Investigating the Antiquity of Inter-Regional Contact Between Southern Yukon and the Northern Northwest Coast Through an Ancient

University of Calgary PRISM: University of Calgary's Digital Repository

Graduate Studies The Vault: Electronic Theses and Dissertations

2015-08-07 Investigating the Antiquity of Inter-Regional Contact between Southern Yukon and the Northern Northwest Coast through an Ancient DNA Analysis of Cryogenic Wooden Biofacts Recovered from Alpine Archaeological Sites in the Northwestern Subarctic

Murchie, Tyler James

Murchie, T. J. (2015). Investigating the Antiquity of Inter-Regional Contact between Southern Yukon and the Northern Northwest Coast through an Ancient DNA Analysis of Cryogenic Wooden Biofacts Recovered from Alpine Archaeological Sites in the Northwestern Subarctic (Unpublished master's thesis). University of Calgary, Calgary, AB. doi:10.11575/PRISM/26636 http://hdl.handle.net/11023/2386 master thesis

University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY

Investigating the Antiquity of Inter-Regional Contact between Southern Yukon and the Northern

Northwest Coast through an Ancient DNA Analysis of Cryogenic Wooden Biofacts Recovered

from Alpine Archaeological Sites in the Northwestern Subarctic

Tyler James Murchie

A THESIS

SUBMITTED TO THE FACULTY OF GRADUATE STUDIES

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE

DEGREE OF MASTER OF ARTS

GRADUATE PROGRAM IN ARCHAELOGY

CALGARY, ALBERTA

AUGUST, 2015

Abstract

The antiquity of contact between Eyak-Tlingit in Southeastern Alaska and Athabaskans in Southern Yukon is poorly understood. Archaeological evidence of inter-regional interaction is currently confined to the Late Period, although there is ethnographic evidence of more ancient networks. The discovery of a cryogenically preserved stick (willow [Salix sp.]), from the Kluane

Icefields may represent the region’s earliest evidence (2430 ± 20 14C BP) of glacial travel.

Ancient DNA was used in an attempt to assess the specimen’s origin based on a phylogeographic analysis of modern Salix distributed on either side of the Saint Elias Range. DNA could not be amplified from the target specimen, leading to an investigation of the viability of paleogenetics for wooden artifacts using biofacts from alpine ice patches in Southern Yukon. A considerable lack of plastid variability was observed in modern Salix ssp., although three loci were identified that may be amenable to phylogeographic applications.

Preface

In the early stages of this research, I had intended to analyze the willow stick from

Kluane National Park foremost in order to determine whether the specimen had intact aDNA.

Legal issues regarding the specimen emerged as a result of my permit application weeks before departing for field work, resulting in a change in the project’s trajectory towards investigating the viability of aDNA for cryogenic wooden artifacts and biofacts. The new focus aimed at continuing to build upon foundational investigations in aDNA with degraded wood, and facilitate new research projects targeting these important specimens, especially the marginally researched cryogenic biofacts recovered from alpine ice patches for biomolecular applications. Restrictions on the Kluane specimen lasted approximately 1.5 years—far longer than I had originally anticipated, and after most of the other laboratory work had been completed. This partially shaped the delimitations of the research project.

Acknowledgements

Foremost, I would like to thank Peter Dawson (my supervisor) for his guidance and assistance throughout my master’s degree. He further provided extremely helpful support during the first field season while sampling modern willow, and has kindly written many letters of recommendation on my behalf. Camilla Speller was integral to this study by generously sacrificing her time to train me in the Ancient DNA Facility at the University of Calgary before moving to York, but also for her continued support answering questions and providing advice on matters related to the facility through email. Brian Kooyman has been exceptionally helpful and generous throughout the project. I thank him immensely for his thoughtful comments on my interim report, thorough edits to my thesis following my defense, and his continued support over the years in a wide variety of circumstances. I wish to further acknowledge and thank the members of my defense committee (Peter Dawson, Brian Kooyman, Gerald Oetelaar, and

Edward Yeung) for their time and thoughtful consideration of this work, which has improved its quality, readability, and focus.

My thanks to Gerald Holdsworth for providing information on the target specimen and our continued discussions on its analysis. I wish to thank Jeff Hunston and Gregory Hare for their support in Whitehorse, particularly with my permit applications related to the legal proceedings. Gregory Hare also helped immensely with modern sample collection, as well as comments on my archaeological background chapter. I also wish to acknowledge the Yukon

Government: Department of Tourism and Culture, Parks Canada (particularly Carmen Wong,

Sharon Thompson, and Jose Milne) for their support. I apologize for all of the legal issues my permit application caused. My thanks to Kluane First Nations, Champagne-Aishihik First

iii

Nations, Sheila Greer, and all other associated Yukon and Alaskan First Nations for consenting to this analysis.

Thank you to Sean Rogers for allowing us to use a portion of his busy laboratory for our post-PCR analyses, as well as Dale Walde for permitting us a space in ‘the dungeon’ for storage of our post-PCR clothing. I wish to also acknowledge the support of the Department of

Archaeology, University of Calgary (now Department of Anthropology and Archaeology) for their financial assistance with laboratory equipment and reagents, in addition to the Department of Biological Sciences, University of Calgary.

My sincere thanks to the US National Parks Service: Wrangell-St. Elias National Park and Preserve, particularly Miranda Terwilliger for her assistance with my permit application, and especially Michael Thompson for all of his help during my stay in Yakutat, Alaska. My thanks as well to Yak-Tat Kwaan, Inc.

Thank you to M. Anne Katzenberg for allowing me to work in her Stable Isotope

Laboratory, and special thanks to Kris Russell Markin for all the training, patience, and kindness while helping me use the liquid nitrogen mill. I’m glad we finally got the stupid nozzle to seal!

All of the friends and colleagues I have come to know in the Archaeology Department at the University of Calgary through both my undergraduate and master’s degrees have made my time here a truly amazing experience. I am lucky to have come to know the following subset of graduate and undergraduate students during my master’s degree (in no particular order [my sincere apologies to anyone in my cohort that I missed in the following list]): Jamie Eddy, Lance

Evans, Michael Moloney, Steve Simpson, Donald Butler, Robert Patalano, Courtney McConnan

Borstad, Sean Pickering, Mary Lynn Tobiasz, Kim Edwards, Margie Patton, Adrianne

Offenbacker, Alexa Chantel Lacroix, Ana Morales-Arce, Taylor Graham, Shawn Morton, Adam

Benfer, Ashley Nagel, Nicki Engel, Robyn Crook, Rebecca Rainville, Tobi Krahulic, Cara

Tremain, Colleen Hughes, and Sarah Bednar. Special thanks to our archaeology house “The

Brewery” and all of the brewers who lived there during my time. Further thanks to Lance Evans and especially Mary Lynn Tobiasz who guided me in the enigmatic ways of ArcGIS, with Mary also being invaluable as an editor and friend. Nicola Howard, Courtney Wright, and particularly

Nicole Ethier have helped me immensely over the years as amazing administrative and technical staff in the department. I wish to wholeheartedly thank Alexa Chantel Lacroix for her selfless and extensive help during the second half of this project as an amazing laboratory and field assistant, a kind and thoughtful editor, and an incredible friend. Thank you as well to my aDNA colleagues: Christian Barron-Ortiz, Ana Morales-Arce, Norma French, Brian Kooyman, Bjorn

Bartholdy, and Krystyna Hacking.

I have been lucky to work for the cultural resource management company Stantec Inc. during the final years of my undergrad, and first couple years of my graduate degree at the

University of Calgary. I wish to thank Alan Youell, Dale Boland, Matt Moors, Jennifer Tischer,

Kate Peach, and Alison Landals as well as everyone else I came to know at the company.

The following agencies supported this research and its dissemination financially, for which I owe immense thanks: Social Sciences and Research Council of Canada, the Arctic

Institute of North America: Northern Scientific Training Program, Faculty of Graduate Studies and Graduate Students Association (University of Calgary), the University of Calgary and

University Research Grants Committee, the Canadian Archaeological Association, and the

Government of Alberta.

Finally, I wish to thank my family for their support over the years.

Dedication

I dedicate this work to my mother and father.

Thank you for always believing in me.

Table of Contents Abstract ...... i Preface...... ii Acknowledgements ...... iii Dedication ...... vi Table of Contents ...... vii List of Tables ...... xi List of Figures and Illustrations ...... xii List of Symbols, Abbreviations and Nomenclature ...... xiv

CHAPTER ONE: INTRODUCTION ...... 1

CHAPTER TWO: ARCHAEOLOGY AND ENVIRONMENT ...... 8 2.1 The Archaeological Record ...... 9 2.1.1 The Northwestern Subarctic ...... 10 2.1.1.1 Environment and Geography ...... 10 2.1.1.1.1 Southern and Central Yukon ...... 10 2.1.1.1.2 Subarctic Alaska (Southcentral and the Interior) ...... 17 2.1.1.2 Subarctic Culture History ...... 18 2.1.1.2.1 The Northern Archaic ...... 23 2.1.1.2.2 White River Ash, Arrowheads, and Athapaskans ...... 27 2.1.1.2.3 Ethnographic Athapaskans ...... 34 2.1.1.2.3.1 Early Ethnographic Data ...... 40 2.1.2 Northern Northwest Coast ...... 43 2.1.2.1 Environment and Geography of Southeastern Alaska ...... 43 2.1.2.2 Northern Northwest Coast Culture History ...... 46 2.1.2.2.1 Middle Period ...... 47 2.1.2.2.2 Late Period ...... 47 2.1.2.2.3 Ethnohistoric ...... 48 2.2 Cryogenic Archaeology ...... 49 2.2.1 Ice Patch Formation Processes ...... 52 2.2.2 Archaeology and Paleobiology of Alpine Cryogenic Sites ...... 54 2.3 The Antiquity of Inter-Regional Interactions ...... 60 2.3.1 Historic Trade and Travel ...... 63 2.3.2 Archaeological Evidence ...... 65

CHAPTER THREE: ANCIENT DNA ...... 68 3.1 Basic Genetics ...... 68 3.2 Ancient DNA ...... 74 3.3 The Early Development of Ancient DNA Research ...... 76 3.4 The Twin Challenges of aDNA ...... 79 3.4.1 Degradation ...... 79 3.4.2 Contamination ...... 84

vii

3.5 The Diversity of Applications for Paleogenetics in Archaeology ...... 85 3.5.1 Paleoanthropology ...... 86 3.5.2 Ecological and Subsistence Reconstructions ...... 87 3.5.3 Domestication ...... 88 3.5.4 Paleopathology ...... 90 3.5.5 Population Size ...... 91 3.5.6 Post-Processual Approaches (Gender, Kinship, and Agency) ...... 91 3.5.7 Technology ...... 92 3.5.8 Contact and Migration ...... 93 3.6 Conclusion ...... 94

CHAPTER FOUR: PLANT ADNA ...... 95 4.1 Genotypic and Phenotypic Characters ...... 96 4.2 The Relative Rarity of aDNA Plant Research ...... 97 4.2.1 Complications of Plant Tissues: Taphonomy ...... 98 4.2.1.1 aDNA from Pollen and Phytoliths ...... 99 4.2.2 Complications of Plant Tissues: PCR inhibition ...... 102 4.2.3 Complications of Plant Tissues: Decontamination and Extraction of Wood Tissues...... 104 4.2.3.1 A Lack of Consensus Regarding Protocol ...... 105 4.3 The Implications of Wood Physiology and Plastome Distribution for Paleogenetic Analysis...... 107 4.3.1 Wood Physiology ...... 109 4.3.2 Plastid DNA ...... 110 4.3.3 Ancient DNA in Wood ...... 112 4.4 Choosing Appropriate Genetic Loci ...... 115 4.4.1 Taxanomic Identification: Barcoding ...... 116 4.4.2 Loci for Population Genetics and Phylogeography in Plants ...... 118 4.5 Willow (Salix spp.) ...... 120 4.5.1 Genetic Research of Salix ...... 124 4.6 The Feasibility of Extracting aDNA from Wood ...... 127

CHAPTER FIVE: METHOD ...... 128 5.1 Specimen Recovery, Storage, and Sampling ...... 128 5.1.1 Ancient Specimens ...... 128 5.1.2 Modern Specimens ...... 129 5.2 University of Calgary’s Ancient DNA Facility ...... 132 5.2.1 Ancient Specimens ...... 132 5.2.2 Modern Specimens ...... 134 5.3 Primer Design ...... 135

viii

5.4 Sample Preparation and Decontamination ...... 135 5.4.1 Ancient Samples ...... 135 5.4.1.1 First Preparation ...... 136 5.4.1.2 Second Preparation ...... 136 5.4.2 Modern Samples ...... 137 5.5 DNA Incubation and Extraction ...... 138 5.5.1 Ancient Samples ...... 138 5.5.1.1 DNeasy Plant Mini Kit (QIAGEN) ...... 139 5.5.1.2 MinElute PCR Purification Kit (QIAGEN) ...... 140 5.5.2 Modern Samples ...... 140 5.6 PCR Setup, Agarose Electrophoresis, and Sequencing ...... 141 5.6.1 Ancient Samples ...... 141 5.6.2 Modern Samples ...... 142 5.7 Electropherogram Inspection and Analysis ...... 142

CHAPTER SIX: RESULTS ...... 143 6.1 Contamination Testing ...... 147 6.2 Loci Investigated ...... 149 6.2.1 rbcL ...... 149 6.2.2 trnL ...... 152 6.2.3 rpoC1 ...... 154 6.2.4 rpl16 ...... 156 6.2.5 matK ...... 159 6.2.6 rbcL-atpB ...... 160 6.2.7 psbK-psbL ...... 162 6.2.8 trnD-trnT ...... 163 6.2.9 trnH-psbA ...... 164 6.2.10 ITS ...... 167 6.2.11 atpF-atpH ...... 169 6.3 aDNA Species Identification ...... 171 6.4 Kluane Willow Stick (sample K12) ...... 172

CHAPTER SEVEN: DISCUSSION ...... 174 7.1 Archaeological Implications of the Willow Biofact from Kluane National Park ..175 7.2 Phylogeography of Salix in Yukon and Alaska ...... 178 7.3 Viability of aDNA from Wood ...... 181 7.4 Conclusion ...... 185

REFERENCES ...... 188

APPENDIX I: THE EARLY PERIODS OF THE NORTHWESTERN SUBARCTIC AND NORTHERN NORTHWEST COAST ...... 245 I.5 The Northwestern Subarctic ...... 245 I.5.1 The Earliest Inhabitants of Beringia ...... 245 I.5.1.1 Clovis, Pre-Clovis, Microblades, and Non-Microblades ...... 252 I.5.1.1.1 A Note on the Classificatory Reliance on Microblades ...... 256 I.5.1.2 Southern Yukon: The Northern Cordilleran Tradition ...... 257 I.5.2 The Boreal Forest and the Expansion of Microblade Technologies ...... 259 I.6 The Northern Northwest Coast ...... 263 I.6.1 Early Period ...... 263

APPENDIX II: THE ATHAPASKAN MIGRATIONS ...... 265

APPENDIX III: SAMPLE PROVENIENCES ...... 268

APPENDIX IV: SAMPLE PHOTOGRAPHS...... 272

List of Tables

Table 2.1 Northwestern Subarctic cultural-historic framework of the Middle-to-Late Period .... 23

Table 2.2 Northwestern Subarctic cultural-historic framework of the Late Period ...... 28

Table 2.3 Updated marine offset values from Richards et al. (2007) for radiocarbon dating Kwäday Dän Ts'ínchi ...... 58

Table 6.1 Regions Investigated for Phylogeographic Structuring in Salicaceae ...... 144

Table 6.2 Loci amplified with forward and reverse primers and associated PCR results ...... 145

Table 6.3 Taxonomic identifications of archaeological samples by locus ...... 171

Table I.1 Northwestern Subarctic cultural-historic framework of the Beringian-to-Early Periods ...... 246

Table I.2 Northwestern Subarctic cultural-historic framework of the Early-to-Middle Period . 259

Table III.1 Modern plant samples ...... 268

Table III.2 Ancient plant samples from Southwestern Yukon ...... 271

List of Figures and Illustrations

Figure 1.1 Recovery location of the Kluane Stick near Mount Logan on an elevation map ...... 1

Figure 1.2 Geography of the Northwestern Subarctic ...... 4

Figure 2.1 Culture-area divisions of Northern North America ...... 8

Figure 2.2 National parks overlain with the glacial extent as of 2004 ...... 11

Figure 2.3 Major Yukon watersheds ...... 12

Figure 2.4 Terrestrial ecoregions (level 2) of the Northwestern Subarctic ...... 14

Figure 2.5 Western subarctic delineation in North America as per Clark (1991:2) ...... 20

Figure 2.6 A compilation of culture-histories for the Northwestern Subarctic ...... 24

Figure 2.7 The greatest spatial extent of the White River Ash eruptions ...... 30

Figure 2.8 Indigenous peoples and languages of the Northwestern Subarctic and Northern Northwest Coast ...... 37

Figure 2.9 Geography of Southern Yukon and Southeastern Alaska ...... 38

Figure 2.10 Marine offset sources ...... 58

Figure 2.11 “Costumes of the inhabitants of Port des Francais” (Lituya Bay, 1786) a drawing by Gaspard Duché de Vancy ...... 62

Figure 3.1 The chemical structure and directionality of DNA ...... 69

Figure 3.2 ‘Coding’ and ‘non-coding’ DNA strands ...... 70

Figure 3.3 The first two cycles of a Polymerase Chain Reaction (PCR) ...... 72

Figure 3.4 Bond cleavage of individual polynucleotides causing nicks ...... 81

Figure 3.5 Locations of DNA damage caused by various decay processes...... 83

Figure 4.1 The structure of wood tissues in a cross-section of a multiyear old section of non- specific tree trunk ...... 108

Figure 5.1 A map of modern and ancient sample provenance ...... 131

Figure 5.2 Layout of the Ancient DNA facility at the University of Calgary ...... 133

Figure 6.1 Phylogenetic tree of rbcL (partial): Region A (conifers and angiosperms) ...... 150

xii

Figure 6.2 Phylogenetic tree of rbcL (partial): Region B (conifers and angiosperms) ...... 151

Figure 6.3 Phylogenetic tree of trnL (partial): Conifers and angiosperms ...... 153

Figure 6.4 Phylogenetic tree of rpoC1: Salicaceae ...... 155

Figure 6.5 Phylogenetic tree of rpl16: Salicaceae ...... 156

Figure 6.6 Multiple alignment of rpl16 (partial, cpDNA): Salicaceae ...... 158

Figure 6.7 Phylogenetic tree of matK: Salicaceae ...... 159

Figure 6.8 Phylogenetic tree of rbcL-atpB: Salicaceae ...... 161

Figure 6.9 Phylogenetic tree of psbK-psbL: Salicaceae...... 162

Figure 6.10 Phylogenetic tree of trnD-trnT: Salicaceae ...... 163

Figure 6.11 Phylogenetic tree of trnH-psbA: Salicaceae ...... 165

Figure 6.12 Multiple alignment of trnH-psbA (partial, cpDNA): Salicaceae ...... 166

Figure 6.13 Phylogenetic tree of ITS (rDNA), Region a: Salicaceae ...... 168

Figure 6.14 Multiple alignment of ITS1 (partial, rDNA): Salicaceae...... 169

Figure 6.15 Transilluminated agarose gel and electerogram, atpF-atpH spacer (cpDNA, Salix) ...... 170

Figure 6.16 Transilluminated agarose gels: Kluane Stick (K-12) ...... 173

Figure I.1 Deglaciation of Northwestern North America ...... 247

Figure IV.1 Paleobiological sample pictures (IP1a–IP9) ...... 272

Figure IV.2 Paleobiological sample pictures (IP10–K12) ...... 273

Figure IV.3 Modern Salix sample pictures (MP5–MP67) ...... 274

Figure IV.4 Modern Salix sample pictures (MP83–MP145) ...... 275

xiii

List of Symbols, Abbreviations and Nomenclature

Symbol Definition aDNA Ancient DNA mtDNA Mitochondrial DNA cpDNA Chloroplast (plastid) DNA rDNA Coding for ribosomal DNA (nuclear) nDNA Nuclear DNA STR Short Tandem Repeat SNP Single Nucleotide Polymorphism indel Deletion or insertion mutation bp Base pair, refers to the length of a DNA sequence endogenous Target DNA exogenous Non-target DNA kya, mya, bya Thousand, million, and billion years ago

xiv

Chapter One: Introduction

In May 2005, during site preparation for the installation of an automatic weather station on a rock ridge situated between the Ogilvie, Quintino Sella, and Logan Glaciers (≈10 km from the western base of the Mount Logan Massif), two sticks were found protruding (10–12 cm) out of a recently exposed gravel bed (2930 masl [Holdsworth and Lacourse 2015]), with a third stick

(1.32 m long) being discovered on a subsequent visit (Figure 1.1). Overlain snow and ice were cleared in 2007 and a sample from the larger stick was obtained for radiometric dating, Figure 1.1 Recovery location of the Kluane Stick near Mount Logan on an elevation map.

Map data from the Commission for Environmental Cooperation (2014). *2σ, calib 7.0.4, intcal13.14c (Stuiver and Reimer 1993).

producing an AMS date of 2430 ± 20 14C BP (1σ [Holdsworth and Lacourse 2015)—calibrated to 2366–2684 cal-BP (2σ, calib 7.0.4, intcal13.14c [Stuiver and Reimer 1993]). All three specimens were extracted in 2012 by Holdsworth with the intent of paleoenvironmental analysis for use as a climatic signal; the specimens were tentatively microanatomically identified as willow (Salix sp.) by Holdsworth and Lacourse (2015). The isolated alpine range where the specimens were found is void of moss, lichen, or other vegetation with an annual temperature of

−13°C and severe winter winds, with no possibility of local growth or glacial transport from anywhere nearby. The largest specimen had a splintered end, which Holdsworth and Lacourse

(2015) suggest is indicative of screwing the branch or stem off of a tree or out of the ground. The size, context, and breakage pattern are strong evidence of an anthropomorphic origin.

Oral-histories and ethnographic data of First Nations living both in the Yukon Interior, beyond the Pacific Coastal Range, and those who have occupied the thin coastal margins of the

Alaskan Gulf in the vicinity of Yakutat Bay, indicate a deep antiquity of inter-relations between the Northern Northwest Coast and Northwestern Subarctic (Cruikshank 2005; Emmons 1991; de

Laguna 1972; de Laguna and McClellan 1981; McClellan 1975). Conversely, archaeological evidence for coastal-interior interaction is relegated to the Late Period of each area’s associated culture-historical chronology. The spatial-temporal characteristics of the willow specimen

(henceforth referred to as the Kluane Stick in reference to its recovery from Kluane National

Park, Yukon, Canada) are suggestive of an early use of glaciers as travel routes or ‘highways’

(Cruikshank 2005), as well as a deeper antiquity for coast-interior interactions beyond current interpretations of associated archaeological assemblages.

The cryogenic preservation of the specimen hypothetically makes it an ideal candidate for ancient DNA (aDNA). Further south along the western Canada-United States border (comprising

British Columbia, Alberta, Washington, Idaho, and Montana), Brunsfeld et al. (2007) were able to find phylogeographic discrepancies between populations of Salix melanopsis in mesic forests distributed in the Cascade Range and Northern Rocky Mountains, currently isolated by more than 300 km of desert steppe on the Columbia Plateau. Similar physical inhibitors to gene flow exist to the north in the region associated with the Kluane Stick: the Pacific Coast Range

(including the Saint Elias Mountains and Coast Mountains), the Wrangell and Chugach

Mountains, and the Kluane and Bagley Icefields (Figure 1.2). I hypothesized that similar inter- regional genetic disparities exist in Salix populations in Alaska and the Yukon due to physical barriers to gene flow. This could feasibly be used to deduce the origin of the Kluane Stick using an aDNA analysis if polymorphic genetic loci with biogeographic structure can be identified.

The purpose of the analysis is to investigate the origin of the Kluane Stick in order to determine whether there is direct evidence of coast-interior interactions at ca. 2500 BP, to explore the phylogenetic potential of Salix for other applications of phylogeography, and finally, to assess the viability of aDNA for wooden artifacts and biofacts recovered from alpine settings to facility future work with the tissue in similar depositional contexts.

Alpine cryogenic sites have recently impacted archaeology in the Western Subarctic in substantial ways. Since the archaeological and paleobiological importance of alpine ice patches was identified in 1997 (Kuzyk et al. 1999), these frozen sites have added immensely to the material record of the Northwestern Subarctic due to their favorable taphonomic conditions

(Andrews and MacKay 2012). In the Yukon alone, over 100 dart and arrow shafts with attached sinew and feathers have been recovered from these sites, as have over 1700 faunal remains, a moccasin, bow fragments, and more than 200 other archaeological objects, with 14C dates spanning 9000 years (Hare et al. 2012). The discovery of these sites has already contributed

Figure 1.2 Geography of the Northwestern Subarctic.

Map data from the Commission for Environmental Cooperation (2014) and Smith (2004:4).

significantly to our cultural-historical interpretations of this poorly understood region of the

Subarctic (Hare et al. 2004), most notably because typically only lithic artifacts can survive the acidic soils of the boreal forest (Ives 1990:310–311). In contrast, over 95% of archaeological materials from ice patch sites have wooden components (Andrews and MacKay 2012:iv). Due to the effects of climate change, ice patches in the Subarctic have been ablating at an increasing rate

(Andrews and MacKay 2012; Andrews et al. 2012:18), exposing biological materials for recovery, but also leading to further degradation. The disappearance of ice patches is also affecting caribou (reindeer) herds worldwide who use the ice patches for thermoregulation (Ion and Kershaw 1989; Galloway et al. 2012)—this cross-disciplinary, analytic potential and ecological impact has spurred diverse research into these disappearing archaeological and paleobiological features (McCullough 2012).

Unmodified branches and twigs have also been recovered from many remote cryogenic deposits, although it remains unclear at this time why these materials constitute parts of the assemblages given the distance of the ice patches (multiple kilometers) from the modern treeline.

It is possible that altitudinal shifts in the treeline of associated taxa during the Holocene (e.g.,

Bunbury and Gajewski 2009; Clague 2004; Cooper 2014; Danby and Hik 2007a, 2007b; Lloyd and Fastie 2002, 2003; Pisaric et al. 2003) could provide a natural explanation for their presence, although they may have anthropogenic associations that are currently unclear. Regardless of their archaeological or biological association, these sticks can serve as test samples for the viability of destructive analytic methods (aDNA) on wooden cryogenic artifacts and biofacts.

This analysis involved sampling modern willow from three hypothesized regions of origin for the Kluane Stick over two field seasons: the Alaskan Coast (Yakutat Bay, Wrangell-St.

Elias National Park and Preserve), Yukon Interior (Yukon Plateau and Ruby Range), and the

Alaskan Interior (Copper Plateau, Wrangell-St. Elias National Park and Preserve). The initial intent was to sample the Kluane Stick during the first field season to determine whether the specimen in fact contained preserved aDNA. Weeks before starting the field component, an injunction was placed on Yukon government archaeologists and archaeological research permits because of a legal situation that arose in part due to my permit application to sample the Kluane

Stick. The legal situation emerged because of a complex series of events born of a lack of communication between Parks Canada, Yukon Heritage, and local First Nations where certain parties were unaware of the specimen’s existence. The objective of the first field season shifted towards sampling stick fragments recovered from Yukon ice patches (as a test proxy for the

Kluane Stick [intended to be sampled at later date]), as well as modern sampling to investigate phylogeography in Salix (for later use with the Kluane Stick) in Southern Yukon between

Whitehorse and Kluane Lake, and along the Alaskan Coast near Yakutat Bay. The objective of the second field season was to obtain a sample of the Kluane Stick following a year of legal deliberation—it was eventually decided that Parks Canada would conduct the sampling and courier the material to the University of Calgary. The second field season transitioned into additional modern sampling from the third hypothetical sample region, the Copper Plateau in

Wrangell-St. Elias National Park and Preserve, Alaska, along with sampling on the Kenai

Peninsula (Alaska) to expand the phylogeographic scope.

