Graphene Oxide Can Induce in Vitro and in Vivo Mutagenesis
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
CEP41 As an ASD Gene Ashok Patowary 1,Soyeonwon2,Shinjioh2,Ryanrnesbitt1, Marilyn Archer1, Debbie Nickerson3, Wendy H
Patowary et al. Translational Psychiatry (2019) 9:4 https://doi.org/10.1038/s41398-018-0343-z Translational Psychiatry ARTICLE Open Access Family-based exome sequencing and case- control analysis implicate CEP41 as an ASD gene Ashok Patowary 1,SoYeonWon2,ShinJiOh2,RyanRNesbitt1, Marilyn Archer1, Debbie Nickerson3, Wendy H. Raskind1,4, Raphael Bernier1,JiEunLee2,5 and Zoran Brkanac1 Abstract Autism Spectrum Disorder (ASD) is a complex neurodevelopmental disorder with a strong genetic component. Although next-generation sequencing (NGS) technologies have been successfully applied to gene identification in de novo ASD, the genetic architecture of familial ASD remains largely unexplored. Our approach, which leverages the high specificity and sensitivity of NGS technology, has focused on rare variants in familial autism. We used NGS exome sequencing in 26 families with distantly related affected individuals to identify genes with private gene disrupting and missense variants of interest (VOI). We found that the genes carrying VOIs were enriched for biological processes related to cell projection organization and neuron development, which is consistent with the neurodevelopmental hypothesis of ASD. For a subset of genes carrying VOIs, we then used targeted NGS sequencing and gene-based variant burden case-control analysis to test for association with ASD. Missense variants in one gene, CEP41, associated significantly with ASD (p = 6.185e−05). Homozygous gene-disrupting variants in CEP41 were initially found to be responsible for recessive Joubert syndrome. Using a zebrafish model, we evaluated the mechanism by which the 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; CEP41 variants might contribute to ASD. We found that CEP41 missense variants affect development of the axonal tract, cranial neural crest migration and social behavior phenotype. -
Cancer Cells Exploit Eif4e2-Directed Translation to Enhance Their Proliferation, Migration and Invasion
Cancer cells exploit eIF4E2-directed translation to enhance their proliferation, migration and invasion by Joseph F. Varga A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Master of Science in Molecular and Cellular Biology Guelph, Ontario, Canada © Joseph F. Varga, August, 2016 ABSTRACT Cancer cells exploit eIF4E2-directed translation to enhance their proliferation, migration and invasion Joseph F. Varga Advisor: University of Guelph, 2016 Professor James Uniacke Despite the diversity found in the genetic makeup of cancer, many cancers share the same tumor microenvironment. Hypoxia, an aspect of the tumor microenvironment, causes the suppression of the primary translational machinery. Hypoxic cells switch from using the eukaryotic initiation factor 4E (eIF4E) to using a homologue of eIF4E (eIF4E2), in order to initiate the translation of select mRNAs. This thesis investigates the role of eIF4E2-directed translation in a panel of cancer cell lines during autonomous proliferation, migration and invasion. In this thesis, we show that silencing eIF4E2 abrogates the autonomous proliferation of colon carcinoma. Silencing eIF4E2 in glioblastoma cells resulted in decreased migration and invasion. Furthermore, we link eIF4E2-directed translation of cadherin 22 with the hypoxic migration of glioblastoma. These findings answer questions regarding the biology of cancer and expand the current knowledge of genes exploited during tumor progression. This data also highlights eIF4E2 as a potential therapeutic target. Acknowledgements I would like to express my sincere gratitude to Dr. James Uniacke for taking me on as a graduate student in his laboratory and providing me with the opportunity to contribute to scientific research. -
Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids
