bound to AtCIPK16 in a heterologous system, recombinant AtCIPK16 was produced in E. coli. An initial protein expression experiment was performed over a 4 hours time period to determine the optimal time point for obtaining sufficient quantities of protein for future experiments. Each crude bacterial lysate was analysed using SDS-PAGE. His-AtCBL4 was used as a negative control (expected size = 28 kDa). A distinct band around 56 kDa was observed in all E.coli lysate samples expressing His-AtCIPK16 ,
121 indicating this band is potential His-AtCIPK16 (expected size = 56 kDa). No band was observed when His-AtCBL4 was expressed. The total yield of the 56 kDa His-AtCIPK16 increased with incubation time, however, the concentration of the recombinant protein was low. A band of the desired size of His-AtCIPK16 was also observed in uninduced His-AtCIPK16 expressing E. coli
samples (Figure 4.6 A, column 1 and 4), indicating that the expression of the gene was leaky. Other
studies have shown that addition of glucose can further repress basal expression (Lee et al. 1987,
Nielsen et al. 2007) by inhibiting the synthesis of cyclic AMP (cAMP) from adenosine triphosphate
(ATP). cAMP is a second messenger for intercellular signal transduction, repression of which blocking RNA polymerase binding, inhibiting the transcription from genes regulated by the T7 promoter (Miyada et al. 1984, Nielsen et al. 2007). Therefore to avoid expression of the recombinant protein in uninduced samples, the experiment was repeated with 0.2 % D-glucose added to the LB media. Unfortunately, His-AtCIPK16 could still be observed in uninduced samples (Data not shown).
To confirm the 56 kDa band was indeed the protein of interest, a Western blot was performed using an anti-AtCIPK16 antibody (Figure 4.6 B).
122
Figure 4.6 Concentration of His-AtCIPK16 in E.coli strain BL21-AI after 0-4 h induction period. A, SDS-PAGE (12%) stained with Coomassie brilliant blue R-250 showing lanes for 0 , 2 and 4 hour induction with 0.1% L-arabinose of E. coli containing the His-AtCIPK16 construct (columns 1-3), a 4 h uninduced sample (column 4) and a negative control of E. coli containing His-AtCBL4, which is 26 kDa (column 5). All samples were crude E.coli lysate. Compared to His-AtCBL4, the band above 50 kDa present in all E.coli lysate transformed with pDEST17-AtCIPK16. The black arrow indicates the expected size (56 kDa) of His-AtCIPK16. B, A Western blot of the protein samples performed using anti-AtCIPK16 polyclonal antibodies (1:1000 dilution) showing 0 , 2 and 4 hour induction with 0.1% L-arabinose (columns 1-3), a 4 h uninduced sample (column 4) and a negative control His-AtCBL4 (column 5).
4.4.4 Optimisation of recombinant protein synthesis
The results of the SDS-PAGE demonstrated that the His-AtCIPK16 protein was mainly in the insoluble pellets of 2 h and 4 h induced samples (Figure 4.7). A large number of papers indicate that rapid expression of heterologous proteins in E.coli results in the production of mis-folded proteins
(Baneyx 1999, Baneyx and Mujacic 2004, Esposito and Chatterjee 2006, Francis and Page 2010,
Smialowski et al. 2007). PROSOII http://mips.helmholtz-muenchen.de/prosoII/prosoII.seam
(Smialowski et al. 2012) was used to predict the solubility of His-AtCIPK16 in E.coli and suggests the protein could be soluble (Figure 4.8). As the results in Figure 4.7 showed the recombinant protein
123 was mainly in the pellet (insoluble) fraction, it is possible the high level of insoluble AtCIPK16 may be an issue in the technique used to produce the protein. Therefore, optimisation of all conditions in
expression procedure, including different strains, inducers, induction periods and temperature, took place.
Figure 4.7 SDS-PAGE analysis of protein samples from E.coli after either a 2 h or 4 h induction. A 12 % SDS-PAGE gel stained with Coomassie brilliant blue R-250 showing protein bands after a 2 and 4 hour induction with 0.1% L-arabinose. The induced protein samples were collected after sonication as a soluble protein (S) or an insoluble pellet (P). The black arrow indicates the recombinant His-AtCIPK16 band with the expected size of 56 kDa.
Table 4.3 Prediction of His-AtCIPK16 solubility in E.coli The solubility of His-AtCIPK16 in E.coli was predicted using PROSO II (http://mips.helmholtz-muenchen.de/prosoII/prosoII.seam) (Smialowski et al. 2012). Predicated classes are categorised into soluble and insoluble and a solubility score is given (0 = insoluble, 1 = soluble).
4.4.4.1 Expression of recombinant His-AtCIPK16 in two codon bias-adjusted E. coli strains showed no improvement in protein yield
Expression of plant proteins in E.coli is frequently inefficient due differences in codon usage between
124 plants and E.coli (Kane 1995, Rosano and Ceccarelli 2009). This often results in recombinant proteins being mis-folded and insoluble (Kane 1995, Rosano and Ceccarelli 2009, Schenk et al.
1995). To determine whether AtCIPK16 contains codons that are rarely used by E. coli , the Rare
Codon Calculator (RaCC, NIH MBI Laboratory for Structural Genomics and Proteomics, UCLA, http://nihserver.mbi.ucla.edu/RACC/) was used. AtCIPK16 was found to contain 16 rare Arg codons,
4 rare Leu codons, 4 rare Ile codons and 1 rare Pro codon (Figure 4.9). Therefore, two codon bias-adjusted E.coli strains, BL21-CodonPlus(DE3)-RIL (containing extra copies of the argU, ileY and leuW tRNA genes, Stratagene, Cat. #230245, CA, USA) and BL21-CodonPlus(DE3)-RP
(containing extra copies of the argU and proL tRNA genes, Stratagene, Cat.#230255, CA, USA), were used to investigate whether they could enhance AtCIPK16 protein production. Unfortunately, the solubility of the His-AtCIPK16 protein in the two codon bias-adjusted E.coli strains was not significantly improved when compared to the levels observed in BL21-AI (Figure 4.10).
Figure 4.8: Rare E.coli codon analysis of the DNA sequence of AtCIPK16 using Rare Codon Calculator (RaCC, NIH MBI Laboratory for Structural Genomics and Proteomics, UCLA, http://nihserver. mbi.ucla.edu/RACC/). AtCIPK16 contains 16 rare Arg codons (Red), 4 rare Leu codons (Green), 4 rare Ile codons (Blue) and 1 rare Pro codon (Orange).
125
M 1 2 3 4 5 6
Figure 4.9: SDS-PAGE analysis of protein samples extracted from different E.coli strains: BL21-CodonPlus(DE3)-RIL, BL21-CodonPlus(DE3)-RP and BL21-AI M: Marker, lane 1-2: protein synthesised in BL21-CodonPlus(DE3)-RIL, lane 3-4: protein synthesised in BL21-CodonPlus(DE3)-RP, lane 5-6: protein expressed in BL21-AI. Protein samples were collected after a 4 h induction and collected after sonication as either a soluble protein (S) or insoluble pellet (P). Black arrow indicates the His-AtCIPK16 band of the expected size.
4.4.4.2 Low temperature induction shows no improvement in soluble protein yield
The temperature at which the induction takes place is another important factor which can be
optimised to improve protein solubility (Francis and Page 2010, Hartinger et al. 2010). Studies have
shown that low temperatures can reduce the total protein synthesised but can improve protein folding,
thereby increased the proportion of recombinant soluble protein (Francis and Page 2010, Weickert et
al. 1997). A number of induction temperatures were used to improve the solubility of His-AtCIPK16 protein. While it was possible to induce protein production at 28 °C, 30 °C, 33 °C, 35 °C and 37 °C
(lane 3-12), there was no improvement in solubility (Figure 4.11).
4.4.4.3 Induction of His-AtCIPK16 using 0.2 % L-arabinose resulted in the maximum yield of
insoluble recombinant protein
Lower concentrations of inducer may result in less total protein yield but more soluble protein, due to
slowing down the rate of protein synthesis (Rabhi-Essafi et al. 2007, Turner et al. 2005). To assess
the effect of inducer concentration on the production of soluble AtCIPK16, protein production was
induced by adding different percentages of L-arabinose (0.01, 0.02, 0.05, 0.1 and 0.2 %). Induction by 0.2 % L-arabinose resulted in the maximum yield of insoluble recombinant protein while no distinct solubility improvement was observed by decreasing the inducer concentration (Figure 4.11).
126
Although several attempts were made to enhance the solubility of recombinant His-AtCIPK16, it was still primarily produced in the insoluble form. Although further optimisation of the methods might improve the solubility of the recombinant protein, such as using different expression vectors containing a variety of different tags, utilisation of alternative expression systems, examining the various inducer concentration-temperature combinations and lower inducing temperature (≤25°C), the insoluble recombinant protein produced in the above reactions was used for purification due to time constraint.
Figure 4.10 SDS-PAGE analysis of protein samples from cultures induced at different temperatures and concentrations of L-arabinose. Lane 1: ladder, lane 2: crude bacterial lysate, lane 3-25: protein samples collected after sonication as soluble protein (S) and insoluble pellet (P). The black arrow indicates the expected size of the recombinant His-AtCIPK16 protein.
127
4.4.5 Recombinant His-AtCIPK16 was successfully denatured by Guanidine-HCl and purified by using cobalt chelating resin
Optimisation of various conditions during induction of protein expression showed no apparent improvement of the protein solubility. As further optimisation would be time-consuming, it was decided to use the insoluble AtCIPK16. The insoluble His-AtCIPK16 was solubilised using the denaturing agent Gu-HCl and then passed through a cobalt resin column. This allows the immobilisation of the protein to the cobalt resin through the formation of covalent bonds between the cobalt ions and the histidine tags (Bornhorst and Falke 2000, Hochuli et al. 1988). Thus the recombinant His-AtCIPK16 was bound to cobalt resin until elution, while all other proteins were washed away. Elution was performed using imidazole (Figure 4.12 A, column E2, E3 and E4) with increasing imidazole concentrations (150, 200 and 250 mM) leading to improved elution.
A B
Figure 4.11 SDS-PAGE gel of purified denatured His-AtCIPK16 extracted from E. coli and refolded His-AtCIPK16 A. Insoluble His-AtCIPK16 protein from E. coli was denatured in 6M Gu-HCl and purified using a TALON cobalt resin. Protein samples were collected from each of the protein purification steps (denaturation, passing through the column, 3 repeat wash steps and elution by a series concentration of imidazole). L=ladder, D=protein denatured in 6M Gu-HCl, U=unbound protein collected from the column flow-through, W1-W5: samples collected in 5 repeat wash steps, E1-E4: protein eluted from resin with 100, 150, 200, 250 mM imidazole. B. R1-R4: proteins collected from E1-E4 were refolded by gradual dialysis. Black arrow indicates target protein size.
4.4.6 Purified denatured His-AtCIPK16 was refolded using gradual dialysis
As the recombinant His-AtCIPK16 had to be denatured for purification by affinity chromatography, it was necessary to refold the denatured protein into its proper three-dimensional conformation to
128 recover its kinase activity. Gradual dialysis was used to refold the protein and SDS-PAGE was used to ensure that the protein was still present after dialysis. The obtained refolded protein samples were consistent with our expected size and high purity (Figure 4.12 B).
After checking the size and purity of refolded protein, a kinase assay was to be used to examine determine whether His-AtCIPK16 had been refolded properly and retained its enzyme activity. While attempts were made to measure the kinase activity of recombinant His-AtCIPK16, due to time constraints, optimisation of the kinase assay and the optimisation of the following pull-down assay were not finished.
4.4.7 Construction of the vector for yeast two hybrid assay
CIPK16 was previously identified as a regulator of the potassium transporter AKT1 (Lee et al. 2007).
The observation of GFP in the stelar tissue of Arabidopsis expressing a PromoterCIPK16::GFP construct (Roy et al. 2013) might suggest that AtCIPK16 is involved in the processes of Na + and K + loading or retrieval in the xylem. AtHKT1;1 and AtSOS1 are stele transporters which are responsible for Na + efflux and retrieval from the xylem under salt stress (Davenport et al. 2007, Horie et al. 2009,
Munns and Tester 2008, Qiu et al. 2004, Shi et al. 2002, Xue et al. 2011). To determine whether
AtCIPK16 can interact with these xylem located transporters, a targeted yeast two hybrid was used.
As the yeast two hybrid system cannot be used to detect the interaction of membrane localised transporters, fragments of AtHKT1;1, AtSOS1 and AtAKT1 which are cytoplasmic in location and may have a binding site for AtCIPK16 were cloned. A similar strategy had been previously used to show AtAKT1 interacting with AtCIPK16 (Lee et al. 2007). Consequently, these cytosolic fragments of each transporter were identified and used to construct the library.
To identify the cytosolic regions of the three transporters for cloning, the full-length proteins sequences of AtHKT1;1, AtSOS1 and AtAKT1 were analysed by TopPred 1.10 to predict transmembrane segments, cytosolic loops and extracellular loops. AtSOS1 has 12 putative transmembrane segments and 7 cytosolic regions (Figure 4.13A). Predicted phosphorylation sites are located on the N-terminal (Thr 3-Ser 27 ), in the centre of the protein (Ser 307 ) and the C-terminal cytosolic tail region (Thr 444 -Ser 1138 ) - Quintero et al. (2011) revealed that Ser 1138 was phosphorylated
129 by SOS2 (CIPK24). Therefore the nucleotide regions which encode the regions R1, Met 1-Leu 29 ; R2,
Thr 301 -Trp 315 ; R3, Thr 443 -Leu 1146 and R4, Arg 1133 -Leu 1146 were cloned into expression vectors.
AtHKT1;1 has 10 putative transmembrane segments throughout whole protein sequence (Figure
4.13B). Predicted phosphorylation sites are located in cytosolic loops (Thr 185 , Ser 191 -Ser 192 , Thr 260 ,
Tyr 265 , Tyr 267 , Ser 384 ). Therefore, potential regions of AtHKT1;1 for interacting with AtCIPK16 include the third cytosolic loop (R5, Thr 185 -Lys 193 ), the fourth cytosolic loop (R6, Thr 259 -Leu 286 ) and the fifth cytosolic loop (R7, Leu 365 -Lys 391 ) (Figure 4.13B).
AtAKT1 topology is similar to AtSOS1, containing several transmembrane segments and an extended cytosolic C-terminal tail (Figure 4.13C). Predicted phosphorylation sites are located at
N-terminal end (Ser 19 –Ser 51 ), the second cytosolic loop (Tyr 112 -Tyr 118 ) and C-terminal cytosolic tail
(Thr 296 -Ser 811 ) (Figure 4.13C). However, a previous study revealed that the C-terminal region
(Thr 482 -Leu 767 ) is responsible for interacting with CIPKs (Lee et al. 2007). Therefore, this C-terminal
region (R8, Thr 482 -Leu 767 ) (Figure 4.13C) is the potential region which will be cloned and verified the positive interaction with AtCIPK16. Once the function of this region is confirmed, the interacting sites will be narrow down by generating more specific truncated version of this region.
130
A AtSOS1 Extracellular
R2 R4 R1 R3
Cytoplasm
B AtHKT1;1 Extracellular
R5 R6 R7 Cytoplasm
C AtAKT1 Extracellular
Cytoplasm
R8 Figure 4.12 Topology model of AtSOS1, AtHKT1;1 and AtAKT1 with predicted phosphorylation sites. Topology models of AtSOS1, AtHKT1;1 and AtAKT1 were predicted by TopPred 1.10 (Mobyle portal Institut Pasteur: http://bioweb.pasteur.fr/seqanal/interfaces/toppred.html) (Claros and Vonheijne 1994) and phosphorylation sites were predicted by NetPhos 2.0 (www.cbs.dtu.dk/services/NetPhos/) (Blom et al. 1999). Red, green and blue locations indicate predicted Serine, Threonine and Tyrosine phosphorylation sites in the cytosolic loops. The topology models were drawn using TOPO2 (Johns S.J., TOPO2, Transmembrane protein display software http://www.sacs.ucsf.edu/TOPO2/). A, topology model of AtSOS1. B, topology model of AtHKT1;1. C, topology model of AtAKT1. Blue boxes indicate regions identified for cloning.
131
The C-terminal domain of AtCIPK16 harbours an NAF motif which is responsive for regulating the kinase activity. It is this region where CBLs bind and activate the protein (Batistic and Kudla 2004,
Guo et al. 2001, Hedrich and Kudla 2006). Removal of the C-terminal region harbouring the NAF
motif from AtCIPKs has been shown to give them constitutive kinase activity (Gong et al. 2002a,
Guo et al. 2001, Hashimoto et al. 2012). To improve the chance of detecting an interaction of
AtCIPK16 with a transporter protein fragment in the yeast two hybrid system, a truncated version of
AtCIPK16 (AtCIPK16Nt, missing the 470 bp at the 3′ of the gene (Ser 321 -Ser 469 )) was created.
Due to time constraints, the cloning work of potential cytosolic fragments of AtSOS1, AtHKT1;1 and
AtAKT1 for interacting with AtCIPK16 were not finished.
132
4.5 Discussion
CBL-CIPK signalling pathways play an important role in many important plant physiological processes such as embryonic development (Eckert et al. 2014), pollen germination (Maehs et al.
2013), regulation of NADPH oxidase RBOHF (Drerup et al. 2013), salt tolerance (Halfter et al. 2000,
Ishitani et al. 2000, Qiu et al. 2002, Quan et al. 2007, Shi et al. 2000), osmotic tolerance (Chen et al.
2013, Deng et al. 2013, Li et al. 2012), drought tolerance(Cheong et al. 2003, Cheong et al. 2010,
Yang et al. 2008a) and nitrate uptake (Ho et al. 2009, Hu et al. 2009). Although some proteins which are regulated by CBL-CIPKs have been identified, such as SOS1 (Qiu et al. 2002, Quintero et al.
2011, Shi et al. 2000, Yang et al. 2009), AKT1 (Li et al. 2006, Xu et al. 2006) and NRT1.1 (Ho et al.
2009), a large number of downstream targets of CBL-CIPK still remain unknown. Successful identification and characterisation of the target proteins will greatly enhance the understanding and function of the mechanisms of signalling pathways. One of the aims of this project was to identify the proteins activated by AtCIPK16 in the root.
4.5.1 Expression of recombinant protein His-AtCIPK16
Recombinant His-AtCIPK16 was generated by protein expression in E.coli . Although the protein was predicted to have a big chance of solubility (Section 4.4.4), in practice it was produced in a predominately insoluble form, despite numerous attempts to optimise the production conditions
(Figure 4.9). There are numerous techniques which can be used to help improve the solubility of the recombinant His-AtCIPK16, and several were tried here with no success, however, in future other options could be considered.
As analysis of the DNA sequence of AtCIPK16 suggests it contains codons not frequently used by
E.coli codon (Figure 4.8), expression of this plant protein in a bacteria may have resulted in protein mis-folding and insolubility (Kane 1995, Rosano and Ceccarelli 2009, Schenk et al. 1995).
Consequently, to eliminate this issue and improve the expression of AtCIPK16 in E.coli , a synthetic gene of AtCIPK16 which has been codons optimised for E. coli , but still produces the same amino acid sequence can be produced. Companies such as GenScript USA Inc., NJ, USA can artificially synthesis genes and would be appropriate to use. Alternatively, other expression systems which are not bacteria based, such as a wheat germ derived cell-free system or insect cell protein expression
133 system, could also be used to see if this would improve protein yield and solubility (Guild et al.
2011). These systems may have more success with a plant protein, since native proteins in E.coli are quite small and do not require chaperones to help with the folding of large multi-domain containing proteins (Baneyx and Mujacic 2004), which AtCIPK16 might require. Some vectors harbouring affinity tags, like Glutathione S-transferase (GST) and maltose binding proteins (MBP) which have been reported to help heterologous expressed proteins to fold correctly and thus increase solubility in
E.coli (Esposito and Chatterjee 2006, Niiranen et al. 2007, Raran-Kurussi and Waugh 2012). Use of these other alternative vectors may improve the yield of soluble AtCIPK16.
4.5.2 Potential downstream targets of AtCIPK16 The downstream targets of AtCIPK16 for salinity tolerance remain unknown and require investigation. Previously our lab showed that PromoterCIPK16::GFP fusion exhibited high fluorescence in the stelar tissue of roots (Roy et al. 2013). It suggested that AtCIPK16 might be involved in the processes of the Na + and K + loading or retrieval in the xylem, the transport of ions away from the stele, or compartmentation of ions in stelar cells, thereby regulating their movement to the shoot. AtCIPK16 has been identified as an interacting partner of potassium transporter AKT1
(Lee et al. 2007). However, the downstream targets of CIPKs vary depending on the presence/absence of various abiotic stresses and the interacting AtCBL partners. For example,
AtSOS2 (AtCIPK24) interacts with AtSOS3 (AtCBL4) at the plasma membrane, however, AtCIPK24 can also be recruited to the tonoplast by AtCBL10 (Kim et al. 2007). SOS1 was confirmed as the downstream target of AtCIPK24 at the plasma membrane (Shi et al. 2002), while the target of
AtCIPK24 on the tonoplast remains unknown, although evidence suggests it may be regulating Na +
compartmentation into the vacuole (Kim et al. 2007). SOS2 has also been implicated in the
interaction with vacuolar ATPases (Batelli et al. 2007) and tonoplast Na +/H + antiporters (Qiu et al. ,
2004) under salt stress. However, whether AtCIPK16 interacts with AKT1 to regulate K + transport under salt stress, thereby indirectly affecting shoot Na + accumulation, or with another target is still
unknown. AtHKT1;1 and AtSOS1, are two transporters responsible for Na + efflux and retrieval from
the xylem under salt stress (Davenport et al. 2007, Horie et al. 2009, Munns and Tester 2008, Qiu et
al. 2004, Shi et al. 2002, Xue et al. 2011). AtHKT1;1 is a Na + transporter controlling the unloading of
Na + from the transpiration stream by facilitating Na + influx into stelar cells. This reduces the amount
134 of Na + in the transpiration stream, thereby minimizing the Na + accumulation in shoots (Davenport et al. 2007, Horie et al. 2009, Munns and Tester 2008, Sunarpi et al. 2005). It has been hypothesised that post-translational modification of AtHKT1;1, may take place to regulate the transporter’s activity but this requires experimental verification (Zhu 2002, Zhu 2003). AtHKT transporters can mediate
Na + movement in X.Laevis oocytes in the absence of additional kinases (Mian et al. 2011, Munns et al. 2012, Uozumi et al. 2000), however, this is also true of proteins known to be phosphorylated by
CIPKs, e.g. AKT1 (Lee et al., 2007). AtSOS1 has been identified as a plasma membrane Na +/H + antiporter which mediates Na + exclusion from root cell (Luan 2009). Atsos1 knockout lines has shown more Na + accumulation in shoots under salt stress (Shi et al. 2002). While post-translational regulation of AtHKT1;1 still has to be shown, it is known that AtSOS1 requires an interacting kinase
(AtCIPK24) for protein modification and thus excluding Na + from the cell (Luan et al. 2009, Qiu et al. 2002, Weinl and Kudla 2009). Since AtCIPK16 might be involve in the processes of regulating the loading or retrieval of Na + in the stele under salt stress, AtSOS1 and AtHKT1;1, were hypothesised to be potential targets for AtCIPK16. However, as Y2H can't detect any interaction between kinase and transporters, due to the transporters being membrane-bound, attempts were made to clone cytosolic fragments of AtAKT1, AtSOS1 and AtHKT1;1. If AtCIPK16 interacts with them, further work will include co-expression of the kinase and one of the transporters in both X.Laevis oocytes and plants to evaluate the function of two components in ions transport. Unfortunately, due to time constraint, cloning work of these fragments hasn't been finished.
4.5.3 The alignment of 26 AtCIPKs shows unique regions of AtCIPK16 in functional motifs
AtCIPK16 contains several highly unique amino acids which located in the conserved regions compared to other 25 AtCIPKs (Figure 4.14).
In the activation loop, AtCIPK16 harbours a 15 amino acids region, (Met 164 -Asp 178 , Figure 4.14) which is not found in other AtCIPKs. The activation loop in all CIPKs is located at the N-terminal catalytic domain and contains three highly conserved residues (Ser, Thr and Tyr) (Batistic and Kudla
2004, Gong et al. 2002a, Gong et al. 2004). Besides the activation of CIPKs by the binding of a CBL protein to the NAF motif, the activation loop in the kinase represents a phosphorylation target by other unknown protein kinases to further enhance the activation of CIPKs (Guo et al. 2001, Kudla et
135 al. 2010). Guo et al. (2001) revealed that the mutation of this residue Thr to Asp leads to a constitutively hyperactive and CBL-independent kinase. Gong et al. (2002a) found the high conserved residue Ser is a potential target of phosphorylation. This specific region only present in the activation loop of AtCIPK16 contains two additional residues Ser 175 , Ser 176 which were predicted as phosphorylation sites by NetPhos 2.0 (www.cbs.dtu.dk/services/NetPhos/) (Blom et al. 1999) (Figure
4.14). This finding suggests that AtCIPK16 may have a unique function and is regulated by other kinases, thereby providing more accurate and exclusive regulatory in the signalling transduction.
Yeast two hybrid assays and mutations of the phosphorylation sites could be used for screening the interaction of this region with potential kinases in the future work.
The junction domain between the N-terminal catalytic domain and the NAF motif (for AtCIPK16 this can be found at Arg 279 -Arg 310 ) are not greatly conserved between the 26 AtCIPKs (Figure 4.14). In
AtCIPK16 there are five amino acids (Thr 283 , Ser 289 , Ser 296 , Thr 302 and Ser 318 ), which are absent from
most other AtCIPKs, that are predicted as potential phosphorylation sites by NetPhos 2.0 (Blom et al.
1999) (Figure 4.14). As the junction domain is responsible for the kinase activation (Guo et al. 2001),
the variation in the junction domain of AtCIPK16 suggests other known kinases or regulators could be involved in the specific activation of this kinase. To verify this speculation, yeast two hybrid
assays and mutations of the phosphorylation sites might be used for further investigation.
Comparison of the NAF motifs in the 26 AtCIPKs showed that AtCIPK5, AtCIPK16 and AtCIPK25 have high sequence similarity (Figure 4.14). The NAF motif has been identified to mediate the interaction with AtCBLs (Albrecht et al. 2001, Halfter et al. 2000, Kim et al. 2000). Thus, sequence similarities among three kinases suggest AtCIPK16 may share or partly share CBL interacting partners of AtCIPK5 and AtCIPK25. Kim et al. (2000) revealed using a yeast two hybrid system that the full-length of AtCIPK5 can’t interact with the AtCBLs 1, 3, 4, 5, 7 and 8, while its C-terminal region interacts with AtCBL1, 3 and 4. The results of Kolukisaoglu et al. (2004) indicated that the
full-length of AtCIPK5 moderately interacts with AtCBL1 and AtCBL9, when screening the
interaction of 25 AtCIPKs with either AtCBL1 or AtCBL9. AtCIPK16 appears to bind to similar
AtCBLs as AtCIPK5, interacting with CBL1, 2, 3, 4, 5, 9 and 10. It may therefore be possible to use
the amino acid sequences of the NAF domain of all AtCIPKs to determine which CBL interacts with
136 the kinase. Unfortunately, there has been little research on AtCIPK25, but what has been done suggests that AtCIPK25 does not interact with AtCBL1 and AtCBL9 (Kolukisaoglu et al. 2004). It therefore doesn’t appear likely that sequence similarity at the NAF domain is a feasible approach to understand which AtCBLs bind to which AtCIPK. Therefore, further work is required to investigate the relationship between the sequence of the NAF domain and the CBL which binds to it. In addition, two unconserved amino acids (Ser 330, , Ser 333 ) in NAF motif of AtCIPK16 were predicted as potential phosphorylation sites by NetPhos 2.0 (Blom et al. 1999) (Figure 4.14). Thus, this finding suggests these two sites might represent the potential targets of other interactors and provide more opportunities for regulation of the signalling transduction during the various processes in the plants.
137
Activation loop Junction region
138
Junction region NAF motif
Figure 4.13: Alignment of 26 AtCIPKs protein sequences using Vector NTI version 11.0 The alignment of 26 AtCIPKs protein sequences was generated using Vector NTI version 11.0 with the AlignX program. Amino acid residues were labelled as yellow for identical, blue for conserved and green for similar. Red box indicates predicted phosphorylation sites by NetPho 2.0 (www.cbs.dtu.dk/services/NetPhos/) (Blom et al. 1999). Blue box indicates the activation loop of AtCIPKs. Grey box indicates the junction region and orange box indicates the NAF motif.
