TCO5:7srie n rlfrtsi rudbe ilper- will beef ground in proliferates and how survives of O157:H7 understanding STEC An processors. meat for ramifications major (http://www.fsis.usda. in O157:H7 resulting due STEC beef gov/FSIS_Recalls/Open_Federal_Cases/index.asp), ground with during of contamination carcasses recalls of numerous to contamination been in have result There can slaughter. feces in Cat- and hides number 2005). toxin-producing Fratamico large Shiga and a harboring (Smith tle in outbreaks un- implicated documented or been the raw of has particularly, beef, origin, fruit ground bovine and dercooked produce, of fresh food however, water, juices; drinking been have contaminated can Outbreaks 2005). to pigs Fratamico linked and and (Smith birds carriers be including also this animals, for other reservoirs however, are pathogen; cattle, particularly animals, Ruminant wide. ute erdcinwtotpriso sprohibited is permission without reproduction Further 10.1111/j.1750-3841.2010.01952.x doi: works government original to claim No or purpose recommendation compilation the imply Journal for not Agriculture. of solely does Dept. U.S. is and the products by information endorsement commercial specific or providing names of trade of U.S.A. Cancer Mention 19111, Chase PA Fox [email protected]). (E-mail: Philadelphia, with Fratamico Ave., is author to Li Cottman inquiries Author 333 Direct U.S.A. Facility, 60501, Genomic IL Center Summit, Technology, 6502 of Rd, Inst. Technology, Eastern Illinois Archer and Service, Safety S. Food Research for Center Zhang Agricultural Natl. and with Wang Agriculture, are Authors U.S.A. of 19038, PA Wyndmoor, Dept. Center, Fratamico U.S. Research Regional Authors with 9/30/2010. are Yan Accepted and 6/23/2010, Submitted 20100705 MS Introduction Li Yuesheng and Zhang, Wei Yan, Xianghe Wang, Siyun Fratamico, M. Pina of Expression Gene Differential nGon efEtatCmae oTryptic Broth to Soy Compared Extract Beef Ground in .coli E. S oprdt B.Teifrainwl eueu o dnicto fgnsta a eepoe spotential as employed be can that genes of identification for useful of be expression control will gene to that and information interventions demonstrated for matrices, The study targets food This GBE. 1.5. complex to pH using compared fluid, performed gastric TSB synthetic be to can exposed in TSB, analyses when in microarray survival genes molecules, increased incubation degradation) significantly small to showed 54 protein of h compared and 2 for Furthermore, transporters respectively. proteins) responsible TSB, cofactors, shock enzymes to of acid and compared biosynthesis and factors metabolism, proteins, transcription energy transport and for membrane proteins factors, (encoding transcription down-regulated biosynthesis, polysaccharide and DAwshbiie omcorasrpeetn 68oe edn rms(prn eoeAryRayOioSet) Oligo Array-Ready of Genome of (Operon; genomes frames profiles 4 reading expression open to gene 9608 corresponding representing with compared microarrays incubation to study of hybridized This was h cDNA lacking. 2 after are TSB food and as GBE such matrices complex coli in expression of studies gene transcriptomic of for used been have microarrays DNA Keywords: Abstract: 17H aa tani a rudbe xrc GE n rpi o rt TB.TtlRAwsioae from isolated was RNA Total (TSB). broth soy tryptic and (GBE) extract beef ground raw in strain Sakai O157:H7 17H salaigcueo odon lns world- illness foodborne of cause leading a is O157:H7 biotechnology, .coli E. C 00Isiueo odTechnologists Food of Institute 2010 17H sa motn odon ahgn n rudbe sacmo eil finfection. of vehicle common a is beef ground and pathogen, foodborne important an is O157:H7 .coli E. .coli E. .coli E. 17 7 etsft,mcoilsria,mlclrbiology molecular survival, microbial safety, meat H7, O157: .coli E. SE)O5:7on O157:H7 (STEC) tan n lsis hr ee7 prgltd(ee novdi protein in involved (genes up-regulated 74 were There plasmids. 3 and strains O157:H7. .coli E. R 17H.Floigrvretasrpin(T fteRA labeled RNA, the of (RT) transcription reverse Following O157:H7. lr-ihtmeauepoesdsi ika 4 at milk skim temperature-processed and ultra-high of Liu expression food. gene have in examined analyses There (2008) expression Ream challenge. gene on a that reports is few samples very inhibitors fecal been PCR and mRNA and soil, food, nucleases stable as contain of such isolation materials, The complex techni- from matrices. substantial gene complex bacterial the in measuring to expression accurately due with associated realized challenges the completely cal has for environments been potential food yet in The pathogens not food. of as expression medium gene such growth of matrices analysis in complex conducted in been not have and studies expression bacteria gene foodborne Generally, mutants. in isogenic of their bacte- function and wild-type the in ria expression study gene to comparing by and genes that regulators particular genes specific identify to by utilized controlled be are also can con- technology environmental This specific ditions. to response encoded in proteins required the mRNA of level the re- the by in in change a function indicate cellular specific may of mRNAs of levels Altered analysis variables. environmental global specific to a gene sponse allowing every of genome (expression) a activity in the of measurement a provides this inactivate beef. in to growth interventions control effective or pathogen of development the mit RAetato ehdsial o nlssof analyses for developed suitable (2008) method others extraction and syn- mRNA Makhzami protein a division. metabolism, cell energy and and thesis, biosynthesis acid down- involved amino proteins 14 regulators, in were transport transcriptional for there proteins, encoding binding broth, genes and up-regulated infusion 26 and heart genes brain regulated in growth to .coli E. eeepeso rfiiguigDAmcora technology microarray DNA using profiling expression Gene 17H sn aoaoymda oee,analysis however, media; laboratory using O157:H7 o.7,N.1 2011 1, Nr. 76, Vol. .coli E. .coli E. .coli E. 17H nuae nGEfor GBE in incubated O157:H7 O157:H7 r .coli E. 17H rw nGBE in grown O157:H7 ora fFo Science Food of Journal 17H ifr in differs O157:H7 itramonocytogenes Listeria ◦ .Compared C. Enterococcus E. M79 in

