DOCSLIB.ORG
Explore
Sign Up
Log In
Upload
Search
Home
» Tags
» PrimPol
PrimPol
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Intimate Relations—Mitochondria and Ageing
Common Chemical Inductors of Replication Stress: Focus on Cell-Based Studies
A Novel DNA Primase-Helicase Pair Encoded by Sccmec Elements Aleksandra Bebel†, Melissa a Walsh, Ignacio Mir-Sanchis‡, Phoebe a Rice*
S-Phase Checkpoint Regulations That Preserve Replication and Chromosome Integrity Upon Dntp Depletion
Hepatic Proteomic Analysis of Selenoprotein T Knockout Mice by TMT: Implications for the Role of Selenoprotein T in Glucose and Lipid Metabolism
The M1 Aminopeptidase NPEPPS Is a Novel Regulator of Cisplatin
Eukaryotic DNA Polymerases in Homologous Recombination Mitch Mcvey, Varandt Y
Mitochondrial DNA Replication-A Primpol Perspective
SUPPLEMENTARY MATERIALS and METHODS PBMC Transcriptomics
Embryonic Exposure to 10 Μg/L Lead Results in Female-Specific
Mouse and Rat Monoclonal Antibodies 2021
Primpol Is Required for Replication Reinitiation After Mtdna Damage
POLRMT Regulates the Switch Between Replication Primer
Divalent Cations Alter the Rate-Limiting Step of Primpol-Catalyzed DNA Elongation
The PPR Domain of Mitochondrial RNA Polymerase Is a Ribonuclease Required for Mtdna Replication
Oxidative DNA Damage Stalls the Human Mitochondrial Replisome Gorazd Stojkovič Umeå University
Transcription-Mediated Replication Hindrance: a Major Driver of Genome Instability
Top View
{'Ess': 0, 'Noness': 3} True 70007 AAGATCTAAAACTTTACACTAG []
The PRIMPOL Protein Shields Replication Forks in BRCA
Cyclin Kinase-Independent Role of P21 in the Promotion of Nascent DNA Elongation in Unstressed Cells
Translesion Activity of Primpol on DNA with Cisplatin and DNA–Protein Cross‑Links Elizaveta O
Structural Basis of DNA Synthesis Opposite 8-Oxoguanine by Human
WO 2018/102818 Al 07 June 2018 (07.06.2018) W !P O PCT
Mitochondrial DNA Replication: a Primpol Perspective
Identifying the Role of Primpol in TDF-Induced Toxicity and Implications of Its Loss of Function Mutation in an HIV+ Patient Vincent N
Study of the Functions of Mammalian Primpol Protein in Vivo
Supplementary Materials and Methods Analysis of Tumorigenicity
Figure S1. Kaplan‑Meier Plots Showing the Prognostic Values of ANLN and KDR in Different Sample Cohorts
Replication Stress at Telomeric and Mitochondrial DNA: Common Origins and Consequences on Ageing
Rapid Mendelian Sequencing Gene List December 2018
RUNX1-EVI1 Disrupts Lineage Determination and the Cell Cycle by Interfering with RUNX1 and EVI1 Driven Gene Regulatory Networks
The PHP Domain of Polx from Staphylococcus Aureus Aids High
(A) OX40 Expression on Intratumoral Pdc from HPV-Positive (N= 43) and HPV-Negative (N= 46) HNSCC Patients
© Copyright 2019 Laura M. Gabrovsek
DNA Damage Repair: Historical Perspectives, Mechanistic Pathways and Clinical Translation for Targeted Cancer Therapy
Analysis of Human Y-Family DNA Polymerases and Primpol by Pre
Mechanism of DNA Primer Synthesis by Human Primpol
Strand Displacement Activity of Primpol
The Consequences of DNA Lesions for Mitochondrial DNA Maintenance
ACE2.Testis.Correlation Page 1