South Korea, 2019
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
13914444D46c0aa91d02e31218
2 Breeding of wild and some domestic animals at regional zoological institutions in 2013 3 РЫБЫ P I S C E S ВОББЕЛОНГООБРАЗНЫЕ ORECTOLOBIFORMES Сем. Азиатские кошачьи акулы (Бамбуковые акулы) – Hemiscyllidae Коричневополосая бамбуковая акула – Chiloscyllium punctatum Brownbanded bambooshark IUCN (NT) Sevastopol 20 ХВОСТОКОЛООБРАЗНЫЕ DASYATIFORMES Сем. Речные хвостоколы – Potamotrygonidae Глазчатый хвостокол (Моторо) – Potamotrygon motoro IUCN (DD) Ocellate river stingray Sevastopol - ? КАРПООБРАЗНЫЕ CYPRINIFORMES Сем. Цитариновые – Citharinidae Серебристый дистиход – Distichodusaffinis (noboli) Silver distichodus Novosibirsk 40 Сем. Пираньевые – Serrasalmidae Серебристый метиннис – Metynnis argenteus Silver dollar Yaroslavl 10 Обыкновенный метиннис – Metynnis schreitmuelleri (hypsauchen) Plainsilver dollar Nikolaev 4; Novosibirsk 100; Kharkov 20 Пятнистый метиннис – Metynnis maculatus Spotted metynnis Novosibirsk 50 Пиранья Наттерера – Serrasalmus nattereri Red piranha Novosibirsk 80; Kharkov 30 4 Сем. Харацидовые – Characidae Красноплавничный афиохаракс – Aphyocharax anisitsi (rubripinnis) Bloodfin tetra Киев 5; Perm 10 Парагвайский афиохаракс – Aphyocharax paraquayensis Whitespot tetra Perm 11 Рубиновый афиохаракс Рэтбина – Aphyocharax rathbuni Redflank bloodfin Perm 10 Эквадорская тетра – Astyanax sp. Tetra Perm 17 Слепая рыбка – Astyanax fasciatus mexicanus (Anoptichthys jordani) Mexican tetra Kharkov 10 Рублик-монетка – Ctenobrycon spilurus (+ С. spilurusvar. albino) Silver tetra Kharkov 20 Тернеция (Траурная тетра) – Gymnocorymbus -
Changing Pattern of Spatio-Social Interrelationship of Hunting Community in Upper Dibang Valley
Changing Pattern of Spatio-Social Interrelationship of Hunting Community in Upper Dibang Valley, Arunachal Pradesh A Dissertation submitted To Sikkim University In Partial Fulfilment of the Requirements for the Degree of Master of Philosophy By MOHAN SHARMA Department of Geography School of Human Sciences February 2020 Date: 07/02/2020 DECLARATION I, Mohan Sharma, hereby declare that the research work embodied in the Dissertation titled “Changing Pattern of Spatio-Social Interrelationship of Hunting Community in Upper Dibang Valley, Arunachal Pradesh” submitted to Sikkim University for the award of the Degree of Master of Philosophy, is my original work. The thesis has not been submitted for any other degree of this University or any other University. (Mohan Sharma) Roll Number: 18MPGP01 Regd. No.: 18MPhil/GOG/01 Name of the Department: Geography Name of the School: Human Sciences Date: 07/02/2020 CERTIFICATE This is to certify that the dissertation titled “Changing Pattern of Spatio-Social Interrelationship of Hunting Community in Upper Dibang Valley, Arunachal Pradesh” submitted to Sikkim University for the partial fulfilment of the degree of Master of Philosophy in the Department of Geography, embodies the result of bonafide research work carried out by Mr. Mohan Sharma under our guidance and supervision. No part of the dissertation has been submitted for any other degree, diploma, associateship and fellowship. All the assistance and help received during the course of the investigation have been duly acknowledged by him. We recommend -
Keshav Ravi by Keshav Ravi