139
4.5.4 Future work More work is required to finish the remaining steps to produce a working pull-down assay to identify the downstream targets of AtCIPK16. The kinase activity of the recombinant refolded
AtCIPK16 produced from E.coli (Section 4.4.4-4.4.6) still has to be determined, and, if so, the pull-down assay has to be performed by passing extracts of Arabidopsis proteins from the root of salt stressed transgenic plants overexpressing AtCIPK16 through the column which contains the mixture of recombinant refolded AtCIPK16 and anti-AtCIPK16 antibodies in order to capture the interacting partners of AtCIPK16 from plant extracts.
Alternatively, methods such as co-immunoprecipitation, could be performed to identify the downstream target(s). Co-immunoprecipitation would require a specific monoclonal antibody.
Cloning of AtCIPK16 into the destination vector pMDC83 (Figure 4.15) would allow the expression of an AtCIPK16 with a GFP tag on its C-terminus. There are monoclonal antibodies specific to GFP which could be attached to magnetic microbeads coupled to pull out
AtCIPK16::GFP and any interacting partners from a total plant protein extract. Ossenbuel et al. , (2006) use this technique to co-immunoprecipitate the D1 precursor protein in the cyanobacterium Synechocystis sp.
140
Figure 4.14: The vector pMDC83 will be used to express AtCIPK16 fused to GFP tag Feature Description attR1 Gateway recombination sequence Chlor Chloramphenicol resistance gene ccdB ccdB gene, the encoded protein is toxic to standard E. coli strains attR2 Gateway recombination sequence mgfp6 a plant-optimised GFP coding sequence nos-T nos-Terminator hptII Hygromycin resistance gene nptIII Kanamycin resistance gene pBR322 ori pBR322 origin of replication 2 × 35S promoter two copies of 35CaMVS promoter
To determine whether AtCIPK16 interacts with AtAKT1, AtSOS1 and AtHKT1;1, further work is required. The use system of a split-ubiquitin system (SUS) avoids the issues associated with membrane-bound proteins that is the limitation of yeast two hybrid studies (Duenkler et al. 2012, Grefen 2014, Johnsson and Varshavsky 1994, Stagljar et al. 1998). In the SUS, the bait protein is fused to the C-terminal fragment of ubiquitin (Cub) which is attached to a transcription factor. The prey protein is attached to the N-terminal fragment of the ubiquitin protein NubG, which has a single mutation site at Ile 13 (Ile 13 to Gly or Ala) to block the spontaneous reconstitution of Cub and Nub (Grefen 2014, Stagljar et al. 1998). Once the bait protein interacts with the prey protein, the two fragments of ubiquitin combine. The ubiquitin 141 moiety is then detected by ubiquitin-specific proteases within the cell, which results in the cleavage of the transcription factor from the C-terminus. The transcription factor diffuses through the cell and activates reporter genes in the nucleus (Grefen 2014, Stagljar et al. 1998).
As the SUS assay is based on ubiquitin reassembly on the cytosolic side of the membrane and then release of the transcription factor to the nucleus, this assay eliminate the significant Y2H’s limitation which is unable to detect the interaction of membrane proteins.
4.6 Summary
AtCIPK16 harbours a specific region in activation loop which is not found in other 25
AtCIPKs, suggesting unknown kinases might specifically regulate the activity of AtCIPK16 in the plant signalling transduction. Anti-AtCIPK16 antibodies were developed in this chapter and have been successful in recognising the recombinant protein, suggesting it could isolate the recombinant protein in a pull-down assay in the future work.
142
Chapter 5 Dissecting the role of AtCIPK16 in salinity tolerance
5.1 Introduction Na + influx from the soil into root epidermal cells is a passive process, as Na + influx is favoured energetically because of the concentration gradient and the transmembrane voltage gradient of the epidermal cells (Amtmann and Sanders 1999, Tester and Davenport 2003). The level of
Na + accumulation in plants is determined by the balance between passive Na + uptake and active Na + efflux (Tester and Davenport 2003). Transport of Na + from the root back to the soil is believed to be an essential, but energy expensive, mechanism to minimise Na + accumulation in plants during salinity stress (Tester and Davenport 2003). The salt overly sensitive (SOS) pathway in Arabidopsis is thought to be involved in this Na + efflux process. AtCBL4 (SOS3) as a calcium sensor which detects a change in cytosolic free Ca 2+ concentration resulting from
Na + stress, and recruits the protein kinase AtCIPK24 (SOS2) to the plasma membrane.
AtCIPK24 consequently activates the Na +/H + antiporter SOS1 by phosphorylation to mediate
Na + efflux from the root cells to the soil (Qiu et al. 2002).
Any remaining Na + which is not extruded from the plant root is transported through the epidermis, cortex, xylem parenchyma cells and then loaded into the xylem vessels. Na + is then transported from root to shoot via the transpiration stream (Munns et al. 2006, Tester and
Davenport 2003). The level of Na + toxicity of many plants is related to the amount of Na + accumulation in the shoot (Møller and Tester 2007, Munns 1993, Munns 2002, Tester and
Davenport 2003). Thus, another important mechanism is to minimise Na + accumulation in shoot, by minimisation loading of Na + into the xylem, and maximisation of Na + retrieval from the xylem (Munns 1993, Munns 2002, Munns et al. 2006, Tester and Davenport 2003).
AtHKT1;1 and SOS1 have been shown to be involved in this mechanism.
AtHKT1;1 is expressed in root stelar cells (Sunarpi et al. 2005) with athkt1;1 knockout 143 mutants demonstrating increased Na + content in the xylem sap (Sunarpi et al. 2005). Studies using the radioactive tracer 22 Na + revealed that AtHKT1;1 could be involved in Na + retrieval from the xylem and accumulation of Na + in the root (Davenport et al. 2007). In addition, the rice homologue, OsHKT1 has been in the root xylem parenchyma cells, increasing Na + retrieval from the xylem thereby minimizing Na + accumulation in shoots (Ren et al. 2005).
Additionally, AtSOS1 has been suggested to be involved retrieval of Na + from the xylem. After activation by upstream components, AtSOS1 in root parenchymal cells may control Na + loading into the transpiration stream thereby minimizing shoot Na + accumulation. In addition,
AtSOS1 in the shoot parenchymal cells may be involved in reducing Na + movement from the transpiration stream to the photosynthetic cells in leaves by transporting Na + into phloem sap, facilitating the recirculating back to the root (Shi et al. 2000, Shi et al. 2003).
Based on current understanding of Na + transport mechanism, manipulation of Na + transport processes in specific root cells might improve Na + exclusion from shoots and roots, thereby resulting in an improvement of salinity tolerance. Møller et al. (2009) demonstrated the specific expression of AtHKT1;1 in root stelar cells can reduce the transfer of Na+ from root to shoot thereby improving salinity tolerance in Arabidopsis. AtCIPK16 has been identified as a candidate gene for Na + exclusion and constitutive expression of this gene in Arabidopsis and barley significantly reduced Na + accumulation in shoots under salt stress (Roy et al. 2013).
However, AtCIPK16 is a protein kinase that does not directly transport Na + across membranes.
Therefore it is necessary to understand the mechanism by which AtCIPK16 is controlling ion transport.
AtCBL4, also known as SOS3, has been shown to interact with AtCIPK24 (SOS2) to phosphorylate SOS1, consequently regulating the Na + efflux at the plasma membrane during salt stress (Guo et al. 2001, Halfter et al. 2000, Ishitani et al. 2000, Kim et al. 2007, Kim et al.
2003b, Liu et al. 2000, Liu and Zhu 1998, Mahajan et al. 2008, Qiu et al. 2002, Qiu et al.
2004). As AtCBL4 has also been shown to interact with AtCIPK16 (Chapter 3) and like
AtCIPK16, AtCBL4 is expressed in the root (Albrecht et al. 2001, Cheong et al. 2003, Guo et 144 al. 2001, Halfter et al. 2000, Liu et al. 2000), it is possible that AtCIPK16 and
AtCIPK24(SOS2) work in a similar manner and have redundancy in their function. Therefore, a functional complementation analysis of constitutively expressing AtCIPK16 in the sos2 knockout background is necessary to examine the associated signalling pathway of AtCIPK16.
5.2 Chapter aims
The aims of this chapter are:
1. To examine whether AtCIPK16 works has a similar function to SOS2 by generating sos2
knockout lines which over-express AtCIPK16
2. To further investigate the mechanism by which AtCIPK16 reduces shoot Na + using a 22 Na +
flux assay
5.3 Methods
5.3.1 Plant materials for complementary function analysis
Three sos2 knockout lines were ordered from The European Arabidopsis Stock Centre (NASC).
The details of sos2 knockout lines are described in Table 5.1.
Table 5.1: sos2 knockout lines obtained from NASC.
NASC Allele Mutagen Background Phenotype References Line names in ID this chapter N3863 sos2 Fast Col(gl1) Hyper-sensitive to Na + (Halfter et sos2-1 neutrons and Li + stresses; plants al. 2000, Liu accumulate more Na + et al. 2000) and retain less K + than wild-type under salt stress; N681147 sos2 T-DNA Col-0 SALK line; no (Alonso et sos2-2 insertion phenotype information al. 2003) available N6528 sos2 T-DNA Col(gl1) Hyper-sensitive to Na + (Rus et al. sos2:hkt1;1 hkt1;1 insertion and growth deficiency 2004) under low K + conditions
5.3.2 Cloning of AtCIPK16 into constitutive expression vector To over-express AtCIPK16 in sos2 knockout lines, the coding sequence of AtCIPK16 was 145 cloned into pMDC32 (Figure 5.1) from entry vector pCR8-AtCIPK16 (Section 3.4.1) using an
LR reaction (Section 2.18) to construct pMDC32-AtCIPK16 . The integrity of the cloned
AtCIPK16 in pMDC32 was confirmed by Sanger sequencing (Section 2.9) to ensure no errors had been introduced.
5.3.3 Transformation of plasmid DNA into A.tumefaciens AGL1 competent cells pMDC32-AtCIPK16 was transformed into A. tumefaciens AGL1 following the protocol in
Section 2.19.2.
After selection of transformed colonies (section 2.19.2) the presence of AtCIPK16 in A. tumefaciens was confirmed by colony PCR (2.12.3) with specific primers (AtCIPK16_For and
AtCIPK16_Rev, Table 3.3). Cells containing AtCIPK16 were resuspended in 250 mL 5 % sucrose solution with 400 µL Silwet L-77 (Cat. # VIS-02, OsiSpecialties, USA) in preparation for Arabidopsis floral dipping transformation.
5.3.4 Stable constitutive over-expression of AtCIPK16 in sos2 knockout lines
For Agrobacterium-mediated transformation of pMDC32-AtCIPK16 , the three sos2 knockout lines were grown in soil (Section 2.3) and transformed by floral dipping as per Section 2.19.3.
5.3.5 Selection of transformants of AtCIPK16-sos2
Transgenic plants ( sos2 knockout lines) transformed with pMDC32-AtCIPK16, containing the
Hyg gene which confers resistance to the antibiotic hygromycin, were grown on MS plates containing 25 μg mL -1 hygromycin. The MS media plates were prepared as described in section 2.5, using circular petri dishes (145 diameter × 20 deep mm, Cat. # 639102, Greiner
Bioone, Frickenhausen, Germany). The medium contained 1/2 MS, 1% sucrose and 25 μg mL -1 hygromycin. Plant seeds were sterilised, stratified and germinated on the hygromycin medium as described in section 2.5. Antibiotic-positive transgenic seedlings were identified by size and health after 2 weeks and transformed seedlings were then transferred to pots (67 mm
× 85 mm, PUNTPX, Garden City Plastics, Victoria, Australia) with Arabidopsis Soil Mix supplied by the South Australian Research and Development Institute (SARDI) (Section 2.3). 146
After another 2 weeks, a leaf from each plant was used for DNA extraction (Section 2.6), which was used to verify the presence of the transgene gene using PCR (Section 2.12.1) with specific primers (AtCIPK16_For and AtCIPK16_Rev; control gene: Actin2_For and
Actin2_Rev, Table 5.2). After examining the presence of stable transformed full-length coding sequence of AtCIPK16 (1411 bp), which is a different size from native AtCIPK16 (2069 bp) in
Arabidopsis. After confirming the presence of the transgene, positive plants were kept in a long day growth room. Once plants had developed brown siliques, watering was stopped and the plants were moved to a dry cabinet until the siliques were completely dry for T 2 seed collection. The collected seeds were transferred into 1.5 mL microcentrifuge tubes and stored at 4 °C in the dark.
Table 5.2: Primers for genotyping AtCIPK16-sos2 lines
Primers Sequence ( 5′- ′) Tm*°C
AtCIPK16_For ATGGAAGAATCAAACCGTAGTAGTACTGTC 60.8
AtCIPK16_Rev TCATGAAACATTATTTATTTTGTTATCATT 59.7
Actin2_For CTCGTTTGTGGGAATGCAAG 58.9
Actin2_Rev GGTGCAAGTGCTGTGATTTC 56.1
*Primer T m was predicted by NetPrimer (http://www.premierbiosoft.com/netprimer/index. html)
5.3.6 Phenotyping of T 2 transgenic lines that constitutively over-expresses AtCIPK16 in sos2 knockout lines under salt stress
To characterise AtCIPK16-sos2 lines, the protocol described by Halfter et al. (2000) and Zhu et al. (1998) was used to investigate the phenotype of transgenic lines under salt stress (50 mM or 100 mM NaCl treatment) on plates. Briefly, seeds of T 2 transgenic lines of AtCIPK16-sos2 lines and Arabidopsis ecotype Col-0 were sterilised as described in Section 2.5. Seeds were placed on 1/2 MS, 3 % (w/v) sucrose and 0.8 % agar (pH 5.6) media on 100 × 100 × 20 mm square petri dishes (Cat. #82.9923.422, Sarstedt Australia Pty. Ltd., Australia) and kept at 4 °C for 2 days for stratification. Plates were then moved to short day growth room (light/dark
147 period: 10h/14h, temperature: 23 °C, light intensity: 100 μmol m -2 s-1, 60-75 % humidity).
After five days of growth of the seedlings were transferred to 1/2 MS, 3 % (w/v) sucrose and
0.8 % agar (pH 5.6) media supplemented with either 0 mM, 50 mM or 100 m) NaCl for 10 days. Whole seedlings were harvested for the analysis of Na + and K + concentration in the shoots as well as the biomass of shoots and roots.
A soil assay was also utilised to determine the salt tolerance of AtCIPK16 expressing sos2 complementary lines. Seeds were planted in an artificial soil mix (SARDI, Section 2.3) in a 29
× 35 cm sized tray, 40 plants per tray (Section 2.4). Two weeks after germination, seedlings were watered weekly with 400 ml of solution containing 20 mM NaCl and 0.66 mM CaCl 2.
The shoot and last fully expanded leaf were harvested from 5 week old plants.
5.3.7 Biomass and flame photometry measurements
For soil grown samples, the last fully expanded leaf was harvested from each plant and its fresh weight was recorded. The fresh weight of the rest of the shoot was recorded. Whole shoot biomass was the sum of the last fully expanded leaf and the rest part of the whole shoot. To harvest root samples from hydroponics experiments, the root tissue was washed with 10 mM
+ + MgSO 4, to remove residual Na and K on the surface, before the samples were weighed and digested in 1% nitric acid for 18 hours at 85 °C. Samples were then diluted in 1:10 or 1:20 using Milli Q water. The Na + and K + concentrations in leaf and root samples were determined using Model 420 Flame Photometer (Sherwood Scientific LTD, Cambridge, UK). Two leaves were kept from each plant as plant materials for genotyping.
For the samples grown on plates, the fresh weight of the whole shoot and root was recorded.
All plant materials were used for DNA extraction and genotyping. With 100 mM NaCl treatment the plants were severely inhibited by the salt stress so no DNA was extracted.
5.3.8 Genotyping
Shoot and root tissue were collected from each plant and DNA extracted using the Edwards method (Section 2.6.2). A PCR (Section 2.12.1) was employed to genotype the Hygromycin 148 resistant T2 transgenic lines using specific primers (transgene-specific: AtCIPK16_For and
AtCIPK16_Rev; control gene: Actin2_For and Actin2_Rev, Table 5.2).
5.3.9 RT-PCR
The Arabidopsis plants were grown in soil for 3 weeks and treated with 400 ml of 20 mM
NaCl and 0.66 mM CaCl 2 for one week. Three plants were used as biological replicates. To demonstrate the transgene was being expressed, RT-PCR was performed as described in
Section 2.14.4 using cDNA produced from RNA extracted from the root tissue of transgenic lines (Section 2.11) and the primers listed in Table 5.3.
RT-PCR was carried out with AtCIPK24, AtHKT1;1 and AtCIPK16 specific primers respectively (35 cycles) (Section 2.12.1). AtActin2 was used as the internal control gene amplified with 29 cycles.
Table 5.3: Primers for examining the expression levels of AtCIPK24, AtActin2, AtHKT1;1 and AtCIPK16
Primers Sequence (5′- 3′) Tm*°C Product size
AtCIPK16_Q_For ACTCTCAAGATTGCTTGTGCCG 61.9 229 bp
AtCIPK16_Q_Rev TGATGTGATGAATTGGAAGGCG 63.1
Actin2_For CTCGTTTGTGGGAATGCAAG 58.9 145 bp
Actin2_Rev GGTGCAAGTGCTGTGATTTC 56.1
AtCIPK24_Q_For GCTGTAGCGAACTCAATGGG 58.2 238 bp
AtCIPK24_Q_Rev TTCCTTCTGTTGCCCTCCAT 59.4
AtHKT1;1_Q_For TGGACTCATCGTGTCACAAC 53.8 239 bp
AtHKT1;1_Q_Rev GACTCCATCGTCCTGCAAC 55.4
*Primer T m was predicted by NetPrimer (http://www.premierbiosoft.com/netprimer/index.html)
5.3.10 Radioactive Tracer Experiments
Movement of Na + into root and transfer of Na + from roots to shoots in whole Arabidopsis
149 plants was measured using the radioisotope 22 Na + following the protocol modified from Møller et al., 2009.
+ To measure the amount of Na translocation from roots to shoots, three homozygous T 4 lines over-expressing AtCIPK16 Arabidopsis and one null line were grown in hydroponics for 4 weeks (Section 2.4), then pre-treated with 50 mM NaCl and 1.65 mM CaCl 2 for 5 days prior to the tracer experiment. Prior to the addition of 22 Na + plants, samples were acclimatised by incubating their whole root system in uptake solution (50 mM NaCl and 0.5 mM CaCl 2) without the isotope at room temperature for 10 min. Three 20 μL aliquots of uptake solution were collected at the beginning of the uptake period for calculating the specific activity of the uptake solution. Uptake was started by transferring plants to 335 ml of uptake solution containing 20 μCi·L -1 of 22 Na + (equal to 740 KBq per litre). Plants were gently rotated on a shaker at 20-30 RPM for 60 min at room temperature under an irradiance of 85-105
μmol·m -2s-1. Plant roots were then rinsed in cold rinse solution (50 mM NaCl and 10 mM
CaCl 2) for 2 min, followed by another rinse in fresh cold solution (50 mM NaCl and 10 mM
22 + 22 + CaCl 2) for 2 min to remove all traces of apoplastic Na or Na left on the root surface.
Three 20 μL aliquots were collected at the end of the one hour flux to demonstrate that the nominal Na + concentration remains unchanged during the flux experiment. The roots were then blotted with a tissue and separated from the shoots. The root and shoot samples were placed into pre-weighed scintillation vials, weighed again and mixed with 4 mL of Ecolume scintillation cocktail. 22 Na + was liberated by exposure of the plant tissue to the scintillation fluid for 2 h in the dark and was then measured on a liquid scintillation counter (Beckman LS
6500 Scintillation Counter, Beckman Coulter Inc., California, USA).
Na+ content of the tissues was calculated by converting the 22 Na + content to nominal Na + content using the following equation:
(CPM in plant sample-CPM in blank) Na + content (nmols) = Specific activity of flux solution
150
CPM in 20 μL aliquot Specific activity = total nmoles of nominal Na in the 20 μL sample
(CPM in shoot-CPM in blank)/shoot fresh weight 22 Na + translocated to shoot (%) = (CPM in root-CPM in blank)/root fresh weight CPM= counts per minute
For roots, the final results were expressed as: nmol of Na + per gram fresh weight.
For shoots, the source of 22 Na + was the root, not the external solution, therefore expressed as
CPM per gram fresh weight.
151
5.4 Results
5.4.1 Vector constructed for stable constitutive expression of AtCIPK16 in sos2 knockout lines To constitutively express AtCIPK16 in sos2 knockout lines, a new destination vector was constructed (Figure 5.1). An LR reaction (Section 2.18) was used to transfer the full-length coding sequence of AtCIPK16 , from pCR8-ATCIPK16 (Chapter 3) into pMDC32 . This allows the 35S promoter to drive the expression of AtCIPK16 in planta .
Figure 5.1 pMDC32-35S:AtCIPK16 for constitutive over-expression of AtCIPK16 in sos2 knockout lines
Feature Description attB1 Gateway attB1 adapter hptII Hygromycin resistance gene pBR332 origin pBR322 origin of replication attB2 Gateway attB2 adapter nos-T nos-Terminator nptIII Kanamycin resistance gene pAg7 Agropine synthase polyadenylation signal sequence 2 × 35S promoter two copies of 35CaMVS promoter
152
5.4.2 Analysis of the expression level of sos2, AtCIPK16 in sos2 knockout lines and complimentary lines
To determine the expression levels of AtCIPK24, AtHKT1;1 and AtCIPK16 in transgenic lines,
RT-PCR was performed. Results confirmed AtCIPK24 was disrupted in the three sos2 knockout lines and AtHKT1;1 was absent in the double knockout sos2:hkt1;1 line (Figure 5.2).
Although not a quantitative assay, it was noted that complimentary lines had higher expression levels of AtCIPK16 in root tissue (Figure 5.2).
Figure 5.2 Expression analysis of sos2 knockout lines and AtCIPK16-sos2 complimentary lines The expression levels of AtCIPK24, AtHKT1;1 and AtCIPK16 in transgenic lines were confirmed by RT-PCR using cDNA which was synthesised from RNA extracted from root tissue. The Arabidopsis plants were grown in soil for 3 weeks and treated with 400 ml of 20 mM NaCl and 0.66 mM CaCl 2 at last week. Three plants were used as biological replicates. RT-PCR was carried out with AtCIPK24, AtHKT1;1 and AtCIPK16 specific primers respectively (35 cycles). AtActin2 was used as the internal control gene amplified with 29 cycles. (-) represents an negative control (water replaced with DNA); (+) represents a positive control (cDNA from Col was used as the positive control of AtCIPK24 ; pCR8-AtHKT1;1 or pCR8-AtCIPK16 was used as the positive control of AtHKT1;1 or AtCIPK16 ). sos2-1 = sos2 knockout N3863. com-1 = sos2 knockout N3863 with 35S:AtCIPK16 sos2-2 = sos2 knockout N681147. com-2 = sos2 knockout N681147 with 35S:AtCIPK16 sos2:hkt1;1 = sos2 hkt1;1 knockout N6528. com-3 = sos2 hkt1;1 knockout line N6528 with 35S:AtCIPK16
153
5.4.3 Constitutive expression of AtCIPK16 fails to complement the salt sensitivity phenotype of sos2 knockout lines
To examine the functional redundancy of AtCIPK24 and AtCIPK16 in salt stress, the salt tolerance of AtCIPK16 -sos2 lines were examined using both plate and soil assays.
For the plate assay, sos2 and AtCIPK16-sos2 lines were grown on MS media for 5 days, then transferred to plates with either 0 mM, 50 mM and 100 mM NaCl for another 10 days. All sos2 knockout and AtCIPK16 complementary lines had inhibited root length (Figure 5.3 A and B), lower shoot biomass (Figure 5.3 A and C) and lower root biomass (Figure 5.3 A and D) when compared to Col-0, when grown on 50 mM or 100 mM NaCl. While most of the Col-0 plants were able to stay green and healthy (albeit with reduced shoot and root growth) on NaCl concentrations up to 100 mM NaCl, all of the mutants exhibited a large amount of senescent tissue (Figure 5.3 A).
In the soil assay, after two weeks growth with 0 mM NaCl and then weekly watering with 20 mM NaCl for three weeks, Col-0 had the highest shoot biomass and the lowest shoot Na + content compared to the knockout and complementary lines (Figure 5.4). The sos2-1 and sos2-2 knockouts and their complimentary lines, showed the greatest reduction in shoot biomass and higher K + concentrations than Col-0 (Figure 5.4). Interestingly, shoot Na + concentration was lower in sos2 :hkt1;1 knockout and complimentary lines, suggesting that it maintains some exclusion mechanisms. However, there were no difference between the respective knockout and complimentary lines ( sos2-1 and com-1 or sos2-2 and com-2) for their shoot biomass, shoot Na + and K + content suggesting that AtCIPK16 cannot replace SOS2. The sos2:hkt1;1 double knockout line (Rus et al. 2004) and its complementary line (com-3) showed higher shoot biomass and lower K+ content compared to the other sos2 mutants and their complementary lines (Figure 5.4 A, C) but still did not grow as well as wild type plants.
As there was no significant difference in the phenotype response to NaCl stress in the various sos2 knockout lines and complementary lines it appears that constitutive expression of
AtCIPK16 is unable to complement the sos2 salt sensitivity phenotype.
154
A 0 mM NaCl: Col -0 sos2 -1 com -1 sos2 -2 com -2 sos2:hkt1 com -3
50 mM NaCl: Col -0 sos2 -1 com -1 sos2 -2 com -2 sos2:hkt1 com -3
100 mM NaCl: Col -0 sos2 -1 com -1 sos2 -2 com -2 sos2:hkt1 com -3
155
Figure 5.3 Characterisation of sos2 knockout and sos2-AtCIPK16 complimentary lines on plates A. Seedling phenotypes of ecotype Col-0, sos2 knockout lines and complementary lines on the MS media supplemented with 3 % sucrose and various concentration of NaCl (0 mM, 50 mM and 100 mM). The pictures were taken after 10 days of NaCl treatment. B. Root length, C. Shoot biomass and D. Root biomass of each line treated with 0, 50 or 100 mM NaCl. All results are the mean ± SEM (n = 5). sos2-1 = sos2 knockout N3863. com-1 = sos2 knockout N3863 with 35S:AtCIPK16 sos2-2 = sos2 knockout N681147. com-2 = sos2 knockout N681147 with 35S:AtCIPK16 sos2:hkt1;1 = sos2 hkt1;1 knockout N6528. com-3 = sos2 hkt1;1 knockout line N6528 with 35S:AtCIPK16 Scale bar = 2 cm.
156
Figure 5.4 Characterisation of sos2 knockout and sos2-AtCIPK16 complimentary lines on soil A. Shoot biomass B. Na + accumulation in shoots C. K+ accumulation in shoots of ecotype Col-0, sos2 knockout lines and complementary lines with salt treatment. All results are the mean ± SEM (n = 8). sos2-1 = sos2 knockout N3863. com-1 = sos2 knockout N3863 with 35S:AtCIPK16 sos2-2 = sos2 knockout N681147. com-2 = sos2 knockout N681147 with 35S:AtCIPK16 sos2:hkt1;1 = sos2 hkt1;1 knockout N6528. com-3 = sos2 hkt1;1 knockout line N6528 with 35S:AtCIPK16 a, b and c represent data groups which are statistically different using a t-test (p < 0.05).
157
5.4.4 Movement of 22 Na + through 35S:AtCIPK16 expressing Arabidopsis
As AtCIPK16 does not appear to compliment the loss of SOS2, the mechanism by which
AtCIPK16 reduces shoot Na + was investigated further. To determine whether AtCIPK16 over-expressing plants have reduced root to shoot transfer of Na + or reduced Na + influx into the root, the levels of Na + entering a plant were investigated. Using three previously generated over-expression lines of AtCIPK16 (Roy et al. 2013) had been generated and the expression levels of the gene were confirmed using RT-PCR (Figure 5.5). Results showed transgenic lines had higher expression levels of AtCIPK16 in roots.
An initial investigation into the amount of Na + in the roots of 35S:AtCIPK16 Col-0 plants using hydroponic grown 4 week old over-expressing AtCIPK16 Col-0 plants with 50 mM salt treatment for 5 days, suggesting that the transgenic lines had less Na + in their roots (Figure 5.6).
To investigate this result further a 22 Na + flux assay was used to determine if the protein can either alter root Na + influx or Na + translocation to the shoot.
When grown under 50 mM salt stress in hydroponics for 5 days, 5 week old over-expressing
AtCIPK16 Col-0 had lower amounts of shoot 22 Na + after exposure to 22 Na + for 60 min (Figure
5.7 and Table 5.4). However, only OEX-3 showed a significant lower 22 Na + content in the root compared to nulls after incubation in 22 Na + for 60 min. The three AtCIPK16 over-expressing lines displayed lower (but not significant) translocation rate of 22 Na + from the root to shoot compared to nulls (Figure 5.7 C and Table 5.4).
