Unusually Long-Lived Pause Required for Regulation of a Rho-Dependent Transcription Terminator

Unusually long-lived pause required for regulation of PNAS PLUS a Rho-dependent transcription terminator

Kerry Hollandsa,b,c,1, Anastasia Sevostiyanovaa, and Eduardo A. Groismana,b,c,2

aDepartment of Microbial Pathogenesis and cHoward Hughes Medical Institute, Yale School of Medicine, New Haven, CT 06536; and bYale Microbial Diversity Institute, West Haven, CT 06516

Edited by Jeffrey W. Roberts, Cornell University, Ithaca, NY, and approved April 2, 2014 (received for review October 10, 2013) Up to half of all transcription termination events in bacteria rely result in termination of transcription. The RNAP pause site on the RNA-dependent helicase Rho. However, the nucleic acid provides sufficient time for Rho to “catch up” with RNAP and sequences that promote Rho-dependent termination remain poorly terminate transcription in the correct location (1, 18). The se- characterized. Defining the molecular determinants that confer quence features of both the rut sites, which tend to be C-rich but Rho-dependent termination is especially important for under- lack a clear consensus sequence, and the pause sites associated standing how such terminators can be regulated in response to with Rho-dependent terminators remain poorly defined. Un- specific signals. Here, we identify an extraordinarily long-lived derstanding of regulated Rho-dependent terminators is espe- pause at the site where Rho terminates transcription in the 5′- cially limited because the few Rho-dependent terminators that 2+ leader region of the Mg transporter gene mgtA in Salmonella have been investigated in some detail are constitutive house- enterica. We dissect the sequence elements required for pro- keeping terminators or strong terminators from bacteriophage longed pausing in the mgtA leader and establish that the re- (19–24). In addition, most work has focused on the rut site, markable longevity of this pause is required for a riboswitch with less attention paid to the molecular determinants of to stimulate Rho-dependent termination in the mgtA leader re- 2+ RNAP pausing in the context of Rho-dependent termination. gion in response to Mg availability. Unlike Rho-dependent termi- Here, we dissect the sequence components that promote an nators described previously, where termination occurs at multiple unusual pause required for a regulated Rho-dependent ter- pause sites, there is a single site of transcription termination directed mination event. + by Rho in the mgtA leader. Our data suggest that Rho-dependent Expression of the Mg2 transporter gene mgtA from Salmo- + termination events that are subject to regulation may require nella enterica serovar Typhimurium is governed by a Mg2 - elements distinct from those operating at constitutive Rho- sensing riboswitch that functions by modulating the activity of dependent terminators. Rho (17, 25). The 5′-leader region of the mgtA mRNA responds + to intracellular levels of Mg2 by adopting one of two mutually magnesium | RNA polymerase + exclusive conformations (25) (Fig. 1A). High Mg2 favors an RNA conformation (i.e., stem-loops A + B) that permits Rho to ranscription termination is critical for accurate expression interact with the nascent RNA and terminate transcription within Tand regulation of genes. Bacteria use two types of tran- the mgtA leader. By contrast, in the conformer fostered under low + scription terminators: intrinsic terminators, which dissociate Mg2 conditions (i.e., stem-loop C), sequences required for Rho transcription complexes in the absence of auxiliary proteins, and binding are sequestered, which prevents Rho from terminating factor-dependent terminators, which require the action of the transcription and enables transcription to continue into the mgtA RNA-dependent helicase Rho (1). Rho is responsible for 20– 50% of termination events in Escherichia coli (2, 3) and performs Significance an array of important functions in bacteria. In addition to terminating transcription at the ends of operons (4), Rho directs transcription termination within coding regions when translation Accurate gene expression requires that transcription of DNA slows or stalls thereby establishing transcriptional polarity (5), into RNA terminate in the correct location. In bacteria, many silences horizontally acquired DNA (3, 6), protects the chro- transcription termination events rely on the termination factor mosome from R-loops and double-strand breaks (7–9), and sup- Rho. Rho-dependent terminators perform critical housekeeping presses pervasive antisense transcription (10). functions in the cell and also regulate expression of specific Aside from these genome-wide “housekeeping” functions, genes. However, the DNA and RNA sequences that promote Rho-dependent termination are poorly understood, particu- Rho has also been recruited to regulate the expression of GENETICS larly for those terminators with regulatory functions. We now specific genes in response to signals (11). Long-established ex- define the sequence elements required for transcription ter- amples include a Rho-dependent terminator that controls ex- mination at a regulated Rho-dependent terminator. These pression of the E. coli tnaA gene in response to tryptophan sequences cause RNA polymerase to pause for an unusually availability and terminators that regulate rho mRNA levels in long time during transcription. The remarkable longevity of response to the concentration of Rho protein (12–15). The re- this pause is required for a regulatory signal to stimulate Rho- cent identification of two riboswitches and a small regulatory dependent termination and thereby govern expression of the RNA (sRNA) that control gene expression by modulating Rho- gene downstream of the pause site. dependent termination (11, 16, 17) has now refocused attention on Rho as a regulatory factor. However, it is unclear whether Author contributions: K.H. and E.A.G. designed research; K.H. and A.S. performed re- regulated Rho-dependent terminators differ from those per- search; K.H., A.S., and E.A.G. analyzed data; and K.H. and E.A.G. wrote the paper. forming housekeeping functions. The authors declare no conflict of interest. Rho-dependent terminators consist of two elements: a Rho This article is a PNAS Direct Submission. utilization (rut) site in the nascent RNA and a downstream se- 1Present address: DuPont Central Research and Development, Experimental Station, quence that induces pausing of RNA polymerase (RNAP). The Wilmington, DE 19803. ATPase activity of Rho is stimulated upon binding to a rut site, 2To whom correspondence should be addressed. E-mail: [email protected]. ′ ′ which drives 5 -to-3 translocation of Rho along the RNA, and This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. thereby permits Rho to establish interactions with RNAP that 1073/pnas.1319193111/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1319193111 PNAS | Published online April 28, 2014 | E1999–E2007 Downloaded by guest on September 27, 2021 A

Fig. 1. Sequence and structure of the mgtA leader mRNA. (A) Schematic illustrates the two mutually exclusive RNA conformations that can be adopted by + + the Salmonella mgtA leader. Stem-loops A and B are promoted at high Mg2 whereas low Mg2 favors the stem-loop C conformation. Sequences involved in + alternate base pairing in response to Mg2 are shaded gray. Bent arrows indicate the locations of deletions from the 5′ end of the leader that were used in + this study. The position of the long, Mg2 -sensitive pause is indicated in purple. The locations of the G138C and C157G mutations are shown in green, and those of the C196A and G204T mutations are shown in red. The mutated nucleotides downstream of the pause site are shown in orange, and those in the R1 region are shown in blue. (B) Alignment of the mgtA leader sequence around the T218 pause from Salmonella with the corresponding mgtA leader sequences from E. coli strain MG1655, Citrobacter rodentium strain ICC168, and Klebsiella pneumoniae strain 342. T218 is shown in purple in the Salmonella sequence, and the locations of C196 and G204 are boxed. Red arrows indicate sequences that are predicted to form a hairpin upstream of the pause site, and the sequence predicted to form the 8-bp RNA–DNA hybrid in a transcription elongation complex paused at T218 is underlined. (C) Predicted secondary structure of the mRNA upstream of the T218 pause in the Salmonella mgtA leader and homologous sequences in the mgtA leaders from E. coli, C. rodentium,and K. pneumoniae. Secondary structure predictions were generated by entering the Salmonella mgtA leader sequence from +1to+218 (or corresponding sequences from the other bacteria) into mfold (http://mfold.rna.albany.edu/?q=mfold). Triangles (▼) indicate the location of the RNA 3′ end in a transcription elongation complex paused at the position corresponding to T218 in the Salmonella mgtA leader, and the sequence predicted to form the RNA–DNA hybrid in this paused complex is underlined.

