DOCSLIB.ORG

Chytrid Fungus in Frogs from an Equatorial African Montane Forest in Western Uganda

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chytrid Fungus in Frogs from an Equatorial African Montane Forest in Western Uganda Journal of Wildlife Diseases, 43(3), 2007, pp. 521–524 # Wildlife Disease Association 2007 Chytrid Fungus in Frogs from an Equatorial African Montane Forest in Western Uganda Tony L. Goldberg,1,2,3 Anne M. Readel,2 and Mary H. Lee11Department of Pathobiology, University of Illinois, 2001 South Lincoln Avenue, Urbana, Illinois 61802, USA; 2 Program in Ecology and Evolutionary Biology, University of Illinois, 235 NRSA, 607 East Peabody Drive, Champaign, Illinois 61820, USA; 3 Corresponding author (email: [email protected]) ABSTRACT: Batrachochytrium dendrobatidis, grassland, woodland, lakes and wetlands, the causative agent of chytridiomycosis, was colonizing forest, and plantations of exotic found in 24 of 109 (22%) frogs from Kibale trees (Chapman et al., 1997; Chapman National Park, western Uganda, in January and June 2006, representing the first account of the and Lambert, 2000). Mean daily minimum fungus in six species and in Uganda. The and maximum temperatures in Kibale presence of B. dendrobatidis in an equatorial were recorded as 14.9 C and 20.2 C, African montane forest raises conservation respectively, from 1990 to 2001, with concerns, considering the high amphibian mean annual rainfall during the same diversity and endemism characteristic of such areas and their ecological similarity to other period of 1749 mm, distributed across regions of the world experiencing anuran distinct, bimodal wet and dry seasons declines linked to chytridiomycosis. (Chapman et al., 1999, 2005). Kibale has Key words: Africa, amphibians, Anura, experienced marked climate change over Batrachochytrium dendrobatidis,Chytridio- the last approximately 30 yr, with increas- mycota, Uganda. ing annual rainfall, increasing maximum mean monthly temperatures, and decreas- Chytridiomycosis, an emerging infec- ing minimum mean monthly temperatures tious disease caused by the fungus Ba- trachochytrium dendrobatidis, is a major (Chapman et al., 2005). cause of amphibian population declines Medium- and high-altitude equatorial (Daszak et al., 1999). Its global distribu- African forests such as Kibale hold a great tion, responsiveness to microenvironmen- diversity of herpetofauna, including many tal conditions affected by climate change, endemic anuran species (Channing and and association with anuran extinctions in Howell, 2006). Surveys by Vonesh be- Central America and Australia make it tween 1995 and 1997 identified 28 anuran, a disease of special concern for conserva- 15 lizard, and 32 snake species in Kibale, tion (Daszak et al., 1999; Pounds et al., an assemblage that shows an affinity with 2006). Despite growing information about the herpetofauna of the Guinea–Congo- B. dendrobatidis elsewhere in the world, lean rain forests to the west (Vonesh, comparatively little is known about the 2001). The herpetofauna of Kibale is fungus in Africa, where it is thought to markedly different from that of the coastal have originated (Weldon et al., 2004). mountains of Tanzania, which contain This report presents the results of many local endemic anuran species, and a survey for B. dendrobatidis in Kibale where B. dendrobatidis notably contribut- National Park, Uganda. Kibale is a 795- ed to the recent decline of the Kihansi km2 park located in western Uganda near spray toad, Nectophrynoides asperginis the foothills of the Rwenzori Mountains (Krajick, 2006; Lee et al., 2006). To our (0u139–0u419N, 30u199–30u329E), consist- knowledge, ours is the first multispecies ing primarily of moist semideciduous and survey for B. dendrobatidis in Kibale or in evergreen forest, transitional between any similar equatorial African montane lowland rainforest and montane forest forest site. (elevation ranging from approximately Frogs were collected from locations 1,100 to 1,600 m), and interspersed with near Makerere University Biological Field 521 522 JOURNAL OF WILDLIFE DISEASES, VOL. 43, NO. 3, JULY 2007 TABLE 1. Prevalence and