DOCSLIB.ORG

Atlas Journal

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Atlas Journal Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Solid Tumours Cancer-Prone Deep Insight Portal Teaching X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Atlas Journal Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book. TABLE OF CONTENTS Volume 6, Number 3, Jul-Sep 2002 Previous Issue / Next Issue Genes CTNNB1 (Catenin, beta-1) (3p22-p21.3). Brigitte Debuire, Antoinette Lemoine, Raphael Saffroy. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 392-402. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/CTNNB1ID71.html EXT1 (8q24.11-q24.13) - updated. Judith V.M.G. Bovée. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 403-408. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/EXT1ID212.html EXT2 (11p11-p12) - updated. Judith V.M.G. Bovée. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 409-415. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/EXT2ID213.html GPHN (Gephyrin) (14q23.3). Brigitte David-Watine. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3):416-420. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/GPHNID317.html MLN51 (17q11-17q21.3). Sébastien Degot. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 421-424. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/MLN51ID241.html NSD1 (Nuclear receptor-binding, su(var), enhancer-of-zeste and trithorax domain- containing protein 1) (5q35). Lyndal Kearney. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 425-429. [Full Text] [PDF] Atlas Genet Cytogenet Oncol Haematol 2002; 3 I URL : http://AtlasGeneticsOncology.org/Genes/NSD1ID356.html NUP98 (nucleoporin 98 kDa) (11p15) - updated. Lyndal Kearney. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 430-437. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/NUP98.html TPR (Translocated promoter region) (1q25). Brigitte David-Watine. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3):438-442. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/TPRID282.html BCL11A (B-cell lymphoma/leukemia 11A) (2p13-15). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 443-447. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/BCL11AID391.html RECQL5 (17q25.2-25.3). Mounira Amor-Guéret. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 448-451. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/RECQL5ID286.html SDHB (succinate dehydrogenase complex II, subunit B, iron-sulfur protein or IP) (1p36.1- p35). Anne-Paule Gimenez-Roqueplo. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 452-456. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/SDHBID388.html SDHC (succinate dehydrogenase complex II, subunit C, integral membrane protein) (1q21). Anne-Paule Gimenez-Roqueplo. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 457-460. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/SDHCID389.html Glypican-3 (GPC3) (Xq26.1). Daniel Sinnett. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 461-467. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/GPC3ID156.html Leukaemias t(5;11)(q35;p15.5). Lyndal Kearney. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 468-472. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/t0511q35p15ID1209.html t(1;19)(p13;p13.1). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2002; 3 II Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 473-474. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/t0119p13p13ID1230.html t(11;14)(q23;q24). Mariko Eguchi. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 475-478. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/t1114q23q24ID1198.html Classification of acute myeloid leukemias. Georges Flandrin. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 479-487. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/ClassifAMLID1238.html Classification of myelodysplasic syndromes. Georges Flandrin. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 488-497. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/ClassifMDSID1239.html M0 acute non lymphocytic leukemia (M0-ANLL) - updated. Marie Christine Bene. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 498-499. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/M0ANLLID1057.html t(1;3)(p36;q21) - updated. Jay L Hess. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 500-503. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/t0103.html t(1;3)(p36;p21). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 504-506. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/t0103p36p21ID1237.html t(1;16)(q11;q11). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 507-508. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/t0116q11q11ID1247.html +5 or trisomy 5. Edmond Ma, Thomas Wan. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 509-512. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/tri5ID1255.html t(Y;1)(q12;q12). Thomas Wan and Edmond Ma. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3):513-515. [Full Text] [PDF] Atlas Genet Cytogenet Oncol Haematol 2002; 3 III URL : http://AtlasGeneticsOncology.org/Anomalies/tY1q12q12ID1160.html Solid Tumours Bone: Chondrosarcoma - updated. Judith VMG Bovée. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 516-523. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Tumors/chondrosarcID5063.html Cancer Prone Diseases Hereditary multiple exostoses (HME) - updated. Judith VMG Bovée. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 524-529. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Kprones/HeredMultExostosID10061.html Costello syndrome. Nicole Philip. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 530-532. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Kprones/CostelloID10075.html Deep Insights Functional organization of the genome: chromatin. Patricia Ridgway, Christèle Maison, Geneviève Almouzni. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 533-546. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Deep/ChromatinID20024.htm.html Case Reports Pentasomy 21 as a sole abnormality in an atypical CML patient in chronic phase. Shambhu K Roy, Sonal R Bakshi, Shailesh J Patel, Pina J Trivedi, Manisha M Brahmbhatt, Shwetal M Rawal, Pankaj M Shah, Devendra D Patel. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 547-550. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Anomalies/21CRRoyID100004.html Educational Items Immunoglobulin Genes. Marie-Paule Lefranc, Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3):551-559. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Educ/PolyIgEng.html Chromatin. Patricia Ridgway, Christèle Maison, Geneviève Almouzni. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 560-568. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Educ/ChromatinEducEng.html Selection. Atlas Genet Cytogenet Oncol Haematol 2002; 3 IV Robert Kalmes. Atlas Genet Cytogenet Oncol Haematol 2002; 6 (3): 569-582. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Educ/SelectionID30040ES.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Home Genes Leukemias Solid Tumours Cancer-Prone Deep Insight Portal Teaching For comments and suggestions or contributions, please contact us [email protected]. Atlas Genet Cytogenet Oncol Haematol 2002; 3 V Atlas of Genetics and Cytogenetics in Oncology and Haematology CTNNB1 (Catenin, beta-1) Identity Other Cadherin-associated protein, beta names Hugo CTNNB1 Location 3p22-p21.3 CTNNB1 (2p22) - Courtesy Mariano Rocchi, Resources for Molecular Cytogenetics. Laboratories willing to validate the probes are welcome : contact [email protected] DNA/RNA Atlas Genet Cytogenet Oncol Haematol 2002; 3 -392- Description The gene encompasses 23.2kb of DNA ; 16 exons (the first is non- coding). Transcription 3362 nucleotides mRNA ; 2343 bp open reading frame. Alternative splicing within exon 16 produces a splice variant that is 159 bp shorter in the 3' untranslated region. Protein Atlas Genet Cytogenet Oncol Haematol 2002; 3 -393- Description 781 amino acids ; 92 kDa protein. Can be phosphorylated ; contains from N-term to C-term, a phosphorylation site by the serine-threonine glycogen synthase kinase -3b(GSK-3b), an a-catenin binding site, 13 armadillo repeats and a transactivating domain. Expression Widely expressed. Localisation Cytoplasm and nucleus Function Important functions in the E-cadherin-mediated cell-cell adhesion system and also as a dowstream signaling molecule in the Wnt pathway. Cytoplasmic accumulation of b catenin allows it to translocate to the nucleus to form complexes with transcription factors of the T cell factor-lymphoid enhancer factor (Tcf-Lef) family. b-catenin is assumed to transactivate mostly unknown target genes, which may stimulate cell proliferation (acts as an oncogene) or inhibit apoptosis. The b-catenin level in the cell is regulated by its association with the adenomatous polyposis coli ( APC) tumor suppressor protein, axin and GSK-3b. Phosphorylation of b-catenin by the APC-axin-GSK-3b complex leads to its degradation by the ubiquitin-proteasome system. Homology The b-catenin protein shares 70 % amino acid identity with both plakoglobin (intracellular junction in desmosomes)
