Primary Hemopoietic Progenitors and Myelopoiesis from Embryonic Stem

Notch Signaling Requires GATA-2 to Inhibit Myelopoiesis from Embryonic Stem Cells and Primary Hemopoietic Progenitors

This information is current as Renée F. de Pooter, Thomas M. Schmitt, José Luis de la of September 24, 2021. Pompa, Yuko Fujiwara, Stuart H. Orkin and Juan Carlos Zúñiga-Pflücker J Immunol 2006; 176:5267-5275; ; doi: 10.4049/jimmunol.176.9.5267

http://www.jimmunol.org/content/176/9/5267 Downloaded from

References This article cites 74 articles, 39 of which you can access for free at: http://www.jimmunol.org/content/176/9/5267.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 24, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Notch Signaling Requires GATA-2 to Inhibit Myelopoiesis from Embryonic Stem Cells and Primary Hemopoietic Progenitors1

Reneé F. de Pooter,* Thomas M. Schmitt,* Jose´Luis de la Pompa,† Yuko Fujiwara,‡ Stuart H. Orkin,‡ and Juan Carlos Zuń˜iga-Pflu¨cker2*

The bone marrow and thymus, although both hemopoietic environments, induce very distinct differentiation outcomes. The former supports hemopoietic stem cell self-renewal and multiple hemopoietic lineages, while the latter supports T lymphopoiesis almost exclusively. This distinction suggests that the thymic environment acts to restrict the hemopoietic fates available to thymic immigrants. In this study, we demonstrate that the addition of the Notch ligand Delta-like-1 (Dll-1) to an in vitro system that otherwise supports myelopoiesis, greatly reduces the myelopoietic potential of stem cells or uncommitted progenitors. In contrast, Downloaded from committed myeloid progenitors mature regardless of the presence of Dll-1. The block in myelopoiesis is the direct result of Notch signaling within the hemopoietic progenitor, and Dll-1-induced signals cause a rapid increase in the expression of the zinc finger transcription factor GATA-2. Importantly, in the absence of GATA-2, Dll-1-induced signals fail to inhibit commitment to the myeloid fate. Taken together, our results support a role for GATA-2 in allowing Dll-1 to restrict non-T cell lineage differentiation outcomes. The Journal of Immunology, 2006, 176: 5267–5275. http://www.jimmunol.org/ n vertebrates, definitive hemopoiesis is characterized by mul- two proteolytic cleavage events, mediated by a disintegrin and tipotent hemopoietic stem cells (HSCs)3 (1), which possess metalloprotease and ␥-secretase activity, release the intracellular I both the potential for self-renewal and the ability to give rise domain of the Notch receptor (ICN), which translocates to the to all the lineages of the hemopoietic system. The choice between nucleus. In the canonical Notch-signaling pathway, ICN induces self-renewal and differentiation, and between the multiple potential the expression of target genes, such as HES-1, via the DNA- differentiated fates, is influenced by environmental cues. In the binding protein CBF1/supressor of hairless/Lag-1 (CSL) (4). adult mammal, the bone marrow environment provides niches for Alternate, CSL-independent pathways of Notch signaling have both HSCs (2, 3) and their maturation to the majority of hemo- been proposed, but their importance in vertebrates is not clear poietic lineages (1). T cells are the exception, and develop primar- (5) and deficiency in CSL, like deficiency in Notch 1, is em- by guest on September 24, 2021 ily in the thymus. bryonic lethal (6–8). One highly conserved signaling pathway, which controls mul- Within the hemopoietic system, Notch receptors and their li- tiple lineage fate decisions during development, and has been im- gands are expressed by both hemopoietic progenitors (HPC) and plicated in the ability of the thymus to support T lymphopoiesis, is stromal cells (9–11). Notch receptor-ligand interactions in the thy- the Notch pathway (4). In mammals, four Notch receptors mus have been shown to favor T lymphopoiesis, and discourage (Notch-1, -2, -3, and -4) can be engaged by five ligands: Delta-like commitment to other lineages (12, 13). Not surprisingly, bone mar- (Dll)-1, -3, and -4 and Jagged-1 and -2. Following ligand binding, row-derived stromal lines such as OP9 cells, which have been used to support robust in vitro myelopoiesis, erythropoiesis, and B and NK lymphopoiesis, from embryonic stem cell (ESC)-, fetal liver- *Department of Immunology, University of Toronto, Sunnybrook and Women’s Re- and adult bone marrow-derived HPCs (14–17), do not support T search Institute, Toronto, Ontario, Canada; †Departamento de Immunologıá y Onco- lymphopoiesis. In fact, HPCs are rapidly induced to commit to logıá, Centro Nacional de Biotecnologıá-Consejo Superior de Investigaciones Cien- non-T cell fates in the OP9 stromal cell environment (18). Inter- tı´ficas, Universidad Autońoma de Madrid, Madrid, Spain; and ‡Division of Hematology/Oncology, Children’s Hospital and Dana-Farber Cancer Institute, Har- estingly, neither OP9 cells nor bone marrow stroma express de- vard Medical School, and Howard Hughes Medical Institute, Boston MA 02115 tectable levels of Dll-1 (19), in sharp contrast to the high levels of Received for publication December 12, 2005. Accepted for publication February Dll-1 expression found on thymic epithelial cells (20, 21). We 20, 2006. have recently demonstrated that when OP9 cells are retrovirally The costs of publication of this article were defrayed in part by the payment of page transduced to express Dll-1 (OP9-DL1 cells), they support T, but charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. no longer B, lymphopoiesis from HPCs (22, 23). 1 This work was supported by the National Cancer Institute of Canada, with funds In this study, we use this system to characterize the effect of from the Canadian Cancer Society. R.F.d.P. is supported by a Doctoral Research Dll-1/Notch interactions on the commitment and maturation of Award from the Canadian Institute of Health Research. J.C.Z.-P. is supported by a myeloid cells, another hemopoietic lineage that is supported by the Canada Research Chair in Developmental Immunology. bone marrow, but not the thymic, microenvironment. 2 Address correspondence and reprint requests to Dr. Juan Carlos Zuń˜iga-Pflu¨cker, Department of Immunology, University of Toronto, Sunnybrook & Women’s Re- Although Pui et al. (12) observed no myelopoietic defect from search Institute, 2075 Bayview Avenue, Room A-331, Toronto, Ontario M4N 3M5, bone marrow retrovirally transduced with ICN, others have re- Canada. E-mail address: [email protected] ported that exposure to soluble or bound Notch ligands (24–26), or 3 Abbreviations used in this paper: HSC, hemopoietic stem cell; Dll, Delta-like; ESC, transduction with constitutively active Notch (27–30) or its down- embryonic stem cell; HPC, hemopoietic progenitor; CMP, common myeloid progenitor; CSL, CBF1/supressor of hairless/Lag-1; dpc, days postcoitus; GMP, granulo- stream target HES-1 (31), inhibits myelopoiesis from most hemo- cyte-macrophage progenitor; ICN, intracellular Notch. poietic cell lines and HPCs (32, 33). In particular, others have

Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00 5268 NOTCH SIGNALS REQUIRE GATA-2 TO INHIBIT MYELOPOIESIS observed that the Jaggeds do not impede myelopoiesis (34, 35), but Isolation of HPCs Dll-1 does (36, 37). In contrast, two groups found that Notch sig- HPCs were isolated from day 14 fetal liver cells by enriching for CD24low naling promotes differentiation by the 32D cell line (38–40), while lineage marker (Lin)Ϫ fetal liver cells by anti-CD24 Ab-/complement-me- a separate report concluded that Notch signals are necessary for the diated depletion (45), and sorting for the expression of CD117 and Sca-1. differentiation of dendritic cells, but prevent their maturation (41). HPC from adult bone marrow were isolated by staining for Lin (Ter119, CD11b, Gr-1, CD4, CD8, CD45R), CD117, and Sca-1, and sorting based Similarly, Tan-Pertel et al. (40) found that constitutive Notch ac- Ϫ ϩ ϩ on a phenotype of Lin CD117 Sca-1high. Equal numbers of CD117 Sca- tivation enhances granulopoiesis, but inhibits terminal differenti- 1high HPC were seeded onto a ϳ80% conﬂuent monolayer of either OP9- ation. Thus, controversy still remains regarding the effect of Notch DL1 or OP9-control cells. To isolate common myeloid progenitors (CMP) signals on the myeloid potential of uncommitted progenitors, and and granulocyte-macrophage progenitors (GMP) from adult bone marrow ϩ ϩ whether Notch signals deviate committed myeloid progenitors to (46), Lin (CD3, CD4, CD8, CD45R, Gr-1, Ter119, CD19, IgM), IL-7R , and Sca-1ϩ cells were depleted by MACS (Miltenyi Biotec). The resulting other lineages (36), induce their apoptosis (42), or have no effect populations were then sorted based on expression of CD16/32 and CD34: at all (12). Further, the targets of Notch signaling in multipotent CMP as CD117ϩCD34ϩCD16/32int, and GMP as CD117ϩCD34ϩCD16/ HPCs are largely unknown. 32ϩ (46). In this study, we show that myelopoiesis from HPCs obtained For RT-PCR analysis, fetal liver cells were obtained from 13 days post- high from fetal liver, adult bone marrow, or ESCs is severely inhibited coitus (dpc) embryos, depleted of CD24 cells by anti-CD24 Ab-/complement-mediated depletion (45), stained with PE-conjugated anti-Sca-1 in OP9-DL1 vs OP9-control cell cultures. In contrast, committed Ab (BD Biosciences) and anti-PE magnetic microbeads (Miltenyi Biotec), myeloid progenitors complete their maturational program regard- and Sca-1ϩ cells were isolated by two successive double-sensitive enrich- less of the presence of Dll-1. Further, we demonstrate that the ments. Cocultures were harvested by vigorous pipetting at the indicated

Dll-1-induced inhibition of myelopoiesis is mediated by canonical time points. Downloaded from Notch signals within the hemopoietic cell, as the developmental Flow cytometry and cell sorting block is absent when CSLϪ/Ϫ ESCs are cultured on OP9-DL1 cells. In agreement with others (43, 44), we find that GATA-2 Flow cytometry was performed using a FACSCalibur instrument (BD Bio- expression is maintained in HPCs undergoing differentiation in the sciences) as previously described (45). FITC-, PE-, biotin-, and allophy- cocyanin-conjugated Abs, and CyChrome-conjugated streptavidin were presence of Notch signals. Importantly, we extend previous find- purchased from BD Biosciences. For analysis of hemopoietic cells, live ings to establish that modulation of GATA-2 expression is re- cells were gated based on forward and side scatter, lack of propidium http://www.jimmunol.org/ quired to mediate the Dll-1-induced defect in myelopoiesis, as iodide uptake, and lack of GFP expression. Cells were sorted using a HPCs that lack GATA-2 do not demonstrate a Notch/Dll-1-medi- FACSDiVa instrument (BD Biosciences) as previously described. Sorted cells were Ͼ99% pure, as determined by postsort analysis. ated inhibition of myelopoiesis. Thus, our results provide a poten- MACS enrichment was performed according the manufacturer’s instruc- tial mechanism for the observed function of Dll-1 in mediating the tions (Miltenyi Biotec). lineage restriction of differentiating HPCs within specific microenvironments. Limiting dilution assay For the limiting dilution assay, equal numbers of sorted CD117ϩSca-1high fetal liver-derived HPCs were cultured on either OP9-control or OP9-DL1 Materials and Methods cells for 5 days, in the presence of Flt3L at a final concentration of 5 ng/ml. by guest on September 24, 2021 Mice Following 5 days of culture, 12 replicates each of 100, 30, 10, 3, or 1 cell(s)/well were deposited by Clonecyte sorting into 96-well plates con- Timed-pregnant Swiss.NIH and C57BL/6 CD45.1 congenic mice were ob- taining confluent monolayers of OP9-control cells. The fetal liver-derived tained from the National Cancer Institute, Frederick Cancer Research and cells were then cultured in the presence of Flt3L at a final concentration of Development Center (Frederick, MD). 5 ng/ml and IL-3 at a final concentration of 1 ng/ml (R&D Systems), and analyzed by flow cytometry after 8 days. Differentiation of ESCs and cell culture PCR and RT-PCR OP9 cells were originally obtained from Dr. T. Nakano (Osaka University, Osaka, Japan) and the Riken Cell Bank (Tsukuba, Japan). The generation For RT-PCR analysis, cDNA was prepared from OP9-control and OP9- of OP9-DL1 cells and OP9-control (GFP only) cells is described in Schmitt DL1 cells, freshly isolated ex vivo CD117ϩSca-1high sorted fetal liver pro- and Zuń˜iga-Pflu¨cker (23). ESC/OP9 differentiation cocultures, using either genitors, freshly isolated ex vivo CD44ϩCD25ϪCD117ϩ (DN1 subset) and OP9-DL1 or OP9-control cells and ESR1, CSLϩ/Ϫ, CSLϪ/Ϫ, GATA-2ϩ/Ϫ, CD44ϩCD25ϩCD117ϩ (DN2 subset) day 14 fetal thymocytes (47), and or GATA-2Ϫ/Ϫ ESCs were performed as previously described (15, 16). Sca-1ϩ MACS-enriched fetal liver progenitors cultured for 37 h on either Briefly, 5 ϫ 104 ESCs were seeded onto either OP9-DL1 or OP9-control OP9-DL1 or OP9-control stroma. In the latter case, contamination by OP9 cell monolayers in 10-cm dishes. After 5 days of coculture, cells were cells was minimized by sorting CD45ϩ cells directly into TRIzol (Invitro- harvested and resuspended into single-cell suspensions by 0.25% trypsin gen Life Technologies). OP9-control and OP9-DL1 cells were also col- treatment and vigorous pipetting. Cells were then washed and reseeded lected using TRIzol. For the time course comparing GATA-2 expression onto new OP9 cell monolayers, with the addition of Flt3L at a final con- patterns in CSLϪ/Ϫ vs CSLϩ/Ϫ ESC-derived hemopoietic cells, ESCs were centration of 5 ng/ml (R&D Systems). Nonadherent cells were passed to seeded onto OP9-control cells as described above, and transferred to OP9- fresh OP9 monolayers again at day 8 of coculture, and thereafter ESC/OP9 DL1 cells at day 8 of coculture. RNA was isolated following manufactur- cocultures were maintained in the presence of 5 ng/ml Flt3L and 1 ng/ml er’s instructions. All semiquantitative PCRs were performed using 3-fold IL-7 (R&D Systems) by changing media or passaging (without trypsin) to serial dilutions of cDNA that had been normalized by ␤-actin or CD45 fresh OP9 monolayers every 2 days. GATA-2Ϫ/Ϫ and GATA-2ϩ/ϪESC expression, as indicated, using the following primers: ␤-actin forward GT cultures, because of the reduced hemopoietic efficiency of GATA-2Ϫ/Ϫ GGGCCGCTCTAGGCACCAA, ␤-actin reverse CTCTTTGATGTCA progenitors, were seeded onto OP9-control stroma and either maintained CGCACGATTTC (535 bp, 55°C); CD45 forward CTACGCAAAGCA on OP9-control stroma or transferred to OP9-DL1 cells at day 8. This was CGGCCTG, CD45 reverse TCGAGTCTGCGTTGTCCCAC (340 bp, to relieve the GATA-2Ϫ/Ϫ progenitors from the early proliferative inhibi- 52°C); GATA-2 forward ACACAC CACCCGATACCCACCTAT, tion observed in the presence of OP9-DL1 cells (R. de Pooter, unpublished GATA-2 reverse CCTACGCCATGGCAGTCACCATGCT (720 bp, observations). HPCs isolated from adult bone marrow or fetal liver were 60°C) (43); PU.1 forward ATGGAAGGGTTTTCCCTCACCGCC, PU-1 cocultured similarly to ESC-derived progenitors: in the presence of Flt3L reverse GTCCACGCTCTGCAGCTCTGTGAA (216 bp. 61°C) (48); CD3 at a final concentration of 5 ng/ml and IL-7 at 1 ng/ml. forward ATGGCCAAGAGCTGC, CD3 reverse AGAATACAGGTC For experiments using presenilin inhibitors, presenilin inhibitor X (Cal- CCGCT (384 bp, 57°C); CD25 forward GTTGGGGTTTCTCTCATTA, biochem) was added to cultures of sorted CD117ϩSca-1high fetal liver- CD25 reverse GGTGGTGTTCTCTTTCATC (542 bp, 55°C); TCR C␣ derived HPCs on OP9-DL1 cells, at a final concentration of 0.33 or 1.0 forward, AGAACCTGCTGTGTACCAGTTAA, TCR C␣ reverse CAT ␮M. The same volume of DMSO was added to all cultures, including the GAGCAGGTTAAATCCGGCT (331 bp, 60°C). The PCR program was as control culture. follows: 95°C for 2 min, and 30 cycles (␤-actin, CD45) or 34 cycles (all The Journal of Immunology 5269 others) of 95°C for 30 s, annealing temperature for 30 s, 72°C for 30 s, OP9-control cultures contained populations of cells with the followed by a 4-min extension at 72°C. CD11bhighCD11cϩ phenotype characteristic of myeloid dendritic ϩ ϩ Immunohistochemistry cells, and the Gr-1 CD11b phenotype associated with granulo- cytes and immature monocytes, cocultures with OP9-DL1 cells did Cell smears were taken down to water, and endogenous peroxidase was not (Fig. 2A). Most strikingly, the more mature myeloid phenotype blocked with 3% H2O2 for 15 min. Smears were then rinsed with water, followed by Tris buffer and blocked for 10 min with 10% nonimmune goat characterized by high levels of MHC class II (MHC II) expression serum (Zymed Laboratories). Cell smears were stained with rabbit anti- was completely absent in OP9-DL1 cocultures, but comprised over myeloperoxidase at 1/2000 (DakoCytomation) at room temperature for 1 h. one-quarter of the CD11bhigh population present on OP9-control Cell smears were then washed three times with Tris, incubated with bio- cells (Fig. 2A). Finally, we observed no CD11bϩCD19ϩ cells, tinylated goat anti-rabbit Ab (Zymed Laboratories) for 15 min at room ϩ temperature, and washed three more times. Cell smears were then labeled indicating that, not only do our CD11b cells express other char- with peroxidase-conjugated streptavidin (Zymed Laboratories) and washed acteristic myeloid markers, but they do not express a definitive B three more times with Tris before being developed in diaminobenzidine cell marker. This supports the conclusion that our observations solution for 10 min. Cell smears were then washed with water and coun- reflect a loss of myeloid cells in OP9-DL1 cocultures, not just a terstained in Harris hematoxylin before being dehydrated, cleared, and mounted. down-regulation of CD11b, or a loss of CD11b-expressing B cells (Fig. 2B). Results To address whether the block in myelopoiesis was due only to Defect in myelopoiesis in the presence of Dll-1 a lack of proliferation by myeloid progenitors on OP9-DL1 cells, we performed a limiting dilution assay to determine the frequency OP9 cells, despite their failure to produce M-CSF (17), support the Downloaded from of cells with myeloid potential. Fetal liver-derived HPCs were cul- production of myeloid cells from various sources of HPC (14, 15) (Fig. 1A, upper panels). This allowed us to examine the effects of tured on either OP9-control or OP9-DL1 cells for 5 days, and then Dll-1 on myelopoietic potential by coculturing uncommitted HPCs decreasing numbers of cells per well were deposited onto OP9- on either OP9-DL1 or OP9-control cells. control cells in 96-well plates. Following an additional 8 days of We found that OP9-control cells supported robust myelopoiesis coculture with OP9-control cells, the contents of each well were analyzed by flow cytometry. The limiting dilution assay demon-