This thesis is divided into seven chapters. Chapter Two details the environmental and archaeological setting of the study area. An archaeological overview of the Northwestern

Subarctic has not been published in recent years. The length and detail of this chapter is intended to both contextually situate the reader, and to provide a thorough discussion of associated archaeological research to date with emphasis on the ambiguity of culture-history across the

Western Subarctic and Northern Northwest Coast, and the analytic power of cryogenic assemblages for elucidating important elements of a trans-regional past. The third chapter describes the study’s methodology (aDNA analysis) with special attention to the field’s technical challenges and associated developments that have shaped it to its current state. The nuances and additional complications of aDNA with plants is outlined in the fourth chapter. This chapter further details the relevant physiology of wood tissues, with a discussion of the inherent implications of plastid distribution for aDNA, and the state of aDNA research on wood to date. It also provides a botanical overview of Salix with associated genetic research on the genus.

Subsequent to these background chapters, the fifth chapter outlines the methodology used in the analysis. The final two chapters outline the results (Chapter Six), followed by a discussion of this data (Chapter Seven) in a broader context with recommendations for future research. This final chapter discusses the implications of the Kluane Stick for Northwestern Subarctic archaeology, the phylogenetic potential of Salix in the study area, and the viability of aDNA analysis on wooden artifacts and biofacts from cryogenic contexts.

Chapter Two: Archaeology and Environment

The focus of this chapter is the Northwestern Subarctic, in addition to the Northern

Northwest Coast (Figure 2.1). The environment and archaeological record of Southern Yukon is emphasised, with reference to Central Alaska, Northern British Columbia, and the Southeastern

Alaskan Panhandle. The first portion of the chapter summarizes the archaeological record of areas associated with the Saint Elias Mountains; environmental and geographic data are discussed with each archaeological culture-region. This is followed by an overview of cryogenic archaeology, and concludes with a discussion of ethnographic and archaeological evidence for inter-regional coast-interior interactions. The objective of this background chapter is to culture-

Figure 2.1 Culture-area divisions of Northern North America.

Based on terrestrial ecoregions from the Commission for Environmental Cooperation (2014).

historically situate the Kluane Stick to clarify the relevance of an ancient DNA analysis for wooden artifacts and biofacts in the Subarctic.

2.1 The Archaeological Record

This section outlines the archaeological record and environment of the Northwestern

Subarctic (Section 2.1.1), with a brief overview of the Northern Northwest Coast (Section 2.1.2), each divided into temporal periods. The archaeological record discussed in this chapter begins in each area’s Middle Period in order to focus on background information temporally relevant to the recovery of the Kluane Stick and alpine ice patches in the Subarctic. For a review of the

Early Period in both areas, refer to Appendix I.

The archaeological terminology used in this thesis follows Willey and Phillips (1958), although named culture-historic entities follow the cited authors. All radiometric dates are reported as they are in the original source, with radiocarbon dates reported as 14C BP, and calibrated dates as cal-BP (dates calibrated by myself are noted with a citation to the calibration software). Dates reported in the literature as BP, CE, or BCE are likely uncalibrated or estimations; these details were not clarified. Dating inconsistencies can be problematic when comparing disjointed culture-historical frameworks as the chronology developed. The issue of fluctuating discontinuities between 14C and calendric dates is discussed by Hare (1995:27–29).

For example, radiocarbon dates around 2800 BP correspond well with calendar years, while those from 6000 to 7000 BP underestimate calendric ages by 900 years, and those around 12,000

14C BP underestimate by ~2000 years. Problems arise when attempting to calibrate or re- calibrate old dates to make them comparable; dates are reported here as they are in the original text to avoid this complication.

The environmental information discussed in this chapter is derived from the World

Wildlife Fund (2015a) ecoregion database, the Commission for Environmental Cooperation

(2014) terrestrial ecoregion database, and the Yukon Ecoregions Working Group (Smith et al.

2004).

2.1.1 The Northwestern Subarctic

2.1.1.1 Environment and Geography

2.1.1.1.1 Southern and Central Yukon

Most of Yukon is situated in the American Cordillera, except for the northern most tundra near the Beaufort Sea. South of the Arctic Coastal Plain, the territory consists of extensive mountain and glacial ranges, large river valleys (owing to the territories’ Athapaskan namesake as “great river”), and discontinuous plateaus (Smith 2004:8). Eight of Canada’s ten highest mountains are found in Kluane National Park (Southwestern Yukon)—an area physically dominated by the Icefield Ranges (the world’s second largest non-polar icefield [after

Greenland], extending across all four national parks in the region [Figure 2.2]). Continuous and discontinuous permafrost are found throughout the territory (Burn 2004:32). The region near the

Pacific Coast has had an extensive history of volcanism during the Quaternary. The Pacific Coast

Ranges dominate Southwestern Yukon near both the Alaskan and British Columbian borders, with the Pelly, Selwyn, Mackenzie, and Ogilvie Mountains extending across central and eastern

Yukon (Figure 1.2). The majority of Yukon’s modern population lies in a southcentral plateau band (Smith et al. 2015) nestled between the Saint Elias Mountains to the southwest, Selwyn

Mountains to the northeast, and the Ogilvie Mountains to the north. This plateau is punctuated by the Pelly Mountains, which lie to the east of Whitehorse. The mountain ranges that encircle

Figure 2.2 National parks overlain with the glacial extent as of 2004.

Map data from the Commission for Environmental Cooperation (2014). plateaus in Southern Yukon greatly constrained European contact with Athapaskan tribes in the area, as Northwest Coast indigenous groups who wished to maintain trade supremacy over southern interior First Nations guarded coastal alpine passes onto the plateau until nearly the end of the 19th century (McClellan 1975)—giving some sense of the physiographic isolation of this region by formidable and expansive ranges. 11

Figure 2.3 Major Yukon watersheds.

Map data from the Commission for Environmental Cooperation (2014) and Janowicz (2004:15).

The province has six major watersheds (Figure 2.3). The three most expansive of these

(Alsek, Yukon, and Porcupine) drain into the Yukon River which flows west across Alaska, with the North Slope (Arctic Coast) draining into the Beaufort Sea directly, and the Peel (Ogilvie

Mountains), and Liard (Southeastern Yukon) draining into the Mackenzie River Basin, which also flows north into the Beaufort Sea (Janowicz 2004). The territory is dotted with many large,

long, and narrow glacier-fed alpine lakes. Peatlands are present in the territory, but are not as abundant in the south as bordering areas of the boreal forest due to of the alpine nature of the province (Commission for Environmental Cooperation 1997). Yukon’s climate is almost entirely

Subarctic, with lengthy cold winters, and short, often hot summers. The Pacific Coastal Ranges

(Saint Elias and Coast Mountains) create an atmospheric barrier, leading to a severe continental climate; temperatures can vary in extremes from 36.1°C to −62.5°C (Wahl 2004:19). Spring and summer tend to both be particularly brief. Only northern most Yukon has an arctic tundra climate; the lower half of the territory is part of the Boreal Cordillera Ecozone (south of Ogilvie

Mountains), with the uppermost mountain ranges in this half being characterized by alpine tundra (Yukon Ecoregions Working Group 2004a:158) (Figure 2.4). The northern half of Yukon is considered part of the Taiga Cordillera Ecozone, which receives less precipitation than the

Boreal Cordillera, and is typically colder with more extensive permafrost (Yukon Ecoregions

Working Group 2004b:95–96).

The boreal forest biome that dominates Yukon and constitutes the Subarctic as a whole is a coniferous forest consisting of pines, spruces, and larches. In North America, the term taiga is typically reserved for the northern most portion of the boreal forest to describe more barren areas approaching the treeline and arctic tundra. The taiga, referring to the worldwide band of boreal forest across northern latitudes, is the world’s largest terrestrial biome, which was once connected by the Bering Land Bridge. White spruce (Picea glauca), black spruce (Picea mariana), quaking aspen (Populus tremuloides), willow (Salix spp.), and balsam poplar (Populus balsamifera) are common throughout the Yukon, while Alaskan birch (Betula neoalaskana) is less common but still present. Black spruce is much less common in the southern portion of the territory than in adjacent boreal forest areas. Lodgepole pine (Pinus contorta) is only common in

Figure 2.4 Terrestrial ecoregions (level 2) of the Northwestern Subarctic.

Map data from the Commission for Environmental Cooperation (2014).

Southcentral Yukon, with tamarack (Larix laricina) being common in the Southeast, and subalpine fir (Abies lasiocarpa) being restricted to high elevation areas in the southern part of the territory (World Wildlife Fund 2015b). Grasslands are most prominent around Haines Junction, comprising a bunch grass prairie of tufted low grasses with xerophytic sedges, sage, and bearberries (Stuart 1986:16). The timberline lies between 1050–1200 masl, with alpine tundra above. A dense shrub tundra of dwarf birch, moss, lichen, and willows merges with the timberline.

There are two subspecies of Caribou (Rangifer tarandus spp.) currently present in

Yukon: woodland caribou (R.t. caribou) in the south, and porcupine caribou (R.t. granti) or barren-ground caribou (R.t. groenlandicus) in the northwest (O'Donoghue and Staniforth 2004).

The term porcupine caribou (predominantly Alaskan) is often used interchangeably with barren- ground caribou, the latter found primarily in the Northwest Territories and Nunavut; this is because taxonomic issues associated with caribou classification have yet to be fully resolved.

The taxonomy remains contested because of a disjunction between subspecific and ecotypic designations. Cronin et al. (2005:503) found that porcupine and barren-ground caribou lack monophyletic mtDNA, and suggest that they should be collapsed into a single subspecies, with woodland caribou being maintained as a separate subspecies. The Rangifer subspecies reported by Workman (1974:16) and others (e.g., Stuart 1986:18) for the region are no longer accurate due to these phylogenetic revisions. Historically, huge herds of caribou were observed across the territory, which played an important role in subsistence (Stuart 1986:18). Moose (Alces alces) occupied a similar subsistence niche (food, sinew for sewing and netting, hooves for rattles, nets, hide for clothing and boat covers, etc.), but were relatively few in number. Other large mammals include wolves (Canis lupus), grizzly bears (Ursus arctos horribilis) and American black bears

(Ursus americanus). Dall sheep (Ovis dalli) and rocky mountain goats (Oreamnos americanus) are restricted to high elevation areas, but played an important role in summer hunts (particularly

Dall sheep in bands of >50) (Rand 1945:84–85; McClellan 1975:120–121; Workman 1974:17).

Polar bears (Ursus maritimus) are found only on the Arctic coast. Mule deer (Odocoileus hermionus), cougar (Puma concolor), and coyotes (Canis latrans) are also present, with elk

(Cervus canadensis) and wood bison (Bison bison athabascae) having been introduced to the

area in 1950’s and 1980’s respectively. (Wood bison are reported historically as being present in

Southeastern Yukon in the 19th century [McClellan 1975:120].)

There are many rodent species present in the area such as squirrels (Sciuridae) and beavers (Castor canadensis), as well as mustelids like wolverine (Gulo gulo) and marten (Martes americana). Ground squirrels (Spermophilus parryii) played an important role for food and clothing. Other mammals include snowshoe rabbit (Lepus americanus), muskrat (Ondatra zibethica), porcupine (Erethizon dorsatum), and arctic fox (Vulpes lagopus), among others.

There are over 250 species of bird in the Yukon, although there is little evidence for most of these having any economic importance to groups in the area. Notable for ice patch bird hunting are white-tailed ptarmigan (Lagopus leucura), a permanent resident of alpine areas above or near the tree line. Loons (Gavia sp.), eagles, and owls were seen as having supernatural power.

Salmonoids are the most common fish in Yukon, along with burbot (Lota lota) and northern pike

(Esox lucius). Four species of Pacific salmon (chum, coho, chinook, and sockeye) are present, along with landlocked sockeye (Oncorhynchus nerka) and rainbow trout (Oncorhynchus mykiss).

Other species include lake trout (Salvelinus namaycush), Dolly Varden trout (Salvelinus malma), bull trout (Salvelinus confluentus), arctic char (Salvelinus alpinus), arctic grayling (Thymallus arcticus), and whitefish (Coregonus spp.). Ethnohistorically, fish constituted a smaller portion of the diet than mammalian meat in the area, although there is regional variation in this trend that’s correlated with overall abundance (McClellan 1975:185; Workman 1978:24).

In terms of paleoenvironmental development to contemporary conditions, between ca.

11,000–8500 BP (following the progressive retreat of the Cordilleran ice sheet) the Northwestern

Area was largely birch (Betula spp.) tundra with Populus-Salix communities (Hu et al. 1996;

Stuart 1986). Recent pollen data from Rainville and Gajewski (2012) indicates that the spruce

forest was established by as early as 10,200 cal-BP in the Aishihik Region (Southwest Yukon), with white spruce (Picea glauca) maintaining its dominance throughout the Holocene. Alder

(Alnus sp.) and white birch (Betula papyrifera) were present by ca. 6500 BP. Unlike the rest of the boreal forest, black spruce (Picea mariana) never became abundant in Southern Yukon due to a lack of waterlogged soils in Yukon’s alpine areas.

2.1.1.1.2 Subarctic Alaska (Southcentral and the Interior)

The State of Alaska is larger than all but 18 sovereign countries, and counting territorial waters is larger than the next three largest US states combined. Alaska is commonly (but not officially) divided into regions. Two Subarctic regions are relevant to this thesis (Southcentral and the Interior) as well as the Southeast (also referred to as the Alaskan Panhandle or Inside

Passage), as discussed in Section 2.1.2.1.

Subarctic Alaska is very similar in environment to the boreal forest of Southern and

Central Yukon, with the exception that Interior Alaska is not part of the Western Cordillera. The

Interior Alaskan Lowland Taiga (Commission for Environmental Cooperation 2014) is situated north of the Alaska Range (a relatively narrow mountain belt in south-central Alaska at the northernmost end of Wrangell-St. Elias National Park and Preserve, extending in an arc southwest towards the Aleutians [Figure 1.2]). These lowlands are south of Brooks Range in the

Arctic, and are bounded by the Bering Sea in the west and the Richardson Mountains to the east in Northern Yukon. The Interior undergoes the same temperature variability as Yukon, and is underlain by continuous and discontinuous permafrost. Notably, the Interior was not glaciated during the Pleistocene (like North and Central Yukon), making its archaeological and paleobiological remains important for understanding Beringia. The Interior is a more typical taiga (boreal) ecozone than the cordillera of Yukon, with white spruce (P. glauca) in drier sites

on hillsides and along the timberline, and black spruce (P. mariana) in bottomlands and poorly drained peatlands (bogs) in addition to scrub-graminoid communities (e.g., willow, dwarf birch, and sedges [Hagenstein et al. 2015]). Owing to the very low population density in Alaska

(0.49/km2, and only ~100,000 people living in the Interior, centered on Fairbanks), the Interior has retained intact ecosystems overall, with healthy populations of all top predators (Hagenstein et al. 2015).

Southcentral Alaska lies south of the Interior Lowlands, marked in the north by the

Alaskan Range. The northernmost portion of this Subarctic region is ecologically very similar to

Southern Yukon as it is an extension of the Boreal Cordillera (Figure 2.4), with the southern portion of Southcentral Alaska on the Pacific side of the Pacific Coast Range belonging to the temperate coastal hemlock-sitka spruce rainforest (Section 2.1.2.1). In the middle of the region is the Copper Plateau (Figure 1.2)—a lowland, poorly drained area (and the site of a substantial

Pleistocene lake) dominated by black spruce and surrounded by mountain ranges (Hagenstein and Ricketts 2015). Most of Alaska’s modern population lives in western and southern portions of Southcentral Alaska (primarily around Anchorage, which lies just north of the Kenai

Peninsula). The Copper River Valley marks the western boundary of Wrangell-St. Elias National

Park and Preserve (Figure 2.2). This environmental protection area is cut in half latitudinally by the Chitina River. To the north of the narrow river valley are the Wrangell Mountains, to the east the Saint Elias Mountains, and to the south are the Chugach Mountains, along with the Bagley

Icefields (Figure 1.2).

2.1.1.2 Subarctic Culture History

This cultural-historical overview is directed towards Southern Yukon, drawing in large part from Hare (1995) and Workman (1978), with adjacent archaeological histories discussed

where appropriate (e.g., Holmes 2001, 2008). Alaska and Yukon have relatively long, complex histories of cultural-historical classification. MacNeish (1959) was one of the first with his creation of the British Mountain, Cordilleran, Yuma, and Northwest Microblade Traditions, although the lack of chronological control resulted in these entities coming under a variety of criticisms (see Goebel and Buvit 2011a:4–5). West (1967) followed MacNeish with his formulation of the Denali complex, but it was not until the discovery of the Onion Portage site that a degree of chronological control for the area could be achieved (Anderson 1968a). By the mid-1970s, there were at least 14 complexes and six traditions developed by various archaeologists to classify assemblages relegated solely to the Late Pleistocene and Early

Holocene (Goebel and Buvit 2011a:12). The abundance of cultural-historic entities and the lack of consensus on the region’s chronology mirrors the realization, by the 1970s, that the record of the Northwestern Subarctic was far from the simple classification initially proposed by

MacNeish (1959). Goebel and Buvit’s (2011b) edited volume of lithic variability in the Late

Pleistocene-to-Early Holocene in Beringia provides a number of in-depth overviews for complex cultural-historical developments in the area, far beyond the scope of this thesis.

One attempt to create a comprehensive prehistoric areal synthesis of the Subarctic west of

Hudson’s Bay came from Clark (1991). The work is directed at a general audience however, lacking the necessary detail and referencing to make it a defining synthesis. Despite this, the broad overview of prehistoric trends does make the work a valuable reference. A small subset of work that has contributed towards areal and regional prehistoric syntheses include: Anderson

(1968a), Bever (2001a), Clark (1975, 1991, 1992, 2001; Clark and Morlan 1982), Cook (1969,

1996), Dixon (1985, 1999), Dumond et al. (1976), Goebel (2004), Hare (1995), Hoffecker and

Elias (2007), Holmes (1996, 2001, 2008), MacNeish (1959, 1964), Mochanov (1977,1978),

Potter (2008), Stuart (1986) and Workman (1978). The most recent full prehistoric synthesis comes from Holmes (2001, 2008), which is centered on Alaska but proposes a chronology suitable for the Northwestern Area.

In terms of geographic delineation, Clark (1991:2) split the Western Subarctic into four areas, which I will refer to throughout this work (Figure 2.5): The Northwestern Area (the

Subarctic west of Great Bear Lake, Great Slave Lake and Lesser Slave Lake), the Alaskan Area

(Subarctic Alaska), the North-Central Area (Southern Barren Grounds, primarily in the

Northwest Territories), and the Eastern Area (from Western Ontario to Northern Alberta). I will conflate the Alaskan and Northwestern Areas in this thesis using the term Northwestern

Subarctic.

Figure 2.5 Western subarctic delineation in North America as per Clark (1991:2).

In this thesis, I conflate the Alaskan and Northwestern Areas into a single area referred to as the Northwestern Subarctic.

Although the size of the Northwestern Subarctic is substantial, there is a consistency of material culture throughout the area despite the presence of disjointed regional prehistoric frameworks. The difficulty in defining local and regional sequences contributes to this issue due to a lack of independent components in stratified localities. It is an unfortunate consequence of the environmental setting that no prehistoric synthesis for the Northwestern Subarctic could ever likely be as robust as any of the peripheral culture areas.

There are a number of factors that contribute to the challenges of defining a culture- historical chronology in the Western Subarctic; Ives (1990:310–311) has summarized four primary factors that constrict archaeological investigations in the boreal forest. The first is poor preservation—this severely restricts the kinds of materials capable of entering the archaeological record. Subarctic soils are slightly acidic due to the percolation of water through dense coniferous litters (Fenn et al. 2006). This acidity can result in the complete decomposition of organic materials, resulting in a taphonomic bias towards lithic tools and an almost universal absence of paleobotanical remains. The second problem is the disruptive post-depositional processes that disturb artifact provenance, resulting in a ‘flattening’ or ‘mixing’ of components.

Examples of this in the Subarctic include cryoturbation and bioturbation (with both floralturbation and faunalturbation being relevant factors). This is combined with the third problem—that many subarctic sites are found in low or non-depositional contexts. This impression may be due to a survey bias in site discovery, actual site survival in areas that can be excavated or located (for example not being inundated by muskeg), or an actual historic tendency. Most likely, all of these (and others) are contributing factors. Together, post- depositional processes and a tendency towards low-deposition contexts greatly restrict the ability to stratigraphically define a chronological framework. Even when datable organic remains are

discovered, they are accompanied by the pervasive problem that the artifacts and the radiometrically dated materials may not be contextually associated due to vertical mixing. The final factor discussed by Ives (1990:311) is the socioeconomic and cultural tendency towards a

‘simple’ and efficient Athapaskan material culture that is often archaeologically invisible.

Ethnographic accounts for the use of minimally modified materials, such as snares and deadfalls as hunting traps (e.g., Wentzel 1889; Keith 1890) give insight into the ephemeral nature of precontact Athapaskan artifacts. Aspects like hearth construction were relatively expedient— they were often not excavated, rock lined, or used for long periods of time—making it difficult to differentiate these features from soils stained by frequent natural fires. Other factors include low site visibility and a meager amount of work conducted to date (Holly 2002:10). This is exacerbated by geographic remoteness and an enormous, rugged landscape with sparse population centers, both of which impede archaeological survey. When all of the aforementioned factors (which create a lack of stratified sites without diagnostic material culture amenable to typological analysis) are accompanied by small, highly-mobile hunter-gatherers, it becomes evident why finding typological proxies for the construction of a robust archaeological framework in the Western Subarctic has been such an arduous task. Holly (2002:15) argues that a perception of environmental constraints for Subarctic peoples has influenced why Subarctic archaeology remains largely ahistorical and acultural. Spaulding (1946) argued that the boreal forest was so constraining that it acted as a filter that eliminated cultural variability. This was said in regard to the actual diversity of past peoples in this environment, but I think a more apt interpretation of the statement is that the boreal forest acts as a homogenizing factor in the archaeological record of these Subarctic peoples. A large-scape reassessment of the record with

standardized means of quantifying variability is likely key to an accurate culture-historic framework for the Western Subarctic.

2.1.1.2.1 The Northern Archaic as Defined by Emerging Notched Projectile Points (Table 2.1)

Table 2.1 Northwestern Subarctic cultural-historic framework of the Middle-to-Late Period. Alaskan Interior 1: Holmes (2001, 2008) Period Tradition 1. Middle Taiga Period 1.1 Northern Archaic Tradition 6000–3000 cal-BP 6000–1200 cal-BP 1.1 Northern Archaic Tradition 1. Late Taiga Period 6000–1200 cal-BP 3000 cal-BP to contact 1.2 Athapaskan Tradition 1200 cal-BP to contact Alaskan Interior 2: Esdale (2008) 1. Northern Archaic Tradition 6000–3000 14C BP Southern Yukon: Hare (1995), Workman (1978) Tradition Phase or Complex 1. Unnamed Tradition 1.1 Little Arm Phase Early Holocene to ca. 5000 14C BP ca. 7100–4500 14C BP 2.1 Annie Lake Complex 2. Northern Archaic Tradition ca. 5100–4400 14C BP ca. 5000 14C BP to contact 2.2 Taye Lake Phase ca. 4500–1250 14C BP Relevant Cultural-Historic Entities Entity Spatial Extent Age Characteristics Literature Anderson 1968a, Asymmetrical side-notched projectile points, unifacial Northern 2008; Clark 1992, ca. 6000 to knives and end scrapers, originally (and contentiously) Archaic Alaska, Yukon Esdale 2008, Holmes 1200 cal-BP defined as lacking microblades and often lacking Tradition 2008; Morrison 1987; macroblades, similarities to Plains entities. Workman 1978 Diagnostic deeply basally concaved lanceolate points of Annie Lake South-Central ca. 5100– high quality, thinness, and made on good quality lithic Greer 1993; Hare 1995 Complex Yukon 4400 14C BP materials, with a debitage profile suggesting extensive curation. Wedge-shaped, tabular, and ‘pencil-shaped’ microblade Late Denali ca. 3500– Alaska, Yukon cores and microblades, burins, end scrapers, notched and Dixon 1985:53, 57–59 Complex 1500 14C BP lanceolate projectile points. Notched, straight, and concave-baed projectile points, Taye Lake Southern ca. 4500– Hare 1995; Workman heavy bifaces, endscrapers, unifaces, and an absence of Phase Yukon 1250 14C BP 1978 microblades or microcores. Likely Increasingly called Dené, refers to a large indigenous Dumond 1969; Ruhlen Athapaskan Western Pleistocene language family. Na-Dené includes Eyak, Tlingit, and Haida 1998; Torroni et al. (Northern) Subarctic to Contact languages. 1993 *Defining characteristics vary significantly by researcher, these should be taken as approximations. Holmes (2001, 2008, 2011) and Hare (1995) are principle sources. See Figure 2.6 for a compiled figure of culture-historic frameworks.

Figure 2.6 A compilation of culture-histories for the Northwestern Subarctic.

This temporal segment signifies the onset of the Northern Archaic, which was first proposed by Anderson (1968a, 1968b) to describe notched points from the stratified Onion

Portage site in the Kobuk River Valley, Alaska. The name was intended to infer similarity to other adjacent culture areas in Canada and the United States where researchers were identifying larger subsistence shifts correlated with a changing projectile point system, similar in appearance to the notched points appearing in Subarctic components. A conference was held in 1968 to discuss the origins of these notched points (Ackerman 1968a). Between 1968 and 2008, over 200 notched points have been reported from Alaska and the Yukon (Esdale 2008:3), but there has remained relatively little published work on the period, leaving this notable technological tradition poorly understood. Esdale (2008) created a thorough historic synthesis of the problem, proposing new date ranges for the Subarctic Archaic (6000–3000 BP). MacNeish initially had a date range of 7000–1500 BP for his Northwest Microblade Tradition, with the Taye Lake Phase being its last manifestation. A reanalysis of this material by Workman (1978) determined that

Taye Lake was actually microblade free, leading Workman (1978:414) to reinterpret MacNeish’s

(1964) chronology and split the Northern Microblade Tradition into an earlier ‘Unnamed

Tradition’ (which includes the Little Arm Phase) and the Northern Archaic Tradition, the latter of which begins ca. 5000–4500 BP with the recovery of Taye Lake technologies. A variety of other frameworks have been proposed, but the Northern Archaic has retained prominence in the literature. Dixon (1985) proposed a Late Denali Complex to account for the persistence of microblades and burins into the Northern Archaic; Morrison (1987) discusses the pronounced variability of both the Northern Archaic and Northwest Microblade Traditions, where the initial defining characteristics (in this case a presence or absence of microblades) lose coherence and utility when spatial-temporally expanded. Holmes (2008) proposed the Middle Taiga Period to

account for the initial onset of notched points in the Subarctic with a date range of 6000–3000

BP, which is the same range derived by Esdale (2008). Holmes (2008:75) notes that notched and lanceolate points were being used throughout the Middle and Late Taiga periods in reference to ice patch research in Yukon and Alaska (Hare et al. 2004; Dixon et al. 2005). However, dates of dart shaft use identified by Hare et al. (2004:262) range from 8360 ± 60 – 1250 ± 40 14C BP, so we would expect notch points to extend even deeper in time that have yet to be recovered. If new survey research targeting the 8000–6000 BP period, where there is a dearth of Alaskan and

Northwestern sites, a small set of securely dated notched point recoveries could temporally stretch the Northern Archaic Tradition back almost 2000 years, or force a redefining of the tradition’s character-set (Esdale 2008; Holmes 2008). I hypothesize that the earliest dart points

(whether notched or lanceolate) would have substantial morphometric ranges because of an adaptive radiation in experimentation brought about by the new missile system (see Lyman et al.

2008:2811 for an example of this phenomenon with the North American adoption of bow-and- arrow technology), both challenging methodological assessments of the materials, and questioning the defining characteristics of the Northern Archaic and its temporal delineations.

Workman (1978:414) considers the transition from Little Arm to a Northern Archaic

Tradition, with the Taye Lake Phase being its local manifestation in Southern Yukon, to be the one significant technological change in the region’s history. It is significant and “…far-reaching enough that one thinks in terms of movement of people rather than diffusion of ideas.”