intensity of infection with B. dendrobatidis in frogs collected from Kibale National Park, Uganda. Habitat Number Number Prevalence Mean Species Abundancea typeb tested positive (%)c intensityd Bufo funereus U 1 5 3 60 (23–88) 2.2262.00 Hyperolius kivuensis C 2 22 3 14 (4–34) 1.6261.40 Leptopelis christyi U 1, 3 7 2 29 (8–65) 1.2861.20 Leptopelis kivuensis U 3, 4, 5 36 9 25 (14–41) 2.1761.92 Phrynobatrachus graueri C 2 1 0 0.0 N/A Ptychadena mascareniensis U 3, 5 18 2 11 (2–34) 2.4062.30 Xenopus wittei U 5 20 5 25 (11–47) 0.6360.32 All species 109 24 22 (15–31) 2.0261.58 a Relative abundance descriptors are taken from Vonesh (2001); C5common (one can find many specimens); U5usual (one can find when looking in the proper habitat during the appropriate season). b Numbers indicate habitat types from which frogs were captured: 15forest interior, near stream; 25forest interior, in/ near permanent pond; 35forest interior, in/near ephemeral pool; 45forest interior, far from water; 55forest edge, in/ near permanent pool. All frogs were captured in habitat types typical for each species (Vonesh, 2001). c Numbers in parentheses indicate 95% confidence intervals calculated with the modified Wald method (Agresti and Coull, 1998) and are given only where samples sizes are $5. d Mean intensities are expressed as log10 zoospore equivalents per positive toe clip6standard error of the mean, calculated according to the methods of Boyle et al., 2004. Station (elevation approximately 1500 m) a previously described real-time quantita- in Kibale National Park in January and tive PCR was used that can detect a single June 2006. Sites were chosen that were zoospore in a diagnostic sample (Boyle et known to have high amphibian densities, al., 2004). Samples were run in triplicate, both from anecdotal local reports and with the use of 1 ml of extracted DNA from previous amphibian surveys (Vonesh, template per reaction. 2001). Frogs were captured by hand or To confirm positive results, a nested with hand nets, placed individually into PCR was used that targets the fungal single-use plastic bags until a toe clip was cysteinyl tRNA synthase (ctsyn1)gene obtained from the right rear foot, and (Morehouse et al., 2004; Garner et al., released at the site of capture. Toe clips 2006), although with newly designed in- were placed in approximately 5 volumes of ternal PCR primers (ctsyn1aF: 59- RNAlaterH stabilization solution (Ambion, TCAGCTGCCGTCGTTTGTGAATTG - Inc., Austin, Texas, USA) and stored at 4 39 and ctsyn1aR: 59-CCAGAGCAGTTTG- C in the field and at 220 C after transport CCAGCATCAAA -39). Amplicons were to the laboratory. Equipment and hands electrophoresed in 1.5% agarose gels, were disinfected with 10% bleach and which were stained with ethidium bro- alcohol wipes, respectively, between indi- mide and visualized under ultraviolet viduals. light. Amplicons were purified from gels Total DNA was extracted from toe clips with the use of the ZymoClean Gel DNA with the use of the ZR Genomic DNA II Recovery Kit (Zymo Research) and were KitTM (Zymo Research Corp., Orange, sequenced directly and in both directions California, USA). For the tissue homoge- with primers ctsyn1aF and ctsyn1aR. nization step, a rotor-stator homogenizer Sequencing was performed at the Univer- with single-use individually sterilized sity of Illinois Roy J. Carver Biotechnology probes was used to prevent cross-contam- Center. ination. Negative-control DNA extractions A total of 109 frogs from seven species were also performed with every 10 toe clip were collected (Table 1). Frogs of all extractions. To test for B. dendrobatidis, species were adults, with the exception SHORT COMMUNICATIONS 523 of Leptopelis christyi and L. kivuensis, for and it thereby significantly expands the which approximately 50% of frogs were known geographic range of the fungus in post-metamorphic juveniles. All frogs ap- Africa. Kibale is approximately 800 km peared clinically normal at the time of from the nearest other location where sampling. Batrachochytrium dendrobati- frogs infected with B. dendrobatidis have dis was detected in 24/109 (22.0%) toe been documented (P. anchietae in Nair- clip