DOCSLIB.ORG

The Mitochondrial Genome of Paramphistomum Cervi (Digenea), the First Representative for the Family Paramphistomidae

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Mitochondrial Genome of Paramphistomum Cervi (Digenea), the First Representative for the Family Paramphistomidae The Mitochondrial Genome of Paramphistomum cervi (Digenea), the First Representative for the Family Paramphistomidae Hong-Bin Yan1., Xing-Ye Wang1,4., Zhong-Zi Lou1,LiLi1, David Blair2, Hong Yin1, Jin-Zhong Cai3, Xue-Ling Dai1, Meng-Tong Lei3, Xing-Quan Zhu1, Xue-Peng Cai1*, Wan-Zhong Jia1* 1 State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Key Laboratory of Veterinary Public Health of Agriculture Ministry, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu Province, PR China, 2 School of Marine and Tropical Biology, James Cook University, Queensland, Australia, 3 Laboratory of Plateau Veterinary Parasitology, Veterinary Research Institute, Qinghai Academy of Animal Science and Veterinary Medicine, Xining, Qinghai Province, PR China, 4 College of Veterinary Medicine, Northwest A&F University, Yangling, Shanxi Province, PR China Abstract We determined the complete mitochondrial DNA (mtDNA) sequence of a fluke, Paramphistomum cervi (Digenea: Paramphistomidae). This genome (14,014 bp) is slightly larger than that of Clonorchis sinensis (13,875 bp), but smaller than those of other digenean species. The mt genome of P. cervi contains 12 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and 2 non-coding regions (NCRs), a complement consistent with those of other digeneans. The arrangement of protein-coding and ribosomal RNA genes in the P. cervi mitochondrial genome is identical to that of other digeneans except for a group of Schistosoma species that exhibit a derived arrangement. The positions of some transfer RNA genes differ. Bayesian phylogenetic analyses, based on concatenated nucleotide sequences and amino-acid sequences of the 12 protein-coding genes, placed P. cervi within the Order Plagiorchiida, but relationships depicted within that order were not quite as expected from previous studies. The complete mtDNA sequence of P. cervi provides important genetic markers for diagnostics, ecological and evolutionary studies of digeneans. Citation: Yan H-B, Wang X-Y, Lou Z-Z, Li L, Blair D, et al. (2013) The Mitochondrial Genome of Paramphistomum cervi (Digenea), the First Representative for the Family Paramphistomidae. PLoS ONE 8(8): e71300. doi:10.1371/journal.pone.0071300 Editor: Kelly A. Brayton, Washington State University, United States of America Received March 25, 2013; Accepted June 26, 2013; Published August 22, 2013 Copyright: ß 2013 Yan et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This study was supported by the ‘‘Special Fund for Agro-scientific Research in the Public Interest’’ (Grant No. 201303037), the Science Fund for Creative Research Groups of Gansu Province (Grant No. 1210RJIA006), and NBCITS, MOA (CARS-38), the People’s Republic of China. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] (WZJ); [email protected] (XPC) . These authors contributed equally to this work. Introduction misinterpretation or misdiagnosis because the presence of adult paramphistomes (hence their eggs) is not necessarily a cause of Paramphistomosis, due to paramphistomes (Trematoda: Dige- disease [7,13,14]. Early diagnosis of paramphistomosis is essential nea: Paramphistomidae), has recently emerged as a major cause of for prompt treatment before irreparable damage to the rumen and productivity loss in ruminants. Adult worms often inhabit the bile ducts occurs [9]. Immunological diagnosis may be a rumen and reticulum of cattle, water buffaloes, sheep and goats. dependable means for monitoring the infection, and be supple- Their presence in these sites may elicit