(Workman 1978:414). This is manifested materially by an emphasis on notched, straight, and concave based projectile points, bifaces, endscrapers, unifaces, a lack of microblades or microcores, and a sparse and rudimentary burin technology when compared to the preceding

Little Arm Phase. Esdale (2008) has a different temporal range for the tradition (6000–3000 BP),

and finds a similarly reduced emphasis on microblades during that time. The picture remains murky however, as 38% of sites with notched points still contain microblades (Esdale 2008:14).

Notched pebbles are often reported as diagnostic of Northern Archaic sites, while only 4% of sites had these items, and 20% of assemblages had burins (Esdale 2008:14). A synthesis of

Holmes (2008) and Esdale (2008) would likely have good support for an areal framework, as supported by date ranges from ice patches in Yukon and Alaska (Hare et al. 2012). This may necessitate a re-evaluation of the local sequence for Southern Yukon (Hare 1995; Workman

1978). In summary, the Northern Archaic is primarily defined by a horizon of notched dart projectile points, and a lack (but not absence) of burins and microlithics. The period’s termination date is considered by Hare (1995; Hare et al. 2004, 2012), Holmes (2008), and

Workman (1978) to reflect a shift towards bow-and-arrow technology.

2.1.1.2.2 White River Ash, Arrowheads, and Athapaskans (Table 2.2)

Holmes (2008) defined a much earlier terminal period start date than other prehistoric frameworks for the area. This is because Holmes (2008) correlates Cultural Zone 1b (ca. 6000–

3000 BP) at Swan Point, Alaska, with the Middle Taiga. And although the framework draws on data from around the Northwestern Subarctic, it is still focused on the Alaskan record. This

3000 BP transition date is also based on radiocarbon data from a single arrow shaft recovered from an ice patch in Southern Yukon with an age of 3600 ± 40 14C BP (Hare et al. 2004:267).

This early date for the adoption of bow-and-arrow technology is supported by investigations on the Great Plains that have found evidence of a low frequency co-use of atlatls and bows by

3595 ± 150 BP (Dyck and Morland 1995:Table 3.5; Walde 2014:160) with the replacement being a slow, complex process (e.g., Swanton 1938; Patterson 1992; Walde 2014). It is important to consider bow-and-arrow frequency distribution increases as an adoption rather than a new

invention and rapid replacement. There is some evidence that the technology may have existed as early as the Late Pleistocene in Northeast Asia and Beringia (see Maschner and Mason 2013).

Ackerman (1996, 2011) describes several osseous projectile points that appear to be arrowheads contextually dated to ca. 12,250 cal-BP and 8800 cal-BP in Southwestern Alaska, leading to a suggestion that bow-and-arrow technology may have been a Dyuktai derivative, dating as early as 29,000–22,000 cal-BP (see Dixon 2011:365). The sporadic evidence of bow-and-arrow technology in the Subarctic is likely a manifestation of overall sampling bias (Dixon 2011:366)

Table 2.2 Northwestern Subarctic cultural-historic framework of the Late Period. Alaskan Interior 1: Holmes (2001, 2008) Period Tradition 1.1 Northern Archaic Tradition 1. Late Taiga Period 6000–1200 cal-BP 3000 cal-BP to contact 1.2 Athapaskan Tradition 1200 cal-BP to contact Alaskan Interior 2: Clark (1991) 1. The Late Period 1300 14C BP to contact Southern Yukon: Hare (1995), Hare et al. (2012), Workman (1978) Tradition Phase or Complex 1.1 Taye Lake Phase 1. Northern Archaic Tradition ca. 4500–1250 14C BP ca. 5000 14C BP to contact 1.2 Late Prehistoric ca. 1250 14C BP to contact Relevant Cultural-Historic Entities Entity Spatial Extent Age Characteristics Literature Notched, straight, and concave-baed projectile Southern ca. 4500– Hare 1995; Taye Lake Phase points, heavy bifaces, endscrapers, unifaces, and Yukon 1250 14C BP Workman 1978 an absence of microblades or microcores. Likely Increasingly called Dené, refers to a large see Dumond 1969; Western Athapaskan (Northern) Pleistocene indigenous language family. Na-Dené includes Ruhlen 1998; Subarctic to contact Eyak, Tlingit, and Haida languages. Torroni et al. 1993 Post eastern lobe of White River Ash. Less Athapaskan Tradition, also emphasis on lithic technology (microblades and Hare 1995; Hare et referred to as the Late Northwestern 1200 cal-BP burins disappear), increases in bone, antler and al. 2004, 2012; Prehistoric (Precontact) or Subarctic to contact copper technologies, widespread adoption of the Holmes 2008; Late Period bow-and-arrow, evidence of coast-interior Workman 1978 interactions. *Defining characteristics vary significantly by researcher, these should be taken as approximations. Holmes (2001, 2008, 2011) and Hare (1995) are principle sources. See Figure 2.6 for a compiled figure of culture-historic frameworks.

rather than a rapid adoption. Holmes (2008:75–78) notes that during the Late Taiga (ca. 3000 BP to contact), assemblages tend to diversify (both in kinds of lithic tools, but also with a new emphasis on materials like bone and antler for projectile points), but do maintain continuity with the preceding Middle Taiga (even tools such as microblades continued to be produced, but are fewer in proportion). Holmes (2008) equates the shift to bow-and-arrow technology ca. 1200 BP in the Western Subarctic (Hare et al. 2004; Dixon et al. 2005; VanderHoek et al. 2007a) with a transition from the Northern Archaic Tradition to the Athapaskan Tradition within his Late Taiga

Period. This date is linked with the largest White River Ashfall that is thought to have precipitated substantial social changes (represented technologically in the record) in the

Northwestern Area, which is additionally considered to be an antecedent to further social change in adjacent culture areas due to displaced populations (e.g., Derry 1975; Clark 1991; Hare et al.

2005; Moodie et al. 1992; Robinson 2001; Workman 1974, 1979). It should be noted that the perceived degree of impact that the eruptions had on cultural change varies by researcher. The

White River Ashfalls have been argued to be instigating events for the large scale Athapaskan migrations into Central British Columbia (Matson and Magne 2007) and the American

Southwest (Derry 1975; Ives 1990:44; Magne 2012; Workman 1979:352). The larger Eastern

White River Ashfall (ca. 1200 BP) is a convenient marker in stratified sites because of the marked archaeological discontinuities above and below the ash stratum, and is used as a chronostratigraphic control for defining the last precontact period in Northwestern Subarctic chronologies (e.g., Clark 1991; Hare 1995; Holmes 2008; MacNeish 1964; Workman 1974,

1978).

The precise origin of the White River Ashfalls are still debated (e.g., Lerbekmo

2008:693; Lerbekmo and Campbell 1969:113–116; Lerbekemo et al. 1975:204; Mashiotta et al.

2004; Mullen 2012:36; Richter, Preece, McGimsey and Westgate 1995; Richter, Rosenkrans and

Steigerwald 1995:29; Urmann 2009:54–59) but are typically sourced to Mount Churchill in the

Saint Elias Mountains, Wrangell Volcanic Field, Eastern Alaska (Figure 2.7). There were two

relevant White River Ashfalls; the older and smaller lobe extends primarily north, and has been

dated to 1830 cal-BP (Lerbekmo 1975:208). The larger and more recent eruption extended east,

producing an estimated 47 km3 of debris with tephra found at Great Slave Lake, over 1300 km

away (Robinson 2001). This larger eruption has been dated to 1147 cal-BP (Clague et al.

1995:1172). There is evidence that the eastern eruption occurred during late fall or early winter,

with the northern eruption occurring during the summer (West and Donaldson 2001). The

Figure 2.7 The greatest spatial extent of the White River Ash eruptions.

Based on a georeferenced tracing of Mullen (2012:39).

environmental and anthropic consequences of the ashfall are summarized by Mullen (2012:36).

Pollen data has indicated that the devastated area was recolonized by herbaceous plants, later by shrub tundra, and eventually by white spruce, with some regions taking 400 years for the boreal forest to re-establish (Birks 1980:124). Kuhn et al. (2010) has found evidence of a partial genetic replacement of forest-dwelling caribou (Rangifer tarandus caribou) ca. 1000 BP that gives insight into the magnitude of the ecological impact in the Northwestern Subarctic. Beyond the environmental changes, the psychological impact would have also likely been severe for local populations. Those living near the blast in Southern Yukon would have been shrouded in darkness for days (Moodie et al. 1992:161) and would have been subjected to heavy precipitation, and frequent thunderstorms. The eruption would have also likely caused weather disruptions, comparable but much smaller in scale to the “year without a summer” in 1815, which was driven by a succession of eruptions—the culmination of these being the eruption of

Mount Tambora (Sumbawa, Indonesia), approximately three times larger than the Mount

Churchill eruption (Mullen 2012:37; Soon and Yaskell 2003; Stothers 1984). By comparing archaeological radiocarbon dates across the Western Subarctic with the known distribution of the two White River lobes, Mullen (2012) found evidence of population dispersals following both

Wrangell eruptions. The eastern eruption has been argued to be an inciting event for migratory events, language differentiation, and technological change (Hare et al. 2004; Moodie et al. 1992;

Derry 1975; Fast 1990; Workman 1974, 1979). The analysis by Mullen (2012) strengthens hypotheses of a longer time depth (over 650 years) for the environmental devastation to have had broad, culturally significant effects on people of the Northwestern Subarctic. It also provides a synthesis of radiocarbon dated sites showing a spatial dispersal of people from impacted regions.

The first eruption is taken into account in Matson and Magne’s (2007:151) model for the

Athapaskan migrations and is correlated with hypothesized initial migrations ca. 1800 cal-BP into Alaska and the Northwest Territories (see Appendix II for a brief review of research on the

Athapaskan migrations). Mullen (2012) does address issues related to site discovery and dating bias, and accounts for these factors in his radiocarbon analysis. Oral histories of local

Athapaskan groups mention volcanic events in vague mythological lore rather than in more pragmatic terms, which Fast (1990:274) attributes to the generational time depth of volcanic dormancy since the last White River eruption.

It is difficult to estimate the period of time that people were absent from much of the impacted region with the observed lack of post-ash sedimentation (compounded by other challenges of boreal forest archaeology [see Section 2.1.1.2:21]), in addition to understanding the cultural impact that the eruptions had on the indigenous populations (aside from inferred coinciding migrations into adjacent areas [Mullen 2012]). The meager sedimentation since the eruptions is one reason given by Hare (1995:125) for the modification of Workman’s (1978:362–

379) culture history. Workman (1978) divides the Late Prehistoric into the Bennett Lake and

Aishihik Phases, keeping in continuity with MacNeish (1964) (see Figure 2.6). Hare (1995) combines these phases to correlate with a more regional Late Prehistoric categorization that encompasses modern Athapaskan groups (cf., Greer 1983; Gotthardt 1993), and also because the

Bennett Lake Phase lasts less than a century with Workman’s (1978) framework. This correlates well with more recent framings of the area’s culture history by Holmes (2008), and aids in reconceptualising the Southern Yukon as a part of the Northwestern Subarctic by placing it into a wider spatial context.

Subsequent archaeological transformations following the White River Ashfall can be discussed in a local and regional sense, but the broader cultural patterns across the Northwestern

Subarctic are more telling of general trends in the Late Period. In terms of the culture area, changes during this period include: missile weapon technology shifting from predominately stone tipped atlatl darts made of birch (Betula sp.) to antler tipped bow and arrow shafts made from spruce (Picea sp. [Hare et al. 2004:270]), native copper implements and ground stone tools becoming common, trade goods from the coast being found in the interior at an increasing rate, and the growing presence of broader toolkits such as awls and decorated bone. It is important to note that some of these changes may be related to a taphonomic bias (e.g., the higher likelihood of preservation for biological materials in the Late Period because of less time for degradative processes) rather than an authentic cultural shift. The evidence of increasing inter-regional contact between inland and coastal peoples is significant for this thesis, and as such will be discussed in much greater detail in Section 2.3. Holmes (2008:77) notes that at least in Alaska, there is an overall lessened emphasis on lithic technologies with the disappearance of microblades and burins. Clark (1991:64) conversely mentions that there remained a continuity between pre- and post-fall inhabitants despite the larger changes. This is echoed by Hare

(1995:126) who notes that there is a continuation of lithic tools after the ashfall. These differences of perspective partly serve as an example of the archaeological homogenizing that the boreal forest environment has prehistoric material culture—the record of Northwestern

Subarctic peoples in general has relatively few surviving manmade items suitable for deriving an archaeological ethnicity (e.g., Walde 2012), which contributes to the perceived abrupt cultural change with the adoption of the bow. A low strength of conformity (the probability of morphometric conformance in artifact characteristics to metric averages of previous generations), related to cultural transmission in material variation, may also be a factor contributing to this problem (see Eerkens and Lipo 2005 for a statistical means of quantifying

morphometric artifact variation; for a more thorough review of style, function, and ethnicity see also Bettinger and Eerkens 1999; Binford 1989; Eerkens and Bettinger 2001; O'Brien and Lyman

2003; Sackett 1982, 1985, 1986, 1990; Wiessner 1983; Wobst 1977). In this case however, the reason for the difference in perspective between contemporary Subarctic archaeologists and those in the 90s is due to the emergence of ice patch archaeology. The archaeological importance of ice patches only became known in 1997 (Kuzyk et al. 1999; Bowyer et al. 1999; Hare et al.

2001), but have made enormous contributions to our cultural-historic understandings of the area

(e.g., Alix et al. 2012; Andrews et al. 2012; Dixon et al. 2005; Hare et al. 2004; Hare et al. 2012;

VanderHoek et al. 2007a, 2012). Without these sources of information, there would likely remain the same muted impression of cultural change temporally; Holmes (2008) would be unable to make the same assertion that there was significant cultural change after the White

River Ashfalls without the organic ice patch evidence, because the lithic remains do have continuity, but differ in proportion. With very small sample sizes in many sites in the area, the proportional difference is difficult to confidently assess. Ice patch archaeology has been key to providing a new source of information—well preserved organic material—to address the historically problematic archaeological interpretations of the region. An in-depth review of ice patch archaeology to date is provided in Section 2.2.

2.1.1.2.3 Ethnographic Athapaskans

The ethnic correlation between material culture and ethnographically recorded peoples is problematic in most culture areas of North America due to a myriad of factors—arguably the most significant of these being the repeated smallpox epidemics that decimated populations and eliminated generations of oral-historic knowledge. The problem becomes compounded in the

Northwestern Subarctic by the limited archaeological dataset and the area’s rugged physiography

that severely restricted contact (and hence any ethnographic data). A further issue is that even indirect contact with Europeans in Eastern North American resulted in tribal displacement westward, leading to group relocations in the Northwestern Subarctic prior to and during the Fur

Trade Period (Clark 1991:56). Prehistorians tend to organize groups during the Late Period by language families, with direct reference to Subarctic tribes usually being restricted to post- contact. Athapaskans were the principal inhabitants of the Northwestern and North-Central Areas of the Subarctic, although there are exceptions, notably in Southern Yukon and Northern British

Columbia where there was a migration of coastal Tlingit to inland areas formerly populated principally by Athapaskan speakers—or so one would suspect as the antiquity of Pacific

Northwest Coast peoples in the Yukon interior is currently unknown.

The ethnographic summary presented here is in large part restricted to Southwestern

Yukon as the breadth of anthropological information available in the Northwestern Subarctic at the threshold of history is far more extensive than any earlier period. This section is based primarily on the notably thorough, two part ethnographic survey of Southern Yukon by

McClellan (1975). Before proceeding further, it should be stated that the amalgamation of contemporary and historic First Nations peoples into groups of implied political unity is predominantly a Eurocentric construction, and does not (in most cases) reflect the social structuring of precontact First Nations. Yukon First Nations distinguish dialectic variations, but rarely use this distinction for classifying groups of people (McClellan 1975:13–14). For example,

McClellan (1975:14) notes that her Southern Tutchone friends thought it was humorous that

Canadian census takers would insist that they had a ‘tribe name’, when those First Nations peoples being sampled considered themselves simply as ‘persons’, and did not have a ‘tribe’.

McClellan (1975:14) goes on to describe other criteria that Yukon First Nations would

sometimes use to classify people: technology, foodways, direction and distance from speaker, named places where families congregate, inter- and intra-group kinship, and historic ties. People that “live the same way” (McClellan 1975:14) were ‘classified’ the same (at least by her

Southern Tutchone informants), irrespective of linguistic affiliations. It is important to clarify that all of these indigenous classifications are both flexible (open) and relative, which tends to make the social nomenclature of First Nations largely incompatible with the far more static systems of European social classification. The following summary of McClellan (1975) is based on her experiences and hence the experiences of informants that she has documented. It likely does not reflect the emic classifications used by other Yukon First Nations who did not participate in the ethnography.

Southern Yukon was chiefly inhabited by the Tutchone (an Athapaskan language group).

Currently there are three linguistically distinct native groups that occupy the Southwestern Area of the Yukon: the Southern Tutchone, Tagish, and Inland Tlingit. Other Yukon First Nations language groups include the Kaska who occupy the southeastern portion of Yukon, the Mountain

Athapaskans who occupy the eastern-most portion of South-Central Yukon, and finally the Han and Kutchin who occupy the northern Subarctic areas of Yukon, north of the Ogilvie Mountains

(Figure 2.8).

The Athapaskan Southern Tutchone occupy the southwestern corner of the High Plateau

(Yukon), bounded in the southeast by the Saint Elias Mountains and the Boundary Range (the most northerly subrange of the Coast Mountains), and the Teslin and Nisling Rivers to the northeast and northwest respectively (Figure 2.9). At the time of McClellan’s (1975) ethnography, they were composed of six ‘bands’: Champagne, Aishihik, Hutshi, Burwash

Landing (Kluane), Koo Lake, and Lake Laberge (McClellan 1975:25–32). The six Southern

Tutchone ‘bands’ form three First Nations governments: Champagne and Aishihik First Nations

(Haines Junction, Champagne, and Aishihik [Yukon]), the Ta'an Kwach'an Council (Whitehorse, and Lake Laberge [Yukon]), and Kluane First Nation (Burwash Landing [Yukon]). Additionally, many citizens of the Kwanlin Dün First Nation are of Southern Tutchone descent.

Figure 2.8 Indigenous peoples and languages of the Northwestern Subarctic and Northern Northwest Coast.

Language data from Krause et al. (2011), political boundaries from the Commission for Environmental Cooperation (2014).

Figure 2.9 Geography of Southern Yukon and Southeastern Alaska.

Northern Tutchone represents a related but distinct linguistic group from Southern

Tutchone; Northern Tutchone is spoken in the Central Yukon communities of Mayo, Pelly

Crossing, Stewart Crossing, Carmacks, and Beaver Creek, and is represented by three governments: the First Nation of Nacho Nyak Dun (Mayo, Yukon), Little Salmon and Carmacks

First Nation (Carmacks, Yukon), and the Selkirk First Nation (Pelly Crossing, Yukon). The

Northern Tutchone extend as far northeast as the Selwyn Mountains.

Traditional Tagish territory stretches in the south from Tagish Lake in Northern British

Columbia, towards Marsh Lake in the north, which is situated south of Whitehorse. The formerly

Athapaskan speaking Tagish adopted Tlingit as their chief language in the 19th century due to extensive intermarriage, trading, and overall contact with coastal Tlingit. In 2008, the last fluent speaker of the Tagish Athapaskan dialect died. McClellan (1975:37) contends that Tagish

Athapascan was sufficiently different from Southern Tutchone to warrant a distinction. Tagish people live mainly in Carcross or Whitehorse, and are citizens of the Carcross and Tagish First

Nation, or the Kwanlin Dün First Nation.

The Inland Tlingit straddle the Yukon-British Columbia border, occupying a large area around Teslin Lake, east of Whitehorse. It stretches in the north from Northern Lake, Quite

Lake, and Nisutlin Lake almost as far south as the mouth of Taku River drainage near Juneau,

Alaska. There are two contemporary Inland Tlingit bands: the Teslin band (Deisleen Ḵwáan) who occupy the area along Teslin Lake in Yukon, and the Atlin band (Áa Tlein Ḵwáan) who live mainly in and around Atlin, a former Klondike gold rush mining town on the eastern shore of

Atlin Lake, British Columbia. The Inland Tlingit are represented by the Teslin Tlingit Council and Taku River Tlingit First Nation, although the Kwanlin Dün First Nation also has Inland

Tlingit members. It remains unclear if Inland Tlingit pushed Athapaskans out of the area after

migrating from the coast sometime in the past. It seems more likely that the population represents an amalgamation of Tlingit and Athapaskan people brought about through extensive intermarriage in order to maintain lucrative trade networks. The Southern Tutchone and Kaska do not claim to have once occupied the area currently inhabited by the Inland Tlingit bands, leaving the prehistoric time depth of this inland manifestation of Pacific Northwest Coast culture unclear (McClellan 1975:53).

2.1.1.2.3.1 Early Ethnographic Data

Early ethnographic data in Southern Yukon are often convoluted due to inconsistencies in tribal name use and their associated spatial extents, although geographic descriptions tend to be more accurate (McClellan 1975:3). European contact occurred ca. 1741 CE on the Northwest

Pacific Coast, with contact in Southern Yukon Interior occurring much later (ca. 1890 CE) because of both geographic and social barriers. European knowledge of the Alaskan and Yukon interiors was acquired slowly with explorers like Robert Campbell, who mapped the Pelly and

Yukon rivers in 1851, Frederick Schwatka, who charted the upper Yukon headwaters

(Southwestern Yukon) in 1883, and Dawson and Ogilvie (Canadian geologists), who mapped the

Teslin, Pelly, and Lewes Rivers in the 1880s. Sir John Richardson worked to describe and plot

Native Americans in Northwestern North America using explorer’s accounts from Cook,

Wrangell, and Latham, as well as Hudson’s Bay Company traders, in addition to his own accounts from his Arctic expeditions. Ethnographic information on Yukon First Nations was derived from accounts of John Bell (who explored the Porcupine River for Hudson’s Bay

Company) and Alexander Murray (who established Fort Yukon in North-Central Alaska in

Kutchin territory for the Hudson’s Bay Company). J. Arrowsmith created a relatively accurate map of the area in 1854 based on data from Robert Campbell (who had established Fort Selkirk

in 1848 for the Hudson’s Bay Company). Other accounts come from Robert Kennicott, W.H.

Dall, and George Gibbs, among others (for a more in-depth review of early ethnographers in the

Northwestern Subarctic see Cruikshank 2005; de Laguna 1972:107–201; McClellan 1975:3–8).

There are few accounts of the First Nations who occupied the upper Yukon drainage

(Southwestern Yukon) prior to the Klondike Gold Rush, and those few substantially ignore First

Nations south of 62° and west of 134° in Southern Yukon (McClellan 1975:5). Early contact primarily took place in North-Central Yukon, with an expedition by Schwatka, Dawson, and

Glave providing the only firsthand written information about First Nations south of Fort Selkirtk in the late 19th century. They briefly mention their encounters with Tagish and Inland Tlingit while traveling with Southern Tutchone. A second expedition of Glave and Dalton led to additional publications (Glave 1890, 1891, 1892a, 1982b), with Dalton later becoming a Gold

Rush entrepreneur who founded several trading posts in Northern and Southern Tutchone territory.

The principle elements for an absence of ethnographic data throughout Southern Yukon are physical and social barriers that led to an inaccessibility from the Alaskan Gulf Coast.

Chilkoot and Chilkat Tlingit carefully guarded their interior passes (often referred to as grease trails because of the trade of eulachon oil into the interior along numerous trade networks that existed on the Northwest Coast) from Europeans in order to control trade relations with inland groups. The Chilkat Pass (a 10 day hike from the Chilkat River to Kusawa Lake, later known as the Dalton Pass and currently the Haines Highway) and the Chilkoot Pass (a more difficult 3 day hike from Dyea to Summit Lake) connect the coast with the interior in this region (Figure 2.9).

Coastal Tlingit allegedly made little use of the later White Pass Yukon Route (McClellan

1975:5) that became important during the Klondike Gold Rush with the building of a narrow

gauge railroad between 1896 and 1900 CE. Guarded trade relations, which happened to impede ethnographic accounts of Southern Yukon First Nations, took an active form with the assault and sacking of Fort Selkirk (in Northern Tutchone territory) by coastal Chilkat Tlingit in 1852 CE.

The Chilkat and other coastal Tlingit had wished to maintain trade supremacy (as middle-men) over interior First Nations, which was lost in 1896–1898 CE with the influx of around 60,000 prospectors at Dyea and Skagway who moved through the passes on the way to Central Yukon during the Klondike Gold Rush. Although many of these prospectors left soon thereafter, a large number also remained, which irreversibly changed the social landscape.

Both oral-historic and archival data indicate that proto-contact First Nations peoples in the area (ca. 1741–1890) were experiencing significant population transformations due to

European diseases (numerous smallpox epidemics [Cruikshank 2005:205]), Athapaskan tribal displacement to the northwest, the migrations of coastal groups inland, natural disasters (the flooding of neoglacial Lake Alsek), warfare, raids, and extensive intermarriage between interior and coastal peoples (Clark 1991:56; de Laguna 1972; McClellan 1964, 1975; Richards et al.

2007:727). The extinction of sea otter ca. 1800 also lead to a greater demand for inland furs, which would have increased contact between coastal and interior peoples as well as the rate of social change for indigenous peoples of the area. Cruikshank (2005:179-208) discusses the extensive explorations of Edward James Glave along the Alsek-Tatshenshini and Chilkat Rivers where Glave remarks on the “vacant space” of the interior, where “whole forests [were] felled” and there was “undoubted evidences of former occupation[s] by great numbers of people”

(Cruikshank 2005:186).

Surviving ethnographic and oral-historic evidence of these formerly great numbers of people in Southern Yukon will be discussed further with emphasis on coastal-interior interaction

spheres in Section 2.3, following a comparatively brief overview of the environment and culture- history of the Northern Northwest Coast, and a discussion of cryogenic archaeology and its significance for Northwestern Subarctic archaeology and paleobiology.

2.1.2 Northern Northwest Coast

2.1.2.1 Environment and Geography of Southeastern Alaska

The Pacific Temperate Rainforest found along the Southeastern Alaskan coast is environmentally distinct from the boreal forest of the Northwestern Subarctic. The region, ecologically referred to as the North Pacific Coastal Forests (DellaSala et al. 2015), extends in a narrow rugged band (<160 km wide) from the Alexander Archipelago in the south towards Price

William Sound in the northwest along the Alaskan Gulf. This temperate rainforest clings to the lowland ocean edge of the Pacific Coastal Range (a series of mountain ranges forming the western portion of the North America Cordillera that stretches along the West Coast from Alaska to Northern Mexico), occupying thousands of small-to-medium sized islands. Glaciers have carved many long-narrow bays and fjords into the Coast Mountain system, creating an irregular coastline, which historically resulted in its extensive exploration by European explorers searching for a Northwest Passage to Hudson Bay. While there is an extensive botanical diversity across the ecoregion, the predominant forest type is coastal Sitka spruce (Picea sitchensis) and hemlock (Tsuga sp.) (DellaSala et al. 2015). The iconic Pacific redceder (Thuja plicata), found along the Washington, Oregon, and British Columbian coasts, is absent from this northerly section of the rainforest, not growing much further north than Haida Gwaii (Queen

Charlotte Islands). Poorly drained areas contain alder (Alnus spp.), cottonwood (Populus trichocarpa), and Alaska paper birch (Betula papyrifera). The zone has an extremely productive ecosystem, with dense growths of epiphytes, mosses, and lush vegetation, even into the sub-polar

rainforest. Unlikely the boreal forest of the interior which can be prone to frequent forest fires, the coast is typically subjected to small-scale disturbances such as blow-downs and avalanches, in addition to the effects of glaciers (DellaSala et al. 2015). This rainforest ecozone exists because of the combination of mild maritime temperatures and high rainfall from the warm

Alaska Current, often resulting in persistent cloudiness and fog. Most of the ecoregion is within the boundaries of the following environmental protected areas: Tongass National Forest, Glacier

Bay National Park, and Chugach National Forest. Wildlife includes brown bears (Ursus arctos), black bears (Ursus americanus), the Alexander Archipelago wolf (Canis lupus ligoni), Sitka black-tailed deer (Odocoileus hemionus sitkensis), humpback whales (Megaptera novaeangliae), orcas (Orcinus orca), seals (Pinnipeds), sea otters (Enhydra lutris), numerous other important sea mammals, five species of salmon, bald eagles (Haliaeetus leucocephalus), harlequin ducks

(Histrionicus histrionicus), scoters (Melanitta sp.), and marbled murrelets (Brachyramphus marmoratus). Birds represent the majority of taxa (59%), with few herpetofauna (4 amphibia and

1 reptile) being found in this climatologically harsher northern end of the Pacific Temperate

Rainforest (DellaSala et al. 2015; Noss et al. 2015).