samples from six species (Table 1). obi, Kenya; Speare and Berger, 2000). Prevalence estimates varied between 0% Kibale is approximately 1,200 km from and 60% among species, although sample Kihansi Gorge, Tanzania, where B. den- sizes within species were too small for drobatidis contributed to the decline of N. meaningful statistical comparisons. Among asperginis (Krajick, 2006; Lee et al., 2006), infected frogs, there was no significant and over 2,000 km from sites in southern association between intensity of infection Africa where infected Xenopus spp. have and species (Kruskal-Wallis rank sum test existed since at least as early as 1938 statistic510.92; P50.09). Batrachochy- (Weldon et al., 2004). trium dendrobatidis was not detected in It has been suggested that B. dendro- any negative control samples, indicating batidis may have emerged through the that laboratory contamination did not export of X. laevis from southern Africa for affect these results. human pregnancy testing beginning in the With the use of nested PCR, a 235 bp 1930s (Weldon et al., 2004). We note that segment of the B. dendrobatidis ctsyn1 the prevalence of B. dendrobatidis in X. gene was successfully amplified and se- wittei in Kibale (25%) is higher than that quenced in three positive field samples reported in archived specimens of X. (two L. kivuensis and one Ptychadena laevis, X. meulleri, and X. gilli collected mascareniensis). All three sequences from southern Africa between 1879 and matched exactly that of the published B. 1999 (2.7%; Weldon et al., 2004), but is dendrobatidis ctsyn1 gene (GenBank ac- within the range of location-specific prev- cession number BH001044), and all con- alence values for Xenopus spp. collected tained adenine at position 400, a single from South Africa more recently (Weldon, nucleotide A/G polymorphism previously 2005). It is unclear whether this pattern documented in a geographically distribut- represents a recent increase in B. den- ed sample of B. dendrobatidis isolates drobatidis prevalence across Africa, or (Morehouse et al., 2003).
Load more

Recommended publications
  • The Tadpoles of Eight West and Central African Leptopelis Species (Amphibia: Anura: Arthroleptidae)
    Official journal website: Amphibian & Reptile Conservation amphibian-reptile-conservation.org 9(2) [Special Section]: 56–84 (e111). The tadpoles of eight West and Central African Leptopelis species (Amphibia: Anura: Arthroleptidae) 1,*Michael F. Barej, 1Tilo Pfalzgraff,1 Mareike Hirschfeld, 2,3H. Christoph Liedtke, 1Johannes Penner, 4Nono L. Gonwouo, 1Matthias Dahmen, 1Franziska Grözinger, 5Andreas Schmitz, and 1Mark-Oliver Rödel 1Museum für Naturkunde, Leibniz Institute for Evolution and Biodiversity Science, Invalidenstr. 43, 10115 Berlin, GERMANY 2Department of Environmental Science (Biogeography), University of Basel, Klingelbergstrasse 27, 4056 Basel, SWITZERLAND 3Ecology, Evolution and Developmental Group, Department of Wetland Ecology, Estación Biológica de Doñana (CSIC), 41092 Sevilla, SPAIN 4Cameroon Herpetology- Conservation Biology Foundation (CAMHERP-CBF), PO Box 8218, Yaoundé, CAMEROON 5Natural History Museum of Geneva, Department of Herpetology and Ichthyology, C.P. 6434, 1211 Geneva 6, SWITZERLAND Abstract.—The tadpoles of more than half of the African tree frog species, genus Leptopelis, are unknown. We provide morphological descriptions of tadpoles of eight species from Central and West Africa. We present the first descriptions for the tadpoles ofLeptopelis boulengeri and L. millsoni. In addition the tadpoles of L. aubryioides, L. calcaratus, L. modestus, L. rufus, L. spiritusnoctis, and L. viridis are herein reinvestigated and their descriptions complemented, e.g., with additional tooth row formulae or new measurements based on larger series of available tadpoles. Key words. Anuran larvae, external morphology, diversity, mitochondrial DNA, DNA barcoding, lentic waters, lotic waters Citation: Barej MF, Pfalzgraff T, Hirschfeld M, Liedtke HC, Penner J, Gonwouo NL, Dahmen M, Grözinger F, Schmitz A, Rödel M-0. 2015. The tadpoles of eight West and Central African Leptopelis species (Amphibia: Anura: Arthroleptidae).