M: Food Microbiology & Safety × E. E. Cfor E. coli Land ◦ μ first strand buffer, g random hexamer × μ M concentration, and μ SSPE for 1 min each and × -test was used to identify sig- t version 2.0 oligo set (Operon C. The slides were washed once ◦ 0.05. O157:H7 (EDL933), 5251 ORFs TM C for 1 h to generate aminoallyl- ◦ < SSC) were used to monitor for back- E. coli × -value of g of total RNA and 0.5 C for 10 min. Reverse transcription mixture P ◦ μ Genome AROS O157:H7 (Sakai), 5366 ORFs in uropathogenic SSPE and once with 0.06 E. coli × L), containing 0.5 mM dATP, dCTP, dGTP, 0.2 mM dTTP, SSC (standard sodium citrate) at 30 μ strains and 3 plasmids. The number of open reading frames K12, 5306 ORFs in E. coli A total of 30 Microarray slides were prehybridized in buffer containing 5 The × SSC, 1% bovine serum albumin, and 0.1% SDS at 42 with 6 1 h towith minimize labeled nonspecific cDNA target backgroundlent Technologies) in for and 16 Agilent h then at hybridization 60 hybridized buffer (Agi- RNA was then isolatedagen) and according purified to usingisolated manufacturer’s the instructions. was RNeasy The kit quantified (Qi- totalScientific, using RNA Waltham, a Mass., Nanodrop U.S.A.),analyzed 1000 and using (ThermoFisher the an Agilentgies, RNA 2100 Santa quality Clara, Bioanalyzer was Calif., (Agilentprotocol. U.S.A.) Technolo- according to the manufacturer’s Aminoallyl indirect labeling of cDNA targets Hybridization and data analyses Genome oligo set and microarray printing Biotechnologies Inc., Huntville, Ala., U.S.A.) containedmer 9308 70- oligonucleotide probes representing the genomes of 4 coli (ORFs) or genescoli represented was as follows:in 4269 ORFs in CFT073, 3 genes ingenes OSAK1, in 10 pO157_EDL933. genes Therandomly in oligonucleotide pO157_Sakai, set generated and also oligo 97 included trols sequences for hybridization. to The oligonucleotides3 serve were resuspended as in negative con- slides were printed atcore facility the onto Fox aminosylin-coated Chase slidesLowell, (UltraGAPS, Cancer Mass., Corning, Center U.S.A.) microarray atOmniGrid 50% 100 humidity microarrayer (GeneMachines, usingU.S.A.). San a Blank Carlos, GeneMachines spots Calif., (3 ground hybridization signal levels.were Following bound spotting, to the the oligos slidestored by in UV a cross-linking, dry and environment prior the to slides use. were labeled cDNA. After precipitation andwas cleanup, aminoallyl coupled cDNA with monoreactivegets. Cy dye Uncoupled to dyes generate werepurification labeling removed kit tar- (Qiagen). using the QIAquick PCR (10 0.3 mM aminoallyl-dUTP, 10 mM DTT, 1 40 U rRNasin,samples and and 400 incubated U at SuperScript 42 II was added to RNA pd(N)6 primers wereincubated mixed at to 70 a final volume of 10 scanned on an Agilent scanner.of Extraction the of the microarrays signal fromformed intensities scanned using images the andSegundo, ImaGene Calif., filtering software U.S.A.), and were program then per- (BioDiscovery,using the El Genesight data (BioDiscovery) were microarray further data analyzed The analysis Lowess software. intensity-dependent method2 was channel used array intensities, to andnificantly normalize the regulated genes. A totalperformed, of each 3 with separate and experiments2-fold a were up- Cy3 or and down-regulationexpression Cy5 was with dye a chosen swap. A to cutoff define of differential C ◦ C until Cs self- ◦ 137 for 5 min, 20 g − Candgrown ◦ × C and colonies O157:H7 Sakai ◦ 80 − C at 150 rpm. The 0.8). The culture was ◦ E. coli = O157:H7 in beef. The aim CFUwereaddedto10mL 7 L of the overnight culture were O157:H7 in a low pH, high os- 10 Vol. 76, Nr. 1, 2011 μ r m filter and frozen at E. coli × μ E. coli food isolate compared to a clinical isolate, C. Total of 200 ◦ E. faecalis C, and there were no detectable differences in the ◦ O157:H7 in ground beef extract (GBE) and compare O157:H7 Sakai strain was used in this study since the The strain was originally isolated during an outbreak asso- O157:H7 gene expression in beef . . . gene expression profiles in cheese samples using DNA ar- 20 Journal of Food Science ). − E. coli A total of 10 mL of RNA Protect reagent (Qiagen, Valencia, E. coli Fresh, raw, 85% lean ground beef was obtained from a local E. coli were determined in TSB and GBE at 37 and then filtered using a 0.22 quality of thewater beef were added after to irradiation.a 50-g Stomacher portions Total bag of of (Spiralfollowed the 15 by Biotech sterile pummeling mL Inc., in ground a Norwood, of beefLtd., Stomacher Mass., London, in 400 sterile U.S.A.) U.K.) Lab for Blender 1 (Seward liquid min, extract and then was massaging removed, by centrifuged hand. The at 2100 M80 RNA isolation Bacterial strain and culture conditions in GBE and TSA Materials and Methods Preparation of the GBE faecalis rays. Their study revealed thatlevels there of were differences an in transcriptsuggesting that the food isolateronment. may Bergholz have and adapted others tostress (2009) a response dairy examined regulons the envi- of induction of at 150 rpm. In addition, growth curves of contained Lockheed-Georgia Co. (Marietta, Ga.,irradiator U.S.A.) with gamma temperature control.was The irradiation temperature counted. cultures were plated onto tryptic soythe agar plates every hour were for then 13 h, incubated and overnight at 37 of TSB or 10 mL of GBE followed by incubation for 2 h at 37 Calif., U.S.A.) were added toand TSB each samples, of and 5 the mix mLfor was 10 portions incubated min of at to room the temperature ensure GBE that the bacterial RNA was stabilized. Total genome is fully2002 sequenced and annotatedciated with (Ohnishi radish and sproutswas others that obtained from occurred Dr. in ThomasCultures Japan Whittam at in were Michigan inoculated 1996, State and intoMd., Univ. it TSB U.S.A.) from (Becton glycerol Dickinson, stocks Sparks, stored at supermarket and sterilized by irradiation (25 kGy) in a use. overnight at 37 transferred to 20 mLto reach of early fresh exponential phase TSBcentrifuged, (OD600 and and allowed the to cell pellettone grow was water. for washed Following with 4 centrifugation, 0.1% h in sterile the TSB, pep- pellet and was approximately resuspended 1 molarity model apple juice medium. Genesinduction that in showed significant the model apple juiceosmotic, included those oxidative, and involved in envelope acid, stressthere responses. are Thus, a although few reportsfood on or gene model expression food profilingexamining systems, of gene there bacteria have expression in been of no reported studies of this research wasof to determine theit genome to expression that profile infor tryptic growth soy and broth survival (TSB) inuseful to ground elucidate for beef. genes the This important development informationpathogen in of will beef. be effective strategies to control this

M: Food Microbiology & Safety 10020Omtclyidcbeprpamcpoen( protein periplasmic Osmotically-inducible E100004260 10002( ( 2 ( glutaredoxin regulator dual transcriptional DNA-binding E100004012 E100001037 ( NAD(P)-binding alpha-galactosidase, ( protein E100004010 periplasmic shock-inducible acid E100004011 E200001462 transcriptional subunit, transporter D-ribose ( B synthetase asparagine E100003672 E200000827 ID Probe 20079Sgrpopaeatpre ( antiporter phosphate ( Sugar L4 protein ribosomal 50S E200002779 E100003242 rbIsi 0%ietclt nOFo 1,O5:7(D93,adO5:7(aa)srisadhsgetrta 7 dniyt nOFo F03 hnthi then CFT073, of ORF an to identity 97% than greater has sequence and the strains If (Sakai) AF074613). O157:H7 NC_002128, and NC_002127, (EDL933), 4 accession: O157:H7 these gene K12, all pO157-EDL933, of in ORF and http://omad.operon.com/download/storage/. gene an pO157_Sakai, same to (OSAK1, the identical represents plasmids 100% 3 is and probeIDs NC_004431) and NC_002695, ramn ifrne eedtrie yteBnern LSD Bonferroni at the technique 1.5. pH separation by SGF, mean to determined exposure were of time differences and Treatment in- TSB of and effects GBE the of teractions determine to performed was (ANOVA) variance ye ygleetohrsscnrigta nyasnl band single a ana- only also that were confirming produced. independent assays electrophoresis was qPCR 3 gel 2. from by Table data lyzed in expression shown The the are 2009). of experiments others values for and log2 (Wang used average described were previously was gene efficiency as qPCR rRNA evaluated The 2009). 