from ESC-, fetal liver-, and bone marrow-derived hemopoietic http://www.jimmunol.org/ cells, as deﬁned by the expression of CD45 and high levels of strated that the frequency of cells with myeloid potential was 1 in CD11b (Fig. 1A, upper panels). In contrast, there was a marked 65 progenitors from cultures on OP9-control cells, but only 1 in absence of CD45ϩCD11bhigh myeloid cells on OP9-DL1 cells 404 in cultures from OP9-DL1 cells (Table I). Although an appar- (Fig. 1A, lower panels). Instead, as we have previously shown (23, ent reduction in myeloid potential could result if the same absolute 49), the majority of progenitors cultured on OP9-DL1 cells gave number of myeloid progenitors arose on either stroma, but were rise, at later time points, to T lineage cells (data not shown). In greatly outnumbered by T cell progenitors in OP9-DL1 cocultures, addition, we examined the expression of myeloperoxidase, an en- this was not the case, as progenitors on OP9-control cultures ac- zyme contained within the granules of neutrophils and their pro- tually expanded 2- to 3-fold more than the same number of progenitors. Although positive cells were clearly present in OP9-con- genitors cultured on OP9-DL1 cells. Taken together, these results by guest on September 24, 2021 trol cultures, they were not found in OP9-DL1 cocultures (Fig. show that the environment provided by OP9-DL1 cells strongly 1B). Furthermore, when we compared ESC- and fetal liver-derived inhibits the generation of myeloid progenitors from uncommitted culture on OP9-control or OP9-DL1 stroma for their expression of primary or ESC-derived HPCs, in contrast to that provided by other myeloid-restricted surface markers, we found that while OP9-control cells.

FIGURE 1. Myelopoiesis by uncommitted progenitors is inhibited in the presence of Dll-1. A, Day 15 ESC-, day 7 fetal liver-, and day 8 adult bone marrow- derived HPCs, cocultured with either OP9-control cells or OP9-DL1 cells, were analyzed for CD45 and CD11b expression. Data shown are representative of at least three independent experiments, with the fold changes in myelopoiesis between OP9-DL1 and OP9-control cultures ranging from: ESCs 6- to 20-fold, fetal liver 12- to 40-fold, bone marrow 5- to 50-fold. B, Fetal liver HPCs cultured on either OP9-control or OP9-DL1 cells for 8 days were analyzed for expression of myeloperoxidase, an enzyme associated with neutrophil granules. Slides shown at ϫ40 magniﬁcation. 5270 NOTCH SIGNALS REQUIRE GATA-2 TO INHIBIT MYELOPOIESIS

FIGURE 2. Myeloid subsets are inhibited in the presence of Dll-1. A, Day 15 ESC and day 8 fetal liver cultures were compared for their expression of various surface markers of myeloid cells, when cultured in the

presence of either OP9-control or Downloaded from OP9-DL1 cells. B, Day 16 ESC cultures were analyzed for the presence CD11b and CD19 surface staining. Data shown are representative of at least three independent experiments. http://www.jimmunol.org/ by guest on September 24, 2021