    [Show full text]
  • Threat Abatement Plan
    gus resulting in ch fun ytridio trid myc chy osis ith w s n ia ib h p m a f o n o i t THREAT ABATEMENTc PLAN e f n I THREAT ABATEMENT PLAN INFECTION OF AMPHIBIANS WITH CHYTRID FUNGUS RESULTING IN CHYTRIDIOMYCOSIS Department of the Environment and Heritage © Commonwealth of Australia 2006 ISBN 0 642 55029 8 Published 2006 This work is copyright. Apart from any use as permitted under the Copyright Act 1968, no part may be reproduced by any process without prior written permission from the Commonwealth, available from the Department of the Environment and Heritage. Requests and inquiries concerning reproduction and rights should be addressed to: Assistant Secretary Natural Resource Management Policy Branch Department of the Environment and Heritage PO Box 787 CANBERRA ACT 2601 This publication is available on the Internet at: www.deh.gov.au/biodiversity/threatened/publications/tap/chytrid/ For additional hard copies, please contact the Department of the Environment and Heritage, Community Information Unit on 1800 803 772. Front cover photo: Litoria genimaculata (Green-eyed tree frog) Sequential page photo: Taudactylus eungellensis (Eungella day frog) Banner photo on chapter pages: Close up of the skin of Litoria genimaculata (Green-eyed tree frog) ii Foreword ‘Infection of amphibians with chytrid fungus resulting Under the EPBC Act the Australian Government in chytridiomycosis’ was listed in July 2002 as a key implements the plan in Commonwealth areas and seeks threatening process under the Environment Protection the cooperation of the states and territories where the and Biodiversity Conservation Act 1999 (EPBC Act). disease impacts within their jurisdictions.
    [Show full text]
  • Bioseries12-Amphibians-Taita-English
    0c m 12 Symbol key 3456 habitat pond puddle river stream 78 underground day / night day 9101112131415161718 night altitude high low vegetation types shamba forest plantation prelim pages ENGLISH.indd ii 2009/10/22 02:03:47 PM SANBI Biodiversity Series Amphibians of the Taita Hills by G.J. Measey, P.K. Malonza and V. Muchai 2009 prelim pages ENGLISH.indd Sec1:i 2009/10/27 07:51:49 AM SANBI Biodiversity Series The South African National Biodiversity Institute (SANBI) was established on 1 September 2004 through the signing into force of the National Environmental Management: Biodiversity Act (NEMBA) No. 10 of 2004 by President Thabo Mbeki. The Act expands the mandate of the former National Botanical Institute to include responsibilities relating to the full diversity of South Africa’s fauna and ora, and builds on the internationally respected programmes in conservation, research, education and visitor services developed by the National Botanical Institute and its predecessors over the past century. The vision of SANBI: Biodiversity richness for all South Africans. SANBI’s mission is to champion the exploration, conservation, sustainable use, appreciation and enjoyment of South Africa’s exceptionally rich biodiversity for all people. SANBI Biodiversity Series publishes occasional reports on projects, technologies, workshops, symposia and other activities initiated by or executed in partnership with SANBI. Technical editor: Gerrit Germishuizen Design & layout: Elizma Fouché Cover design: Elizma Fouché How to cite this publication MEASEY, G.J., MALONZA, P.K. & MUCHAI, V. 2009. Amphibians of the Taita Hills / Am bia wa milima ya Taita. SANBI Biodiversity Series 12. South African National Biodiversity Institute, Pretoria.