158
Figure 5.5 The expression levels of AtCIPK16 in transgenic lines were confirmed by RT-PCR using cDNA which was synthesised from RNA extracted from root tissue. The Arabidopsis plants were grown in hydroponics for three weeks and treated with 50 mM
NaCl and 1.67 mM CaCl 2 for one week. Three plants were used as biological replicates. RT-PCR was carried out with AtCIPK16 specific primers (35 cycles). AtActin2 was used as the internal control gene amplified with 29 cycles. (-) represents negative control (water replaced with DNA); (+) represents positive control (plasmid DNA of pCR8-AtCIPK16 was used as the positive control of AtCIPK16 ).
Figure 5.6 Measurement of Na + content in 35S:AtCIPK16 over-expressing Col-0 and nulls after 5 days 50 mM NaCl treatment in the initial experiments The Arabidopsis plants were grown in hydroponics for four weeks and treated with 50 mM
NaCl and 1.67 mM CaCl 2 for 5 days prior to samples harvested. Results are the mean ± SEM, n = 8-15 plants.
159
A B
*
C
Figure 5.7 Measurement of 22 Na + content in 35S:AtCIPK16 over-expressing Col-0 and nulls using radioactive tracer 22 Na + A. Na + content in roots of transgenic and nulls using radioactive tracer 22 Na +. B. 22 Na + content in shoots of transgenic and nulls using radioactive tracer 22 Na +. C. % 22 Na + translocated from the root to the shoot in transgenic and nulls using radioactive tracer 22 Na +. Results are the mean ± SEM, n = 5-18 plants. t-test, * indicates p < 0.05.
Table 5.4 Tissue concentrations of 22 Na + and % translocated from root to shoot. Results are the mean ± SEM (n = 5-18 plants)
Na content in roots 22 Na + in shoots 22 Na + translocated line sample no. (μmol·g -1FW) (CPM·g -1FW) to shoot (%) Null 3.54 ± 0.33 643.52 ± 123.63 22.32 ± 2.60 n = 18 OEX-1 3.55 ± 0.12 561.14 ± 77.96 20.23 ± 2.97 n = 12 OEX-2 3.51 ± 0.19 553.50 ± 70.82 20.61 ± 2.02 n = 18 OEX-3 2.36 ± 0.21 382.82 ± 52.23 20.44 ± 1.25 n = 5
160
5.5 Discussion In the SOS pathway, CIPK SOS2 (AtCIPK24) has been identified as a downstream target of the CBL SOS3 (AtCBL4) and is recruited to the plasma membrane to phosphorylate the
Na +/H + antiporter SOS1, thus activating it and mediating Na + efflux from the cell (Qiu et al.
2002). As AtCBL4 has also been shown to interact with AtCIPK16 (Chapter 3), it was speculated that AtCIPK16 may perform similar functions to SOS2 and that expression of
AtCIPK16 in a sos2 knockout Arabidopsis line, may improve the line’s salt tolerance. However, sos2 knockout lines constitutively expressing AtCIPK16 are still salt sensitive (Figures 5.3 and
5.4). The reasons behind these results will be discussed below.
5.5.1 AtCIPK16 and AtCIPK24 could have no functional redundancy
SOS2 and AtCIPK16 may perform different functions in regulating the transport of Na + through a plant. SOS2 is expressed highly in pollen (Schmid et al. 2005, Wang et al. 2008), moderately in leaf, shoot and root (Liu et al. 2000, Schmid et al. 2005) and flower (Schmid et al. 2005). In the root SOS2 is recruited to the plasma membrane by AtCBL4 to activate SOS1, thereby mediating Na + efflux (Qiu et al. 2002), but is also recruited to the tonoplast by
AtCBL10 in the shoot (Kim et al. 2007). In addition, SOS2 has been found to interact with two regulatory subunits of the vacuolar ATPase, and is possibly involved in the establishment of proton concentration gradient at the vacuolar membrane - important for the activity of tonoplast localised Na +/H + antiporters (Batelli et al. 2007). This evidence suggests a function of SOS2 is in coordinating ion transport processes which are important cellular responses during salt stress. Unlike SOS2 , AtCIPK16 is mainly expressed in the root, with GFP observed in the stelar tissue of Arabidopsis roots in promoterCIPK16::GFP plants (Roy et al . 2013), suggesting the kinase is likely only involved in the salt response in roots, such as Na + and K + transport which might include regulation of the loading or retrieval of Na + and K + in the xylem therefore reducing Na + movement to the shoot. The results of BiFC in Chapter 3 suggest nuclear localisation of many AtCBL-AtCIPK16 complexes, suggesting that AtCIPK16 may function by regulating transcription factors in the nucleus which direct the plant’s response to the stress. Therefore AtCIPK16 may not be directly targeting transporters, like AtCIPK24, but regulating upstream processes which consequently lead to alterations in ion transport. If this 161 hypothesis is found to be true, the different expression profile, location of the AtCIPK16 and
SOS2 within the cell, and lack of complementary might suggest that CIPK16 and SOS2 have different functions in the salt stress signalling pathway.
Another possibility is that AtCIPK16 may be involved in the regulation of SOS2 or the expression of the SOS2 . It is known that CIPKs are regulated by other kinases. The microscopy pictures from Chapter 3 which show AtCIPK16 is found in the nucleus, might suggest that
AtCIPK16 is involved in regulating gene expression (by regulating transcription factors) or in downstream modulation of salt tolerance response. If AtCIPK16 improves the salt tolerance of
Arabidopsis through the direct or indirect regulation of SOS2, then expressing AtCIPK16 in sos2 knockout plants will not recover the plant’s salt tolerance as a functional SOS2 is not present. Further work exploring whether AtCIPK16 has a direct or indirect role in SOS2 regulation is required.
However, there may be other explanations for the failure of AtCIPK16 to compliment the loss of SOS2. Only one independent transgenic line expressing AtCIPK16 from each sos2 knockout was used for complementation analysis, instead of three. For most journal publications a minimum of three independent transformation events for each line is required to demonstrate that the phenotype observed is not due to the insertion site of the transgene (potentially knocking out a native gene) rather than the transgene itself. This may result in the failure of complementing the salt-sensitivity phenotype of sos2 knockout lines. This is unlikely, however, as three sos2 knockout mutants were transformed and no phenotype was seen in any of them.
The sos2:hkt1;1 double knockout line in this study demonstrated a higher shoot biomass and a lower shoot K + content compared to other sos2 mutants (Figure 5.4). Interestingly, hkt1;1 suppresses the salt sensitivity phenotype of sos2 knockout line and improves biomass of sos2 knockout which was observed in Rus et al. (2004). However, suppression of hkt1;1 could not reach the salt tolerant level of wild type Col-0 (Figure 5.4 A, t-test, p < 0.05). The SOS pathway and AtHKT1;1 are two important regulators for controlling the Na + homeostasis in plants. Disruption of either one of them results in ion disequilibrium therefore leads to salt 162 hypersensitivity phenotype of plants (Liu et al. 2000, Rus et al. 2001), while double knockout lines displayed partially re-established ion homeostasis. This may suggest other unknown functions of AtHKT1;1, which may include tight coordination with other ions transporters to mediate Na + homeostasis intracellularly and intercellularly. Therefore, further investigation might be required to reveal the association between HKT1;1 and SOS pathway.
As AtCIPK16 could not complement the salt sensitivity phenotype of sos2 knockout lines, the question still remains on how AtCIPK16 alters the Na + uptake and Na + movement in plants during salt stress. Comparison the Na + flux in transgenic lines and null using radioactive tracer
22 Na + would be helpful to answer this question.
5.5.2 AtCIPK16 may alter net Na + influx in root
Both preliminary experiments and the radioactive tracer 22 Na + demonstrated transgenic lines showed lower Na + content in the root, than the nulls under 50 mM NaCl treatment. These results suggest that over-expression of AtCIPK16 can lead to an inhibition of Na + influx from the soil or/ and increase in Na + efflux to the soil. Care must be taken however, no to infer that this is the function of the native AtCIPK16 in plants as promoterCIPK16::GFP lines only had a strong GFP fluorescence in stelar cells (Roy et al. 2013), suggesting that AtCIPK16 might be mainly expressed in root stele and may be involved in the processes of the Na + and K + loading or retrieval in the xylem. If AtCIPK16 is involved in mediating either the movement of Na + or
K+ into or out of cells, then constitutively over-expressing the gene will results in artefacts. If
AtCIPK16 is not usually found expressed in epidermal cells but is expressed there in
35S:AtCIPK16 lines then the protein could still perform its functions in these cells (assuming the necessary parts of the CBL/CIPK16 signalling pathway are still present i.e. upstream and downstream targets), either moving Na + or K + into or out of the epidermal cell – a similar function to what it is doing in stelar cells.
Another possibility is that AtCIPK16 may be only involved in K + movement, by phosphorylating transporters such as AKT1 (Lee et al. 2007); increased K+ content in plant roots will reduces the amount of Na + in the root and therefore the amount of Na + in the shoot. 163
Roy et al. (2013) showed no difference in shoot K + content but root K + was not determined. It is therefore important in the future to determine K+ content in root tissue of 35S:AtCIPK16 transgenic plants by flame photometry. Caution should be taken in interpreting the root Na + results presented here, although a large drop in root Na + was observed in the preliminary study, the concentration of root Na + of 35S:AtCIPK16 lines during the follow up 22 Na + experiment was only significant for one line. These experiments should be replicated and more time spent on dissecting the root Na + trait.
The protocol used for the radiation experiment is based on Møller et al. (2009) which successful revealed the function of HKT1;1 in cell type specific lines. HKT1;1 as a Na + transporter, directly mediates Na + movement at the plasma membrane (Platten et al. 2006); while AtCIPK16 as a protein kinase, is considered to be activated by CBL and then likely to mediate Na + exclusion by phosphorylation of downstream targets. Therefore, the efficiency of
Na + transport in these two proteins might be quite different and so some optimisation of the steps in the 22 Na + protocol may be required, such as extension of the uptake period and optimisation of solutions and pre-treatment. To gain a greater knowledge of the mechanisms for AtCIPK16’s role in salt stress, more characterisation of the function of the protein will be required.
5.5.3 Future work
Questions still remain about the mechanisms of AtCIPK16 function in both wild type, over-expressing and sos2 knockout lines. A greater understanding of these mechanisms will aid an understanding of the role of AtCIPK16.
Measurements of Na + content in xylem sap (Navarro et al. 2003, Olias et al. 2009) would allow the function of AtCIPK16 in Na + retrieval from the xylem sap under salt stress to be investigated. Scanning electron microscopy with X-ray microanalysis can be used to determine the amount of Na + accumulation in different cell types of the root, including epidermis, cortex, endodermis, pericycle and xylem parenchyma cells (Møller et al. 2009). This could reveal how
AtCIPK16 alters the Na + movement through root tissue during salt stress in over-expressing 164 lines. In addition, microelectrode ion flux estimation (MIFE) is an alternative non-invasive technique could be utilised to see if 35S:CIPK16 lines have altered influx or efflux of Na + or
K+ in the root (Cuin et al. 2011, Henriksen et al. 1992, Kuhtreiber and Jaffe 1990, Newman
2001).
5.6 Summary
AtCIPK16 was found not to compliment sos2 knockout lines, with AtCIPK16 sos2 lines showing similar shoot and root biomass, as well as Na + and K + concentrations as the knockouts.
22 Na + flux assays demonstrated that while slightly lower shoot and root 22 Na + concentrations were observed in the transgenic lines, no real significant difference (with the exception of root
Na + in one line) could be observed.
Before a firm conclusion can be made about the function of AtCIPK16 in improving the salt tolerance of Arabidopsis further experimentation is required.
165
Chapter 6: Characterisation of AtCIPK16 under various abiotic stresses
6.1 Introduction
Individual CIPKs interact with one or several CBLs to regulate various cellular functions in response to different abiotic stresses. For instance, CIPK3 is involved in ABA signalling and cold stress (Kim et al. 2003a, Pandey et al. 2008); CIPK23 has been shown to be important under low K + stress and in regulation of leaf transpiration (Cheong et al. 2007); CIPK6 has been found to be involved in the response to salt/osmotic stress and ABA (Chen et al. 2013); while CIPK8 is involved in the nitrate response and guard cell responses in plants (Hu et al.
2009, McLachlan et al. 2009).
Very few papers have focused on the function of CIPK16 under various abiotic stresses (Roy et al. 2013). The only CIPK16 which has been studied is ZmCIPK16, isolated from maize ( Zea mays ), which was found to improve salt tolerance and be strongly induced by PEG6000, NaCl,
ABA and drought (Zhao et al. 2009). However, the amino acid sequence identity and similarity between AtCIPK16 and ZmCIPK16 are 52.8 % and 75.0 % (http://fasta.bioch.virginia.edu/ fasta_www2/fasta_www.cgi?rm=compare) respectively. These proteins could therefore have quite different functions. Given other AtCIPKs have been shown to be important under multiple stresses, it is reasonable to assume that AtCIPK16 could be involved in multiple stresses.
According to the results in Chapter 3, AtCIPK16 interacts with AtCBL1, AtCBL2, AtCBL3,
AtCBL4, AtCBL5, AtCBL9 and AtCBL10. Previous studies have exhibited AtCBL1, AtCBL4,
AtCBL5 and AtCBL10 are involved in salt stress (Cheong et al. 2003, Cheong et al. 2010,
Kim et al. 2007, Qiu et al. 2002, Quan et al. 2007); AtCBL1, AtCBL2, AtCBL3, AtCBL4,
AtCBL9 and AtCBL10 are involved in K + transport (Cheong et al. 2007, Held et al. 2011, Ren
166 et al. 2013, Tang et al. 2012, Xu et al. 2006); AtCBL1, AtCBL2 and AtCBL9 are involved in response to ABA signalling during abiotic stress (Batistic et al. 2012, D'Angelo et al. 2006,
Pandey et al. 2004); AtCBL1 is involved in cold stress (Huang et al. 2011); AtCBL1 and
AtCBL5 are involved in drought and osmotic stresses (Cheong et al. 2003, Cheong et al. 2010).
AtCIPK16 may therefore have a role in these stresses.
Previously, transgenic Arabidopsis lines over-expressing AtCIPK16 were shown to reduce shoot Na + accumulation and increase salt tolerance (Roy et al. 2013). This material provides the perfect opportunity to investigate the role of AtCIPK16 in other abiotic stresses. A potential range of abiotic stresses, including osmotic, drought, cold, low K + stresses and ABA treatment, can be tested to investigate the role of AtCIPK16 in these stresses.
In this chapter, the majority of abiotic stresses were applied on agar plates. Agar plates provide a simple and sterile experimental system to investigate the response of the shoot and root to different stresses and are commonly used for growing the plants in the laboratory. The advantages of this system include potential accessibility to all tissues in plants and simple regulation of the nutrient in growth medium when compared with soil that may have issues caused by the complex interaction of various ions with soil particles (Conn et al. 2013). Due to medium containing nutrients and sucrose, plant samples are must be sterilised for agar plates grown. This system was employed for investigating the responses of transgenic over-expression lines to osmotic stresses (200 mM, 300 mM mannitol), low K + stress, KCl stress (100 mM, 150 mM KCl) and ABA treatments. As the sugar alcohol mannitol was used to induce osmotic stress, a plate system was preferred over a hydroponics or soil assay to reduce infection by fungi and bacteria. As a number of studies (Liu et al. 2013, Xu et al. 2006) successfully characterised function of the various genes under low K + using agar plates system, the same system and nutrient medium were employed in the experiments of the low potassium stress. Consequently, to compare the data from low K + and high K + stress, agar plates system was also used in the experiments of KCl treatment. The germination assay under different
ABA treatments, agar plates system was used due to accurate manipulation of ABA concentration in medium, easy observation of samples and high throughput (for germination 167 assay). All of the seedlings in these experiments (osmotic, low K +, KCl and ABA) required less than four weeks growth.
6.2 Chapter aims
The aims of this chapter are:
• To analyse the expression profile of AtCIPK16 in silico under a variety of stresses
• To phenotype 35S:AtCIPK16 expressing Arabidopsis after exposure to ABA, drought, cold,
osmotic, low K + and high K + stress .
6.3 Materials and methods
6.3.1 In silico analysis of AtCIPK16
Genevestigator (version 4.0) (Hruz et al. 2008) was used to analyse the expression profiles of
AtCIPK16 under a variety of stresses. The Affymetrix microarray probe set for AtCIPK16 ,
264375_at, was used to search the database.
6.3.2 Selection of homozygous transgenic lines that constitutively over-expresses
AtCIPK16
T3 lines, containing a pTOOL2-35S:AtCIPK16 (Figure 6.1) were previously generated in our laboratory (Roy et al. 2013). To screen for homozygous transgenic lines, T 3 seeds were grown in soil for 10-12 days as described in Section 2.3 and Section 2.20.1 and then sprayed with 100
μg mL-1 glufosinate. After observation of segregation ratio, as determined by the number of surviving plants vs those that were dying, positive transgenics were transferred into individual pots and transgene presence confirmed by PCR using genomic DNA, as described in Section
2.12.1. 35S promoter-specific primers 35S For and 35S Rev listed in Table 6.1, were used to identify transgenics. One microliter of gDNA was used as a temple. Positive plants were moved into a long day growth room (light/dark period: 16h/8h, temperature: 23 °C day/21 °C night, light intensity: 100 μmol m -2 s-1, 60-75 % humidity) to induce bolt formation and flowering. When the first siliques ripened, plastic bags were placed over the plants and secured by stick tape at the bottom to ensure only seeds from that plant were collected. Once all siliques on the plant were brown, watering was stopped and the plants were moved to a drying 168 cabinet until the siliques were completely dry for seed collection. The T 4 seeds were transferred into 1.5 mL microcentrifuge tubes and stored at 4 °C in the dark.
Table 6.1 Primers used for identifying homozygous transgenic lines over-expressing AtCIPK16
Primers Sequence (5′- 3′) Tm* Size
35S For TGTGATATCTCCACTGACGTAAGG 58.8 °C 347 bp
35S Rev ATTTGCTCCATCATGCCAC 56.1 °C
*Primer T m was predicted by NetPrimer (http://www.premierbiosoft.com/netprimer/index. html)
169
Figure 6.1 pTOOL2-35S:AtCIPK16 for constitutively over-expressing AtCIPK16 in Arabidopsis (Roy et al. 2013)
Feature Description attB1 Gateway attB1 adapter site AtCIPK16 The full-length gene of AtCIPK16 , including the intron (2069 bp) attB2 Gateway attB2 adapter site LB Left border RK2ori RK2 origin of replication Bla(amp) Ampicillin resistance gene for selection in E.coli ColE1 ColE1 replication origin Pat(basta) Basta resistance gene for selection in planta RB Right border P35SS Cauliflower mosaic virus 35S promoter
170
6.3.3 Phenotyping transgenic lines constitutively over-expressing AtCIPK16 under ABA treatment
To characterise the ABA-related function of AtCIPK16, the phenotype of 35S:AtCIPK16 lines under a series ABA treatments was investigated following a protocol described by Fujita et al.,
(2009). Briefly, seeds of four independent homozygous T 4 lines over-expressing AtCIPK16 , along with the Arabidopsis ecotype Col-0 as a control, were sterilised following the protocol described in Section 2.5. Seeds were then placed on control growth medium (1/2 MS, 1 % sucrose, 0.8 % agar, pH 5.6) or ABA treatment (1/2 MS, 1 % sucrose, 0.8 % agar, pH 5.6, with different ABA concentrations: 0.2 μM, 0.5 μM, 0.8 μM, 1 μM, 1.5 μM, 2 μM or 3 μM) and stored at 4 °C for 2 days to stratify. Plates were moved to a short day growth room (light/dark period: 10h/14h, temperature: 23 °C, light intensity: 100 μmol m -2 s-1, 60-75 % humidity).
Seeds were germinated and allowed to grow on plates. After 3 days, the numbers of seedlings with two green cotyledons were calculated to determine the germination rate of each line. This was repeated every 24 hours for the next 7 days .
6.3.4 Phenotyping transgenic lines constitutively over-expressing AtCIPK16 under low potassium stress
To characterise the potassium transport-related function of AtCIPK16, the phenotype of
35S:AtCIPK16 lines under low potassium stress was determined following the protocol described by Liu et al. (2013). Seeds of four independent homozygous T 4 transgenic lines over-expressing AtCIPK16 , along with the Arabidopsis ecotype Col-0 as a control were sterilised as described in Section 2.5. Seeds were placed on control growth medium or low potassium treatment (Table 6.3) and kept at 4 °C for 2 days to stratify. Plates were moved to a short day growth room (light/dark period: 10h/14h, temperature 23 °C, light intensity: 100
μmol m -2 s-1, 60-75 % humidity). Seeds were germinated and allowed to grow on plates for 22 days. Seedlings of various lines were harvested for analysis of biomass and K + concentration in both shoots and roots (Section 5.3.7).
171
Table 6.2 Medium for low K+ stress treatment Control medium (Final conc.) Low potassium medium (Final conc.)
2.99 mM CaCl 2 2.99 mM CaCl 2
1.25 mM KH 2PO 4 1.25 mM NH 4H2PO 4
1.5 mM MgSO 4 1.5 mM MgSO 4
20.6 mM NH 4 NO 3 20.6 mM NH 4 NO 3
18.79 mM KNO 3
25 μM H 3BO 3 25 μM H 3BO 3 0.1 mM NaFe(III)EDTA 0.1 mM NaFe(III)EDTA
2 μM MnCl 2.4H 2O 2 μM MnCl 2.4H 2O
0.5 μM CuSO 4.5H 2O 0.5 μM CuSO 4.5H 2O
2 μM ZnSO 4.7H 2O 2 μM ZnSO 4.7H 2O
0.01 μM CoCl 2.6H 2O 0.01 μM CoCl 2.6H 2O
0.2 μM Na 2MoO 4.2H 2O 0.2 μM Na 2MoO 4.2H 2O 0.8 % (w/v) Difco TM Agar 0.8 % (w/v) Difco TM Agar 3 % (w/v) sucrose 3 % (w/v) sucrose K+ concentration was adjusted to 100 ± 10 μM by adding KCl (K + concentration was measured by using flame photometry)
6.3.5 Phenotyping transgenic lines constitutively over-expressing AtCIPK16 when exposed to additional KCl
To further characterise the potassium transport-related function of AtCIPK16, the phenotype of
35S:AtCIPK16 lines under KCl treatment was determined. Seeds of four independent homozygous T 4 lines over-expressing AtCIPK16 , along with the Arabidopsis ecotype Col-0 were sterilised as per the protocol in Section 2.5. Seeds were placed on control growth medium
(1/2 MS, 1 % (w/v) sucrose, 0.8 % agar, pH5.6) and kept at 4 °C for 2 days to stratify. Plates were moved to a short day growth room (light/dark period: 10h/14h, temperature: 23 °C, light intensity: 100 μmol m -2s-1, 60-75 % humidity). Seeds were germinated and allowed to grow on plates for 10 days. Seedlings of similar size and developmental stage of either the AtCIPK16 lines or Col-0 were transferred to either control plates (1/2 MS, 3 % sucrose, 0.8 % agar, pH
5.6), or plates of different K + concentrations (1/2 MS, 3 % sucrose, 0.8 % agar, pH 5.6, with two KCl concentrations: 100 mM KCl or 150 mM KCl) and allowed to grow for another 14 days. Seedlings were harvested for analysis of biomass and K + concentration in both shoots
172 and roots (Section 5.3.7).
6.3.6 Phenotyping transgenic lines constitutively over-expressing AtCIPK16 under drought stress
To characterise the drought-related function of AtCIPK16, the protocol described by Fujita et al ., (2009) was modified and used to investigate the phenotype of 35S:AtCIPK16 lines under drought stress. Briefly, seeds of four independent homozygous T 4 lines over-expressing
AtCIPK16 , along with the Arabidopsis ecotype Col-0, were sterilised as per the protocol described in Section 2.5. Seeds were placed on control growth medium (1/2 MS, 1 % sucrose,
0.8 % agar, pH 5.6) and kept at 4 °C for 2 days to stratify. Plates were moved to a short day growth room (light/dark period: 10h/14h, temperature: 23 °C, light intensity: 100 μmol m -2 s-1,
60-75 % humidity) and grown for 10 days. Once the true leaves were present, seedlings of similar size and developmental stage were transferred into Arabidopsis Soil Mix supplied by
SARDI (for detail description of soil mix, please see Section 2.3) in a randomised distributions into a 29 × 35 cm sized tray. Plants were cultivated at 23 °C in a short day growth room
(light/dark period: 10h/14h, temperature: 23 °C, light intensity: 100 μmol m -2 s-1, 60-75 % humidity). Plants were well-watered until 4 weeks old and divided into two groups, drought-treatment and normal-watered (control) groups. The drought-treatment samples were not watered for 7 days and other conditions were maintained the same as the normal-watered
(control) group. After 7 days treatment, the leaves from various lines were collected for analysis of shoot biomass, relative water content, proline content and chlorophyll content.
Relative water content (RWC) was measured on the three youngest fully expanded leaves using the protocol described by Smart and Bingham (1974). Briefly, three leaves were collected from plants and their total fresh weight measured. The leaves were left in distilled water for 4 hours to allow them to fill with water and the turgid weight measured. To measure the dry weight, leaves were incubated at 70 °C for 3 days before weighing. RWC is calculated using the following formula (Smart and Bingham 1974):
Fresh Weight- Dry Weight RWC = Turgid Weight - Dry Weight
173
6.3.7 Phenotyping transgenic lines constitutively over-expressing AtCIPK16 under osmotic stress To characterise the osmotic-related function of AtCIPK16, the phenotype of 35S:AtCIPK16 lines under osmotic stress were determined. Seeds of four independent homozygous T 4 lines over-expressing AtCIPK16 , along with the Arabidopsis ecotype Col-0 were sterilised following the protocol described in Section 2.5. Seeds were placed on the control growth medium (1/2
MS, 1 % (w/v) sucrose, 0.8 % agar, pH 5.6) and kept at 4 °C for 2 days to stratify. Plates were moved to a short day growth room (light/dark period: 10h/14h, temperature: 23 °C, light intensity: 100 μmol m -2 s-1, 60-75 % humidity). Seeds were germinated and allowed to grow on plates for 10 days. Seedlings of similar size and developmental stage were transferred to either control plates (1/2 MS with 1 % sucrose, 0.8 % agar, pH 5.6) or osmotic stress plates (1/2 MS,
1 % sucrose, 0.8 % agar, pH 5.6 with either 200 mM or 300 mM mannitol) for another 14 days.
The seedlings were harvested for root length, lateral root numbers and biomass analysis.
6.3.8 Phenotyping transgenic lines constitutively over-expressing AtCIPK16 under cold stress
To characterise the cold-related function of AtCIPK16, T 4 seeds of homozygous over-expression of AtCIPK16 lines and seeds of ecotype Col-0 were sterilised as described in
Section 2.5. After rinsing with sterilised Milli Q water for 5 times to remove any residual ethanol and bleach, seeds were placed on 1/2 MS plates and incubated at 4 °C for 48 hours to stratify to promote even germination (Section 2.5). Then plates were moved to short day growth room (growth condition as described above). After 10 days, young seedlings of similar size and developmental stage were transferred to the surface of moistened soil as described in
Section 2.3. The four over-expression lines and Col-0 were randomised distribution into a 29 ×
35 cm sized tray and grown at 23 °C in the short growth room. For cold treatment, 4 weeks old plants were moved to the growth chamber (APT.line KBW, Binder, Germany) and the temperature gradually reduced to 4 °C (programme described in Table 6.3). The same photoperiod and light intensity was maintained as the short day growth room. After 2 or 5 days treatment, the leaves from various lines were collected for measurement of shoot biomass, proline content and chlorophyll content.
174
Table 6.3 Programme used for cold treatment Steps Temperature Duration Time of day Initial: 23 °C 9:00 Harvested untreated samples 9:00 Step 1 18 °C 3 hours 9:00-12:00 Step 2 12 °C 3 hours 12:00-15:00 Step 3 8 °C 3 hours 15:00-18:00 Step 4 4 °C 48 hours 18:00-18:00 (day 3) Harvested 2-day treatment samples 18:00 (day 3) Step 5 4 °C 72 hours 18:00 (day 3) -18:00 (day 6) Harvested 5-day treatment samples 18:00 (day 6)
6.3.9 Proline content measurements
Proline production and accumulation in many plants has been correlated with abiotic stress tolerance (Hare and Cress 1997, Kishor et al. 1995, Saradhi et al. 1995, Siripornadulsil et al.
2002). Thus, proline content may indicate the stress level of plant samples in drought and cold treatment. The proline content was measured using the protocol described by Bates et al.(1973).
Briefly, proline was extracted from a single leaf with 500 μL of 3 % sulphosalicylic acid and incubated at 100 °C for 10 min. After incubation, the supernatant was transferred into a fresh tube and mixed with 200 μL of freshly made acid ninhydrin solution (1.25 % (w/v) ninhydrin,
60 % (v/v) glacial acetic acid and 40 % (v/v) 6 M phosphoric acid) and 200 μL of glacial acetic acid. The mixture was incubated at 100 °C for 45 min in sealed 2 mL tube and moved to ice.