few apparent signs or mented by the finding of eggs. In order to develop this method, symptoms. However, acute parasitic gastroenteritis causing high whole worm extract of adult P. cervi has been subjected to immuno- morbidity and mortality may occur as large numbers of immature blotting using sera from bovines infected with P. cervi. This paramphistomes migrate through the intestine towards the rumen method, however, has not been widely adopted [15]. and reticulum. Severity of disease is greatest in young animals [1– Rapid development of molecular biology techniques, especially 6]. As a consequence of frequent under-diagnosis, the significance the polymerase chain reaction (PCR), may provide valuable of subclinical infection in many animals remains unclear and supplementary tools for the differential identification of digenean economic losses may exceed those caused by many other helminth infection to overcome limitations of current morphological- parasites [5,7]. Paramphistomosis is widespread [6–10], with diagnostic methods. Due to their high nucleotide substitution different species predominating in different places. However, rates, partial or complete mitochondrial (mt) genomes of parasitic Paramphistomum cervi is perhaps the most widespread species, being flatworms have become very popular markers for detecting their reported from many parts of Eurasia [9,11] and North America presence in animals and for investigating their phylogenetic [12]. Conventional diagnosis of paramphistomosis is based on the relationships at different levels [16–29]. history and clinical signs of the disease. Further confirmation can The lack of knowledge of mt genomics for P. cervi is a major be obtained by collection of fecal samples from the host and limitation for the development of molecular diagnostic techniques, examination for parasite eggs. However, this can lead to PLOS ONE | www.plosone.org 1 August 2013 | Volume 8 | Issue 8 | e71300 The Mitochondrial Genome of Paramphistomum cervi Table 1. Primers for amplification of mt DNA genome of P. Seven pairs of oligonucleotide primers were designed based on the cervi. conserved regions from published complete mtDNA sequences of Fasciola hepatica [27,28], Clonorchis sinensis [30,31], Opisthorchis felineus [30] and Paragonimus westermani (GenBank Accession No. Primer name (positions) Sequence of primer (59R39) AF219379) (Table 1). These sets of primers amplified overlapping fragments to facilitate eventual assembly using Taq polymerase – PC1-F_nad5 (12177–12198) TTDCKTCTCGNTTBGGKGATGT KOD FX Neo (TOYOBO, Japan). The cycling conditions used PC1-R_cytb (1497–1519) ARAAARTAYCACTCNGGCTTWAT were 94uC for 5 min (initial denaturation); then 94uC for 1 min PC2-F_cytb (1110–1132) TATTGRGCTGCTACDGTTTTGAC (denaturation), 50uC for 35 s (annealing), 72uC for 1–3 min PC2-R_nad2 (4623–4648) CATCATATGACACCAACAATAATACC (extension) for 30 cycles and a final extension at 72uC for 10 min. Each PCR reaction yielded a single band detected in a 1.0% (w/v) PC3-F_nad2 (4054–4076) TTTKTTTATGAGRTYTTTGTBGC agarose gel stained with ethidium-bromide [24]. PCR products PC3-R_nad1 (5839–5963) AYTCDCTYTCVGMCTCMSCRTAATC were directly sequenced on an ABI 3370 DNA sequencer at PC4-F_nad1 (5350–5372) CGTAAGGGKCCDAAHAAGGTTGG Sangon Company (Shanghai, China) using a primer walking PC4-R_cox1 (7603–7628) CCAAARAAYCAAAAYAWATGYTGAAA strategy. The complete mtDNA sequence of P. cervi was assembled PC5-F_cox1 (7285–7307) GTTGGKTGRACTTTTTATCCWCC using DNAStar software as a sequence editor [32]. PC5-R_s-rRNA (9455–9474) AGATAAGAACCGACCTGGCT PC6-F_s-rRNA (9296–9318) TTACCTYGGGGATAACTRRGTAA Prediction of protein-coding genes, tRNAs and genes for rrnL and rrnS PC6-R_nad6 (10851–10876) GCACCACAHAAYTCMSTACARTAHCC The ORF finder tool at NCBI (http://www.ncbi.nlm.nih.gov/ PC7-F_cox2 (10265–10292) TAGCTCTGATAAGTCGTAACATGGTAAT gorf/gorf.html) was used to find protein-coding gene sequences, PC7-R_nad5 (12326–12343) HGGAGCVCGCATHGCYTC which were subsequently used to search for homologous digenean TM Notes: D = A/T/G; H = A/C/T; K = G/T; M = A/C; N = A/C/G/T; R = A/G; V = A/C/G; sequences deposited in the GenBank by using tBLASTn. The W = A/T; Y = T/C. The positions of primers in the study are based on the mt rhabditophoran platyhelminth genetic code [33] was specified. genome sequence of P. cervi. Gene boundaries were confirmed based on comparison and doi:10.1371/journal.pone.0071300.t001 alignment with other published mt genomes of species in Fasciolidae, Opisthorchiidae and Paragonimidae [27,28,30,31]. for analyses of population and genetic variation within this species, Putative tRNA genes were identified using the program and for phylogenetic studies of the Digenea in general. tRNAscan-SE [34] and the online tool ARWEN [35] combined In our present study, we determined the complete mt with observations and alignments by eye. Genes for large (rrnL) nucleotide sequence of P. cervi, which was collected from Qinghai and small (rrnS) subunit ribosomal RNA genes were identified by Province, China. Phylogenetic analyses were performed using comparison with the mt rRNA genes of F. hepatica, C. sinensis, O. concatenated mt sequences of 12 protein-coding genes of felineus, P. westermani and other flatworms [27,28,31]. digenean species available in GenBank to date. The new mt Phylogenetic analyses. DNA sequences of the 12 protein- genome sequence may provide useful information on both coding genes were concatenated and imported into BioEdit [36]. genomics and the evolution of Paramphistomidae,
Load more

Recommended publications
  • Digenea: Paramphistomidae) a Parasite of Bubalus Bubalis on Marajó Island, Pará, Brazilian Amazon
    Original Article ISSN 1984-2961 (Electronic) www.cbpv.org.br/rbpv Cotylophoron marajoensis n. sp. (Digenea: Paramphistomidae) a parasite of Bubalus bubalis on Marajó Island, Pará, Brazilian Amazon Cotylophoron marajoensis n. sp. (Digenea: Paramphistomidae) parasito de Bubalus bubalis na Ilha de Marajó, Pará, Amazônia Brasileira Vanessa Silva do Amaral1,2 ; Diego Ferreira de Sousa1 ; Raimundo Nonato Moraes Benigno3 ; Raul Henrique da Silva Pinheiro4 ; Evonnildo Costa Gonçalves5 ; Elane Guerreiro Giese1,2* 1 Programa de Pós-graduação em Saúde e Produção Animal na Amazônia, Instituto da Saúde e Produção Animal, Universidade Federal Rural da Amazônia – UFRA, Belém, PA, Brasil 2 Laboratório de Histologia e Embriologia Animal, Instituto da Saúde e Produção Animal, Universidade Federal Rural da Amazônia – UFRA, Belém, PA, Brasil 3 Laboratório de Parasitologia Animal, Instituto da Saúde e Produção Animal, Universidade Federal Rural da Amazônia – UFRA, Belém, PA, Brasil 4 Programa de Pós-graduação em Sociedade, Natureza e Desenvolvimento, Instituto de Biodiversidade e Florestas, Universidade Federal do Oeste do Pará – UFOPA, Santarém, PA, Brasil 5 Laboratório de Tecnologia Biomolecular, Instituto de Ciências Biológicas, Universidade Federal do Pará – UFPA, Belém, PA, Brasil How to cite: Amaral VS, Sousa DF, Benigno RNM, Pinheiro RHS, Gonçalves EC, Giese EG. Cotylophoron marajoensis n. sp. (Digenea: Paramphistomidae) a parasite of Bubalus bubalis on Marajó Island, Pará, Brazilian Amazon. Braz J Vet Parasitol 2020; 29(4): e018320. https://doi.org/10.1590/S1984-29612020101 Abstract The genus Cotylophoron belongs to the Paramphistomidae family and its definitive hosts are ruminants in general. This work describes the presence of a new species of the gender, a parasite in the rumen and reticulum of Bubalus bubalis, on Marajó Island in the Eastern Brazilian Amazon, using of light microscopy, scanning electronic microscopy and molecular biology techniques.