    [Show full text]
  • Maritime Southeast Asia and Oceania Regional Focus
    November 2011 Vol. 99 www.amphibians.orgFrogLogNews from the herpetological community Regional Focus Maritime Southeast Asia and Oceania INSIDE News from the ASG Regional Updates Global Focus Recent Publications General Announcements And More..... Spotted Treefrog Nyctixalus pictus. Photo: Leong Tzi Ming New The 2012 Sabin Members’ Award for Amphibian Conservation is now Bulletin open for nomination Board FrogLog Vol. 99 | November 2011 | 1 Follow the ASG on facebook www.facebook.com/amphibiansdotor2 | FrogLog Vol. 99| November 2011 g $PSKLELDQ$UN FDOHQGDUVDUHQRZDYDLODEOH 7KHWZHOYHVSHFWDFXODUZLQQLQJSKRWRVIURP $PSKLELDQ$UN¶VLQWHUQDWLRQDODPSKLELDQ SKRWRJUDSK\FRPSHWLWLRQKDYHEHHQLQFOXGHGLQ $PSKLELDQ$UN¶VEHDXWLIXOZDOOFDOHQGDU7KH FDOHQGDUVDUHQRZDYDLODEOHIRUVDOHDQGSURFHHGV DPSKLELDQDUN IURPVDOHVZLOOJRWRZDUGVVDYLQJWKUHDWHQHG :DOOFDOHQGDU DPSKLELDQVSHFLHV 3ULFLQJIRUFDOHQGDUVYDULHVGHSHQGLQJRQ WKHQXPEHURIFDOHQGDUVRUGHUHG±WKHPRUH \RXRUGHUWKHPRUH\RXVDYH2UGHUVRI FDOHQGDUVDUHSULFHGDW86HDFKRUGHUV RIEHWZHHQFDOHQGDUVGURSWKHSULFHWR 86HDFKDQGRUGHUVRIDUHSULFHGDW MXVW86HDFK 7KHVHSULFHVGRQRWLQFOXGH VKLSSLQJ $VZHOODVRUGHULQJFDOHQGDUVIRU\RXUVHOIIULHQGV DQGIDPLO\ZK\QRWSXUFKDVHVRPHFDOHQGDUV IRUUHVDOHWKURXJK\RXU UHWDLORXWOHWVRUIRUJLIWV IRUVWDIIVSRQVRUVRUIRU IXQGUDLVLQJHYHQWV" 2UGHU\RXUFDOHQGDUVIURPRXUZHEVLWH ZZZDPSKLELDQDUNRUJFDOHQGDURUGHUIRUP 5HPHPEHU±DVZHOODVKDYLQJDVSHFWDFXODUFDOHQGDU WRNHHSWUDFNRIDOO\RXULPSRUWDQWGDWHV\RX¶OODOVREH GLUHFWO\KHOSLQJWRVDYHDPSKLELDQVDVDOOSUR¿WVZLOOEH XVHGWRVXSSRUWDPSKLELDQFRQVHUYDWLRQSURMHFWV ZZZDPSKLELDQDUNRUJ FrogLog Vol. 99 | November
    [Show full text]
  • Méta-Analyse Exploratoire Des Effets De Perturbations Anthropiques Sur
    Tropicultura 2295-8010 Volume 39 (2021) Numéro 1, 1709 Méta-analyse exploratoire des effets de perturbations anthropiques sur la diversité des amphibiens dans les stations de Kasugho, Butembo, Mambasa et Kisangani en République Démocratique du Congo Loving Musubaho Kako-Wanzalire, Léon Iyongo Waya Mongo, Marc Boketshu Ilonga, Joël Mbusa Mapoli, Jean-Louis Juakaly Mbumba, Sylvie Muhinda Neema, Guy-Crispin Gembu Tungaluna, Jean- Claude Mukinzi Itoka & Jan Bogaert Loving Musubaho Kako-Wanzalire : MSc, Enseignant, Département d’Écologie et Gestion des Ressources Animales, Faculté des Sciences, Université de Conservation de la Nature et de Développement à Kasugho/Goma (RD Congo) ; Doctorant, Unité Biodiversité et Paysage, Université de Liège, Gembloux Agro-Bio Tech, 2 Passage des Déportés, 5030, Gembloux (Belgique). Auteur correspondant : [email protected] Léon Iyongo Waya Mongo : PhD, Professeur Associé, Enseignant, Section des Eaux et Forêts, Institut Supérieur d’Études Agronomiques de Bengamisa/Kisangani, 202, RD Congo. Marc Boketshu Ilonga : Enseignant-Chercheur, Section d’Agronomie Générale, Institut Supérieur d’Etudes Agronomiques de Yatolema, 2324, Opala/RD Congo. Joël Mbusa Mapoli : Enseignant-Chercheur, Département d’Écologie et Gestion des Ressources Animales, Faculté des Sciences, Université de Conservation de la Nature et de Développement à Kasugho/Goma (RD Congo). Jean-Louis Juakaly Mbumba : PhD, Professeur, Enseignant, Département d’Écologie et Gestion des Ressources Animales, Faculté des Sciences, Université de Kisangani, 2012, Kisangani (RD Congo). Sylvie Muhinda Neema : Chercheuse, Département d’Ecologie et Gestion des Ressources Animales, Faculté des Sciences, Université de Conservation de la Nature et de Développement à Kasugho/Goma (RD Congo). Guy-Crispin Gembu Tungaluna : PhD, Professeur, Enseignant, Département d’Ecologie et Gestion des Ressources Animales, Faculté des Sciences, Université de Kisangani, 2012, Kisangani (RD Congo).