Load more

Recommended publications
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Short Reports a Small Interstitial Deletion in the GPC3 Gene Causes Simpson-Golabi-Behmel Syndrome in a Dutch-Canadian Family
    J Med Genet 1999;36:57–58 57 Short reports J Med Genet: first published as 10.1136/jmg.36.1.57 on 1 January 1999. Downloaded from A small interstitial deletion in the GPC3 gene causes Simpson-Golabi-Behmel syndrome in a Dutch-Canadian family Jian Y Xuan, Rhiannon M Hughes-Benzie, Alex E MacKenzie Abstract prisingly, a family member with the apparent Deletions in the heparan sulphate proteo- stigmata of SGBS including Wilms tumour glycan encoding glypican 3 (GPC3) gene appeared not to inherit the SGBS chromosome have recently been documented in several in a previous linkage study.2 The definition of Simpson-Golabi-Behmel syndrome the GPC3 mutation has allowed the unequivo- (SGBS) families. However, no precisely cal documentation of a normal GPC3 status in defined SGBS mutation has been pub- this child. lished. We report here a 13 base pair DNA (extracted from peripheral blood and deletion which causes a frameshift and tumour tissues) was obtained from members of premature termination of the GPC3 gene the SGBS family and unrelated controls. PCR in the Dutch-Canadian SGBS family in amplification of exon 2 of the GPC3 gene was whom the trait was originally mapped. Our performed using the oligonucleotide primers analysis shows that a discrete GPC3 disa- EX2 A (5' gtttgccctgtttgccatg 3') and EX2 B (5' bling mutation is suYcient to cause SGBS. caaataatgatgccactaagc 3') producing a 329 bp Furthermore, our finding of a GPC3 nor- fragment in normal subjects.8 The reactions mal daughter of an SGBS carrier with contained 1 µg of DNA, 50 ng of each primer, skeletal abnormalities and Wilms tumour 0.2 mmol/l of each of the four dNTPs (dATP, raises the possibility of a trans eVect from dCTP, dGTP, and dTTP), and 1.2 U of Ta q the maternal carrier in SGBS kindreds.
    [Show full text]
  • Molecular Genetic Delineation of 2Q37.3 Deletion in Autism and Osteodystrophy: Report of a Case and of New Markers for Deletion Screening by PCR
    UC Irvine UC Irvine Previously Published Works Title Molecular genetic delineation of 2q37.3 deletion in autism and osteodystrophy: report of a case and of new markers for deletion screening by PCR. Permalink https://escholarship.org/uc/item/83f0x61r Journal Cytogenetics and cell genetics, 94(1-2) ISSN 0301-0171 Authors Smith, M Escamilla, JR Filipek, P et al. Publication Date 2001 DOI 10.1159/000048775 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Original Article Cytogenet Cell Genet 94:15–22 (2001) Molecular genetic delineation of 2q37.3 deletion in autism and osteodystrophy: report of a case and of new markers for deletion screening by PCR M. Smith, J.R. Escamilla, P. Filipek, M.E. Bocian, C. Modahl, P. Flodman, and M.A. Spence Department of Pediatrics, University of California, Irvine CA (USA) Abstract. We recently studied a patient who meets criteria us to determine the parental origin of the deletion in our for autistic disorder and has a 2q37 deletion. Molecular cyto- patient. DNA from 8–13 unrelated individuals was used to genetic studies were carried out using DNA isolated from 22 determine heterozygosity estimates for these markers. We re- different 2q37 mapped BACs to more precisely define the view four genes deleted in our patient – genes whose known extent of the chromosome deletion. We also analyzed 2q37 functions and sites of expression in the brain and/or bone make mapped polymorphic markers. In addition DNA sequences of them candidates for involvement in autism and/or the osteo- BACs in the deletion region were scanned to identify microsa- dystrophy observed in patients with 2q37.3 deletions.