Committed immature myeloid progenitors are refractory to a to an OP9-DL1-induced developmental block, as they can mature Notch signaling-mediated block in maturation to express high cell surface levels of CD11b in the presence of To address whether the OP9-DL1 environment could inhibit the either OP9-DL1 or OP9-control cells. No evidence for apoptosis maturation of committed myeloid progenitors, bone-marrow-de- was observed, as these populations persisted on both stroma for at rived LinϪCD117ϩSca-1ϪCD34ϩ CMP and GMP, as deﬁned by least 7 days (data not shown). Akashi et al. (46) on the basis of CD16/32 expression, were cultured on either OP9-control or OP9-DL1 cells for 3 days. CD16/ 32int CMPs and CD16/32ϩ GMPs appeared to be unimpeded in their ability to generate CD11bhigh myeloid cells in OP9-DL1 cultures (Fig. 3), although CMPs showed a slight 2-fold reduction in cell yields. Thus, committed myeloid progenitors are not sensitive

Table I. Myeloid progenitor frequency analysis for fetal liver HPCs cultured on OP9-control or OP9-DL1 cells

Progenitor FrequencyϪ1 (95% Stroma Conﬁdence Interval)a

HPCb/OP9-control 65 (38.56–110.7) HPC/OP9-DL1 404 (146.58–1115.36)

a Statistical analysis was performed using the method of maximum likelihood applied to the Poisson model. b Day 5 fetal liver-derived HPCs were cultured on OP9-control or OP9-DL1 cells, FIGURE 3. Committed immature myeloid progenitors are refractory to and then decreasing numbers of cells per well were deposited in 96-well plates of a Notch signaling-mediated block in maturation. GMPs (A) and CMPs (B), OP9-control cells. Individual wells (n ϭ 12) were analyzed for the generation of ϩ cultured on either OP9-control cells or OP9-DL1 cells, were analyzed for myeloid cells (CD45 CD11bhigh). The minimum number of cells per well considered to contain myeloid cells was CD45 and CD11b expression. Data shown are representative of three in- 50 cells, with at least 10% expressing high levels of CD11b and CD45. dependent experiments. The Journal of Immunology 5271

The block in myelopoiesis is due to Notch signaling within the HPC To confirm that the observed defect in myelopoiesis was due to Notch signaling, we cultured fetal liver HPCs on OP9-DL1 cells in the presence or absence of a presenilin inhibitor specific for both presenilins-1 and -2. We found that the percentage of CD11bhigh cells increased with increasing concentrations of this inhibitor (Fig. 4A). This observation indicated that Notch signaling was involved in the myelopoietic defect, but could not distinguish whether this defect was the direct result of Notch signaling intrinsic to the HPCs, or resulted indirectly from a Notch signaling-mediated effect on the OP9 cells, which altered their expression of some other unidentified factor critical to myeloid development. To distinguish between these two possibilities, we used HPCs derived from CSLϪ/Ϫ ESCs. When cocultured with OP9-DL1 cells, CSLϩ/Ϫ ESC-derived HPCs behaved as wild-type cells (Fig. 1A), exhibiting a profound defect in myelopoiesis (Fig. 4B), and giving rise to T lineage cells at later time points (data not shown). Downloaded from In contrast, CSLϪ/Ϫ ESCs produced robust populations of myeloid cells in the presence of Dll-1 (Fig. 4B). These results demonstrate that Notch signaling within the HPC is sufficient and required to mediate the block in myelopoiesis observed in cocultures with OP9-DL1 cells, and that the induced inhibition is downstream of the canonical Notch-signaling pathway mediated by CSL. http://www.jimmunol.org/

GATA-2 is differentially expressed in OP9-DL1 vs OP9-control cocultures Our results showed that the diminished myelopoiesis from HPCs cultured on OP9-DL1 cells was the result of Notch signals within the hemopoietic cells. Thus, to address the mechanism of this block, we used semiquantitative RT-PCR to examine the expres-

sion of several genes known to be involved in hemopoiesis. To this by guest on September 24, 2021 end, RNA was isolated from fetal liver HPCs cultured on either OP9-control or OP9-DL1 cells for 37 h. This early time point was chosen to focus on events proximal to Notch signals. Although several genes were examined, strikingly, analysis by densitometry showed that GATA-2 expression was up-regulated ϳ3.5-fold in FIGURE 5. GATA-2 is differentially expressed in OP9-DL1 vs OP9- HPCs cultured on OP9-DL1 cells, compared with those on OP9- control cocultures, and early thymocyte subsets. A, For RT-PCR analysis, cDNA was prepared from OP9-control and OP9-DL1 cells, freshly isolated control cells (Fig. 5A). In contrast, PU.1 expression was not dif- ϩ ϩ ex vivo CD117 Sca-1high fetal liver HPCs, and Sca-1 MACS-enriched fetal liver progenitors cultured for 37 h on either OP9-DL1 or OP9-control stroma, and analyzed for the expression of the indicated gene products. Normalized against the intensity of CD45 by densitometric analysis, hemopoietic cells cultured in the presence of OP9-DL1 cells expressed 3.5- fold more GATA-2. B, cDNA was prepared from sorted DN1 (CD44ϩCD25ϪCD117ϩ) and DN2 (CD44ϩCD25ϩCD117ϩ) day 14 fetal thymocyte subsets and total fetal thymus, and analyzed for the expression of the indicated gene products. C, cDNA was prepared from CSLϩ/Ϫ or CSLϪ/Ϫ ESC-derived cells from OP9 cocultures as described in Materials and Methods and analyzed for the expression of the indicated gene products.

ferentially affected in HPCs cultured on either stroma at this early time point (Fig. 5A). In addition, we also examined whether GATA-2 is expressed by thymocyte progenitors. Fig. 5B shows that the earliest thymic immigrants, which are contained within the CD117ϩCD44ϩCD25Ϫ subset (DN1 cells), express detectable FIGURE 4. The block in myelopoiesis is due to Notch signaling. A, The ϩ high levels of GATA-2, in contrast to the T cell-speciﬁed percentage of CD45 CD11b cells was analyzed in day 7 fetal liver ϩ ϩ ϩ cocultures on OP9-DL1 in the presence of increasing concentrations of CD117 CD44 CD25 subset (DN2 cells). This observation sug- presenilin inhibitor. B, Day 16 CSLϩ/Ϫ and CSLϪ/Ϫ ESC/OP9-DL1 were gests in vivo relevance for the increased expression of GATA-2 by analyzed for the expression of CD45 and CD11b. Plots shown are gated on fetal liver HPCs cultured on OP9-DL1 vs OP9-control cells. We the CD45ϩ population. Data shown are representative of at least three then examined the expression of GATA-2 by ESC-derived cells in independent experiments. the presence or absence of Notch signals, by comparing GATA-2 5272 NOTCH SIGNALS REQUIRE GATA-2 TO INHIBIT MYELOPOIESIS mRNA levels in CSLϩ/Ϫ or CSLϪ/Ϫ ESC-derived HPCs cultured on OP9-control cells for 8 days, and then transferred to OP9-DL1 cells to induce Notch signals. GATA-2 expression was analyzed from the ESC cocultures at the indicated culture periods, and normalized to CD45 expression levels as a gauge of hemopoietic cell contribution. Our results show that, similar to fetal liver-derived hemopoietic cells, ESC-derived HPCs sustained GATA-2 expression in the presence (CSLϩ/Ϫ), but not the absence (CSLϪ/Ϫ), of Notch signals (Fig. 5C). These initial results suggested that sustained GATA-2 expression in HPCs, as a consequence of Dll-1- induced Notch signals, could be proximally involved in the myelopoietic block observed on OP9-DL1 cells.