The stretch of coastal rainforest relevant to inter-relations between Eyak, Tlingit, and

Athapaskans lies between Prince William Sound and Cross Sound, centered on Yakutat (see

Figure 2.9). The coast is vertically dominated by the Saint Elias, Chugach, Wrangell, and Coast

Mountains. Near Yakutat, Mount Saint Elias fills the skyline, with Mount Logan (the highest mountain in Canada, second in North America, and sixth in the world) about 70 km from the coast still making an imposing impression. The landscape underwent dramatic changes during the Pleistocene-Holocene transition, and throughout much of the Holocene following the Last

Glacial Maximum (26.5–19 kya) (Fedje et al. 2011:323). Further south on Haida Gwaii, the sea

level was >35 m below modern at ca. 15,340 cal-BP (13,000 14C BP), and 150 m below at ca.

14,490 cal-BP (12,500 14C BP), with the vegetative landscape shifting from dwarf willow tundra to pine parkland. A closed hemlock-sitka spruce forest was established by 10,000 14C BP, and a high treeline by 9500 14C BP. Sea levels rose to modern levels at ca. 10,200 cal-BP (9400 14C

BP), and rose 15 meters above sea level (masl) by 10,200 cal-BP (9000 14C BP) (Barrie et al.

1993; Fedje et al. 2005a, 2005b; Fedje et al. 2011:323). Sea level fluctuations continued regionally throughout the Holocene due to glacially induced isostatic depression and rebound

(see Shugar et al. 2014).

Not only was the vegetation and coastal line shifting throughout this period, but there were also many glacial advances and retreats during the Holocene. These glacial pattern changes affected not only the Alaskan Coast, but also the entire region surrounding the glacial icefields of the North Pacific Coast (an interior example is the surging of the Lowell Glacier, which cut off the Alsek River and causing massive flooding, see Cruikshank 2005:43–47; see also Cruikshank

2005:76–124 for oral-narratives related to surging glaciers and their devastating effects). A retreat from the Last Glacial Maximum was underway by 22–20 kya in Southeastern Alaska, with neoglaciation occurring by 4.5–4.0 kya in some areas and major glacial advances occurring between 3.3–2.9 and 2.2–2.0 kya (Barclay et al. 2009). Major advances also occurred between

550–720 CE, in addition to the Little Ice Age advances from 1180–1320 CE, 1540–1710 CE, and

1810–1880 CE. Of note, Icy, Yakutat, Lituya and Glacier Bays (among most others in the area) have undergone significant glacial advances and retreats over the Holocene (see Barclay et al.

2001, 2006, 2009; de Laguna 1972:24–29; Motyka and Begét 1996; Santos et al. 2010; Trüssel et al. 2013), which affected Eyak and Tlingit settlements in the area, repeatedly reshaped the landscape, razed local ecosystems, and erased much of the area’s archaeological past. The

challenging task of finding glacial refugia along the coast is important for understanding centers of biotic dispersal upon regional deglaciation, and for identifying early human migrations from

Asia down the west coast (e.g., Carrara et al. 2007).

2.1.2.2 Northern Northwest Coast Culture History

This archaeological overview of Northern Northwest Coast precontact will be substantially briefer than the preceding section on the Northwestern Subarctic. In continuity with the previous cultural-historic review, information on the Early Period can be found in

Appendix I.

The Northern Northwest Coast is typically defined as being bounded in the north by

Yakutat Bay (Moss 1998), Cape Suckling (Moss 2004), the Copper River Delta (Ames 2003), or

Cross Sound (Ames 2003) and in the south by the Dixon Entrance (north of Haida Gwaii) (Moss

1998), or south of Haida Gwaii (Ames 2003). This overview will focus on the area between

Prince William Sound and Haida Gwaii using the chronology developed by Moss (1998, 2004), although there have been alternative chronologies proposed (e.g., Ames & Maschner 1999;

Davis 1990; Matson and Coupland 1995).

Donald (2003) discusses the following as key features of Northwest Coast culture

(summarized in Ames 2003:19): marine and riverine subsistence and ideology, sophisticated marine technology, developed woodworking, dense populations, an emphasis on property and control of wealth, a tripartite social stratification with true slavery, a lack of intercommunity political organization or political offices, and as an addition from Ames (2003), the household as the basic economic unit.

Frederica de Laguna was one of the first to conduct extensive archaeological and ethnographic work in Southeast Alaska, primarily in Yakutat (de Laguna 1960, 1972; de Laguna

et al. 1964). Originally, it was thought that much of the area was uninhabited until the late prehistoric, a notion that changed with the work of Ackerman (1968b; Ackerman et al. 1979) who demonstrated an occupation older than 9,000 14C BP along Icy Strait.

2.1.2.2.1 Middle Period (ca. 5000–1000 14C BP [Moss 2004])

The Middle Period is notable for significant changes from Early Period assemblages towards what will become the trends of Northwest Coast assemblages. It marks the first of a three-part Development Stage defined by Fladmark (1982), and the first of a three-part Pacific

Period defined by Ames and Maschner (1999; Ames 2003). New assemblage characteristics after

5000 BP (particularly after 4300 BP) include: an adoption of ground slate industries, an increase in site number and average size, the common presence of shell middens, the preservation of bone and antler tools, increased sedentism, and an increasing abundance of faunal materials (Moss

2004:182). Traditionally this Middle or Pacific Period is thought to categorize the development of corporate households, intensive exploitation of salmon, food storage, and social inequality— all correlated with a stabilizing environment (Ames 2003:24–31). Other notable changes include the presence of wood stake fishing weirs, warfare, toggling harpoons, watertight wooden boxes, and seagoing freight canoes (during the Middle Pacific [1800 BCE to 200–500 CE]).

2.1.2.2.2 Late Period (ca. 1000 14C BP – Historic [Moss 2004])

The Late Period has strong cultural continuity with the preceding Middle Period and subsequent Historic (Contact) Period, with an overall increase in artifact diversity, site frequencies, and regional interaction (including raiding, warfare, and trade); Moss (1998) introduces the Late Period into the chronology as a relatively arbitrary construction for organizational convenience. The specific date is of less significance than the onset of the Middle

Period where a more distinctive shift is archaeologically visible. However, on the Northern

Northwest Coast, there are few sites that have been excavated sufficiently to recover large artifact assemblages, and relatively few materials have been dated from this period (radiocarbon samples are often chosen from the bottom of deposits rather than throughout, leading to an underrepresentation of Late Period sites [Moss 2004]). Most of the information from this period comes from further south rather than Southeastern Alaska, with little comparison to developments in the Yukon and British Columbia interiors. In Southeastern Alaska, this period is best known from the work of de Laguna (1960) at Daax Haat Kanadaa (de Laguna 1960) and

Old Town (de Laguna et al. 1964), as well as Ackerman’s (1968b) excavations at Grouse Fort.

The Old Town site near Yakutat has evidence of complex transitions between the Late and

Historic (Contact) Periods with the earliest residents appearing to be Eyak, and Tlingit displacing the former principle inhabitants at some point post-contact—as such, “…we should consider

Yakutat archaeology to be Eyak archaeology” (de Laguna et al. 1964:207). The Late Period is marked by the increase in copper materials, indicating trade with interior Athapaskans, in addition to signs of Pacific Eskimo influences (Moss 1998:102). Population pressure is a major theme at this time, with the Thule Expansion ca. 1000 BP, a protohistoric Haida migration into

Southeast Alaska, and a displacement of Eyak and Tlingit around Yakutat (Moss 1998:104). The

Late Period transitions into the Proto-Historic and Historic (Contact) ca. 1775, although it is important to note that this contact did not reach beyond the coast into the interior, resulting in a much longer Proto-Historic for interior groups (including a large portion of formerly coastal peoples) prior to direct contact.

2.1.2.2.3 Ethnohistoric

Frederica de Laguna (1972) carried out extensive ethnographic work in Yaktuat, producing a three volume, 1395 page tomb titled ‘Under Mount Saint Elias: The History and

Culture of the Yakutat Tlingit’, in addition to her extensive archaeological survey and excavations in the region (de Laguna 1960; de Laguna et al. 1964). The Tlingit (meaning

“People of the Tides”) are matrilineal, complex hunter-gatherers. The Tlingit who came to occupy Yaktuat as recently as the 18th century were preceded by the Eyak (who historically occupy the Copper River Delta, and are linguistically more related to Athapaskans than the

Tlingit further south [de Laguna 1990:189; Moss 2004:179]). Modern Tlingit are organized into as many as 17 groups (kwaans). Prior to contact, Kaignai Haida from Grahm Island (BC) moved into the southern half of the Alexander Archipelago, an event repeated by the Tsimshian in

1887 CE who moved into the southeastern portion of the archipelago. The Tlingit occupied all major rivers and overland routes into the interior (except for the Copper River which was occupied by the Eyak) including: the Alsek, Tatshenshini, Chilkat, Taku, and Stikine—this impeded ethnographic accounts of the interior due to closely guarded trade relations with interior peoples (as discussed in Section 2.1.1.2.3.1). Inter-regional interactions (trade and intermarriage) between Athapaskans, Eyak, and Tlingit led to many coastal peoples moving permanently into the interior (coming to be known as Inland Tlingit), who settled around Atlin, Teslin, and Tagish

Lakes (see Section 2.1.1.2.3).

2.2 Cryogenic Archaeology

Ice patches have arguably become the most important discovery in recent years for

Northwestern Subarctic archaeology because of their abundance of cryogenically preserved organic artifacts, biofacts, and paleobiological materials. The identification of these features in

Southern Yukon in 1997 (Farnell et al. 2004; Kuzyk et al. 1999; Bowyer et al. 1999; Hare et al.

2001) has spawned research into ice patches in Alaska (Dixon et al. 2005; Vanderhoek et al.

2007a, 2007b, 2012), the Northern United States Rocky Mountains (Lee 2012), and the

Northwest Territories (Andrews et al. 2012). The paleoorganic potential of ice patches, which are also referred to as snow patches or snow packs (e.g., Callanan 2012), have a much deeper history in Scandinavia where these kinds of sites were first discovered in Norway early in the 20th century (e.g., Shetelig 1917; Farbegd 1972, 1983, 1991) with important discoveries such as Ötzi

(the Neolithic natural mummy) inciting the spread of this research into alpine areas like the

European Alps (Hafner 2012). Ice patches provide a unique opportunity to recover all of the various materials that are integral to human material culture, but rarely enter the archaeological record in any environmental context (e.g., antler, wood, sinew, feathers, pigments, hafting adhesives). Well over 95% of Northwestern Subarctic artifacts recovered from ice patch sites have wooden components, and temporally range over almost the entire human occupation of

Southern Yukon (Andrews and MacKay 2012:iv-v). In contrast, in a combination of the largest pre-ice patch Athapaskan collections, wooden components constituted at most 21% of the assemblages with the vast majority of finds being lithic (without any contextual organic materials), particularly with sites older than the Late Period. The proportion of organic materials emphasize the missing data that Subarctic archaeologists have been forced to work with when interpreting past lifeways. In a similar vein, prior to the discovery of alpine ice patches there was very little acknowledgement of the role that high elevation regions played in past populations.

Only two archaeological sites in the Yukon had been recorded over 1200 masl prior to 1997, while that number has risen to 24 sites with artifacts (and biofacts) in the thousands in the subsequent years (Hare et al. 2012:130). Neolithic researchers in Europe had also not considered the use of alpine regions above 2000 m (Hafner 2012:190) during the Neolithic Period (7500–

4200 BP) until the discovery of Ötzi the Iceman (5300–5100 BP) in the Ötztal Alps between the

border of Austria and Italy (Bortenschlager and Oeggl 2000; Egg and Spindler 2009; Höpfel et al., 1992; Spindler et al. 1995, 1996).

The research potential of these sites is unfortunately matched by the climate-induced impacts that have been observed across much of the circumpolar north. Coastal sites have undergone significant erosion from rising sea levels, and sites previously protected from taphonmic processes by permafrost have begun to lose their artifactual context through thaw slumping and organic decomposition from microbial activity (Andrews and MacKay 2012:v;

Lawrence et al. 2008; Rignot et al. 2008; Rignot and Thomas 2002; Zemp et al. 2009;). Ice patches have become somewhat of a ‘poster-child’ for the impacts of climate change on archaeological and paleobiological sites. One of the most striking examples is an ice patch

(KhTe-2) in the Selwyn Mountains (Northwest Territories) that was dated at the basal most caribou dung stratum to 3270 ± 40 BP. This ice patch completely ablated between 2009 and

2011, despite millennia of stability (Andrews and MacKay 2012:v-vi). This site once had immense analytic potential to understand caribou food and habitat patterns with its distinct strata of caribou dung amassed over >3000 years, but is “…now little more than a thick smear of

[decontextualized] caribou dung across the mountainside…” (Andrews and MacKay2012:v).

This raises questions as to the impact that the loss of these features will have on contemporary caribou populations. Research has shown that caribou (reindeer, Rangifer tarandus spp.) use these features for summer thermoregulation and for relief from insect harassment (Anderson and

Nilssen 1998; Ion and Kershaw 1989; Kuzyk et al. 1999)—a behaviour pattern that was responsible for the associated archaeological sites in these alpine regions. Andrews and MacKay

(2012:v; Andrews et al. 2012:18) observed caribou returning to recently melted ice patches in

2010, and suggest that the caribou are habituated not only to the ice patches but to their specific

locations. The albedo of dung and ice are dramatically different however, and it is to be expected that these former ice patches will cease to provide a cooling environment as they continue to absorb more heat because of the dark dung (Andrews et al. 2012:18). There is also the potential that ice patch melting may drive the caribou to higher and more dangerous areas to thermoregulate, which could further impact local caribou population health. The disappearance of these landscape features may have significant repercussions for caribou that have already had dramatic population changes in recent years from a variety of external stressors, mostly anthropogenic (Andrews and MacKay:v-vi ; Festa-Biancet et al. 2011; Hebblewhite et al. 2010;

Serrouya and Wittmer 2010). These features contain a wealth of data that could be used to assess past population genetics, diet, and health, which could be applied in future management strategies to mitigate population declines and a narrowing genetic diversity. There is robust evidence for long term ice patch and caribou stability in the Selwyn Mountains (Galloway et al.

2012; Meulendyk et al. 2012; Letts et al. 2012), which would suggest that past indigenous hunters could rely on these caribou to some extent as part of their subsistence strategies. The reduction of caribou would almost certainly also affect contemporary aboriginal peoples who hunt the animals today.

2.2.1 Ice Patch Formation Processes

Before discussing the ecological and archaeological research that has been conducted with materials recovered from ice patches, it is important to outline their structure and formation processes to contextualize these depositional settings. The development of ice patches is still relatively poorly understood, though significant insights were gained in a recently published study that used ground-penetrating radar (GPR) and ice coring to investigate their morphology in the Selwyn Mountains (Meulendyk et al. 2012). Ice patches are permanent alpine ice that form

due to the gradual accumulation of snow compressed into lenses (Meulendyk et al. 2012:43).

They initially develop as snowdrifts on leeward slopes (typically in pre-existing depressions) and accumulate in a consistent location over time (Farnell et al. 2004; Meulendyk et al. 2012;

Vanderhoek et al. 2007a; Washburn 1979). Unlike glaciers, ice patches do not build enough mass to flow (Glen 1955). They range from 100–1000 m in length, and 10–80 m in height

(Meulendyk et al. 2012:43). The ice cores recovered by Meulendyk et al. (2012) in the Selwyn

Mountains ranged from ~0.1–3.4 m in thickness, with their GPR data suggesting a maximum bottom depth of ~3.8 m (Meulendyk et al. 2012: 49, 52). Their data suggest that the characteristics (such as accumulation rate) of each ice patch are strongly correlated with microclimatic variations in the association area, and that they tend to respond (by adjusting in width, length, and thickness) much more quickly than glaciers to climatic change (Meulendyk et al. 2012:55). Despite the ability for single extreme weather events and annual fluctuations to affect the structure of ice patches more readily than glaciers, it should also be kept in mind that some of these features have survived up to 8000 years (uncalibrated 14C date) (Hare et al.

2004:262)—an inconsequential period of time geologically speaking, but enormously relevant for archaeological applications, in addition to contemporary climatological monitoring.

Interspersed within the ice are frequent strata of datable caribou dung (Andrews et al.

2012:5). Caribou congregate annually at these alpine locations, with their dung being continually deposited on the uppermost snow surface. These deposits are preserved as the snow turns into ice, but when there is a particularly warm summer and the ice patch ablates through multiple dung layers, these layers concentrate into a single stratum and record time in decades or centuries where there was no net accumulation of ice (Meulendyk et al. 2012:54). These dung ‘super layers’ have also been observed in Yukon ice patches (Farnell et al. 2004). This would allow for

a bracketing of undated materials if they were found in situ without a mixing of upper components. However, most of the ice patch survey strategies rely on surface finds exposed by recently ablated ice. The materials recovered are typically conducive to radiocarbon dating (with over 200 radiocarbon dates from Yukon ice patches alone, Hare et al. [2012:128–132]), which reduces the problem of this vertical conglomerating of components. Intact dung pellets have been extracted in ice cores, suggesting minimal surface exposure for deposited materials prior to cryogenic preservation.

Snow not lost during seasonal ablation densifies through grain packing; melt water percolates through snow and firn (snow left from previous seasons that has recrystallized and exists in an intermediate form between snow and glacial ice) and freezes in the matrix. Melt that is held in place during the summer by surface tension in the firn refreezes in the winter, further reducing pore space. When this is repeated for multiple years, the remaining pores continue to be reduced creating ‘bubbly ice’ (Meulendyk et al. 2012:53–54). Because ice patches share the same accumulation control (precipitation) as glaciers, the rate of glacial retreat or advancement can be correlated with ice patches, although microclimate variations in the region can lead to discontinuities, particularly when considering the relative sizes of these features.

2.2.2 Archaeology and Paleobiology of Alpine Cryogenic Sites in the Northwestern Subarctic

In August 1997, two hunters found a concentration of caribou dung and antler on a north facing snow patch 1830 masl on Thandlät Ddhäl (meaning “sharp, pointed mountain” in

Southern Tutchone) in Southern Yukon, 60 km west of Whitehorse near Kusawa Lake (Kuzyk et al. 1999:214; Hare et al. 2011:2). Kuzuk et al. (1999:214) found this worthy of further investigation because caribou have not been seen in the area since the winter of 1932 (see also

CAFN et al. 2001). One month later, a survey of the snow patch led to the discovery of faunal

remains (including hair) as well as the proximal end of a feathered projectile point shaft (with surviving sinew). Caribou fecal pellets retrieved from the base of the patch with an ice core were

14C dated to 2450 ± 50 BP, while the dart shaft was 14C dated to 4360 ± 50 BP. Kuzyk et al.

(1999:215) estimate that the ice was 5–10 m thick. Although faunal materials were sent for DNA analysis, the results were unavailable at the time of publication. An analysis of the fecal matter determined that it was deposited by caribou (Rangifer tarandus spp.) rather than dall sheep (Ovis dalli) because of the high proportion of lichen. The authors argue that these were summer fecal deposits because of caribou thermoregulation behaviour patterns associated with alpine snow patches (Ion and Kershaw 1989). This presumed seasonal use of the area by caribou is combined with the direct historical approach to support ethnohistoric hunting strategies at these locations because of a preference for summer hide with its shorter hair (Cruikshank 1985; Kuzyk et al.

1999:218). Kuzyk et al. (1999) discuss oral historic information that suggests that hunting blinds were used at these locations; these structures have been archaeologically interpreted in the area

(Greer 1986) but not at the original site (Kuyzk et al. 1999:219). Further reporting of the initial ice patch research drew attention to the archaeological and paleobiological potential of ice patches in the area (e.g., Bowyer et al. 1999; Farnell et al. 2000; Hare et al. 2001; Krajick 2002).

The initial recovery of cryogenic archaeological material in the Northwestern Subarctic was significantly expanded upon in August 1999 with the discovery of human remains and associated artifacts by three hunters in the traditional territory of Champagne and Aishihik First

Nations (CAFN) in Northern British Columbia (Beattie et al. 2000). They were found over

100 km inland eroding from a high elevation glacier (1600 masl) near the Tatshenshini River at the southern end of the Saint Elias Range (Figure 2.9). The remains of a young adult male were given the name Kwäday Dän Ts'ínchi by the CAFN, which means “long ago person found” in

Southern Tutchone (Beattie et al. 2000:135). Associated materials with the naturally mummified remains were initially 14C dated to around 550 BP although there were a broad range of dates identified, which the authors attribute to multiple depositional events and a mixing of materials; the human remains themselves were also displaced horizontally across the glacier. A revised analysis using direct dating of osteological samples produced two 14C dates: 952 ± 28 and 935 ±

75 BP (Richards et al. 2007:721). However, the individual was also found to have a strong

(lifetime) marine-based diet based on their elevated δ15N (Richards et al. 2007:721; Corr et al.

2009), which suggests the consumption of high trophic level marine protein (Peterson et al.

1985; Peterson and Fry 1987; Richards and Hedges 1999). The δ13C values in the bone and muscle tissue also indicate a marine based diet approaching 100% (Richards et al. 2007:723).

This diet profile makes it necessary to apply a marine reservoir correction to the 14C dates

(Arneborg et al. 1999; Barrett et al. 2000; Richards and Sheridan 2000). This effect is caused by weathered limestone dissolved into biocarbonate that has no 14C, which leads to a dilution, resulting in a relative depletion of 14C compared with terrestrial environments. This process makes marine samples appear much older (Stuiver and Braziunas 1993). The effect is further compounded by a delay in exchange between atmospheric CO2 and ocean bicarbonate

(Mangerud 1972). A marine correction (referred to as ΔR) recorded from a nearby source has to be applied to the original date, but at the time of publication there were no published coastal ΔR values near the recovery location. Richards et al. (2007:721–722) used values recorded from

Haida Gwaii and Prince Rupert (Southon and Fedje 2003) as a closest analog. Since their publication, ΔR values have been published much closer to the recovery location of Kwäday Dän

Ts'ínchi, and the software and calibration curves have been updated. For this reason, I have

supplied a new list of calibrated dates that suggests that the Kwäday Dän Ts'ínchi materials are even younger than previously considered (Table 2.3, Figure 2.10).

Aside from the complications of the marine reservoir affect, the marine diet of the individual indicates that this was a Northwest Coast person, rather than an Athapaskan. A stable isotope analysis of hair recovered from the individual found a shift during the last year of the

13 individual’s life towards terrestrial C3 foods, with compound specific δ C values showing a C3 terrestrial and marine diet in the months prior to death. There is also evidence in the skin cholesterol δ13C values suggesting a return to marine foods recently before death (Richards et al.

2007:724-728). An analysis of stomach contents (Dickson et al. 2004) found coastal foods such as a marine crustacean, salt marsh plant, and fish bones (potentially chum salmon based on scales found on the clothing). The dietary analysis was expanded upon soon thereafter (Corr et al. 2008; Corr et al. 2009) with more intricate methods to investigate subtle changes in the life history of the individual. The authors found a sudden shift to inland C3 foods only months prior to death (and presumably a final return to marine foods based on the stomach contents at death), with the rest of the individual’s life being entirely marine based. Some of the wooden artifacts recovered with the remains were anatomically identified as hemlock (Tsuga sp.) (Young 2000), a coastal tree species not found in the interior. Cruikshank (2001:386) further suggests that descriptions of Tlingit clothing by La Pérouse in July 1786 matches those recovered with the cryogenic remains. A diverse variety of other research has been conducted on Kwäday Dän

Ts'ínchi, including a stomach bacteria analysis (Swanston et al. 2011) and an investigation of free fatty acids as an indicator of decomposition (Liu et al. 2010), in addition to many others

(e.g., Malhi and Smith 2002; Monsalve et al. 2002; Dickson and Mudie 2008).

Table 2.3 Updated marine offset values from Richards et al. (2007) for radiocarbon dating Kwäday Dän Ts'ínchi (see Figure 2.10). Sample Region for offset ΔR km to KDT Calibrated age (1σ) Offset Source Richards et al. (2007) 1 Pavlov Harbor, Alaska 242 ± 50 1548 1480-1700 cal-CE Robinson and Thompson (1981) 2 Haida Gwaii 300 686 1540-1720 cal-CE Southon and Fedje (2003) 3 Prince Rupert 375 723 1660-1850 cal-CE Southon and Fedje (2003) updated with calib 7.0.4 1660-1880 cal CE Revision 4 Glacier Bay, AK 460 ± 60 77 1728-1950 cal-CE McNeely et al. (2006) 5 Sitka Sound, AK 410 ± 60 278 1688-1890 cal-CE McNeely et al. (2006) 6 Orca, AK 440 ± 20 503 1719-1893 cal-CE McNeely et al. (2006) Revised calibrations conducted using calib 7.0.4 (Stuiver and Reimer 1993).

Figure 2.10 Marine offset sources (see Table 2.3).

Map data from the Commission for Environmental Cooperation (2014).

Ice patches in Southern Yukon have been surveyed annually since 1997 with varied recovery rates (Hare et al. 2012:121). Farnell et al. (2004) and Hare et al. (2004) published in the same landmark volume of Arctic in 2004 describing the multidisciplinary research conducted to date on the Southern Yukon ice patches. For the archaeological material, Hare et al. (2004) focused primarily on the dart and arrow shaft changes through time, which was expanded upon with a larger assemblage and associated radiocarbon dates (Hare et al. 2012) as well as a thorough analysis of arrow shaft wood types (Alix et al. 2012). The abrupt technological shift from throwing darts to arrows ca. 1200–1100 14C BP (as discussed by Hare et al. [2004:268–

270]) is one of the clearest indicators of past cultural change made apparent by ice patch research. The shift in weapon type is also signaled by a change in preferred shaft wood (birch to spruce) and armature (stone to antler). The apparent speed at which this change occurred is suggested by Hare et al. (2012:133) to be linked with the coinciding eastern lobe of the White

River eruption ca. 1200 BP which seems to have led to a temporary abandonment of Southern

Yukon (see Section 2.1.1.2.2). The re-colonizing groups appear to have entered the area with a fully developed bow-and-arrow technological system in place. As discussed previously (Section

2.1.1.2.2), it is difficult to know how long areas of Southern Yukon remained uninhabited following the eruptions, but the coinciding partial replacement of caribou in Southwestern

Yukon would have also certainly affected the presence of caribou at Yukon ice patches (Kuhn et al. 2010; Letts et al. 2012:91). Other notable materials recovered from Yukon ice patches include: a microblade core, numerous bifaces, a moccasin, and a musket ball, with ochre being found on many of the artifacts (Hare et al. 2012:122). The organic artifacts and biofacts range in dates from Klondike Gold Rush to a 8360 ± 60 14C bp dart shaft fragment (Hare et al. 2012:131–

132)—calculated (2σ) to ca. 9306–9515 cal-BP using Calib Rev 7.0.4 (Stuiver and Reimer 1993,

2014). Similar archaeological work has been conducted in the Selwyn Mountains, Northwest

Territories where there is also a Late Period shift to arrow technology sometime after the Eastern

White River Ashfall, however the same wood taxon shift from bitch to spruce is not present

(Andrews et al. 2012a, 2012b). This may be due in part to a smaller sample size of archaeological materials recovered from these patches. One particularly interesting artifact found from a Selwyn ice patch was a snare made of willow. Although caribou hunting appears to have been the primary hunting activity at these sites, the snare indicates that small game was also caught in the area, which is possibly supported by small mammalian and bird remains recovered from ice patches throughout the Northwestern Subarctic (Farnell et al. 2004:254). Vanderhoek et al. (2012:155) further suggest that a blunt antler projectile point found in Wrangell-St. Elias

National Park, Alaska was used to hunt Ptarmigan (or ground squirrels) that commonly nest adjacent to ice patches. While it is likely that ice patches represented specialized hunting sites, as no evidence of habitation structures have been found at the ice patches and most are situated nearby (10–15 km) to known archaeological sites in valley bottoms (Hare et al. 2004:262), it is probable that these locations provided a number of resources required by Subarctic groups.

