DOCSLIB.ORG

Interferon Regulatory Factors (IRF) 1 and 8 in the Context of Pathogen Challenge by Chip on Chip and Genome Wide Transcription Profiling

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Interferon Regulatory Factors (IRF) 1 and 8 in the Context of Pathogen Challenge by Chip on Chip and Genome Wide Transcription Profiling The identification of transcriptional targets of Interferon Regulatory Factors (IRF) 1 and 8 in the context of pathogen challenge by ChIP on Chip and genome wide transcription profiling Oxana Kapoustina August 2009 A thesis submitted for the fulfillment of the Master of Science degree, Dept. of Biochemistry Acknowledgments: I sincerely thank Dr. Philippe Gros for giving me the opportunity to complete my degree in his laboratory and for providing support and advice. Thank you Gundula and Joanne for showing me the ropes (in the lab and outside) and your friendship. I would like to extend my thanks to Susan and Norm for keeping our lab running smoothly, Michel for always having advice and the right solutions, Anne for showing me how to work in TC, the rest of the ladies in the Gros lab, Charles and JF. Abstract: Interferon regulatory factors (IRFs) is a family of transcriptional regulators that are essential for cell differentiation and growth, oncogenesis and the regulation of immunity. IRF1 and IRF8 play a crucial role in immunity by regulating the differentiation of the cells of myeloid lineage, particularly the development of immune cells including macrophages, NK and dendritic cells. Both transcription factors are essential for the resistance to viral and bacterial infections. We optimized the chromatin immunoprecipitation (ChIP) technique to be used with IRF8 and IRF1 antibodies in a J774 line stimulated with IFNγ/CpG. Using ChIP coupled to an exon promoter 244K microarray (ChIP on Chip) we identified 201 and 303 binding sites of high confidence for IRF1 and IRF8 respectively. Previously known IRF1 and IRF8 transcription targets (OAS1b for IRF1 and IFNb for IRF8) as well as novel transcriptional control loci were identified. One of the major gene ontology (GO) functional categories in the two gene lists was “immune response”. The overlap of IRF1 and IRF8 transcription target genes from ChIP on Chip revealed an overlap of 19 genes most of which belonged to the “immune regulation” GO pathway and included targets of high confidence: Gbp6, Mx2, Tnfsf13b, H2-T24, and Ifit1. A parallel microarray transcription profiling study on mouse bone marrow macrophages (BMDMs) from an F2 generation of Balb/C IRF8-wildtype and BXH2 IRF8-mutant cross was performed. The BMDMs possessing the wildtype and the mutant IRF8 alleles were infected with Legionella pneumophila or stimulated with IFNγ/CpG to identify genes regulated by IRF8 in the context of infection. 1171 and 852 differentially regulated genes were differentially regulated in the infection and stimulation experiments respectively. Genes that displayed interaction between IRF8 allele and the infection conditions were isolated to yield high confidence gene lists of 31 and 129 genes for the Legionella and IFNγ/CpG experiments respectively. The overlap of the two gene lists revealed 7 genes in common, two of which belong to the JAK-STAT signalling pathway (IL10 and Ccd1). The comparison of the IFNγ/CpG microarray experiment gene list with the gene list from IRF8 ChIP on Chip revealed 15 genes in common. 2 of the 15 genes (Gbp6 and H2-T24) were also identified as potential targets common to IRF1 and IRF8 by ChIP on Chip. Gbp2 and H2-T24 represent interesting target genes for study and validation as high confidence targets of IRF8 and possibly, IRF1. Taken together, our data provides a set of novel IRF8 and IRF1 targets that may be studied to further our understanding of the regulatory networks controlled by IRF1 and IRF8 in the context of immunity. Résumé: Les facteurs régulateurs interférons (IRFs) sont une famille de régulateurs transcriptionnels essentiels à la différenciation et la croissance cellulaire, à l’oncogénèse et au bon maintien du système immunitaire. IRF1 et IRF8 jouent un role clé dans l’immunité de l’organisme par la régulation de la différenciation des lignées cellulaires myéloïdes, nottament le développement de cellules immunitaires comme les macrophages, les cellules tueuses naturelles (NK) et les cellules dendritiques. Ces deux facteurs de transcription sont indispensables pour la résistance aux infections virales et bactériennes. Nous avons optimisé une technique d’immunoprécipitation de la chromatine (ChIP) afin d’y utiliser des anticorps ciblant IRF1 et IRF8, et ce à partir d’une lignée cellulaire J774 suivant un stimulation par interféron gamma et par oligonucléotides CpG (IFNγ/CpG). En combinant cette technique ChIP à un microarray 244K comprenant exons et promoteurs (ChIP on Chip), nous avons identifiés respectivement 201 et 303 sites d’ancrages pour chacun de IRF1 et IRF8. Certaines cibles transcriptionnelles