    [Show full text]
  • Role of Glypican-6 and Ng2 As Metastasis Promoting Factors
    UNIVERSITA’ DEGLI STUDI DI PARMA Dottorato di ricerca in Fisiopatologia Sistemica Ciclo XX ROLE OF GLYPICAN-6 AND NG2 AS METASTASIS PROMOTING FACTORS Coordinatore: Chiar.mo Prof. Ezio Musso Tutor: Chiar.mo Prof.Roberto Perris Dottoranda: Katia Lacrima Anni Accademici 2005-2008 To Indy L'anima libera e' rara, ma quando la vedi la riconosci: soprattutto perché provi un senso di benessere, quando gli sei vicino. (Charles Bukowski ) Index Summary ……………………………………………………..................................................... 3 1. Introduction …………………………………………………………………………………… 5 1.1. Proteoglycans (PGs)………………………………………………………………......... 6 1.2. Membrane associated proteoglycans……………………………………………..…... 8 1.3. Syndecans……………………………………………………………………………..…. 9 1.4. Glypicans……………………………………………………………………………...….. 11 1.5. GPC6……………………………………………………………………………….…….. 13 1.6. NG2/CSPG4……………………………………………………………………….…….. 14 1.7. Metastasis………………………………………………………………………….….…. 16 1.8. Soft Tissue Sarcoma (STS)…………………………………………………………….. 17 1.9. Membrane PGs and tumour……………………………………………………………. 18 1.10. Membrane PGs in sarcoma…………………………………………………………….. 24 2. Material and Methods ……………………………………………………………………… 26 2.1. Cell Culture……………………………………………………………………….………. 27 2.2. RNA extraction……………………………………………………………………….…. 28 2.3. Real Time quantitative PCR……………………………………………….………….. 28 2.4. DNA extraction…………………………………………….……………………………. 30 2.5. Plasmids and Transfection………………………………………….………………… 30 2.6. Western Blotting………………………………………………………………………... 31 2.7. Preparation of ECM substrates………………………………………….……………
    [Show full text]
  • Senescence Induced by RECQL4 Dysfunction Contributes to Rothmund–Thomson Syndrome Features in Mice
    Citation: Cell Death and Disease (2014) 5, e1226; doi:10.1038/cddis.2014.168 OPEN & 2014 Macmillan Publishers Limited All rights reserved 2041-4889/14 www.nature.com/cddis Senescence induced by RECQL4 dysfunction contributes to Rothmund–Thomson syndrome features in mice HLu1, EF Fang1, P Sykora1, T Kulikowicz1, Y Zhang2, KG Becker2, DL Croteau1 and VA Bohr*,1 Cellular senescence refers to irreversible growth arrest of primary eukaryotic cells, a process thought to contribute to aging- related degeneration and disease. Deficiency of RecQ helicase RECQL4 leads to Rothmund–Thomson syndrome (RTS), and we have investigated whether senescence is involved using cellular approaches and a mouse model. We first systematically investigated whether depletion of RECQL4 and the other four human RecQ helicases, BLM, WRN, RECQL1 and RECQL5, impacts the proliferative potential of human primary fibroblasts. BLM-, WRN- and RECQL4-depleted cells display increased staining of senescence-associated b-galactosidase (SA-b-gal), higher expression of p16INK4a or/and p21WAF1 and accumulated persistent DNA damage foci. These features were less frequent in RECQL1- and RECQL5-depleted cells. We have mapped the region in RECQL4 that prevents cellular senescence to its N-terminal region and helicase domain. We further investigated senescence features in an RTS mouse model, Recql4-deficient mice (Recql4HD). Tail fibroblasts from Recql4HD showed increased SA-b-gal staining and increased DNA damage foci. We also identified sparser tail hair and fewer blood cells in Recql4HD mice accompanied with increased senescence in tail hair follicles and in bone marrow cells. In conclusion, dysfunction of RECQL4 increases DNA damage and triggers premature senescence in both human and mouse cells, which may contribute to symptoms in RTS patients.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Essential Genes and Their Role in Autism Spectrum Disorder
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2017 Essential Genes And Their Role In Autism Spectrum Disorder Xiao Ji University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Bioinformatics Commons, and the Genetics Commons Recommended Citation Ji, Xiao, "Essential Genes And Their Role In Autism Spectrum Disorder" (2017). Publicly Accessible Penn Dissertations. 2369. https://repository.upenn.edu/edissertations/2369 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2369 For more information, please contact [email protected]. Essential Genes And Their Role In Autism Spectrum Disorder Abstract Essential genes (EGs) play central roles in fundamental cellular processes and are required for the survival of an organism. EGs are enriched for human disease genes and are under strong purifying selection. This intolerance to deleterious mutations, commonly observed haploinsufficiency and the importance of EGs in pre- and postnatal development suggests a possible cumulative effect of deleterious variants in EGs on complex neurodevelopmental disorders. Autism spectrum disorder (ASD) is a heterogeneous, highly heritable neurodevelopmental syndrome characterized by impaired social interaction, communication and repetitive behavior. More and more genetic evidence points to a polygenic model of ASD and it is estimated that hundreds of genes contribute to ASD. The central question addressed in this dissertation is whether genes with a strong effect on survival and fitness (i.e. EGs) play a specific oler in ASD risk. I compiled a comprehensive catalog of 3,915 mammalian EGs by combining human orthologs of lethal genes in knockout mice and genes responsible for cell-based essentiality.