16S others the and (Wang and from normalization (2001), data Pfaffl by fluorescence described the method change the fold using expression determined sample relative was The RNA reaction, contamination. ge- a potential of DNA and detect nomic type to water) included were each grade transcriptase (PCR reverse for without control and negative triplicate, a in both run were reactions n 10 and 10 cDNA, 8 RceApidSine ihamxcnitn f5 of LightCycler consisting a mix in a cycles with 45 Science) for Applied run (Roche was 480 Indianapo- qPCR Science, U.S.A.). Applied Ind., (Roche lis, kit strand first contamination. Transcriptor DNA 1 from genomic synthesized eliminate was cDNA to U.S.A.) Carls- (Invitrogen, Calif., DNaseI bad, with treated as and isolated program was previously RNA Total gene. described software each for size Primer3 in bp ap- 200 the proximately of amplicon Primers using an produce 480. to designed experi- LightCycler (http://frodo.wi.mit.edu/primer3) were microarray Roche real- the 1) the quantitative using (Table by in (qPCR) verified PCR repressed) and time selected 5 randomly and were ments induced (5 0.05) iue,adpae noTB n ooyfriguis(CFU) units 37 forming at incubation colony overnight and after TSB, enumerated were onto plated and diluted, .coli E. a tolerance Acid verification RT-PCR and transcription Reverse coli E. Lo h utrswr hnaddt 5m fsyn- at described of incubation as by mL prepared followed 25 (2007), 1.5, to Drake pH added and 37 (SGF), then Azizoglu were fluid by cultures gastric the thetic of mL 8hwr de o2 Lo S n B n nuae o at for h TSB 2 for in incubated and grown GBE culture and TSB a of 37 mL of 25 mL to added were 5 h GBE, 18 and TSB to exposure al –lgncetdsue o eltm C oeaut p n onrgltdgnsin genes down-regulated and up- evaluate to PCR real-time for used 1–Oligonucleotides Table h Operon The odtrieteai oeac of tolerance acid the determine To ( expressed differentially were that ORFs 10 of Total ◦ ◦ o .Smlswr eoe ttm n t2h, 2 at and 0 time at removed were Samples h. 2 for C tan K2 eeacsin 006 17H EL3] eeacsin E014 17H Ski,gn ceso:B000;CT7,gn access gene CFT073, BA000007; accession: gene [Sakai], O157:H7 AE005174; accession: gene [EDL933]: O157:H7 U00096; accession: gene (K12, strains t10rma ecie rvosy oa f2 of total A previously. described as rpm 150 at C 17H eeepeso nbe . . . beef in expression gene O157:H7 μ a fec rmri nlvlm f20 of volume final a in primer each of M .coli E. μ Lof2 eoeAO eso . ossso 38poeD.Ec rbI ersne nTbe1t aea es eeacsinnme orsodn ote4 the to corresponding number accession gene 1 least at have 3 to 1 Table in represented probeID Each probeIDs. 9308 of consists 2.0 version AROS Genome melB erso—aRlc aiy( family repressor—GalR/lacl × eiis-ainctasotpoenCCAAAGGGGG GATGGCTTCCTTCAGCAGAC CTCGATAAACGTGAGCGTGA protein cotransport melibiose-cation ) YRGenPRmse i (Roche), mix master PCR Green SYBR .coli E. grxB P μ < fttlRAuigteRoche the using RNA total of g CGCTATCTAACTTCAATGGCAGGGGAAC ACTGCCCTTACTGCCTCAAA ) tan.Tecrepniggn ceso ubr n eal fgn nomto eae h niiulpoeD a efudat found be can probeIDs individual the related information gene of details and numbers accession gene corresponding The strains. 0.05. eeFradpie ees primer Reverse primer Forward Gene asnB .coli E. rplD uhpT GTGCCCGAGAATCGCTTTAGCGGAAGAACA GGATCGACACCCTGAAAGAA ) TACGCTCTAGATGGCTCTGGAAGATGTGCT TTCAGCAGACGTTCTTCACG ) rbsB 17H aa after Sakai O157:H7 CTCGTGGAGCAGGCAATCATCAGGAACAGG ACCTACGGGTTGAGCATGAC ) ) melA ◦ μ .Aayi of Analysis C. asr .AlqPCR All L. TTTACGAGTTAGCCCGACCTGTTTG GTCTGTAAGCGGCATGGTCT ) osmY GTCAGGCGCTTTTTGTTCTGGGGCTTTCTG CGCTGCTATGGGTCTGTCTT ) melR AAGGTAGGTAGCTTTGGCGATACTTTCAGC GAAAGGTGTTGAAGGGGTGA ) TAACTGGTTTAGCATCAGGCCAATTTCATC GTCAGAGCATGGCGATTTTT ) μ P Lof < CGTTCGCGATTTCTCGCCTTTCAGCACTTT CCGGATGTTCAGGCTGTATT hs eso ee htmyb soitdwt rwhadsurvival of and Incubation growth within with beef. targets associated ground be potential may in new that genes identify in of to down-regulated sets these TSB to or to used up- compared control were differentially GBE were microarrays of that DNA development study, genes the how current identify for on the targeted In potentially be strategies. and may food survival genes this and how specific on growth insights influences provide may matrix beef ground in O157:H7 of presence the higher to a due have ions. particularly, will sodium GBE, TSB ion that than the expected concentration on is ion information it available, Although not (7). is TSB content than (6.3) pH TSB lower fat. a and vita- g/L) iron, zinc, (2.5 acids, selenium, glucose amino vitamins, contains beef B essential other Ground the and content. B12, of min vitamin all protein and including 50% carbohydrate protein, about contains high contains a meal and has soy milk cow’s and from in peptone proteins of and 80% cheese, nearly for accounts Peptone (2.5). casein phosphate from hydrogen di-potassium and (5), chloride tes20) opnns(/)i S nld etn from peptone D( and (3), include meal (Guerini soy TSB from applications peptone in (17), ex- of casein (g/L) least range Components the 2006). widest prepare, others the to rapid easiest had allowed the and that was pensive, medium pathogen, the the as of TSB growth identified beef ground in coli eut n Discussion and Results 10 eeGn ucinMcora qPCR a Microarray grxB melR melB osmY melA asr function Gene uhpT rplD rbsB asnB Gene al –eltm uniaiePRadmcora eut for results microarray and PCR quantitative 2–Real-time Table vrg eut rm3idpnetexperiments. independent 3 from results Average neaiaino h lbltasrpinlpol of profile transcriptional global the of examination An rpi o rt sacmol sdmdu o rwhof growth for medium used commonly a is broth soy Tryptic neauto f8mdafrercmn of enrichment for media 8 of evaluation An . .coli E. ua hsht niotr51 7.27 4.01 5.49 5.18 4.49 7.21 3.60 2 6.54 Glutaredoxin regulator dual transcriptional DNA-binding protein cotransport Melibiose-cation protein periplasmic osmotically-inducible NAD(P)-binding alpha-galactosidase, protein periplasmic shock-inducible acid antiporter phosphate Sugar L4 protein ribosomal 50S subunit,transcriptional transporter D-ribose B synthetase asparagine erso Gl/alfamily) (GalR/lacl repressor 17H genes. O157:H7 o.7,N.1 2011 1, Nr. 76, Vol. , hra B osnt n B had GBE and not, does GBE whereas .coli E. .coli E. r ora fFo Science Food of Journal 17H nGEadTSB and GBE in O157:H7 O157:H7. + guoe(.) sodium (2.5), )glucose .coli E. − − − − − odchange Fold 3.07 2.66 2.69 2.79 4.41 .82.42 3.88 o:NC_002655, ion: O157:H7 probeID s ATATG .coli E. fthese of − − − − − M81 a 3.43 3.68 2.70 3.05 6.44 E.