déjà connues pour IRF1 (OAS1b) et IRF8 (IFNb) ainsi que de nouveaux loci de control transcriptionel ont été identifiés. Parmi les catégories par fonction relevées par Ontologie de gène (GO), une des catégories majeures des deux listes de gènes générées fut pour les gènes reliés à la ‘‘réponse immunitaire’’. La comparaison entre les gènes cibles de transcription pour IRF1 et IRF8 par ‘‘ChIP on Chip’’ a révélé 19 gènes représentés dans les deux cas. La majeure partie de ces gènes sont reliés à la ‘‘réponse immunitaire’’ par GO et ils incluent les cibles suivantes avec détection très significative: Gbp6, Mx2, Tnfsf13b, H2-T24, et Ifit1. En parallèle, des macrophages dérivés de la moëlle osseuse de souris (BMDMs) furent utilisés pour l’étude du profile transcriptionel par microarray d’une génération F2 générée avec des souris Balb/C (IRF8-wildtype) et des souris BXH2 (IRF8-mutant). Ces BMDMs comprenant les allèles normale et mutante d’IRF8 ont été infectés avec Legionella pneumophila ou stimulés avec IFNγ/CpG pour identifer les gènes dépendant d’IRF8 dans le cadre d’une infection. Pour chaque traitement, l’expression de respectivement 1171 et 852 gènes furent observés comme étant modifiés selon la situation relative à IRF8 dans les expériences d’infections et de stimulations. Selon leur intéraction avec les allèles d’IRF8 et pour chaque traitement des BMDBs, une liste de gènes fut établie avec haut niveau de confiance comprenant 31 et 129 gènes pour chacun des types de stimulation par Legionelle et par IFNγ/CpG, respectivement. Ces deux listes de gènes comprennent 7 gènes en commun, deux appartenant à la voie de signalement JAK-STAT (IL10 et Ccd1). La comparaison en les listes de gènes générées dans les expériences de stimulation IFNγ/CpG par microarray ainsi que celles générées par les expériences ‘‘ChIP on Chip’’ avec IRF8 ont révélés 15 gènes en commun. Deux de ces 15 gènes (Gbp6 et H2-T24) ont aussi été identifiés comme cibles potentielles pour IRF1 en plus de IRF8 par ‘‘ChIP on Chip’’. Gpb2 et H2-T24 représentent des gènes cibles intéressants pour d’autres séries d’études et de validations comme étant des cibles à haut niveau de confiance pour IRF8 et possiblement, IRF1. En somme, ces résultats fournissent un nouveau répertoire de cibles pour IRF1 et IRF8 qui pourront être étudiées pour approfondir nos connaissances sur les réseaux de régulation controlés par IRF1 et IRF8 dans le maintien de l’immunité de l’organisme. Table of Contents 1. Introduction 4 1.1 Rationale .................................................................................................................. 4 1.2 Specific aims of the project ...................................................................................... 5 1.3 Interferons ................................................................................................................ 5 1.3.1 Interferons as a family ...................................................................................... 5 1.3.2 Interferon receptors and interferon signalling .................................................. 6 1.3.3 IFNγ-IL12 signalling axis ................................................................................ 8 1.2 Interferon Regulatory Factors .................................................................................. 9 1.2.1. IRFs as a family of structurally related transcription factors ......................... 9 1.2.1. IRF8 (ICSBP) ................................................................................................ 10 1.2.2. IRF8 induction ............................................................................................... 11 1.2.3. Transcription targets of IRF8 ........................................................................ 11 1.2.4. IRF8 in immune response ............................................................................. 12 1.2.5. IRF8 in myelopoiesis .................................................................................... 12 1.2.6. IRF8 in cancer .............................................................................................. 13 1.3. IRF1 ...................................................................................................................... 14 1.3.1 IRF1 expression and induction .................................................................. 14 1.3.2. IRF1 in immunity .......................................................................................... 16 1.3.3. IRF1 in oncogenesis ...................................................................................... 17 2. Results 20 2.1 Materials and methods ........................................................................................... 20 2.2 Overview ........................................................................................................... 31 2.3. Optimization of the ChIP technique .....................................................................