Supplementary Materials: Evaluation of cytotoxicity and α-glucosidase inhibitory activity of amide and polyamino-derivatives of lupane triterpenoids Oxana B. Kazakova1*, Gul'nara V. Giniyatullina1, Akhat G. Mustafin1, Denis A. Babkov2, Elena V. Sokolova2, Alexander A. Spasov2* 1Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences, 71, pr. Oktyabrya, 450054 Ufa, Russian Federation 2Scientific Center for Innovative Drugs, Volgograd State Medical University, Novorossiyskaya st. 39, Volgograd 400087, Russian Federation Correspondence Prof. Dr. Oxana B. Kazakova Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences 71 Prospeсt Oktyabrya Ufa, 450054 Russian Federation E-mail: [email protected] Prof. Dr. Alexander A. Spasov Scientific Center for Innovative Drugs of the Volgograd State Medical University 39 Novorossiyskaya st. Volgograd, 400087 Russian Federation E-mail: [email protected] Figure S1. 1H and 13C of compound 2. H NH N H O H O H 2 2 Figure S2. 1H and 13C of compound 4. NH2 O H O H CH3 O O H H3C O H 4 3 Figure S3. Anticancer screening data of compound 2 at single dose assay 4 Figure S4. Anticancer screening data of compound 7 at single dose assay 5 Figure S5. Anticancer screening data of compound 8 at single dose assay 6 Figure S6. Anticancer screening data of compound 9 at single dose assay 7 Figure S7. Anticancer screening data of compound 12 at single dose assay 8 Figure S8. Anticancer screening data of compound 13 at single dose assay 9 Figure S9. Anticancer screening data of compound 14 at single dose assay 10 Figure S10. -
Translational Control in Cancer Etiology
Downloaded from http://cshperspectives.cshlp.org/ on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press Translational Control in Cancer Etiology Davide Ruggero Helen Diller Cancer Center, School of Medicine, University of California, San Francisco, California 94158 Correspondence: [email protected] The link between perturbations in translational control and cancer etiology is becoming a primary focus in cancer research. It has now been established that genetic alterations in several components of the translational apparatus underlie spontaneous cancers as well as an entire class of inherited syndromes known as “ribosomopathies” associated with in- creased cancer susceptibility. These discoveries have illuminated the importance of dereg- ulations in translational control to very specific cellular processes that contribute to cancer etiology. In addition, a growing body of evidence supports the view that deregulation of translational control is a common mechanism by which diverse oncogenic pathways promote cellular transformation and tumor development. Indeed, activation of these key oncogenic pathways induces rapid and dramatic translational reprogramming both by in- creasing overall protein synthesis and by modulating specific mRNA networks. These trans- lational changes promote cellular transformation, impacting almost every phase of tumor development. This paradigm represents a new frontier in the multihit model of cancer for- mation and offers significant promise for innovative cancer therapies. Current research, -
Cytokine-Driven Cell Cycling Is Mediated Through Cdc25a
JCB: ARTICLE Cytokine-driven cell cycling is mediated through Cdc25A Annette R. Khaled,1,3 Dmitry V. Bulavin,2 Christina Kittipatarin,1 Wen Qing Li,3 Michelle Alvarez,1 Kyungjae Kim,3,5 Howard A. Young,4 Albert J. Fornace,2 and Scott K. Durum3 1University of Central Florida, BioMolecular Science Center, Orlando, FL 32628 2Division of Basic Sciences, National Cancer Institute, Bethesda, MD 20892 3Laboratory of Molecular Immunoregulation and 4Laboratory of Experimental Immunology, National Cancer Institute at Frederick, Frederick, MD 21702 5Department of Pharmacy, Sahm-Yook University, Seoul, Korea, 139-742 ymphocytes are the central mediators of the im- the critical mediator of proliferation. Withdrawal of IL-7 mune response, requiring cytokines for survival and or IL-3 from dependent lymphocytes activates the stress L proliferation. Survival signaling targets the Bcl-2 kinase, p38 MAPK, which phosphorylates Cdc25A, in- family of apoptotic mediators, however, the pathway for ducing its degradation. As a result, Cdk/cyclin com- the cytokine-driven proliferation of lymphocytes is poorly plexes remain phosphorylated and inactive and cells understood. Here we show that cytokine-induced cell arrest before the induction of apoptosis. Inhibiting p38 cycle progression is not solely dependent on the synthe- MAPK or expressing a mutant Cdc25A, in which the two sis of cyclin-dependent kinases (Cdks) or cyclins. Rather, p38 MAPK target sites, S75 and S123, are altered, ren- we observe that in lymphocyte cell lines dependent on ders cells resistant to cytokine withdrawal, restoring the interleukin-3 or interleukin-7, or primary lymphocytes activity of Cdk/cyclin complexes and driving the cell cycle dependent on interleukin 7, the phosphatase Cdc25A is independent of a growth stimulus. -
Supplementary Table 1. Primer Sequences Used in RT-PCR Analysis