M: Food Microbiology & Safety melB E. coli CFU/mL in GBE and 10 -galactosidase and the O157:H7 was approximately α O157:H7 in TSB and in GBE O157:H7 strain Sakai in GBE E. coli E. coli E. coli Figure 2–Correlation of gene expression levels across 6 individual hybridization sets. A/B, C/D, and E/F are 3 replicatespurified using from RNA 3 different experiments. A/BC/D flip, flip, and E/F flip areexperiments; 3 A, dye-swap C, replicate and E representand GBE, F B, represent D, TSB. Panel A,genes; up-regulated panel B, down-regulated genes. gene encoding melA lower in GBE than in TSB. At 14 h of growth, the 10 O157 involved in O-polysaccharide synthesis were all up- C, the population level of ◦ The 74 up-regulated genes in GBE were categorized into dif- Thegrowthcurvesfor The up- and down-regulated genes were distributed throughout A number of up- and down-regulated genes were part of oper- shown in Figure 3 were37 similar. However, after 10 h of growth at ferent functional groups (Table 3). gene encoding the(Table 4). melibiose transporter were down-regulated Up-regulated genes in observed for oligoindividual ID/probes hybridizations, replicated indicating that withinpression differences the between in GBE RNA arrays and ex- TSB in were 6 reproducible. the chromosome and plasmid genomesdifferent and functional were groups categorized based into ongenes annotations, involved in which various included biologicallular processes, biosynthesis components, of cel- andtrol global the regulatory utilization of mechanismssources. carbon, A that total energy, nitrogen, of con- 10 andgenes) genes phosphorous (5 were up-regulated chosen and for 5 RT-PCRdata confirmation down-regulated (see of Table the 1 microarray foror primer down-regulated are sequences). presented The in genes Table that 3 were and up- 4, respectively. ons. The correlation ofinformation gene expression permits profiles the withdence the classification measurements into operon of the multi-gene genes operons,operon and information the with is verified also low useful confi- forray the data. interpretation of For microar- example,E. 6 coli genes inregulated the (Table O-antigen 3), gene and clusterconsists of of genes the in the melibiose operon, which Growth curves in GBE and TSB 0.5 log population levels were 8.76 and 9.43 log O157:H7 in GBE and TSB, calculatedincrease by in dividing the the exponential average growth log 0.891 phase log/h, by respectively. time, were 0.869 and TSB, Totalof respectively. 3 separate experiments wereand performed, the curves generated were similar. The growth rates of O157:H7 grown E. coli C for 2 h to simulate temper- ◦ C could have been performed; ◦ Vol. 76, Nr. 1, 2011 r O157:H7 gene expression in beef . . . Journal of Food Science O157:H7 Sakai grown in GBE and lanes 3 and 4, grown in TSB. M, ) showed similar patterns of expression, corroborating results E. coli M82 Figure 1–RNA quality control results using1 and the 2 Agilent show Bioanalyzer. microcapillary Lanes electrophoresis resultsE. of coli RNA extracted from RNA ladder at low temperatures including 4 ature abuse conditions. RNA preparations fromsamples the TSB gave and clear GBE patternsmal with RNA prominent bands with 23S 23S/16S and1). ratios Statistically of 16S significant approximately riboso- gene 1.8 expression (Figure differencesbridization among sets, 6 which hy- included 3 dye-swap experimentsA/B (Figure 2, and A/Bfrom flip, 3 C/D RNA and preparationsserved from C/D 3 for flip, a separate total experiments andoligo of were E/F 143 ob- IDs and oligo (for IDs/probes. E/F example, DuplicatelldD flip) Table or 3, triplicate E200002660and and providing E100003527, an additionalID/probe tracking internal procedure. quality After removal checkthere of for duplicated were results, the 74 oligo up-regulatedresponding and to 54 79 down-regulated and genes, 64 cor- oligo IDs, in in GBE comparedcrease), to respectively (Figure TSB 2A (greater and B). than Consistency 2-fold in results increase was or de- however, we chose incubation at 37

M: Food Microbiology & Safety 10022( E100003232 ( E100003230 10022( E100003242 biosynthesis Protein ID probe Operon group Functional 10055( E100003525 ( E200002622 ( E100003587 ( E100003240 10044( cluster) E100005464 gene (O-antigen biosynthesis Polysaccharide (n/a) E200001463 10015( E100003115 ( E100003234 ( E100003882 20060( E200002660 factors Transcription ( E100002126 ( E100003469 ( E100003671 ( E100003238 ( E100003235 10048(/)Oatgnplmrs 2.00 polymerase antigen O ( E100005462 (n/a) E100005468 ( E100005461 20079( E200002779 genes related and Transporters ( E100003263 20092( E200002962 ( E100003377 ( E100004015 10057( E100003527 ( E100003241 ( E100002553 10062( E100003672 ( E100003670 ( E100003669 ( E100003244 20042( E200001462 ( bound) E100001567 (membrane proteins response Acid ( E100003191 ( E200002659 10026( E100003226 ( E100002144 ( E100003225 ( E100004090 ( E100003236 ( E100003237 10027( E100003227 ( E100003243 ( E100003239 10024( E100003264 ( E100003161 20041( E200002481 10089( E100003879 10027( E100003217 10008( E100004088 ( E100003229 10024( E100003224 ( E100000169 ( E100003218 ( E100003231 10084( E100003884 ( E100003220 10028( E100003228 10080( E100003880 10083( E100003883 10081( E100003881 ( E100002555 ( E100003222 .coli E. al –ee prgltdi B oprdt TSB. to compared GBE in up-regulated 3–Genes Table 17H eeepeso nbe . . . beef in expression gene O157:H7 rplX rpsN rplJ rplD lldP yhjX uhpT rplB wbdP rpmA rpsQ rplL lldD fruA yhjX rbsC rplV rpmC fcl wbdQ uhpT fusA malE livF dcuB lldD rplW rplS rbsB rbsA rbsD rpsJ asr asr fis lldR rpsE rplY rpmD rpsR rplP rpsC rplR rplC rpsS rpsG rplM rpsE rplK rplQ rpsF rpsH rplO rpsB rpoA rplE rpoC rpsK rplF rplA rpoB rimM rpmJ D--uoesnhts 2.36 synthetase GDP-L-fucose ) N-idn rti i 2.45 Fis protein DNA-binding ) cdsokidcbeprpamcpoen6.82 protein periplasmic shock-inducible Acid ) ) b 0 iooa rti 1 2.17 L10 protein ribosomal 50S ) 0 iooa rti 1 3.45 S10 protein ribosomal 30S ) ecn/sluievln rnpre uui 2.00 subunit transporter Leucine/isoleucine/valine ) 0 iooa rti 1 3.76 L19 protein ribosomal 50S ) -att emae(-att rnpr)2.39 transport) (L-lactate permease L-lactate ) 0 iooa rti 7L22.10 L7/L12 protein ribosomal 50S ) 0 iooa rti 1 3.06 L16 protein ribosomal 50S ) 0 iooa rti 1 2.75 S19 protein ribosomal 30S ) 0 iooa rti 23.96 L2 protein ribosomal 50S ) 0 iooa rti 62.29 L6 protein ribosomal 50S ) ) N-idn rncitoa erso 2.34 repressor transcriptional DNA-binding ) 0 iooa rti 52.40 L5 protein ribosomal 50S ) 0 iooa rti 22.37 S2 protein ribosomal 30S ) 0 iooa rti 62.41 S6 protein ribosomal 30S ) 0 iooa rti 12.28 L1 protein ribosomal 50S ) M-ikdLlcaedhdoeae rncitoa euao Gt aiy 2.60 family) (GntR regulator transcriptional dehydrogenase, L-lactate FMN-linked ) M-ikdLlcaedhdoeae rncitoa euao Gt aiy 2.13 family) (GntR regulator transcriptional dehydrogenase, L-lactate FMN-linked ) uui ffuts T rnpre 2.12 transporter PTS fructose of Subunit ) 0 iooa rti 1 2.63 L18 protein ribosomal 50S ) c ue -ioetasotrsbnt fACspraiy T-idn opnns2.30 components ATP-binding superfamily: ABC of subunits transporter D-ribose Fused ) 0 iooa rti 52.95 S5 protein ribosomal 30S ) 0 iooa rti 52.56 S5 protein ribosomal 30S ) T-idn rti/lnainfco 3.10 factor protein/elongation GTP-binding ) 0 iooa rti 2 3.02 L25 protein ribosomal 50S ) 0 iooa rti 32.64 L3 protein ribosomal 50S ) 0 iooa rti 2 2.14 L24 protein ribosomal 50S ) ) ioeACtasotrpres rti 2.59 protein permease transporter ABC Ribose ) rdce yolsi ua-idn rti 2.56 protein sugar-binding cytoplasmic Predicted ) 0 iooa rti 1 3.05 S18 protein ribosomal 30S ) 0 iooa rti 1 2.50 L11 protein ribosomal 50S ) N-ietdRAplmrs uui ea2.27 beta subunit polymerase RNA DNA-directed ) 0 iooa rti 1 2.47 