    [Show full text]
  • Classificação E Morfologia De Platelmintos Em Medicina Veterinária
    UNIVERSIDADE FEDERAL RURAL DO RIO DE JANEIRO INSTITUTO DE VETERINÁRIA CLASSIFICAÇÃO E MORFOLOGIA DE PLATELMINTOS EM MEDICINA VETERINÁRIA: TREMATÓDEOS SEROPÉDICA 2016 PREFÁCIO Este material didático foi produzido como parte do projeto intitulado “Desenvolvimento e produção de material didático para o ensino de Parasitologia Animal na Universidade Federal Rural do Rio de Janeiro: atualização e modernização”. Este projeto foi financiado pela Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ) Processo 2010.6030/2014-28 e coordenado pela professora Maria de Lurdes Azevedo Rodrigues (IV/DPA). SUMÁRIO Caracterização morfológica de endoparasitos de filos do reino Animalia 03 A. Filo Nemathelminthes 03 B. Filo Acanthocephala 03 C. Filo Platyhelminthes 03 Caracterização morfológica de endoparasitos do filo Platyhelminthes 03 C.1. Superclasse Cercomeridea 03 1. Classe Trematoda 03 1.1. Subclasse Digenea 03 1.1.1. Ordem Paramphistomida 03 A.1.Família Paramphistomidae 04 A. 1.1. Gênero Paramphistomum 04 Espécie Paramphistomum cervi 04 A.1.2. Gênero Cotylophoron 04 Espécie Cotylophoron cotylophorum 04 1.1.2. Ordem Echinostomatida 05 A. Superfamília Cyclocoeloidea 05 A.1. Família Cyclocoelidae 05 A.1.1.Gênero Typhlocoelum 05 Espécie Typhlocoelum cucumerinum 05 A.2. Família Fasciolidaea 06 A.2.1. Gênero Fasciola 06 Espécie Fasciola hepatica 06 A.3. Família Echinostomatidae 07 A.3.1. Gênero Echinostoma 07 Espécie Echinostoma revolutum 07 A.4. Família Eucotylidae 08 A.4.1. Gênero Tanaisia 08 Espécie Tanaisia bragai 08 1.1.3. Ordem Diplostomida 09 A. Superfamília Schistosomatoidea 09 A.1. Família Schistosomatidae 09 A.1.1. Gênero Schistosoma 09 Espécie Schistosoma mansoni 09 B.
    [Show full text]
  • Paramphistomum Spp in Irish Livestock
    HERD HEALTH < FOCUS Paramphistomum spp in Irish livestock A previously unidentified Paramphistomum spp, has now been identified in sheep flocks and deer herds; Sharon Magnier, ruminant technical adviser, MSD Animal Health, looks at the impact this will have in Irish livestock In the past, paramphistomosis (infection with rumen fluke) species of rumen fluke that has been identified in cattle is was not considered to be a significant parasitic disease Calicophoron daubneyi. in cattle in Europe. However, over the past few years the prevalence of rumen fluke has increased sharply and clinically CLINICAL SIGNS significant outbreaks have been reported in several European The immature stages of the fluke in the duodenum cause countries, including countries with a temperate climate, such clinical disease including enteritis with diarrhoea anorexia as Ireland.1 Since 2012 cases of clinical paramphistomosis, dehydration and increased thirst.3 Youngstock are more severe enough to cause mortalities have been reported in vulnerable than older cattle and infection has been both cattle and sheep.1 associated with high mortality in this group. LIFE CYCLE RUMEN FLUKE IN SHEEP The life cycle of rumen fluke has similarities to liver fluke in A recent study in Irish sheep flocks into the prevalence and that it is indirect, involving the mud snail (Galba truncatula) risk factors associated with rumen fluke demonstrated an as the intermediate host. Encysted fluke (metacercariae) on exceptionally high true flock prevalence of 85.7%.1 This is pasture are ingested by grazing ruminants. The cyst wall is considerably higher than the prevalence reported in other digested releasing immature fluke larvae into the duodenum.