by Keshav Ravi by Keshav Ravi Preface About the Author In the whole world, there are more than 30,000 species Keshav Ravi is a caring and compassionate third grader threatened with extinction today. One prominent way to who has been fascinated by nature throughout his raise awareness as to the plight of these animals is, of childhood. Keshav is a prolific reader and writer of course, education. nonfiction and is always eager to share what he has learned with others. I have always been interested in wildlife, from extinct dinosaurs to the lemurs of Madagascar. At my ninth Outside of his family, Keshav is thrilled to have birthday, one personal writing project I had going was on the support of invested animal advocates, such as endangered wildlife, and I had chosen to focus on India, Carole Hyde and Leonor Delgado, at the Palo Alto the country where I had spent a few summers, away from Humane Society. my home in California. Keshav also wishes to thank Ernest P. Walker’s Just as I began to explore the International Union for encyclopedia (Walker et al. 1975) Mammals of the World Conservation of Nature (IUCN) Red List species for for inspiration and the many Indian wildlife scientists India, I realized quickly that the severity of threat to a and photographers whose efforts have made this variety of species was immense. It was humbling to then work possible. realize that I would have to narrow my focus further down to a subset of species—and that brought me to this book on the Endangered Mammals of India. -
Ectoparasites of Bats in Mongolia, Part 2 (Ischnopsyllidae, Nycteribiidae, Cimicidae and Acari) Ingo Scheffler University of Potsdam, [email protected]
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Erforschung biologischer Ressourcen der Mongolei Institut für Biologie der Martin-Luther-Universität / Exploration into the Biological Resources of Halle-Wittenberg Mongolia, ISSN 0440-1298 2012 Ectoparasites of Bats in Mongolia, Part 2 (Ischnopsyllidae, Nycteribiidae, Cimicidae and Acari) Ingo Scheffler University of Potsdam, [email protected] Dietrich Dolch Radensleben, Germany Jargalsaikhan Ariunbold Mongolian State University of Education Annegret Stubbe Martin-Luther Universität, [email protected] Andreas Abraham University of Potsdam FSeoe nelloxtw pa thige fors aaddndition addal aitutionhorsal works at: http://digitalcommons.unl.edu/biolmongol Part of the Asian Studies Commons, Biodiversity Commons, Environmental Sciences Commons, Nature and Society Relations Commons, Other Animal Sciences Commons, Parasitology Commons, and the Zoology Commons Scheffler, Ingo; Dolch, Dietrich; Ariunbold, Jargalsaikhan; Stubbe, Annegret; Abraham, Andreas; and Thiele, Klaus, "Ectoparasites of Bats in Mongolia, Part 2 (Ischnopsyllidae, Nycteribiidae, Cimicidae and Acari)" (2012). Erforschung biologischer Ressourcen der Mongolei / Exploration into the Biological Resources of Mongolia, ISSN 0440-1298. 16. http://digitalcommons.unl.edu/biolmongol/16 This Article is brought to you for free and open access by the Institut für Biologie der Martin-Luther-Universität Halle-Wittenberg at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Erforschung biologischer Ressourcen der Mongolei / Exploration into the Biological Resources of Mongolia, ISSN 0440-1298 by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Authors Ingo Scheffler, Dietrich Dolch, Jargalsaikhan Ariunbold, Annegret Stubbe, Andreas Abraham, and Klaus Thiele This article is available at DigitalCommons@University of Nebraska - Lincoln: http://digitalcommons.unl.edu/biolmongol/16 Copyright 2012, Martin-Luther-Universität Halle Wittenberg, Halle (Saale). -
The Best of Korea 10 Days UNESCO World Heritage Tour to Seoul, Jeju Island, Busan, Gyeongju, Daegu, Andong & Mt
The Best of Korea 10 days UNESCO World Heritage Tour to Seoul, Jeju Island, Busan, Gyeongju, Daegu, Andong & Mt. Sorak This amazing tour visit major world cultural and natural heritages in Korea designated by UNESCO in order to help foreign visitors to have broad and deep understanding of Korean. Starting from hustle and bustle metropolitan city of Seoul, to deep blue waters of Jeju Island, then UNESCO heritages of Bulguksa Tempe, Tripitaka Koreana and Seoraksan National Park, there are a lot to see in this beautiful country! Day 1 Arrival Seoul Departure on Friday Upon arrival at Incheon International Airport you are met by our representative and transfer to check in your hotel. The rest of day is at your leisure. Day 2 Seoul – DMZ half