L17 protein ribosomal 50S ) 0 iooa rti 1 2.36 L15 protein ribosomal 50S ) 0 iooa rti 2 3.85 L22 protein ribosomal 50S ) 0 iooa rti 3 2.26 L36 protein ribosomal 50S ) 4dcroyaeatpre 2.37 antiporter C4-dicarboxylate ) 0 iooa rti 33.37 S3 protein ribosomal 30S ) 0 iooa rti 1 2.31 S11 protein ribosomal 30S ) N-ietdRAplmrs uui lh 2.38 alpha subunit polymerase RNA DNA-directed ) 0 iooa rti 72.60 S7 protein ribosomal 30S ) 0 iooa rti 1 2.02 S17 protein ribosomal 30S ) 0 iooa rti 82.47 S8 protein ribosomal 30S ) N-ietdRAplmrs uui ea 2.30 beta’ subunit polymerase RNA DNA-directed ) 0 iooa rti 1 2.16 S14 protein ribosomal 30S ) 0 iooa rti 1 2.61 L13 protein ribosomal 50S ) b rdce rnpre 2.62 transporter Predicted ) rdce rnpre 2.42 transporter Predicted ) ats B rnpre eilsi rti 2.81 protein periplasmic transporter ABC Maltose ) b 0 iooa rti 2 3.65 L23 protein ribosomal 50S ) uaiegyoy rnfrs 2.36 transferase glycosyl Putative ) 0 iooa rti 2 2.00 L27 protein ribosomal 50S ) ua hsht niotr2.77 antiporter phosphate Sugar ) ) 6 RApoesn rti 2.24 protein rRNA-processing 16S ) 0 iooa rti 2 3.93 L29 protein ribosomal 50S ) 0 iooa rti 3 3.04 L30 protein ribosomal 50S ) D-ans anslhdoae2.36 hydrolase mannosyl GDP-mannose ) b a gn)Gn ucinFl change Fold function Gene (gene) 0 iooa rti 44.49 L4 protein ribosomal 50S ua hsht niotr5.18 3.88 family) (GalR/lacl repressor subunit,transcriptional transporter D-ribose antiporter phosphate Sugar uaieai hc rti 2.71 6.54 protein shock acid Putative protein periplasmic shock-inducible Acid o.7,N.1 2011 1, Nr. 76, Vol. r ora fFo Science Food of Journal (Continued) M83

M: Food Microbiology & Safety was gene fthese E. coli E. coli sprobeID asr lldD (GDP-L- fcl ion: NC_002655, , was also up- show a similar genes were up- There are 2 up- fis ), and wbdO (GDP-mannose man- lldPRD wzy (up-regulated 6.82-fold O157 O-antigen gene Genes in this operon may and asr ). wbdQ There were 6 up-regulated E. coli wbdN operon, while in the presence of L-lactate, it transcription. It is not surprising that O157:H7. Additionally, there was a putative acid (glycosyl transferase), is a nucleoid-associated histone-like transcriptional lldPRD fis lldPRD wbdP E. coli ˙ e and others 2008). This is an interesting gene for functional Acid response genes (membrane bound). Polysaccharide biosynthesis. All 3 genes that are in the same operon up-regulated since lactate is foundbreakdown in of beef glycogen muscle (Hamm tissue due 1977 to the gene expression pattern, whichAguilera is and consistent others with theunder (2008) findings that anaerobic of in conditions,tion the LldR of absence regulator the of represses L-lactate transcrip- and O157:H7 in ground beef. A universal regulator, be further studied to determine their effect on the survival of activates regulator for acategories number and genes is belongingcells found to (Bradley in and different high others functional in 2007). levels translation It in regulates (rRNA exponentially many andmation, growing genes tRNA energy involved metabolism, genes), stress virulence,metabolism, response, amino biofilm central acid for- biosynthesis, intermediary transport,bon cell structure, compound car- metabolism, aminometabolism, acid motility, and metabolism, chemotaxis nucleotide Sheikh (Finkel and and Johnson others 1992; 2002;another Bradley potential knockout and target others in 2007). future studies. This gene is regulated. regulated acid response genes (Table 3). and confirmed by qPCR) playsditions; a it role is in involved survival inallows under wild-type an acid cells acid-induced con- to protective survivetiene response exposure that and to very others lowcontributed 2004). pH to (Sepu- It bacterial is colonizationmalyt of also the noteworthy mouse that intestine (Ar- the shock protein (operon2.71-fold, ID: which E200001463) was thatO157 similar was Sakai to ECs2303 up-regulated (gene the accession: EU900748). acid shockgenes, protein, which arecluster, located in the nosyl hydrolase), O antigenfucose synthetase) polymerase (Table 3). ( The regulated 1.71-fold and 1.35-fold, respectively (data not shown). analyses and may serve astrol a target of gene for novel strategies to con- is are rbsB fruA malE jhjX ,and dcuB-fumB. ). RbsABC Putative fimbrial proteinAsparagine synthetase B 2.74 3.60 and rbsA rbsR , uhpT A total of 41 out of rbsC ,and There were 12 up- The O157:H7 after overnight rbsD , ). (Table 3). In response to in- (C4-dicarboxylate antiporter) (gene) Gene function Fold change , was also up-regulated. fis strains. The corresponding gene accession numbers and details of gene information related the individual probeIDs can be found at rbsK a E. coli Vol. 76, Nr. 1, 2011 r dcuB rbsD E. coli ,and operon, and all were up-regulated in There were 3 transcription factors that lldR , operons is activated by MalT and cAMP- lldD malK b ) tRNA (guanine-N(1)-)-methyltransferase 2.56 ) Anaerobic class I fumarate hydratase (fumarase B) (TCA cycle) 2.03 ) Asparagine synthetase AsnA 2.85 ) Hypothetical protein 2.34 ) Hypothetical protein (tRNA processing) 2.06 ) ) Asparagine synthetase B 3.16 Genome AROS version 2.0 consists of 9308 probeIDs. Each probeID represented in Table 1 to 3 have at least 1 gene accession number corresponding to the 4 b ) Ketol-acid reductoisomerase 3.40 ) Protein translocase subunit SecY 2.08 ) Nitrite reductase, large subunit, NAD(P)H-binding 2.37 ) Primosomal replication protein N 3.06 rbsDACBKR gene expression. ) Trigger factor (cell division) 2.21 and asnB ilvC asnB priB asnA trmD nirB yedF tig prlA yedF fumB (fuamrase B—converts malate to fumarate) were up- E. coli malE 1-fold (data not shown for O157:H7 gene expression in beef . . . malE O157:H7 in GBE compared to TSB. Journal of Food Science not available. > is repressed by glucose, accounting for its up-regulation in strains (K12, gene accession: U00096; O157:H7 (EDL933): gene accession: AE005174; O157:H7 (Sakai), gene accession: BA000007; CFT073, gene access fumB = Transporters and related genes. Genes involved in protein biosynthesis. Transcription factors. Used as targets for qPCR validation of microarray data. n/a The Operon Table 3–(Continued) E. coli creased L-lactate transport, LldR, a lactatetion regulator, factor is a that transcrip- controlsand expression of catabolism genes of involved L-lactate inothers (Dong transport and 2008). others It 1993; can Aguilera be and positively and negatively auto-regulated. b c M84 a E. coli growth in TSB intotrient GBE environment, resulted likely contributing in to exposureof the protein to elevated biosynthesis an expression genes altered duringgrowth nu- in growth TSB, in a GBE relatively rich compared medium.with to These the data growth are consistent curve dataE. coli showing somewhat slower growth of regulated transporter and related genes (Table 3). were up-regulated: 74 up-regulated genes were involved inof protein biosynthesis. the Most genesothers encoded included for genes 50S encoding forbinding and RNA protein. 