    [Show full text]
  • Chronic Wasting Due to Liver and Rumen Flukes in Sheep
    animals Review Chronic Wasting Due to Liver and Rumen Flukes in Sheep Alexandra Kahl 1,*, Georg von Samson-Himmelstjerna 1, Jürgen Krücken 1 and Martin Ganter 2 1 Institute for Parasitology and Tropical Veterinary Medicine, Freie Universität Berlin, Robert-von-Ostertag-Str. 7-13, 14163 Berlin, Germany; [email protected] (G.v.S.-H.); [email protected] (J.K.) 2 Clinic for Swine and Small Ruminants, Forensic Medicine and Ambulatory Service, University of Veterinary Medicine Hannover, Foundation, Bischofsholer Damm 15, 30173 Hannover, Germany; [email protected] * Correspondence: [email protected] Simple Summary: Chronic wasting in sheep is often related to parasitic infections, especially to infections with several species of trematodes. Trematodes, or “flukes”, are endoparasites, which infect different organs of their hosts (often sheep, goats and cattle, but other grazing animals as well as carnivores and birds are also at risk of infection). The body of an adult fluke has two suckers for adhesion to the host’s internal organ surface and for feeding purposes. Flukes cause harm to the animals by subsisting on host body tissues or fluids such as blood, and by initiating mechanical damage that leads to impaired vital organ functions. The development of these parasites is dependent on the occurrence of intermediate hosts during the life cycle of the fluke species. These intermediate hosts are often invertebrate species such as various snails and ants. This manuscript provides an insight into the distribution, morphology, life cycle, pathology and clinical symptoms caused by infections of liver and rumen flukes in sheep.
    [Show full text]
  • Diplomarbeit
    DIPLOMARBEIT Titel der Diplomarbeit „Microscopic and molecular analyses on digenean trematodes in red deer (Cervus elaphus)“ Verfasserin Kerstin Liesinger angestrebter akademischer Grad Magistra der Naturwissenschaften (Mag.rer.nat.) Wien, 2011 Studienkennzahl lt. Studienblatt: A 442 Studienrichtung lt. Studienblatt: Diplomstudium Anthropologie Betreuerin / Betreuer: Univ.-Doz. Mag. Dr. Julia Walochnik Contents 1 ABBREVIATIONS ......................................................................................................................... 7 2 INTRODUCTION ........................................................................................................................... 9 2.1 History ..................................................................................................................................... 9 2.1.1 History of helminths ........................................................................................................ 9 2.1.2 History of trematodes .................................................................................................... 11 2.1.2.1 Fasciolidae ................................................................................................................. 12 2.1.2.2 Paramphistomidae ..................................................................................................... 13 2.1.2.3 Dicrocoeliidae ........................................................................................................... 14 2.1.3 Nomenclature ...............................................................................................................