coding region (17). Therefore, the mgtA riboswitch differs from pause described to date in that (i) it is remarkably long-lived previously described transcriptionally acting riboswitches, which both in vitro and in vivo, and (ii) its duration is longer in high + + typically respond to ligand binding by forming an intrinsic Mg2 conditions than in low Mg2 conditions in vitro. We define + transcription terminator (26). sequence elements that are required for prolonged Mg2 -sensi- In common with other Rho-dependent terminators, Rho pro- tive pausing and show that an extended pause is required for 2+ motes transcription termination at an RNAP pause site in the high Mg to promote Rho-dependent transcription termination mgtA leader (17). We now report that this pause differs from any in the mgtA leader region in vivo. Our results establish pre-

E2000 | www.pnas.org/cgi/doi/10.1073/pnas.1319193111 Hollands et al. Downloaded by guest on September 27, 2021 mgtA mgtA PNAS PLUS Pause sequence wild-type C196A his

KMnO4 + + + Rifampicin time (min) 0250.5 1 0250.5 1 0250.5 1 180 PR mgtA leader A SpeI SphI 30 promoter or his pause sequence 190 40 C-less 200 ITS

50 210 -35 -10 TTGACTATTTTACCTCTGGCGGTGATAATGG 60 220 +1 ITS (no C) SpeI TTGCATATGAGTAAGGAGGTTGTATGGAAGACTAGT-3 70 230 B mgtA leader full-length 126-264

C TA G C TA G MgCl2 (mM) 0.35 3.5 0.35 3.5 mgtA his time GAUC read- Fig. 2. The mgtA leader contains an unusually long-lived pause that can be through detected in vivo. A primer extension analysis of plasmid DNA extracted from pause KMnO4-treated WT Salmonella 14028s harboring a plasmid with a plac1–6- (T218) GAUC driven fusion of either the WT mgtA leader (pYS1010), the C196A mutant read- mgtA leader (pYS10120), or the his pause sequence (pYS10138) to a pro- through moterless lacZ gene was performed. Bacteria were treated with KMnO4 at the indicated times after addition of rifampicin to inhibit reinitiation of transcription. “CTAG” lanes represent DNA sequencing reactions generated using the same primer and plasmid pYS1010 (mgtA) or pYS10138 (his)as a template. Sequence positions are numbered with respect to the first nu- pause (T218) cleotide transcribed from plac1–6 (designated +1). Arrows indicate the location of the mgtA and his pause sites detected in vitro (Fig. 3 B and C).

viously unidentified molecular features that play a central role in enabling gene regulation via Rho-dependent termination. half-life (s) 80 155 76 146 0.48 0.62 0.42 0.41 Results and Discussion C template mgtA 126-264 his RNAP Pauses for an Unusually Long Time in the mgtA Leader in Vivo. MgCl2 (mM) 0.35 3.5 0.35 3.5 Rho-dependent transcription termination takes place at a site in time GAUC the mgtA leader where RNAP pauses in the absence of Rho (17). read- ∼ GAUC In vitro studies revealed that this pause is located 220 nt through read- downstream from the transcription start site and that it is atyp- through ically long-lived (17). To determine whether RNAP pauses at pause this location in vivo, we carried out KMnO4 footprinting experi- (T218) ments in WT Salmonella harboring a plasmid-borne fusion of pause the mgtA leader to the lacZ coding region, driven by the constitutive plac1–6 promoter (27). We chose this construct because it has been characterized extensively in vivo (17, 25) and because 2+ Mg does not regulate the plac1–6 promoter. half-life (s) 90 174 8 9 KMnO4 enables detection of DNA melted inside a transcrip- 0.50 0.52 0.71 0.93 tion bubble because it preferentially modifies nucleotides (par- + Fig. 3. High Mg2 extends the duration of the long-lived pause in the mgtA ticularly T residues) in single-stranded regions of DNA. Such leader. (A) Schematic of the DNA templates used to synchronize transcription modifications are more readily observed when RNAP is paused, elongation complexes (ECs) for in vitro pause assays. The mgtA leader or his pause GENETICS λ providing additional time for the melted DNA to react with sequence was cloned downstream of the constitutive PR promoter (blue) and a 26-nt ITS that lacks C residues (green). Initiation of transcription in the absence of KMnO4 (28). We detected modification of T212, T213, T218, and G219 in the nontemplate strand of the mgtA leader DNA CTP generates ECs stalled after the ITS (EC26), and subsequent addition of all four NTPs permits transcription to continue into the downstream sequence. The tran- after treatment with KMnO in vivo (Fig. 2). These results are in 4 scription start site (+1) is indicated by the red arrow. The sequences of the λ PR agreement with the pause location determined in vitro (17, 25). promoter (with −10 and −35 promoter elements highlighted in blue) and C-less ITS A strong pause signal was still detected 2 min after treatment are shown. (B) In vitro transcription of derivatives of the DNA template shown in A with rifampicin, an antibiotic that inhibits reinitiation of tran- containing either the full-length mgtA leader or nucleotides 126–264 of the mgtA scription. By contrast, no KMnO reactivity was observed around leader. Transcripts were analyzed 0.5, 1, 2, 3, 5, 7, 10, 30, and 60 min after addition 4 of all four NTPs to EC26. Gels were calibrated using RNA sequencing reactions the well-characterized his pause site (29) in bacteria harboring (GAUC). Black arrows indicate the positions of the Mg2+-sensitive long pause at + a plasmid with a plac1–6-driven fusion of the his pause sequence T218 and of the read-through transcript. Gray arrows indicate shorter Mg2 - to a promoterless lacZ gene (Fig. 2). This lack of KMnO4 re- insensitive pauses upstream of the T218 pause. The half-life and efficiency of the activity is likely because the his pause is too short-lived to be pause at position T218 are shown for each condition. (C) In vitro transcription of detected by this in vivo assay. Our data indicate that the duration derivatives of the DNA template shown in A containing either the mgtA leader sequence from positions +126 to +264 or the his pause sequence. of the mgtA pause is much longer than that of the his pause and, Transcripts were analyzed 0.25, 0.5, 0.75, 1, 2, 3, 5, 7, 10, and 45 min after to our knowledge, of other natural bacterial pauses that have addition of all four NTPs to EC26. The half-life and efficiency of the pause at been detected in vivo (30–33). position T218 are shown for each condition.