30S polymerase, The and ribosomal transfer GTP- of proteins, and NC_002695, and NC_004431)probeIDs and is 3 100% plasmidsrepresents identical the to (OSAK1, same an pO157_Sakai genehttp://omad.operon.com/download/storage/. ORF and in of pO157-EDL933, all K12, these gene O157:H7 4 accession: (EDL933), NC_002127, and NC_002128, O157:H7 (Sakai) AF074613). strains If and the has sequence greater o than 97% identity to an ORF of CFT073, then thi CRP (Vidal-Ingigliardi and Raibaudinhibits 1991). Phosphate depletion regulated genes, which are found in the same operon, belong to the and dcuB GBE, which does notDcuB contain and glucose FumB (Golby arefumarate and both others and involved in 1998). nitrate providingin substrate reductase successive to regulator steps the (Fnr) inmalate. and the FruA is are anaerobic the transport involved was subunit and also of up-regulated metabolism fructose in of PTS GBE. transporter, and GBE both members of the major facilitatoralso superfamily known (MFS), as which the is uniporter–symporter–antiporter familyand (Marger Saier 1993; Pao and others 1998 is an ATP-dependent riboseATP-binding cassette transporter (ABC) that superfamily of is transportersPark a (Park 1999). and A member ribose of pyranase, the a maltose ABC transporter periplasmicof protein, and the the expression Others E200000827 ( E100003688 ( E100000657 ( E100004089 ( E100003665 ( E100002554 ( E100000428 ( E100003223 ( E100005465 (n/a)E100003288 ( E100001895 ( Aminotransferase, DegT/DnrJ/EryC1/StrS family 2.37 E200001600 ( E100004014 ( Functional group Operon probe ID Fimbriae E100005847 (n/a) M: Food Microbiology & Safety 10047( E100003417 10082( E100005892 phase stationary and stress, degradation, to response ( E100004011 factors, transcription and Enzymes ( E100004115 20001( E200001021 processes metabolic and Metabolism ID Operon group Functional 20074( E200000714 ( E100003285 ( E200000322 ( E100003137 ( E100001918 20035( E200000315 protein phase-induced Stationary ( E100003025 peptides and acids, amino ( molecules, E100004012 small degraded of Transportors 20002( E200001022 20035( E200000355 ( E100001397 10041( E100001451 ( E100004010 ( E200001538 ( E100001751 10096( E100000976 20049( E200001469 ( E100002983 ( E100002486 ( E100003284 10047( E100000427 10044( E100001464 10098( E100002958 ( E100004018 ( E200000157 ( E200003030 Others ( E100003827 20013( E200002183 20017( E200000167 ( E200000851 ( E100000690 ( E200001807 10080( E100002840 10000( E100003030 ( E200002182 20004( E200001014 10049( E100003439 10079( E100000779 20080( E200001820 ( E200003141 ( E100004126 10070( E100005700 10091( E100001931 ( E100000633 ( E100003031 ( E100002813 10009( E100004019 10007( E100001037 complex toxin-antitoxin and Glutaredoxin 20044( E200000424 10068( E100003628 10097( E100003937 ( proteins E200000333 inducible stress adaptation, Osmotic 10020( E100004260 rbIsi 0%ietclt nOFo 1,O5:7(D93,adO5:7(aa)srisadhsgetrta 7 dniyt nOFo F03 hnthi then CFT073, of ORF an to identity 97% than o greater sequence has the and If strains AF074613). (Sakai) O157:H7 NC_002128, and NC_002127, (EDL933), accession: 4 O157:H7 gene these K12, all pO157-EDL933, of in and ORF http://omad.operon.com/download/storage/. gene pO157_Sakai an same (OSAK1, to the identical represents plasmids 100% 3 is and probeIDs NC_004431) and NC_002695, .coli E. b a coli E. al –ee onrgltdi B oprdt TSB. to compared GBE in down-regulated 4–Genes Table h Operon The sda agt o PRvldto fmcora data. microarray of validation qPCR for targets as Used tan K2 eeacsin 006 17H EL3] eeacsin E014 17H Ski,gn ceso:B000;CT7,gn access gene CFT073, BA000007; accession: gene [Sakai], O157:H7 AE005174; accession: gene [EDL933]: O157:H7 U00096; accession: gene (K12, strains 17H eeepeso nbe . . . beef in expression gene O157:H7 .coli E. yhiO ecnB melA ytfQ agp yahO yhfG ydcH yrbL yodD sra uxaC melB agp yegP ydcH sra melR yeaG yeaG agp sodC glgS csiE fic bolA gadB ygiW yjdI yjfO yjdI yiiT gcvH ybdD ybgA ybgA yeiT gcvH yqjC yqfA hyaE gadX ybiI yeiQ nrdD nrdD bfr yedU ybeL yqjD ygfJ yjdJ grxB tnaC tnaC yjbJ osmB osmY ttoaypaeprotein phase Stationary ) 0 iooa uui rti S22 protein subunit ribosomal 30S ) 0 iooa uui rti S22 protein subunit ribosomal 30S ) atroertnmnmr(epnet ion) to (response monomer Bacterioferritin ) Glucose-1-phosphatase ) Glucose-1-phosphatase ) Glucose-1-phosphatase ) osre nnw protein unknown Conserved ) ttoaypaeidcbepoen(induced) protein inducible phase Stationary ) rdce tesrsos protein response stress Predicted ) osre nnw protein unknown Conserved ) rdce clrnfrs ihay-o -clrnfrs domain N-acyltransferase acyl-CoA with acyltransferase Predicted ) osre nnw protein unknown Conserved protein unknown Conserved ) ) rdce lcgnsnhsspoen(induced) protein synthesis glycogen Predicted ) uaiergltr(epnet stress) to (response regulator Putative ) neiii B Entericidin ) osre nnw protein unknown Conserved ) eoeAO eso . ossso 38poeD.Ec rbI ersne nTbe1t aea es eeacsinnme orsodn ote4 the to corresponding number accession gene 1 least at have 3 to 1 Table in represented probeID Each probeIDs. 9308 of consists 2.0 version AROS Genome uui fYf/tRYf/tTYf B transporter ABC YtfQ/YtfR/YtfS/YtfT/YjfF of Subunit ) rdce protein Predicted ) oAtasrpinlda euao sainr phase) (stationary regulator dual transcriptional BolA ) rdce protein Predicted ) rdce oxidoreductase Predicted ) ) rdce xdrdcae ne ebaesubunit membrane inner oxidoreductase, Predicted ) osre nnw protein unknown Conserved ) rdce eyrgns,NAD-dependent dehydrogenase, Predicted ) ltmt eabxls subunit B decarboxylase Glutamate ) osre nnw protein unknown Conserved ) osre nnw protein unknown Conserved ) ) lcn laaesse protein H system cleavage Glycine ) lcn laaesse protein H system cleavage Glycine ) rti novdi rcsigo yAadHa proteins HyaB and HyaA of processing in involved Protein ) ) ) ueoiedsuaepeusr(uZ)(induced) (Cu-Zn) precursor dismutase Superoxide ) osre nnw protein unknown Conserved protein unknown Conserved ) ) rdce protein Predicted ) iouloietihsht reductase Ribonucleoside-triphosphate reductase Ribonucleoside-triphosphate ) ) r,unknown Orf, ) ) eRtasrpinlda euao dschrd eiis degradation) melibiose (disaccharide regulator dual transcriptional MelR ) rti iae(ttoaypae cdadsl stress) salt and acid phase, stress) (stationary salt kinase and Protein acid phase, (stationary kinase Protein ) ) rdce protein Predicted ) rdce protein Predicted ) aXtasrpinlactivator transcriptional GadX ) sBomtclyidcbelipoprotein osmotically-inducible OsmB ) r,unknown Orf, ) rdce protein Predicted ) osre nnw protein unknown Conserved ) b rdce protein Predicted ) ) -lcrnt smrs/-aatrnt smrs guuoaeadglcuoaedegradation) galacturonate and (glucuronate isomerase isomerase/D-galacturonate D-glucuronate ) osre nnw protein unknown Conserved ) b b b a gn)Gn ucinFl change Fold function Gene (gene) .coli E. tan.Tecrepniggn ceso ubr n eal fgn nomto eae h niiulpoeD a efudat found be can probeIDs individual the related information gene of details and numbers accession gene corresponding The strains. eue ltrdxn2 glutaredoxin Reduced degradation) (melibiose monomer Galactosidase protein cotransport melibiose-cation protein periplasmic inducible Hyperosmotically tna tna prnlae peptide leader operon prnlae peptide leader operon o.7,N.1 2011 1, Nr. 76, Vol. r ora fFo Science Food of Journal o:NC_002655, ion: − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − − probeID s 2.21 3.07 2.41 2.69 2.40 2.43 2.46 2.70 2.11 2.42 4.41 2.79 2.35 2.07 2.09 2.30 2.02 2.16 2.48 2.18 2.25 2.24 2.13 2.45 2.19 2.66 2.08 2.93 2.20 2.59 3.69 2.43 2.29 2.53 2.57 2.58 2.21 2.21 2.39 2.30 2.00 2.39 2.31 2.18 2.25 2.12 2.30 2.22 2.23 2.40 2.27 2.26 2.04 3.30 2.00 2.09 2.23 2.75 fthese M85