day tour (Meal: B) 07:30~14:20, Passport is required to join 07:30 Pick up from your hotel and drive to Imjingak Park; you will have ID check at Unification Bridge before we head to DMZ theatre & Exhibition hall. Then followed by visiting the 3rd infiltration tunnel- Dorasan Observatory and Dorasan Station. After lunch, continue your tour to Advance Camp, Joint Security Area, Freedom House, Conference Room, UN guard post 3, Bridge of no return and Imjingak Park. Return to Seoul and visit Ginseng Center at around 14:30. You will be drop off at Itaewon street where you can enjoy your free time there. Return to hotel on your own. Day 3 Seoul – Jeju Island (Meal: B) You are transferred to the airport for your early morning flight to Jeju Island. -
TAXONOMIC STUDIES from RODENT OUTBREAK AREAS in the CHITTAGONG HILL TRACTS Nikhil
Bangladesh J. Zool. 46(2): 217-230, 2018 ISSN: 0304-9027 (print) 2408-8455 (online) NEW RECORDS OF RODENT SPECIES IN BANGLADESH: TAXONOMIC STUDIES FROM RODENT OUTBREAK AREAS IN THE CHITTAGONG HILL TRACTS Nikhil Chakma*, Noor Jahan Sarker, Steven Belmain1, Sohrab Uddin Sarker, Ken Aplin2 and Sontosh Kumar Sarker3 Department of Zoology, University of Dhaka, Dhaka-1000, Bangladesh Abstract: Rodents are regarded as crop pests, significant reservoirs and vectors for many zoonotic diseases around the world. Basic taxonomic information of rodents present in a locality can help understand which species are responsible as crop pest in that habitat. The phenomenon of the 50-year cycle of gregarious bamboo flowering and rodent outbreaks in the Chittagong Hill Tracts (CHT) of Bangladesh, rodents trapping were carried out in four habitats from March, 2009 to December, 2011 in Ruma upazila of Bandarban hill district. Variety of traps were used to capture small mammals. The captured species were measured and identified using taxonomical dichotomous keys and DNA bar-coding performed in Australia. A total of 14 different small mammalian species were captured of which nine belonging to the Muridae family, and one species each of Spalacidae, Sciuridae, Tupaiidae and Soricidae families. The dominant small mammal species captured were Rattus rattus (54.06%) followed by Mus musculus (26.39%), Rattus nitidus (10.98%), Suncus murinus (5.45%), Mus terricolor (1.09%), Mus cookii nagarum (0.97%), Cannomys badius (0.16%), Leopoldamys edwardsi (0.12%), Berylmys bowersi (0.12%), Vernaya fulva (0.08%), Rattus andamanensis (0.08%), Tupaia glis (0.04%) and Callosciurus pygerythrus (0.04%). -
Table S1. Nakharuthai and Srisapoome (2020)
Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P. -
Mouse Models of Human Disease an Evolutionary Perspective Robert L
170 commentary Evolution, Medicine, and Public Health [2016] pp. 170–176 doi:10.1093/emph/eow014 Mouse models of human disease An evolutionary perspective Robert L. Perlman* Department of Pediatrics, The University of Chicago, 5841 S. Maryland Ave, MC 5058, Chicago, IL 60637, USA *E-mail: [email protected] Received 31 December 2015; revised version accepted 12 April 2016 ABSTRACT The use of mice as model organisms to study human biology is predicated on the genetic and physio- logical similarities between the species. Nonetheless, mice and humans have evolved in and become adapted to different environments and so, despite their phylogenetic relatedness, they have become very different organisms. Mice often respond to experimental interventions in ways that differ strikingly from humans. Mice are invaluable for studying biological processes that have been conserved during the evolution of the rodent and primate lineages and for investigating the developmental mechanisms by which the conserved mammalian genome gives rise to a variety of different species. Mice are less reliable as models of human disease, however, because the networks linking genes to disease are likely to differ between the two species. The use of mice in biomedical research needs to take account of the evolved differences as well as the similarities between mice and humans. KEYWORDS: allometry; cancer; gene networks; life history; model organisms transgenic, knockout, and knockin mice, have If you have cancer and you are a mouse, we can provided added impetus and powerful tools for take good care of you. Judah Folkman [1] mouse research, and have led to a dramatic increase in the use of mice as model organisms. -