Hollands et al. PNAS | Published online April 28, 2014 | E2001 Downloaded by guest on September 27, 2021 2+ High Mg Extends the Duration of the Long-Lived Pause in the mgtA A 1.2 B 1.2 Leader. To quantify the kinetic parameters of the mgtA pause, we carried out single-round in vitro transcription assays using a 1.0 1.0 DNA template corresponding to the mgtA leader cloned down- 0.8 0.8 stream of the constitutive λ PR promoter and a C-less initial transcribed sequence (ITS) (Fig. 3A). This strategy, which has been 0.6 0.6 used extensively to study transcriptional pauses in vitro (29), en- 0.4 0.4 abled us to synchronize transcription through the mgtA leader. relative pause half-life We observed a long-lived pause at position T218 in the mgtA 0.2 relative pause half-life 0.2 leader (Figs. 1A and 3B), which corresponds to the site where transcription terminates in the presence of Rho (17). This find- 0.0 0.0 MgCl2 HHLL LHH L MgCl2 L HHLHL ing is consistent with our previous estimate of RNAP pausing start of +1 +126 +161 +188 mgtA wild-type G138C mgtA leader G138C near position 220 (17, 25). That the pause confers a single site of leader (126-264) C157G transcription termination (17) is a unique feature of Rho-de- CD1.2 1.2 pendent termination in the mgtA leader because Rho typically terminates transcription at clusters of tandem pause sites to 1.0 1.0 generate RNA products with heterogeneous 3′ ends (34, 35). + 0.8 0.8 Remarkably, high Mg2 extended the half-life of the pause at T218: It was twice as long in reactions carried out at 3.5 mM 0.6 0.6 + + Mg2 as in those performed at 0.35 mM Mg2 (Fig. 3B). This + lengthening of the pause is particularly striking given that Mg2 0.4 0.4 relative pause half-life is required for RNAP to catalyze nucleotide addition. Therefore, relative pause half-life + 0.2 0.2 one would expect high Mg2 to have the opposite effect, that is, to favor a more rapid escape from the paused state rather than 0.0 0.0 2+ MgCl2 HL HL HLHL MgCl2 LH LH actually increasing the longevity of the pause. The effect of Mg pause mgtA wild- C196A G204T C196A mgtA his on RNAP pausing is distinct from its impact on alternate folding leader type G204T hairpin 2+ of the mgtA leader RNA because Mg -regulated pausing was Fig. 4. RNA sequences in the mgtA leader are required for long, Mg2+- still observed on a template in which nucleotides 1–125 of the sensitive pausing. (A) Relative half-life of the T218 pause measured after in mgtA leader were deleted (Fig. 3B). This truncated derivative of vitro transcription of DNA templates containing nucleotides 1–264, 126–264, the mgtA leader is unable to switch between the stem-loop A + B 161–264, or 188–264 of the mgtA leader at low (L, 0.35 mM) or high (H, 3.5 and stem-loop C conformers (25). This conformational switch is mM) MgCl2. The half-lives were normalized to the half-life measured using + 2+ required for Mg2 to regulate Rho loading onto the RNA (17) the nucleotide 126–264 template at high Mg . Data are averages from at (Fig. 1A). least three independent experiments, and error bars show the SD. A rep- 2+ resentative gel from these experiments is shown in Fig. S1A.(B) Relative The long duration and Mg sensitivity are distinct charac- half-life of the T218 pause measured after in vitro transcription of DNA templates teristics of the mgtA pause at position T218 because the half- containing nucleotides 126–264 of either the WT mgtA leader or the mgtA life of the well-characterized his pause was 11- and 19-fold leader harboring the indicated substitutions in stem-loop B at low (0.35 mM) 2+ shorter than the mgtA pause in low and high Mg , respectively, or high (3.5 mM) MgCl2. Pause half-lives were normalized to the half-life + + and because the his pause did not respond to Mg2 under the measured using the WT template at high Mg2 . Data are averages from at + same assay conditions (Fig. 3C). In addition, Mg2 did not affect least three independent experiments, and error bars show the SD. A rep- the duration of a number of shorter pauses observed in the mgtA resentative gel from these experiments is shown in Fig. S1B.(C) Relative + leader (Fig. 3B). In contrast to its effect on pause duration, Mg2 half-life of the T218 pause measured after in vitro transcription of DNA templates had only a minor effect on the efficiency of the T218 pause (i.e., containing either the full-length WT mgtA leader or derivatives harboring the indicated substitutions in hairpin P, at low (0.35 mM) or high (3.5 mM) the fraction of RNAP molecules that enter the paused state), 2+ MgCl2. Pause half-lives were normalized to the half-life measured using the which was similar to the effect of Mg on the efficiency of the WT template at high Mg2+. Data are averages from three independent his pause (Fig. 3 B and C). experiments, and error bars show the SD. A representative gel from these Taken together, these data indicate that the mgtA leader experiments is shown in Fig. S1C.(D) Relative half-life of the T218 pause contains a pause that is distinctive because (i) it is unusually measured after in vitro transcription of DNA templates containing nucleo- + long-lived, (ii) its duration is increased in high Mg2 , and (iii)it tides 126–264 of either the WT mgtA leader or a derivative in which hairpin confers a single site of transcription termination in the presence P was replaced with the corresponding hairpin from the his pause. Pause of Rho. half-lives were normalized to the half-life measured using the WT template at high Mg2+. Data are averages from three independent experiments, and + error bars show the SD. A representative gel from these experiments is RNA Sequences >50 nt Upstream of T218 Are Required for High Mg2 shown in Fig. S1D. to Prolong Pausing in the mgtA Leader. Pausing occurs when the transcription elongation complex undergoes conformational + + changes that disrupt the normal nucleotide addition cycle. Pausing 2.5-fold in high Mg2 but had little effect in low Mg2 , resulting in + can be induced by sequence elements in the DNA template, a similar half-life under both low and high Mg2 conditions (Fig. the nascent RNA transcript, and/or by regulatory proteins that – 2+ 4A and Fig. S1A). Deletion of nucleotides 1 187 resulted in a contact the elongation complex (36). Because the long, Mg - small additional decrease in pause duration (Fig. 4A and Fig. sensitive pause in the mgtA leadercanbedetectedintheab- S1A). These results suggest that some sequence between posi- sence of auxiliary proteins in vitro (Fig. 3B), it must be pro- 2+ moted by DNA or RNA sequences in the leader itself. Thus, we tions 126 and 160 is required for Mg -sensitive pausing in the mgtA leader. This region harbors a sequence previously shown sought to identify sequence determinants responsible for this 2+ unusual pause. to adopt an RNA stem-loop (stem-loop B) in high Mg conditions We began by making a series of deletions from the start of the (25) (Fig. 1A). We determined that stem-loop B is required for 2+ mgtA leader to investigate whether upstream sequences have an high Mg to promote extended pausing in the mgtA leader be- impact on the pause (Fig. 1A). Pausing in vitro was unaffected cause a G138C substitution predicted to disrupt stem-loop B + by deletion of nucleotides 1–125 (Figs. 3B and 4A). However, halved the pause half-life in high Mg2 conditions but had no + deletion of nucleotides 1–160 reduced the half-life of the pause effect in low Mg2 conditions (Fig. 4B and Fig. S1B). Further-