M: Food Microbiology & Safety are is a Three is also a bolA gadX thus GBE Two genes, , csiE , a hyperosmot- ,and -galactosidase that is a stress-inducible ) that were down- α , are either involved gadX osmY are predicted oxidore- There were 10 genes , -D-galactose (4.41-fold yjbJ sodC β ,an osmY ,and grown in rich or minimal gene encodes for a bacteri- yeaG yqfA , of which the gene expres- melA genes (2.66-fold change) are osmB ,and ,and and was confirmed by qPCR, which ecnB genes depend on RpoS and are ) is a secondary membrane trans- E. coli are 2 down-regulated transporters. glgS There were a number of genes en- under stress conditions)-dependent yjbJ gadABC , , yeiT melB osmY melAB sodC ytfQ and csiE (entericidin B), were also down-regulated -D-glucose and osmB E. coli , β and and fic is an enzyme responsible for glucuronate and ecnB gadA , , a transcription activator essential for melibiose- glgS sra melB , functions to regulate programmed cell death under . uxaC is a subunit of the YtfQ/YtfR/YtfS/YtfT/YjfF ABC melR ecnAB ytfQ , encoding for Grx2 that functions as an electron carrier in Osmotic adaptation, stress inducible protein. The unknown proteins. Stationary-phase or stationary phase-induced proteins. Transporters of degraded small molecules, amino acids, Enzymes and transcription factors, response to degra- Glutaredoxin and toxin–antitoxin complex. regulated. Both lysine, and methionine (Neilands and others 1949) likely had a higher level of tryptophan than TSB. in osmotic adaptationosmotically-inducible or lipoprotein, encode stress inducible proteins. The stationary phase-induced protein underthe the cAMP-CRP control complex. of RpoS and coding for unknown proteins that were down-regulated in GBE. induced inregulated the gene stationary (datastationary-phase phase. not protein RpoS shown—fold withor possible change, was folate role 1.07). biosynthesis. another in FicS22, Sra p-aminobenzoate down- which is is is the a only 30S ribosomal expressed in subunit stationary protein phase. high osmolarity conditions. The olytic protein that maymoribund play cells a in role stationary-phase populations in1998). (Bishop the Both and Grx2 others selective and elimination EcnB are of a RpoS (a critical global regulator in that survival plays stationary of phase proteins (Schellhorn andand others others 1998; 2002). Potamitou There were 5induced additional genes stationary-phase ( or stationary phase- down-regulated genes, ically inducible periplasmic protein, wereGBE both down-regulated (2.09- in and 2.79-fold,absence respectively). of This NaCl may in the be GBE.NaCl. due TSB Down-regulation contained to of approximately the 0.3 M showed an approximately 3-fold change. protein that may beis involved in not the an osmotic stress essential response. protein YjbJ for media; however, it was inducedNaCl under under osmotic both stress imposed aerobicothers by 2006). and anaerobic conditions (Weber and and peptides The melibiose transporter ( porter, which mediates symportcations. of galactosides and monovalent change) and involved in melibiose degradation. gene that regulates dependent expression of considered stationary phase transcriptional regulators. transporter. dation, stress anddown-regulated in stationary this phase. converts category. melibiose to sion levels dependphase, on and culture acid conditions. conditions,ductases, entry and intogalacturonate stationary degradation. grxB the glutathione-dependent synthesis ofribonucleotide reductase deoxyribonucleotides and by may alsoidative damage, protect and the cell against ox- in GBE compared to TSB. Themodule, linked entericidin toxin–antitoxin is en- nrdD gene is hyaE agp are all involved fcl is involved in the (NADH-dependent There were 8 down- is a NAD-dependent ) may participate in the ,and nirB tnaC yeiQ primosomal protein. It has wzy wbdQ O157:H7 in ground beef , E100005847, identified as a pu- Vol. 76, Nr. 1, 2011 is a predicted acyltransferase with r E. coli biosynthesis of purine nucleotides wbdQ , catalyzing the glutamine-dependent E. coli yjdJ , O157 O-polysaccharide antigen, and ,an de novo E. coli priB wbdP , E. coli has a role in the glutamate metabolic process; wbdO gadB O157:H7 Sakai growth curves in ground beef extract (GBE) , E. coli wbdN O157:H7 gene expression in beef . . . Journal of Food Science helps in the utilization of glycine to form serine, and is also involved in colanic acid biosynthesis (Wang and Reeves Fimbrial genes and others. There were 51 down-regulated genesMetabolism in and GBE metabolic (Table processes. 4). E. coli the ability to restart replicationwhich after is encountering essential DNA for damage, nitrite bacterial reductase) is another survival. interesting up-regulated gene;able its prob- metabolic functionoften is used to in processed detoxify meat nitrite. as a Sodium preservative nitrite and antioxidant. is compared to tryptic soy broth (TSB) (averages of 3 experiments). Figure 3– M86 Down-regulated genes of GDP-mannose mannosyl hydrolase ( in synthesis of the fcl 1998). tative fimbrial protein genewere was 12 up-regulated up-regulated (2.74-fold). genes,cell There which division, have tRNA diverse processing, roles,functions including cell (Table 3). damage Asparagine recovery, andparagine synthetase synthetases other B in (AsnB) is 1 of 2 as- regulation of cellcentration wall of biosynthesis GDP-mannose by or influencing1995). GDP-glucose the (Frick cell and con- others and ammonia-dependent conversionAn of important aspartate gene to is asparagine. regulated genes involved in metabolic processes. The an enzyme involved in codes a nonessential chaperone, and and pyrimidine deoxyribonucleotides. predicted dehydrogenase and isin most degradation likely of a(http://bioinformatics.biol.rug.nl/standalone/prosecutor/data/ small regulator involved molecules, sucheco/genes/yeiQ.html), and as carbonan compounds acyl-CoA N-acyltransferasethe domain glycogen most metabolic likelynl/standalone/prosecutor/data/eco/genes/yjdJ.html). process involved in (http://bioinformatics.biol.rug. tryptophan catabolic process.good Beef sources and of other animal essential foods amino are acids, including tryptophan, involved in glucose anddid glucose-1-phosphate not contain degradation. glucose whereas GBE mM TSB contained glucose. approximately 14 gcvH

M: Food Microbiology & Safety oe pl uc p 3.5). (pH juice apple model Ho S n B 7ad63 epciey ieyhda effect an of had likely profiles respectively) expression 6.3, gene and the the (7 and on GBE composition and the TSB in of Differences pH TSB. and GBE in pressed 2). (Table data qPCR the with microarray concordance The good qPCR. showed by data validation postmicroarray for selected nuae nGEcmae oTBwt usqetepsr to pathogen Therefore, exposure subsequent the 1.5. with pH of TSB SGF, survival to compared increased GBE was in incubated there acid and putative a protein, and shock protein periplasmic encoding shock-inducible genes acid using of an up-regulation for perform in resulted to GBE to difficult exposed Sakai are that showed products We types technologies. food available these currently actual However, of in presence GBE. studies the to in of compared beef microflora ground natural in additional the expression be may gene There in pathogen. differences this by caused infections with of adaptations coli the understanding for information provides study log in resulted 1.5, pH SGF, to h, nrae cdtlrne egozadohr 20)as found also (2009) others to and contributed that Bergholz likely also tolerance. GBE (6.3) acid in increased incubated GBE cells of the in tolerance expression increase) increased acid of fold increased Furthermore, pH induced pathogen. likely lower the 7) in The (pH after TSB 5). CFU/mL to (Table 4.44 compared by SGF declined to TSB exposure to exposed bacteria while S olwdb xouet ytei ati ud H1.5. pH fluid, gastric synthetic to exposure by followed TSB Conclusions 1.5 pH fluid, gastric synthetic to exposure by followed of Survival data microarray and qPCR between Correlation the functions. monitoring their directly determining experiments of Future response stress 2007). (Bradley genes others uncharacterized these small and of by portion encoded a be and may proteins degradation, stationary protein amino adaptation, and early stress biosynthesis, the metabolism, acid in energy in proteins involved for are phase encode that transcripts Many coli E. 17H nbe.Frhroe ehv eosrtdta gene that demonstrated have we identify- control Furthermore, for