After cooling, the reaction mixture was extracted by adding 400 μL toluene and mixed vigorously. The toluene phase at the top from each sample was transferred into a 96-well plate
(Greiner bio-one, Kremsmuenster, Austria) and the absorbance measured at 520 nm using
FLUOstar Optima microplate reader (BMG LABTECH, NC, USA). To determine the proline concentration, a standard curve was established using a series concentration of proline solution and the proline content was calculated using a fresh weight data and the following formula published by Bates et al.,(1973): μg proline/ml × ml toluene Proline content (μmoles proline g -1 FW) = 115.5 μg/μmole×(fresh weight)/5 175
6.3.10 Chlorophyll content measurements
Chlorophyll content was determined using the protocol described by Warren (2008). Briefly, two leaves were collected from each sample and snap frozen in liquid nitrogen. Samples were ground to a fine powder with stainless steel grinding beads using a vortex (VM1 Vortex Mixer,
Ratek Instruments, Australia). After removal of metal beads, the samples were vigorously mixed with 1 mL methanol for 3 min, followed by centrifugation at 14,000 g for 2 min to separate the tissue pellets and supernatant. The supernatant was then transferred into a new 2 ml tube. To collect the residual chlorophyll from the tissue pellet, chlorophyll was re-extracted from the pellet by adding 1 mL methanol, followed by centrifugation at 14,000 g for 2 min.
The supernatant from the re-extraction was transferred and mixed with the supernatant from initial extraction. The chlorophyll extract for each sample was transferred into a 96-well plate
(Greiner bio-one) and the absorbance at 655 nm and 665 nm measured using an FLUOstar
Optima microplate reader (BMG LABTECH). The chlorophyll content was calculated on a fresh weight basis using following formula published by Ritchie (2006):
-1 Chlorophyll a (μg mL )=-8.0962 × A 652nm +16.5169 × A 665nm
-1 Chlorophyll b (μg mL )=27.4405 × A 652nm -12.1688 × A 665nm 2 × (Chlorophyll a + Chlorophyll b) Chlorophyll content (μg/mg) = mg of fresh weight material
6.3.11 Flame photometry measurements
To determine the K + concentration in whole seedlings, shoots or roots of samples in this chapter, flame photometry was performed as described in Section 5.3.7.
176
6.4 Results
6.4.1 In silico expression profile of AtCIPK16
Genevestigator is an online platform that contains more than 20,000 microarray experiments from a wide range of organisms, including human, mouse, Arabidopsis and barley. It has been designed to allow easy access to researchers to the large volume of microarray experiments that has been performed previously, thereby supporting the investigation of future gene expression and pathway analysis studies (Hruz et al. 2008). The expression profile of
AtCIPK16 was obtained in silico using Genevestigator to examine the relative expression ratios of the gene in response to 320 different external stimuli (Figure 6.2). The expression of
AtCIPK16 was identified to be significantly altered (≥ 2-fold, P < 0.05) in 152 arrays out of
3230. The expression of AtCIPK16 was up-regulated by 69 stimuli and down-regulated by 83 stimuli (Appendix A). The expression level of AtCIPK16 was consistently down-regulated in response to sulphur deficiency and up-regulated in response to ABA treatment, alterations in length of photoperiod study and heat treatment (Figure 6.2). However, the expression of the gene demonstrated both up-regulated and down-regulated in response with regards to iron deficiency, hypoxia, chemical and biotic stresses in different studies (Figure 6.2).
177
Figure 6.2: The transcriptional response of AtCIPK16 to various stimuli (e.g. biotic, chemical, hormone, nutrient, photoperiod, stresses and others) in 152 microarray studies stored in Genevestigator. The relative expression ratios of AtCIPK16 under various treatments are labelled as red dots. Log (2) ratio > 0 represents up-regulation and log (2) <0 represents down-regulation. The filter was set as fold-change > 2 and p-value < 0.05. Appendix A contains a complete list of AtCIPK16 regulated by all 152 perturbations.
178
6.4.2 Constitutive expression of AtCIPK16 resulted in lower germination rate with increasing ABA treatments In silico expression profile showed the expression of AtCIPK16 is regulated by ABA, suggesting ABA may have an effect on the over-expressing transgenic lines (Figure 6.2). In addition, the transcription level of ZmCIPK16 was also regulated by ABA (Zhao et al. 2013).
As AtCIPK16 as shares 52.8 % amino acid sequence identity with ZmCIPK16
(http://fasta.bioch.virginia.edu/ fasta_www2/fasta_www.cgi?rm=compare), AtCIPK16 may be involved in ABA signalling pathways.
To test this hypothesis, four over-expressing AtCIPK16 and Col-0 were germinated on plates with increasing ABA concentrations (0 μM, 0.2 μM, 0.5 μM, 0.8 μM, 1 μM, 1.5 μM, 2 μM or 3
μM respectively). Germination was determined daily from the third to the tenth day after treatment. Under most ABA concentrations, Col-0 exhibited a higher germination rate than the transgenic lines (Figure 6.3). Under 0 μM and 0.2 μM ABA treatments, Col-0 showed a higher
(but not significant) germination rates than four transgenic lines (Figure 6.4 A, B). With increasing the ABA concentration, the difference between Col-0 and the transgenic lines became more apparent (Figure 6.3 and 6.4). 2 µM ABA had the greatest effect on germination rates (Figure 6.4 K, L), however, the largest difference between then lines was observed at 1.5
µM ABA (Figure 6.4 I, J).
179
Col-0 OEX-1 OEX-2 OEX-3 OEX-4
0 μM
0.2 μM
0.5 μM
0.8 μM
1.0 μM
1.5 μM
2.0 μM
3.0 μM
Figure 6.3: Effect of ABA on seedling growth Seedlings of Col-0 and AtCIPK16 over-expression lines grown on1/2 MS with 0, 0.2, 0.5, 0.8, 1.0, 1.5, 2.0 or 3.0 μM ABA and 1 % sucrose for 10 days after stratification.
180
A B
C
D ** *
* * *
* * **
*
*
E
181
F ** ** **
** * * ** ** ** * *
* ** **
* ** *
** **
**
** * ** **
**
* * *
G
H
* * * * *
*
** * **
* ** *
* *
** ** ** * *
* * **
* * * * *
* * * * * * *
182
I
J ** *
** ** * ** *
** * * **
* * ** * * **
* * *
* * * * * * * *
*
* * * *
183
K
L
* * *
* *
* * * *
* * *
* * *
184
*
*
* * *
* * *
Figure 6.4: Effect of increasing ABA concentrations on germination rate of AtCIPK16 over-expression lines day 3 to day 10 after stratification. Plates contained 1/2 MS with 0, 0.2, 0.5, 0.8, 1.0, 1.5, 2.0 or 3.0 μM ABA and 1 % sucrose. All results are the mean ± SEM, n = 31-43 plants. T-test, *,**,***, and **** indicate P < 0.05, < 0.01, < 0.005 and < 0.001, respectively.
185
6.4.3 Under low potassium stress constitutively over-expressing AtCIPK16 lines have improved root K + accumulation compared with Col-0
Using a yeast two hybrid assay Lee et al. , (2007) found that CIPK16 interacts with the ankyrin domain of the potassium transporter AKT1. Furthermore, they show that co-expression of
AtCIPK16 with AtCBL1 , 2, 3, 5 or 9 can increase the activation of AKT1 currents in X.Laevis oocytes. These results suggest CIPK16 might be involved in pathways which mediate K + transport in plants.
To determine whether AtCIPK16 over-expressing plants have improved K + uptake, four homozygous AtCIPK16 over-expression lines and Col-0 were grown on plates containing with either normal K + or low K + concentrations for 20 days. As Figure 6.5A shown, all plants showed inhibition in shoot growth when grown on low K +, while K + deficiency promoted lateral root development of all samples. While K + content in shoot is similar to the transgenics and the control plants lines (Figure 6.5B), under both control and deficient K + concentrations, the root K + content was higher in the transgenic lines, compared to wild type when grown under K + deficiency (Figure 6.5C). Under low K + stress, growth of shoot in all samples were inhibited (Figure 6.5D) while root growth was promoted as seen in the improved root biomass
(Figure 6.5E), primary root length (Figure 6.5F) and the number of lateral roots (Figure 6.5G) in all plants studied. There was, however, no difference between transgenic and wild type lines.
186
Normal K + Low K + A
B C
** ** **
D E
F G
187
Figure 6.5 AtCIPK16 over-expressing lines have improved K + uptake under K + deficient conditions. A, 4 week-old Col-0 and four over-expression lines on control plates (containing 1/2 MS, 3 % (w/v) sucrose with normal potassium concentration (10 mM) or low potassium concentrations (100 μM ± 10 μM) media and 3 % (w/v) sucrose). B, potassium accumulation in shoots of transgenic and Col-0 under control and low potassium treatment. C, potassium accumulation in roots of transgenic and Col-0 under control and low potassium treatment. D, shoot biomass of transgenic and Col-0 under control and low potassium treatment. E，root biomass of transgenic and Col-0 under control and low potassium treatment F, primary root length of transgenic and Col-0 under control and low potassium treatment G, lateral roots numbers of transgenic and Col-0 under control and low potassium treatment. All results are the mean ± SEM, n = 5 plants. T-test, ** indicates P < 0.01. Scale bar = 2 cm. Black bars indicate control samples, grey bars indicate low K samples.
188
6.4.4 Col-0 and AtCIPK16 over-expression lines behave similarly under high KCl stress Since misexpression of AtCIPK16 results in increasing the root K + content in low K + stress
(Figure 6.5C), this suggested that AtCIPK16 enhances the K + inward transport in the root of plants. To further examining the function of AtCIPK16 in K + transport especially K + outward transport, high K + concentrations were applied by the addition of 100 mM KCl or 150 mM
KCl.
Four transgenic lines over-expressing AtCIPK16 and Col-0 were grown on MS plates for 7 days before being transferred to plates with various K + concentrations (0 mM, 100 mM or 150 mM KCl) for another 14 days. As figure 6.6A shown, all plants showed inhibition in biomass and growth of both root and shoot after application of 100 mM KCl, while plants were severely inhibited in growth when 150 mM KCl was applied, with only half number of samples could survive. K + accumulation in both shoot and root of all samples were increased with application of K + stresses (Figure 6.6 B, C). With increasing K + concentrations, both shoot and root growth of all lines were inhibited (Figure 6.6 A, D, E). No differences in either biomass or K + concentrations could be observed between transgenics or Col-0 under the various KCl concentrations (Figure 6.6).
189
A Control: Col-0 OEX-1 OEX-2 OEX-3 OEX-4
100 mM KCl
150 mM KCl
190
B C
D E
Figure 6.6 AtCIPK16 over-expressing Arabidopsis were not more tolerant to high concentrations of K +. A, 4 week-old Col-0 and four AtCIPK16 over-expression lines grown on 1/2 MS plates (containing 10 mM K +) or on 1/2 MS plates supplemented with 100 mM or 150 mM KCl. Scale bar = 2 cm. B, potassium accumulation in shoots of transgenics and Col-0 with increasing KCl treatments. C, potassium accumulation in roots of transgenics and Col-0 with increasing KCl treatments. D, shoot biomass of transgenics and Col-0 with increasing KCl treatments. E, root biomass of transgenics and Col-0 with increasing KCl treatments. All results are the mean ± SEM, n= 1-3 plants. Black bars indicate control samples, light grey bars or dark grey bars indicate samples with 100 mM KCl or 150 mM KCl treatment.
191
6.4.5 Col-0 and AtCIPK16 over-expression lines behave similarly under drought stress A wide range of abiotic stresses result in high accumulation of the compatible solute proline which works as both osmotic agent and a ROS scavenger, protecting cells against damage caused by various stresses (Kavi Kishor and Sreenivasulu 2014, Krasensky and Jonak 2012).
Proline production and accumulation in many plants had been correlated with abiotic stress tolerance, such as drought, therefore making it a good indicator of drought stress (Hare and
Cress 1997, Kishor et al. 1995, Saradhi et al. 1995, Siripornadulsil et al. 2002). Additionally, chlorophyll levels have also been associated with the level of abiotic stresses, such as cold
(Dai et al. 1990, Tian et al. 2011), drought (Bu et al. 2014), salt (Huang et al. 2005) and osmotic stress (Zhang et al. 2013a). Therefore, measurement of proline content and chlorophyll content were carried out to determine whether over-expression of AtCIPK16 improved tolerance to drought and osmotic stresses. In addition, biomass and relative water content (RWC) were also used to evaluate the phenotype of various lines.
T4 over-expression of AtCIPK16 lines and Col-0 were grown in soil for 3 weeks before water was withheld for 7 days to induce drought stress. AtCIPK16 does not appear to be important for drought tolerance as no significant differences were observed for shoot biomass or relative water content between the four over-expression lines and Col-0 after 7 days of drought treatment (Figure 6.7 A-C).
After application of drought stress, proline content in the shoot was greatly increased (Figure
6.7 D), while chlorophyll content in shoot was only slightly decreased (Figure 6.7 E).
Although the accumulation of both proline and chlorophyll was affected by stress, the transgenic lines showed no significant difference to Col-0 under drought stress.
192
Control Drought Treatment A
B C
D E
Figure 6.7 Over-expression of AtCIPK16 does not improve drought tolerance. A, 4 week-old Col-0 and four AtCIPK16 over-expression lines grown in soil for 4 weeks under control conditions (short day growth room, 8 hr light/16 hr dark, 23 °C) or drought treatment (control conditions for 3 weeks before water was withheld for 7 days). B, shoot biomass of transgenics and Col-0 under control conditions or drought treatment. C, relative water content of transgenics and Col-0 under control conditions or drought treatment. D, proline content in transgenics and Col-0 under control conditions or drought treatment. E, chlorophyll content in transgenics and Col-0 under control conditions or drought treatment. All results are the mean ± SEM, n = 10 plants. Black bars indicate control samples, grey bars indicate samples with drought treatment.
193
6.4.6 Col-0 and AtCIPK16 over-expression lines behave similarly during osmotic stresses
Osmotic stress caused by drought and/or soil salinity severely inhibits plant growth. AtCIPK16 has been identified as an important component in Na+ exclusion and therefore increases salt tolerance (Roy et al. 2013). However, the osmotic tolerance of AtCIPK16 lines has yet to be determined.
Transgenic lines over-expressing AtCIPK16 and Col-0 were grown on 1/2 MS plates supplemented with 0 mM, 200 mM or 300 mM mannitol. Data including shoot biomass, root biomass, root length and number of lateral roots were measured and analysed to assess the response to osmotic stress.
There was no significant difference between the four transgenic lines and the Col-0 wild type
(Figure 6.8). All plants showed a severe inhibition in biomass and root growth after application of osmotic stress (200 mM or 300 mM mannitol).
194
A Control: 200 mM mannitol:
Col-0 OEX-1 OEX-2 OEX-3 OEX-4 300 mM mannitol:
Col-0 OEX-1 OEX-2 OEX-3 OEX-4 Col-0 OEX-1 OEX-2 OEX-3 OEX-4
B C
D E
Figure 6.8 AtCIPK16 over-expressing lines have no significant difference in osmotic stress tolerance when compared to Col-0. A, 3 week-old Col-0 and four AtCIPK16 over-expression lines on control plates (containing 1/2 MS) or on 1/2 MS plates supplemented
195 with 200 mM or 300 mM mannitol. B, shoot biomass of transgenics and Col-0 with increasing mannitol treatments. C, root biomass of transgenics and Col-0 with increasing mannitol treatments. D, root length of transgenics and Col-0 with increasing mannitol treatments. E, lateral root number of transgenics and Col-0 with increasing mannitol treatments. All results are the mean ± SEM, n = 3 plants. Scale bar = 2 cm. Black bars indicate control samples, light grey bars or dark grey bars indicate samples with 200 mM mannitol or 300 mM mannitol treatment.
196
6.4.7 Col-0 and AtCIPK16 over-expression lines behave similarly during cold stresses
CBL1 has been identified as an interacting partner of CIPK7 in vitro and plays a role in plant cold response by the interaction with CIPK7 (Huang et al. 2011). Since CBL1 interacts with
CIPK16 in both a yeast two hybrid and a BiFC assay (Chapter 3), it was investigated whether
CIPK16 may be involved in pathway plant’s response to cold stress. Proline content and chlorophyll accumulation have been associated with the level of cold stress (Dai et al. 1990,
Hare and Cress 1997, Kishor et al. 1995, Saradhi et al. 1995, Siripornadulsil et al. 2002, Tian et al. 2011). Therefore, measurement of proline content and chlorophyll content were performed to evaluate whether over-expression of AtCIPK16 improves tolerance to cold stress.
Additionally, biomass was also utilised to examine the phenotype of transgenic lines.
T4 over-expression of AtCIPK16 lines and Col-0 were grown in soil for 3 weeks before being transferred to a growth chamber with cold treatment at 4 °C for 2 or 5 days to induce cold stress. AtCIPK16 does not appear to be important for cold tolerance as no significant differences were observed for shoot biomass, proline content or chlorophyll content between the over-expression lines and Col-0 after 2 or 5 days of cold treatment (Figure 6.9).
197
A Control Cold Treatment
B C
D
Figure 6.9 Over-expression of AtCIPK16 does not improve cold tolerance. A, 4 week-old Col-0 and four AtCIPK16 over-expression lines grown in soil for 4 weeks under control conditions (short day growth room, 8 hr light/16 hr dark, 23 °C) or cold treatment (control conditions for 3 weeks before cold treatment with 4 °C for 5 days). B, shoot biomass of transgenics and Col-0 with increasing cold treatment. C, proline content of transgenics and Col-0 with increasing cold treatment. D, chlorophyll content of transgenics and Col-0 with increasing cold treatment. All results are the mean ± SEM, n = 5 plants. Black bars indicate control samples, light grey bars or dark grey bars indicate samples with 2 days or 5 days cold treatment.
198
6.5 Discussion
Ca 2+ sensors such as CBLs work with protein kinase CIPKs to form regulatory networks of signalling pathways in plants (Albrecht et al. 2001, Kim et al. 2000, Luan 2009). The
CBL-CIPK regulatory network has been shown to be involved in responses to salt and other abiotic stresses, such as K + deficiency (Liu et al. 2013, Xu et al. 2006), cold signal transduction (Huang et al. 2011, Kim et al. 2003a), ABA treatment (D'Angelo et al. 2006), osmotic and drought stress (Zhao et al. 2009). Due to crosstalk between signalling pathways,
CBLs and CIPKs can have different roles and multiple functions depending on the stress. For example, CBL1 has been shown to positively regulate response to salt and drought stresses, but negatively regulate response to cold stress (Cheong et al. 2003). CIPK23 has been identified to be a component of signalling pathways involved in K + deficiency (Liu et al. 2013,
Xu et al. 2006) and nitrate transport (Ho et al. 2009).
The amino acid sequence of AtCIPK16 shares 52.8 % identity and 75.0 % similarity with
ZmCIPK16. Expression of ZmCIPK16 is strongly induced by osmotic, ABA and drought treatment (Zhao et al. 2009). The AtCBL interacting partners of AtCIPK16, AtCBL1, AtCBL2,
AtCBL3, AtCBL4, AtCBL5, AtCBL9 and AtCBL10 (Chapter 3), have been found to be involved in ABA, cold and K + transport (D'Angelo et al. 2006, Held et al. 2011, Huang et al.
2011, Kim et al. 2003b, Liu et al. 2013, Xu et al. 2006). As transgenic Arabidopsis lines over-expressing AtCIPK16 have already been generated (Chapter 5, Roy et al. , 2013) it was therefore logical to investigate whether these lines had different responses to various abiotic stresses to provide some insight into the AtCIPK16 signalling pathway.
6.5.1 AtCIPK16 exhibits ABA-related characteristics
The plant hormone ABA regulates many physiological processes during various stage of plant development, including bud dormancy, seed dormancy and maturation, abscission, closing of stomata and responses to external abiotic stresses, such as water deficiency, salinity and low-temperature stresses (Arroyo et al. 2003, Fedoroff 2002, Finkelstein et al. 2002,
Himmelbach et al. 2003).
199
In silico expression profiling using Genevestigator showed the relative expression level of
AtCIPK16 is significantly up-regulated by various ABA treatment (P < 0.05) (Figure 6.2), while AtCIPK16 over-expressing lines exhibited increased ABA-hypersensitivity (Figure 6.4).
Some CBL proteins and CIPKs have shown their function in response to ABA in plants.
Loss-of-function mutations in CIPK3 and CBL9 resulted in a hypersensitive phenotype of plants to ABA (Kim et al. 2003a, Pandey et al. 2004). In addition, mutations in CIPK15/PKS3 led to ABA hypersensitivity(Guo et al. 2002). Therefore, these results indicated CIPK3, CBL9 and CIPK15/PKS3 are negative regulators of the ABA response. In contrast, misexpression of
CIPK20/PKS18 (T169D) confers a hypersensitive phenotype of transgenic plants whereas knockout mutants result in ABA-insensitivity (Gong et al. 2002b). Moreover, BnCIPK6 from
Brassica napus has been identified as an important component which is involved in abiotic stress and ABA signalling (Chen et al. 2012). Misexpression of BnCIPK6 confers plants insensitive to salinity stress and hypersensitive to ABA (Chen et al. 2012). Subsequently,
AtCIPK6 as homolog of BnCIPK6 in Arabidopsis has been found to be up-regulated by ABA and play the same functions as BnCIPK6 (Chen et al. 2013).
Some regulatory factors have been identified in the ABA response to moderate the plant’s response at different stages of development. During seed germination, two protein phosphatases Abscisic Acid Insensitive 1 (ABI1) and ABI2 were recognised as negative regulators of the ABA response, while in contrast three transcription factors ABI3, ABI4 and
ABI5 were identified as positive regulators (Allen et al. 1999, Arroyo et al. 2003, Finkelstein et al. 2002, Pandey et al. 2004, Pei et al. 1997) which are expressed at high levels during seed germination (Arroyo et al. 2003, Finkelstein et al. 2002). Loss-of-function mutations in these three genes decreased sensitivity of seeds to germinate on ABA, while misexpression of these genes resulted in hypersensitivity phenotype to ABA (Finkelstein 1994, Finkelstein et al. 2002,
Koornneef et al. 1984, Lopez-Molina et al. 2001). CIPK26 has been found to positively regulate the ABA response in Arabidopsis and this kinase can phosphorylate the transcription factor ABI5 which also is a positive regulator of ABA response (Lyzenga et al. 2013). On the other hand, four ABA-responsive elements (ABREs) binding factors have been found (Kang et 200 al. 2002, Uno et al. 2000). ABF2 and ABF4 could activate an ABA-responsive promoter (Uno et al. 2000), while ABF1, ABF3 and ABF4 can interact with the positive regulator ABI3
(Yoshida et al. 2010). Constitutive expression of ABF3 or ABF4 confer hypersensitivity phenotype in Arabidopsis to ABA (Kang et al. 2002). Moreover, AtCPK32 showed interaction with ABF4 and misexpression of AtCPK32 enhances ABA sensitivity in plants during germination (Choi et al. 2005). These evidences suggest interaction with ABREs binding factors is another possible pathway to modulate the ABA response by using ABIs as intermediates.
In this study, transgenic lines that constitutively over-expressing AtCIPK16 had an increase in
ABA sensitivity (Figure 6.3 and 6.4), suggesting AtCIPK16 may directly interact with positive regulators (ABI3, ABI4, ABI5, or others unknown regulators) or indirectly modulate the activity of ABI regulators by other components (such as ABF3, ABF4), thereby altering ABA responses in Arabidopsis. To investigate this further, yeast two hybrid assay could be used in future to examine the interaction (if any) of AtCIPK16 with the two protein phosphatases ABI1,
ABI2; the transcription factors ABI3, ABI4 and ABI5, and the ABREs binding factors ABFs.
Additionally, expression analysis of the post-germination developments of AtCIPK16-OEX lines under ABA treatment will be required, with Northern blots and qRT-PCR employed to examine variation in the expression levels of ABA-related genes ( COR47 , COR15A , RD29A ,
RAB18, ABI1-5 and ABF1-4) between AtCIPK16 over-expression lines and AtCIPK16 knock-down lines in response to ABA. Establishment of correlation or inverse relation of expression levels between AtCIPK16 and ABA-related genes may contribute to identify the components of AtCIPK16 associated pathway.
As AtCIPK16 might be involved in Na + transport (Roy et al. 2013) and in ABA signalling (this chapter) a hypothetical pathway the role of AtCIPK16 during stress can be speculated.
External salt concentrations results in a release of Ca 2+ into the cytosol. AtCBLs, which respond to the Ca 2+ signal specific to salt stress, are then activated by Ca 2+ , followed by the
CBL interacting with AtCIPK16. These AtCBL-AtCIPK16 complexes could move to Na + transporters at the plasma membrane to improve Na + exclusion from the cell and/or bind to 201 tonoplast-localised transporter to enhance the Na + compartmentation into vacuole. While the complexes might also bind to ABA-related transcription factors (e.g ABI3, ABI4, ABI5) or
ABREs binding factors (ABFs) to modulate ABA signalling pathway, and consequently regulate Na + movement by ABA effect, for example ABA could minimise the Na + in the xylem by accumulating more Na + in roots (Cram and Pitman 1972, Karmoker and Van Steveninck
1978) although the mechanism is still unknown. AtCIPK16 may represent an overlap node between the ABA-dependent and ABA-independent pathways in response to various stresses.
However, further investigation is required to test this hypothesis.
With the over-expressing lines having improved salinity tolerance (Roy et al. , 2013), the function of AtCIPK16 appears similar to the function of BnCIPK6 and AtCIPK6 to enhance salt tolerance in plants (Chen et al. 2012, Chen et al. 2013). Expression profile of AtCIPK6 using Genevestigator showed a similar pattern to expression profile of AtCIPK16 in various tissues in Arabidopsis. Moreover, although sequence analysis shows AtCIPK16 only shares
46.9 % identity and 62.2 % similarity of AtCIPK6 using the online tool (GCG Emboss-Lite: http://helixweb.nih.gov/ emboss_lite/compare.html), AtCIPK6 demonstrated exactly the same interactions as AtCIPK16 with 10 AtCBLs in yeast two hybrid assays (Lee et al. 2007). Taken together, this evidence may suggest the signalling pathways of two proteins are partial overlap or share same components in response to salinity and ABA treatment. To test this hypothesis of sharing signalling pathway with AtCIPK6, Atcipk6 knockout mutants would have to be complemented by over-expressing AtCIPK16 and then both the knockouts and the complemented lines characterised their phenotypic response to ABA.
6.5.2 AtCIPK16 exhibits K + transport characteristics
Potassium as an important macronutrient plays essential functions in a wide diverse range of physiological processes in plant growth and development, including enzyme activation, osmotic regulation, maintenance of membrane potential and the stomatal movement
(Armengaud et al. 2010, Clarkson and Hanson 1980, Kim et al. 2010, Leigh and Jones 1984,
Very and Sentenac 2003, Wang and Wu 2010). In contrast with nitrogen and phosphorus which can be metabolised in plants, potassium is always kept in ionic form within cells to regulate 202 physiological functions (Amtmann and Blatt 2009). Previous studies indicated that absorption and translocation of K + is primarily mediated by K + transporters or channels (Amtmann and
Blatt 2009, Gierth and Maeser 2007, Ward et al. 2009). Two major transmembrane proteins for
K+ absorption in Arabidopsis have been identified: Arabidopsis K + Transporter1 (AKT1) and the High affinity K + transporter 5 (AtHAK5) (Kim et al. 2012, Pyo et al. 2010). Both are responsible for high affinity K + uptake in Arabidopsis roots. In addition, the stelar K + outward rectifier (SKOR) and Arabidopsis K + transporter 2 (AKT2) have been identified as two important proteins which mediate K + translocation in the vascular tissue in Arabidopsis by controlling K + transport in xylem and phloem respectively (Gaymard et al. 1998, Lacombe et al. 2000).
It is believed that some, perhaps all, of these K + transporters and ion channels may be regulated by CBLs and CIPKs, controlling the process of K+ absorption and transport (Cheong et al. 2007, Lee et al. 2007, Liu et al. 2013, Xu et al. 2006). CIPK23 has been shown to interacts with CBL1 and CBL9, forming CBL1-CIPK23 or CBL9-CIPK23 complex that phosphorylates AKT1 and mediates inward K + currents in X.Laevis oocytes (Xu et al. 2006).
CBL2, CBL3 and CIPK9 have also been identified as upstream regulators of AKT1 (Liu et al.
2013). Misexpression of CBL2 or CBL3 or CIPK9 increases plants sensitivity to low-K+ stress, while Atcbl3 and Atcipk9 knockout mutants exhibited low-K+ insensitivity (Liu et al. 2013).