2.3 The Antiquity of Inter-Regional Interactions between the Subarctic Interior and the Northern Northwest Coast

The extensive trade networks that had developed between interior Athapaskans and coastal Tlingit and Eyak are well-documented ethnohistorically, and are thought archaeologically to have had an increasingly important role during the Late and Historic (Contact) Periods in both archaeological culture areas (see Clark 1991:79–89; Cruikshank 2005; de Laguna 1975;

McClellan 1975). It is difficult to estimate the antiquity of these protohistorically flourishing trade networks because much of the documented trade was in perishable materials (e.g., coastal

marine products for furs and skins [Cruikshank 2005:213]), but native copper on the coast and cryogenic organic materials in the Subarctic do provide some evidence. Linguistically, the presence of Inland Tlingit people in the interior, as well as the adoption of Tlingit as the Tagish’s primary language (an Athabaskan group [Section 2.1.1.2.3]), are suggestive of a relatively long term relationship between the coast and interior. A visual piece of evidence for these trade relations comes from a drawing by Gaspard Duché de Vancy, an artist accompanying La

Pérouse’s expeditions, where an individual in frame is wearing clothing indicative of interior

Athapaskans (Figure 2.11) (Dunmore and de Brossard 1985: Plate 8; Cruikshank 2001:386).

Cruikshank (2001:386) discusses La Pérouse’s descriptions of First Nations encountered by

European explorers at Lituya Bay, where the chief was wearing a moose skin—moose were not present on the coast until the mid-20th century when they began to move down the Alsek Valley, further suggesting the extent of trade goods from the interior on the coast.

The Pacific Coastal Range and associated glacial icefields were boundaries that constricted contact between coastal and interior First Nations, but it is important to recognize that these geographic features (and their bi-correlated culture-historical constructs) were more permeable than we might otherwise assume. Cruikshank (2005) uses ethnographic and historic data to discuss the importance (economically and ideologically) of glaciers for Alaskan and

Yukon First Nations in past lifeways, and the use of glaciers as ‘highways’ for trade and migration between the coast and interior, rather than barriers to be avoided (see Cruikshank

2005). Tlingit traders are reported to have used snowshoes with claws as crampons to scale ice and traverse glaciers (Cruikshank 2005:38). The perils of glacier travel play an important role in oral narratives of First Nations in the area, with norms of conduct around glaciers (for example not cooking with grease and not disrespecting glaciers for fear of surges), and the mutual

Figure 2.11 “Costumes of the inhabitants of Port des Francais” (Lituya Bay, 1786) a drawing by Gaspard Duché de Vancy.

The ‘Athapaskan’ individual is circled in red. Source: Dunmore and de Brossard (1985); Cruikshank (2001:386, Figure 2). accountability for the safety of interior and coastal trading partners being central themes. Oral- historic and ethnographic evidence suggests that coast-interior interactions were an important aspect of lifeways deep into antiquity, in part because of the overall expanse and defense of these trade networks historically (Clark 1991:67). Workman (1978:93) disagrees in sense, arguing that it is “…extremely unlikely that contact with Tlingit-speakers was a factor in Southwest Yukon life for more than a century or two before the coming of the white man.” He goes onto say that earlier contact with other coastal peoples who preceded the Tlingit in the area—the Eyak or other

Athapaskan speakers (see de Laguna 1964:207)—is possible. It is important to consider that trade relations with the earlier Eyak occupants of the Northern Northwest Coast may have been 62

quite different from those with the historically documented Tlingit. A summary of evidence for antiquity of coast-interior interactions will be discussed here, split between ethnohistoric and archaeological evidence.

2.3.1 Historic Trade and Travel

Although treacherous (see Cruikshank’s overview of oral-histories and Edward Glave’s travels along the Alsek-Tathenshini River route [Cruikshank 2005:39–47, 179–210]), glacier bound alpine rivers in the region served as routes for trade into the interior. These eulachon grease trails existed on the Copper, Alsek-Tatshenshini, Chilkat, Taku, Stikine, and Nass Rivers

(the only river passes through the northern portion of the Pacific Coast Range), with

Athapaskans trading baskets, ladles, spruce gum, native copper, obsidian, ground-squirrel robes, moose and caribou hides, and other clothing for marine-coastal items such as dried clams and seaweed, dentalium shells, and eulachon oil (Clark 1991:80). Obsidian was being traded from sporadic sources along the Pacific Coast Range including Northwestern Alaska, Mount Edziza

(Northwestern British Columbia), and the Wrangell and Saint Elias Mountains (Clark 1991:80).

Archaeologically visible coastal materials traded to the interior include shells, particularly dentalium shells that were traded out from Vancouver Island and up along the coast and into the

Subarctic and Arctic.

Native copper was principally sourced from the Wrangell Mountains along Copper and

Chitina Rivers and the headwaters of the White River (Clark 1991:80), a resource controlled historically by the Ahtna of the Copper River Valley, as well as Southern Tutchone. These same copper sources along the Chitina River in modern day Wrangell-St. Elias National Park and

Preserve (found to be the richest concentrations of copper in the world) were exploited historically at the Kennecott Mine, which extracted 4.625 million tons of copper ore during its 27

years (1911–1938) of operation. Prior to the Klondike Gold Rush (1896–1899), native copper was traded to the Tagish by Southern Tutchone, who in turn traded it to the Eyak and Tlingit; the

Ahtna traded directly with the Eyak and Tlingit by way of the Copper River Delta, or alternatively across the Bagley Icefield and towards Icy Bay (Cruikshank 2005:34; de Laguna and McClellan 1981:651). Segments of Eyak and Tlingit around Icy and Yakutat Bay have oral- histories of descent from Ahtna, either coming down the Copper River to the sea, and moving southeast along the coast to integrate with people already established in the area (Cruikshank

2005:35), or moving south from the Chitina River across the Tana Glacier, southeast across the

Bagley Icefield (Figure 2.9), and southwest from Mount Saint Elias to Yahtse River and Icy Bay

(Cruikshank 2005:33–36). The Bagley Icefield was an established precontact trade route for travel between the Ahtna and Eyak-Tlingit (de Laguna and McClellan 1981:650–652). The

Tlingit linguistically distinguished between interior Athapaskan tribes and the Ahtna, referring to the Ahtna as ‘copper diggers’ (de Laguna 1975:214). Copper is also figured prominently in

Yakutat oral history, where a large copper plate or nugget was given by the Kwaashk'i Kwáan as payment for a Yakutat salmon stream (Cooper 2011:260; de Laguna 1964:7; Swanton 1909:347–

368). Many Eyak-Tlingit origin stories tell of a past in the interior, with their ancestors traveling to the coast from the Alsek, Taku, and Stikine rivers to join displaced Tlingit moving north under the northward expanding pressures of Haida (Cruikshank 2005:33–39). Collections of people from peripheral areas converged at Yakutat, which was itself being ‘reborn’ from a period of glacial advance (Cruikshank 2005:141). Tlingit oral-histories recounting migration from the interior have yet to be critically examined (Moss 1998:105; Moss 2004:184).

During Edward Glave’s expeditions from the coast to the interior, he observed markers of old trails everywhere, noted by blazed large trees and knots in the limbs of sapplings, in addition

to evidence of large, now absent, populations (Cruikshank 2005:186). This hints at the former expansiveness of trade networks prior to population disruptions of the protohistoric. There was likely a long-lived stimulus for the obvious opportunities afforded by trade between people of the neighbouring temperate rainforest and boreal cordillera due to their dissimilar environmental zones, offering varied resources. In the Northwestern Subarctic, these trade relations were mostly amicable (as opposed to other Subarctic areas where raiding and pillaging were commonplace), with prearranged trade meetings at Tagish and Kusawa Lakes (for example) being accompanied by ceremonies, contests, and feasting (Clark 1991:87–88). The power-dynamic shifted during the

Historic Period. Coastal groups having direct access to European goods took on the role of middlemen where they could barter these goods at great profit to interior Athapaskans, leading in some cases to hostilities (see Reedy-Maschner and Maschner 1999). With the collapse of sea otter trade, the Chilkat Tlingit were in need of furs from the interior to trade with Europeans. The

Chilkat in particular drove hard bargains with Tutchone, becoming overlords in a sense, denying access of interior peoples to the coast, and assaulting trade outposts such as Fort Selkirk

(Workman 1978:91-92).

2.3.2 Archaeological Evidence

Workman (1978:419) was skeptical of the antiquity for coast-interior interactions. Both de Laguna et al. (1964:207–210) and McClellan (1967:5, 55, 1975:23) suggest that interior-coast interactions were ancient in the area, and that a North Pacific Culture may have crosscut linguistic boundaries between Athapaskans and Tlingit-Eyak deep into the past. Workman

(1978) found that the Aishihik Phase (and potentially the Late Taye Lake Phase) showed strong ties between the North Pacific Coast and Southern Yukon (Section 2.1.1.2.2). The material evidence includes: elaborate and nearly identical copper implements, grooved adzes, abraded

cobbles, blunt-ground slate pieces, boulder spalls, tabular schist bifaces, and certain bone implements (see de Laguna et al. 1964). Workman (1978:419) goes on to note that there has been too little archaeological work conducted in the Yakutat area to assess the significance of these relations in earlier precontact times. Other archaeological evidence includes a fragmented scallop shell from the Annie Lake site (south of Whitehorse), relatively dated to the Late Prehistoric

(Hare 1995). A hemlock (Tsuga sp.) arrow shaft with an antler arrow head was also recovered from an ice patch site (JcUu-2, southwest of Whitehorse) with an associated age of 410 ± 100 cal-BP (Alix et al. 2012:106). Based on the straightness of the grain, the lack of knots, and the regular and narrow growth rings, this arrow shaft is likely western hemlock (Tsuga heterphylla) rather than mountain hemlock (T. mertensiana), meaning it originated from the Pacific Coast from an elevation of less than 1000 masl. Kwäday Dän Ts'ínchi and the associated remains (see

Section 2.2.2) constitutes the clearest archaeological evidence of coastal-interior interactions.

The main evidence of interior materials on the coast is copper, which again is relegated to the

Late Period (Moss 1998:101–102). Based on the archaeological evidence recovered to date,

Workman’s (1978) is correct in his assessment; strong ties between the North Pacific Coast and

Subarctic Interior are confined to the Late Period (Hare 1995), with the fur trade and associated cultural transformations greatly expanding the importance of the trade network during the contact period (see Cooper 2006:155).

Two artifacts have been recovered that could extend the known depth of contact in this area. The first is a 1 x 0.5 m bear hide dated to 1110 ± 50 cal-BP (which is contemporaneous with the eastern lobe of the White River Ashfall [see Section 2.1.1.2.2]) (Cruikshank 2005:245,

286), and recovered from a glacier in the upper Kaskawulsh drainage. This artifact is suggestive of the use of glacial travel routes (referred to by Cruikshank [2005] as ‘highways’) by ca. 1100

BP, although there already exists some evidence of coast-interior interaction in the Late Middle

Period. The second piece of evidence is the 1.32 m long Kluane Stick (2430 ± 20 14C BP

[Holdsworth and Lacourse 2015]) as discussed in Chapter One. The specimen may have been used a walking stick for glacial travel, similar to a story recorded by Cruikshank (2005:58) where a Tagish man saved his trading partner who had fallen into a crevasse by lowering a staff tied by babiche (cordage made by soaking moose or caribou hide) to propel him to the surface. The artifact may have also been used as Holdsworth and Lacrouse (2015) propose, as part of a bundle for a sleeping platform, or for making fire. The recovery location southeast of Mount Logan is intriguing, as it is in close proximity to the oral-historic Ahtna trade route. This specimen suggests that travel along ‘glacier highways’ may have been occurring as early as 2500 14C BP.

If determined to originate from the coast, it would shift the archaeological evidence of coast- interior contact to the mid-Taye Lake Phase, or the Early Late Taiga Period (see Figure 2.6).

Whether the specimen is from the coast or interior, it is still indicative of glacial travel deeper into antiquity than other evidence currently supports, particularly given the remote recovery location. If the specimen originated from the coast, it would be suggestive of an established precontact trade route through the Icefield Ranges given the treacherous nature of travel through the Saint Elias Range in order to reach the location of recovery (Holdsworth and Lacourse 2015).

To investigate the origin of this specimen, modern and ancient genetics was used to investigate the population genetic diversity of Salix ssp. in the vicinity of the Saint Elias Range, followed by ancient DNA extractions of ice patch biofacts and the Kluane Stick. The following two chapters will outline the field of ancient DNA (Chapter Three), including its complications, limitations, and strengths, as well as the nuances of botanical tissues (particularly wood) for ancient plant DNA (Chapter Four).

Chapter Three: Ancient DNA

This chapter consists of an overview of background fundamentals, methodological developments, and cross-disciplinary applications of ancient DNA (aDNA) in order properly convey the strengths and limitations of the method for a critical review of this thesis. DNA is a vulnerable biomolecule prone to degradation, which creates the challenge of overwhelming exogenous contaminants that can only be removed or avoided through adherence to meticulous protocols. Nearly all of the early work in paleogenetics has been shown to be erroneous, which has instilled a hyper vigilance in the field for caution and skepticism. Despite these challenges, aDNA has become the most direct means of addressing biological variability in the past, with a broad range of applications. The specific complications of woody plant tissues and chloroplast

DNA for paleogenetics will be discussed in the following chapter (Chapter Four).

The first portion of this chapter serves as a summary of basic genetics, followed by an overview of aDNA. Subsequently, the early history of aDNA is discussed to create a historical basis for the following discussion on the twin issues of paleogenetics: degradation and contamination. The final portion of this chapter is dedicated to an overview of the breadth of applications of aDNA to paleobiology and archaeology with the intent of illustrating that despite the problems of aDNA authentication, a myriad of research problems can be addressed in unique and powerful ways using paleogenetics, but more powerfully moving forward: paleogenomics.

3.1 Basic Genetics

Deoxyribonucleic acid (DNA) is an information molecule that encodes genetic instructions for the development and maintenance of living organisms and many viruses. It is composed of a pentose (a type of sugar with 5 carbon atoms), a phosphate group (comprising three linked phosphate units attached to the 5’ carbon of the pentose sugar), and a nitrogenous

base (or nucleotide base) (see Figure 3.1 [Brown and Brown 2011:9–37; Freeland et al. 2011]).

The four potential nucleotide bases in DNA are cytosine (dCTP or C) and thymine (dTTP or

T)—which are single-ring pyrimidines—as well as adenine (dATP or A) and guanine (dGTP or

G)—which are double-ring purines. The bases are attached to the 1’ carbon of the sugar by a β-

N-gycosidic bond (a kind of covalent bond). In living cells, a DNA molecule includes two polynucleotides that are wound together to form a double helix. The two opposing strands are

Figure 3.1 The chemical structure and directionality of DNA.

The figure progresses from a structural formula in the upper left upper left to a simplified sketch in the bottom right.

anti-parallel, and are held together by base bonding. Hydrogen bonds (which are non-covalent) bind A with T (two bonds), and C with G (three bonds). The standard unit when discussing DNA length is the base pair (bp), which describes the bond between two complementary nitrogenous bases. Variants of this include the kilobase (kb) for 1,000 bp, and megabase (mb) for 1,000,000 bp. For scale, the human nuclear genome is approximately 3,200 mb. The sugar-phosphate backbone of DNA is linked together by phosphodiester bonds between the 5’ and 3’ carbons on the sugar. This creates the directionality of DNA, as a newly forming DNA strand can only be extended on the 3’ end with the addition of a new phosphate group through the polymerization reaction, which removes the 3’ hydroxyl group (OH). This is important for replication because the strands can only extend 5’ to 3’, and the nucleotides enter according to the complimentary base pairs of the existing strand (which runs in the opposite direction); by convention, DNA is read 5’ to 3’ on the coding strand (Figure 3.2) (the side with an identical sequence to mRNA produced during transcription, aside from the replacement of T with U).

The entire set of DNA is referred to as the organism’s genome. The nuclear genome of humans is divided into 23 paired linear molecules called chromosomes (which are also

Figure 3.2 ‘Coding’ and ‘non-coding’ DNA strands.

structurally composed of proteins). Twenty two of these pairs are autosomes, with an additional two sex chromosomes (X and Y). Chromosomes are divided into genes, which are considered the molecular unit of heredity, with internal subdivisions of exons (sequences that remain present in a mature RNA product) and introns (a sequence within a gene that is removed by RNA splicing, derived from the term intragenic region, meaning a region inside a gene). It was originally considered that introns were non-coding, unimportant sequences, but it is now well-established that introns do have complex functionality (see Chorev and Carmel 2012). Protein creation occurs when the double helix partially unwinds, and messenger RNA (mRNA) is created from the template strand through a process called transcription. RNA is then used to build proteins through translation, carried out by ribosomes. This process allows for the transition from an organisms genotype (genomic information inherited from parents to progeny) to their phenotype

(an organisms observable characteristics). There are three types of DNA that can be present in eukaryotes (an organism whose cells contain a nucleus and other organelles enclosed in a membrane). Nuclear DNA (nDNA) is stored in a cell’s nucleus, is biparentially inherited, and there are only two copies per cell. Mitochondrial DNA (mtDNA) exists in a cell’s cytoplasm in mitochondrial organelles, is maternally inherited, and there are thousands of copies per cell.

Chloroplast DNA (cpDNA) exists in plant cells and some other eukaryotic organisms, and is located in plastid organelles (specifically in chloroplasts, the sites of photosynthesis). Often cpDNA is maternally inherited, but there are many exceptions to this, owing to the complex inheritance pattern of cpDNA.

The polymerase chain reaction (PCR) is the primary method used to amplify (artificial replication) specific regions of DNA (Figure 3.3) through the creation of primers (that are

Figure 3.3 The first two cycles of a Polymerase Chain Reaction (PCR).

The orange primer is forward, the green is reverse. The combination of the two eventually leads to just the target area being amplified in the majority of PCR products. 72

approximately 20–30 bp in length), and are designed to bind to conserved regions (a DNA sequence similar or identical within or cross-species due to strong selective pressures) on a genetic sequence, up and downstream of the target polymorphic locus or loci. The primers will extend downstream (5’ to 3’) during PCR to amplify a small section of DNA (typically with a maximum of ≤ 5 kb in non-degraded DNA, but can exceed 30–40 kb using long range PCR).

This process can amplify a single DNA fragment into millions of copies.

It is because of the massive size and complex nature of an organism’s genome, in addition to cost and technological limitations, that small specific loci have been the primary target of traditional genetic research. The field has dramatically shifted in recent years to genome wide amplifications with ‘next-generation methods’, which have increasingly become cheaper and more accurate than locus specific targeting (if the equipment is available). This emergence of big data (genomics and proteomics) has necessitated the rapid development of bioinformatics technologies (computer software developed to mathematically and statistically make sense of molecular data). Entire genomes in the megabase range can be amplified and sequenced in a single multi-hour run for as little as $50 to $1000. The equipment is expensive however, and the methodology is more involved than traditional ‘Sanger sequencing’. These powerful but expensive methods have seen limited use in archaeological applications, although they are rapidly becoming the norm. This thesis uses standard PCR and Sanger sequencing; only a small portion of aDNA labs worldwide can conduct paleogenomics work, although this number is growing rapidly.

3.2 Ancient DNA

Ancient DNA is typically associated with organisms that died over 50 years ago as applications of forensic DNA generally use this boundary as a limit of legality. Genetic forensic applications also tend to use protocols very similar to aDNA analyses because of the degraded nature of the samples (Melton and Nelson 2001). Due to the time depth of these biomolecules, as well as the relatively unstable nature of DNA (Mitchell et al. 2005:267), aDNA is principally characterized by its degradation. The fragments are typically small, as in less than 300 BP, of poor quality (issues such as base modifications and miscoding lesions are common), of low quantity (intact DNA can be far less than 1% of the total extracted DNA), and mixed with impurities—most problematic of these being PCR inhibitors. Although the recent work by

Allentoft et al. (2012) has derived a DNA half-life of approximately 521 years in bone, the actual probability of DNA preservation is highly contingent upon environmental factors. The rate process of DNA degradation that Alentoft et al. (2012) found helps to dispel notions of multi- million year aDNA preservation—samples exposed to favorable conditions for decay processes could degrade to a total lack of recoverable DNA in a very short period of time following the organisms death, while those in optimal preservation conditions could store preserved DNA up to 450–800 kya or more (Willerslev et al. 2007). It is generally thought that DNA will not preserve much longer than 100 kya, except in special cases—“to consider amplification of DNA molecules older than one million years of age is overly optimistic” (Hofreiter et al. 2001:353).

Ancient DNA can be recovered from a variety of organic tissues or matrices in varying states of preservation. Bones and teeth are the most common sources of aDNA for archaeological and paleobiological purposes. Bone cells (osteoblasts, osteocytes, and osteoclasts) tend preserve

DNA fragments well. It might be assumed that lamellar (also known as compact or cortical) bone

would tend to preserve DNA better than trabecular (or woven) bone, due to the structural permeability of the latter, but because of the complex nature of bone decay, burial environments must be assessed independently. Teeth tend to preserve DNA well due to their lower porosity when compared with bone, which also leads to a reduced rate of decay from microorganisms

(Brown and Brown 2011:100–101; Gilbert et al. 2005). DNA can be found in the dentine, pulp, and cementum of teeth. Overall, the dentition is one of the most taphonomically robust materials, and is frequently found when all other organic materials have decayed beyond use. Soft tissues are also potential sources of aDNA, whether via natural or artificial mummification; this can occur in hot-dry, cold-dry, or cold-anaerobic environments. Coprolites (fossilized feces), are also a viable aDNA source, although verification of the biomolecules can be difficult and the state of fossilisation can also affect the quantity of DNA preserved. Plant macrofossils (such as seeds, cobs, wood, or leaves in exceptional cases) can yield aDNA, particularly in desiccated or partially charred specimens (Brown 1999:95). Ancient DNA can also be extracted from ancient soils (sedaDNA); leaching, authentication, PCR inhibitors, and dating can all be issues when investigating sedaDNA (Haile et al. 2007), particularly since sediments cannot be chemically decontaminated with bleach because the treatments would likely destroy all DNA in the sample, rather than just surficial contaminants. However, exogenous sedaDNA can now be methodologically overcome (by amplifying all DNA present and only analyzing the target sequences) through high-throughput platforms (next generation sequencing) in ways that traditional Sanger sequencing could not. Finally, DNA can be recovered from a variety of other biological sources, given amenable taphonomic conditions, including: hair, fur, leather, insects, eggshells, feathers, tool residue, and parchment (Brown and Brown 2011:91–114).

3.3 The Early Development of Ancient DNA Research

The field of ancient DNA began in the early 1980s with the extraction of genetic material from a well preserved 2,100 year old natural mummy from China (Hunan Medical College 1980; see also Herrmann 1994:1–2). Although this is the first published study of an aDNA extraction, it is not commonly cited in the literature. The first well known study to successfully extract ancient DNA came four years later from Higuchi et al. (1984) at Berkeley. The authors were able to extract a DNA sequence from dried muscle tissue of a museum stored Quagga (Equus quagga), which was a zebra-like species that became extinct in 1883 CE. The authors were able to demonstrate that DNA remained in this specimen for more than 150 years after its death.

Following this success, Pääbo (1985a; 1985b) was able to show that this was also possible in multi-thousand year old mummified remains from Egypt. The laborious method used by Pääbo

(bacterial cloning) required so much aDNA to be extracted from the specimen that few other studies were able to replicate these results. It was not until the development of PCR in the late

1980s (Mullis et al. 1986; Mullis and Faloona 1987; Saiki et al. 1988) that the prospect of ancient DNA (and genetics as we know it today) became feasible. PCR permitted sequences to be amplified from a single template molecule. Some notable firsts that resulted from the new technique include the first successful extraction and amplification of aDNA from bone in 1989

(Hagelberg et al. 1989), and the first extraction of Neanderthal DNA in 1997 (Krings et al.

1997).

The advent of PCR brought on a wave of aDNA publications asserting recovery what

Lindahl (1993a) refers to as ‘antediluvian DNA’. These publications competiveitly claimed to each have extracted the oldest aDNA to date. The first of these claimed to have sequenced a 820 bp DNA fragment from a well preserved 17–20 million year old magnolia leaf compression

fossil that was formed in clay sediments (Golenberg 1991). A focus soon arose to look for DNA preserved in ancient amber; a convincing case was made that amber would rapidly desiccate remains, and inhibit bacterial activity (Poinar 1994; Wayne et al. 1999:459). Publications came out claiming to have extracted DNA from a variety of organsims trapped in amber, including bees (Cano et al. 1992a, 1992b), termites (DeSalle et al. 1992), weevils (Cano et al. 1993), and plants (Golenberg et al. 1990; Poinar et al. 1993). This research led to speculations in the public of reiving extinct organisms by extracting aDNA from amber specimens; the idea for Jurrasic

Park (a popular book and later motion picture in the 1990s) came out of this work. It has since been demonstrated using Oligocene amber specimens that amber preservation would not be expected to yield authentic DNA (Stankiewicz et al. 1998).

The focus on multi-million year old DNA culiminated with the claimed extraction of 80 million year old Cretaceous dinousaur mtDNA from a coal deposit in Idaho (Woodward et al.

1994). The sequence did not match any known sequence at the time, leading the authors to conclude that it was authentic. It was later discovered that this dinousar DNA was actually a previously undescribed exogenous human intron, which historically originated from a degraded mitochondrial insert into the nuclear genome (Zischler, Geisert, et al. 1995; Zischler, Hoss, et al.

1995). This is why these mitochondrial sequences seemed to be so novel initially. Almost all other studies that targeted this ‘antediluvian DNA’ have either been shown to be contaminated

(e.g. Gutiérrez and Marin 1998; Wang et al. 1997), or have been disregarded due to their poor evidence for aDNA authenticity.

While a number of papers were published around the time criticizing the current standard of authentication in aDNA analyses, the most influential and widely cited publication came from

Cooper and Poinar (2000). The authentication of any contemporary aDNA study is almost

universally now conducted through an adherence to (or acknowledgement of) Cooper and

Poinar’s (2000) nine criteria of authenticity, or a variant thereof. This single page, landmark aDNA paper synthesized and promoted a standardized means for authenticating results in the discipline. The authors criticized the lack of authentication criteria in the field by highlighting the erroneous recent ‘discoveries’ of dinosaur DNA. While similar, and far more thorough criticisms came out around the same time (Pääbo et al. 1989; Pääbo 1993), Cooper and Poinar’s

(2000) work succeeded by providing a simple list of standardized criteria with which to judge whether a study sufficiently demonstrated the authenticity of the ancient sequences.

The authors suggested the following nine criteria: 1) a physically isolated and dedicated aDNA facility with a physically separate post-PCR facility. This includes personnel wearing appropriate clothing (e.g., disposable gloves, full body suits, masks, boots, and safety glasses) and appropriate laboratory maintenance (positive pressure, separate heap-filtered ventilation, sterile reagents and plasticwear, UV irradiation, preparation cleanings with bleach, restricted access, and one way travel between facilities). 2) Universal control amplifications, such as blanks and PCR negative and positive controls. 3) Tests for appropriate molecular behaviour—

PCR amplification strength should be inversely related to product size; this can be tested using

Quantitative PCR. 4) Results need to be reproducible from the same and different extracts of a specimen. 5) PCR products should be cloned to determine the ratio of endogenous to exogenous sequences, and can also be used to identify damage induced modifications. 6) Independent replication to rule out intra-laboratory contamination, although this is generally reserved for novel or unexpected results. 7) Tests of biochemical preservation to quantify the extent of diagenetic change in other biomolecules. 8) Quantitation to assess starting templates, which is similar to criterion three. 9) Testing associated remains (for example soil or other organics) with

negative and positive controls. Some disagree with the need to adhere to each criterion (Kemp and Smith 2010), and others have reminded researchers that adherence to these nine points does not necessarily mean that the results are accurate (Gilbert et al. 2005). These debates have highlighted the need to address criteria of authenticity, explicate reasons for divergence, and provide a sufficient overall justification for their efficacy. In an aside to their conclusion, Gilbert et al. (2005:544), suggest an appropriate tenth criterion: “...[one should] interpret the veracity of the data by a critical consideration of all available information”.