    [Show full text]
  • Parasitology Volume 60 60
    Advances in Parasitology Volume 60 60 Cover illustration: Echinobothrium elegans from the blue-spotted ribbontail ray (Taeniura lymma) in Australia, a 'classical' hypothesis of tapeworm evolution proposed 2005 by Prof. Emeritus L. Euzet in 1959, and the molecular sequence data that now represent the basis of contemporary phylogenetic investigation. The emergence of molecular systematics at the end of the twentieth century provided a new class of data with which to revisit hypotheses based on interpretations of morphology and life ADVANCES IN history. The result has been a mixture of corroboration, upheaval and considerable insight into the correspondence between genetic divergence and taxonomic circumscription. PARASITOLOGY ADVANCES IN ADVANCES Complete list of Contents: Sulfur-Containing Amino Acid Metabolism in Parasitic Protozoa T. Nozaki, V. Ali and M. Tokoro The Use and Implications of Ribosomal DNA Sequencing for the Discrimination of Digenean Species M. J. Nolan and T. H. Cribb Advances and Trends in the Molecular Systematics of the Parasitic Platyhelminthes P P. D. Olson and V. V. Tkach ARASITOLOGY Wolbachia Bacterial Endosymbionts of Filarial Nematodes M. J. Taylor, C. Bandi and A. Hoerauf The Biology of Avian Eimeria with an Emphasis on Their Control by Vaccination M. W. Shirley, A. L. Smith and F. M. Tomley 60 Edited by elsevier.com J.R. BAKER R. MULLER D. ROLLINSON Advances and Trends in the Molecular Systematics of the Parasitic Platyhelminthes Peter D. Olson1 and Vasyl V. Tkach2 1Division of Parasitology, Department of Zoology, The Natural History Museum, Cromwell Road, London SW7 5BD, UK 2Department of Biology, University of North Dakota, Grand Forks, North Dakota, 58202-9019, USA Abstract ...................................166 1.
    [Show full text]
  • Parasite Ecology and the Conservation Biology of Black Rhinoceros (Diceros Bicornis)
    Parasite Ecology and the Conservation Biology of Black Rhinoceros (Diceros bicornis) by Andrew Paul Stringer A thesis submitted to Victoria University of Wellington in fulfilment of the requirement for the degree of Doctor of Philosophy Victoria University of Wellington 2016 ii This thesis was conducted under the supervision of: Dr Wayne L. Linklater Victoria University of Wellington Wellington, New Zealand The animals used in this study were treated ethically and the protocols used were given approval from the Victoria University of Wellington Animal Ethics Committee (ref: 2010R6). iii iv Abstract This thesis combines investigations of parasite ecology and rhinoceros conservation biology to advance our understanding and management of the host-parasite relationship for the critically endangered black rhinoceros (Diceros bicornis). My central aim was to determine the key influences on parasite abundance within black rhinoceros, investigate the effects of parasitism on black rhinoceros and how they can be measured, and to provide a balanced summary of the advantages and disadvantages of interventions to control parasites within threatened host species. Two intestinal helminth parasites were the primary focus of this study; the strongyle nematodes and an Anoplocephala sp. tapeworm. The non-invasive assessment of parasite abundance within black rhinoceros is challenging due to the rhinoceros’s elusive nature and rarity. Hence, protocols for faecal egg counts (FECs) where defecation could not be observed were tested. This included testing for the impacts of time since defecation on FECs, and whether sampling location within a bolus influenced FECs. Also, the optimum sample size needed to reliably capture the variation in parasite abundance on a population level was estimated.
    [Show full text]
  • Environmental Conservation Online System
    U.S. Fish and Wildlife Service Southeast Region Inventory and Monitoring Branch FY2015 NRPC Final Report Documenting freshwater snail and trematode parasite diversity in the Wheeler Refuge Complex: baseline inventories and implications for animal health. Lori Tolley-Jordan Prepared by: Lori Tolley-Jordan Project ID: Grant Agreement Award# F15AP00921 1 Report Date: April, 2017 U.S. Fish and Wildlife Service Southeast Region Inventory and Monitoring Branch FY2015 NRPC Final Report Title: Documenting freshwater snail and trematode parasite diversity in the Wheeler Refuge Complex: baseline inventories and implications for animal health. Principal Investigator: Lori Tolley-Jordan, Jacksonville State University, Jacksonville, AL. ______________________________________________________________________________ ABSTRACT The Wheeler National Wildlife Refuge (NWR) Complex includes: Wheeler, Sauta Cave, Fern Cave, Mountain Longleaf, Cahaba, and Watercress Darter Refuges that provide freshwater habitat for many rare, endangered, endemic, or migratory species of animals. To date, no systematic, baseline surveys of freshwater snails have been conducted in these refuges. Documenting the diversity of freshwater snails in this complex is important as many snails are the primary intermediate hosts of flatworm parasites (Trematoda: Digenea), whose infection in subsequent aquatic and terrestrial vertebrates may lead to their impaired health. In Fall 2015 and Summer 2016, snails were collected from a variety of aquatic habitats at all Refuges, except at Mountain Longleaf and Cahaba Refuges. All collected snails were transported live to the lab where they were identified to species and dissected to determine parasite presence. Trematode parasites infecting snails in the refuges were identified to the lowest taxonomic level by sequencing the DNA barcoding gene, 18s rDNA. Gene sequences from Refuge parasites were matched with published sequences of identified trematodes accessioned in the NCBI GenBank database.