Controlled Animals
Environment and Sustainable Resource Development Fish and Wildlife Policy Division Controlled Animals Wildlife Regulation, Schedule 5, Part 1-4: Controlled Animals Subject to the Wildlife Act, a person must not be in possession of a wildlife or controlled animal unless authorized by a permit to do so, the animal was lawfully acquired, was lawfully exported from a jurisdiction outside of Alberta and was lawfully imported into Alberta. NOTES: 1 Animals listed in this Schedule, as a general rule, are described in the left hand column by reference to common or descriptive names and in the right hand column by reference to scientific names. But, in the event of any conflict as to the kind of animals that are listed, a scientific name in the right hand column prevails over the corresponding common or descriptive name in the left hand column. 2 Also included in this Schedule is any animal that is the hybrid offspring resulting from the crossing, whether before or after the commencement of this Schedule, of 2 animals at least one of which is or was an animal of a kind that is a controlled animal by virtue of this Schedule. 3 This Schedule excludes all wildlife animals, and therefore if a wildlife animal would, but for this Note, be included in this Schedule, it is hereby excluded from being a controlled animal. Part 1 Mammals (Class Mammalia) 1. AMERICAN OPOSSUMS (Family Didelphidae) Virginia Opossum Didelphis virginiana 2. SHREWS (Family Soricidae) Long-tailed Shrews Genus Sorex Arboreal Brown-toothed Shrew Episoriculus macrurus North American Least Shrew Cryptotis parva Old World Water Shrews Genus Neomys Ussuri White-toothed Shrew Crocidura lasiura Greater White-toothed Shrew Crocidura russula Siberian Shrew Crocidura sibirica Piebald Shrew Diplomesodon pulchellum 3. -
Conservation Studies of Korean Stone Heritages
Conservation Studies of Korean Stone Heritages Chan Hee Lee Department of Cultural Heritage Conservation Sciences, Kongju National University, Gongju, 32588, Republic of Korea Keywords: Korean stone heritages, Conservation, Weathering, Damage, Environmental control. Abstract: In Republic of Korea, a peninsula country located at the eastern region of the Asian continent, is mostly composed of granite and gneiss. The southern Korean peninsula stated approximately 7,000 tangible cultural heritages. Of these, the number of stone heritages are 1,882 (26.8%), showing a diverse types such as stone pagoda (25.8%), stone Buddha statues (23.5%), stone monuments (18.1%), petroglyph, dolmen, fossils and etc. Igneous rock accounts for the highest portion of the stone used for establishing Korean stone heritages, forming approximately 84% of state-designated cultural properties. Among these, granite was used most often, 68.2%, followed by diorite for 8.2%, and sandstone, granite gneiss, tuff, slate, marble, and limestone at less than 4% each. Furthermore, values of the Korean stone heritages are discussed as well as various attempts for conservation of the original forms of these heritages. It is generally known that the weathering and damage degrees of stone heritage are strongly affected by temperature and precipitation. The most Korean stone heritages are corresponded to areas of middle to high weathering according to topography and annual average temperature and precipitation of Korea. Therefore, examination of environmental control methods are required for conservation considering the importance of stone heritages exposed to the outside conditions, and monitoring and management systems should be established for stable conservation in the long term. -