3.4 The Twin Challenges of aDNA

Ancient DNA research is plagued by two challenges: contamination and degradation. It is because of the degradation process that contamination becomes a significant factor in aDNA, necessitating stringent lab protocols and authentication criteria. Hence, it is first important to discuss the processes of degradation before elaborating on the means by which aDNA studies can succumb to the issue of authentication in the presence of ubiquitous exogenous DNA.

3.4.1 Degradation

DNA degradation is an issue in paleogenetics because it can result in nucleotide modifications, the breakdown of sequences into short fragments, and the inhibition of amplification (Brown and Brown 2011:115-124). A variety of environmental factors can influence the decay rates, and because of the multitude of environmental conditions that the remains were likely exposed to, it is difficult to accurately assess the degree to which these factors have influenced the surviving biomolecules. There are two main mechanisms of decay relevant to paleontological remains, and three for archaeological remains. The first is autolysis, the second is diagenesis (which includes environmental factors and microbial agents), and the third, which is generally specific to archaeological remains, is human induced damage.

Autolysis, also known as self-digestion, occurs immediately following the death of the organism. Cell death triggers the release of endogenous enzymes (like DNase and protease) from lysosomes. The breakdown of the cell’s structure can also allow for the addition of other chemicals that contribute to the destruction of cellular material. These processes have the ability to completely degrade DNA—and although a threshold is generally reached, the process can be amplified by extraneous variables found in the burial environment. Often DNA only survives in cases where autolytic processes were stopped, for example if the remains become desiccated.

Regardless of the taphonomic conditions that the remains are subsequently exposed to, the rapid autolytic actions following the death of the organism will generally be a universal source of degradation for all instances of aDNA. The processes of autolysis have less specific markers of decay when compared to the forms of diagenesis, but will almost universally result in a low proportion of aDNA available for extraction.

Diagenesis refers to the complex changes caused by microbial, chemical, and physical processes that act upon buried specimens. Each internment is unique, and different factors could affect varying segments of the same specimen. The most important decay process affecting aDNA is strand breakage caused by reactions with water, which is known as hydrolysis. Water can induce cleavage of the 1’ β-N-gycosidic bond (a kind of covalent bond), which links the base to the sugar component of the nucleotide, leaving an abasic site prone to other chemical reactions. Hydrolytic cleavage of this bond is 20 times more common with purines (guanine and adenine) than pyrimidines (cytosine and thymine) (Lindahl and Karlstrom 1973; Lindahl and

Nyberg 1972; Loeb and Preston 1986; Mitchell et al. 2005:268). This particular process is referred to as depurination, and although it occurs in vivo, it is repaired by the cell. Overtime, this will result in the fragmentation of a polynucleotide. Because DNA is double stranded, bond

cleavage of individual polynucleotides will not result in the splitting of the DNA molecule as a whole. This will create nicks in the strands, and when the strands are denatured in PCR, the fragments yielded will be short because the molecules will fall apart into their constituent polynucleotides (Figure 3.4). The initial surviving fragments might be in the kilobase range, but due to these nicks, the amplified products will be significantly smaller. These abasic sites are a kind of blocking lesion, but often result in strand breaks.

Figure 3.4 Bond cleavage of individual polynucleotides causing nicks.

During the initial denaturation phase of PCR, single stranded DNA is unable to remain together, and primers can only bind to small fragments. Image based on Figure 8.3 in Brown and Brown (2011:120).

A more deceptive kind of hydrolytic damage is deaminization, which results in miscoding lesions. It is caused by the removal of the amino group (-NH2) from cytosine, which changes the base into uracil. Through PCR amplification, this results in a C to T error (or G to A error if the opposing strand is being sequenced). This process occurs naturally in living cells; one function being to silence genes in particular tissues (Brown and Brown 2011:123). Other

nucleotides can be affected by deaminization, such as adenine to hypoxanthine, which ultimately results in an A to G error, although this error is much less common than cytosine deaminization.

Guanine can also deaminize into xanthine, but will still pair with cytosine, so there is no miscoding error. Thymine is not subject to deaminization because it does not have an amino group.

Another mechanism of DNA decay is oxidative damage. This can result in base modification, blocking lesions, and structure distortion. Ring saturation is one of the most common oxidative damages, which results in the replacement double bonds with single bonds.

This results in structural instability, causing blocking lesions (which stop extension during PCR and only allow for small fragments to be amplified); these lesions can also be caused by cross- linking. Oxidative damages can modify sugar molecules, bases, and abasic sites, which can also result in miscoding lesions. In addition to these types of decay, microbial action can result in structural damage to DNA, as can cosmic and ultraviolet radiation. Specifically for archaeologically relevant materials, human actions can amplify or reduce decay processes.

Cooking, for example, could destroy DNA. Alternatively, cooking could desiccate or partially char the remains if the temperatures are sufficiently low, leading to reduced microbial effects and a reduction of degradation (Schlumbaum et al. 2007:238). Mummification is an example of anthropogenic actions generally improving preservation in dry contexts, while cremation or high temperature burning would be expected to destroy DNA in most circumstances. Human activities can also modify the burial environment in unique ways. For example, sky burials (intentionally exposed remains) might reduce hydrolytic effects in typically dry environments, while amplifying damage caused by radiation. Ultimately, given enough time, all DNA sequences will be reduced to mononucleotides as a result of degradation, or will contain so many nicks,

blocking, and miscoding lesions that PCR will be unable to retrieve any useful information. A summary of molecular locations affected by the processes of degradation can be seen in Figure

3.5.

Each type of degradation discussed thus far can result in the inaccuracy of amplified aDNA products, and hence necessitate repeated amplifications to insure authenticity. Due to these specific mechanisms of degradation, there are certain conditions thought to be preferable for aDNA preservation (Burger et al. 1999). The first is a neutral pH, because depurination is mainly acid-catalyzed, while deamination is mainly alkaline-catalyzed. The second is anaerobic conditions because this reduces oxidative damage, as well as microbial activity. Third, low temperatures result in reduced microbial and enzymatic activity. Finally, low humidity results in less hydrolytic damage, less enzymatic activity, and less microbial activity.

Figure 3.5 Locations of DNA damage caused by various decay processes.

Image copied from Figure 1 in Hofreiter et al. (2001:354) with modifications.

3.4.2 Contamination

If degradation was the only problem with aDNA, the technical challenges would be much more similar to modern DNA analyses, with the additional need for caution when interpreting sequence data. However, because of its degraded nature, there is an omnipresent threat of exogenous DNA overwhelming endogenous aDNA during amplification, and no absolute means exist for assessing whether the DNA sequence is authentic in Sanger sequencing—meaning, that which was actually targeted. It is this problem that characterizes the unique technical challenges when investigating ancient biomolecules. Contamination can be defined simply as: similar or identical DNA molecules to those of interest with the potential to become preferentially amplified during PCR. For example, this could be human DNA contaminating hominin samples, or modern corn starch contaminating ancient maize DNA. Contamination is a major issue for paleogenetics because of the extreme sensitivity of PCR—the ability to preferentially amplify single contaminant DNA molecules (with less degradation) over the target aDNA locus. This optimized sensitivity is necessary however, otherwise it would be impossible to amplify so few, highly degraded aDNA fragments.

Brown and Brown (2011:138) identify five stages of contamination potential during the life-history of a specimen: during burial, while buried, during and after excavation, in the aDNA laboratory during sample preparation, and anytime throughout the extraction and PCR setup stages in the aDNA facility. Contamination can be modern in origin, for example from those who came in contact with the samples during recovery or storage, the laboratory personnel, or those that produce laboratory reagents or plasticwear. For non-human projects, contamination can come from modern animal and plant DNA from comparative specimens, other unrelated research specimens in the same building, or generic items in contact with aDNA technicians (e.g., food,

office plants). Canid and felid contamination can be nearly as common as human DNA, allowing these taxa to be used as proxy tests of contamination in an aDNA facility. Other ancient DNA can contaminate a sample through contact during storage, the leaching of water in soil during burial, and microorganisms. In the aDNA lab, samples can contaminate one another, especially previously amplified PCR products from the same target loci.

A common philosophy when targeting ancient biomolecules is to acknowledge that contamination is ubiquitous, contaminants outnumber authentic endogenous molecules, and biomolecular degradation in a given sample may be absolute. For these reasons, it has become standard practise to assume that any amplified product is exogenous until sufficient evidence can be amassed that the sequence is authentic. This evidence is commonly built by addressing

Cooper and Poinar’s (2000) nine criteria of authenticity. As discussed previously (Section 3.3), it is often not considered necessary to address each of the criteria directly, but rather to generate a sufficient bulk of data that can be critically considered to assess the likelihood of sequence authenticity. Like any science, it is ultimately impossible to verify the data absolutely, and while epistemological problems may be more pronounced in aDNA, they exist in any analytic discourse; the important factor is the relative probability of authenticity.

3.5 The Diversity of Applications for Paleogenetics in Archaeology

Arguably the most significant strength of paleogenetics is the breadth of questions that can be addressed. This section summarizes some of the diversity of aDNA research conducted to date in an effort to demonstrate the utility and analytic power of genetics for archaeology and paleobiology for the future, as well as the importance to continually test the viability of aDNA for different tissue types and research questions.

3.5.1 Paleoanthropology

Ancient DNA research has had the most well-known impact on paleoanthropology. To date, hominin aDNA research has focused on Neanderthals in the Upper Paleolithic across

Eurasia, as led by Dr. Svante Pääbo’s research group at the Max Planck Institute (Briggs et al.

2007; Green et al. 2006, 2009, 2010; Krings et al. 1997, Prüfer et al. 2014). In recent years, this has expanded to include Denisovans (Krause et al. 2010; Meyer et al. 2012; Reich et al. 2010,

2011) and early Europeans on the Iberian Peninsula from the Sima de los Huesos (‘pit of bones’) site in Spain (Meyer et al. 2014). Denisova hominins were first identified genetically from a single phalanx recovered in Siberia using a full coverage mitochondrial genome (Krause et al.

2010). The authors were able to demonstrate that the species is monophyletic with Neanderthals and Homo sapiens, with a common ancestor around 1.0 mya. Reich et al. (2010) also found evidence of Neanderthal and Denisovan gene flow in Homo sapiens lineages. These investigations have continued to assess the degree of Denisovan DNA in modern human populations, in addition to their range and areas of interaction with archaic humans (e.g., Cooper and Stringer 2013). Meyer et al. (2012) generated a high-coverage genome sequence (30x) for the Denisovan individual. This means that each nucleotide position has been covered ~30 times; high coverage is particularly necessary for ancient DNA because of the error rate caused by diagenesis. Methods of genome-wide coverage can suffer from single nucleotide miscoding errors, which when amplified across an entire genome, can significantly affect phylogenetic interpretations (e.g., Briggs et al. 2007; Mateiu and Rannala 2008). The study from Meyer et al.

(2012) is unique because other earlier full genome sequences derived from Neanderthals and

Denosovians initially had low coverage—1.9x coverage from the Denisovan phalanx (Reich et al. 2010), and 1.3x coverage derived from three Croatian Neanderthals (Green et al. 2009; 2010).

Without paleogenomics, the scant Denisovan remains would have likely remained either unidentified, or identified as another hominin.

Further information can be found in Stoneking and Krause (2011), which contains a summary of next-generation sequencing techniques and their applications for human origins and evolution. One example is improving the out-of-Africa migration model to include temporally separate New Guinea and Asian migrations (e.g., Wollstein et al. 2010).

3.5.2 Ecological and Subsistence Reconstructions

Methods related to paleoenvironmental reconstruction are also suitable for supplementation by aDNA. Willerslev et al. (2003) used Holocene and Pleistocene sedaDNA for paleoenvironmental research in Siberia and New Zealand. They were able to track population density in variety plant and animal species through time, and make inferences as to their changing interspecific ratios. Similarly, Anderson-Carpenter et al. (2011) were able infer ecological change during the Holocene from aDNA in cored lake sediments in the Western Great

Lakes region of North America. A critical review of genetic data is necessary when working with sedaDNA because of the vertical migration of DNA due to leaching (Haile et al. 2007:988).

Lorenzen et al. (2011) used aDNA to assess the megafauna extinction events at the onset of the Holocene by specifically targeting six Late Quaternary herbivores. By analyzing 846 mtDNA control sequences, the authors found that the history and relevant variables for the survival and extinction of each species was unique, and were able to dispel the climate and anthropogenically induced extinction dichotomy; each species responded differently to climate change, habitat redistribution, and human encroachment. In terms of evolutionary development,

Bunce et al. (2005) were able to demonstrate that New Zealand’s extinct giant eagle is very closely related to H. moorei, which is one of the world’s smallest eagle species. King et al.

(2009) extracted DNA from archaeological insect remains, which could allow for some degree of entomological reconstruction, which helps both with understanding the large scale environmental setting, but also the microscale setting of dwellings or areas of dwellings where particular insects might have had an ecological niche.

In terms of subsistence, Yang et al. (2005) used aDNA to identify archaeological rabbit remains, and were able make inferences as to their abundance in the region and place within the subsistence economy. Speller (2005; Speller et al. 2005) was able to infer social stratification on the Pacific Northwest Coast by taxonomically differentiating three salmon species and combining this information with the associated contexts of the materials in structures across the

Keatley Creek pithouse village site. As well, Cannon and Yang (2006) were able to find evidence of storage and sedentism by identifying salmon remains using ancient DNA at the site of Namu.

3.5.3 Domestication

One of the first promotions for an aDNA approach to domestication came from Brown

(1999:89) who argued that biomolecular archaeology was the most appropriate means of addressing the origins of animal and plant domestication because genetic data can assess evolutionary relationships directly. One of the key points that Brown (1999) highlights is the ability of molecular methods to determine the number of domestication ‘events’ that took place for a particular organism, as well as an approximate timing of these ‘events’. In a related study,

Allaby et al. (1999) conducted paleogenetic research of emmer wheat (Triticum dicoccoides) that allowed them to discover two previously undescribed clades, which they suggest might be the result of isolated domestication events. The authors also describe results of a study where they

found a gene (Glu-D1-1b) in ancient wheat samples that has been argued to be advantageous for baking (Brown et al. 1993).

A well suited example for the applicability of aDNA research to domestication comes from Zheng et al. (2012). The authors assess the theoretical assumption that population levels increased after the development of agriculture because the local carrying capacity was increased.

They used whole mtDNA sequences from The 1000 Genomes Project (2010), which they divided into population regions to investigate effective population sizes. They found genetic evidence of population expansions occurring after the Last Glacial Maximum (26.5–19 kya). The authors suggest that increasingly amiable environments, caused by rising temperatures, were potentially the most important factors for prehistoric human population expansions. Therefore, the population increases may have contributed to the development of agriculture. This result directly challenges other research that theoretically and methodologically suggests that populations expansions were the result of agricultural developments (e.g., Bellwood and

Oxenham 2008; Diamond 2002; Gignoux et al. 2011).

Ancient DNA is also suitable for addressing animal domestication. Leonard et al. (2002) assessed hypotheses related to the domestication of dogs in the New World, and using aDNA were able to demonstrate that Old World dogs were brought with humans during migrations into the Americas. As another example, Larson et al. (2007) attempted to identify the geographic origin of pigs found in European Neolithic contexts in order to assess the timing of the domestication of the European wild boar, and to understand the dispersal pattern of Neolithic domesticates in western Eurasia. They found that pigs were introduced to Europe from the Near

East along at least two distinct routes. There were also at least two other large scale movements from Italy and Sardinia, as well as a back trade of European pigs into the Near East.

3.5.4 Paleopathology

Ancient DNA can be informative in confirming skeletal diagnoses of past disease, in understanding cultural practises which might influence disease, confirming or challenging historically documented or archaeologically inferred epidemic events, and uncovering yet unknown ecological variables to past afflictions. It is important however to not overplay the ability of aDNA to identify disease, both because bacterial DNA is difficult to authenticate (but has undergone a revitalization due to next-generation methods), and the bacterial disease cells must be able to be found in the preserved remains—particularly in the bone cell matrix. For example, without pathognomonic bone lesions, it could be impossible to obtain ancient tuberculosis DNA (Wilbur et al. 2009:1991–1992). But if they are present, then there would be little justification to confirm the illness using destructive analyses when osteological assessments can come to the same conclusion.

Papagrigorakis et al. (2006a) attempted to identify the probable cause of the Plague of

Athens (~430 BCE). They extracted DNA samples from the dental pulp of three teeth found in a cemetery dated to the period, concluding that typhoid fever was the probable cause of the plague.

A follow-up phylogenetic analysis by Shapiro et al. (2006) showed that the unknown specimen is not genetically related to typhoid fever (caused by Salmonella enteric serovar Typhi). They suggest that it is most likely contaminant bacterial DNA (Shapiro et al. 2006:334). This work emphasizes the ubiquity and subtlety of contamination in aDNA studies. Papagrigorakis et al.

(2006b) maintain that their research conclusions are valid despite the phylogenetic analysis performed by Shapiro et al. (2006). Regardless of the validity of the original results

(Papagrigorakis et al. 2006b:210–213), the study hints at the potential of aDNA (when sufficiently authenticated) to understand ancient disease, and the ability to investigate historically

recorded events. Genetic defects, and their historical spread through time, can also be investigated using aDNA analyses (e.g. Hughey et al. 2012).

3.5.5 Population Size

Ancient DNA could provide a means for measuring a rise in social complexity through population size. Zheng et al.’s (2012) demonstration of population growth prior to the Neolithic

Revolution is a direct example of how aDNA can assess rapid changes in population size when compared with other suspected correlated factors. A test of these methods comes from O'Fallon and Fehren-Schmitz (2011) who genetically found a significant population bottleneck was experienced by Native North Americans following European contact. O'Fallon and Fehren-

Schmitz (2011) were able to demonstrate—by using mtDNA genomics—that at approximately

500 BP there was a contraction in effective female population size by ~50%. The authors do not frame their research objective as being a test of genetic population estimates, but I would argue that this is the most important role fulfilled by the study. For archaeology as a whole, these examples demonstrate that population size can be assessed in the past, irrespective of the abundance of other material remains commonly utilized to estimate past populations.

3.5.6 Post-Processual Approaches (Gender, Kinship, and Agency)

The ability of DNA to identify individuals and assess their relationships with others makes the methodology very powerful when testing and analytically informing archaeological schools related to gender, kinship, agency, and identity. Typically, gender studies are methodologically informed by skeletal assessments of sex. Unfortunately, osteological analyses can be notoriously inaccurate when differentiating between males and females because of a wide intraspecific variability in morphological forms. The analyses require the presence of certain key elements and associated features, that the individual went through puberty, that they have no

morphological abnormalities on those key features, and that the individual was not too old at the time of death. Conversely, aDNA could provide very accurate assessments of sex in many instances. Brown and Brown (2011:151-152) argue that sex identification is one of the most fundamental contributions that biomolecular techniques as a whole can make to archaeology, with aDNA being a part of the contribution. A variety of DNA tests can detect the presence or absence of the Y chromosome, irrespective of the many issues that affect osteological assessments. Although sex and gender are different, knowing the biological sex of an individual can allow for understandings of societal gender roles when used in conjunction with the associated archaeological context. By using reliable datasets, issues of false osteological identification or indeterminate results could assist with some foundational issues in archaeological gender studies.

One example of aDNA being used to identify sex comes from Katzenberg et al. (2005).

The authors were able to successfully identify remains from an unmarked grave using a variety of methodologies. An osteological analysis of skeletal and dental age at death was used to filter historic records in order to generate a list of possible individuals. Sex was determined using aDNA, and identification was confirmed by comparing the mtDNA of suspected relatives to the ancient mtDNA of the specimen. In a similar case, Stone et al. (2001) claim to have identified the suspected remains of Jesse James (a well-known American outlaw) by testing the mtDNA of known material relatives with the suspected remains.

3.5.7 Technology

Technology and its use can be assessed using aDNA when biological components are involved. Hartnup et al. (2011) used aDNA to investigate the construction of cloaks made by prehistoric Maori on New Zealand. The authors collected both mtDNA and nDNA from feathers

to assess phylogeography (the location of the birds targeted for their feathers), as well as selective targeting (in terms of subspecies or sex). They found that there was a strong disconformity in terms of regions targeted; the majority of feathers came from the North Island, which they propose suggests trade. They also found that there was strong selection for a particular haplotype that is relatively uncommon in natural populations, and a preferential selection of males over females. The paper highlights the ability to achieve a more detailed understanding of patterned resource exploitation, which would presumably help structure further research objectives in investigating this previously invisible practice. Poulakakis et al. (2007) were similarly able to assess the geographic and biological origins of Greek manuscripts (the actual parchment) dating from the 13th to 16th centuries CE.

In another example, Foley et al. (2012) analyzed aDNA residue in amphora recovered from sunken vessels. It has been commonly assumed that Greek amphorae from the 5th to 3rd centuries BCE primarily contained wine, as well as olive oil to a lesser extent. The authors found

DNA from a much wider variety of taxa including: mint, rosemary, pine, legumes, ginger, thyme, oregano, sage, juniper, grape, and olive. This wide array of goods challenges the notion that wine was the principle trade good of the Greek world, highlighting how aDNA can critique long held, but largely unsubstantiated claims. Furthermore, it is an example of aDNA assessing the accuracy of historic documents.

3.5.8 Contact and Migration

The majority of aDNA migration studies in archaeology have been focused on the spread of hominins throughout the globe, although many tangential organisms could be used to track the movement of people, and potentially contact between groups. Gilbert et al. (2008) were able to genetically demonstrate that Paleo-Eskimo Saqqaq and Independence 1 cultures migrated into

Northern Canada and Greenland through a separate migration from those of earlier Native

Americans, and later Neo-Eskimo Thule. They used 454 pyro-sequencing to generate a full mtDNA genome with 20-fold coverage using 4,500–3,400 year old frozen hair samples excavated from a Greenlandic Saqqaq settlement. Shapiro and Hofreiter (2010) are optimistic that the recovery of Saqqaq DNA, and specifically the techniques used by Gilbert et al. (2008), will drive further technological innovations in the field, and eventually make large-scale genome-wide analyses of ancient organisms a common reality. Recently, Rasmussen et al.

(2014) were able to refute the Solutrean hypothesis of a European origin for Clovis peoples in

North America by demonstrating that all indigenous Americans are descendants of Siberian populations in Northeast Asia during the Upper Paleolithic.

3.6 Conclusion

Ancient DNA is likely to become an increasingly important aspect of archaeological and paleobiological method in the future. This necessitates an understanding of the method’s strengths and shortcomings, in addition to its breadth of application. The emphasis on the technical difficulties of aDNA methods throughout the first half of this chapter was intended not to imply the inappropriateness of the method, but rather to temper expectations of its analytic power. The diversity of applications discussed demonstrates that despite paleogenetics’ infancy and associated technical challenges, the method has already contributed a broad range of important data related to evolutionary relationships and human-environmental interactions. The following chapter goes into extended detail on botanical aDNA work to date, and the added complexity of plant tissues for paleogenetic research, as relevant to this study’s aDNA analysis of wooden biofacts and artifacts.

Chapter Four: Plant aDNA

Paleogenetic analyses of plant tissues are more challenging than their faunal counterparts because of increased PCR inhibitors, more permeable and taphonomically sensitive tissues, a differential distribution of genomic material by tissue type, and variable genomic inheritance.

For these reasons, it was considered appropriate to discuss the complexities of plant aDNA separately from paleogenetics as a whole to appropriately setup for the technical nuances and testing of the subsequent methodology chapter. The broad intricacies of plant genetics are sufficiently multifaceted to warrant a much longer review than is appropriate in this work. In order to focus the discussion on pertinent elements, only those factors directly related to wood tissues, taxonomy, and botanical phylogeography will be considered. This chapter will focus on plastid (organelles involved in the storage and production of food or pigment in the cells of plants and algae including: chloroplasts, chromoplasts and leucoplasts) DNA, as the majority of ancient and modern plant genetic studies primarily target the chloroplast genome as opposed to nDNA or mtDNA. The first section in this chapter touches on the difference in approach when using genotypic or phenotypic characters for taxonomic or biogeographical analyses in plants.

This is followed by a discussion of the reasons for the relative rarity of plant aDNA work compared with animals (specifically mammals), with a follow-up discussion as to why these factors are problematic. The next section summarizes basic wood physiology and its implications for aDNA analyses. Following this is a review of appropriate loci for the aforementioned goals of this work (taxonomic identification and phylogeography in degraded cryogenic wood biofacts), with a summary of problems associated with finding informative loci in cpDNA. The final section discusses relevant phenotypic and genotypic factors within willow (Salix spp.), as this is the target taxon of phylogeographic investigation in this analysis.

4.1 Genotypic and Phenotypic Characters

Resolution can be problematic in anatomical identification with paleobotanicals—closely related taxa can have indistinguishable structural morphology at low taxonomic levels (due in part to the state of preservation) with phenotypic plasticity being a challenge in even modern botanical classification (Schlumbaum et al. 2007:233–234). This problem can permeate investigations of taxonomy, intraspecific variability, or anthropogenically linked aspects like domestication. An issue with genotypic resolution is the discontinuity with a taxonomy that is based largely on phenotypic characters, and the inherent problem of deciding which is more accurate (genotypic or phenotypic characters) in cases of disagreement (Duminil and Michele

2009). Debates regarding the relative importance of varied character sets for the species concept

(see Duminil and Michele 2009:1–2) can become pronounced in a variety of aDNA applications because of the restricted set of the genome available for investigation (this is specific to Sanger sequencing where small, discontinuous loci are targeted), and hence the possibility that organisms considered taxonomically distinct from a phenotypic stance may show no predictable genotypic variability at documented loci. This complication can act as a strength however, as indistinguishable specimens (potentially due to extensive phenotypic plasticity) could show predictable genetic variability, despite being morphologically indeterminate. The number of available loci for use as population proxies gives paleogenetic investigations the potential to provide an entirely unique and informative dataset. This is mirrored by a general trend of paleobotanists shifting towards a focus on microbotanical remains (e.g., phytolith, starch grain, pollen grain, and other residue analyses).

Lowe and Cross (2011) discuss the utility of DNA-based methods for timber tracking and origin verification. While taxonomic identification can be addressed using morphological

characteristics in macro- or microbotanical remains, origin can be investigated using stable isotopes, and individual specimens can be identified by log marking—DNA-based methods can investigate all of these aspects by targeting genetic loci with varied mutation rates. DNA barcoding (taxonomic classification based on predictable hypervariable genetic loci) can address taxonomy and origin, phylogentics can address both of these with more of an emphasis on intraspecific (population level) variability, and DNA fingerprinting can be used on both populations and individuals. Furthermore, while other non-morphological methods can be used to understand aspects like biogeography (chemical analyses for example), these can become compromised in some burial conditions due to relatively permeable plant tissues (when compared with hard tissues).

Despite this potential, in contrast to the vast catalogue of aDNA research on bone, plant tissue aDNA extractions are rare. Wood DNA analyses are especially uncommon (in both modern and paleogenetic settings) because the amount of DNA in wood tissues in living organisms is already substantially less than that of leaves, buds, and fruits. Fortunately for aDNA analyses, post-mortem degradation of wood DNA is relatively limited when compared to other soft tissues (Tang et al. 2011:609), which is of course contingent upon the burial environment.

Wood tissues have been found to preserve well in cryogenic settings (Section 2.2), which is of direct relevance to this thesis.