Supplementary Table 1. Primer sequences used in RT-PCR analysis L32 Forward TGAAGCAGGCATCTGAGGG Reverse CGAAGGTGGAAGAG TGGGAG LIFR Forward CTCTCAGGCCAGAGTTGAGC Reverse GCTGTTCAGTCAGCCCTCTC CCR2 Forward TGTCTTCCCTGAATTGAGCC Reverse AAACGCATTAGTGGACAGGG IL12R Forward CGCAATACGTCGTGCGCTGC Reverse CACTCTGACTCCCACGCGCC CSF1R Forward GCTGGTGCGGATTCGAGGGG Reverse TTCGGCGTTAGTGGCCGAGC TGFbR1 Forward ACGCGCTGACATCTATGCAA Reverse CGTCGAGCAATTTCCCAGAA TGFbR2 Forward GCGCATCGCCAGCACGATCC Reverse TGGGCTTCCATTTCCACATCCGA CXCR1 Forward TCCTCCTGCCGCTGCTCACT Reverse CATGCGCAGTGTGAGCCCGT CXCR2 Forward CCTCGTGCCGCTGCTCATCA Reverse GGTGCGCAGTGTGAACCCGT CXCR3 Forward GGTCGCACTGCTCTGCGTGT Reverse GGGGCAGCAGGAAACCAGCC CXCR4 Forward GAGGCGTTTGGTGCTCCGGT Reverse TCGGTTCCATGGCAACACTCGC VEGFR1 (Flt1) Forward CGCGTGAAGAGTGGGTCCT Reverse CACATGCACGGAGGTGTTG VEGFR2 (Flk1) Forward AGCCCAGACTGTGTCCCGCA Reverse GGTGTCCGCGGAATCGGGTC VEGFR3 (Flt4) Forward GCCCGAGGACGAGGGTGACT Reverse CCTGGCTGCGCCTATCCTGC human Flt1 Forward GCACGTCAGCGAAGGCAAGC Reverse CCAGCTCAGCGTGGTCGTAGG Supplementary Table 2. List of putative miR-200 target genes amplified in human cancers amplified in cancers (Tumorscape)a Gene Symbol Title various cancers NSCLC PCT Errfi1 ERBB receptor feedback inhibitor 1 - yes 0.94 D11Bwg0517e DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed - yes 0.91 Pvrl4 poliovirus receptor-related 4 yes - 0.91 Mecp2 methyl CpG binding protein 2 yes yes 0.9 Jun Jun oncogene yes - 0.88 Prdm16 PR domain containing 16 - yes 0.88 Flt1 FMS-like tyrosine kinase 1 yes -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Profiling Data
Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8 -
De Novo EIF2AK1 and EIF2AK2 Variants Are Associated with Developmental Delay, Leukoencephalopathy, and Neurologic Decompensation
bioRxiv preprint doi: https://doi.org/10.1101/757039; this version posted September 16, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. De novo EIF2AK1 and EIF2AK2 variants are associated with developmental delay, leukoencephalopathy, and neurologic decompensation Dongxue Mao1,2, Chloe M. Reuter3,4, Maura R.Z. Ruzhnikov5,6, Anita E. Beck7, Emily G. Farrow8,9,10, Lisa T. Emrick1,11,12,13, Jill A. Rosenfeld12, Katherine M. Mackenzie5, Laurie Robak2,12,13, Matthew T. Wheeler3,14, Lindsay C. Burrage12,13, Mahim Jain15, Pengfei Liu12, Daniel Calame11,13, Sebastien Küry17,18, Martin Sillesen19, Klaus Schmitz-Abe20, Davide Tonduti21, Luigina Spaccini22, Maria Iascone23, Casie A. Genetti20, Madeline Graf16, Alyssa Tran12, Mercedes Alejandro12, Undiagnosed Diseases Network, Brendan H. Lee12,13, Isabelle Thiffault8,9,24, Pankaj B. Agrawal#,20, Jonathan A. Bernstein#,3,25, Hugo J. Bellen#,2,12,26,27,28, Hsiao- Tuan Chao#,1,2,11,12,13,28,27,29 #Correspondence should be addressed: [email protected] (P.A.), [email protected] (J.A.B.), [email protected] (H.J.B.), [email protected] (H.T.C.) 1Department of Pediatrics, Baylor College of Medicine (BCM), Houston, TX 2Jan and Dan Duncan Neurological Research Institute, Texas Children’s Hospital, Houston, TX 3Stanford Center for Undiagnosed Diseases, Stanford University, Stanford, CA 4Stanford Center for Inherited Cardiovascular Disease, Division of Cardiovascular Medicine, -
Análise Integrativa De Perfis Transcricionais De Pacientes Com
UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. -
WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US). -
Supplementary Material
BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Neurol Neurosurg Psychiatry Page 1 / 45 SUPPLEMENTARY MATERIAL Appendix A1: Neuropsychological protocol. Appendix A2: Description of the four cases at the transitional stage. Table A1: Clinical status and center proportion in each batch. Table A2: Complete output from EdgeR. Table A3: List of the putative target genes. Table A4: Complete output from DIANA-miRPath v.3. Table A5: Comparison of studies investigating miRNAs from brain samples. Figure A1: Stratified nested cross-validation. Figure A2: Expression heatmap of miRNA signature. Figure A3: Bootstrapped ROC AUC scores. Figure A4: ROC AUC scores with 100 different fold splits. Figure A5: Presymptomatic subjects probability scores. Figure A6: Heatmap of the level of enrichment in KEGG pathways. Kmetzsch V, et al. J Neurol Neurosurg Psychiatry 2021; 92:485–493. doi: 10.1136/jnnp-2020-324647 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Neurol Neurosurg Psychiatry Appendix A1. Neuropsychological protocol The PREV-DEMALS cognitive evaluation included standardized neuropsychological tests to investigate all cognitive domains, and in particular frontal lobe functions. The scores were provided previously (Bertrand et al., 2018). Briefly, global cognitive efficiency was evaluated by means of Mini-Mental State Examination (MMSE) and Mattis Dementia Rating Scale (MDRS). Frontal executive functions were assessed with Frontal Assessment Battery (FAB), forward and backward digit spans, Trail Making Test part A and B (TMT-A and TMT-B), Wisconsin Card Sorting Test (WCST), and Symbol-Digit Modalities test.