GATA-2 is required to mediate the block in myelopoiesis The observed Notch signaling-dependent increase in GATA-2 expression by fetal liver- or ESC-derived HPCs was consistent with results from Kumano et al. (43) using the 32D myeloid cell line transduced with ICN. Given that overexpression of GATA-2 did not cause a maturational block in this cell line model system, we Downloaded from asked whether GATA-2 is required for the Dll-1-induced block of myelopoiesis observed in primary cells. GATA-2 deficiency is embryonic lethal before 10.5 dpc and embryos exhibit severe anemia due to the requirement for GATA-2 for efficient expansion of HSCs, precluding the use of GATA-2Ϫ/Ϫ fetal liver or adult bone Ϫ/Ϫ marrow (50). Nevertheless, GATA-2 ESCs give rise to my- http://www.jimmunol.org/ eloid lineage cells when cultured on either OP9-control or OP9- DL1 cells (Fig. 6A). This is in marked contrast to the case of wild-type ESCs (Fig. 1A) or GATA-2ϩ/Ϫ ESCs (Fig. 6A), which showed a dramatic reduction in myelopoiesis when cultured on OP9-DL1 cells, as compared with OP9-control cells (Fig. 6). The FIGURE 6. GATA-2 is required to inhibit myelopoiesis in the presence ϩ Ϫ ability of GATA-2Ϫ/Ϫ ESCs to give rise to myeloid cells is not due of Dll-1, but is not required for T lymphopoiesis. A, Day 17 GATA-2 / Ϫ/Ϫ simply to their inability to respond to the OP9-DL1 environment, and GATA-2 ESC/OP9-control and OP9-DL1 cocultures were analyzed for the presence of CD45ϩCD11bhigh myeloid cells. Plots shown are as these cells give rise to T cells when cultured on OP9-DL1 cells ϩ ϩ/.ϩ (Fig. 6B). Although, in keeping with their reduced potential for gated on CD45 population. B, Day 19 cocultures of GATA-2 and by guest on September 24, 2021 GATA-2Ϫ/Ϫ were analyzed for the expression of CD4 and CD8, indicative early hemopoietic expansion, fewer T cells were produced in the ϩ ϩ of the presence of T lineage cells. Data shown are representative of three absence of GATA-2, the percentages of CD4 CD8 cells that independent experiments. were generated were similar to wild-type ESC cultures. Taken together, our findings indicate that modulation of GATA-2 expression by Notch signals is required to mediate the defect in HPC commitment to the myeloid lineage, and that this because only uncommitted progenitors are susceptible to a Notch- defect and the commitment of progenitors to the T cell fate appear mediated inhibition in myelopoiesis. Indeed, two recent findings to be distinct events. using the same model system, but starting with different types of HPC, have shown differing degrees of myeloid inhibition in re- Discussion sponse to Notch-induced signals (44, 55). On one hand, fetal liver Environmental signals play an important role in the outcome of CD117ϩ progenitors showed nearly a 3-fold reduction in myelo- hemopoiesis. Interestingly, while thymic epithelial cells express poiesis (44), while purified bone marrow CD117ϩSca-1high HSCs high levels of Dll-1 (20, 21), bone marrow stroma does not (19), showed considerably greater 14-fold change between OP9-DL1 although the levels of Dll-1 to which progenitors are exposed in and OP9-control cultures (55). This discrepancy in fold change is the thymus, vs various niches within the bone marrow, remains probably the result of committed myeloid progenitors present in unresolved. In this study, we demonstrate that OP9-DL1 cells in- the CD117ϩSca-1Ϫ population, consistent with our unpublished hibit myelopoiesis from HPCs, in contrast to OP9-control cells observations that this population contains sufficient committed my- (23). Our findings, taken together with the observation that the eloid progenitors to obscure any defect in myelopoiesis in the cul- thymic environment actively discourages the adoption of non-T tures with OP9-DL1 stroma. Furthermore, other models using the cell fates (51, 52), strongly support a physiological role for Notch 32D cell line have yielded disparate conclusions regarding the role receptor/Dll-1 interactions in preventing significant myelopoiesis of Notch in myelopoiesis. However, as it is unclear where the 32D from occurring in the thymus from thymus-seeding progenitor cell line falls on the gradient between specification and commit- cells, which are known to possess myelopoietic potential (53, 54). ment to the myeloid lineage, it is possible that the conflicting re- Furthermore, our findings suggest that any myelopoiesis taking sults obtained using this cell line, finding either that Notch signals place within the thymus is likely derived from incoming myeloid inhibit (26, 29, 30, 43) or promote myeloid differentiation (38– committed cells. 40), may reflect clonal variation in this regard. The requirement to Although it has been suggested that signals downstream of transfect 32D cells with exogenous Notch to render them respon- Notch are involved in inhibiting myelopoiesis, there are conflicting sive to Notch ligands, despite the presence of endogenous Notch reports regarding this and potential underlying mechanisms. Our expression (40), might also reflect a resistance to physiological results suggest that some of these contradictions might have arisen levels of Notch signaling. The Journal of Immunology 5273

Although previous analysis of Notch1 deficient in vivo models the inherent, confounding problems of forced overexpression of did not report an accumulation of myeloid cells, this does not GATA-2 in hemopoiesis (59, 60). exclude a physiological relevance for Dll-1-mediated signals in Although GATA-2 is required for the efficient expansion of the inhibiting myeloid commitment, as such an accumulation might HSC pool during development, and its homeostasis in the adult, not have been examined. Further, in the absence of Notch signal- GATA-2-deficient cells appear to be capable of the full range of ing, the B cell fate is available to progenitors entering the thymus, hemopoietic differentiation (50, 61, 62), suggesting that hemopoi- and in the IL-7-rich lymphopoietic thymic environment, B cells etic commitment in the absence of GATA-2 is not sufficiently per- would have a proliferative advantage over myeloid cells. turbed to preclude the conclusions drawn from our model system. An important aspect of the OP9 model system is differentiation A role for GATA-2 in inhibiting myelopoiesis is consistent with kinetics, as HSCs do not undergo long-term self-renewal in this the ability of GATA-2 to physically interact with the Ets transcrip- environment, and the various lineages arise in successive waves. tion factor PU.1 and interfere with its ability to transactivate target Specifically, erythroid and myeloid lineages appear first, followed genes (60, 63, 64). This suggests that the inability of Notch signals by lymphoid cells (16). Notably, at the time points shown here, to inhibit myelopoiesis from committed progenitors might be due neither culture is composed predominantly of lymphocytes, thus to the high levels of PU.1 expressed by committed myeloid pro- the defect in myelopoiesis observed in OP9-DL1 cocultures is not genitors, which could preclude effective inhibition by GATA-2. due to the same number of myeloid cells being masked by large Alternatively, myeloid progenitors may no longer be responsive to numbers of T cell progenitors. Additionally, the block in myelo- Notch signals. Initially, GATA-2 does not appear to down-regulate poiesis is not due to a rapid commitment of HPCs to the T cell fate the expression of PU.1, but rather to interfere with its function Ϫ Ϫ on OP9-DL1 cells, as the ability of GATA-2 / ESCs to give rise (64), although GATA-2 may inhibit PU.1 expression at later time Downloaded from to both myeloid and T lineage cells on OP9-DL1 cells demon- points (60). This mechanism is consistent with our observation that strates that the defect in myelopoiesis and commitment to the T PU.1 expression is equivalent between HPCs cultured on either cell fate are mechanistically distinct events. Nor does the defect in OP9-control or OP9-DL1 cells, and with antagonism between myelopoiesis appear to be one of delayed kinetics, despite the ev- PU.1 and another GATA family member, GATA-1, during eryth- idence that Notch signals can delay cell cycle (32, 56), as myeloid ropoiesis (64–66, 67). Furthermore, while GATA-2 expression is