    [Show full text]
  • TB1066 Current Stateof Knowledge and Research on Woodland
    June 2020 A Review of the Relationship Between Flow,Current Habitat, State and of Biota Knowledge in LOTIC and SystemsResearch and on Methods Woodland for Determining Caribou Instreamin Canada Low Requirements 9491066 Current State of Knowledge and Research on Woodland Caribou in Canada No 1066 June 2020 Prepared by Kevin A. Solarik, PhD NCASI Montreal, Quebec National Council for Air and Stream Improvement, Inc. Acknowledgments A great deal of thanks is owed to Dr. John Cook of NCASI for his considerable insight and the revisions he provided in improving earlier drafts of this report. Helpful comments on earlier drafts were also provided by Kirsten Vice, NCASI. For more information about this research, contact: Kevin A. Solarik, PhD Kirsten Vice NCASI NCASI Director of Forestry Research, Canada and Vice President, Sustainable Manufacturing and Northeastern/Northcentral US Canadian Operations 2000 McGill College Avenue, 6th Floor 2000 McGill College Avenue, 6th Floor Montreal, Quebec, H3A 3H3 Canada Montreal, Quebec, H3A 3H3 Canada (514) 907-3153 (514) 907-3145 [email protected] [email protected] To request printed copies of this report, contact NCASI at [email protected] or (352) 244-0900. Cite this report as: NCASI. 2020. Current state of knowledge and research on woodland caribou in Canada. Technical Bulletin No. 1066. Cary, NC: National Council for Air and Stream Improvement, Inc. Errata: September 2020 - Table 3.1 (page 34) and Table 5.2 (pages 55-57) were edited to correct omissions and typos in the data. © 2020 by the National Council for Air and Stream Improvement, Inc. EXECUTIVE SUMMARY • Caribou (Rangifer tarandus) is a species of deer that lives in the tundra, taiga, and forest habitats at high latitudes in the northern hemisphere, including areas of Russia and Scandinavia, the United States, and Canada.
    [Show full text]
  • Review on Paramphistomosis
    Advances in Biological Research 14 (4): 184-192, 2020 ISSN 1992-0067 © IDOSI Publications, 2020 DOI: 10.5829/idosi.abr.2020.184.192 Review on Paramphistomosis 12Adane Seifu Hotessa and Demelash Kalo Kanko 1Hawassa University, Revenue Generating PLC Farm, P.O. Box: 05, Hawassa, Ethiopia 2Gerese Woreda Livestock and Fishery Resource Office, Gamo Zone, SNNPR, Ethiopia Abstract: Paramphistomum is considered to be one of the most important emerging rumen fluke affecting livestock worldwide and the scenario is worst in tropical and sub-tropical regions. Different species of rumen fluke or paramphistomum dominate in different countries. For example, Calicophoron calicophorum is the most common species in Australia whilst Paramphistomum cervi is described as the most common species in countries as far apart as Pakistan and Mexico. In the Mediterranean and temperate regions of Algeria and Europe, Calicophoron daubneyi predominates and it has recently also been recognized as the main rumen fluke in the British Isles. Sharp increases in the prevalence of rumen fluke infections have been recorded across Western European countries. The species Calicophoron daubneyi has been identified as the primary rumen fluke parasite infecting cattle, sheep and goats in Europe. In our country Ethiopia also paramphistomum has been reported from different parts of the country. The rumen fluke life cycle requires two hosts; featuring snail intermediate host and the mammalian host usually, ruminants are the definitive host. The infection of the definitive host is initiated by the ingestion of encysted metacercariae attached to vegetation or floating in the water. Diagnosis of rumen fluke is based on the clinical sign usually involving young animals in the herd history of grazing land around the snail habitat.