    [Show full text]
  • Chytridiomycosis (Infection with Batrachochytrium Dendrobatidis) Version 1, 2012
    Disease Strategy Chytridiomycosis (Infection with Batrachochytrium dendrobatidis) Version 1, 2012 © Commonwealth of Australia 2012 This work is copyright. Apart from any use as permitted under the Copyright Act 1968, no part may be reproduced by any process without prior written permission from the Commonwealth. Requests and enquiries concerning reproduction and rights should be addressed to Department of Sustainability, Environment, Water, Populations and Communities, Public Affairs, GPO Box 787 Canberra ACT 2601 or email [email protected] The views and opinions expressed in this publication are those of the authors and do not necessarily reflect those of the Australian Government or the Minister for Sustainability, Environment, Water, Population and Communities. While reasonable efforts have been made to ensure that the contents of this publication are factually correct, the Commonwealth does not accept responsibility for the accuracy or completeness of the contents, and shall not be liable for any loss or damage that may be occasioned directly or indirectly through the use of, or reliance on, the contents of this publication. 1 Preface This disease strategy is for the control and eradication of Chytridiomycosis/Batrachochytrium dendrobatidis. It is one action among 68 actions in a national plan to help abate the key threatening process of chytridiomycosis (Australian Government 2006). The action is number 1.1.3: “Prepare a model action plan (written along the lines of AusVetPlan — http://www.aahc.com.au/ausvetplan/) for chytridiomycosis — free populations based on a risk management approach, setting out the steps of a coordinated response if infection with chytridiomycosis is detected. The model action plan will be based on a risk management approach using quantitative risk analysis where possible and will be able to be modified to become area-specific or population- specific.
    [Show full text]
  • Diversification of African Tree Frogs (Genus Leptopelis) in the Highlands of Ethiopia
    Received: 27 August 2017 | Revised: 25 February 2018 | Accepted: 12 March 2018 DOI: 10.1111/mec.14573 ORIGINAL ARTICLE Diversification of African tree frogs (genus Leptopelis) in the highlands of Ethiopia Jacobo Reyes-Velasco1 | Joseph D. Manthey1 | Xenia Freilich2 | Stephane Boissinot1 1New York University Abu Dhabi, Saadiyat Island, Abu Dhabi, UAE Abstract 2Department of Biology, Queens College, The frog genus Leptopelis is composed of ~50 species that occur across sub-Saharan City University of New York, Flushing, NY, Africa. The majority of these frogs are typically arboreal; however, a few species USA have evolved a fossorial lifestyle. Most species inhabit lowland forests, but a few Correspondence species have adapted to high elevations. Five species of Leptopelis occupy the Ethio- Stephane Boissinot, New York University Abu Dhabi, Saadiyat Island, Abu Dhabi, UAE. pian highlands and provide a good opportunity to study the evolutionary transition Email: [email protected] from an arboreal to a fossorial lifestyle, as well as the diversification in this biodiver- sity hot spot. We sequenced 14 nuclear and three mitochondrial genes, and gener- ated thousands of SNPs from ddRAD sequencing to study the evolutionary relationships of Ethiopian Leptopelis. The five species of highland Leptopelis form a monophyletic group, which diversified during the late Miocene and Pliocene. We found strong population structure in the fossorial species L. gramineus, with levels of genetic differentiation between populations similar to those found between arbo- real species. This could indicate that L. gramineus is a complex of cryptic species. We propose that after the original colonization of the Ethiopian highlands by the ancestor of the L.