    [Show full text]
  • Original Article Immunization with Glypican-3 Nanovaccine Containing
    Am J Transl Res 2018;10(6):1736-1749 www.ajtr.org /ISSN:1943-8141/AJTR0072039 Original Article Immunization with glypican-3 nanovaccine containing TLR7 agonist prevents the development of carcinogen-induced precancerous hepatic lesions to cancer in a murine model Kun Chen1, Zhiyuan Wu1, Mengya Zang1, Ce Wang2, Yanmei Wang1, Dongmei Wang1, Yifan Ma2, Chunfeng Qu1,3 1Department of Immunology, National Cancer Center/National Clinical Research Center for Cancer/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100021, China; 2Guangdong Key Laboratory of Nanomedicine, Key Lab of Health Informatics of Chinese Academy of Sciences, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen 518055, China; 3State Key Laboratory of Molecular Oncology, National Cancer Center/National Clinical Research Center for Cancer/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100021, China Received January 3, 2018; Accepted June 1, 2018; Epub June 15, 2018; Published June 30, 2018 Abstract: Background: Glypican-3 (GPC3) is one of the key tissue markers that could discriminate malignant pre- cancerous lesions from benign hepatic lesions in cirrhotic patients. We aimed to develop a GPC3 cancer vaccine to induce specific T cells to intervene in hepatocellular carcinoma (HCC) development. Methods: Synthesizing manno- sylated liposomes (LPMan) as vaccine delivery system, incorporating one Toll-like receptor (TLR)-7/8 agonist CL097 as adjuvant, we prepared a GPC3 nanovaccine, LPMan-GPC3/CL097. We injected 25 mg/kg diethylnitrosamine intraperitoneally to induce autochthonous HCC in HBV-transgenic mice, which persistently express hepatitis B sur- face antigen in hepatocytes. Starting from week 8 after diethylnitrosamine injection when malignant hepatocytes generated, we immunized the mice subcutaneously every 2 weeks 4 times with LPMan-GPC3/CL097 containing 5 µg of GPC3 plus 5 µg of CL097.
    [Show full text]
  • Prognostic Value of Glypican Family Genes in Early-Stage Pancreatic Ductal Adenocarcinoma After Pancreaticoduodenectomy and Possible Mechanisms
    Prognostic value of Glypican family genes in early-stage pancreatic ductal adenocarcinoma after pancreaticoduodenectomy and possible mechanisms Jun-qi Liu Guangxi Medical University First Aliated Hospital Xi-wen Liao Guangxi Medical University First Aliated Hospital Xiang-kun Wang Guangxi Medical University First Aliated Hospital Cheng-kun Yang Guangxi Medical University First Aliated Hospital Xin Zhou Guangxi Medical University First Aliated Hospital Zheng-qian Liu Guangxi Medical University First Aliated Hospital Quan-fa Han Guangxi Medical University First Aliated Hospital Tian-hao Fu Guangxi Medical University First Aliated Hospital Guang-zhi Zhu Guangxi Medical University First Aliated Hospital Chuang-ye Han Guangxi Medical University First Aliated Hospital Hao Su Guangxi Medical University First Aliated Hospital Jian-lu Huang Guangxi Medical University First Aliated Hospital Guo-tian Ruan Guangxi Medical University First Aliated Hospital Ling Yan Guangxi Medical University First Aliated Hospital Xin-ping Ye Guangxi Medical University First Aliated Hospital Tao Peng ( [email protected] ) the rst aliated hospital of guangxi medical university Research article Keywords: GPC family genes, pancreatic ductal adenocarcinoma, prognostic indicator, mechanism Posted Date: December 9th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-48421/v3 Page 1/32 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published on December 10th, 2020. See the published version at https://doi.org/10.1186/s12876-020-01560-0. Page 2/32 Abstract Background: This study explored the prognostic signicance of Glypican (GPC) family genes in patients with pancreatic ductal adenocarcinoma (PDAC) after pancreaticoduodenectomy using data from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO).