4.2 The Relative Rarity of aDNA Plant Research

The majority of plant aDNA work conducted to date has been driven by archaeological applications investigating the domestic origins of cultivated plants. Despite this emphasis, as of

2004 only 7% (n = 53) of all published aDNA research (n = 537) investigated plants (Gugerli et al. 2005:410). The proportion of plant aDNA research is less than that of microorganisms (9%),

and far less than that of human and vertebrae aDNA work (63%). Of those plant aDNA studies,

43% investigated agricultural species and 42% of the papers were interested in relatively simple taxonomic identifications or barcoding (Gugerli et al. 2005:411). The small remaining proportions of papers focused on topics like phylogeny (9%), individual identification (3%), and intraspecific variation (29%). A similar web search today brings back over 5000 papers on aDNA, with 100–300 on plant aDNA and less than a dozen on wood aDNA. Despite this overall increase, the proportional lack of research using ancient plants has remained, leaving this particular sub-focus in its relative infancy. The lack of standardization for aDNA protocols in general when compared with modern genetics has been an issue when dealing with the intricacies of authentication, but this problem is far more pronounced in studies of ancient plants.

The variety of methodologies used in plant aDNA studies is complicated by the diversity in tissue types and their related nuances. This lessened emphasis on plants, despite their importance for many aspects of archaeological, paleobiological, and paleoenvironmental research, could be attributed to a variety of factors, including: taphonomic bias, increased PCR inhibition, the nuances of plant physiology for DNA preservation and tissue selection, and increased complexity in choosing genetic markers because of a variable range of utility for genetic loci by taxa.

4.2.1 Complications of Plant Tissues: Taphonomy

The first and most obvious complication is differential preservation. Botanical remains require certain physical and chemical variables in the burial environment to preserve (contingent on intensity, duration, and tissue type), some of these include: desiccation, low temperatures, mineralization, water-logging, anaerobicity, carbonization, or preservation in coprolites (Wright

2010:44–47). Often botanical preservation is rare in temperate and tropical environments without

changes such as carbonization (Bryant 1989). However, carbonization is itself a kind of partial destruction (Wilson 1984:14), and can often destroy microremains such as starch grains (Fritz

205:808). This kind of degradation is complex, as starch grains have been successfully identified in the carbonized food residues of pottery (e.g., Boyd et al. 2006, 2008), although contamination has been shown to be a factor in starch grain analyses, calling into question some of this research

(Crowther et al. 2014). While hard plant tissues such as wood and charcoal can often be archaeological recovered, most other plant materials require a focus during excavation on fine screening, floatation, and soil-sampling for both micro- and macrobotanical remains (e.g.,

Pearsall 2008:13–119). Additional time costs associated with these procedures have likely contributed in part to the sampling bias towards an underrepresented paleobotanical dataset. This is exacerbated by the taphonomic bias associated with hard versus soft tissue decay rates in botanical remains.

4.2.1.1 A Potential Solution to the Taphonomic Bias: aDNA from Pollen and Phytoliths

One means of circumventing the differential preservation of macrobotanical remains is to instead focus on the microbotanical level; promising work has been conducted extracting aDNA from pollen. Suyama et al. (1996) and Petersen et al. (1996) were the first studies to demonstrate the possibility of retrieving nucleic or plastid DNA from single fossil pollen grains. Suyama et al. (1996) amplified the spacer region between rrn5 and trnR in cpDNA for four specimens, and determined that they were Abies spp. (fir). These pollen grains were recovered from a depth of

44 m below surface in Japan, and have been determined to be associated with the last glacial period in the Late Pleistocene (this was based on tephrochronology and pollen analysis). The authors note (Suyama et al. 1996:145) that pollen grains are often preserved in Pleistocene sediment because their outer wall is relatively resistant to diagenesis when compared with many

other easily degraded paleo-biomolecules. Petersen et al. (1996) were similarly able to amplify cpDNA from the rbcL gene of Hordeum vulgare (barley), although the authors make no mention of a dedicated aDNA facility being used. Since 1996, a number of studies have successfully amplified aDNA from pollen grains (e.g., Bennett and Parducci 2006; Claudio et al. 2007; Eliet and Harbison 2006; Matsuki et al. 2006; Milanesi et al. 2006; Nakazawa et al. 2013; Parducci et al. 2005). Isagi and Suyama (2011) have compiled an edited volume on the topic that details the procedures of single-pollen genotyping, its significance, and a variety of case studies showing its wide utility in a variety of environmental contexts. Nakazawa et al. (2013) discuss that despite the success of the method, there is a very low success rate of DNA amplified pollen grains. In their study, they were able to amplify DNA sequences from eight of 105 pollen grains; a success rate of 7.6%. This is markedly higher than the average among previous investigations of 0–3.6%

(Nakazawa et al. 2013:5). So although the method shows promise, the majority of pollen grains to date produce no detectable DNA amplifications. This is a significant problem because of the cost involved with processing so many negative samples. It seems as though the state of preservation of the individual grains is an important factor for moving forward with the method.

Certain environments are more conducive to pollen survival; for example, glaciers are argued (Nakazawa et al. 2013:2) to be better sources of well-preserved pollen because these grains are less affected by diagenesis. Preservation in pollen grains has additionally been shown to be taxonomically non-uniform and that low intensity diagenetic conditions generated in the lab can easily degrade pollen grains (Twiddle and Bunting 2010). Microbotanical remains are often just as susceptible to degradation in normal taphonomic conditions. Presumably, air contamination from modern pollen is also a significant issue to overcome during an excavation, storage, or within a laboratory. Likely, with an improved methodology and a better set of criteria

100

for selecting pollen grains for DNA extraction, the success rate of the method will continue to improve over time.

Phytoliths (silica structures found in some plant tissues that persist after the organic tissue decays) may hypothetically be suitable microbotanical sources of trapped biomolecules. They have been used to investigate biochemical compositions of paleobotanical remains and for radiometric dating (e.g., Kelly et al. 1991; Piperno and Stothert 2003), but have only been preliminarily explored (in the published literature) for their ability to preserve DNA. Elbaum et al. (2009) investigated the suitability of aDNA preservation in silica bodies that may hypothetically become trapped during the process of phytolith formation. They experimented with methods to dissolve the silica in such a way as to preserve the nucleic acids. Despite their success in preserving DNA while dissolving silica bodies, the authors were unable to detect

DNA in the phytolith samples from both ancient and modern extracts using PCR. To test whether the lack of PCR amplification was due to inhibition, they used mass spectrometry to determine if any nucleic acids were present; this also produced negative results. The authors suggest in their conclusion (Elbaum et al. 2009:18) that the deposition of silica may occur within cells after apoptosis (massive nucleic degradation) or may occur primarily in intercellular space where it is unlikely for DNA fragments to become trapped. They note that certain phytolith types not analyzed in this study may be more amenable to DNA preservation, and that further investigation along this trajectory is necessary. Their inability to amplify DNA from phytoliths in fresh leaf tissue strongly suggests the impracticality of the method. However, the authors fail to explain their choice of loci, which is important in this instance because they chose to use COIII and

ITS—mtDNA and rDNA loci respectively—rather than cpDNA that would likely be more abundant and potentially easier to amplify, especially in fresh leaf tissue. A further analysis with

101

broader taxa and genetic loci, while using the silica dissolution methods outlined in Elbaum et al.

(2009), is needed to better understand the recoverability of aDNA from phytoliths.

4.2.2 Complications of Plant Tissues: PCR inhibition

Another complicating factor with plant aDNA is increased PCR inhibition (the prevention of PCR amplification). Because PCR is an enzymatic reaction, it is sensitive to inhibiting substances and is susceptible to a decrease in sensitivity or false-negative results

(Schrader et al. 2012). Phenols, for example, may cross-link RNA (Su and Gibor 1988; Wilkins and Smart 1996), while melanin might stop reverse transcription (Eckhart et al. 2000). Primers may also be out competed in binding to the DNA template by chemicals like humic acid

(Abbaszadegan et al. 1999; Chandler et al. 1998)—this particular inhibitor can be overcome by increasing the melting temperature (e.g., Huggett et al. 2008; Opel et al. 2010). The polymerase can also be directly impacted by proteases or detergents (Rossen et al. 1992; Powell et al. 1994), calcium, collagen, haematin, and tannic acid (Opel et al. 2010). Plants are not unique in terms of their susceptibility to PCR inhibitors, as these chemical substances can be found in a variety of burial environments, within the biological tissues being investigated, or from other sources within (or that were inadvertently brought into) the aDNA facility (Schrader et al. 2012:1015).

Plants simply contain additional inhibitors that must be removed during extraction or prior to amplification. Plant tissues can contain some of these additional inhibiting substances (Schrader et al. 2012:1015): terpenes, pectin, polyphenols, polysaccharides, and xylan (Demeke and Adams

1992; Henson and French 1993; John 1992; Sipahioglu et al. 2006; Su and Gibor 1988; Wan and

Wikins 1994; Wei et al. 2008; Wilkins and Smart 1996). Wood and seeds in particular contain all of these in relatively high quantities, which necessitates more complex extraction methods than annual plants (Shepherd et al. 2002:452a)—an unfortunate coincidence considering wood and

102

seeds are usually archaeologically recovered far more frequently than soft tissues such as leaves or fruits. Researchers often choose to use leaf tissue because of its relative lack in PCR inhibitors

(Kasem et al. 2008; Moore 2011). Asif and Cannon (2005:189) hypothesized that the presence of

Maillard products in their DNA extracts of wood (or any of the other inhibitors mentioned above) may have caused their low yield and failed PCR amplifications using both the Cetyl

Trimethyl Ammonium Bromide (CTAB) and QIAGEN kit methodologies. Only the protocol using N-Phenacylthiazolium Bromide (PTB) successfully amplified their wood samples, which they suggest is because the PTB cleaved the glucose-derived protein cross-links to allow for the release of DNA trapped in reduced sugar Maillard products. Deguilloux et al. (2006:1224) encountered similar issues, finding that certain DNA solutions which produced no amplifications were very dark in colour. They suggest that hydrosoluble ellagitannins in the wood following tissue death contributed to PCR inhibition, and emphasize that effective purification of wood

DNA in particular is essential. The use of PTB is not universally useful however. Kemp et al.

(2006) found no change between bone and coprolite samples extracted with and without PTB

(Moore 2011:17–19). Despite the increased complexity of PCR inhibition in woody plant tissues, it has been possible to extract DNA fragments up to at least 500 bp from degraded samples

(Gugerli et al. 2005; Rachmayanti 2009; Rachmayanti et al. 2009:190), which has been confirmed in other research (Asif and Cannon 2005; Deguilloux et al. 2002, 2006; Dumolin-

Lapègue et al. 1999; Liepelt et al. 2006; Rachmayanti and Leinemann 2006; Shepherd et al.

2002). One means of circumventing inhibition in plant tissues is through extract dilutions (e.g.,

Pollman et al. 2005; Schlumbaum et al. 2008), although this can be problematic for aDNA because of the low quantity and quality of the DNA (Moore 2011:20). Increasing the quantity of

Taq polymerase to overcome deactivation can also be employed (Kemp et al. 2006).

103

4.2.3 Complications of Plant Tissues: Decontamination and Extraction of Wood Tissues

DNA extraction is also marked by complications in wood tissues during sample preparation. First, common physical mechanisms used to disrupt wood tissue to produce sawdust such as rotary tools with drills or saws can cause overheating and burning, leading to extensive

DNA damage (Finkeldey et al. 2007; Rachmayanti 2009:6; Rachmayanti et al. 2006). This can hypothetically be avoided by using lower speeds and ice water cleanings (Kistler 2012:77), or using liquid nitrogen tissue disruption methods such as a mortar and pestle, or liquid nitrogen mills.

The removal of surface and sub-surface contaminants is also problematic with wood tissues. Common physical decontamination methods (Watt 2003:12–15) involving rotary tools or sandpaper can again result in overheating, while using a scalpel to cut away the surficial bark can easily remove the thin vascular cambium (where viable DNA is most common in wood).

Common chemical methods (Watt 2003:15–21) such as bleach (NaOCl) are used to ‘destroy’ exogenous DNA through oxidative damage—causing strand-cleavage, eventually to the point of being mononucleotides—which has been shown to be effective at removing contaminants while leaving endogenous DNA intact in bone (Kemp and Smith 2005). Kemp and Smith (2005) found that even bone samples exposed to extreme NaOCl treatments (6% for 21 hr) had intact DNA, which they argue is due to DNA absorption into hydroxyapatite in bone that itself facilities the preservation of aDNA in skeletal remains. Wood presumably lacks this mechanism for aDNA survival, which is further complicated by the more permeable and fragile nature of wood tissues when compared with bone. Chemical decontamination procedures used in skeletal research

(including UV decontamination) are typically not used when analyzing wood tissues. At most, the surficial bark is washed with diluted bleach (the concentration, timing, and means of this

104

washing are usually not detailed in the literature) and removed by scalpel, with another sterile scalpel being used to remove internal wood shavings for further pulverization (e.g., Deguilloux et al. 2002, 2006). More intensive soakings in bleach would likely degrade all nucleic acids in the sample, rather than just the contaminants (e.g., Bachus 2007:61). Presumably however, the permeable nature of wood tissues would suggest further internal contamination that cannot be removed, necessitating an avoidance strategy using taxa-specific primers in order to exclude exogenous DNA. Internal contamination from pollen or sawdust from other trees was found in

20% of the logs analyzed by Deguilloux et al. (2002:1043), a problem the authors were able to avoid in most cases by using conserved primer pairs. Further internal contamination can result from an invasion of fungi into inactive xylem in living and dead trees (Nabors 2004:108), in addition to a diverse community of organisms such as bacteria, protozoa, microorganisms, insects, and algae (see Neustupa and Škaloud 2010; Rose et al. 2001). Green algae contamination could be a factor in cpDNA amplification using universal primers; Tuovinen et al. (2015) for example found green algae in the inner and outer wood of all of their decayed wood samples

(n = 62).

4.2.3.1 A Lack of Consensus Regarding Protocol

Protocol variability is common in genetics; however, the rarity in wood aDNA publications makes this variability challenging when attempting to carefully consider the most appropriate method for the tissue. Moore (2011) compared the effectiveness of three plant extraction methods using heat degraded seeds intended to simulate degraded DNA associated with archaeological macro-botanical remains. Moore (2011) compared the Silica-Spin Column (a modified protocol of the QIAquick Nucleotide Removal Kit), the DNeasy Plant Mini Kit, and the

DTAB (dodecyltrimethylammonium bromide)/CTAB (cetyltrimethylammonium bromide)

105

extraction method. DTAB/CTAB was the most inefficient method tested, but is the most commonly used DNA extraction method for modern plant samples (Kasem et al. 2008; Moore

2011:97; Weising et al. 2005). It is likely that this method is sufficiently capable of extracting modern DNA, but its comparative lack in efficiency was critical to the inability to recover aDNA in the investigation (Moore 2011:97). The DNeasy Plant Mini Kit performed better than the

DTAB/CTAB protocol, however this trend was not found to be statistically significant (Moore

2011:98). The commercial kit’s (DNeasy) restriction to a maximum of 100 mg wet weight, or 20 mg dry weight of starting material was considered to be the major disadvantage when compared with the Silica-Spin Column that had performed the best in the comparison. The Silica-Spin

Column method is already considered to be the most efficient for ancient faunal remains (Moore

2011:99). Moore (2011:118) suggests that silica-based extraction methods could be used as the universal extraction method for ancient plants because of how well it performs compared with the other two most common plant protocols. The majority of wood aDNA research to date uses modified protocols of CTAB (e.g., Asif and Cannon 2005; Jiao et al. 2012; Petit et al. 1997;

Tang et al. 2011), and the DNeasy Plant Mini Kit (e.g., Abe et al. 2011; Deguilloux et al. 2002,

2003, 2006; Dumolin-Lapègue 1999; Jiao et al. 2012; Liepelt et al. 2006; Rachmayanti et al.

2006, 2009; Tang et al. 2011), with fewer using Silica-Spin Methods (QIAquick Nucleotide

Removal Kit or QIAGEN MinElute PCR Purification Kit for direct extraction rather than pre- sequencing purification) (e.g., Deguilloux et al. 2002; Dumolin-Lapègue 1999). Kistler

(2012:77) discourages using the CTAB method for wood samples, but goes on to note that the

DNeasy Plant Mini Kit/PTB method he describes for plant aDNA extraction has not yet been demonstrated to be effective for wood tissues, due to the expected overall low DNA yield from wood.

106

The discontinuity in extraction extends to decontamination procedures where frequently only the removal of bark is specified (Liepelt et al. 2006:1108; Rachmayanti et al. 2009:186), with further chemical or physical decontamination being mentioned as an aside, for example:

“Surface tissues of wood fragments were washed with diluted bleach and removed” (Deguilloux et al. 2006:1217), or “All samples and equipment were thoroughly cleaned with 70% ethanol before processing to reduce the risk of contamination” (Asif and Cannon 2005:186). The lack of consensus regarding the effectiveness or need for wood decontamination in aDNA has not been addressed in the literature.

4.3 The Implications of Wood Physiology and Plastome Distribution for Paleogenetic Analysis

It is useful to briefly define two terms that are used frequently in this section: phloem and xylem. Both are types of vascular tissue used for the transport of fluid and nutrients in plants, separated by meristem (a growth zone of undifferentiated cells). Phloem is a tissue that moves sugars and other organic nutrients from the leaves to the rest of the plant (Nabors 2004:595), derived from the Greek word φλοιός (phloios) meaning “bark”. Xylem is a tissue that transports water and mineral nutrients from the roots to the rest of the plant (Nabors 2004:601), derived from the Greek word ξύλον (xylon) meaning “wood”—the best known xylem tissue. The information presented here on wood physiology is largely derived from Nabors (2004:101–112).

See Figure 4.1 for a diagram of the tissues discussed.

It is important to discuss physiology of wood in order to frame a discussion on the probable sources of aDNA in this tissue, along with the overall feasibility of paleogenetics for woody plants. Wood tissues are more difficult than bone for paleogenetics because many wood cells lack viable nuclei, mitochondria, and plastids (a group of plant organelles with a double

107

membrane envelope). The majority of wood cells will die during the lifetime of woody plants due to apoptosis and autolysis (Nabors 2004:101–109) (except for species that do not develop heartwood), with these structures remaining intact as inactive xylem or bark (Deguilloux et al.

2002:1044); they remain to perform a variety of important functions (to be discussed in Section

4.3.1). Despite all of the cellular material in wood once containing intact DNA, once the tissues have undergone programed cell death, the majority of wood available for sampling in modern specimens will already lack viable DNA. This degradative process is accentuated in archaeological and paleobiological specimens due to a variety of biological, physical, and chemical taphonomic processes. The degraded nature of inner wood DNA was discussed by

Deguilloux et al. (2002), although in their study they were able to amplify short fragments of cpDNA in heartwood that may have remained adsorbed on cell walls (Cano 1996).

Figure 4.1 The structure of wood tissues in a cross-section of a multiyear old section of non- specific tree trunk.

Derived from Nabors (2004:101–110).

108

4.3.1 Wood Physiology

Bark consists of all tissues outside the vascular cambium (the material surrounding the wood of a tree [Nabors 2004:105]), which is divided into inner and outer bark. The outer bark consists of the dead tissues that form the cork, in addition to a variety of other layers of periderm outside the cork cambium. As periderm layers build, the outer bark cracks and peels off in patterns that vary by taxon. The inner bark includes the living secondary phloem and dead phloem between the vascular cambium and the cork cambium. Bark is relatively thin compared with wood, but is vital to the plant’s health. The dead outer bark provides protection, while the living phloem of the inner bark carries sugar and organic molecules from leaves to roots.

Girdling (the entire removal of bark in a ring around a tree) disrupts phloem transport, thereby killing the plant.

Vascular cambium is the source of secondary tree growth; it produces the secondary phloem that transports food within the inner bark, as well as the secondary xylem, the ray parenchyma, and finally, more vascular cambium (Nabors 2004:101–109). The vascular cambium is a meristematic tissue that consists of embryonic (unspecialized) cells that can divide indefinitely to produce other (differentiated) plant tissues. Two types of meristematic cells form the vascular cambium: fusiform initials (which produce new vascular tissue) and ray initials

(which produce parenchyma cells that serve as storage and provide some horizontal nutrient transport [Nabors 2004:107]).

Sapwood consists of the outer rings of xylem, medial relative to the vascular cambium, that continue to transport nutrients (Nabors 2004:101–109). Growth rings are visible in xylem due to seasonable variability in moisture, with seasonal conditions affecting the cell wall thickening. Each ring of secondary xylem will only transport materials for a few years before the

109

water columns break in a process called cavitation (Nabors 2004:108). Heartwood is the older, non-conducting part of xylem at the center of a tree’s trunk or roots. As the heartwood no longer conducts nutrients, a hollowed tree can still survive and grow. The heartwood is often darker than the sapwood, but this is subject to variation. Fungi can invade the heartwood and potentially compromise the life of a tree, which is why many trees produce tyloses to block xylem cells from invading organisms, in addition to antibacterial and antifungal substances (e.g., resins, gums) that can act as PCR inhibitors. The transition of sapwood to heartwood (live to dead cells) is a complex and somewhat enigmatic process that introduces a number of costs and benefits to woody plants such as optimizing sapwood volumes for nutrient support by conserving resources, providing structural support, or endangering the plant by providing a pathway for invading organisms (Bamber 1976; Taylor et al. 2002). The characteristics of sapwood and heartwood vary dramatically between taxa.

Finally, at the center of the trunk is the pith—a soft, spongy ground tissue (specifically parenchyma) in the central cylinder of vascular plants. The pith is often darker than the heartwood.

4.3.2 Plastid DNA

The plastid genome (also known as the plastome) is between 120–160 kb in length, contains two highly conserved inverted repeats—the long single copy section (LSC) and short single copy section (SSC)—and contains over 100 genes (Sugiura 1989, 1992; Wakasugi et al.

2001). As such, the plastome is relatively gene-dense compared with plant mtDNA and nDNA

(Bock 2007). Erwin Baur (a German geneticist and plant breeder) first proposed that chloroplasts

(plastids) had their own genetic material (Baur 1909, 1910), a finding confirmed half a century later (Chun et al. 1963; Sager and Ishida 1963; Tewari and Wildman 1966) with the plastome

110

today becoming the most studied genetic component of the plant cell. Organelle DNA

(mitochondrial and chloroplast) is considered to have evolved due to endosymbiosis (a symbiosis between formerly free-living bacteria taken inside another cell as an endosymbiont) around 1.5 bya (see Bendich 1987, 2010; Chan and Bhattacharya 2011), which explains many of the prokaryotic features in both mtDNA and cpDNA. The plastid genome is mapped as a single circular structure. This structural simplicity can be misleading and contentious however, as cpDNA can have significant structural dynamics, with initial notions concerning ‘typical’ cpDNA structures being biased by comparatively small datasets (see Bendich 2004; Bock 2007;

Lilly et al. 2001).

The plastome is a useful tool for plant phylogeny (Provan et al. 2001) and phylogeographic applications (Petit et al. 1997) due to its general lack of heteroplasmy

(organelle DNA with different genetic constitutions or allelic variability in a single cell), lack of recombination, conserved gene order, uniparental inheritance (often maternal in angiosperms and parental in gymnosperms), and high copy number per cell (up to 10,000 copies per cell)

(Bendich 1987; Bock 2007). This is unlike plant mtDNA that is known for low substitution rates, low copy number per cell, and high rates of intermolecular recombination, making it often a poor choice for botanical phylogenetic investigations. Conversely, animal mtDNA has much greater utility for phylogenetics. Paleo-phylogenetic assessments of animals often use mtDNA and nDNA to a lesser extent, while research into plants often focuses on cpDNA and ribosomal nDNA (Schlumbaum et al. 2008).

Chloroplasts are generally considered to be present in photosynthetic cells (green parts of a plant such as green stems and leaves), while being absent in vascular tissues (phloem and xylem, the majority of wood tissue). Chloroplasts are common in parenchyma cells (versatile

111

ground tissue that constitutes the filler in soft parts of plants) and can be present in collenchyma tissue (elongated cells with thick cell walls that provided structural support in growing shoots and leaves). Cells that contain chloroplasts can be referred to as chlorenchyma. Meristem

(undifferentiated cells) contains rudimentary plastids called proplastids (Pyke 2007). Due to the development of xylem (sapwood and heartwood) from the meristem, wood contains cpDNA at a higher copy number per cell than nuclear DNA (Degulloux et al. 2002:1045), despite not being photosynthetic (Rachmayanti et al. 2009:190). The presence of cpDNA in wood makes it a viable tissue for paleogenetics because most photosynthetic plant tissues do not preserve in even the most hospitable archaeological conditions.

4.3.3 Ancient DNA in Wood

Based on the distribution of viable DNA in wood, we can make inferences as to the tissues that would be most likely to contain aDNA. The vascular cambium is the most obvious target. The cells are alive throughout the life of the tree, and they are protected from external diagenetic factors by the bark. The inner bark is also a likely candidate, but because of the mixture of live and dead cells (the phloem and periderm), there should be less detectable DNA.

Also, because of the active transportation of nutrients by the phloem, this region may preferentially absorb liquids after death that contain trace amounts of exogenous DNA. Both the vascular cambium and inner bark are thin however; if the specimen size is small, it may be difficult to extract a sufficient amount of tissue for DNA isolation and extraction. The sapwood would appear to have the same conditions as the inner bark with a chance for contaminants from the xylem absorbing a variety of fluids, however this wood is much more extensive and hence may have a higher chance of containing viable endogenous DNA. The heartwood and pith would have a much smaller chance of DNA preservation, and likely a greater chance of exogenous

112

DNA. Finally, we would expect the outer bark to have the least amount of surviving DNA, and the highest number of surficial contaminants.

These tissues have been tested for their relative aDNA amplification success rates.

Deguilloux et al. (2002) investigated this issue for the forensic purposes of certification by testing 10 oak logs of known origin. Their best results came from small amplicons (the piece of

DNA that is the source or product of amplification), which was shown with the high coefficient of determination (r2 = 0.85) indicating a strong negative correlation between success rate and amplicon length (Deguilloux et al. 2002:1043). The vascular cambium and ‘inner’ sapwood performed best with the highest success rates and highest mean fragment lengths. The heartwood had generally low success rates, although DNA was still recoverable. The ‘outer’ sapwood performed surprisingly poorly in terms of mean fragment length. Finally, no recoverable DNA could be obtained from the bark. Two logs had no recoverable DNA, which the authors argue was because of PCR inhibition. The mode of conservation (outdoors or indoors, dry or wet conditions, and age of wood) was found to have a strong effect on DNA availability, with water exposure likely being the most destructive force (Cano 1996; Deguilloux et al. 2002:1044).

A more robust version of this study was performed by Rachmayanti et al. (2009). The authors in this investigation wanted to assess the impact of four variables on PCR amplification: taxa (diperocarps, tropical, and temperate), processing status of wood (treated versus untreated), wood tissue (sapwood, sapwood-to-heartwood transition zone, and heartwood), and amplification target size (ranging from 150 bp to 1.1 kb). The authors used 406 samples and had an overall PCR success rate of 75.7% using nine primer pairs to amplify three ranges of cpDNA amplicons (Short: ccmp2, PS, paGB3 at ~0.15 kb; middle length: trnL at ~0.6 kb; long: trnL-F at

~1.1 kb) using the DNeasy Plant Mini Kit (Qiagen). The authors used DNA extracts of leaves as

113

a verification of the sequences and found the same correlation of success rate with smaller amplicons. There was also a progressive decrease in inhibition moving inwards from sapwood to the transition zone to the heartwood; the authors report the dilutions necessary to remove associated inhibitors (Rachmayanti et al. 2009:191). They found that processed wood had lower success rates, particularly for middle length and long fragments, and that all taxa showed a similar pattern.

Tang et al. (2011) designed five universal primer pairs for chloroplast noncoding sequences of 300–1,200 bp. The authors also used five different pre-treatments to find the most effective means of isolating DNA and removing PCR inhibitors. They tested a simple EDTA treatment, a sodium acetate addition to the EDTA, a CTAB protocol, a PTB protocol, and a

CTAB/PTB protocol. Finally, they also tested the success rate among different wood tissues. The authors found that PTB treatment significantly increased the DNA yield and quality from all samples, and that the tissues progressed in the following order from most DNA to least DNA: cambium, sapwood, ‘outer’ heartwood, ‘inner’ heartwood. Although the cambium had the most

DNA, it also had the most PCR inhibition in some cases, with different species being found to have different rates of PCR inhibition in the cambium. The authors argue that sampling from the

‘outer’ heartwood and sapwood is most productive, and balances the amount of DNA with the lowest number of inhibitory substances. They were able to amplify sequences up to 1,000 BP in samples that fell ~4 years prior to extraction. Although the time depth is not equivalent to archaeological conditions, it does give insight into the rates of decay in wood, particularly since wood DNA is already highly degraded during the lifetime of woody plants.