E2002 | www.pnas.org/cgi/doi/10.1073/pnas.1319193111 Hollands et al. Downloaded by guest on September 27, 2021 Sequence B and C). Moreover, the ability to form a hairpin in this region of PNAS PLUS GCCTG (wt) CGGAC CCCTG after pause the mgtA leader RNA is conserved among other enterobacteria MgCl2 (mM) 0.35 3.5 0.35 3.5 0.35 3.5 time (Fig. 1 B and C). We termed this hairpin “hairpin P.” read- To examine the role of hairpin P, we monitored the effect through of nucleotide substitutions anticipated to disrupt its formation. Nucleotide C196 is predicted to base-pair with G204 in the stem pause of hairpin P (Fig. 1A). A C196A substitution disrupts pausing at (T218) T218 in vivo because KMnO reactivity at positions T212, T213, half-life (s) 82 148 n/a n/a n/a n/a 4 efficiency 0.44 0.60 0.07 0.16 0.18 0.15 T218, and G219 was lost in the C196A mutant (Fig. 2). In vitro, the C196A substitution reduced the half-life of the T218 pause + + Fig. 5. Sequences downstream of the pause are required for entry into the twofold in low Mg2 and threefold in high Mg2 , whereas the paused state. In vitro transcription of derivatives of DNA templates con- G204T mutation decreased the half-life two- and fourfold in low taining either the full-length WT mgtA leader or derivatives with the GCCTG sequence from +219 to +223 mutated to CGGAC, or with a single G-to-C substitution at position 219. Transcripts were analyzed 0.5, 1, 2, 3, 5, 7, 10, and 45 min after addition of all four NTPs to EC26. Arrows indicate positions of the Mg2+-sensitive pause at T218 and of the read-through transcript. The efficiency of the pause at position T218 is shown for each condition, together with the pause half-life for the WT template. n/a, not applicable.

more, incorporation of a compensatory C157G mutation that restores the ability to form stem-loop B reestablished the long-lived + pause in high Mg2 conditions (Fig. 4B and Fig. S1B). The mutations in stem-loop B affected the T218 pause specifically + because they had little impact on the shorter Mg2 -insensitive pauses earlier in the mgtA leader (Fig. S1B). These data indicate that stem-loop B, and possibly other sequences >57 nt upstream of the pause site, promote extended + pausing in the mgtA leader in high Mg2 . To our knowledge, this is the first time that RNA this far upstream has been found to stimulate pausing. RNA elements in the putL transcript from bacteriophage HK022 have been shown to bind RNAP and to influence its elongation properties. However, in this case, the nascent RNA suppresses, rather than promotes, pausing at a downstream site (37, 38). It is notable that in the case of putL, formation of a stem-loop is also required for the nascent RNA to affect pausing.

Sequences Downstream of the mgtA Pause Are Necessary for Entry into the Paused State. The first step in pausing involves rear- rangement of the RNAP active site into a conformation termed the “elemental pause state” in which incorporation of the incoming nucleotide into the 3′ end of the transcript is hindered (36, 39–41). Because sequences downstream of the pause site can have an impact on entry into the elemental pause state (42–44), we analyzed the effect of mutations downstream of T218 on pausing in the mgtA leader in vitro. Consistent with this region promoting entry into the paused state, mutation of the GCCTG sequence from positions 219–223, which is strikingly conserved

among the mgtA leader regions from different enterobacteria GENETICS (Fig. 1B), virtually eliminated pausing at T218 (Fig. 5). The effect of these mutations appears to be due primarily to the G-to-C Fig. 6. Model for the mechanism of prolonged, Mg2+-sensitive pausing in substitution at position 219, because a G219C substitution alone the mgtA leader. During transcription elongation, incorporation of a nucle- ′ was sufficient to reduce the pause efficiency drastically in vitro otide into the 3 end of the nascent RNA is followed by downstream trans- (Fig. 5). This result is in agreement with previous findings at location of RNAP to free up the active center for addition of the next nucleotide. Pausing occurs when the transcription elongation complex (TEC) other pause sites where the identity of the incoming nucleotide is undergoes conformational changes that disrupt this normal nucleotide ad- an important determinant of entry into the elemental pause state dition cycle. In the mgtA leader, downstream DNA sequences induce con- (40, 45). formational changes in the TEC that inhibit nucleotide addition, causing RNAP to enter an “elemental pause” state at position T218. This elemental An RNA Hairpin Is Required to Stabilize Paused RNAP in both Low and pause state is then stabilized by formation of hairpin P in the nascent RNA. High Mg2+. Formation of the elemental and hairpin-stabilized pause states appears to Once RNAP enters the elemental pause state, the + occur in both low and high Mg2 conditions, and is similar to other hairpin- transcription elongation complex may undergo additional re- 2+ organization to generate pauses that are more stable (36). One stabilized pauses. However, in high Mg conditions, upstream RNA sequences (including, but possibly not limited to, stem-loop B) promote a unique “hyper- way in which this pause stabilization can be achieved is by for- ” – stable pause in the mgtA leader that is substantially longer-lived than any mation of a hairpin in the nascent RNA (45 49). We noticed that pause described previously. Here, stem-loop B is shown interacting directly the mgtA leader RNA has the potential to form a hairpin with with RNAP, but it might also stabilize the pause by interacting with other a 5-bp stem located 11 nt upstream of the T218 pause site (Fig. 1 RNA sequences involved in pausing. Modified from Weixlbaumer et al. (41).

Hollands et al. PNAS | Published online April 28, 2014 | E2003 Downloaded by guest on September 27, 2021 + and high Mg2 , respectively (Fig. 4C and Fig. S1C). In both the escape the paused state and resume transcript elongation in + C196A and G204T mutants, high Mg2 was unable to extend the the absence of other protein factors (Fig. 3B). The hyperstable + + duration of the pause (Fig. 4C and Fig. S1C). Mg2 -sensitive paused state appears to be attained more readily when Mg2 is pausing was restored in a C196A G204T double mutant that high, resulting in a remarkably long pause (Fig. 6). regained the capacity to form hairpin P (Fig. 4C and Fig. S1C). Our data suggest that distinct regions of the mgtA leader se- The C196A and G204T mutations (individually and in combi- quence enforce different stages of this pausing pathway (Fig. 6). nation) interfered with pausing at T218 specifically because they In common with other pause sites (40, 45), the sequence im- did not have an impact on a short pause earlier in the mgtA mediately downstream of T218 (particularly the G at position leader (Fig. S1C). These results indicate that formation of 219) appears to promote entry of RNAP into the elemental hairpin P is required for stabilization of the pause in both low + + paused state because mutations that alter this sequence essen- andhighMg2 ,andalsoforhighMg2 to extend the pause tially abolish pausing at T218 (Fig. 5). Formation of hairpin P in duration. the nascent RNA furthers initial stabilization of the pause be- The configuration of the mgtA pause sequence resembles that – cause mutations that disrupt hairpin P reduced the overall pause of other well-characterized hairpin-stabilized pauses (45 49). In 2+ particular, it is strikingly similar to that of the his pause, which duration in both low and high Mg conditions (Fig. 4C and Fig. also consists of a 5-nt hairpin located 11 nt upstream of the pause S1C). This finding also echoes the role of RNA hairpins at other site (46–48). Given this likeness, we investigated whether the hairpin-stabilized pauses, such as those in the leader regions of unusual properties of the mgtA pause might depend on particular the Salmonella his, E. coli trp, and Bacillus subtilis trp operons, features of hairpin P or whether hairpin P could be substituted where mutations that disrupt hairpin formation also reduce with an alternative pause hairpin. Hence, we monitored tran- pause longevity (45, 48, 49). However, in contrast to these other scription using DNA templates in which the nucleotides speci- pauses, RNA sequences upstream of hairpin P (particularly stem- fying hairpin P were replaced with those encoding the his pause loop B) appear to drive hyperstablization of the mgtA pause in + hairpin. Replacement of hairpin P with the his pause hairpin high Mg2 conditions because mutations that disrupt stem-loop + + reduced the half-life of the pause under high Mg2 conditions B prevented high Mg2 from extending the pause duration but + + but had no effect in low Mg2 (Fig. 4D and Fig. S1D). This hadnoeffectinlowMg2 (Fig. 4B and Fig. S1B). Hyper- result indicates that some distinctive feature of hairpin P in stabilization also appears to require particular sequences in particular, and not just any pause-stabilizing hairpin, is required hairpin P because replacement of this hairpin with that from the 2+ + for high Mg to prolong pausing in the mgtA leader. his pause specifically reduced pausing in high Mg2 (Fig. 4D and