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Whole Proteome Analysis of Human Tankyrase Knockout Cells Reveals Targets of Tankyrase- Mediated Degradation
    ARTICLE DOI: 10.1038/s41467-017-02363-w OPEN Whole proteome analysis of human tankyrase knockout cells reveals targets of tankyrase- mediated degradation Amit Bhardwaj1, Yanling Yang2, Beatrix Ueberheide2 & Susan Smith1 Tankyrase 1 and 2 are poly(ADP-ribose) polymerases that function in pathways critical to cancer cell growth. Tankyrase-mediated PARylation marks protein targets for proteasomal 1234567890 degradation. Here, we generate human knockout cell lines to examine cell function and interrogate the proteome. We show that either tankyrase 1 or 2 is sufficient to maintain telomere length, but both are required to resolve telomere cohesion and maintain mitotic spindle integrity. Quantitative analysis of the proteome of tankyrase double knockout cells using isobaric tandem mass tags reveals targets of degradation, including antagonists of the Wnt/β-catenin signaling pathway (NKD1, NKD2, and HectD1) and three (Notch 1, 2, and 3) of the four Notch receptors. We show that tankyrases are required for Notch2 to exit the plasma membrane and enter the nucleus to activate transcription. Considering that Notch signaling is commonly activated in cancer, tankyrase inhibitors may have therapeutic potential in targeting this pathway. 1 Kimmel Center for Biology and Medicine at the Skirball Institute, Department of Pathology, New York University School of Medicine, New York, NY 10016, USA. 2 Proteomics Laboratory, Department of Biochemistry and Molecular Pharmacology, New York University School of Medicine, New York, NY 10016, USA. Correspondence and requests for materials should be addressed to S.S. (email: [email protected]) NATURE COMMUNICATIONS | 8: 2214 | DOI: 10.1038/s41467-017-02363-w | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-017-02363-w ankyrases function in cellular pathways that are critical to function in human cells will provide insights into the clinical cancer cell growth including telomere cohesion and length utility of tankyrase inhibitors.
    [Show full text]
  • Metastatic Adrenocortical Carcinoma Displays Higher Mutation Rate and Tumor Heterogeneity Than Primary Tumors
    ARTICLE DOI: 10.1038/s41467-018-06366-z OPEN Metastatic adrenocortical carcinoma displays higher mutation rate and tumor heterogeneity than primary tumors Sudheer Kumar Gara1, Justin Lack2, Lisa Zhang1, Emerson Harris1, Margaret Cam2 & Electron Kebebew1,3 Adrenocortical cancer (ACC) is a rare cancer with poor prognosis and high mortality due to metastatic disease. All reported genetic alterations have been in primary ACC, and it is 1234567890():,; unknown if there is molecular heterogeneity in ACC. Here, we report the genetic changes associated with metastatic ACC compared to primary ACCs and tumor heterogeneity. We performed whole-exome sequencing of 33 metastatic tumors. The overall mutation rate (per megabase) in metastatic tumors was 2.8-fold higher than primary ACC tumor samples. We found tumor heterogeneity among different metastatic sites in ACC and discovered recurrent mutations in several novel genes. We observed 37–57% overlap in genes that are mutated among different metastatic sites within the same patient. We also identified new therapeutic targets in recurrent and metastatic ACC not previously described in primary ACCs. 1 Endocrine Oncology Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA. 2 Center for Cancer Research, Collaborative Bioinformatics Resource, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA. 3 Department of Surgery and Stanford Cancer Institute, Stanford University, Stanford, CA 94305, USA. Correspondence and requests for materials should be addressed to E.K. (email: [email protected]) NATURE COMMUNICATIONS | (2018) 9:4172 | DOI: 10.1038/s41467-018-06366-z | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-018-06366-z drenocortical carcinoma (ACC) is a rare malignancy with types including primary ACC from the TCGA to understand our A0.7–2 cases per million per year1,2.
    [Show full text]