Load more

Recommended publications
  • Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids
    Supplementary Materials: Evaluation of cytotoxicity and α-glucosidase inhibitory activity of amide and polyamino-derivatives of lupane triterpenoids Oxana B. Kazakova1*, Gul'nara V. Giniyatullina1, Akhat G. Mustafin1, Denis A. Babkov2, Elena V. Sokolova2, Alexander A. Spasov2* 1Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences, 71, pr. Oktyabrya, 450054 Ufa, Russian Federation 2Scientific Center for Innovative Drugs, Volgograd State Medical University, Novorossiyskaya st. 39, Volgograd 400087, Russian Federation Correspondence Prof. Dr. Oxana B. Kazakova Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences 71 Prospeсt Oktyabrya Ufa, 450054 Russian Federation E-mail: [email protected] Prof. Dr. Alexander A. Spasov Scientific Center for Innovative Drugs of the Volgograd State Medical University 39 Novorossiyskaya st. Volgograd, 400087 Russian Federation E-mail: [email protected] Figure S1. 1H and 13C of compound 2. H NH N H O H O H 2 2 Figure S2. 1H and 13C of compound 4. NH2 O H O H CH3 O O H H3C O H 4 3 Figure S3. Anticancer screening data of compound 2 at single dose assay 4 Figure S4. Anticancer screening data of compound 7 at single dose assay 5 Figure S5. Anticancer screening data of compound 8 at single dose assay 6 Figure S6. Anticancer screening data of compound 9 at single dose assay 7 Figure S7. Anticancer screening data of compound 12 at single dose assay 8 Figure S8. Anticancer screening data of compound 13 at single dose assay 9 Figure S9. Anticancer screening data of compound 14 at single dose assay 10 Figure S10.
    [Show full text]
  • A Ph-Eqtl Interaction at the RIT2-SYT4 Parkinson's Disease Risk
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423140; this version posted June 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. A pH-eQTL interaction at the RIT2-SYT4 Parkinson’s disease risk locus in the substantia nigra Authors and affiliations: Sejal Patel1*, Derek Howard1, Leon French1,2,3,4* 1. Krembil Centre for Neuroinformatics, Centre for Addiction and Mental Health, Toronto, ON, Canada 2. Campbell Family Mental Health Research Institute, Centre for Addiction and Mental Health, Toronto, Canada 3. Department of Psychiatry, University of Toronto, Toronto 4. Institute for Medical Science, University of Toronto, Toronto, Canada Abstract Parkinson's disease (PD) causes severe motor and cognitive disabilities that result from the progressive loss of dopamine neurons in the substantia nigra. The rs12456492 variant in the RIT2 gene has been repeatedly associated with increased risk for Parkinson's disease. From a transcriptomic perspective, a meta-analysis found that RIT2 gene expression is correlated with pH in the human brain. To assess these pH associations in relation to PD risk, we examined the two datasets that assayed rs12456492, gene expression, and pH in the postmortem human brain. Using the BrainEAC dataset, we replicate the positive correlation between RIT2 gene expression and pH in the human brain (n=100). Furthermore, we found that the relationship between expression and pH is influenced by rs12456492.