2+ Fig. S1D). A Model for Prolonged, Mg -Sensitive Pausing in the mgtA Leader. Stem-loop B and hairpin P may bring about hyperstablization We suggest that transcription elongation through the mgtA + of the pause in high Mg2 in a variety of nonmutually exclusive leader region is disrupted by entry of the transcription elongation + ways. For instance, Mg2 may have an impact on the ability of complex into an elemental pause state, which is then stabilized by these RNA elements to interact with RNAP in ways that stabilize formation of hairpin P in the nascent RNA (Fig. 6). These events + + 2 likely occur in low and high Mg2 because the pause takes the pause. Alternatively or in addition, Mg may control the place and is as stable as other hairpin-stabilized pauses in both capacity of these RNA sequences to interact with each other and/or conditions (Fig. 3C). In this regard, the initial stages of pausing with other pause-inducing signals in the RNA. In either of these 2+ in the mgtA leader are similar to those described for other scenarios, Mg could act either by stabilizing RNA–protein or hairpin-stabilized pauses (36). However, the mgtA pause appears RNA–RNA interactions directly, or by altering the conforma- to be able to achieve an even longer-lived state that we term tional state of the RNA to favor or hinder such contacts. These a “hyperstable” pause (Fig. 6). This state does not represent an conformational changes would differ from the stem-loop A + B “arrested” transcription complex because RNAP can eventually vs. stem-loop C switch previously implicated in controlling Rho

9000 5000 A B High Mg2+ 8000

7000 4000

6000 3000 5000

4000 2000 3000

2000 1000 galactosidase activity activity galactosidase (Miller units) galactosidase activity units) (Miller activity galactosidase - 1000

0 0 MgCl2 HHLL HHL HL L HL H L HL H L HL mgtA leader none wild- R1 C196A R1 + BCM − + − + − + − + − + type C196A mgtA leader wild-type d/s pause C196A his hairpin R1

+ Fig. 7. A long-lived pause is required for high Mg2 to promote Rho-dependent termination in the mgtA leader in vivo. (A) β-Gal activity expressed by WT

Salmonella 14028s harboring a plasmid with a plac1–6-driven fusion of the mgtA leader to a promoterless lacZ gene (pYS1010) or derivatives of pYS1010 with the GCCTG sequence from +219 to +223 mutated to CGGAC (“d/s pause”; pYS10150), the C196A substitution (pYS10120), the mgtA pause hairpin substituted for that from the his pause (“his hairpin”; pYS10176), or mutations in the “R1” region (pYS10116). Bacteria were grown in N-minimal medium with 10 μM (L)

or 10 mM (H) MgCl2 in the absence or presence of BCM. Data shown are averages from at least three independent experiments, and error bars represent the SD. (B) β-Gal activity expressed by WT Salmonella 14028s harboring a plasmid with a plac1–6-driven fusion of the mgtA leader to lacZ (pYS1010) or derivatives of pYS1010 containing mutations in the R1 region (pYS10116), the C196A substitution (pYS10120), or both (pYS10128). The term “none” corresponds to data

for bacteria harboring the control plasmid pYS1000, which contains the plac1–6-driven lacZ fusion without the mgtA leader. Bacteria were grown in N-minimal medium with 10 mM MgCl2. Data shown are averages from four independent experiments, and error bars represent the SD.

E2004 | www.pnas.org/cgi/doi/10.1073/pnas.1319193111 Hollands et al. Downloaded by guest on September 27, 2021 + PNAS PLUS loading (17) because the pause remains Mg2 -sensitive even in pausing (16)], thereby abolishing termination in the mgtA leader + templates where this transition cannot take place (Fig. 3B). in high Mg2 (Fig. 7B). One way in which stem-loop B and hairpin P could hyper- Finally, replacement of hairpin P with the hairpin from the his stabilize the pause is via a “kissing” interaction between their pause, which prevents hyperstabilization of the pause in high + respective loops. Indeed, examination of the Salmonella mgtA Mg2 in vitro (Fig. 4D), did not have an impact on transcription leader sequence suggests potential base-pairing interactions that through the mgtA leader in vivo under the tested conditions (Fig. could occur between the loops of stem-loop B and hairpin P (Fig. 7A). This result suggests that although a long pause is required + S2A). However, such an interaction is unlikely to explain pro- for high Mg2 to promote Rho-dependent termination in the + longed, Mg2 -sensitive pausing in the mgtA leader because the mgtA leader, additional hyperstabilization of the pause by high + + putative interaction is not conserved in other enterobacteria (25) Mg2 is not. It remains possible, however, that Mg2 sensing by (Fig. 1B) and also because mutations in the loops of stem-loop B the pause affects gene expression under conditions other than or hairpin P predicted to disrupt such an interaction had little those tested here. effect on transcription (Fig. S2 B and C). Thus, alternative RNA– protein or RNA–RNA interactions are likely required to achieve Concluding Remarks. Most Rho-dependent terminators charac- hyperstable pausing in the mgtA leader. terized to date either terminate transcription at the ends of operons and therefore are constitutively active (e.g., the trp t′ + Prolonged Pausing Is Required for High Mg2 to Promote Rho- terminator downstream of the E. coli trp operon), or participate Dependent Termination in the mgtA Leader Region in Vivo. Be- in bacteriophage development and thus act in an “all or none” cause the T218 pause corresponds exactly to the site where manner (e.g., the tR1 terminator from phage lambda) (19–24). transcription terminates in the presence of Rho, and because By contrast, for Rho-dependent terminators to regulate gene + Rho-dependent termination at this site is controlled by a Mg2 - expression in response to signals, their activities must be “fine- sensing riboswitch (17), we hypothesized that the unusual fea- tuned” in response to fluctuating signal levels. Thus, they likely tures of this pause might contribute to the ability of the mgtA rely on molecular determinants distinct from those described riboswitch to control transcription elongation into the associated for constitutive Rho-dependent terminators. We have conducted coding region. To test this notion, we examined the effect of what is, to our knowledge, the first detailed molecular dissection mutations that disrupt pausing on the β-gal activity expressed by of a pause site that participates in a regulated Rho-dependent WT Salmonella harboring a plasmid-borne transcriptional fusion termination event. We have established that this pause is re- between the full-length mgtA leader and lacZ (driven by the markably long-lived and that the extraordinary longevity of the 2+ 2+ plac1–6 promoter)aftergrowthathighorlowMg in the ab- pause is required for high Mg to promote Rho-dependent sence or presence of the Rho-specific inhibitor bicyclomycin termination in the mgtA leader region. (BCM) (50). Why should regulation of Rho-dependent termination in the First, mutations downstream of the pause site that prevent mgtA leader rely on such a long-lived pause? It does not appear entry into the paused state (Fig. 5) enhanced β-gal activity 10- to be a requirement imposed by regulation of Rho-dependent + fold in high Mg2 , a condition that represses transcription termination by a riboswitch per se because there is no evidence elongation through the WT mgtA leader (Fig. 7A). The effect of of such a long pause in the 5′-leader region of the E. coli ribB + these mutations is most pronounced in cells grown in high Mg2 transcript, which contains an flavin-mononucleotide–sensing because they exerted a smaller (less than threefold) derepression riboswitch that also acts on Rho-dependent termination (17). + effect in low Mg2 conditions (Fig. 7A). Moreover, it is dependent Instead, we envision several nonmutually exclusive explan- on a functional Rho protein because the mutations resulted in ations. First, prolonged pausing may grant additional time for + only approximately twofold derepression when bacteria were sensing of Mg2 by the mgtA riboswitch aptamer. Thus, the mgtA grown in the presence of BCM (Fig. 7A). [Note that it was riboswitch could potentially be driven thermodynamically (i.e., by + necessary to use a BCM concentration that allowed some limited the affinity of the riboswitch RNA for Mg2 ). This potential for Rho-dependent transcription termination because complete in- thermodynamic regulation is in contrast to most transcriptionally hibition of Rho is lethal (51).] These data indicate that pausing acting riboswitches, which tend to be driven by the kinetic + per se is required for high Mg2 to promote Rho-dependent competition between the rates of ligand binding and transcrip- termination in the mgtA leader. tion elongation (52, 53). Second, the long pause may provide It is noteworthy that the derepression effect caused by muta- additional time for Rho to load onto the mgtA leader RNA. This tions that prevent entry into the pause is at least as great as that RNA is likely a suboptimal substrate for Rho because it is highly exerted by mutations in the “R1 region” (Figs. 1A and 7A), which structured, whereas Rho typically binds to RNAs that are fairly reduce the ability of the RNA to interact with Rho but do not single-stranded (1, 18). Thus, by providing a longer time window