Lee et al . (2007) revealed CIPK6 is also a regulator component of AKT1, interacting with several CBLs to active AKT1-mediated inward K + currents in oocytes. In addition, their study also showed the interactions of CIPK16 with CBL1, CBL2, CBL3, CBL5 or CBL9 to activate the K + channel AKT1, thereby mediating the inward K + currents in X.Laevis oocytes (Lee et al.
2007). However, to date, the role of AtCIPK16 in the uptake of K + in planta had not yet been shown.
In this chapter, three of four transgenic lines over-expressing AtCIPK16 exhibited significantly higher K + accumulation in roots but no changes in shoot K + content compared to ecotype Col-0
(Figure 6.5 B), suggesting that K + uptake may have been improved by constitutively expressing AtCIPK16 but K + translocation from root to shoot was unchanged. This may 203 suggest the function of AtCIPK16 in over-expression lines may be only involved in K + uptake in root, or that the transgenic plants have also altered the movement of K + through the plant via pleiotropic effects. Moreover, AKT1 as a transporter for K + absorption has been found its interaction with AtCIPK16 in Y2H (Lee et al. 2007). In 35S:AtCIPK16 expressing plants,
AtCIPK16 would be highly expressed in the epidermis in Arabidopsis constitutive expression lines, thereby possibly allowing the interaction of AtCIPK16 with AKT1 by phosphorylation to improve K + uptake in roots. In addition, as AtCIPK16 might be involved in ABA response,
K+ transport and accumulation could be regulated by ABA. ABA has been found to regulate the membrane potential of root cells therefore might be involved in K + uptake.
The K + content in shoots of the four transgenic lines is very similar to the shoot K + content of ecotype Col-0, suggesting that K + translocation from roots to shoot has not been up-regulated in the transgenics. This is particularly interesting as AtCIPK16 was found to be in root stelar cells (Roy et al. 2013), suggesting this kinase might have a function in translocation of ions from the root to the shoot by interaction with SKOR and AKT2 in stelar cells. However, root stelar cells may lack the appropriate AtCBL partner which would allow AtCIPK16 to target
SKOR and AKT2, thereby K + translocation showed a similar level in transgenic lines compared to Col-0. In addition, another possible reason is speculated. AtCIPK16 might be involved in ABA signalling pathway. ABA could regulate the membrane potential to activate
K+ inward channels and inhibit the K + outward channels in root stelar tissue therefore reducing
K+ transport to the xylem and increasing K + accumulation in the root (Roberts and Snowman
2000). AtCIPK16 may interact with SKOR in the stelar cells but ABA effect on K + channels may counteract the function of AtCIPK16, thereby K + translocation from roots to shoot has not been up-regulated in the transgenics.
It should be noted that nitrate concentration were quite different between the control media and low K + media as this study followed the protocol of Liu et al. (2013). The low potassium media had a lower nitrate concentration compared to control media. K + has been shown to improve nitrate uptake and accumulation in plants (Blevins et al. 1978) and has an effect on the nitrate translocation in plants (Blevins et al. 1978, Forster and Jeschke 1993). All this 204 evidence suggests a relationship between K + concentration and nitrate transport in plants, therefore the root K+ concentration observed under low potassium conditions may be caused by the low nitrate conditions. It is therefore necessary to characterise the phenotype of
35S:AtCIPK16 Arabidopsis under different K + treatment but the same nitrate condition.
No differences were observed between transgenic lines and Col-0 when high K + stresses (100 mM KCl and 150 mM KCl) were applied (Figure 6.6). This suggests that AtCIPK16 is not involved in regulating K + uptake when K + is sufficient or high.
Future work to investigate the function of AtCIPK16 in K + transport would include BiFC to examine the interaction of AtCIPK16 with various K + transporters/channels (such as AKT1,
AtHAK5, SKOR and AKT2). Moreover, pull-down assays could identify all downstream targets of AtCIPK16 and X.Laevis oocytes could be used for co-expressing AtCIPK16 with different combinations of stelar K + transporters/channels and interacting CBL partners, particularly with CBL4 and CBL10 which exhibit no interaction with AtCIPK16 in Lee et al., (2007) but positive interaction in Chapter 3 (Figure 3.7).
6.5.3 AtCIPK16 exhibits no characteristics for drought, osmotic and cold stresses
No significant differences in the phenotype of shoot biomass, relative water content, proline concentration and chlorophyll content were found in four over-expression of AtCIPK16 lines compared to ecotype Col-0, when grown with or without drought, osmotic and cold treatment
(Figure 6.6; 6.8 and 6.9). Moreover, in silico expression profile of AtCIPK16 using
Genevestigator showed the relative expression level of gene is not significantly regulated by drought (P≥0.172) and cold (P≥0.068) treatments (Appendix A).
These data suggest that AtCIPK16 might be not involved in the pathways to response the osmotic, drought and cold stresses. A key component of tolerance to these stresses is the ability to synthesise compatible solutes. Most solutes work as osmolytes and their accumulation in cells could mediate the osmotic adjustment (Louis and Galinski 1997, McCue and Hanson
1990) under abiotic stresses and increase the cell ability of maintain water balance without 205 affecting cellular normal functions (Yancey et al. 1982), consequently stabilizing proteins and membrane functions under stresses. Moreover, cold, drought and osmotic stresses induce the production and accumulation of reactive oxygen species (ROS) in plants (Hasegawa et al.
2000, Prasad et al. 1994). ROS could be involved in protective mechanism (Prasad et al. 1994) and Ca 2+ transduction signalling pathway (Price et al. 1994) but excessive ROS can cause enzyme inhibition, lipids peroxidation, protein oxidation nucleic acid damage and finally result in cells death (Maheshwari and Dubey 2009, Mishra et al. 2011, Mittler 2002, Shah et al. 2001,
Sharma and Dubey 2005, Srivastava and Dubey 2011). Therefore, another key component of tolerance to cold, drought and osmotic stresses is the ability to up-regulated ROS scavenging enzymes which can improve abiotic stress tolerance in plants by increasing ROS scavenging capacity (Apel and Hirt 2004, Gill and Tuteja 2010). The data presented from this study suggest AtCIPK16 may not be involved in compatible solutes production and antioxidant enzymes accumulation and the protein is more involved in the ions transport, such as Na + and
K+.
As CIPKs have been found to be involved in other ions transport besides Na + and K + transport, further studies on these 35S:AtCIPK16 lines may go on to investigate whether the transport of other ions through a plant have been modified. For instance, AtCIPK8 was induced by nitrate and works as a positive regulator in nitrate response (Hu et al. 2009). Additionally, 12
OsCIPKs were up-regulated by heavy metal (HgCl 2) treatment (Chen et al. 2011a). Thus, it then is speculated that AtCIPK16 may participate in response pathways to other stresses which are involved in ions transport, such as nutrients uptake (nitrogen and phosphorus) and heavy metal compartmentation.
6.5.4 Limitations of experimental techniques
Even though agar plate system has a lot of advantages, the disadvantages of agar plates include alterations in morphology of tissues of plants grown on plates when compared to plants in soil, such as loss of root hairs (Ahn et al. 2004). In addition, the growth window of seedlings is limited to only 3 weeks before they are too big for the system. Moreover, the transpiration of plants on agar plates is very much reduced due to stomatal closure in the high humidity on the 206 plate, which reduces ion uptake and makes it necessary to add sucrose into medium as a carbon substrate due to a reduction in photosynthesis (Conn et al. 2013). Therefore, further experiment into stresses should use other systems to verify the preliminary results found in this study and eliminate the potential issues caused by agar plates system. Growth on soil is high throughput system allowing the whole lifecycle of the plant to be studied but has the risk of fungal contamination and thrip damage on young seedlings; growth on hydroponics is another alternative which is intermediate throughput and large growth window but has risk of algal contamination.
To study the gene function under various abiotic stresses, over-expression and knockout are two commonly used reverse genetics approaches. Only transgenic lines over-expressing
AtCIPK16 were employed in the experimentation of this chapter, however, as no completely knocked out AtCIPK16 mutant has been found (Roy et al., 2013). Previous experimentation in our laboratory used a GABI-Kat (Max Planck Institute for Plant Breeding Research, Koeln,
Germany) knockout line which had a T-DNA insertion in the promoter close to the start codon of AtCIPK16 to examine whether the expression of gene was disrupted (Roy et al. 2013).
However, the expression level of the gene was not affected by the T-DNA insert (Roy et al.
2013). Consequently, knock-down mutants of the gene were generated using an artificial miRNA construct. The amiRNA construct was developed by using 21 bp of the AtCIPK16 sequence, cloned into pCR8 and transferred into pTOOL2 (Roy et al. 2013). Experimentation in the lab examined the expression of AtCIPK16 were reduced at different levels in the various knock-down mutants which resulted in the plants accumulating more shoot Na + (Roy et al.
2013). Therefore, in future knock-down mutants of AtCIPK16 could be employed to examine the germination rate under ABA treatment and K + content under low K + condition to observe the relationship between the expression level of AtCIPK16 and ABA- or low K +-related phenotype of transgenic plants.
In addition, in silico expression profiling showed the expression level of AtCIPK16 was up-regulated significantly by osmotic perturbation (P ≤ 0.001) (Appendix B). However, no significant phenotypic variation was observed in transgenic lines compared to wild type with 207 or without osmotic stress. A possible reason for this conflict might be the utilisation of different protocol for osmotic treatment, including various osmotic stress agents, different osmotic potential, age of seedlings and treatment duration. Therefore, an optimised protocol is required for further investigation of the function of AtCIPK16 under osmotic stress in the future.
6.6 Summary
This chapter investigated the responses of constitutive expression lines of AtCIPK16 under various abiotic stresses. Over-expressing AtCIPK16 plants were more sensitive to ABA and had increased K + root accumulation when grown under low K + stress. No significant phenotypic variation was observed in cold, drought, osmotic and high KCl stresses. Taken with the observation that over-expression of AtCIPK16 can reduce shoot Na + concentrations
(Chapter 5, Roy et al ., 2013), it appears that AtCIPK16 is involved with processes involving the transport of monovalent cations. Whether AtCIPK16 is involved with the transport of other cations and anions requires further investigation. The results in this chapter do suggest that
AtCIPK16 is not involved in other stresses which typically require the production of compatible solutes or enzymes which mop up reactive oxygen species.
Further investigation is required to make firm conclusions about the function of AtCIPK16 under ABA and low K + stresses and whether the kinase is involved in the transport of other ions.
208
Chapter 7 General Discussion
7.1 Summary of accomplished work
AtCIPK16 had previously been identified as a novel candidate gene important for improving salinity tolerance (Roy et al. 2013). Over-expression of AtCIPK16 has been shown to reduce the shoot sodium in a number of species. Arabidopsis with constitutive over-expression of
AtCIPK16 shows significant reductions in Na + concentration in shoot, compared with wild-type and nulls, while in barley constitutive expression of AtCIPK16 resulted in reduced shoot Na + and greater biomass under a high salt stress (Roy et al. 2013). While it can be clearly seen that alterations in the expression of AtCIPK16 result in increased salinity tolerance, little is known, however, about the role the protein plays in tolerance mechanisms. This study aimed to identify AtCIPK16’s cellular location, upstream regulators, downstream targets, and under what abiotic stress the protein moderates the plant’s response, therefore to reveal the function of the protein stress tolerance mechanisms.
7.1.1 AtCBL interacting partners and localisations of AtCIPK16
In Chapter 3, seven AtCBLs (AtCBL1, AtCBL2, AtCBL3, AtCBL4, AtCBL5, AtCBL9 and
AtCBL10) were identified as interacting partners of AtCIPK16 using yeast two hybrid and
BiFC assays. As AtCBL5 and AtCBL10 are predominantly expressed in shoots (Cheong et al.
2010, Kim et al. 2007), while AtCIPK16 is mainly expressed in roots (Roy et al. 2013), it is unlikely that AtCIPK16 interacts with either AtCBL5 or AtCBL10 in the plant. Therefore, it is likely AtCIPK16 only interacts with AtCBL1, AtCBL2, AtCBL3, AtCBL4 and AtCBL9 in planta . BiFC assay in N. benthamiana leaves revealed that the complexes of AtCBL1 and
AtCIPK16, AtCBL4 and AtCIPK16 and AtCBL9 and AtCIPK16 are localised in the nucleus and possibly at the plasma membrane, suggesting AtCBL1, AtCBL4 and AtCBL9 interact with
AtCIPK16 in roots and recruit AtCIPK16 from nucleus to the plasma membrane for phosphorylation of downstream targets which could be transporters or channels. As AtCBL4
(SOS3) is an important component in SOS signalling pathway for improving plant salinity 209 tolerance and has also been shown to interact with AtCIPK16 at the plasma membrane, it was hypothesised that AtCIPK16 and AtCIPK24 (SOS2) may work in a similar manner during salt stress. This hypothesis was tested in Chapter 5.
Additionally, the complex formed between AtCBL2 and AtCIPK16 was observed in the nucleus and cytoplasm, suggesting AtCBL2 binds to AtCIPK16 and interacts with some unknown transcription factors in the nucleus. As AtCBL2 has been shown to be involved in plant response to ABA, AtCIPK16 may participate in plant response to ABA via interaction with AtCBL2 and ABA-related transcription factors (such ABI3, ABI4, ABI5) or ABREs binding factors (ABFs) to modulate ABA signalling pathway, just like AtCIPK26 has been found to positively regulate the ABA response in Arabidopsis via phosphorylation of the transcription factor ABI5 (Lyzenga et al. 2013). Thus, these two hypothesises were tested in
Chapter 6.
Finally, the complex of AtCBL3 and AtCIPK16 exhibited exclusive cytoplasmic localisation, suggesting the AtCBL3 and AtCIPK16 might be involved in other unknown regulatory mechanism which can regulate the complex translocation.
7.1.2 Function of AtCIPK16 in Na +, K + transport and response to ABA in Arabidopsis plants
Based on the results obtained in BiFC, it was speculated that AtCIPK16 may perform complimentary functions of AtCIPK24 (SOS2). To examine whether AtCIPK16 works in a similar manner as AtCIPK24, transgenic lines that constitutively expresses AtCIPK16 in sos2 knockout lines were used to investigate the complementary function of salt sensitivity phenotype during salt stress. The results showed that AtCIPK16 cannot compliment sos2 knockout lines, with the complimentary lines showing similar shoot and root biomass, as well as Na + and K + concentrations as the knockouts.
As over-expression of AtCIPK16 has been shown to reduce the shoot sodium in plants, to further investigate the mechanism by which AtCIPK16 reduces shoot Na +, 22 Na + flux assays 210 were used to examine Na + content in plants during salt stress. The results demonstrated that while slightly lower shoot and root 22 Na + concentrations were observed in the transgenic lines, no real significant difference could be observed.
Based on the results obtained in Chapter 3, it was speculated that AtCIPK16 may be involved in K + transport and response to ABA. Over-expressing AtCIPK16 plants were found to be more sensitive to ABA and have increased K + root accumulation when grown under low K + stress. Taken with the observation that over-expression of AtCIPK16 can reduce shoot Na + concentrations which was found in Chapter 5 and Roy et al. (2013) and the observation of
BiFC that AtCIPK16 interacts with 3 AtCBLs at the plasma membrane (Chapter 3), it suggests that AtCIPK16 may be involved in the regulation of the transport processes of the monovalent cations via phosphorylation of the plasma membrane-localised transporters or channels and may participate in response pathways to other stresses which are involved in ions transport, such as nitrate transport; heavy metals compartmentation; phosphate and calcium uptake or transport. No significant variation in phenotype of over-expression transgenic lines was observed in cold, drought, osmotic and high KCl stresses.
7.2 Future work
A number of key questions still remain to be answered to the role of AtCIPK16 in salinity tolerance. While some of these questions have arisen from the research performed here, other still remain due to some transgenic lines have yet to be developed, confirmed or characterised due to time constraints.
7.2.1 Future directions for functionally characterising AtCIPK16 in ion transport
Results of Chapter 5 and Chapter 6 suggest that AtCIPK16 could be involved in the transport of Na + and K +, raising the question as to whether the kinase is involved in the regulation of the transport of other ions, such as nitrate uptake; heavy metals; phosphorus and calcium. A number of AtCIPKs are found to be involved in nitrate uptake; AtCIPK23 phosphorylates
NRT1.1 by forming a complex with AtCBL9 to mediate nitrate uptake under nitrate deficiency
(Hu et al. 2009); AtCIPK8 also works as a positive regulator in nitrate response (Hu et al. 211
2009). The expression levels of 12 OsCIPKs were up-regulated under heavy metal (HgCl 2) treatment (Chen et al. 2011a). BnCIPK6 and BnCBL1 have been shown their function in the regulation of the response to phosphorus deficiency and over-expression of BnCIPK6 and
BnCBL1 improves plant biomass under low phosphate stress (Chen et al. 2012). Given
AtCIPK16 has been shown to regulate monovalent cations transport, it is possible that it may have a role in the transport of other ions. To test this hypothesis, over-expression lines and knockdown lines of AtCIPK16 could be grown in soil containing different concentrations of nitrate, phosphate, heavy metals and calcium to see if they show any differences in growth when compared to wild type plants.
7.2.2 Future directions for identifying AtCIPK16 equivalent homologues in different species
As constitutive expression of AtCIPK16 in Arabidopsis results in the reduction of shoot Na+ accumulation (Roy et al ., 2013), AtCIPK16 was then over-expressed in the barley cultivar
Golden Promise to examine the possibilities of improving salt tolerance of cereals. The transgenic barley had lower leaf Na + content and higher biomass compared to nulls under salt stress (Roy et al. 2013), suggesting AtCIPK16 may have similar regulatory domains with its barley counterpart and therefore could interact with HvCBLs and modulate the downstream targets in barley to enhance the salt tolerance mechanism. It could therefore be speculated that a HvCBLs-HvCIPK16 signalling pathway, with identical or similar function to that of
AtCBLs-AtCIPK16, may exist in barley.
This raises speculation about, how best to find these equivalents of AtCIPK16 from different species? Does allelic variation exist for CIPK16s in crop plants that could be used for selective breeding approaches? Which CIPK16s would be the best for generating transgenic plants with higher biomass and yield during salinity stress? Kolukisaoglu et al. (2004) identified ESTs encoding CIPKs in Medicago truncatula , wheat ( Triticum aestivum ), barley ( Hordeum vulgare ), soybean ( Glycine max ), the gymnosperm Pinus sp. and the moss Physcomitrella patens by searching the publicly EST and genomic databases with the criteria including the presence of the NAF domain and the high similarity with the AtCIPKs. Thus, the same manner 212 could be used to identify equivalents of AtCIPK16 from other species, particularly those commercially relevant cultivars where more sequence data is becoming available, e.g. bread wheat. Additionally, identification of CIPK16 equivalent homologues could through evolutionary study, based on phylogenetic trees as well as Single Nucleotide Polymorphism
(SNP) analysis and intron-exon structure analysis of CIPK16 between different species. After being identified, the equivalents will be introduced into Arabidopsis and crop for phenotypic characterisation under various salt stresses consequently to evaluate the function of salt tolerance in each AtCIPK16 equivalents.
Care, however, needs to be taken by using an approach based solely on sequence homology.
Recently, a CIPK16 was identified in maize, and named ZmCIPK16 , due to its sequence similarity with AtCIPK16. However, over-expression of this gene could enhance salt tolerance and induce the expression of SOS1 in Arabidopsis sos2 mutant (Zhao et al. 2009), suggesting an overlap between ZmCIPK16 and AtCIPK24’s function, a function not observed for
AtCIPK16 . Any approach to identifying the functional equivalent of AtCIPK16 in another plant species will have to rely not solely on sequence information but also function of the protein.
7.2.3 Future directions for identifying downstream targets of AtCIPK16
To date most papers in the CBL/CIPK field have focused on the interaction between CBL and
CIPK; localisation and function of different CBL-CIPKs; and/or the phenotypic analysis of
CBL or CIPK mutants exposed to different abiotic stresses over past decade (Chen et al. 2012,
Chen et al. 2013, Cheong et al. 2003, Cheong et al. 2007, Cheong et al. 2010, D'Angelo et al.
2006, de la Torre et al. 2013, Deng et al. 2013, Drerup et al. 2013, Eckert et al. 2014, Hamada et al. 2009, Hu et al. 2009, Huang et al. 2011, Jeong et al. 2005, Kim et al. 2007, Kim et al.
2003a, Maehs et al. 2013, Mahajan et al. 2006, Nagae et al. 2003, Piao et al. 2010, Quan et al.
2007, Tripathi et al. 2009, Waadt et al. 2008, Yang et al. 2008a, Zhang et al. 2013b). Only few downstream targets of CBL-CIPKs, however, have been identified successfully, such as AKT1
(Cheong et al. 2007, Lee et al. 2007, Xu et al. 2006); AKT2 (Held et al. 2011); SOS1 (Qiu et al. 2002, Shi et al. 2000) and CHL1 (Ho et al. 2009). To gain a better understanding of the 213
CBL/CIPK pathways involved in abiotic stress signalling, identification of the downstream targets of CBL-CIPK complexes is an essential step.
However, the identification of downstream targets is the bottleneck in the investigation of
CBL-CIPK pathways due to limitations of techniques. In recent years, the development of new technologies, may aid in the identification of the downstream targets of CBL-CIPK. In this study antibody facilitated pull-down assays and co-immunoprecipitation were attempted
(Chapter 4), however, there are a number of other assays which could be tested.
Phosphoproteomics is a key technology for the investigation of signal transduction using the analysis of a huge number of phosphoprotein in vivo (Choudhary and Mann 2010, Rossignol
2006, Schreiber et al. 2008). It was used successfully to identify the key elements in
SnRK2-related ABA signalling pathway (Umezawa et al. 2013, Wang et al. 2013). A number of phosphorylated peptides were identified in wild type Arabidopsis but not in snrk2 knockout mutants after exposure to ABA treatment. After comparative analysis, further investigation revealed a transcription factor AREB1 and a previously unknown protein SNS1 were the downstream phosphorylation targets of SnRK2 in ABA response (Umezawa et al. 2013, Wang et al. 2013). Phosphoproteomics would be a possibility to screen for differentially phosphorylated peptides between wild type Arabidopsis and over-expressing or knockdown lines of AtCIPK16 lines during NaCl treatment. This may improve our understanding of the gene’s tolerant mechanism to salt stress in plants. Additionally, as AtCIPK16 might be involved in ion transport, split-ubiquitin system (Duenkler et al. 2012, Grefen 2014, Johnsson and Varshavsky 1994, Stagljar et al. 1998) could be used to screening the interaction between
AtCIPK16 and thousands of plasma membrane or tonoplast localised transporters from
Arabidopsis.
Moreover, RNA-seq as a powerful approach to transcriptome analysis can be used for expression profiling of a large range of genes in a plant. A comparative RNA-seq analysis between Col-0 and transgenic lines over-expressing AtCIPK16 could demonstrate the number of genes which are differentially expressed transcripts between the Col-0 and over-expression lines; the list candidate genes could be reduced by comparing between independent transgenic 214 lines. Further bioinformatics analysis would be then required to investigate the functional involvements of these candidate genes for AtCIPK16-related signalling pathways.
Furthermore, metabolomics analysis could be used to characterise the metabolic phenotypes of
Col-0 and over-expression lines under salt stress by mass spectrometry systems. This method may reveal the variations in accumulation of amino acids, organic acids and sugars in various lines and may establish the correlations between the kinase and metabolites, therefore indicating AtCIPK16-related regulation of the biosynthesis of metabolites and revealing the its molecular mechanism of metabolic networks under salt stress. Additionally, a recent technique
- Stochastic Optical Reconstruction Microscopy (STORM) which is a super resolution microscopy based on different fluorescent probes to observe the interactions between proteins at a molecular level in vivo (Hell 2009, Huang et al. 2010, Huang et al. 2009) .
7.3 Conclusion
Investigation of the function of AtCIPK16 during salt stress is important to reveal the tolerant mechanism in plants. In this project, a number of approaches have been employed to identify the interacting partners and potential targets and to characterise the phenotype of
35S:AtCIPK16 under abiotic stresses. BiFC has shown distinct subcellular localisation of
AtCBL-AtCIPK16 complexes in cells and over-expression of the gene results in significant alteration in the phenotype of transgenic lines during K + deficiency and response to ABA.
Results of this study increase the knowledge of the AtCIPK16’s function in plants, therefore not only contribute to the understanding of the cellular signalling mechanisms in plant salinity tolerance, but also provide potential genetic modification approaches to effectively enhance plant salinity tolerance.
215
216
References Abebe, T., Guenzi, A.C., Martin, B. and Cushman, J.C. (2003) Tolerance of mannitol-accumulating transgenic wheat to water stress and salinity. Plant Physiology , 131 , 1748-1755. Ahn, S.J., Shin, R. and Schachtman, D.P. (2004) Expression of KT/KUP genes in Arabidopsis and the role of root hairs in K + uptake. Plant Physiology , 134 , 1135-1145. Albrecht, V., Ritz, O., Linder, S., Harter, K. and Kudla, J. (2001) The NAF domain defines a novel protein-protein interaction module conserved in Ca 2+ -regulated kinases. Embo Journal , 20 , 1051-1063. Albrecht, V., Weinl, S., Blazevic, D., D'Angelo, C., Batistic, O., Kolukisaoglu, U., Bock, R., Schulz, B., Harter, K. and Kudla, J. (2003) The calcium sensor CBL1 integrates plant responses to abiotic stresses. Plant Journal , 36 , 457-470. Allen, G.J., Kuchitsu, K., Chu, S.P., Murata, Y. and Schroeder, J.I. (1999) Arabidopsis abi1-1 and abi2-1 phosphatase mutations reduce abscisic acid-induced cytoplasmic calcium rises in guard cells. Plant Cell , 11 , 1785-1798. Alonso, J.M., Stepanova, A.N., Leisse, T.J., Kim, C.J., Chen, H.M., Shinn, P., Stevenson, D.K., Zimmerman, J., Barajas, P., Cheuk, R., Gadrinab, C., Heller, C., Jeske, A., Koesema, E., Meyers, C.C., Parker, H., Prednis, L., Ansari, Y., Choy, N., Deen, H., Geralt, M., Hazari, N., Hom, E., Karnes, M., Mulholland, C., Ndubaku, R., Schmidt, I., Guzman, P., Aguilar-Henonin, L., Schmid, M., Weigel, D., Carter, D.E., Marchand, T., Risseeuw, E., Brogden, D., Zeko, A., Crosby, W.L., Berry, C.C. and Ecker, J.R. (2003) Genome-wide Insertional mutagenesis of Arabidopsis thaliana. Science , 301 , 653-657. Amtmann, A. and Blatt, M.R. (2009) Regulation of macronutrient transport. New Phytologist , 181 , 35-52. Amtmann, A. and Sanders, D. (1999) Mechanisms of Na + uptake by plant cells. Advances in Botanical Research , 29 , 75. Apel, K. and Hirt, H. (2004) Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annual Review of Plant Biology , 55 , 373-399. Apse, M.P., Aharon, G.S., Snedden, W.A. and Blumwald, E. (1999) Salt tolerance conferred by overexpression of a vacuolar Na +/H + antiport in Arabidopsis. Science , 285 , 1256-1258. Apse, M.P., Sottosanto, J.B. and Blumwald, E. (2003) Vacuolar cation/H + exchange, ion homeostasis, and leaf development are altered in a T-DNA insertional mutant of AtNHX1, the Arabidopsis vacuolar Na +/H + antiporter. Plant Journal , 36 , 229-239. Armengaud, P., Breitling, R. and Amtmann, A. (2010) Coronatine-insensitive 1 (coi1) mediates transcriptional responses of Arabidopsis thaliana to external potassium supply. Molecular Plant , 3, 390-405. Arroyo, A., Bossi, F., Finkelstein, R.R. and Leon, P. (2003) Three genes that affect sugar sensing (Abscisic Acid Insensitive 4, Abscisic Acid Insensitive 5, and Constitutive Triple Response 1 ) are differentially regulated by glucose in Arabidopsis. Plant Physiology , 133 , 231-242. Aslam, M., Travis, R.L. and Huffaker, R.C. (1992) Comparative kinetics and reciprocal inhibition of nitrate and nitrite uptake in roots of uninduced and induced barley ( Hordeum vulgare L. ) seedlings. Plant Physiology , 99 , 1124-1133. Auerbach, D.a.S.I. (2005) Yeast two-hybrid protein-protein interaction networks. In Proteomics and protein-protein interactions (Waksman, G. ed: Springer, pp. 323-354.