    [Show full text]
  • Human Stem Cells from Single Blastomeres Reveal Pathways of Embryonic Or Trophoblast Fate Specification Tamara Zdravkovic1,2,3,4,5,‡, Kristopher L
    © 2015. Published by The Company of Biologists Ltd | Development (2015) 142, 4010-4025 doi:10.1242/dev.122846 STEM CELLS AND REGENERATION RESEARCH ARTICLE Human stem cells from single blastomeres reveal pathways of embryonic or trophoblast fate specification Tamara Zdravkovic1,2,3,4,5,‡, Kristopher L. Nazor6,‡, Nicholas Larocque1,2,3,4,5, Matthew Gormley1,2,3,4,5, Matthew Donne1,2,3,7, Nathan Hunkapillar1,2,3,4,5, Gnanaratnam Giritharan8, Harold S. Bernstein4,9, Grace Wei4,10, Matthias Hebrok10, Xianmin Zeng11, Olga Genbacev1,2,3,4,5, Aras Mattis4,12, Michael T. McMaster4,5,13, Ana Krtolica8,*, Diana Valbuena14, Carlos Simón14, Louise C. Laurent6,15, Jeanne F. Loring6 and Susan J. Fisher1,2,3,4,5,7,§ ABSTRACT INTRODUCTION For many reasons, relatively little is known about human Mechanisms of initial cell fate decisions differ among species. To gain preimplantation development. The small number of cells makes insights into lineage allocation in humans, we derived ten human embryos of any species difficult to study. In humans, the technical embryonic stem cell lines (designated UCSFB1-10) from single difficulties are compounded by other challenges. Genetic variation blastomeres of four 8-cell embryos and one 12-cell embryo from a among individuals could contribute to developmental differences, a single couple. Compared with numerous conventional lines from well-appreciated phenomenon in the mouse (Dackor et al., 2009), blastocysts, they had unique gene expression and DNA methylation which is difficult to assess in humans owing to the limited patterns that were, in part, indicative of trophoblast competence. At a availability of embryos that are donated for research.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 1 Single-Cell Mrna Profiling Reveals Heterogeneous Combinatorial Expression of Hoxd Genes During Limb Development Short Title
    bioRxiv preprint doi: https://doi.org/10.1101/327619; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Single-cell mRNA profiling reveals heterogeneous combinatorial expression of Hoxd genes during limb development Short title: Single-cell Hox combinations in developing limbs Authors : P. J. Fabre1,4,*, M. Leleu1, B. Mascrez2, Q. Lo Giudice4, J. Cobb3 and D. Duboule1,2,* Affiliations: 1School of Life Sciences, Ecole Polytechnique Fédérale, Lausanne, 1015 Lausanne, Switzerland. 2Department of Genetics and Evolution, University of Geneva, 1211 Geneva 4, Switzerland. 3Department of Biological Sciences, University of Calgary, Calgary, Canada. 4Department of Basic Neurosciences, University of Geneva, 1205 Geneva, Switzerland. KEYWORDS: Hox genes, digits, limb, development, enhancers, single-cell, transcriptome, differentiation, gene expression. *Corresponding authors: Pierre Fabre ([email protected]) and Denis Duboule ([email protected]) HIGHLIGHTS • Collinear expression of Hox genes is only weaved at the tissue scale • Enhancer-sharing to specific target genes is reduced at the single-cell level • Hoxd gene combinatorial expression is linked to distinct transcriptional signatures • In presumptive digits, Hoxd combinations follow a pseudotime trajectory 1 bioRxiv preprint doi: https://doi.org/10.1101/327619; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Zbtb16 Regulates Social Cognitive Behaviors and Neocortical
    Usui et al. Translational Psychiatry (2021) 11:242 https://doi.org/10.1038/s41398-021-01358-y Translational Psychiatry ARTICLE Open Access Zbtb16 regulates social cognitive behaviors and neocortical development Noriyoshi Usui 1,2,3,4, Stefano Berto5,AmiKonishi1, Makoto Kondo1,4, Genevieve Konopka5,HideoMatsuzaki 2,6,7 and Shoichi Shimada1,2,4 Abstract Zinc finger and BTB domain containing 16 (ZBTB16) play the roles in the neural progenitor cell proliferation and neuronal differentiation during development, however, how the function of ZBTB16 is involved in brain function and behaviors unknown. Here we show the deletion of Zbtb16 in mice leads to social impairment, repetitive behaviors, risk- taking behaviors, and cognitive impairment. To elucidate the mechanism underlying the behavioral phenotypes, we conducted histological analyses and observed impairments in thinning of neocortical layer 6 (L6) and a reduction of TBR1+ neurons in Zbtb16 KO mice. Furthermore, we found increased dendritic spines and microglia, as well as developmental defects in oligodendrocytes and neocortical myelination in the prefrontal cortex (PFC) of Zbtb16 KO mice. Using genomics approaches, we identified the Zbtb16 transcriptome that includes genes involved in neocortical maturation such as neurogenesis and myelination, and both autism spectrum disorder (ASD) and schizophrenia (SCZ) pathobiology. Co-expression networks further identified Zbtb16-correlated modules that are unique to ASD or SCZ, respectively. Our study provides insight into the novel roles of ZBTB16 in behaviors and neocortical development related to the disorders. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Introduction identified as a causative mutation for skeletal defects, ZBTB16 (PLZF) encodes a transcription factor, which genital hypoplasia, and mental retardation (SGYMR)6,7.