populations do not arise even at later time points. Neither is Dll-1 required for efficient early hemopoiesis (50, 68, 69), it is dispens- http://www.jimmunol.org/ simply preventing all hemopoietic differentiation, as OP9-DL1 co- able for myeloid terminal differentiation (69), and is antagonized cultures produce robust populations of T lineage cells at later time by PU.1 during macrophage differentiation (63). points (23, 49). In turn, while PU.1Ϫ/Ϫ embryos lack significant numbers of T Our results showing that GATA-2 expression is up-regulated by cells, B cells, and macrophages (70, 71), PU.1 seems to be only fetal liver- or ESC-derived HPCs in the presence of Dll-1 agree absolutely required for B lymphopoiesis and myelopoiesis, as adult with observations by Kumano et al. (43), who also found that PU.1Ϫ/Ϫ HPCs are capable of low levels of T cell development myeloid maturation in the 32D myeloid cell line could be blocked (72). Thus, taken with other findings demonstrating that graded by transduction with ICN or HES-1. However, while this inhibi- expression of PU.1 is involved in B cell vs macrophage lineage tion could be overcome by further transducing 32D cells with ei- commitment (73), it is possible that Notch/Dll-1 interactions could by guest on September 24, 2021 ther a dominant-negative form of GATA-3 (DN-GATA3), which inhibit PU.1 function to below the level required for B and myeloid inhibits all GATA family members, or PU.1, overexpression of cell production without abrogating T cell development. GATA-2 itself did not block myeloid maturation. As neither DN- Taken together, our results, and the existing literature on the role GATA3 nor PU.1 is a specific inhibitor of GATA-2 function, these of GATA-2 in hemopoiesis and its interactions with other hemo- results, while suggestive, did not allow the conclusion that Notch poietic transcription factors (74), lead us to propose a model in acts through GATA-2 to interfere with normal myelopoiesis (43). which sustained GATA-2 expression downstream of Dll-1/Notch Recent findings in both nonhemopoietic systems (57) and pe- receptor interactions may contribute to the lineage restriction of ripheral T cells (58) have demonstrated regulatory interactions be- early thymic immigrants. tween Notch signals and GATA family transcription factors during differentiation. Importantly, given our hypothesis that Notch sig- Acknowledgments naling-induced modulation of GATA-2 expression is involved in We thank Dr. Janet Rossant (Mt. Sinai Hospital, Toronto, Ontario, Canada) restricting non-T lineage fate choices within the thymus, we find for her helpful advice, suggestions, and gift of reagents; Dr. Michele that DN1 thymocytes express GATA-2. As GATA-2 expression is Anderson (Sunnybrook & Women’s Research Institute, Toronto, Ontario, lost by the T cell-committed DN2 stage of thymocyte develop- Canada) for valuable discussion and suggestion; Gisele Knowles for her ment, other mechanisms must later assume the role of excluding expert assistance with flow cytometry and cell sorting; and Kevin Kwok for the myeloid fate, indicating that GATA-2 is not required for main- his expert assistance with immunohistochemistry. R. de Pooter thanks tenance of the T cell fate. In fact, we have demonstrated that Georges de Pooter (1914–2004) for his encouragement. GATA-2 is not required for T lymphopoiesis, as GATA-2Ϫ/Ϫ ESCs produce CD4ϩCD8ϩ T lineage cells when cultured on OP9- Disclosures DL1 cells (Fig. 6). In contrast, we have directly assessed the role The authors have no financial conflict of interest. of GATA-2 in mediating the Dll-1/Notch-induced block of myelopoiesis, and demonstrate that the absence of GATA-2 alleviates References the defect in myelopoiesis observed in the presence of Dll-1. Al- 1. Morrison, S. J., N. Uchida, and I. L. Weissman. 1995. The biology of hematopoietic stem cells. Annu. Rev. Cell Dev. Biol. 11: 35–71. though our results do not allow us to draw conclusions regarding 2. Zhang, J., C. Niu, L. Ye, H. Huang, X. He, W. G. Tong, J. Ross, J. Haug, how Notch signals control GATA-2 up-regulation, recent work by T. Johnson, J. Q. Feng, et al. 2003. Identification of the haematopoietic stem cell niche and control of the niche size. Nature 425: 836–841. others has demonstrated the presence of CSL-binding sites in the 3. Calvi, L. M., G. B. Adams, K. W. Weibrecht, J. M. Weber, D. P. Olson, regulatory regions of the GATA-2 gene (57), suggesting that ICN M. C. Knight, R. P. Martin, E. Schipani, P. Divieti, F. R. Bringhurst, et al. 2003. can directly up-regulate GATA-2 expression. Osteoblastic cells regulate the haematopoietic stem cell niche. Nature 425: 841–846. We chose to examine a system in which GATA-2 was absent, 4. Artavanis-Tsakonas, S., M. D. Rand, and R. J. Lake. 1999. Notch signaling: cell instead of one in which GATA-2 was overexpressed. This avoided fate control and signal integration in development. Science 284: 770–776. 5274 NOTCH SIGNALS REQUIRE GATA-2 TO INHIBIT MYELOPOIESIS

5. Martinez Arias, A., V. Zecchini, and K. Brennan. 2002. CSL-independent Notch 33. Walker, L., M. Lynch, S. Silverman, J. Fraser, J. Boulter, G. Weinmaster, and signalling: a checkpoint in cell fate decisions during development? Curr. Opin. J. C. Gasson. 1999. The Notch/Jagged pathway inhibits proliferation of human Genet. Dev. 12: 524–533. hematopoietic progenitors in vitro. Stem Cells 17: 162–171. 6. Conlon, R. A., A. G. Reaume, and J. Rossant. 1995. Notch1 is required for the 34. Karanu, F. N., L. Yuefei, L. Gallacher, S. Sakano, and M. Bhatia. 2003. Differ- coordinated segmentation of somites. Development 121: 1533–1545. ential response of primitive human CD34Ϫ and CD34ϩ hematopoietic cells to the 7. Swiatek, P. J., C. E. Lindsell, F. F. del Amo, G. Weinmaster, and T. Gridley. Notch ligand Jagged-1. Leukemia 17: 1366–1374. 1994. Notch1 is essential for postimplantation development in mice. Genes Dev. 35. Varnum-Finney, B., L. E. Purton, M. Yu, C. Brashem-Stein, D. Flowers, 8: 707–719. S. Staats, K. A. Moore, I. Le Roux, R. Mann, G. Gray, et al. 1998. The Notch 8. Oka, C., T. Nakano, A. Wakeham, J. L. de la Pompa, C. Mori, T. Sakai, ligand, Jagged-1, inﬂuences the development of primitive hematopoietic precur- S. Okazaki, M. Kawaichi, K. Shiota, T. W. Mak, and T. Honjo. 1995. Disruption sor cells. Blood 91: 4084–4091. of the mouse RBP-J␬ gene results in early embryonic death. Development 121: 36. Ohishi, K., B. Varnum-Finney, R. E. Serda, C. Anasetti, and I. D. Berstein. 2001. 3291–3301. The Notch ligand, Delta-1, inhibits the differentiation of monocytes into macro- 9. Walker, L., A. Carlson, H. T. Tan-Pertel, G. Weinmaster, and J. C. Gasson. 2001. phages but permits their differentiation into dendritic cells. Blood 98: 1402–1407. The Notch receptor and its ligands are selectively expressed during hematopoietic 37. Ohishi, K., B. Varnum-Finney, and I. D. Berstein. 2002. Delta-1 enhances mar- ϩ Ϫ development in the mouse. Stem Cells 19: 543–552. row and thymus repopulating ability of human CD34 CD38 cord blood cells. 10. Singh, N., R. A. Phillips, N. N. Iscove, and S. E. Egan. 2000. Expression of notch J. Clin. Invest. 110: 1165–1174. receptors, notch ligands, and fringe genes in hematopoiesis. Exp. Hematol. 28: 38. Schroeder, T., and U. Just. 2000. Notch signalling via RBP-j promotes myeloid 527–534. differentiation. EMBO J. 19: 2558–2568. 11. Jonsson, J.-I., Z. Xiang, M. Pettersson, M. Lardelli, and G. Nilsson. 2001. Dis- 39. Schroeder, T., H. Kohlhof, N. Rieber, and U. Just. 2003. Notch signaling induces tinct and regulated expression of Notch receptors in hematopoietic lineages and multilineage myeloid differentiation and up-regulates PU.1 expression. J. Immu- during myeloid differentiation. Eur. J. Immunol. 31: 3240–3247. nol. 170: 5538–5548. 12. Pui, J. C., D. Allman, L. Xu, S. DeRocco, F. G. Karnell, S. Bakkour, J. Y. Lee, 40. Tan-Pertel, H. T., L. Walker, D. Browning, A. Miyamoto, G. Weinmaster, and T. Kadesch, R. R. Hardy, J. C. Aster, and W. S. Pear. 1999. Notch1 expression J. C. Gasson. 2000. Notch signaling enhances survival and alters differentiation in early lymphopoiesis inﬂuences B versus T lineage determination. Immunity 11: of 32D myeloblasts. J. Immunol. 165: 4428–4436. 41. Cheng, P., Y. Nefedova, L. Miele, B. A. Osborne, and D. Gabrilovich. 2003.