217
Badawi, G.H., Kawano, N., Yamauchi, Y., Shimada, E., Sasaki, R., Kubo, A. and Tanaka, K. (2004) Over-expression of ascorbate peroxidase in tobacco chloroplasts enhances the tolerance to salt stress and water deficit. Physiologia Plantarum , 121, 231-238. Baneyx, F. (1999) Recombinant protein expression in Escherichia coli. Current Opinion in Biotechnology , 10 , 411-421. Baneyx, F. and Mujacic, M. (2004) Recombinant protein folding and misfolding in Escherichia coli . Nature Biotechnology , 22 , 1399-1408. Bao, A.-K., Wang, S.-M., Wu, G.-Q., Xi, J.-J., Zhang, J.-L. and Wang, C.-M. (2009) Over-expression of the Arabidopsis H +-PPase enhanced resistance to salt and drought stress in transgenic alfalfa ( Medicago sativa L. ). Plant Science , 176 , 232-240. Bartels, D. and Sunkar, R. (2005) Drought and salt tolerance in plants. Critical Reviews in Plant Sciences , 24 , 23-58. Batelli, G., Verslues, P.E., Agius, F., Qiu, Q., Fujii, H., Pan, S., Schumaker, K.S., Grillo, S. and Zhu, J.K. (2007) SOS2 promotes salt tolerance in part by interacting with the vacuolar H +-ATPase and upregulating its transport activity. Molecular and Cellular Biology , 27 , 7781-7790. Bates, L.S., Waldren, R.P. and Teare, I.D. (1973) Rapid determination of free proline for water-stress studies. Plant and Soil , 39 , 205-207. Batistic, O. and Kudla, J. (2004) Integration and channeling of calcium signaling through the CBL calcium sensor/CIPK protein kinase network. Planta , 219 , 915-924. Batistic, O. and Kudla, J. (2009) Plant calcineurin B-like proteins and their interacting protein kinases. Biochimica Et Biophysica Acta-Molecular Cell Research , 1793 , 985-992. Batistic, O. and Kudla, J. (2012) Analysis of calcium signaling pathways in plants. Biochimica Et Biophysica Acta-General Subjects , 1820 , 1283-1293. Batistic, O., Rehers, M., Akerman, A., Schluecking, K., Steinhorst, L., Yalovsky, S. and Kudla, J. (2012) S-acylation-dependent association of the calcium sensor CBL2 with the vacuolar membrane is essential for proper abscisic acid responses. Cell Research , 22 , 1155-1168. Batistic, O., Sorek, N., Schueltke, S., Yalovsky, S. and Kudla, J. (2008) Dual fatty acyl modification determines the localization and plasma membrane targeting of CBL/CIPK Ca 2+ signaling complexes in Arabidopsis. Plant Cell , 20 , 1346-1362. Batistic, O., Waadt, R., Steinhorst, L., Held, K. and Kudla, J. (2010) CBL-mediated targeting of CIPKs facilitates the decoding of calcium signals emanating from distinct cellular stores. Plant Journal , 61 , 211-222. Berendzen, K.W., Boehmer, M., Wallmeroth, N., Peter, S., Vesic, M., Zhou, Y., Tiesler, F.K.E., Schleifenbaum, F. and Harter, K. (2012) Screening for in planta protein-protein interactions combining bimolecular fluorescence complementation with flow cytometry. Plant Methods , 8, 25. Bernstein, L., Brown, J.W. and Hayward, H.E. (1956) The influence of rootstock on growth and salt accumulation in stone-fruit trees and almonds. Proceedings. American Society for Horticultural Science , 68 , 86-95. Blevins, D.G., Barnett, N.M. and Frost, W.B. (1978) Role of potassium and malate in nitrate uptake and translocation by wheat seedlings. Plant Physiology , 62 , 784-788. Blom, N., Gammeltoft, S. and Brunak, S. (1999) Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. Journal of Molecular Biology , 294 , 1351-1362. Bornhorst, J.A. and Falke, J.J. (2000) Purification of proteins using polyhistidine affinity tags.
218
Methods in Enzymology , 326 , 245-254. Boruc, J., Van den Daele, H., Hollunder, J., Rombauts, S., Mylle, E., Hilson, P., Inze, D., De Veylder, L. and Russinova, E. (2010) Functional modules in the Arabidopsis core cell cycle binary protein-protein interaction network. Plant Cell , 22 , 1264-1280. Boudsocq, M. and Lauriere, C. (2005) Osmotic signaling in plants. Multiple pathways mediated by emerging kinase families. Plant Physiology , 138 , 1185-1194. Braun, P., Tasan, M., Dreze, M., Barrios-Rodiles, M., Lemmens, I., Yu, H., Sahalie, J.M., Murray, R.R., Roncari, L., de Smet, A.-S., Venkatesan, K., Rual, J.-F., Vandenhaute, J., Cusick, M.E., Pawson, T., Hill, D.E., Tavernier, J., Wrana, J.L., Roth, F.P. and Vidal, M. (2009) An experimentally derived confidence score for binary protein-protein interactions. Nature Methods , 6, 91-98. Brueckner, A., Polge, C., Lentze, N., Auerbach, D. and Schlattner, U. (2009) Yeast two-hybrid, a powerful tool for systems biology. International Journal of Molecular Sciences , 10 , 2763-2788. Bu, Q., Lv, T., Shen, H., Phi, L., Wang, J., Wang, Z., Huang, Z., Xiao, L., Engineer, C., Kim, T.H., Schroeder, J.I. and Huq, E. (2014) Regulation of drought tolerance by the F-box protein MAX2 in Arabidopsis. Plant Physiology , 164 , 424-439. Byrt, C.S., Platten, J.D., Spielmeyer, W., James, R.A., Lagudah, E.S., Dennis, E.S., Tester, M. and Munns, R. (2007) HKT1;5-like cation transporters linked to Na+ exclusion loci in wheat, Nax2 and Kna1 . Plant Physiology , 143 , 1918-1928. Byrt, C.S., Xu, B., Krishnan, M., Lightfoot, D.J., Athman, A., Jacobs, A.K., Watson-Haigh, N.S., Plett, D., Munns, R., Tester, M. and Gilliham, M. (2014) The Na + transporter, TaHKT1;5-D, limits shoot Na + accumulation in bread wheat. The Plant journal : for cell and molecular biology , 80 , 516-526. Chakrabarti, A. and Mukhopadhyay, D. (2012) Novel adaptors of amyloid precursor protein intracellular domain and their functional implications. Genomics Proteomics & Bioinformatics , 10 , 208-216. Chen, L.-H., Zhang, B. and Xu, Z.-Q. (2008) Salt tolerance conferred by overexpression of Arabidopsis vacuolar Na +/H + antiporter gene AtNHX1 in common buckwheat ( Fagopyrum esculentum ). Transgenic Research , 17 , 121-132. Chen, L., Ren, F., Zhou, L., Wang, Q.-Q., Zhong, H. and Li, X.-B. (2012) The Brassica napus calcineurin B-like 1/CBL-interacting protein kinase 6 (CBL1/CIPK6) component is involved in the plant response to abiotic stress and ABA signalling. Journal of Experimental Botany , 63 , 6211-6222. Chen, L., Wang, Q.-Q., Zhou, L., Ren, F., Li, D.-D. and Li, X.-B. (2013) Arabidopsis CBL-interacting protein kinase (CIPK6) is involved in plant response to salt/osmotic stress and ABA. Molecular Biology Reports , 40 , 4759-4767. Chen, X., Gu, Z., Liu, F., Ma, B. and Zhang, H. (2011a) Molecular analysis of rice CIPKs involved in both biotic and abiotic stress responses. Rice Science , 18 , 1-9. Chen, Z., Grefen, C., Donald, N., Hills, A. and Blatt, M.R. (2011b) A bicstronic, Ubiguitin-10 promoter-based vector cassette for transient transformation and functional analysis of membrane transport demonstrates the utility of quantitative voltage clamp studies on intact Arabidopsis root epidermis. Plant Cell and Environment , 34 , 554-564. Cheong, Y.H., Kim, K.N., Pandey, G.K., Gupta, R., Grant, J.J. and Luan, S. (2003) CBL1, a calcium sensor that differentially regulates salt, drought, and cold responses in Arabidopsis.
219
Plant Cell, 15 , 1833-1845. Cheong, Y.H., Pandey, G.K., Grant, J.J., Batistic, O., Li, L., Kim, B.G., Lee, S.C., Kudla, J. and Luan, S. (2007) Two calcineurin B-like calcium sensors, interacting with protein kinase CIPK23, regulate leaf transpiration and root potassium uptake in Arabidopsis. Plant Journal , 52 , 223-239. Cheong, Y.H., Sung, S.J., Kim, B.-G., Pandey, G.K., Cho, J.-S., Kim, K.-N. and Luan, S. (2010) Constitutive overexpression of the calcium sensor CBL5 confers osmotic or drought stress tolerance in Arabidopsis. Molecules and Cells , 29 , 159-165. Chini, A. (2014) Application of yeast-two hybrid assay to chemical genomic screens: A high-throughput system to identify novel molecules modulating plant hormone receptor complexes. In Plant Chemical Genomics: Methods and Protocols (Hicks, G.R. and Robert, S. eds), pp. 35-43. Choi, H.I., Park, H.J., Park, J.H., Kim, S., Im, M.Y., Seo, H.H., Kim, Y.W., Hwang, I. and Kim, S.Y. (2005) Arabidopsis calcium-dependent protein kinase AtCPK32 interacts with ABF4, a transcriptional regulator of abscisic acid-responsive gene expression, and modulates its activity. Plant Physiology , 139 , 1750-1761. Choudhary, C. and Mann, M. (2010) Decoding signalling networks by mass spectrometry-based proteomics. Nature Reviews Molecular Cell Biology , 11 , 427-439. Choudhury, K.R., Raychaudhuri, S. and Bhattacharyya, N.P. (2012) Identification of HYPK-interacting proteins reveals involvement of HYPK in regulating cell growth, cell cycle, unfolded protein response and cell death. PLoS ONE , 7, e51415. Clapham, D.E. (2007) Calcium signaling. Cell , 131 , 1047-1058. Clarkson, D.T. and Hanson, J.B. (1980) The mineral-nutrition of higher-plants. Annual Review of Plant Physiology and Plant Molecular Biology , 31 , 239-298. Claros, M.G. and Vonheijne, G. (1994) TopPred-II: An improved software for membrane-protein structure predictions. Computer Applications in the Biosciences , 10 , 685-686. Clough, S.J. and Bent, A.F. (1998) Floral dip: a simplified method for Agrobacterium -mediated transformation of Arabidopsis thaliana . Plant Journal , 16 , 735-743. Conn, S.J., Hocking, B., Dayod, M., Xu, B., Athman, A., Henderson, S., Aukett, L., Conn, V., Shearer, M.K., Fuentes, S., Tyerman, S.D. and Gilliham, M. (2013) Protocol: optimising hydroponic growth systems for nutritional and physiological analysis of Arabidopsis thaliana and other plants. Plant Methods , 9, 4. Cortina, C. and Culianez-Macia, F.A. (2005) Tomato abiotic stress enhanced tolerance by trehalose biosynthesis. Plant Science , 169 , 75-82. Cram, W.J. and Pitman, M.G. (1972) Action of abscisic acid on ion uptake and water flow in plant roots. Australian Journal of Biological Sciences , 25 , 1125-1132. Cuellar, T., Azeem, F., Andrianteranagna, M., Pascaud, F., Verdeil, J.-L., Sentenac, H., Zimmermann, S. and Gaillard, I. (2013) Potassium transport in developing fleshy fruits: the grapevine inward K + channel VvK1.2 is activated by CIPK-CBL complexes and induced in ripening berry flesh cells. Plant Journal , 73 , 1006-1018. Cuin, T.A., Bose, J., Stefano, G., Jha, D., Tester, M., Mancuso, S. and Shabala, S. (2011) Assessing the role of root plasma membrane and tonoplast Na +/H + exchangers in salinity tolerance in wheat: in planta quantification methods. Plant Cell and Environment , 34 , 947-961. D'Angelo, C., Weinl, S., Batistic, O., Pandey, G.K., Cheong, Y.H., Schultke, S., Albrecht, V., Ehlert, B., Schulz, B., Harter, K., Luan, S., Bock, R. and Kudla, J. (2006) Alternative complex
220
formation of the Ca 2+ -regulated protein kinase CIPK1 controls abscisic acid-dependent and independent stress responses in Arabidopsis. Plant Journal , 48 , 857-872. Dai, Q., Vergara, B.S. and Visperas, R.M. (1990) Amelioration of cold injury in rice ( Oryza sativa L. ): improving root oxidizing activity by plant growth regulators. Philippine Journal of Crop Science , 15 , 49-54. Das, R. and Pandey, G.K. (2010) Expressional analysis and role of calcium regulated kinases in abiotic stress signaling. Current Genomics , 11 , 2-13. Davenport, R.J., Munoz-Mayor, A., Jha, D., Essah, P.A., Rus, A. and Tester, M. (2007) The Na + transporter AtHKT1;1 controls retrieval of Na + from the xylem in Arabidopsis. Plant Cell and Environment , 30 , 497-507. David, L., Raoul, R. and Alain, P. (2006) Calcium in plant defence-signalling pathways. New Phytologist , 171 , 249-269. Day, I.S., Reddy, V.S., Ali, G.S. and Reddy, A.S.N. (2002) Analysis of EF-hand-containing proteins in Arabidopsis. Genome Biology , 3, 0056-0056. de la Torre, F., Gutierrez-Beltran, E., Pareja-Jaime, Y., Chakravarthy, S., Martin, G.B. and del Pozo, O. (2013) The tomato calcium sensor CBL10 and its interacting protein kinase CIPK6 define a signaling pathway in plant immunity. Plant Cell , 25 , 2748-2764. DeFalco, T.A., Bender, K.W. and Snedden, W.A. (2010) Breaking the code: Ca 2+ sensors in plant signalling. Biochemical Journal , 425 , 27-40. Demuro, A. and Parker, I. (2006) Imaging single-channel calcium microdomains. Cell Calcium , 40 , 413-422. Deng, X., Hu, W., Wei, S., Zhou, S., Zhang, F., Han, J., Chen, L., Li, Y., Feng, J., Fang, B., Luo, Q., Li, S., Liu, Y., Yang, G. and He, G. (2013) TaCIPK29 , a CBL-interacting protein kinase gene from wheat, confers salt stress tolerance in transgenic tobacco. PLoS ONE , 8, e69881. Doddema, H. and Telkamp, G.P. (1979) Uptake of nitrate by mutants of Arabidopsis thaliana disturbed in uptake or reduction of nitrate .II. Kinetics. Physiologia Plantarum , 45 , 332-338. Drake, P.M.W., Chargelegue, D., Vine, N.D., Van Dolleweerd, C.J., Obregon, P. and Ma, J.K.-C. (2002) Transgenic plants expressing antibodies: A model for phytoremediation. The FASEB Journal , 16 , 1855-1860. Drerup, M.M., Schluecking, K., Hashimoto, K., Manishankar, P., Steinhorst, L., Kuchitsu, K. and Kudla, J. (2013) The calcineurin B-like calcium sensors CBL1 and CBL9 together with their interacting protein kinase CIPK26 regulate the arabidopsis NADPH oxidase RBOHD. Molecular Plant , 6, 559-569. Du, L., Ali, G.S., Simons, K.A., Hou, J., Yang, T., Reddy, A.S.N. and Poovaiah, B.W. (2009) Ca 2+ /calmodulin regulates salicylic-acid-mediated plant immunity. Nature , 457 , 1154-U1116. Du, L.Q. and Poovaiah, B.W. (2005) Ca 2+ /calmodulin is critical for brassinosteroid biosynthesis and plant growth. Nature , 437 , 741-745. Duan, X.-G., Yang, A.-F., Gao, F., Zhang, S.-L. and Zhang, J.-R. (2007) Heterologous expression of vacuolar H +-PPase enhances the electrochemical gradient across the vacuolar membrane and improves tobacco cell salt tolerance. Protoplasma , 232 , 87-95. Duenkler, A., Mueller, J. and Johnsson, N. (2012) Detecting protein-protein interactions with the split-ubiquitin sensor. In Gene Regulatory Networks: Methods and Protocols (Deplancke, B. and Gheldof, N. eds), pp. 115-130. Eckert, C., Offenborn, J.N., Heinz, T., Armarego-Marriott, T., Schueltke, S., Zhang, C., Hillmer, S.,
221
Heilmann, M., Schumacher, K., Bock, R., Heilmann, I. and Kudla, J. (2014) The vacuolar calcium sensors CBL2 and CBL3 affect seed size and embryonic development in Arabidopsis thaliana . Plant Journal , 78 , 146-156. Edwards, K., Johnstone, C. and Thompson, C. (1991) A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Research , 19 , 1349-1349. Ehlig, C.F. (1960) Effects of salinity on four varieties of table grapes grown in sand culture. Proceedings. American Society for Horticultural Science , 76 , 323-331. Eltayeb, A.E., Kawano, N., Badawi, G.H., Kaminaka, H., Sanekata, T., Shibahara, T., Inanaga, S. and Tanaka, K. (2007) Overexpression of monodehydroascorbate reductase in transgenic tobacco confers enhanced tolerance to ozone, salt and polyethylene glycol stresses. Planta , 225 , 1255-1264. Esposito, D. and Chatterjee, D.K. (2006) Enhancement of soluble protein expression through the use of fusion tags. Current Opinion in Biotechnology , 17 , 353-358. Fang, Y., Macool, D.J., Xue, Z., Heppard, E.P., Hainey, C.F., Tingey, S.V. and Miao, G.H. (2002) Development of a high-throughput yeast two-hybrid screening system to study protein-protein interactions in plants. Molecular Genetics and Genomics , 267 , 142-153. Fedoroff, N.V. (2002) Cross-talk in abscisic acid signaling. Science's STKE : signal transduction knowledge environment , 2002 , re10-re10. Ferro, E. and Trabalzini, L. (2013) The yeast two-hybrid and related methods as powerful tools to study plant cell signalling. Plant Molecular Biology , 83 , 287-301. Finkelstein, R.R. (1994) Mutations at two new Arabidopsis ABA response loci are similar to the abi3 mutations. Plant Journal , 5, 765-771. Finkelstein, R.R., Gampala, S.S.L. and Rock, C.D. (2002) Abscisic acid signaling in seeds and seedlings. Plant Cell , 14 , S15-S45. Forster, B.P. (2001) Mutation genetics of salt tolerance in barley: An assessment of Golden Promise and other semi-dwarf mutants. Euphytica , 120 , 317-328. Forster, J.C. and Jeschke, W.D. (1993) Effects of potassium withdrawal on nitrate transport and on the contribution of the root to nitrate reduction in the whole plant. Journal of Plant Physiology , 141 , 322-328. Francis, D.M. and Page, R. (2010) Strategies to optimize protein expression in E. coli . Current protocols in protein science / editorial board, John E. Coligan ... [et al.] , Chapter 5 , Unit 5.24.21-29. Fuglsang, A.T., Guo, Y., Cuin, T.A., Qiu, Q., Song, C., Kristiansen, K.A., Bych, K., Schulz, A., Shabala, S., Schumaker, K.S., Palmgren, M.G. and Zhu, J.-K. (2007) Arabidopsis protein kinase PKS5 inhibits the plasma membrane H +-ATPase by preventing interaction with 14-3-3 protein. Plant Cell , 19 , 1617-1634. Fujii, H. and Zhu, J.-K. (2009) An autophosphorylation site of the protein kinase SOS2 is important for salt tolerance in arabidopsis. Molecular Plant , 2, 183-190. Fujita, Y., Nakashima, K., Yoshida, T., Katagiri, T., Kidokoro, S., Kanamori, N., Umezawa, T., Fujita, M., Maruyama, K., Ishiyama, K., Kobayashi, M., Nakasone, S., Yamada, K., Ito, T., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2009) Three SNRK2 protein kinases are the main positive regulators of abscisic acid signaling in response to water stress in Arabidopsis. Plant and Cell Physiology , 50 , 2123-2132. Gao, F., Gao, Q., Duan, X., Yue, G., Yang, A. and Zhang, J. (2006) Cloning of an H +-PPase gene
222
from Thellungiella halophila and its heterologous expression to improve tobacco salt tolerance. Journal of Experimental Botany , 57 , 3259-3270. Garg, A.K., Kim, J.K., Owens, T.G., Ranwala, A.P., Do Choi, Y., Kochian, L.V. and Wu, R.J. (2002) Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stresses. Proceedings of the National Academy of Sciences of the United States of America , 99 , 15898-15903. Garthwaite, A.J., von Bothmer, R. and Colmer, T.D. (2005) Salt tolerance in wild Hordeum species is associated with restricted entry of Na + and Cl - into the shoots. Journal of Experimental Botany , 56 , 2365-2378. Gaxiola, R., Rao, R., Sherman, A., Grisafi, P., Alper, S. and Fink, G. (1999) The Arabidopsis thaliana proton transporters AtNHX1 and AVP1, can function in cation detoxification in yeast. Proceedings of the National Academy of Sciences of the United States of America , 96 , 1480. Gaymard, F., Pilot, G., Lacombe, B., Bouchez, D., Bruneau, D., Boucherez, J., Michaux-Ferriere, N., Thibaud, J.B. and Sentenac, H. (1998) Identification and disruption of a plant shaker-like outward channel involved in K + release into the xylem sap. Cell , 94 , 647-655. Geiger, D., Becker, D., Vosloh, D., Gambale, F., Palme, K., Rehers, M., Anschuetz, U., Dreyer, I., Kudla, J. and Hedrich, R. (2009) Heteromeric AtKC1.AKT1 channels in Arabidopsis roots facilitate growth under K +-limiting conditions. Journal of Biological Chemistry , 284 , 21288-21295. Geiger, D., Scherzer, S., Mumm, P., Marten, I., Ache, P., Matschi, S., Liese, A., Wellmann, C., Al-Rasheid, K.A.S., Grill, E., Romeis, T. and Hedrich, R. (2010) Guard cell anion channel SLAC1 is regulated by CDPK protein kinases with distinct Ca 2+ affinities. Proceedings of the National Academy of Sciences of the United States of America , 107 , 8023-8028. Gierth, M. and Maeser, P. (2007) Potassium transporters in plants - Involvement in K + acquisition, redistribution and homeostasis. FEBS Letters , 581 , 2348-2356. Gill, S.S. and Tuteja, N. (2010) Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiology and Biochemistry , 48 , 909-930. Gong, D.M., Guo, Y., Jagendorf, A.T. and Zhu, J.K. (2002a) Biochemical characterization of the Arabidopsis protein kinase SOS2 that functions in salt tolerance. Plant Physiology , 130 , 256-264. Gong, D.M., Guo, Y., Schumaker, K.S. and Zhu, J.K. (2004) The SOS3 family of calcium sensors and SOS2 family of protein kinases in Arabidopsis. Plant Physiology , 134 , 919-926. Gong, D.M., Zhang, C.Q., Chen, X.Y., Gong, Z.Z. and Zhu, J.K. (2002b) Constitutive activation and transgenic evaluation of the function of an Arabidopsis PKS protein kinase. Journal of Biological Chemistry , 277 , 42088-42096. Grefen, C. (2014) The split-ubiquitin system for the analysis of three-component interactions. In Arabidopsis Protocols, 3rd Edition (SanchezSerrano, J.J. and Salinas, J. eds), pp. 659-678. Grefen, C. and Blatt, M.R. (2012) Do calcineurin B-like proteins interact independently of the serine threonine kinase CIPK23 with the K + channel AKT1? Lessons learned from a menage a trois. Plant Physiology , 159 , 915-919. Grefen, C., Chen, Z., Honsbein, A., Donald, N., Hills, A. and Blatt, M.R. (2010a) A novel motif essential for SNARE interaction with the K + channel KC1 and channel gating in Arabidopsis. Plant Cell , 22 , 3076-3092. Grefen, C., Donald, N., Hashimoto, K., Kudla, J., Schumacher, K. and Blatt, M.R. (2010b) A
223
ubiquitin-10 promoter-based vector set for fluorescent protein tagging facilitates temporal stability and native protein distribution in transient and stable expression studies. Plant Journal , 64 , 355-365. Guild, K., Zhang, Y., Stacy, R., Mundt, E., Benbow, S., Green, A. and Myler, P.J. (2011) Wheat germ cell-free expression system as a pathway to improve protein yield and solubility for the SSGCID pipeline. Acta Crystallographica Section F-Structural Biology and Crystallization Communications , 67 , 1027-1031. Guo, Y., Halfter, U., Ishitani, M. and Zhu, J.K. (2001) Molecular characterisation of functional domains in the protein kinase SOS2 that is required for plant salt tolerance. Plant Cell , 13 , 1383-1399. Guo, Y., Xiong, L.M., Song, C.P., Gong, D.M., Halfter, U. and Zhu, J.K. (2002) A calcium sensor and its interacting protein kinase are global regulators of abscisic acid signaling in Arabidopsis. Developmental Cell , 3, 233-244. Halfter, U., Ishitani, M. and Zhu, J.K. (2000) The Arabidopsis SOS2 protein kinase physically interacts with and is activated by the calcium-binding protein SOS3. Proceedings of the National Academy of Sciences of the United States of America , 97 , 3735-3740. Hamada, S., Seiki, Y., Watanabe, K., Ozeki, T., Matsui, H. and Ito, H. (2009) Expression and interaction of the CBLs and CIPKs from immature seeds of kidney bean ( Phaseolus vulgaris L.). Phytochemistry , 70 , 501-507. Hare, P.D. and Cress, W.A. (1997) Metabolic implications of stress-induced proline accumulation in plants. Plant Growth Regulation , 21 , 79-102. Harmon, A.C., Gribskov, M. and Harper, J.F. (2000) CDPKs - a kinase for every Ca 2+ signal? Trends in Plant Science , 5, 154-159. Hartinger, D., Heinl, S., Schwartz, E., Grabherr, R., Schatzmayr, G., Haltrich, D. and Moll, W.-D. (2010) Enhancement of solubility in Escherichia coli and purification of an aminotransferase from Sphingopyxis sp. MTA144 for deamination of hydrolyzed fumonisin B1. Microbial Cell Factories , 9, 1-14. Hasegawa, P.M., Bressan, R.A., Zhu, J.K. and Bohnert, H.J. (2000) Plant cellular and molecular responses to high salinity. Annual Review of Plant Physiology and Plant Molecular Biology , 51 , 463-499. Hashimoto, K., Eckert, C., Anschuetz, U., Scholz, M., Held, K., Waadt, R., Reyer, A., Hippler, M., Becker, D. and Kudla, J. (2012) Phosphorylation of calcineurin B-like (CBL) calcium sensor proteins by their CBL-interacting protein kinases (CIPKs) is required for full activity of CBL-CIPK complexes toward their target proteins. Journal of Biological Chemistry , 287 , 7956-7968. He, L., Yang, X., Wang, L., Zhu, L., Zhou, T., Deng, J. and Zhang, X. (2013) Molecular cloning and functional characterization of a novel cotton CBL-interacting protein kinase gene ( GhCIPK6 ) reveals its involvement in multiple abiotic stress tolerance in transgenic plants. Biochemical and Biophysical Research Communications , 435 , 209-215. Hedrich, R. and Kudla, J. (2006) Calcium signaling plant K + uptake networks channel. Cell , 125 , 1221-1223. Held, K., Pascaud, F., Eckert, C., Gajdanowicz, P., Hashimoto, K., Corratge-Faillie, C., Offenborn, J.N., Lacombe, B., Dreyer, I., Thibaud, J.-B. and Kudla, J. (2011) Calcium-dependent modulation and plasma membrane targeting of the AKT2 potassium channel by the
224
CBL4/CIPK6 calcium sensor/protein kinase complex. Cell Research , 21 , 1116-1130. Hell, S.W. (2009) Microscopy and its focal switch. Nature Methods , 6, 24-32. Henriksen, G.H., Raman, D.R., Walker, L.P. and Spanswick, R.M. (1992) Measurement of net fluxes of ammonium and nitrate at the surface of barley roots using ion-selective microelectrodes .II. Patterns of uptake along the root axis and evaluation of the microelectrode flux estimation technique. Plant Physiology , 99 , 734-747. Hetherington, A.M. and Brownlee, C. (2004) The generation of Ca 2+ signals in plants. Annual Review of Plant Biology , 55 , 401-427. Hetherington, A.M. and Woodward, F.I. (2003) The role of stomata in sensing and driving environmental change. Nature , 424 , 901-908. Himmelbach, A., Yang, Y. and Grill, E. (2003) Relay and control of abscisic acid signaling. Current Opinion in Plant Biology , 6, 470-479. Ho, C.-H., Lin, S.-H., Hu, H.-C. and Tsay, Y.-F. (2009) CHL1 Functions as a Nitrate Sensor in Plants. Cell , 138 , 1184-1194. Hochuli, E., Bannwarth, W., Dobeli, H., Gentz, R. and Stuber, D. (1988) Genetic approach to facilitate purification of recombinant proteins with a novel metal chelate adsorbent. Nature Biotechnology , 6, 1321-1325. Hocking, B. (2008) The Arabidopsis Ca 2+ /H + exchangers, AtCAX1 and AtCAX3, are shown by co-localisaion, interaction and complementation to participate in plant Ca 2+ homeostasis. In Master thesis, University of Adelaide . Adelaide. Hole, D.J., Emran, A.M., Fares, Y. and Drew, M.C. (1990) Induction of nitrate transport in maize roots, and kinetics of influx, measured with nitrogen-13. Plant Physiology , 93 , 642-647. Horie, T., Hauser, F. and Schroeder, J.I. (2009) HKT transporter-mediated salinity resistance mechanisms in Arabidopsis and monocot crop plants. Trends in Plant Science , 14 , 660-668. Hrabak, E.M., Chan, C.W.M., Gribskov, M., Harper, J.F., Choi, J.H., Halford, N., Kudla, J., Luan, S., Nimmo, H.G., Sussman, M.R., Thomas, M., Walker-Simmons, K., Zhu, J.K. and Harmon, A.C. (2003) The Arabidopsis CDPK-SnRK superfamily of protein kinases. Plant Physiology , 132 , 666-680. Hruz, T., Laule, O., Szabo, G., Wessendorp, F., Bleuler, S., Oertle, L., Widmayer, P., Gruissem, W. and Zimmermann, P. (2008) Genevestigator v3: a reference expression database for the meta-analysis of transcriptomes. Advances in bioinformatics , 2008 , 420747-420747. Hu, C.D., Chinenov, Y. and Kerppola, T.K. (2002) Visualization of interactions among bZip and Rel family proteins in living cells using bimolecular fluorescence complementation. Molecular Cell , 9, 789-798. Hu, D.-G., Li, M., Luo, H., Dong, Q.-L., Yao, Y.-X., You, C.-X. and Hao, Y.-J. (2012) Molecular cloning and functional characterization of MdSOS2 reveals its involvement in salt tolerance in apple callus and Arabidopsis. Plant Cell Reports , 31 , 713-722. Hu, H.C., Wang, Y.Y. and Tsay, Y.F. (2009) AtCIPK8, a CBL-interacting protein kinase, regulates the low-affinity phase of the primary nitrate response. Plant Journal , 57 , 264-278. Huang, B., Babcock, H. and Zhuang, X. (2010) Breaking the diffraction barrier: Super-resolution imaging of cells. Cell , 143 , 1047-1058. Huang, B., Bates, M. and Zhuang, X. (2009) Super-resolution fluorescence microscopy. In Annual Review of Biochemistry , pp. 993-1016. Huang, C., Ding, S., Zhang, H., Du, H. and An, L. (2011) CIPK7 is involved in cold response by
225
interacting with CBL1 in Arabidopsis thaliana . Plant Science , 181 , 57-64. Huang, C.H., He, W.L., Guo, J.K., Chang, X.X., Su, P.X. and Zhang, L.X. (2005) Increased sensitivity to salt stress in an ascorbate-deficient Arabidopsis mutant. Journal of Experimental Botany , 56 , 3041-3049. Huang, W. (2010) Role of AtCIPK16 in plant salinity tolerance. In Master thesis, University of Adelaide . Adelaide. Huertas, R., Olias, R., Eljakaoui, Z., Javier Galvez, F., Li, J., Alvarez De Morales, P., Belver, A. and Pilar Rodriguez-Rosales, M. (2012) Overexpression of SlSOS2 (SlCIPK24) confers salt tolerance to transgenic tomato. Plant Cell and Environment , 35 , 1467-1482. Ishitani, M., Liu, J.P., Halfter, U., Kim, C.S., Shi, W.M. and Zhu, J.K. (2000) SOS3 function in plant salt tolerance requires N-myristoylation and calcium binding. Plant Cell , 12 , 1667-1677. Jeong, H.J., Jwa, N.S. and Kim, K.N. (2005) Identification and characterization of protein kinases that interact with the CBL3 calcium sensor in Arabidopsis. Plant Science , 169 , 1125-1135. Jha, A., Joshi, M., Yadav, N.S., Agarwal, P.K. and Jha, B. (2011) Cloning and characterization of the Salicornia brachiata Na +/H + antiporter gene SbNHX1 and its expression by abiotic stress. Molecular Biology Reports , 38 , 1965-1973. Ji, H., Pardo, J.M., Batelli, G., Van Oosten, M.J., Bressan, R.A. and Li, X. (2013) The Salt Overly Sensitive (SOS) Pathway: Established and Emerging Roles. Molecular Plant , 6, 275-286. Johnsson, N. and Varshavsky, A. (1994) Split ubiquitin as a sensor of protein interactions in vivo . Proceedings of the National Academy of Sciences of the United States of America , 91 , 10340-10344. Kane, J.F. (1995) Effects of rare codon clusters on high-level expression of heterologous proteins in Escherichia coli . Current Opinion in Biotechnology , 6, 494-500. Kang, J.Y., Choi, H.I., Im, M.Y. and Kim, S.Y. (2002) Arabidopsis basic leucine zipper proteins that mediate stress-responsive abscisic acid signaling. Plant Cell , 14 , 343-357. Kapila, J., DeRycke, R., VanMontagu, M. and Angenon, G. (1997) An Agrobacterium-mediated transient gene expression system for intact leaves. Plant Science , 122 , 101-108. Karakas, B., OziasAkins, P., Stushnoff, C., Suefferheld, M. and Rieger, M. (1997) Salinity and drought tolerance of mannitol-accumulating transgenic tobacco. Plant Cell and Environment , 20 , 609-616. Karmoker, J.L. and Van Steveninck, R.F. (1978) Stimulation of volume flow and ion flux by abscisic acid in excised root systems of Phaseolus vulgaris L. cv. Redland Pioneer. Planta , 141 , 37-43. Kavi Kishor, P.B. and Sreenivasulu, N. (2014) Is proline accumulation per se correlated with stress tolerance or is proline homeostasis a more critical issue? Plant, Cell & Environment , 37 , 300-311. Kavitha, K., George, S., Venkataraman, G. and Parida, A. (2010) A salt-inducible chloroplastic monodehydroascorbate reductase from halophyte Avicennia marina confers salt stress tolerance on transgenic plants. Biochimie , 92 , 1321-1329. Kerppola, T.K. (2008) Bimolecular fluorescence complementatlon: Visualization of molecular interactions in living cells. In Fluorescent Proteins, Second Edition (Sullivan, K.F. ed, pp. 431-456. Kim, B.G., Waadt, R., Cheong, Y.H., Pandey, G.K., Dominguez-Solis, J.R., Schultke, S., Lee, S.C., Kudla, J. and Luan, S. (2007) The calcium sensor CBL10 mediates salt tolerance by regulating ion homeostasis in Arabidopsis. Plant Journal , 52 , 473-484.