+ GENETICS have an impact on pausing (17). Thus, pausing appears to be just over which the RNA can sense Mg2 and Rho loading onto the as critical as Rho loading for Rho to terminate transcription in RNA can be modulated, the long pause may act together with the mgtA leader. slow Rho loading to exert precise regulation over Rho-dependent Second, the C196A mutation, which reduces the pause dura- termination. + tion in both low and high Mg2 (Fig. 4C), increased β-gal activity Third, the long pause may provide time for sensing of addi- 4.5-fold relative to the WT mgtA leader when bacteria were tional signals by the mgtA leader RNA. For instance, the mgtA + growninhighMg2 conditions but exerted a smaller (approx- leader contains a short, proline codon-rich ORF, termed mgtL, + imately twofold) effect in low Mg2 and/or when Rho was the translation of which results in transcription termination in inhibited by treatment with BCM (Fig. 7A). These results in- the mgtA leader by favoring the formation of stem-loop B (and + dicate that C196A specifically prevents high Mg2 from promoting thus, presumably promoting Rho loading) (54, 55). Proline lim- Rho-dependent termination in the mgtA leader. Conceivably, the itation is thought to induce ribosome stalling at the proline effect of the C196A substitution could be ascribed to an effect on codons in mgtL, which favors stem-loop C and permits tran- + the ability of the RNA to interact with Rho, but this is not the scription elongation into the mgtA coding region. The Mg2 and case because an mgtA leader RNA with the C196A substitution proline signals act synergistically on the mgtA leader RNA (54) retained a WT ability to stimulate Rho’s ATPase activity in vitro and appear to influence the same Rho-dependent termination (Fig. S3). This notion is further supported by the finding that the event even though translation of mgtL would occlude sequences + C196A substitution acts synergistically with mutations in the R1 required for Mg2 sensing by the riboswitch (25). Prolonged region [which hinder Rho loading but do not have an impact on pausing may allow time for mgtL translation to complete, thereby

Hollands et al. PNAS | Published online April 28, 2014 | E2005 Downloaded by guest on September 27, 2021 + freeing up the riboswitch RNA to detect intracellular Mg2 mM EDTA, 80% (vol/vol) deionized formamide, 0.1% bromophenol blue, levels before the transcription termination decision must be made. and 0.1% xylene cyanol FF]. Samples were heated for 2 min at 90 °C and The extraordinary longevity of the mgtA pause may also be then analyzed on denaturing 6% (vol/vol) polyacrylamide sequencing gels responsible for Rho directing transcription termination at a single (Ureagel; National Diagnostics). Gels were calibrated using DNA sequencing reactions generated using primer 12901 and the Sequenase 2.0 DNA se- site. This unorthodox behavior is in contrast to Rho-dependent quencing kit (Affymetrix) according to the manufacturer’s instructions. terminators described previously, where termination typically takes place at a series of weaker pause sites spread over a region of up ∼ In Vitro Transcription. To examine pausing, we adapted previously described to 100 nt (34, 35). A possible explanation for the single Rho- single-round in vitro transcription assays (29). Linear DNA templates har-