    [Show full text]
  • An Ontogenetic Switch Drives the Positive and Negative Selection of B Cells
    An ontogenetic switch drives the positive and negative selection of B cells Xijin Xua, Mukta Deobagkar-Lelea, Katherine R. Bulla, Tanya L. Crockforda, Adam J. Meadb, Adam P. Cribbsc, David Simsc, Consuelo Anzilottia, and Richard J. Cornalla,1 aMedical Research Council Human Immunology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, OX3 9DS Oxford, United Kingdom; bMedical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, OX3 9DS Oxford, United Kingdom; and cMedical Research Council, Weatherall Institute of Molecular Medicine, Centre for Computational Biology, Weatherall Institute of Molecular Medicine, University of Oxford, OX3 9DS Oxford, United Kingdom Edited by Michael Reth, University of Freiburg, Freiburg, Germany, and approved January 6, 2020 (received for review September 3, 2019) + Developing B cells can be positively or negatively selected by self- BM HSCs increased CD5 B-1a B cell development (15), while antigens, but the mechanisms that determine these outcomes are expression of let-7b in FL pro-B cells blocked the development of incompletely understood. Here, we show that a B cell intrinsic B-1 B cells (17). These findings support the notion of hard-wired switch between positive and negative selection during ontogeny differences during ontogeny, but possibly downstream of the HSC is determined by a change from Lin28b to let-7 gene expression. commitment stage. Ectopic expression of a Lin28b transgene in murine B cells restored Several lines of evidence also suggest that B-1 B cells can un- the positive selection of autoreactive B-1 B cells by self-antigen in dergo positive selection, which is linked to their B cell receptor adult bone marrow.
    [Show full text]
  • The CXCR4 Antagonist AMD3100 Impairs Survival of Human AML Cells and Induces Their Differentiation
    Leukemia (2008) 22, 2151–2158 & 2008 Macmillan Publishers Limited All rights reserved 0887-6924/08 $32.00 www.nature.com/leu ORIGINAL ARTICLE The CXCR4 antagonist AMD3100 impairs survival of human AML cells and induces their differentiation S Tavor1, M Eisenbach1, J Jacob-Hirsch2, T Golan1, I Petit1, K BenZion1, S Kay1, S Baron1, N Amariglio2, V Deutsch1, E Naparstek1 and G Rechavi2 1Institute of Hematology and Bone Marrow Transplantation, Sourasky Medical Center, Tel Aviv, Israel and 2Cancer Research Center, Sheba Medical Center, Tel-Hashomer, and Sackler School of Medicine, Tel Aviv University, Tel Aviv, Israel The chemokine stromal cell-derived factor-1 (SDF-1) and its NOD/SCID mice, homing and subsequent engraftment of human receptor, CXCR4, participate in the retention of acute myelo- normal or AML stem cells are dependent on the expression of cell blastic leukemia (AML) cells within the bone marrow micro- 9–12 environment and their release into the circulation. AML cells surface CXCR4 and SDF-1 produced within the murine. In also constitutively express SDF-1-dependent elastase, which addition to controlling cell motility, SDF-1 regulates cell regulates their migration and proliferation. To study the proliferation, induces cell cycle progression and acts as a survival molecular events and genes regulated by the SDF-1/CXCR4 factor for normal human stem cells and AML cells.13–16 axis and elastase in AML cells, we examined gene expression CXCR4 blockage in AML cells, using the polypeptide profiles of the AML cell line, U937, under treatment with a RCP168, enhanced chemotherapy-induced apoptosis in vitro.17 neutralizing anti-CXCR4 antibody or elastase inhibitor, as compared with non-treated cells, using DNA microarray Most importantly, high CXCR4 expression level in leukemic technology.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • 140503 IPF Signatures Supplement Withfigs Thorax
    Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network.
    [Show full text]