226
Kim, J., Stroud, R.M. and Craik, C.S. (2011) Rapid identification of recombinant Fabs that bind to membrane proteins. Methods , 55 , 303-309. Kim, K.N., Cheong, Y.H., Grant, J.J., Pandey, G.K. and Luan, S. (2003a) CIPK3, a calcium sensor-associated protein kinase that regulates abscisic acid and cold signal transduction in Arabidopsis. Plant Cell , 15 , 411-423. Kim, K.N., Cheong, Y.H., Gupta, R. and Luan, S. (2000) Interaction specificity of Arabidopsis calcineurin B-like calcium sensors and their target kinases. Plant Physiology , 124 , 1844-1853. Kim, K.N., Lee, J.S., Han, H., Choi, S.A., Go, S.J. and Yoon, I.S. (2003b) Isolation and characterization of a novel rice Ca 2+ -regulated protein kinase gene involved in responses to diverse signals including cold, light, cytokinins, sugars and salts. Plant Molecular Biology , 52 , 1191-1202. Kim, M.J., Baek, K. and Park, C.-M. (2009) Optimization of conditions for transient Agrobacterium-mediated gene expression assays in Arabidopsis. Plant Cell Reports , 28 , 1159-1167. Kim, M.J., Ciani, S. and Schachtman, D.P. (2010) A peroxidase contributes to ROS production during Arabidopsis root response to potassium deficiency. Molecular Plant , 3, 420-427. Kim, M.J., Ruzicka, D., Shin, R. and Schachtman, D.P. (2012) The Arabidopsis AP2/ERF transcription factor RAP2.11 modulates plant response to low-potassium conditions. Molecular Plant , 5, 1042-1057. Kishor, P.B.K., Hong, Z.L., Miao, G.H., Hu, C.A.A. and Verma, D.P.S. (1995) Overexpression of delta-pyrroline-5-carboxylate synthetase increases proline production and confers osmotolerance in transgenic plants. Plant Physiology , 108 , 1387-1394. Kolukisaoglu, U., Weinl, S., Blazevic, D., Batistic, O. and Kudla, J. (2004) Calcium sensors and their interacting protein kinases: Genomics of the Arabidopsis and rice CBL-CIPK signalling networks. Plant Physiology , 134 , 43-58. Koornneef, M., Reuling, G. and Karssen, C.M. (1984) The isolation and characterization of abscisic-acid insensitive mutants of Arabidopsis thaliana . Physiologia Plantarum , 61 , 377-383. Krasensky, J. and Jonak, C. (2012) Drought, salt, and temperature stress-induced metabolic rearrangements and regulatory networks. Journal of Experimental Botany . Kudla, J., Batistic, O. and Hashimoto, K. (2010) Calcium signals: The lead currency of plant information processing. Plant Cell , 22 , 541-563. Kudla, J., Xu, Q., Harter, K., Gruissem, W. and Luan, S. (1999) Genes for calcineurin B-like proteins in Arabidopsis are differentially regulated by stress signals. Proceedings of the National Academy of Sciences of the United States of America , 96 , 4718. Kuhtreiber, W.M. and Jaffe, L.F. (1990) Detection of extracellular calcium gradients with a calcium-specific vibrating electrode. Journal of Cell Biology , 110 , 1565-1573. Kyte, J. and Doolittle, R.F. (1982) A simple method for displaying the hydropathic character of a protein. Journal of Molecular Biology , 157 , 105-132. Lacombe, B., Pilot, G., Michard, E., Gaymard, F., Sentenac, H. and Thibaud, J.B. (2000) A shaker-like K + channel with weak rectification is expressed in both source and sink phloem tissues of Arabidopsis. Plant Cell , 12 , 837-851. Lan, W.-Z., Lee, S.-C., Che, Y.-F., Jiang, Y.-Q. and Luan, S. (2011) Mechanistic analysis of AKT1 regulation by the CBL-CIPK-PP2CA interactions. Molecular Plant , 4, 527-536.
Lee, N., Francklyn, C. and Hamilton, E.P. (1987) Arabinose-induced binding of AraC protein to aral 2
227
activates the araBAD operon promoter. Proceedings of the National Academy of Sciences of the United States of America , 84 , 8814-8818. Lee, S.C., Lan, W.Z., Kim, B.G., Li, L.G., Cheong, Y.H., Pandey, G.K., Lu, G.H., Buchanan, B.B. and Luan, S. (2007) A protein phosphorylation/dephosphorylation network regulates a plant potassium channel. Proceedings of the National Academy of Sciences of the United States of America , 104 , 15959-15964. Lee, Y.P., Baek, K.-H., Lee, H.-S., Kwak, S.-S., Bang, J.-W. and Kwon, S.-Y. (2010) Tobacco seeds simultaneously over-expressing Cu/Zn-superoxide dismutase and ascorbate peroxidase display enhanced seed longevity and germination rates under stress conditions. Journal of Experimental Botany , 61 , 2499-2506. Leidi, E.O., Barragan, V., Rubio, L., El-Hamdaoui, A., Teresa Ruiz, M., Cubero, B., Fernandez, J.A., Bressan, R.A., Hasegawa, P.M., Quintero, F.J. and Pardo, J.M. (2010) The AtNHX1 exchanger mediates potassium compartmentation in vacuoles of transgenic tomato. Plant Journal , 61 , 495-506. Leigh, R.A. and Jones, R.G.W. (1984) A hypothesis relating critical potassium concentrations for growth to the distribution and functions of this ion in the plant-cell. New Phytologist , 97 , 1-13. Lewit-Bentley, A. and Rety, S. (2000) EF-hand calcium-binding proteins. Current Opinion in Structural Biology , 10 , 637-643. Li, D.D., Xia, X.L., Yin, W.L. and Zhang, H.C. (2013) Two poplar calcineurin B-like proteins confer enhanced tolerance to abiotic stresses in transgenic Arabidopsis thaliana . Biologia Plantarum , 57 , 70-78. Li, H.-W., Zang, B.-S., Deng, X.-W. and Wang, X.-P. (2011) Overexpression of the trehalose-6-phosphate synthase gene OsTPS1 enhances abiotic stress tolerance in rice. Planta , 234 , 1007-1018. Li, L., Kim, B.-G., Cheong, Y.H., Pandey, G.K. and Luan, S. (2006) A Ca 2+ signaling pathway regulates a K + channel for low-K+ response in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America, 103 , 12625-12630. Li, R., Zhang, J., Wu, G., Wang, H., Chen, Y. and Wei, J. (2012) HbCIPK2, a novel CBL-interacting protein kinase from halophyte Hordeum brevisubulatum, confers salt and osmotic stress tolerance. Plant Cell and Environment , 35 , 1582-1600. Li, R.F., Zhang, J.W., Wei, J.H., Wang, H.Z., Wang, Y.Z. and Ma, R.C. (2009) Functions and mechanisms of the CBL-CIPK signalling system in plant response to abiotic stress. Prog. Natural Sci. , 19 , 667-676. Li, Z., Baldwin, C.M., Hu, Q., Liu, H. and Luo, H. (2010) Heterologous expression of Arabidopsis H + -pyrophosphatase enhances salt tolerance in transgenic creeping bentgrass ( Agrostis stolonifera L. ). Plant Cell and Environment , 33 , 272-289. Liu, J., Ishitani, M., Halfter, U., Kim, C.-S. and Zhu, J.-K. (2000) The Arabidopsis thaliana SOS2 gene encodes a protein kinase that is required for salt tolerance. Proceedings of the National Academy of Sciences , 97 , 3730-3734. Liu, J. and Zhu, J.-K. (1998) A calcium sensor homolog required for plant salt tolerance. Science , 280 , 1943. Liu, K.H., Huang, C.Y. and Tsay, Y.F. (1999) CHL1 is a dual-affinity nitrate transporter of Arabidopsis involved in multiple phases of nitrate uptake. Plant Cell , 11 , 865-874. Liu, L.-L., Ren, H.-M., Chen, L.-Q., Wang, Y. and Wu, W.-H. (2013) A protein kinase, calcineurin
228
B-like protein-interacting protein kinase9, interacts with calcium sensor calcineurin B-like protein3 and regulates potassium homeostasis under low-potassium stress in Arabidopsis. Plant Physiology , 161 , 266-277. Lopez-Molina, L., Mongrand, S. and Chua, N.H. (2001) A postgermination developmental arrest checkpoint is mediated by abscisic acid and requires the AB15 transcription factor in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America , 98 , 4782-4787. Louis, P. and Galinski, E.A. (1997) Characterization of genes for the biosynthesis of the compatible solute ectoine from Marinococcus halophilus and osmoregulated expression in Escherichia coli . Microbiology-Uk , 143 , 1141-1149. Luan, S. (2009) The CBL-CIPK network in plant calcium signalling. Trends Plant Science , 14 , 37-42. Luan, S., Kudla, J., Rodriguez-Concepcion, M., Yalovsky, S. and Gruissem, W. (2002) Calmodulins and calcineurin B-like proteins: Calcium sensors for specific signal response coupling in plants. Plant Cell , 14 , S389-400. Luan, S., Lan, W.Z. and Lee, S.C. (2009) Potassium nutrition, sodium toxicity, and calcium signalling: Connections through the CBL-CIPK network. Current Opinion in Biotechnology , 12 , 339-346. Lyzenga, W.J., Liu, H., Schofield, A., Muise-Hennessey, A. and Stone, S.L. (2013) Arabidopsis CIPK26 interacts with KEG, components of the ABA signalling network and is degraded by the ubiquitin-proteasome system. Journal of Experimental Botany , 64 , 2779-2791. Maas, C. and Werr, W. (1989) Mechanism and optimized conditions for PEG mediated dna transfection into plant-protoplasts. Plant Cell Reports , 8, 148-151. MacRobbie, E.A.C. and Kurup, S. (2007) Signalling mechanisms in the regulation of vacuolar ion release in guard cells. New Phytologist , 175 , 630-640. Maehs, A., Steinhorst, L., Han, J.-P., Shen, L.-K., Wang, Y. and Kudla, J. (2013) The calcineurin B-like Ca 2+ sensors CBL1 and CBL9 function in pollen germination and pollen tube growth in Arabidopsis. Molecular Plant , 6, 1149-1162. Mahajan, S., Pandey, G.K. and Tuteja, N. (2008) Calcium- and salt-stress signaling in plants: Shedding light on SOS pathway. Archives of Biochemistry and Biophysics , 471 , 146-158. Mahajan, S., Sopory, S.K. and Tuteja, N. (2006) Cloning and characterization of CBL-CIPK signalling components from a legume ( Pisum sativum ). FEBS Journal , 273 , 907-925. Mahajan, S. and Tuteja, N. (2005) Cold, salinity and drought stresses: An overview. Archives of Biochemistry and Biophysics , 444 , 139-158. Maheshwari, R. and Dubey, R.S. (2009) Nickel-induced oxidative stress and the role of antioxidant defence in rice seedlings. Plant Growth Regulation , 59 , 37-49. Maqbool, S.B. and Christou, P. (1999) Multiple traits of agronomic importance in transgenic indica rice plants: analysis of transgene integration patterns, expression levels and stability. Molecular Breeding , 5, 471-480. McAinsh, M.R. and Hetherington, A.M. (1998) Encoding specificity in Ca 2+ signalling systems. Trends in Plant Science , 3, 32-36. McCue, K.F. and Hanson, A.D. (1990) Drought and salt tolerance - towards understanding and application. Trends in Biotechnology , 8, 358-362. McLachlan, D.H., Kudla, J. and Hetherington, A.M. (2009) Role of the protein kinase CIPK8 in guard cell signalling. Comparative Biochemistry and Physiology a-Molecular & Integrative Physiology , 153A , S210-S210.
229
Mian, A., Oomen, R.J.F.J., Isayenkov, S., Sentenac, H., Maathuis, F.J.M. and Very, A.-A. (2011) Over-expression of an Na + and K + permeable HKT transporter in barley improves salt tolerance. Plant Journal , 68 , 468-479. Mishra, S., Jha, A.B. and Dubey, R.S. (2011) Arsenite treatment induces oxidative stress, upregulates antioxidant system, and causes phytochelatin synthesis in rice seedlings. Protoplasma , 248 , 565-577. Mittler, R. (2002) Oxidative stress, antioxidants and stress tolerance. Trends in Plant Science , 7, 405-410. Miyada, C.G., Stoltzfus, L. and Wilcox, G. (1984) Regulation of the arac gene of Escherichia coli - catabolite repression, auto-regulation, and effect on araBAD expression. Proceedings of the National Academy of Sciences of the United States of America , 81 , 4120-4124. Møller, I.S., Gilliham, M., Jha, D., Mayo, G.M., Roy, S.J., Coates, J.C., Haseloff, J. and Tester, M. (2009) Shoot Na + exclusion and increased salinity tolerance engineered by cell type-Specific alteration of Na + transport in Arabidopsis. Plant Cell , 21 , 2163-2178. Møller, I.S. and Tester, M. (2007) Salinity tolerance of Arabidopsis: a good model for cereals? Trends in Plant Science , 12 , 534-540. Moriwaki, T., Yamamoto, Y., Aida, T., Funahashi, T., Shishido, T., Asada, M., Prodhan, S.H., Komamine, A. and Motohashi, T. (2008) Overexpression of the Escherichia coli catalase gene, katE , enhances tolerance to salinity stress in the transgenic indica rice cultivar, BR5. Plant Biotechnology Reports , 2, 41-46. Munns, R. (1993) Physiological processes limiting plant-growth in saline soils - some dogmas and hypotheses. Plant Cell and Environment , 16 , 15-24. Munns, R. (2002) Comparative physiology of salt and water stress. Plant Cell and Environment , 25 , 239-250. Munns, R. and James, R.A. (2003) Screening methods for salinity tolerance: a case study with tetraploid wheat. Plant and Soil , 253 , 201-218. Munns, R., James, R.A. and Lauchli, A. (2006) Approaches to increasing the salt tolerance of wheat and other cereals. Journal of Experimental Botany , 57 , 1025-1043. Munns, R., James, R.A., Xu, B., Athman, A., Conn, S.J., Jordans, C., Byrt, C.S., Hare, R.A., Tyerman, S.D., Tester, M., Plett, D. and Gilliham, M. (2012) Wheat grain yield on saline soils is improved by an ancestral Na + transporter gene. Nature Biotechnology , 30 , 360-373. Munns, R. and Tester, M. (2008) Mechanisms of salinity tolerance. Annual Review of Plant Biology , 59 , 651-681. Murguia, J.R., Belles, J.M. and Serrano, R. (1995) A salt-sensitive 3'(2'),5'-bisphosphate nucleotidase involved in sulfate activation. Science , 267 , 232-234. Nagae, M., Nozawa, A., Koizumi, N., Sano, H., Hashimoto, H., Sato, M. and Shimizu, T. (2003) The crystal structure of the novel calcium-binding protein AtCBL2 from Arabidopsis thaliana . Journal of Biological Chemistry , 278 , 42240-42246. Navarro, J.M., Garrido, C., Martinez, V. and Carvajal, M. (2003) Water relations and xylem transport of nutrients in pepper plants grown under two different salts stress regimes. Plant Growth Regulation , 41 , 237-245. Neumann, E., Sowers, A.E. and Jordan, A. (1989) Critical evaluation of electromediated gene transfer and transient expression in plant cells. In Electroporation and electrofusion in cell biology (Proels, M., Schell, J. and Steinbiss, H.H. eds): Springer Science & Business Media, pp.