dependent termination site in the mgtA leader is evoked by the boring the λ PR promoter and a 26-nt C-less ITS cloned upstream of WT or finding that a truncated RNA generated by riboswitch-directed mutant derivatives of the mgtA leader or the his pause sequence (Fig. 3A) transcription termination may function in trans as an sRNA (56). were generated by PCR using primers W174 and W175 and plasmid pKH100 Thus, if the product of transcription termination in the mgtA or derivatives harboring mutations in the mgtA leader region (Table S1). We leader were to act as an sRNA (52), it might require that ter- used previously described methods to purify E. coli core RNAP (60) and σ70 mination generate a single, defined RNA product rather than (61). RNAP holoenzyme was reconstituted by mixing core RNAP with a σ70 a collection of RNA molecules with heterogeneous 3′ ends. twofold molar excess of and incubating for 20 min at room tempera- ture. Transcription elongation complexes stalled at the end of the ITS (EC26) Materials and Methods were prepared by incubating 50 nM template DNA, 60 nM RNAP holoenzyme, 5 μMATP,5μMUTP,1μMGTP,0.1μM ApU RNA primer, and 0.2 μCi/μL Bacterial Strains, Plasmids, and Growth Conditions. Bacterial strains and plasmids α32P-GTP in transcription buffer [100 mM KCl and 10 mM Tris·HCl (pH 7.9)] used in this study are listed in Table S1, and oligonucleotide primers are listed containing 5 mM MgCl2 and 1 U/μL SUPERaseIn (Life Technologies) for 15 in Table S2. Details of plasmid constructions are described in SI Materials and min at 37 °C. Reaction mixtures were purified using Sephadex G-50 columns Methods. Bacteria were grown in either N-minimal medium (pH 7.4) (57) preequilibrated with transcription buffer lacking MgCl2, then the MgCl2 supplemented with 0.1% casamino acids, 38 mM glycerol, and the indicated concentration was adjusted to 0.35 or 3.5 mM. Transcription was initiated by concentration of MgCl , or in M9 medium (58) containing the indicated 2 addition of all four NTPs to a final concentration of 50 μM and rifampicin to concentration of MgSO . Chloramphenicol (20 μg/mL) was added for growth 4 8 μg/mL, followed by incubation at 37 °C. Samples were taken at various of strains harboring derivatives of plasmid pYS1000. time points and mixed with an equal volume of stop solution [50 mM EDTA, 80% (vol/vol) deionized formamide, 0.1% bromophenol blue, and 0.1% In Vivo KMnO4 Footprinting. In vivo KMnO4 footprinting was carried out by xylene cyanol FF]. DNA samples were analyzed on denaturing 6% (vol/vol) following a published protocol (28) with some modifications. Bacteria were polyacrylamide sequencing gels (Ureagel; National Diagostics) alongside grown overnight in M9 medium containing 1 mM MgSO4, washed twice in RNA sequencing reactions prepared as described (62). Gels shown are rep- M9 medium lacking MgSO4, and inoculated 1:100 into fresh M9 medium resentative of at least three independent experiments. Pause half-lives and μ containing 10 M MgSO4. (Note that bacteria were grown in M9 medium efficiencies were estimated as described (29). instead of N-minimal medium because N-minimal medium appeared to quench permanganate.) Cultures were incubated for 3 h at 37 °C (OD ∼ 600 β-Gal Assays. β-gal assays were performed as described (17). 0.4), and 12-mL samples were then treated with 10 mM KMnO4 for 2 min at 37 °C. To monitor the pause duration, cultures were incubated with rifam- Rho ATPase Assays. RNA corresponding to WT or mutant derivatives of the picin at 0.2 mg/mL for the indicated time (0.5–5 min) before addition of KMnO . After treatment with KMnO , cultures were immediately trans- mgtA leader was synthesized with the Megascript T7 kit (Ambion) according 4 4 ’ ferred to prechilled centrifuge tubes and placed on ice. Cells were harvested to the manufacturer s instructions, using T7 promoter-driven templates by centrifugation, washed in 0.9% NaCl, and pelleted again. Plasmid DNA generated by PCR with primers 6712 and 11882 and plasmid pYS1010 (WT), was isolated from cell pellets using the boiling method (59). After pre- pYS10120 (C196A), or pYS10116 (R1 mutant) as a template. Rho ATPase cipitation with isopropanol, DNA pellets were resuspended in 600 μLof activity in the presence of different RNA substrates was measured as de- Tris·EDTA (TE) buffer and treated with 1 μL of 20 mg/mL RNaseA (Life scribed (17). Technologies) for 20 min at 37 °C. Plasmid DNA was then extracted once with phenol, three to four times with phenol/chloroform/isoamyl alcohol ACKNOWLEDGMENTS. We thank Barbara Stitt for supplying purified Rho, [25:24:1 (vol/vol/vol)], and once with chloroform/isoamyl alcohol [24:1 (vol/vol)] Max Gottesman for providing BCM, and David Lee and Yixin Shi for plasmid constructions. We also thank Sergey Proshkin, Alex Yakhnin, and Paul before precipitation with ethanol and resuspension in 30 μL of TE buffer. Babitzke for technical advice regarding the in vivo KMnO4 footprinting For detection of KMnO4 modifications, primer extension reactions were experiments, Robert Landick for useful discussions, and Albert Weixlbaumer μ – × 6 32 carried out using 2 g of plasmid DNA and 0.3 0.5 10 cpm of P end- for providing the original drawing used as the basis for Fig. 6. This work was labeled primer 12901 as described (28). After precipitation with ethanol, supported, in part, by National Institutes of Health Grant AI49561 (to E.A.G., primer extension products were resuspended in 7 μL of gel loading dye [50 who is an investigator of the Howard Hughes Medical Institute).

1. Peters JM, Vangeloff AD, Landick R (2011) Bacterial transcription terminators: The 12. Konan KV, Yanofsky C (2000) Rho-dependent transcription termination in the tna RNA 3′-end chronicles. J Mol Biol 412(5):793–813. operon of Escherichia coli: Roles of the boxA sequence and the rut site. J Bacteriol 2. Peters JM, et al. (2009) Rho directs widespread termination of intragenic and stable 182(14):3981–3988. RNA transcription. Proc Natl Acad Sci USA 106(36):15406–15411. 13. Stewart V, Landick R, Yanofsky C (1986) Rho-dependent transcription termination in 3. Cardinale CJ, et al. (2008) Termination factor Rho and its cofactors NusA and NusG the tryptophanase operon leader region of Escherichia coli K-12. J Bacteriol 166(1): – silence foreign DNA in E. coli. Science 320(5878):935 938. 217–223. – 4. Roberts JW (1969) Termination factor for RNA synthesis. Nature 224(5225):1168 1174. 14. Yanofsky C, Konan KV, Sarsero JP (1996) Some novel transcription attenuation 5. Richardson JP, Grimley C, Lowery C (1975) Transcription termination factor rho ac- mechanisms used by bacteria. Biochimie 78(11-12):1017–1024. tivity is altered in Escherichia coli with suA gene mutations. Proc Natl Acad Sci USA 15. Matsumoto Y, Shigesada K, Hirano M, Imai M (1986) Autogenous regulation of the 72(5):1725–1728. gene for transcription termination factor rho in Escherichia coli: Localization and 6. Menouni R, Champ S, Espinosa L, Boudvillain M, Ansaldi M (2013) Transcription ter- function of its attenuators. J Bacteriol 166(3):945–958. mination controls prophage maintenance in Escherichia coli genomes. Proc Natl Acad 16. Bossi L, Schwartz A, Guillemardet B, Boudvillain M, Figueroa-Bossi N (2012) A role for Sci USA 110(35):14414–14419. Rho-dependent polarity in gene regulation by a noncoding small RNA. Genes Dev 7. Dutta D, Shatalin K, Epshtein V, Gottesman ME, Nudler E (2011) Linking RNA poly- – merase backtracking to genome instability in E. coli. Cell 146(4):533–543. 26(16):1864 1873. 8. Leela JK, Syeda AH, Anupama K, Gowrishankar J (2013) Rho-dependent transcription 17. Hollands K, et al. (2012) Riboswitch control of Rho-dependent transcription termi- – termination is essential to prevent excessive genome-wide R-loops in Escherichia coli. nation. Proc Natl Acad Sci USA 109(14):5376 5381. Proc Natl Acad Sci USA 110(1):258–263. 18. Rabhi M, Rahmouni AR, Boudvillain M (2010) Transcription termination factor Rho: A 9. Washburn RS, Gottesman ME (2011) Transcription termination maintains chromo- ring-shaped RNA helicase from bacteria. RNA Helicases, ed Jankowsky E (Royal Society some integrity. Proc Natl Acad Sci USA 108(2):792–797. of Chemistry, Cambridge, UK), pp 243–271. 10. Peters JM, et al. (2012) Rho and NusG suppress pervasive antisense transcription in 19. Chen CY, Richardson JP (1987) Sequence elements essential for rho-dependent Escherichia coli. Genes Dev 26(23):2621–2633. transcription termination at lambda tR1. J Biol Chem 262(23):11292–11299. 11. Boudvillain M, Figueroa-Bossi N, Bossi L (2013) Terminator still moving forward: Ex- 20. Ciampi MS (2006) Rho-dependent terminators and transcription termination. Micro- panding roles for Rho factor. Curr Opin Microbiol 16(2):118–124. biology 152(Pt 9):2515–2528.