    [Show full text]
  • Asymptomatic Infection of the Fungal Pathogen Batrachochytrium
    www.nature.com/scientificreports OPEN Asymptomatic infection of the fungal pathogen Batrachochytrium salamandrivorans in captivity Received: 5 July 2017 Joana Sabino-Pinto 1, Michael Veith2, Miguel Vences 1 & Sebastian Steinfartz1 Accepted: 14 July 2018 One of the most important factors driving amphibian declines worldwide is the infectious disease, Published: xx xx xxxx chytridiomycosis. Two fungi have been associated with this disease, Batrachochytrium dendrobatidis and B. salamandrivorans (Bsal). The latter has recently driven Salamandra salamandra populations to extirpation in parts of the Netherlands, and Belgium, and potentially also in Germany. Bsal has been detected in the pet trade, which has been hypothesized to be the pathway by which it reached Europe, and which may continuously contribute to its spread. In the present study, 918 amphibians belonging to 20 captive collections in Germany and Sweden were sampled to explore the extent of Bsal presence in captivity. The fungus was detected by quantitative Polymerase Chain Reaction (qPCR) in ten collections, nine of which lacked clinical symptoms. 23 positives were confrmed by independent processing of duplicate swabs, which were analysed in a separate laboratory, and/or by sequencing ITS and 28 S gene segments. These asymptomatic positives highlight the possibility of Bsal being widespread in captive collections, and is of high conservation concern. This fnding may increase the likelihood of the pathogen being introduced from captivity into the wild, and calls for according biosecurity measures. The detection of Bsal-positive alive specimens of the hyper-susceptible fre salamander could indicate the existence of a less aggressive Bsal variant or the importance of environmental conditions for infection progression.
    [Show full text]
  • Amphibian Conservation INTRODUCTION
    2014 | HIGHLIGHTS AND ACCOMPLISHMENTS amphibian conservation INTRODUCTION Zoos and aquariums accredited by the Association of Zoos and Aquariums (AZA) have made long-term commitments, both individually and as a community organized under the Amphibian Taxon Advisory Group (ATAG), to the conservation of amphibians throughout the Americas and around the world. With the support and hard work of directors, curators, keepers and partners, 85 AZA-accredited zoos and aquariums reported spending more than $4.2 million to maintain, adapt and expand amphibian conservation programs in 2014. The stories in this report are drawn primarily from annual submissions to AZA’s field conservation database (available when logged into AZA’s website under “Conservation”), as well as from articles submitted directly to AZA. They share the successes and advances in the areas of reintroduction and research, conservation breeding and husbandry and citizen science and community engagement. These efforts are the result of extensive collaborations and multi-year (even multi-decadal!) commitments. AZA congratulates each of the members included in this report for their dedication, and encourages other facilities to become involved. The ATAG has many resources to help people get started or to expand their engagement in amphibian conservation, and people are also welcome to contact the facilities included in this report or the ATAG Chair, Diane Barber ([email protected]). Cover: Spring peeper (Pseudacris crucifer). Widespread throughout the eastern United States and with a familiar call to many, the spring peeper was the most frequently reported frog by FrogWatch USA volunteers in 2014. Although reports of spring peepers began in February, they peaked in April.
    [Show full text]
  • Meristic and Morphometric Characters of Leptopelis Natalensistadpoles
    Acta Herpetologica 12(2): 125-132, 2017 DOI: 10.13128/Acta_Herpetol-20740 Meristic and morphometric characters of Leptopelis natalensis tadpoles (Amphibia: Anura: Arthroleptidae) from Entumeni Forest reveal variation and inconsistencies with previous descriptions Susan Schweiger1, James Harvey2, Theresa S. Otremba1, Janina Weber1, Hendrik Müller1,* 1 Institut für Spezielle Zoologie und Evolutionsbiologie mit Phyletischem Museum, Friedrich Schiller Universität Jena, Erbertstrasse 1, 07743 Jena, Germany. *Corresponding author. E-mail: [email protected] 2 41 Devonshire Avenue, Howick, 3290, South Africa Submitted on: 2017, 5th June; revised on: 2017, 31st August; accepted on: 2017, 3rd October Editor: Rocco Tiberti Abstract. The tadpole ofLeptopelis natalensis is described based on a series of 32 specimens from Entumeni Forest, KwaZulu-Natal, South Africa. Previous descriptions are brief, lack morphometric data, or are based on specimens of imprecise origin. The tadpole resembles other Leptopelis tadpoles and is generally in agreement with existing accounts, although some differences exist. Some of these differences seem to fall within the range of natural variation. Others, such as the presence of a fifth anterior row of keratodonts, might be indicative of variation at the population level and should be considered in future taxonomic revisions. Leptopelis natalensis tadpoles seem to be most readily dis- tinguished by their more narrowly keratinized beaks from the geographically overlapping or adjacent L. mossambicus and L. xenodactylus.