230
367-375. Newman, I.A. (2001) Ion transport in roots: Measurement of fluxes using ion-selective microelectrodes to characterize transporter function. Plant Cell and Environment , 24 , 1-14. Nielsen, B.L., Willis, V.C. and Lin, C.-Y. (2007) Western blot analysis to illustrate relative control levels of the lac and ara promoters in Escherichia coli . Biochemistry and Molecular Biology Education , 35 , 133-137. Niiranen, L., Espelid, S., Karlsen, C.R., Mustonen, M., Paulsen, S.M., Heikinheimo, P. and Willassen, N.P. (2007) Comparative expression study to increase the solubility of cold adapted Vibrio proteins in Escherichia coli . Protein Expression and Purification , 52 , 210-218. Ohad, N., Shichrur, K. and Yalovsky, S. (2007) The analysis of protein-protein interactions in plants by bimolecular fluorescence complementation. Plant Physiology , 145 , 1090-1099. Ohta, M., Guo, Y., Halfter, U. and Zhu, J.K. (2003) A novel domain in the protein kinase SOS2 mediates interaction with the protein phosphatase 2C AB12. Proceedings of the National Academy of Sciences of the United States of America, 100 , 11771-11776. Okamoto, M., Kumar, A., Li, W.B., Wang, Y., Siddiqi, M.Y., Crawford, N.M. and Glass, A.D.M. (2006) High-affinity nitrate transport in roots of Arabidopsis depends on expression of the NAR2-like gene AtNRT3.1 . Plant Physiology , 140 , 1036-1046. Olias, R., Eljakaoui, Z., Li, J., Alvarez De Morales, P., Carmen Marin-Manzano, M., Pardo, J.M. and Belver, A. (2009) The plasma membrane Na +/H + antiporter SOS1 is essential for salt tolerance in tomato and affects the partitioning of Na + between plant organs. Plant Cell and Environment , 32 , 904-916. Orsel, M., Chopin, F., Leleu, O., Smith, S.J., Krapp, A., Daniel-Vedele, F. and Miller, A.J. (2006) Characterization of a two-component high-affinity nitrate uptake system in Arabidopsis. Physiology and protein-protein interaction. Plant Physiology , 142 , 1304-1317. Ossenbuehl, F., Inaba-Sulpice, M., Meurer, J., Soll, J. and Eichacker, L.A. (2006) The Synechocystis sp PCC 6803 oxa1 homolog is essential for membrane integration of reaction center precursor protein pD1. Plant Cell , 18 , 2236-2246. Pandey, G.K. (2008) Emergence of a novel calcium signaling pathway in plants: CBL-CIPK signaling network. Physiology and Molecular Biology of Plants , 14 , 51-68. Pandey, G.K., Cheong, Y.H., Kim, B.-G., Grant, J.J., Li, L. and Luan, S. (2007) CIPK9: a calcium sensor-interacting protein kinase required for low-potassium tolerance in Arabidopsis. Cell Research , 17 , 411-421. Pandey, G.K., Cheong, Y.H., Kim, K.N., Grant, J.J., Li, L.G., Hung, W., D'Angelo, C., Weinl, S., Kudla, J. and Luan, S. (2004) The calcium sensor calcineurin B-like 9 modulates abscisic acid sensitivity and biosynthesis in Arabidopsis. Plant Cell , 16 , 1912-1924. Pandey, G.K., Grant, J.J., Cheong, Y.H., Kim, B.-G., Li, L.G. and Luan, S. (2008) Calcineurin-B-like protein CBL9 interacts with target kinase CIPK3 in the regulation of ABA response in seed germination. Molecular Plant , 1, 238-248. Pandey, G.K., Grant, J.J., Cheong, Y.H., Kim, B.G., Li, L.G. and Luan, S. (2005) ABR1, an APETALA2-domain transcription factor that functions as a repressor of ABA response in Arabidopsis. Plant Physiology , 139 , 1185-1193. Pandey, G.K., Kanwar, P. and Panday, A. (2014) Functional role of CBL-CIPK in abiotic stresses. In Global comparative analysis of CBL-CIPK families in plants : Springer, pp. 65-73. Pasapula, V., Shen, G., Kuppu, S., Paez-Valencia, J., Mendoza, M., Hou, P., Chen, J., Qiu, X., Zhu,
231
L., Zhang, X., Auld, D., Blumwald, E., Zhang, H., Gaxiola, R. and Payton, P. (2011) Expression of an Arabidopsis vacuolar H +-pyrophosphatase gene ( AVP1 ) in cotton improves drought- and salt tolerance and increases fibre yield in the field conditions. Plant Biotechnology Journal , 9, 88-99. Pei, Z.M., Kuchitsu, K., Ward, J.M., Schwarz, M. and Schroeder, J.I. (1997) Differential abscisic acid regulation of guard cell slow anion channels in Arabidopsis wild-type and abi1 and abi2 mutants. Plant Cell , 9, 409-423. Pepinsky, R.B. (1991) Selective precipitation of proteins from guanidine hydrochloride-containing solutions with ethanol. Analytical Biochemistry , 195 , 177-181. Piao, H.L., Xuan, Y.H., Park, S.H., Je, B.I., Park, S.J., Kim, C.M., Huang, J., Wang, G.K., Kim, M.J., Kang, S.M., Lee, I.J., Kwon, T.R., Kim, Y.H., Yeo, U.S., Yi, G., Son, D. and Han, C.D. (2010) OsCIPK31, a CBL-interacting protein kinase is involved in germination and seedling growth under abiotic stress conditions in rice plants. Molecules and Cells , 30 , 19-27. Platten, J.D., Cotsaftis, O., Berthomieu, P., Bohnert, H., Davenport, R.J., Fairbairn, D.J., Horie, T., Leigh, R.A., Lin, H.-X., Luan, S., Maeser, P., Pantoja, O., Rodriguez-Navarro, A., Schachtman, D.P., Schroeder, J.I., Sentenac, H., Uozumi, N., Very, A.-A., Zhu, J.-K., Dennis, E.S. and Tester, M. (2006) Nomenclature for HKT transporters, key determinants of plant salinity tolerance. Trends in Plant Science , 11 , 372-374. Plett, D., Toubia, J., Garnett, T., Tester, M., Kaiser, B.N. and Baumann, U. (2010) Dichotomy in the NRT gene families of dicots and grass species. Plos ONE , 5. Plett, D.C. and Møller, I.S. (2010) Na + transport in glycophytic plants: what we know and would like to know. Plant Cell and Environment , 33 , 612-626. Prasad, T.K., Anderson, M.D., Martin, B.A. and Stewart, C.R. (1994) Evidence for chilling-induced oxidative stress in maize seedlings and a regulatory role for hydrogen peroxide. Plant Cell , 6, 65-74. Prashanth, S.R., Sadhasivam, V. and Parida, A. (2008) Over-expression of cytosolic copper/zinc superoxide dismutase from a mangrove plant Avicennia mayina in indica Rice var Pusa Basmati-1 confers abiotic stress tolerance. Transgenic Research , 17 , 281-291. Price, A.H., Taylor, A., Ripley, S.J., Griffiths, A., Trewavas, A.J. and Knight, M.R. (1994) Oxidative signals in tobacco increase cytosolic calcium. The Plant Cell Online , 6, 1301-1310. Pyo, Y.J., Gierth, M., Schroeder, J.I. and Cho, M.H. (2010) High-Affinity K + transport in Arabidopsis: AtHAK5 and AKT1 are vital for seedling establishment and postgermination growth under low-potassium conditions. Plant Physiology , 153 , 863-875. Qiu, Q.S., Guo, Y., Dietrich, M.A., Schumaker, K.S. and Zhu, J.K. (2002) Regulation of SOS1, a plasma membrane Na +/H + exchanger in Arabidopsis thaliana , by SOS2 and SOS3. Proceedings of the National Academy of Sciences of the United States of America , 99 , 8436-8441. Qiu, Q.S., Guo, Y., Quintero, F.J., Pardo, J.M., Schumaker, K.S. and Zhu, J.K. (2004) Regulation of vacuolar Na +/H + exchange in Arabidopsis thaliana by the Salt-Overly-Sensitive (SOS) pathway. Journal of Biological Chemistry , 279 , 207-215. Quan, R.D., Lin, H.X., Mendoza, I., Zhang, Y.G., Cao, W.H., Yang, Y.Q., Shang, M., Chen, S.Y., Pardo, J.M. and Guo, Y. (2007) SCABP8/CBL10, a putative calcium sensor, interacts with the protein kinase SOS2 to protect Arabidopsis shoots from salt stress. Plant Cell , 19 , 1415-1431. Quintero, F.J., Martinez-Atienza, J., Villalta, I., Jiang, X., Kim, W.-Y., Ali, Z., Fujii, H., Mendoza,
232
I., Yun, D.-J., Zhu, J.-K. and Pardo, J.M. (2011) Activation of the plasma membrane Na/H antiporter Salt-Overly-Sensitive 1 (SOS1) by phosphorylation of an auto-inhibitory C-terminal domain. Proceedings of the National Academy of Sciences of the United States of America , 108 , 2611-2616. Quintero, F.J., Ohta, M., Shi, H.Z., Zhu, J.K. and Pardo, J.M. (2002) Reconstitution in yeast of the Arabidopsis SOS signaling pathway for Na + homeostasis. Proceedings of the National Academy of Sciences of the United States of America, 99 , 9061-9066. Rabhi-Essafi, I., Sadok, A., Khalaf, N. and Fathallah, D.M. (2007) A strategy for high-level expression of soluble and functional human interferon alpha as a GST-fusion protein in E.coli . Protein Engineering Design & Selection , 20 , 201-209. Rajagopala, S.V., Hughes, K.T. and Uetz, P. (2009) Benchmarking yeast two-hybrid systems using the interactions of bacterial motility proteins. Proteomics , 9, 5296-5302. Rajendran, K., Tester, M. and Roy, S.J. (2009) Quantifying the three main components of salinity tolerance in cereals. Plant Cell and Environment , 32 , 237-249. Raran-Kurussi, S. and Waugh, D.S. (2012) The ability to enhance the solubility of its fusion partners is an intrinsic property of maltose-binding protein but their folding is either spontaneous or chaperone-mediated. PLoS ONE , 7. Reddy, V.S., Ali, G.S. and Reddy, A.S.N. (2002) Genes encoding calmodulin-binding proteins in the Arabidopsis genome. Journal of Biological Chemistry , 277 , 9840-9852. Rees, D.C., Deantonio, L. and Eisenberg, D. (1989) Hydrophobic organization of membrane-proteins. Science , 245 , 510-513. Ren, X.-L., Qi, G.-N., Feng, H.-Q., Zhao, S., Zhao, S.-S., Wang, Y. and Wu, W.-H. (2013) Calcineurin B-like protein CBL10 directly interacts with AKT1 and modulates K + homeostasis in Arabidopsis. Plant Journal , 74 , 258-266. Ren, Z.H., Gao, J.P., Li, L.G., Cai, X.L., Huang, W., Chao, D.Y., Zhu, M.Z., Wang, Z.Y., Luan, S. and Lin, H.X. (2005) A rice quantitative trait locus for salt tolerance encodes a sodium transporter. Nature Genetics , 37 , 1141-1146. Rengasamy, P. (2002) Transient salinity and subsoil constraints to dryland farming in Australian sodic soils: an overview. Australian Journal of Experimental Agriculture , 42 , 351-361. Rengasamy, P. (2006) World salinization with emphasis on Australia. Journal of Experimental Botany , 57 , 1017-1023. Rengasamy, P. (2010) Soil processes affecting crop production in salt-affected soils. Functional Plant Biology , 37 , 613-620. Resh, M.D. (1999) Fatty acylation of proteins: new insights into membrane targeting of myristoylated and palmitoylated proteins. Biochimica Et Biophysica Acta-Molecular Cell Research , 1451 , 1-16. Ritchie, R.J. (2006) Consistent sets of spectrophotometric chlorophyll equations for acetone, methanol and ethanol solvents. Photosynthesis Research , 89 , 27-41. Roberts, S.K. and Snowman, B.N. (2000) The effects of ABA on channel ‐mediated K + transport across higher plant roots. Journal of Experimental Botany , 51 , 1585-1594. Rodriguez-Rosales, M.P., Galvez, F.J., Huertas, R., Aranda, M.N., Baghour, M., Cagnac, O. and Venema, K. (2009) Plant NHX cation/proton antiporters. Plant signaling & behavior , 4, 265-276. Romero, C., Belles, J.M., Vaya, J.L., Serrano, R. and CulianezMacia, F.A. (1997) Expression of the
233
yeast trehalose-6-phosphate synthase gene in transgenic tobacco plants: Pleiotropic phenotypes include drought tolerance. Planta, 201 , 293-297. Rosano, G.L. and Ceccarelli, E.A. (2009) Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories , 8, 41-50. Rossignol, M. (2006) Proteomic analysis of phosphorylated proteins. Current Opinion in Plant Biology , 9, 538-543. Roxas, V.P., Smith, R.K., Allen, E.R. and Allen, R.D. (1997) Overexpression of glutathione S-transferase glutathione peroxidase enhances the growth of transgenic tobacco seedlings during stress. Nature Biotechnology , 15 , 988-991. Roy, S.J., Huang, W., Wang, X.J., Evrard, A., Schmoeckel, S.M., Zafar, Z.U. and Tester, M. (2013) A novel protein kinase involved in Na + exclusion revealed from positional cloning. Plant Cell and Environment , 36 , 553-568. Roy, S.J., Negrao, S. and Tester, M. (2014) Salt resistant crop plants. Current Opinion in Biotechnology , 26 , 115-124. Roy, S.J. and Tester, M. (2012) Approaches for increasing salinity tolerance of crops. In Encyclopaedia of Sustainable Science and Technology. , New York, USA: McGraw-Hill. Rus, A., Lee, B.H., Munoz-Mayor, A., Sharkhuu, A., Miura, K., Zhu, J.K., Bressan, R.A. and Hasegawa, P.M. (2004) AtHKT1 facilitates Na + homeostasis and K + nutrition in planta. Plant Physiology , 136 , 2500-2511. Rus, A., Yokoi, S., Sharkhuu, A., Reddy, M., Lee, B.H., Matsumoto, T.K., Koiwa, H., Zhu, J.K., Bressan, R.A. and Hasegawa, P.M. (2001) AtHKT1 is a salt tolerance determinant that controls Na + entry into plant roots. Proceedings of the National Academy of Sciences of the United States of America , 98 , 14150-14155. Sanchez-Barrena, M.J., Fujii, H., Angulo, I., Martinez-Ripoll, M., Zhu, J.K. and Albert, A. (2007) The structure of the C-terminal domain of the protein kinase AtSOS2 bound to the calcium sensor AtSOS3. Molecular Cell , 26 , 427-435. Sanders, D., Brownlee, C. and Harper, J.F. (1999) Communicating with calcium. Plant Cell , 11 , 691-706. Sanders, D., Pelloux, J., Brownlee, C. and Harper, J.F. (2002) Calcium at the crossroads of signaling. Plant Cell , 14 , S401-S417. Saradhi, P.P., Alia, Arora, S. and Prasad, K. (1995) Proline accumulates in plants exposed to UV radiation and protects them against UV induced peroxidation. Biochemical and Biophysical Research Communications , 209 , 1-5. Scarsi, M., Majeux, N. and Caflisch, A. (1999) Hydrophobicity at the surface of proteins. Proteins-Structure Function and Genetics , 37 , 565-575. Schenk, P.M., Baumann, S., Mattes, R. and Steinbiss, H.H. (1995) Improved high-level expression system for eukaryotic genes in Escherichia coli using T7 RNA-polymerase and rare Arg tRNAs. BioTechniques , 19 , 196. Schmid, M., Davison, T.S., Henz, S.R., Pape, U.J., Demar, M., Vingron, M., Scholkopf, B., Weigel, D. and Lohmann, J.U. (2005) A gene expression map of Arabidopsis thaliana development. Nature Genetics , 37 , 501-506. Schob, H., Kunc, C. and Meins, F. (1997) Silencing of transgenes introduced into leaves by agroinfiltration: a simple, rapid method for investigating sequence requirements for gene silencing. Molecular and General Genetics , 256 , 581-585.
234
Schreiber, T.B., Maeusbacher, N., Breitkopf, S.B., Grundner-Culemann, K. and Daub, H. (2008) Quantitative phosphoproteomics - an emerging key technology in signal-transduction research. Proteomics , 8, 4416-4432. Scrase-Field, S. and Knight, M.R. (2003) Calcium: just a chemical switch? Current Opinion in Plant Biology , 6, 500-506. Serulle, Y., Sugimori, M. and Linas, R.R. (2007) Imaging synaptosomal calcium concentration microdomains and vesicle fusion by using total internal reflection fluorescent microscopy. Proceedings of the National Academy of Sciences of the United States of America , 104 , 1697-1702. Shah, K., Kumar, R.G., Verma, S. and Dubey, R.S. (2001) Effect of cadmium on lipid peroxidation, superoxide anion generation and activities of antioxidant enzymes in growing rice seedlings. Plant Science , 161 , 1135-1144. Shah, S.H., Gorham, J., Forster, B.P. and Jones, R.G.W. (1987) Salt tolerance in the triticeae - the contribution of the d-genome to cation selectivity in hexaploid wheat. Journal of Experimental Botany , 38 , 254-269. Sharma, P. and Dubey, R.S. (2005) Drought induces oxidative stress and enhances the activities of antioxidant enzymes in growing rice seedlings. Plant Growth Regulation , 46 , 209-221. Sheen, J. (2001) Signal transduction in maize and Arabidopsis mesophyll protoplasts. Plant Physiology , 127 , 1466-1475. Sheveleva, E., Chmara, W., Bohnert, H.J. and Jensen, R.G. (1997) Increased salt and drought tolerance by D-ononitol production in transgenic Nicotiana tabacum L. Plant Physiology , 115 , 1211-1219. Shi, H. (2007) Intergration of Ca 2+ in Plant Drought and Salt Stress Signal Transduction Pathways. In Advances in Molecular Breeding Toward Drought and Salt Tolerant Crops (Jenks, M.A., Hasegawa, P.M. and Jain, S.M. eds): Springer, pp. 166-167. Shi, H.Z., Ishitani, M., Kim, C.S. and Zhu, J.K. (2000) The Arabidopsis thaliana salt tolerance gene SOS1 encodes a putative Na +/H + antiporter. Proceedings of the National Academy of Sciences of the United States of America , 97 , 6896-6901. Shi, H.Z., Lee, B.H., Wu, S.J. and Zhu, J.K. (2003) Overexpression of a plasma membrane Na +/H + antiporter gene improves salt tolerance in Arabidopsis thaliana . Nature Biotechnology , 21 , 81-85. Shi, H.Z., Quintero, F.J., Pardo, J.M. and Zhu, J.K. (2002) The putative plasma membrane Na +/H + antiporter SOS1 controls long-distance Na + transport in plants. Plant Cell , 14 , 465-477. Shi, J.R., Kim, K.N., Ritz, O., Albrecht, V., Gupta, R., Harter, K., Luan, S. and Kudla, J. (1999) Novel protein kinases associated with calcineurin B-like calcium sensors in Arabidopsis. Plant Cell , 11 , 2393-2405. Siddiqi, M.Y., Glass, A.D.M., Ruth, T.J. and Fernando, M. (1989) Studies of the regulation of nitrate 13 - influx by barley seedlings using NO 3 . Plant Physiology , 90 , 806-813. Singh, R., Lee, M.-O., Lee, J.-E., Choi, J., Park, J.H., Kim, E.H., Yoo, R.H., Cho, J.-I., Jeon, J.-S., Rakwal, R., Agrawal, G.K., Moon, J.S. and Jwa, N.-S. (2012) Rice mitogen-activated protein kinase interactome analysis using the yeast two-hybrid system. Plant Physiology , 160 , 477-487. Siripornadulsil, S., Traina, S., Verma, D.P.S. and Sayre, R.T. (2002) Molecular mechanisms of proline-mediated tolerance to toxic heavy metals in transgenic microalgae. Plant Cell , 14 ,
235
2837-2847. Smart, R.E. and Bingham, G.E. (1974) Rapid estimates of relative water-content. Plant Physiology , 53 , 258-260. Smialowski, P., Doose, G., Torkler, P., Kaufmann, S. and Frishman, D. (2012) PROSO II – a new method for protein solubility prediction. FEBS Journal , 279 , 2192-2200. Smialowski, P., Martin-Galiano, A.J., Mikolajka, A., Girschick, T., Holak, T.A. and Frishman, D. (2007) Protein solubility: sequence based prediction and experimental verification. Bioinformatics , 23 , 2536-2542. Song, C.P., Agarwal, M., Ohta, M., Guo, Y., Halfter, U., Wang, P.C. and Zhu, J.K. (2005) Role of an Arabidopsis AP2/EREBP-type transcriptional repressor in abscisic acid and drought stress responses. Plant Cell , 17 , 2384-2396. Srivastava, S. and Dubey, R.S. (2011) Manganese-excess induces oxidative stress, lowers the pool of antioxidants and elevates activities of key antioxidative enzymes in rice seedlings. Plant Growth Regulation , 64 , 1-16. Stagljar, I., Korostensky, C., Johnsson, N. and te Heesen, S. (1998) A genetic system based on split-ubiquitin for the analysis of interactions between membrane proteins in vivo . Proceedings of the National Academy of Sciences of the United States of America , 95 , 5187-5192. Stellberger, T., Hauser, R., Baiker, A., Pothineni, V.R., Haas, J. and Uetz, P. (2010) Improving the yeast two-hybrid system with permutated fusions proteins: the Varicella Zoster Virus interactome. Proteome science , 8, 8-8. Suarez, R., Calderon, C. and Iturriaga, G. (2009) Enhanced Tolerance to Multiple Abiotic Stresses in Transgenic Alfalfa Accumulating Trehalose. Crop Science , 49 , 1791-1799. Sun, W.-H., Duan, M., Shu, D.-F., Yang, S. and Meng, Q.-W. (2010) Over-expression of StAPX in tobacco improves seed germination and increases early seedling tolerance to salinity and osmotic stresses. Plant Cell Reports , 29 , 917-926. Sunarpi, Horie, T., Motoda, J., Kubo, M., Yang, H., Yoda, K., Horie, R., Chan, W.Y., Leung, H.Y., Hattori, K., Konomi, M., Osumi, M., Yamagami, M., Schroeder, J.I. and Uozumi, N. (2005) Enhanced salt tolerance mediated by AtHKT1 transporter-induced Na + unloading from xylem vessels to xylem parenchyma cells. Plant Journal , 44 , 928-938. Tang, R.-J., Liu, H., Yang, Y., Yang, L., Gao, X.-S., Garcia, V.J., Luan, S. and Zhang, H.-X. (2012) Tonoplast calcium sensors CBL2 and CBL3 control plant growth and ion homeostasis through regulating V-ATPase activity in Arabidopsis. Cell Research , 22 , 1650-1665. Tester, M. and Davenport, R. (2003) Na + tolerance and Na + transport in higher plants. Annals of Botany , 91 , 503-527. Tian, Y., Zhang, H., Pan, X., Chen, X., Zhang, Z., Lu, X. and Huang, R. (2011) Overexpression of ethylene response factor TERF2 confers cold tolerance in rice seedlings. Transgenic Research , 20 , 857-866. Toda, K., Kuroiwa, H., Senthil, K., Shimada, N., Aoki, T., Ayabe, S.-i., Shimada, S., Sakuta, M., Miyazaki, Y. and Takahashi, R. (2012) The soybean F3'H protein is localized to the tonoplast in the seed coat hilum. Planta , 236 , 79-89. Tracy, F.E., Gilliham, M., Dodd, A.N., Webb, A.A.R. and Tester, M. (2008) NaCl-induced changes in cytosolic free Ca 2+ in Arabidopsis thaliana are heterogeneous and modified by external ionic composition. Plant Cell and Environment , 31 , 1063-1073. Trewavas, A.J. and Malho, R. (1997) Signal perception and transduction: The origin of the phenotype.
236
Plant Cell , 9, 1181-1195. Tripathi, V., Parasuraman, B., Laxmi, A. and Chattopadhyay, D. (2009) CIPK6, a CBL-interacting protein kinase is required for development and salt tolerance in plants. Plant Journal , 58 , 778-790. Turner, P., Holst, O. and Karlsson, E.N. (2005) Optimized expression of soluble cyclomaltodextrinase of thermophilic origin in Escherichia coli by using a soluble fusion-tag and by tuning of inducer concentration. Protein Expression and Purification , 39 , 54-60. Umetsu, M., Tsumoto, K., Hara, M., Ashish, K., Goda, S., Adschiri, T. and Kumagai, I. (2003) how additives influence the refolding of immunoglobulin-folded proteins in a stepwise dialysis system: Spectroscopic evidence for highly efficient refolding of a single-chain fv fragment. Journal of Biological Chemistry , 278 , 8979-8987. Umezawa, T., Sugiyama, N., Takahashi, F., Anderson, J.C., Ishihama, Y., Peck, S.C. and Shinozaki, K. (2013) Genetics and phosphoproteomics reveal a protein phosphorylation network in the abscisic acid signaling pathway in Arabidopsis thaliana . Science Signaling , 6, rs8. Uno, Y., Furihata, T., Abe, H., Yoshida, R., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2000) Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proceedings of the National Academy of Sciences of the United States of America , 97 , 11632-11637. Uozumi, N., Kim, E.J., Rubio, F., Yamaguchi, T., Muto, S., Tsuboi, A., Bakker, E.P., Nakamura, T. and Schroeder, J.I. (2000) The Arabidopsis HKT1 gene homolog mediates inward Na + currents in Xenopus laevis oocytes and Na + uptake in Saccharomyces cerevisiae . Plant Physiology , 122 , 1249-1259. Very, A.A. and Sentenac, H. (2003) Molecular mechanisms and regulation of K + transport in higher plants. Annual Review of Plant Biology , 54 , 575-603. Waadt, R., Schmidt, L.K., Lohse, M., Hashimoto, K., Bock, R. and Kudla, J. (2008) Multicolor bimolecular fluorescence complementation reveals simultaneous formation of alternative CBL/CIPK complexes in planta . Plant Journal , 56 , 505-516. Walhout, A.J.M., Sordella, R., Lu, X.W., Hartley, J.L., Temple, G.F., Brasch, M.A., Thierry-Mieg, N. and Vidal, M. (2000) Protein interaction mapping in C-elegans using proteins involved in vulval development. Science , 287 , 116-122. Walter, M., Chaban, C., Schutze, K., Batistic, O., Weckermann, K., Nake, C., Blazevic, D., Grefen, C., Schumacher, K., Oecking, C., Harter, K. and Kudla, J. (2004) Visualization of protein interactions in living plant cells using bimolecular fluorescence complementation. Plant Journal , 40 , 428-438. Wang, P., Xue, L., Batelli, G., Lee, S., Hou, Y.-J., Van Oosten, M.J., Zhang, H., Tao, W.A. and Zhu, J.-K. (2013) Quantitative phosphoproteomics identifies SnRK2 protein kinase substrates and reveals the effectors of abscisic acid action. Proceedings of the National Academy of Sciences of the United States of America , 110 , 11205-11210. Wang, R.-K., Li, L.-L., Cao, Z.-H., Zhao, Q., Li, M., Zhang, L.-Y. and Hao, Y.-J. (2012) Molecular cloning and functional characterization of a novel apple MdCIPK6L gene reveals its involvement in multiple abiotic stress tolerance in transgenic plants. Plant Molecular Biology , 79 , 123-135. Wang, R.C., Liu, D. and Crawford, N.M. (1998) The Arabidopsis CHL1 protein plays a major role in high-affinity nitrate uptake. Proceedings of the National Academy of Sciences of the United
237
States of America , 95 , 15134-15139. Wang, Y. and Wu, W.-H. (2010) Plant sensing and signaling in response to K+-deficiency. Molecular Plant , 3, 280-287. Wang, Y., Zhang, W.-Z., Song, L.-F., Zou, J.-J., Su, Z. and Wu, W.-H. (2008) Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. Plant Physiology , 148 , 1201-1211. Ward, J.M., Maeser, P. and Schroeder, J.I. (2009) Plant ion channels: Gene families, physiology, and functional genomics analyses. In Annual Review of Physiology , pp. 59-82. Warren, C.R. (2008) Rapid measurement of chlorophylls with a microplate reader. Journal of Plant Nutrition , 31 , 1321-1332. Webb, A.A.R., McAinsh, M.R., Taylor, J.E. and Hetherington, A.M. (1996) Calcium ions as intracellular second messengers in higher plants. Advances in Botanical Research, Vol 22 , 22 , 45-96. Weickert, M.J., Pagratis, M., Curry, S.R. and Blackmore, R. (1997) Stabilization of apoglobin by low temperature increases yield of soluble recombinant hemoglobin in Escherichia coli . Applied and Environmental Microbiology , 63 , 4313-4320. Weinl, S., Held, K., Schluecking, K., Steinhorst, L., Kuhlgert, S., Hippler, M. and Kudla, J. (2008) A plastid protein crucial for Ca 2+ -regulated stomatal responses. New Phytologist , 179 , 675-686. Weinl, S. and Kudla, J. (2009) The CBL-CIPK Ca 2+ -decoding signaling network: function and perspectives. New Phytologist , 184 , 517-528. Wroblewski, T., Tomczak, A. and Michelmore, R. (2005) Optimization of Agrobacterium-mediated transient assays of gene expression in lettuce, tomato and Arabidopsis. Plant Biotechnology Journal , 3, 259-273. Wu, S.J., Ding, L. and Zhu, J.K. (1996) SOS1 , a genetic locus essential for salt tolerance and potassium acquisition. Plant Cell , 8, 617-627. Wydro, M., Kozubek, E. and Lehmann, P. (2006) Optimization of transient Agrobacterium-mediated gene expression system in leaves of Nicotiana benthamiana . Acta Biochimica Polonica , 53 , 289-298. Xiang, Y., Huang, Y.M. and Xiong, L.Z. (2007) Characterisation of stress-responsive CIPK genes in rice for stress tolerance improvement. Plant Physiology , 144 , 1416-1428. Xiong, L.M., Schumaker, K.S. and Zhu, J.K. (2002) Cell signaling during cold, drought, and salt stress. Plant Cell , 14 , S165-S183. Xu, B. (2009) Functional characterisation of HKT1;5 homologues from wheat and rice. In Master thesis, University of Adelaide . Adelaide. Xu, J., Li, H.-D., Chen, L.-Q., Wang, Y., Liu, L.-L., He, L. and Wu, W.-H. (2006) A protein kinase, interacting with two calcineurin B-like proteins, regulates K + transporter AKT1 in Arabidopsis. Cell , 125 , 1347-1360. Xu, K., Huang, X., Wu, M., Wang, Y., Chang, Y., Liu, K., Zhang, J., Zhang, Y., Zhang, F., Yi, L., Li, T., Wang, R., Tan, G. and Li, C. (2014) A Rapid, Highly Efficient and Economical Method of Agrobacterium-Mediated In planta Transient Transformation in Living Onion Epidermis. Plos ONE , 9. Xue, S., Yao, X., Luo, W., Jha, D., Tester, M., Horie, T. and Schroeder, J.I. (2011) AtHKT1;1 mediates nernstian sodium channel transport properties in Arabidopsis root stelar cells. PLoS ONE , 6.
238
Yancey, P.H., Clark, M.E., Hand, S.C., Bowlus, R.D. and Somero, G.N. (1982) Living with water-stress - evolution of osmolyte systems. Science , 217 , 1214-1222. Yang, Q., Chen, Z.-Z., Zhou, X.-F., Yin, H.-B., Li, X., Xin, X.-F., Hong, X.-H., Zhu, J.-K. and Gong, Z. (2009) Overexpression of SOS (Salt Overly Sensitive) genes increases salt tolerance in transgenic Arabidopsis. Molecular Plant , 2, 22-31. Yang, W.Q., Kong, Z.S., Omo-Ikerodah, E., Xu, W.Y., Li, Q. and Xue, Y.B. (2008a) Calcineurin B-like interacting protein kinase OsCIPK23 functions in pollination and drought stress responses in rice ( Oryza sativa L. ). Journal of Genetics and Genomics , 35 , 531-543. Yang, X., Liang, Z., Wen, X. and Lu, C. (2008b) Genetic engineering of the biosynthesis of glycinebetaine leads to increased tolerance of photosynthesis to salt stress in transgenic tobacco plants. Plant Molecular Biology , 66 , 73-86. Yeo, A.R. (1992) Variation and inheritance of sodium-transport in rice. Plant and Soil , 146 , 109-116. Yokoi, S., Quintero, F.J., Cubero, B., Ruiz, M.T., Bressan, R.A., Hasegawa, P.M. and Pardo, J.M. (2002) Differential expression and function of Arabidopsis thaliana NHX Na +/H + antiporters in the salt stress response. Plant Journal , 30 , 529-539. Yoo, S.D., Cho, Y.H. and Sheen, J. (2007) Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis. Nature protocols , 2, 1565-1572. Yoshida, T., Fujita, Y., Sayama, H., Kidokoro, S., Maruyama, K., Mizoi, J., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2010) AREB1, AREB2, and ABF3 are master transcription factors that cooperatively regulate ABRE-dependent ABA signaling involved in drought stress tolerance and require ABA for full activation. Plant Journal , 61 , 672-685. Yuasa, T., Ishibashi, Y. and Iwaya-Inoue, M. (2012) A flower specific calcineurin B-like molecule (CBL)-interacting protein kinase (CIPK) homolog in tomato cultivar Micro-Tom ( Solanum lycopersicum L .). American Journal of Plant Sciences , 3, 753-763. Zhang, B., Liu, K., Zheng, Y., Wang, Y., Wang, J. and Liao, H. (2013a) Disruption of AtWNK8 enhances tolerance of arabidopsis to salt and osmotic stresses via modulating proline content and activities of catalase and peroxidase. International Journal of Molecular Sciences , 14 , 7032-7047. Zhang, H., Lv, F., Han, X., Xia, X. and Yin, W. (2013b) The calcium sensor PeCBL1, interacting with PeCIPK24/25 and PeCIPK26, regulates Na +/K + homeostasis in Populus euphratica . Plant Cell Reports , 32 , 611-621. Zhang, H.X. and Blumwald, E. (2001) Transgenic salt-tolerant tomato plants accumulate salt in foliage but not in fruit. Nature Biotechnology , 19 , 765-768. Zhao, F.Y., Zhang, X.J., Li, P.H., Zhao, Y.X. and Zhang, H. (2006) Co-expression of the Suaeda salsa SsNHX1 and Arabidopsis AVP1 confer greater salt tolerance to transgenic rice than the single SsNHX1. Molecular Breeding , 17 , 341-353. Zhao, J., Yu, A., Tian, G., Du, Y., Guo, E. and Diao, X. (2013) Identification of CBL genes from foxtail millet ( Setaria italica L. Beauv .) and its expression under drought and salt stresses. Acta Agronomica Sinica , 39 , 360-367. Zhao, J.F., Sun, Z.F., Zheng, J., Guo, X.Y., Dong, Z.G., Huai, J.L., Gou, M.Y., He, J.G., Jin, Y.S., Wang, J.H. and Wang, G.Y. (2009) Cloning and characterisation of a novel CBL-interacting protein kinase from maize. Plant Molecular Biology , 69 , 661-674. Zhu, J.K. (2002) Salt and drought stress signal transduction in plants. Annual Review of Plant Biology , 53 , 247-273.
239
Zhu, J.K. (2003) Regulation of ion homeostasis under salt stress. Current Opinion in Plant Biology , 6, 441-445. Zhu, J.K., Liu, J.P. and Xiong, L.M. (1998) Genetic analysis of salt tolerance in Arabidopsis: Evidence for a critical role of potassium nutrition. Plant Cell , 10 , 1181-1191.
240
Appendix 1. Full list of the transcriptional response of AtCIPK16 to various stimuli in 152 microarray studies stored in Genevestigator.
241
242
243