299–308. Downloaded from 13. Radtke, F., A. Wilson, G. Stark, M. Bauer, J. van Meerwijk, R. MacDonald, and Notch signaling is necessary but not sufficient for differentiation of dendritic cells. M. Aguet. 1999. Deficient T cell fate specification in mice with an induced Blood 103: 3980–3988. inactivation of. Notch1. Immunity 10: 547–558. 42. Ohishi, K., B. Varnum-Finney, D. Flowers, C. Anasetti, D. Myerson, and 14. Nakano, T., H. Kodama, and T. Honjo. 1996. In vitro development of primitive I. D. Bernstein. 2000. Monocytes express high amounts of Notch and undergo and definitive erythrocytes from different precursors. Science 272: 722–724. cytokine specific apoptosis following interaction with the Notch ligand, Delta-1. 15. Nakano, T., H. Kodama, and T. Honjo. 1994. Generation of lymphohematopoi- Blood 95: 2847–2854. etic cells from embryonic stem cells in culture. Science 265: 1098–1101. 43. Kumano, K., S. Chiba, K. Shimizu, T. Yamagata, N. Hosoya, T. Saito, 16. Cho, S. K., T. D. Webber, J. R. Carlyle, T. Nakano, S. M. Lewis, and T. Takahashi, Y. Hamada, and H. Hirai. 2001. Notch1 inhibits differentiation of Blood http://www.jimmunol.org/ J. C. Zuń˜iga-Pflu¨cker. 1999. Functional characterization of B lymphocytes gen- hematopoietic cells by sustaining GATA-2 expression. 98: 3283–3289. erated in vitro from embryonic stem cells. Proc. Natl. Acad. Sci. USA 96: 44. Taghon, T. N., E. S. David, J. C. Zuń˜iga-Pflu¨cker, and E. V. Rothenberg. 2005. 9797–9802. Delayed, asynchronous, and reversible T-lineage specification induced by Notch/ Delta signaling. Genes Dev. 19: 965–978. 17. Kodama, H., M. Nose, S. Niida, and S. Nishikawa. 1994. Involvement of the c-kit 45. Carlyle, J. R., and J. C. Zuń˜iga-Pflu¨cker. 1998. Requirement for the thymus in ␣␤ receptor in the adhesion of hematopoietic stem cells to stromal cells. Exp. He- T lymphocyte lineage commitment. Immunity 9: 187–197. matol. 22: 979–984. 46. Akashi, K., D. Traver, T. Miyaamoto, and I. L. Weissman. 2000. A clonogenic 18. de Pooter, R. F., S. K. Cho, J. R. Carlyle, and J. C. Zuń˜iga-Pflu¨cker. 2003. In vitro common myeloid progenitor that gives rise to all myeloid lineages. Nature 404: generation of T lymphocytes from embryonic stem cell-derived pre-hematopoi- 193–197. etic progenitors. Blood 102: 1649–1653. 47. Schmitt, T. M., M. Ciofani, H. T. Petrie, and J. C. Zuń˜iga-Pflu¨cker. 2004. Main- 19. Bertrand, F. E., C. E. Eckfeldt, J. R. Fink, A. S. Lysholm, J. A. Pribyl, N. Shah, tenance of T cell specification and differentiation requires recurrent notch recep- and T. W. LeBien. 2000. Microenvironmental influences on human B-cell de- tor-ligand interactions. J. Exp. Med. 200: 469–479.