    [Show full text]
  • Fasciola and Paramphistomum INFECTIONS in SMALL RUMINANTS (SHEEP and GOAT) in TERENGGANU
    MALAYSIAN JOURNAL OF VETERINARY RESEARCH pages 8-12 • VOLUME 8 NO. 2 JULY 2017 Fasciola AND Paramphistomum INFECTIONS IN SMALL RUMINANTS (SHEEP AND GOAT) IN TERENGGANU MURSYIDAH A.K.1, KHADIJAH S.1* AND RITA N.1 School of Food Science and Technology, Universiti Malaysia Terengganu, 21300, Kuala Terengganu, Terengganu, Malaysia. * Corresponding author: [email protected] ABSTRACT. A study was conducted to INTRODUCTION identify the current status of Fasciola and Paramphistomum infections in small About 70% of small ruminants farming in ruminants in Terengganu. A total of 267 Malaysia were reared in small farms, usually faecal samples from small ruminants were in small groups of 20-50 animals (Alimon, collected and subjected to sedimentation 1990). Trematode infections are the main technique. Serum samples were diagnosed threat to the production of sheep and goats for detection of IgG antibody for Fasciola in both small-scale and large-scale farms infection using sELISA method. Results (Copeman, 1980; Sani and Rajamanickam, showed that there were 4% of the goats 1990; Koinari et al., 2013). These infections positive with Paramphistomum eggs whereas were caused by two different species, Fasciola egg was not observed in any of Fasciola sp. and Paramphistomum sp. Both the faecal samples. However, it was found species are categorised as a food- or water- that 89% of the serum samples from goats borne trematodiasis where Fasciola infection were positive with IgG antibody for Fasciola is considered as one of the most significant infection. Small ruminants in Terengganu parasitic disease for domestic ruminants were not infected with severe Fasciola (Saleha, 1991; Hopkins, 1992).
    [Show full text]
  • Paramphistomum Cervi Infection in the Liver of Buffaloes in Karachi and Its Economic Importance
    INT. J. BIOL. BIOTECH., 6 (4): 283-287, 2009. PARAMPHISTOMUM CERVI INFECTION IN THE LIVER OF BUFFALOES IN KARACHI, PAKISATN Samreen Mirza1, Nasira Khatoon1 and F.M. Bilqees2 1Department of Zoology, University of Karachi, Karachi-75270, Pakistan 2Jinnah University for Women, Karachi, Pakistan. ABSTRACT Paramphistomum cervi is one of the most common trematode infection in bovines specially in buffaloes. The present studies have confirmed that a least 50-70% buffaloes slaughtered in slaughter houses are infected with this trematode. During the present survey 130 out of 150 buffaloes were found infected with this parasite, the commonly infected organ was found to be the liver. Hundreds of trematodes were found attached to liver and sometimes hardly any liver tissue was obvious appearing as a mass of beads. This infection has an adverse effect on the health of animals and their byproducts. Key-words: Trematode, Paramphistomum cervi, buffaloes, liver infection, histopathology, Karachi, Pakistan. INTRODUCTION Pakistan is a developing country and a large population is engaged with agriculture. They cultivate the crops and domesticate livestock for the national needs. Pakistan is deficient in the production of animal food to feed its increasing human population, which was previously estimated as 148.72 million (Economic Survey of Pakistan, 2005). Importance of livestock in our socio-economic life is obvious. On the pure economic side, it is one of the major sub-sectors of our economy with its share to Gross National Production (GNP). It is responsible for roughly one third (⅓) of total share of agriculture to the GNP. Livestock accounts for 30% of the Agricultural Gross Domestic Production (GDP) and about 10.6% of total GDP (Economic Survey of Pakistan, 2005).
    [Show full text]