Micromys Minutus)
Acta Theriol (2013) 58:101–104 DOI 10.1007/s13364-012-0102-0 SHORT COMMUNICATION The origin of Swedish and Norwegian populations of the Eurasian harvest mouse (Micromys minutus) Lars Råberg & Jon Loman & Olof Hellgren & Jeroen van der Kooij & Kjell Isaksen & Roar Solheim Received: 7 May 2012 /Accepted: 17 September 2012 /Published online: 29 September 2012 # Mammal Research Institute, Polish Academy of Sciences, Białowieża, Poland 2012 Abstract The harvest mouse (Micromys minutus) occurs the Mediterranean, from France to Russia and northwards throughout most of continental Europe. There are also two to central Finland (Mitchell-Jones et al. 1999). Recently, isolated and recently discovered populations on the it has also been found to occur in Sweden and Norway. Scandinavian peninsula, in Sweden and Norway. Here, we In 1985, an isolated population was discovered in the investigate the origin of these populations through analyses province of Dalsland in western Sweden (Loman 1986), of mitochondrial DNA. We found that the two populations and during the last decade, this population has been on the Scandinavian peninsula have different mtDNA found to extend into the surrounding provinces as well haplotypes. A comparison of our haplotypes to published as into Norway. The known distribution in Norway is sequences from most of Europe showed that all Swedish and limited to a relatively small area close to the Swedish Norwegian haplotypes are most closely related to the border, in Eidskog, Hedmark (van der Kooij et al. 2001; haplotypes in harvest mice from Denmark. Hence, the two van der Kooij et al., unpublished data). In 2007, another populations seem to represent independent colonisations but population was discovered in the province of Skåne in originate from the same geographical area. -
Genetic Diversity of Northeastern Palaearctic Bats As Revealed by DNA Barcodes
Acta Chiropterologica, 14(1): 1–14, 2012 PL ISSN 1508-1109 © Museum and Institute of Zoology PAS doi: 10.3161/150811012X654222 Genetic diversity of northeastern Palaearctic bats as revealed by DNA barcodes SERGEI V. K RUSKOP1, ALEX V. B ORISENKO2, NATALIA V. I VANOVA2, BURTON K. LIM3, and JUDITH L. EGER3 1Zoological Museum of Moscow University, Ul Bol’shata Nikitskaya, 6, Moscow, Russia, 125009 2Canadian Centre for DNA Barcoding, Biodiversity Institute of Ontario, University of Guelph, 50 Stone Road E, Guelph, Ontario, Canada, N1G 2W1 3Department of Natural History, Royal Ontario Museum, 100 Queen’s Park, Toronto, Ontario, Canada, M5S 2C6 4Corresponding author: E-mail: [email protected] Sequences of the DNA barcode region of the cytochrome oxidase subunit I gene were obtained from 38 species of northeastern Palaearctic bats to assess patterns of genetic diversity. These results confirmed earlier findings of deep phylogeographic splits in four pairs of vicariant species (Myotis daubentonii/petax, M. nattereri/bombinus, Plecotus auritus/ognevi and Miniopterus schreibersii/ fuliginosus) and suggested previously unreported splits within Eptesicus nilssoni and Myotis aurascens. DNA barcodes support all taxa raised to species rank in the past 25 years and suggest that an additional species — Myotis sibiricus — should be separated from Myotis brandtii. Major phylogeographic splits occur between European and Asian populations of Myotis aurascens, Rhinolophus ferrumequinum and Myotis frater; smaller scale splits are observed between insular and mainland populations in the Far East (M. frater, Myotis ikonnikovi and Murina ussuriensis) and also between southeastern Europe and Ciscaucasia (Myotis daubentonii, Plecotus auritus, and Pipistrellus pipistrellus). One confirmed case of sequence sharing was observed in our dataset — Eptesicus nilssoni/serotinus.