    [Show full text]
  • Addis Ababa University Science Faculty School of Graduate Studies Department of Environmental Science Zoology Module
    ADDIS ABABA UNIVERSITY SCIENCE FACULTY SCHOOL OF GRADUATE STUDIES DEPARTMENT OF ENVIRONMENTAL SCIENCE ZOOLOGY MODULE AN INVESTIGATION OF AMPHIBIAN DIVERSITY AND ABUNDANCE IN RELATION TO ENVIRONMENTAL CHANGE IN HARENNA FOREST, BALE MOUNTAINS NATIONAL PARK, ETHIOPIA A Thesis Submitted to the School of Graduate Studies of Addis Ababa University, in Partial Fulfillment of the Requirements for the Degree of Master of Environmental Science By Roman Kassahun Advisors: Professor Samy A.Saber, A.A.U. Ethiopia Dr. Simon Loader, Institute of Biogeography, Basel, Switzerland July, 2009 ADDIS ABABA UNIVERSITY SCHOOL OF GRADUATE STUDIES An investigation of Amphibian diversity and abundance in relation to environmental change in Harenna Forest, Bale Mountains National Park. By Roman Kassahun A Thesis presented to the School of Graduate Studies of Addis Ababa University, in partial fulfillment of the requirements for the Degree of Master of Environmental Science Approved by Examining Board: _______________________ _____________ _____________________________ ________________ _____________________________ ________________ ______________________________ ________________ Acknowledgement I owe my sincere gratitude to my adviser Prof Samy A. Saber for his advice and encouragement prior to the start of research work and for his enormously consistent and valuable guidance and advice without which this research project would not have been realized. I am also grateful to my Co-advisor Dr. Simon Loader from the University of Basel, for the logistical support and great help during the wet season of the project, for his guidance in the identifications of the specimens and for giving me this opportunity in the first place. My gratitude also goes to the Ethiopian Wild Life Conservation Authority (EWCA) for allowing me to pursue the M.S.C.
    [Show full text]
  • Systematics of Leptopelis (Anura: Arthroleptidae) from the Itombwe
    University of Texas at El Paso DigitalCommons@UTEP Open Access Theses & Dissertations 2012-01-01 Systematics of Leptopelis (Anura: Arthroleptidae) from the Itombwe Plateau, Eastern Democratic Republic of the Congo Francisco Portillo University of Texas at El Paso, [email protected] Follow this and additional works at: https://digitalcommons.utep.edu/open_etd Part of the Biology Commons, Developmental Biology Commons, Evolution Commons, and the Zoology Commons Recommended Citation Portillo, Francisco, "Systematics of Leptopelis (Anura: Arthroleptidae) from the Itombwe Plateau, Eastern Democratic Republic of the Congo" (2012). Open Access Theses & Dissertations. 1906. https://digitalcommons.utep.edu/open_etd/1906 This is brought to you for free and open access by DigitalCommons@UTEP. It has been accepted for inclusion in Open Access Theses & Dissertations by an authorized administrator of DigitalCommons@UTEP. For more information, please contact [email protected]. SYSTEMATICS OF LEPTOPELIS (ANURA: ARTHROLEPTIDAE) FROM THE ITOMBWE PLATEAU, EASTERN DEMOCRATIC REPUBLIC OF THE CONGO FRANK PORTILLO Department of Biological Sciences APPROVED: ______________________________ Eli Greenbaum, Ph.D., Chair ______________________________ Jerry D. Johnson, Ph.D. ______________________________ Rip Langford, Ph.D. ______________________________________ Benjamin C. Flores, Ph.D. Dean of the Graduate School Copyright © by Frank Portillo 2012 SYSTEMATICS OF LEPTOPELIS (ANURA: ARTHROLEPTIDAE) FROM THE ITOMBWE PLATEAU, EASTERN DEMOCRATIC REPUBLIC OF THE CONGO by FRANK PORTILLO, B.S. THESIS Presented to the Faculty of the Graduate School of The University of Texas at El Paso in Partial Fulfillment of the Requirements for the Degree of MASTER OF SCIENCE Department of Biological Sciences THE UNIVERSITY OF TEXAS AT EL PASO December 2012 ACKNOWLEDGMENTS First I would like to thank my family for their love and support throughout my life.
    [Show full text]