E2006 | www.pnas.org/cgi/doi/10.1073/pnas.1319193111 Hollands et al. Downloaded by guest on September 27, 2021 21. Graham JE, Richardson JP (1998) rut Sites in the nascent transcript mediate Rho- 43. Lee DN, Phung L, Stewart J, Landick R (1990) Transcription pausing by Escherichia coli PNAS PLUS dependent transcription termination in vivo. J Biol Chem 273(33):20764–20769. RNA polymerase is modulated by downstream DNA sequences. J Biol Chem 265(25): 22. Lau LF, Roberts JW, Wu R (1983) RNA polymerase pausing and transcript release at 15145–15153. the lambda tR1 terminator in vitro. J Biol Chem 258(15):9391–9397. 44. Levin JR, Chamberlin MJ (1987) Mapping and characterization of transcriptional 23. Zalatan F, Galloway-Salvo J, Platt T (1993) Deletion analysis of the Escherichia coli rho- pause sites in the early genetic region of bacteriophage T7. J Mol Biol 196(1):61–84. ′ – dependent transcription terminator trp t . J Biol Chem 268(23):17051 17056. 45. Yakhnin AV, Babitzke P (2010) Mechanism of NusG-stimulated pausing, hairpin- ′ 24. Zhu AQ, von Hippel PH (1998) Rho-dependent termination within the trp t termi- dependent pause site selection and intrinsic termination at overlapping pause and – nator. I. Effects of rho loading and template sequence. Biochemistry 37(32):11202 11214. termination sites in the Bacillus subtilis trp leader. Mol Microbiol 76(3):690–705. + 25. Cromie MJ, Shi Y, Latifi T, Groisman EA (2006) An RNA sensor for intracellular Mg(2 ). 46. Artsimovitch I, Landick R (1998) Interaction of a nascent RNA structure with RNA Cell 125(1):71–84. polymerase is required for hairpin-dependent transcriptional pausing but not for 26. Henkin TM (2008) Riboswitch RNAs: Using RNA to sense cellular metabolism. Genes transcript release. Genes Dev 12(19):3110–3122. Dev 22(24):3383–3390. 47. Artsimovitch I, Landick R (2000) Pausing by bacterial RNA polymerase is mediated by 27. Liu M, Tolstorukov M, Zhurkin V, Garges S, Adhya S (2004) A mutant spacer sequence mechanistically distinct classes of signals. Proc Natl Acad Sci USA 97(13):7090–7095. between -35 and -10 elements makes the Plac promoter hyperactive and cAMP re- 48. Chan CL, Landick R (1993) Dissection of the his leader pause site by base substitution ceptor protein-independent. Proc Natl Acad Sci USA 101(18):6911–6916. 28. Sasse-Dwight S, Gralla JD (1991) Footprinting protein-DNA complexes in vivo. reveals a multipartite signal that includes a pause RNA hairpin. J Mol Biol 233(1): – Methods Enzymol 208:146–168. 25 42. 29. Landick R, Wang D, Chan CL (1996) Quantitative analysis of transcriptional pausing by 49. Landick R, Yanofsky C (1984) Stability of an RNA secondary structure affects in vitro Escherichia coli RNA polymerase: his leader pause site as paradigm. Methods Enzymol transcription pausing in the trp operon leader region. JBiolChem259(18):11550–11555. 274:334–353. 50. Kohn H, Widger W (2005) The molecular basis for the mode of action of bicyclomycin. 30. Hatoum A, Roberts J (2008) Prevalence of RNA polymerase stalling at Escherichia coli Curr Drug Targets Infect Disord 5(3):273–295. promoters after open complex formation. Mol Microbiol 68(1):17–28. 51. Zwiefka A, Kohn H, Widger WR (1993) Transcription termination factor rho: The site 31. Yakhnin AV, Yakhnin H, Babitzke P (2006) RNA polymerase pausing regulates of bicyclomycin inhibition in Escherichia coli. Biochemistry 32(14):3564–3570. translation initiation by providing additional time for TRAP-RNA interaction. Mol Cell 52. Coppins RL, Hall KB, Groisman EA (2007) The intricate world of riboswitches. Curr 24(4):547–557. Opin Microbiol 10(2):176–181. 32. Yakhnin AV, Yakhnin H, Babitzke P (2008) Function of the Bacillus subtilis tran- 53. Wickiser JK, Winkler WC, Breaker RR, Crothers DM (2005) The speed of RNA transcription elongation factor NusG in hairpin-dependent RNA polymerase pausing in scription and metabolite binding kinetics operate an FMN riboswitch. Mol Cell 18(1): the trp leader. Proc Natl Acad Sci USA 105(42):16131–16136. 49–60. 33. Kainz M, Roberts JW (1995) Kinetics of RNA polymerase initiation and pausing at the 54. Park SY, Cromie MJ, Lee EJ, Groisman EA (2010) A bacterial mRNA leader that em- – lambda late gene promoter in vivo. J Mol Biol 254(5):808 814. ploys different mechanisms to sense disparate intracellular signals. Cell 142(5): 34. Lau LF, Roberts JW, Wu R (1982) Transcription terminates at lambda tR1 in three 737–748. – clusters. Proc Natl Acad Sci USA 79(20):6171 6175. 55. Zhao G, Kong W, Weatherspoon-Griffin N, Clark-Curtiss J, Shi Y (2011) Mg2+ facili- 35. Wu AM, Christie GE, Platt T (1981) Tandem termination sites in the tryptophan op- tates leader peptide translation to induce riboswitch-mediated transcription termi- eron of Escherichia coli. Proc Natl Acad Sci USA 78(5):2913–2917. nation. EMBO J 30(8):1485–1496. 36. Landick R (2006) The regulatory roles and mechanism of transcriptional pausing. 56. Loh E, et al. (2009) A trans-acting riboswitch controls expression of the virulence Biochem Soc Trans 34(Pt 6):1062–1066. regulator PrfA in Listeria monocytogenes. Cell 139(4):770–779. 37. King RA, Banik-Maiti S, Jin DJ, Weisberg RA (1996) Transcripts that increase the 57. Snavely MD, Miller CG, Maguire ME (1991) The mgtB Mg2+ transport locus of Sal- processivity and elongation rate of RNA polymerase. Cell 87(5):893–903. – 38. Komissarova N, et al. (2008) Inhibition of a transcriptional pause by RNA anchoring to monella typhimurium encodes a P-type ATPase. J Biol Chem 266(2):815 823. RNA polymerase. Mol Cell 31(5):683–694. 58. Elbing K, Brent R (2002) Media preparation and bacteriological tools. Curr Protoc Mol 39. Herbert KM, et al. (2006) Sequence-resolved detection of pausing by single RNA Biol, Chapter 1:Unit 1.1. polymerase molecules. Cell 125(6):1083–1094. 59. Holmes DS, Quigley M (1981) A rapid boiling method for the preparation of bacterial – 40. Kireeva ML, Kashlev M (2009) Mechanism of sequence-specific pausing of bacterial plasmids. Anal Biochem 114(1):193 197. RNA polymerase. Proc Natl Acad Sci USA 106(22):8900–8905. 60. Belogurov GA, et al. (2007) Structural basis for converting a general transcription 41. Weixlbaumer A, Leon K, Landick R, Darst SA (2013) Structural basis of transcriptional factor into an operon-specific virulence regulator. Mol Cell 26(1):117–129. pausing in bacteria. Cell 152(3):431–441. 61. Grainger DC, Goldberg MD, Lee DJ, Busby SJ (2008) Selective repression by Fis and 42. Chan CL, Landick R (1989) The Salmonella typhimurium his operon leader region H-NS at the Escherichia coli dps promoter. Mol Microbiol 68(6):1366–1377. contains an RNA hairpin-dependent transcription pause site. Mechanistic implications 62. Artsimovitch I, Henkin TM (2009) In vitro approaches to analysis of transcription of the effect on pausing of altered RNA hairpins. J Biol Chem 264(34):20796–20804. termination. Methods 47(1):37–43. GENETICS

Hollands et al. PNAS | Published online April 28, 2014 | E2007 Downloaded by guest on September 27, 2021