velopment. Immunol. Rev. 175: 175–186. by guest on September 24, 2021 48. Anderson, M. K., G. Hernandez-Hoyos, R. A. Diamond, and E. V. Rothenberg. 20. Anderson, G., J. Pongracz, S. Parnell, and E. J. Jenkinson. 2001. Notch ligand- 1999. Precise developmental regulation of Ets family transcription factors during bearing thymic epithelial cells initiate and sustain Notch signalling in thymocytes specification and commitment to the T cell lineage. Development 126: independently of T cell receptor signaling. Eur. J. Immunol. 31: 3349–3354. 3131–3148. 21. Parreira, L., H. Neves, and S. Simoes. 2003. Notch and lymphopoiesis: a view 49. Schmitt, T. M., R. F. de Pooter, M. A. Gronski, S. K. Cho, P. S. Ohashi, and from the microenvironment. Semin. Immunol. 15: 81–89. J. C. Zuń˜iga-Pflu¨cker. 2004. Induction of T cell development and establishment 22. Zuń˜iga-Pflu¨cker, J. C. 2004. T-cell development made simple. Nat. Rev. Immu- of T cell competence from embryonic stem cells differentiated in vitro. Nat. nol. 4: 67–72. Immunol. 5: 410–417. 23. Schmitt, T. M., and J. C. Zuń˜iga-Pflu¨cker. 2002. Induction of T cell development 50. Tsai, F.-Y., G. Keller, F. C. Kuo, M. Weiss, J. Chen, M. Rosenblatt, F. W. Alt, from hematopoietic progenitor cells by Delta-like-1 in vitro. Immunity 17: and S. H. Orkin. 1994. An early hematopoietic defect in mice lacking the tran- 749–756. scription factor GATA-2. Nature 371: 221–226. 24. Varnum-Finney, B., C. Brashem-Stein, and I. D. Bernstein. 2003. Combined 51. Spangrude, G. J., and R. Scollay. 1990. Differentiation of hematopoietic stem effects of Notch signaling and cytokines induce a multiple log increase in pre- cells in irradiated mouse thymic lobes: kinetics and phenotype of progeny. J. Im- cursors with lymphoid and myeloid reconstituting ability. Blood 101: munol. 145: 3661–3668. 1784–1789. 52. Abboud, S. L., M. Bunegin, N. Ghosh-Choudhury, and K. Woodruff. 2003. Anal- 25. Masuya, M., N. Katayama, N. Hoshino, H. Nishikawa, S. Sakano, H. Araki, ysis of the mouse CSF-1 gene promoter in a transgenic mouse model. J. Histo- K. Mitani, H. Suzuki, H. Miyashita, K. Kobayashi, et al. 2002. The soluble Notch ϩ chem. Cytochem. 51: 941–949. ligand, Jagged-1, inhibits proliferation of CD34 macrophages progenitors. Int. 53. Porritt, H. E., L. L. Rumfelt, S. Tabrizifard, T. M. Schmitt, J. C. Zuniga-Pflucker, J. Hematol. 75: 269–276. and H. T. Petrie. 2004. Heterogeneity among DN1 prothymocytes reveals mul- 26. Li, L., L. A. Milner, Y. Deng, M. Iwata, A. Banta, L. Graf, S. Marcovina, tiple progenitors with different capacities to generate T cell and non-T cell lin- C. Friedman, B. J. Trask, L. Hood, and B. Torok-Storb. 1998. The human ho- eages. Immunity 20: 735–745. molog of rat Jagged1 expressed by marrow stroma inhibits differentiation of 32D 54. Katsura, Y. 2002. Redefinition of lymphoid progenitors. Nat. Rev. Immunol. 2: cell through interaction with Notch1. Immunity 8: 43–55. 127–132. 27. Ye, Q., J.-H. Shieh, G. Morrone, and M. A. S. Moore. 2004. Expression of 55. Huang, J., K. P. Garrett, R. Pelayo, J. C. Zuniga-Pflucker, H. T. Petrie, and constitutively active Notch4 (Int-3) modulates myeloid proliferation and differ- P. W. Kincade. 2005. Propensity of adult lymphoid progenitors to progress to entiation and promotes expansion of hematopoietic progenitors. Leukemia 18: DN2/3 stage thymocytes with Notch receptor ligation. J. Immunol. 175: 777–787. 4858–4865. 28. Stier, S., T. Cheng, D. Dombkowshi, N. Carlesso, and D. T. Scadden. 2002. 56. Schroeder, T., and U. Just. 2000. mNotch1 signaling reduces proliferation of Notch 1 activation increases hematopoietic stem cell self renewal in vivo and myeloid progenitor cells by altering cell-cycle kinetics. Exp. Hematol. 28: favors lymphoid over myeloid outcome. Blood 99: 2369–2378. 1206–1213. 29. Milner, L. A., A. Bigas, R. Kopan, C. Brashem-Stein, I. D. Berstein, and 57. Robert-Moreno, A., L. Espinosa, J. L. de la Pompa, and A. Bigas. 2005. RBPj␬- D. I. K. Martin. 1996. Inhibition of granulocytic differentiation by mNotch1. dependent Notch function regulates Gata2 and is essential for the formation of Proc. Natl. Acad. Sci. USA 93: 13014–13019. intra-embryonic hematopoietic cells. Development 132: 1117–1126. 30. Bigas, A., D. I. Martin, and L. A. Milner. 1998. Notch1 and Notch2 inhibit 58. Amsen, D., J. M. Blander, G. R. Lee, K. Tanigaki, T. Honjo, and R. A. Flavell. myeloid differentiation in response to different cytokines. Mol. Cell. Biol. 18: 2004. Instruction of distinct CD4 T helper cell fates by different notch ligands on 2324–2333. antigen-presenting cells. Cell 117: 515–526. 31. Kawamata, S., C. Du, K. Li, and C. Lavau. 2002. Overexpression of the Notch 59. Persons, D. A., J. A. Allay, E. R. Allay, R. A. Ashmun, D. Orlic, S. M. Jane, target genes Hes in vivo induces lymphoid and myeloid alterations. Oncogene 21: J. M. Cunningham, and A. W. Nienhuis. 1999. Enforced expression of the 3855–3863. GATA-2 transcription factor blocks normal hematopoiesis. Blood 93: 488–499. 32. Carlesso, N., J. C. Aster, J. Sklar, and D. T. Scadden. 1999. Notch1-induced delay 60. Kitajima, K., M. Tanaka, J. Zheng, H. Yen, A. Sato, D. Sugiyama, H. Umehara, of human hematopoietic progenitor cell differentiation is associated with altered E. Sakai, and T. Nakano. 2006. Redirecting differentiation of hematopoietic pro- cell cycle kinetics. Blood 93: 838–848. genitors by a transcription factor, GATA-2. Blood 107: 1857–1863. The Journal of Immunology 5275

61. Ling, K. W., K. Ottersbach, J. P. van Hamburg, A. Oziemlak, F. Y. Tsai, 67. Nerlov, C., E. Querfurth, H. Kulessa, and T. Graf. 2000. GATA-1 interacts with S. H. Orkin, R. Ploemacher, R. W. Hendriks, and E. Dzierzak. 2004. GATA-2 the myeloid PU.1 transcription factor and represses PU.1-dependent transcrip- plays two functionally distinct roles during the ontogeny of hematopoietic stem tion. Blood 95: 2543–2551. cells. J. Exp. Med. 200: 871–882. 68. Minegishi, N., N. Suzuki, T. Yokomizo, X. Pan, T. Fujimoto, S. Takahashi, 62. Rodrigues, N. P., V. Janzen, R. Forkert, D. M. Dombkowski, A. S. Boyd, T. Hara, A. Miyajima, S.-I. Nishikawa, and M. Yamamoto. 2003. Expression and S. H. Orkin, T. Enver, P. Vyas, and D. T. Scadden. 2005. Haploinsufficiency of domain-specific function of GATA-2 during differentiation of the hematopoietic GATA-2 perturbs adult hematopoietic stem-cell homeostasis. Blood 106: precursor cells in midgestation mouse embryos. Blood 102: 896–905. 477–484. 69. Tsai, F. Y., and S. H. Orkin. 1997. Transcription factor GATA-2 is required for 63. Walsh, J. C., R. P. DeKoter, H.-J. Lee, E. D. Smith, D. W. Lancki, M. F. Gurish, proliferation/survival of early hematopoietic cells and mast cell formation, but D. S. Friend, R. L. Stevens, J. Anastasi, and H. Singh. 2002. Cooperative and not for erythroid and myeloid terminal differentiation. Blood 89: 3636–3643. antagonistic interplay between PU.1 and GATA-2 in the specification of myeloid 70. Scott, E. W., M. C. Simon, J. Anastasi, and H. Singh. 1994. Requirement of cell fates. Immunity 17: 665–676. transcription factor PU.1 in the development of multiple hematopoietic lineages. 64. Zhang, P., G. Behre, J. Pan, A. Iwama, N. Wara-Aswapati, H. S. Radomska, Science 265: 1573–1577. P. E. Auron, D. G. Tenen, and Z. Sun. 1999. Negative cross-talk between hematopoietic regulators: GATA proteins repress PU.1. Proc. Natl. Acad. Sci. USA 71. Scott, E. W., R. C. Fisher, M. C. Olson, E. W. Kehrli, M. C. Simon, and H. Singh. 96: 8705–8710. 1997. PU.1 functions in a cell autonomous manner to control the differentiation Immunity 65. Zhang, P., X. Zhang, A. Iwama, C. Yu, K. A. Smith, B. U. Mueller, S. Narravula, of multipotential lymphoid-myeloid progenitors. 6: 437–447. B. E. Torbett, S. H. Orkin, and D. G. Tenen. 2000. PU.1 inhibits GATA-1 func- 72. Spain, L. M., A. Guerriero, S. Kunjibettu, and E. W. Scott. 1999. T cell devel- tion and erythroid differentiation by blocking GATA-1 DNA binding. Blood 96: opment is PU.1-deficient mice. J. Immunol. 163: 2681–2687. 2641–2648. 73. DeKoter, R. P., and H. Singh. 2000. Regulation of B lymphocyte and macrophage 66. Rekhtman, N., F. Radparvar, T. Evans, and A. I. Skoultchi. 1999. Direct inter- development by graded expression of PU.1. Science 288: 1439–1441. action of hematopoietic transcription factors PU.1 and GATA-1: functional an- 74. Ranganath, S., and K. M. Murphy. 2001. Structure and specificity of GATA tagonism in erythroid cells. Genes Dev. 13: 1398–1411. proteins in Th2 development. Mol. Cell. Biol. 21: 2716–2725. Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021