to beef. strategies data in intervention baseline O157:H7 for in provides targets survival study molecular increase current ing will The which host. tolerant, the acid more become may ensprto ehiu at technique separation mean ie2h6.27 7.01 a h 2 Time h 0 Time al –uvvlof 5–Survival Table n en ihn etri omnaesaitclydfeetb h ofroiLSD Bonferroni the by different statistically are common in letter no with means 2 Any ehv sdmcorast dniygnsdfeetal ex- differentially genes identify to microarrays used have We of Exposure were genes down-regulated 5 and up-regulated 5 of total A 17H ngon ef odvhcecmol associated commonly vehicle food a beef, ground in O157:H7 asr 17H eeepeso nbe . . . beef in expression gene O157:H7 a nue in induced was .coli E. .coli E. .coli E. 17H aa nuae nGEadTSB and GBE in incubated Sakai O157:H7 .coli E. P .coli E. 17H aa,epsdt B o 2 for GBE to exposed Sakai, O157:H7 17H a eueu nmr precisely more in useful be may O157:H7 < 0.05. .coli E. 17H aa nuae nGEand GBE in incubated Sakai O157:H7 B TSB GBE ± ± 17H fe 0mnepsr to exposure 10-min after O157:H7 .2b7.75 b 0.22 .5c3.31 c 0.15 17H on ngon beef ground in found O157:H7 10 .coli E. o1 CFU/mL Log10 .4dces nCFU/mL, in decrease 0.74 17H.Tecurrent The O157:H7. .coli E. a O157:H7 asr ± ± (6.82- .coli E. .1d 0.51 .1a 0.21 E. hlisfrpromn h ttsia nlsso h data. the of John analyses thank statistical also the We article. performing the for and of Phillips Smith review James critical to for grateful are Liu Yanhong we and Fratamico, David and Bagi ogJ,Tyo S aorD,IciS i C.19.Treoverlapping Three 1993. ECC. Lin S, Iuchi DJ, Latour JS, Taylor JM, Dong Armalyt gieaL,Cmo ,GmnzJ ai ,AulrJ adm .20.Da oeo LldR of role Dual 2008. L. Baldoma J, Aguilar J, Badia J, Gimenez R, Campos LE, Aguilera References Acknowledgments odmti.GEcnsrea oe ytmfor a system using model as conducted serve be can GBE can matrix. microarrays food using analysis expression eeepeso studies. expression gene ahaiS Qu of S, review. profiling Makhzami a expression muscle: Gene 2008. ground A. in Ream glycogen Y, and Liu ATP of breakdown Postmortem 1977. R. Hamm of Evaluation 2006. M. Koohmaraie SD, Shackelford TM, Arthur MN, Guerini organization and regulation Transcriptional 1998. SC. Andrews JR, Guest DJ, Kelley P, Golby shares Mol hydrolase anymore. mannosyl inversion GDP-mannose novel DNA A 1995. for MJ. just Bessman BD, Townsend not DN, it’s Frick protein: Fis The 1992. RC. Johnson SE, Finkel on Fis of Effects of 2007. locus R. Osuna entericidin TS, The Pratt AP, 1998. Koning JH. de Weiner MB, Beach CM, MD, Kay in Bradley RS, induced Hodges expression BK, Gene Leskiw 2009. RE, TS. Bishop Whittam SK, Vanaja virulence TM, and tolerance Bergholz heat and acid on stress antibiotic of Impact 2007. M. Drake RO, Azizoglu mt L rtmc M 05 Diarrhea-inducing 2005. PM. Fratamico JL, Smith agS egK aeb ,Dn ,LnC agQ otrloM,ZagW 2009. W. Zhang ML, K Tortorello Q, A, Wang C, Weber Lin X, Deng S, Zaremba K, Deng S, Wang the of Organization 1998. PR. Reeves L, Wang euin ,Szeei ,NrakS eeosO uidleeE 04 Transcriptional 2004. E. RpoS- Suziedeliene O, conserved, Melefors of S, Identification Normark 1998. K, L. Suziedelis Chang V, LIC, Seputiene Wei JP, Audia HE, of Schellhorn Expression 2002. A. Vlamis-Gardikas A, RT-PCR. Holmgren real-time P, in Neubauer A, quantification Potamitou relative transporter, for ribose model the mathematical of new A component 2001. membrane MW. a Rev Pfaffl RbsC, Biol of Mol Topology Microbiol 1999. C. superfamily. Park facilitator Y, Major Park 1998. MH. Saier IT, Paulsen Watanabe SS, Y, Pao Ogura K, Tamura T, Murata K, Nakayama K, Kurokawa canned of J, value Terajima nutritive M, The Ohnishi 1949. CA. Elvehjem catalyse FM, Strong that I, facilitators Sohljell RJ, transmembrane Sirny of JB, Neilands superfamily major A 1993. MH. Saier MD, Marger ia-nilad ,RiadO 91 he daetbnigstsfrcM eetrprotein receptor cAMP for sites binding adjacent Three 1991. O. Raibaud D, Vidal-Ingigliardi hihJ zcui R arntnS ik ,HnesnI,L Bougu Le IR, Henderson S, Hicks S, Harrington JR, Czeczulin J, Sheikh nLlcaeuiiainby utilization L-lactate in 190:2997–05. Bacteriol nrglto fthe of regulation in rwhi lrhg-eprtr-rcse kmml.Ap nio irbo 74:6859–66. Microbiol Environ Appl milk. skim ultrahigh-temperature-processed in growth J processing. 1:15–39. Sci beef Meat ground for procedures test-and-hold in 69:1007–11. use Prot Food for media growth O157:H7 in 270:24086–91. the Chem of Biol J enzymes. of family MutT the with homology 6:3257–65. Microbiol coli 75:3542–53. coli Microbiol Escherichia Environ Appl juice. apple model to exposure upon O157:H7 of 159:486–93. expression Microbiol factor Res model. mouse a in colonization during fitness decreased hlisA aaoJ.20.Anvldsesnpoeni enteroaggregative in protein dispersin novel A 110:1329–37. Invest 2002. Clin JP. Nataro A, Phillips 2008. uigarbcadaarbcgot in growth anaerobic and aerobic during 75:6110–23. of response Transcriptomic 66:3545–51. Immun Infect genes. specific its of identification Norfolk, 357–82. biology. p molecular Press. and microbiology Academic pathogens: Caister U.K.: Foodborne editors. JL, Smith AK, nlsso h acid-inducible the of analysis 277:17775–80. of Chem genes Biol stationary-phase J dependent sigmaS. and ppGpp by regulated mainly is 2 glutaredoxin 29:2002–7. Res Acids Nucl 181:1039–42. Bacteriol J superfamily. AraH the to belonging 99:17043–8. USA 62:1–34. Sci Acad Natl Proc scanning. enterohemorrhagic PCR of genome diversity whole Genomic by 39:187–02. 2002. Nutr T. J Hayashi products. H, meat and fish of content acid Amino II foods. 18:13–20. Sci Biochem Trends antiport. and symport uniport, 75:485–90. Methods Microbiol r novdi h ciaino h divergent the of 88:229–33. activation USA the in involved are eakoldeteottnigtcnclassac fLori of assistance technical outstanding the acknowledge We shrci coli Escherichia eeepeso uigdfeetgot tgs irbooy153:2922–40. Microbiology stages. growth different during expression gene eJ,Seputien ˙ nsitu In dcuA g A ugK 06 iedpnetpoem leain ne soi stress osmotic under alterations proteome Time-dependent 2006. K. Jung SA, ogl ¨ and eeepeso nces arcs plcto oasto neooclgns J genes. enterococcal of set a to application matrices: cheese in expression gene n t mlctosfrporme atra eldah o il280:583–96 Biol Mol J death. cell bacterial programmed for implications its and en ´ atro 180:6586–96. Bacteriol J . dcuB eP kr ,Bc ,AgeM eari-uhtA ge -,Sro P. Serror J-C, Ogier A, Delacroix-Buchet M, Aigle C, Bach E, Akary P, ee ´ ,Mlfr ,Su O, Melefors V, e ˙ shrci coli Escherichia o.7,N.1 2011 1, Nr. 76, Vol. lldPRD ee,ecdn oooosaarbcC-iabxlt transporters C4-dicarboxylate anaerobic homologous encoding genes, shrci coli Escherichia shrci coli Escherichia asr prn novdi -att eaoimin metabolism L-lactate in involved operon, eei neoatra e irbo 155:35–42. Microbiol Res enterobacteria. in gene 17H.JFo rt70:194–9. Prot Food J O157:H7. shrci coli Escherichia zied atro 175:6671–8. Bacteriol J . ˇ shrci coli Escherichia 17H ooiaiesrs.Ap nio Microbiol Environ Appl stress. oxidative to O157:H7 elien ˙ shrci coli Escherichia r malEp-malKp .20.An 2008. E. e ˙ ora fFo Science Food of Journal shrci coli Escherichia atro 23:6283–91. Bacteriol J . itramonocytogenes Listeria atro 188:7165–75. Bacteriol J . 17Oatgngn lse and cluster gene antigen O O157 rmtr.Po alAa Sci Acad Natl Proc promoters. shrci coli Escherichia shrci oiasr coli Escherichia n rtmc M Bhunia PM, Fratamico In: . .coli E. tanF35during F2365 strain ncC onnP, Gounon C, enec ´ lct shrci coli Escherichia shrci coli Escherichia ee involved genes 17revealed O157 O157:H7 shrci coli Escherichia shrci coli Escherichia shrci coli Escherichia uathas mutant Escherichia M87 .J .J

M: Food Microbiology & Safety