The potential longevity of wood aDNA has been demonstrated in other research, although some studies need further authentication (Tang et al. 2011:609–610). Liepelt et al.

114

(2006) were able to confirm the recovery of 1,000 year old authenticated wood aDNA, and unauthenticated pine DNA from clay sediments over 11,000 years old (Liepelt et al. 2006:1109).

Rogers and Kaya (2006) recovered cedar wood DNA from the Tumulus of King Midas (ca.

2,700 BP), Deguilloux et al. (2006) were able to recover DNA from oak wood that fell in 260

CE, and Speirs et al. (2009) were able to extract aDNA from 16th century CE waterlogged oak timbers from the Mary Rose, these being recovered from a marine environment. Despite there being significant decay in wood DNA within a single human lifetime (Abe et al. 2011), with one study reporting a decrease in DNA quality by 50% in 36 year old wood samples (Jiao et al.

2012), the tissue is a viable candidate for aDNA when the taphonomic conditions are conducive to biomolecular survival.

4.4 Choosing Appropriate Genetic Loci

The selection of appropriate genetic loci for plant aDNA (using Sanger sequencing) can be more challenging than animal based studies because of the relatively limited foundational research conducted to date. A variety of publications exist for animals detailing the utility of various DNA markers within nuclear and mitochondrial genomes with an emphasis on loci small enough for aDNA applications (e.g., Hummel 2003:19–56). While the utility of specific markers for aDNA has been addressed for certain taxa, a comprehensive outline of these loci in relation to their utility for varying paleogenetic applications has yet to be developed. A complication with the genetic loci used in modern plant studies is the targeting of long sequences that are unlikely to survive in an archaeological setting as amplicon size is not typically a limiting factor in modern genetics. In this section, I discuss molecular taxonomic identification and phylogeography specifically because of their application in this thesis.

115

Plant studies rely heavily on the chloroplast genome. This is because cpDNA is haploid, has a stable structure, has a very low recombination rate, is typically uniparentally transmitted, can be targeted by universal primers, and specifically for archaeological applications, there is a high copy number per cell. However, these characteristics are frequently complicated. For example, Hansen et al. (2007) found that passion flowers (Passifloraceae) exhibited paternal, maternal, and biparental inheritance of the chloroplast genome. This complication has been found in other species (e.g., Lee and Lemieux 1986; Lee et al. 1988). Despite the variability in chloroplast inheritance (Reboud and Zeyl 1994), cpDNA has more utility in plants than mtDNA because unlike animals, plant mtDNA has a much more variable size, is prone to frequent gene gain, loss, and rearrangement, and can have variable transmission types. For example, widespread horizontal gene transfer of mitochondrial genes has been observed in flowering plants (Bergthorsson et al. 2003). While all of these factors are manageable, they do combine to limit the kinds of phylogenetic analyses that can be conducted on plant genomes when compared with animal mtDNA or nDNA.

4.4.1 Taxanomic Identification: Barcoding

One of the most basic goals in plant aDNA analysis is taxonomic identification, which is closely tied with DNA barcoding (Hebert, Cywinska et al. 2003; Herbert, Ratnasingham et al.

2003). This method uses short genetic markers chosen by consensus for their ability to differentiate taxa using a pre-existing classification (e.g., Baselga et al. 2013). This emphasis on an a priori classification makes it different from a molecular phylogeny where the goal instead is to understand the variable relationship patterns between specimens without regard to phenotypically derived classifications—meaning, that the patterns may not correlate with any contemporary taxonomy.

116

In animals, the 600 bp mitochondrial gene cytochrome c oxidase I (COI) was first proposed by Hebert, Ratnasingham, et al. (2003) as marker of choice for barcoding. This has become the standard used by the Barcode of Life Data Systems (BOLD) database (Ratnasingham and Hebert 2013; Sujeevan and Paul 2007) as the COI sequence has been shown to have a high accuracy among animals (e.g., Hajibabaei et al. 2006; Herbert, Ratnasingham, et al. 2003;

Herbert et al. 2004; Ward et al. 2005). Despite this, there is a significant contingent of barcoding skeptics that have outlined criticisms with the use of COI and the underlying assumptions of barcoding in general. Kress et al. (2005) argued that COI is not appropriate for plant barcoding because of its much slower rate of gene evolution compared with animals. They proposed the nuclear internal transcribed spacer (ITS) region and the chloroplast trnH-psbA intergenic spacer as appropriate sites for plant barcoding after investigating a range of published plant genomes.

Kress et al. (2005:8370) based their assessment on three criteria: there must been significant species-level variability in the loci, the loci must be short enough to facilitate extraction and amplification, and there must be conserved flanking sites for the development of universal primers. The gene rbcL was argued against because of its length (1428 bp [Kress et al. 2005]).

Other papers proposed the use of the rbcL gene in addition to the trnH-psbA spacer (Kress and

Erickson 2007), but the BOLD database has decided on the use of rbcL and matK genes as the molecular sites for plant barcoding (CBOL Plant Working Group 2009). The nuclear ribosomal

ITS region has been chosen as the loci for use in the BOLD database for fungi (Schoch et al.

2012).

Barcoding has been debated since its inception in the early 2000s. Many continue to use the principles and associated community data of DNA barcoding to good effect in their research

(e.g., Bhargava and Sharma 2013; Decaëns et al. 2013; Di Pinto et al. 2013; Leavitt et al. 2013;

117

Lees et al. 2013; Meiklejohn et al. 2013), which is supported by the 1,540,956 sequences on the

BOLD systems database as of October 2013, with 138,653 species and 56,354 interm species represented. This continued support is not universal however (Moritz and Cicero 2004)—some contend that barcoding is a gross oversimplification of the complexities of taxonomy (e.g.,

Rubinoff et al. 2006). There is also a contention regarding the utility of DNA barcodes at the species and family ranks in a variety of circumstances (Whitworth et al. 2007), as well as evidence that COI does not work in some instances (e.g., Funk and Omland 2003; Kerr et al.

2007; Meyer and Paulay 2005), particularly among insects (Wiemers and Fiedler 2007). Other criticisms include the complexity of inheritance of mtDNA (Johnstone and Hurst 1996), and the assertion that barcoding will outcompete traditional taxonomic methods for necessary funding because of its ‘big science’ potential (this particular assertion has been rebutted [Gregory 2005]).

At this time, many agree that barcoding can add another level of data to assist in taxonomic identification, but is limited in its ability to create, delimit, or describe new taxa (e.g., Desalle

2006; Rubinoff 2006a, 2006b).

4.4.2 Loci for Population Genetics and Phylogeography in Plants

Determining appropriate sites for phylogeographic analysis in plants is much more species, genus, or family specific because of nuanced taxonomic differences in the rates of loci evolution. Phylogeography (the study of processes responsible for contemporary geographic distributions of individuals using genetics) was first proposed by Avise (1986) to refer to the relationship between mtDNA and detectable genomic patterning with geography (see also Avise

1989; Avise et al. 1987). This kind of analysis has moved beyond the use of mtDNA and animals while gaining sophistication in the phylogenetic analysis used to investigate spatial structure. A phylogeographic assessment is more limited by previous research in the sense that other

118

sequences are necessary to investigate markers with suitable intraspecific variability to differentiate geographic populations. If there is no pre-existing research on a particular taxon, genomic data is needed to find variable loci. The goal of phylogeography is tying population genetic variability—haplotypes (combinations of alleles or polymorphisms inherited together), haplogroups (monophyletic haplotypes representing a clade), and lineages (monophyletic haplogroups)—with geographic distributions. The identification of intraspecific haplotypes allows for the investigation of geographic structure within genetic lineages.

Depending on the markers chosen, there may be strong geographic structures detected from the genetic data (e.g., Xie et al. 2012), or there may be a lack of structure due to factors such as a high dispersal, high mutation rate, extensive hybridization, or uninhibited gene flow

(e.g., Palmé et al. 2003). Without geographic barriers to gene flow, minimal spatial structure in haplotype distributions would be expected. The method need not be limited to understanding the phylogeography of a single taxon. On the Pacific Northwest Coast, researchers have used a variety of species indicative of mesic forest ecosystems to understand the evolution of the local environment (Carstens et al. 2005; Brunsfeld et al. 1992). When markers from one species show no apparent spatial structure, the markers from another can be utilized if there is sufficient environmental justification to assume that the taxa inhabit the same niche. For plants, a variety of nucleic and plastid markers have been utilized to investigate phylogeographic questions, some of these include: matK (e.g., Brunsfeld et al. 2007; Liu et al. 2012), rbcL (e.g., Chen et al. 2012;

Marais et al. 2003), rpl16 (e.g., Brunsfeld et al. 2007), rps16/rpsF/rpsR2 (e.g., Xie et al. 2012), ccmp5/ccmp6 (e.g., Guicking et al. 2011), trnL (e.g., Deguilloux et al. 2003; Liu et al. 2012;

Taberlet et al. 1991), trnH/trnH-psbA (e.g., Chen et al. 2012; Liu et al. 2012; Payn et al. 2007), trnC-D (e.g., Erickson et al. 2005), trnD-T (e.g., Chen et al. 2012; Deguilloux et al. 2003;

119

Erickson et al. 2005), trnT-L (e.g., Taberlet et al. 2007; Xie et al. 2012), trnL-F (e.g.,

Abdollahzadeh et al. 2011, Marais et al. 2003), trnC-petn1R (e.g., Dauby et al. 2010), and atpB- rbcL (e.g., Chen et al. 2010, 2012; Guicking et al. 2011; Liu et al. 2012). It is likely impossible to standardize the genetic marker chosen for phylogeography because—especially for plants— each locus can differ in its tendencies for intraspecific variability among distinct taxa.

Often the sequences necessary for phylogeographic assessment in a particular taxon are too long for use in an archaeological setting. This is not always the case however—Erickson et al. (2005) were able to use three loci ranging from 97–125 bp to reconstruct the domestic origins of bottle gourds through a phylogeographic assessment to differentiate haplotypes present in

Asia and Africa. This has also been shown specifically in wood (Deguilloux et al. 2006) where three cpDNA markers ranging in size from 65–113 bp were used to identify four oak cpDNA haplotypes. The study also confirms the hypothesis that there was population stability in two regions since the post-glacial period in Europe, despite anthropogenic influences on the local forests.

4.5 Willow (Salix spp.)

As outlined in Chapter One, the primary specimen of investigation in this thesis was micro-anatomically identified as willow (Salix sp.). The objective of the project was to use molecular genetics to source the target specimen to the contemporary haplotype distribution of

Salix on either side of the Pacific Coast Range that arose through Late Pleistocene or Early

Holocene dispersals following glacial retreat. This is based on a hypothesized regional haplotype diversity, arising from restricted gene flow during the Holocene. This section outlines ecological and phenotypic characteristics of Salix, in addition to a summary of genetic research conducted to date on the genus.

120

The genus Salix, belonging to the family Salicaceae, comprises ~450 species of willow and over 200 classified hybrids (Newsholme 2002:221; Percy et al. 2014:4737). The majority are deciduous trees and shrubs with catkins (composed of small compact flowers, subtended by a flower scale). The Latin word Salix is derived from the Celtic word sallis, meaning near (‘sal’) water (‘lis’). Salix has traditionally been divided into three subgenera: Salix (Amerina), true willows (upright trees and large shrubs); Caprisalix (Vetrix), oisers and sallows (mostly shrubs and small trees); and Cahaetia (dwarf, creeping, arctic, or mountain shrubs); with an additional fourth subgenus Choseina (which has some traits more closely aligned with Populus)

(Newsholme 2002:22–23; see also Chen et al. 2010). This taxonomy is controversial as genetic evidence continues to alter the traditional phenotypic classification of the genus by adding additional genera or combining previous ones (see Angiosperm Phylogeny Group II 2003; Argus

2004; Chase et al. 2002; Chen et al. 2010; Judd 1997). Recent genetic evidence suggests that traditional subgenera within Salix are not monophyletic (Abdollahzadeh 2011; Hardig et al.

2010), meaning the current taxonomic classification is not supported genetically. Morphological identification of individual Salix specimens, in addition to deriving useful criteria for classification, can be notoriously problematic for some of the following reasons: intraspecific variability due to phenotypic plasticity, developmental variability (in flowers, hairiness, and quantitative characters), substantial heteroblasty (markedly different juvenile and adult leaves)

(Rechinger 1992; Zotz et al. 2011), widespread natural hybridization that leads to highly variably morphology (Hardig et al. 2000; Mosseler 1990), dioecy (flowers of only one sex occur on a single individual) with simple flowers and few consistent characters for classification, and temporally disjunct timings for leaf and flower production (Argus 2004:5–6; Percy et al.

2014:4738).

121

The genus has a near worldwide distribution, being most numerous in North America

(including Canada), the British Isles, Europe, Asia, Japan, and China (Newsholme 2002:12).

Salix is found in the Arctic and the Tropics, in South America and Africa, and on islands such as

Ceylon, the Canary Islands, Madeira, the Philippines, Madagascar, as well as New Zealand

(these are naturalized exotic species), Greenland, Newfoundland, and Iceland. The majority exist in the Northern Hemisphere, with ~70% of identified species being in Asia, and 17% in North

America (Fang 1987). The ability of Salix to adapt through phenotypic plasticity (and genotypic evolution) to a diverse range of environments contributes in part to the enigmatic phylogeny of the genus. Salix are pioneer species, often being the first woody shrubs to colonize areas following natural upheavals (e.g., deglaciation, flooding, earthquakes, forest fires, anthropogenically denuded areas) because they tolerate long drought and have prolific seed production with wind dispersal over considerable distances (Newsholme 2002:33–34). Although

Salix thrive best in wet habitats, sallows in particular have adapted to low-grade soils, infertile, compacted and poorly drained land, and even grow in areas without humus or topsoil and on steep slopes and impoverished hillsides.

Fossil evidence of Salicaceae extends at least to the Upper Paleocene with the genus

Populus, and the early Eocene with Salix (Collinson et al. 1993; see also Ramírez and Cevallos-

Ferriz 2000; Thiébaut 2002). There is some evidence that the genus arose in warm temperate or subtropical regions, likely in the mountains of Eastern Asia where there are links between the small genus Chosenia which has basic Salix traits and some Populus characteristics (Newsholme

2002:10). The wide-spread distribution of willow is one reason why the genus can form an important aspect of archaeological datasets when preserved in favorable taphonomic conditions.

Willow stem crafts have a long history worldwide, being used for a variety of items such as

122

shelter construction and fuel, fishing technologies such as crab and lobster pots, eel traps, creels, vessels like coracles, and baskets. They are also used for soil consolidation on eroding banks, as windbreaks, and livestock fodder (Newsholme 2002:17–18). Salix also has medicinal properties; salicin is an anti-inflamatory agent produced in willow bark, a precursor to salicylic acid found in castoreum which is now synthetically produced for aspirin. The genus is a significant component of Holarctic ecosystems (Ager and Phillips 2008; Argus 2010; Myers-Smith et al.

2011; Percy et al. 2014:4738) as indicators of riparian habitats; for this reason many ecological studies use estimates of Salix diversity and abundance to understand ecosystem development, function, and dynamics (Myers-Smith et al. 2011: Percy et al. 2014:4738). The prolific nature of the genus makes it a useful paleoenvironmental marker (e.g., Bement et al. 2007; Farnell et al.

2004; Kuzmina et al. 2008), which could hypothetically be strengthened with an increased taxonomic resolution for more detailed reconstructions by paleogenetic barcoding if amenable.

Willows are insect pollinated, primarily by honey bees (Apis mellifera) (Newsholme

2002:10), with potentially some wind pollination (Argus 1986). Bees may fly 3–5 km to collect pollen and nectar (Cremer 2003), with crosspollination being restricted to short distances such as

50 m2 (Free 1970). Biosexuality can be widespread (Cremer 2003; Mosseler and Zsuffa 1989), especially in hybrids (Neumann 1981), despite most Salix being either male or female.

Hybridization appears to be more common in anthropogenically introduced willow, with natural barriers to gene flow (non-overlapping flowering times, non-overlapping geographical and ecological ranges, subgenera genetic barriers [Mosseler and Papadopol 1989; Neumann 1981;

White 1995]) maintaining species to a greater extent in native habitats (Cremer 2003:19). Wind is the primary mechanism of willow seed dispersal, with 50% of S. cinerea seeds in southeastern

Australia being documented to have traveled over 15 km (CSIRO 2011). Cremer (1999) found

123

that S. nigra spread between 50 and 100 km in all directions in three decades, although it is believed that other species are not as mobile, particularly in areas with established Salix populations (Cremer 2003:19).

4.5.1 Genetic Research of Salix

There has been a degree of discontinuity in the literature regarding the phylogeny of

Salix. While some have found clear evidence of biogeographic structuring (e.g., Brunsfeld et al.

1992, 2007), others have found an absence in genetic diversity (e.g., Palmé 2003; Palmé et al.

2003), and a complete inability to barcode the genus (Percy et al. 2014). This final background section summarizes the genetic work to date on Salix.

Brunsfeld et al. (1992, 2007) were able to identify subalpine, lowland, and mesic races of

S. melanopsis with strong geographic structuring across Washington, Northern Oregon, Northern

Idaho, Western Montana, Southern British Columbia and Southwestern Alberta using matK and rpl16. The mesic coniferous forests of the Pacific Northwest are split longitudinally by the

Columbia Plateau, creating a 300 km isolation zone of xeric shrub and desert steppe with the mesic forests constrained to the Cascade Mountains and the Northern Rocky Mountains

(Brunsfeld et al. 2007:129). Brunsfeld et al. (2001) hypothesized an ancient vicariance from the

Cascadian Orogeny 2–5 mya, in addition to a multiple refugia hypothesis with over half of the area being glaciated during the Last Glacial Maximum, to explain the presence of three distinct intraspecific races of dusky willow (S. melanopsis) in the area (e.g., Brunsfeld et al. 1992). A recent analysis using next generation sequencing (Illumina) to investigate >400 loci found evidence of complex refugia and recolonization dynamics since the glacial retreat ~20 kya to explain the disjunct distribution of S. melanopsis between the Pacific Northwest and Rocky

Mountains (Carstens et al. 2013). Hybridization events were identified (e.g., Brunsfeld et al.

124

2007), however the authors were able to thoroughly assess biogeographic variability and genetically distinguish between interior and coastal willow (e.g., Carstens et al. 2013).

While Brunsfeld et al. were able to assess biogeography in Salix, other analyses attempting to refine the phylogeny of the genus encountered problems with the phenotypically defined subgenera. Abdollahzadeh et al. (2011) found, using ITS (nDNA) and the trnL-F region

(cpDNA), that all five recognized subgenera except Longifoliae are not monophyletic, in addition to certain species having a potential hybrid origin. Hardig et al. (2010) reported similar results using ITS (nDNA) and matK (cpDNA), suggesting that hybridization, introgression, and lineage sorting have all contributed to the polyphyly in subgenera within Salix, and further call for a reassessment of the taxonomic classification for the genus.

In a stark contrast to the work of Brunsfeld et al. (2007), Palmé (2003; Palmé et al. 2003) found a distinct lack of geographic structuring in the molecular phylogeny of 24 European populations of S. caprea L. and 10 other Salix species. Palmé et al. (2003) used PCR-restriction fragment polymorphisms (RFPL) to assess cpDNA variation. The authors found high levels of variation within populations, and an absence of geographic structure. They suggested that high speed recolonization and dispersal, high mutations rates, extensive hybridization, and large population sizes in refugia populations during the last glacial maximum may be the cause of this lack of cpDNA spatial haplotypes.

The work of Palmé (2003; Palmé et al. 2003) was recently expanded by Percy et al.

(2014) who completed the largest investigation to date of DNA barcoding in Salix. Their primary objective was to assess the feasibility of barcoding methods for Salix species identification. They fully acknowledged the added difficulty in barcoding plants as compared with animals (e.g.,

Fazekas et al. 2009; Hollingsworth et al. 2011), in addition to documenting haplotype patterns,

125

establishing diversification time-scales, and exploring hypotheses to explain the issues taxonomists have encountered with Salix (Percy et al. 2014:4738). They found an absence of geographic influence in haplotype distribution using willow primarily from Western North

America (notably British Columbia, Yukon, and Alberta), but also from Eastern Canada and the

United States, Mexico, Japan, Europe, as well as other published samples downloaded from

GenBank (collected worldwide). Further, they conclude that barcoding is not feasible within

Salix using typically polymorphic cpDNA loci. The authors argue that repeated plastid capture events (chloroplast inter-specific hybridization and backcrossing, the mating of a hybrid with one of its parents or one genetically similar to the parent) with a single or multiple large scale historic selective sweeps (reduction or elimination of variation among nucleotides as a result of strong positive selection) have resulted in the dominance of one primary haplotype (as well as five other smaller haplotypes) that is trans-specific and cross-continental within Salix. Using more than 500 specimens (in addition to GenBank sequences) that represent 71 species, 10 hybrids, and 10 additional specimens of unknown species, they were only able to consistently identify a single species using 8 molecular loci—four cpDNA coding regions (matK, rbcL, rpoB, cpoC1), three cpDNA intergenic spacer regions (atpF-atpH, psbK-psbI, trnH-psbA), and one mtDNA coding region (COI). The inability to identify species within Salix is compounded by a ‘striking absence’ of geographical effects on haplotype distribution that the authors argue is more indicative of trans-species selective sweeps than just interspecific hybridization (although long range seed dispersal and high levels of hybridization are important contributing factors [Percy et al. 2014]).

The research by Percy et al. (2014) was published in October 2014, with this thesis work having begun in Winter 2013. At the time, the work of Brunsfeld et al. (1992, 2001, 2007)

126

formed the justification for this research project, that a similar biogeographical assessment of

Salix could be undertaken further north where the last remnants of the Cordillera Ice Sheet cling to the extensive Pacific Coastal Range. It was only once the majority of the laboratory work in this thesis had been completed (Summer 2014) that the scope of the problem with phylogeographic variability in Salix could be placed into a wider context with the publication of

Percy et al. (2014). A partial failure of the plastome to detect species or populations is common in plant phylogenetic research (e.g., Percy et al. 2008; Starr et al. 2009; Hassel et al. 2013), however Salix presents an unusually difficult case. The extent of this difficulty will be explored in the results and discussion chapters of this thesis.

4.6 The Feasibility of Extracting aDNA from Wood

Despite the complications of PCR inhibition, taphonomic bias, tissue type limitations, and variability in plastome diversity and inheritance, there is good evidence that plants can be viable sources of ancient DNA. While this is truer for robust tissues such as seeds, wood has been shown to be viable through the successful amplification of DNA from archaeological, paleobiological, and forensic specimens in a variety of publications. The problem associated with an analysis of variable plant tissues is additional protocol experimentation and development with taxonomically and physiologically identical materials to those of the ancient samples. This periodic methodological refinement is a time-consuming but necessary objective for conducing analyses of this sort. Complications in refining the methodology of wood aDNA extraction is exacerbated in this instance by the disjunct and abnormal (when compared with other taxa) patterns of genetic variability detected in Salix. The following chapter details the methodological trial-and-error used in an attempt to circumvent these issues, and the protocols used to extract aDNA from modern and archaeological plant samples in the Yukon and Alaska.

127

Chapter Five: Method

This chapter is divided into seven sections. The first outlines the recovery, storage conditions, and field sampling of both ancient and modern specimens. The Ancient DNA Facility at the University of Calgary is discussed in the second section, along with an outline of laboratory decontamination procedures and contamination monitoring. The third outlines the process of primer design and the selection of viable genetic loci based on previous research. The fourth details procedures utilized during sample preparation and decontamination. DNA incubation and extraction protocols are discussed in the fifth section, while PCR, agarose electrophoresis, and sequencing conditions are discussed in the sixth. Finally, section seven reviews electropherogram inspection and bioinformatics software used in the phylogenetic analysis. Sections are sub-divided into an ancient and modern sample component where necessary, although only modifications to the ancient protocol for modern samples are noted as a continuity in protocol has been largely maintained throughout the project.

5.1 Specimen Recovery, Storage, and Sampling

5.1.1 Ancient Specimens

The unmodified ice patch sticks were initially recovered as surface finds ablated from alpine ice, presumably without gloves or other contaminant conscientious equipment. They were stored in a warehouse in standard room conditions in a single polycarbonate box (without physical separation) for up to 13 years. The Kluane Stick was collected with gloves, enclosed in a plastic bag, and stored in a separate container from the other samples.

The sampling of ice patch specimens was conducted in a non-sterilized artifact storage facility, surrounded by faunal material—primarily mammalian mega-fauna. A layer of plastic wrap was placed on a wooden table, and all equipment (including the plastic wrap) was

128

thoroughly cleaned with 100% commercial bleach (5.5% NaClO). The Dremel™ and bits were also rinsed with distilled water in order to minimize damage to the equipment. A picture was taken with identifying labels for each specimen on the sterilized surface prior to sampling. A small piece (~5 cm3) was cut from the specimen using a Dremel™ saw (the samples often, but not always, included bark, sapwood, heartwood, and pith). The sampling location, type of cut, and sample size was based on minimizing damage to the biofacts. The sample was then placed on a sterilized piece of plastic wrap on a scale using sterilized forceps. Approximately 2–4 g of each specimen was collected as per the Yukon science permit. Throughout the sampling process a

Tyvek suit with face mask and gloves were worn (gloves were changed between samples). All plastic wrap was changed and all tools were cleaned with bleach between each sample to minimize cross-contamination. Samples were stored in a sterilized plastic bag, which was placed in a second bag with adhering sample information. The samples were stored in freezer in

Whitehorse, transported to the laboratory in Calgary with freezer packs in a cooler, and placed in a deep freezer upon arrival. They remained there until sample preparation and are currently stored in a −80°C freezer in the ancient DNA laboratory.

The large Salix sp. stick from Kluane had a small precariously attached fragment (1.5 g,

10 cm long) that was removed (presumably with gloves and sterile equipment) by Parks Canada researchers 1.5 years after the initial sampling due to the sensitive legal circumstances. The specimen was shipped with dry ice to the University of Calgary and stored in a −80°C freezer.

5.1.2 Modern Specimens

Small fragments of the ice patch specimens were used to make rough taxonomic identifications using microscopic morphological characteristics (Alix 2006) in order to confirm the presence Salix spp. specimens in the assemblage. Other modern taxa representative of the

129

biofacts (conifers for example) were collected in Yukon and Alaska, although these were later deemed beyond the scope of the thesis (consequently, they were not processed further and remain in cold storage). Modern Salix ssp. were obtained from six general locations in 2013 and

2014 (Figure 5.1). The first was via a helicopter trip to a treeline adjacent to three ice patches where a portion of the ancient specimens had been recovered. The second was along the Alaska-

Canadian Highway (Yukon Highway 1) traveling northwest from Whitehorse to the western side of Kluane Lake, which skirts the eastern boundary of Kluane National Park, Yukon. These two locations represent samples from the westernmost portion of the Yukon Plateau (Figure 1.2). The third was on the eastern shore of Yakutat Bay, within a day’s drive and hiking distance of

Yakutat, Alaska. The fourth was on the western shore of Yakutat Bay in Wrangell-St. Elias

National Park and Preserve, Alaska. The fifth was on Kenai Peninsula, near Seward, Alaska for a more spatially isolated sample set on the coast. These last three locations represent the hemlock- sitka spruce coastal rainforest ecozone (Marine West Coast Forests) on the Pacific side of the

Coast Mountain System (Figure 2.4). Finally, the sixth was from the western Portion of

Wrangell-St. Elias National Park and Preserve along the McCarthy road and within hiking distance of Kennecott, which represents the southeastern most portion of the Copper Plateau. All modern sampling was conducted after the ice patch specimens had been sampled in Whitehorse, but a year prior to the sampling of the willow stick from Kluane.

Approximately 2–10 g were collected from modern trees at the sample locations. The knife used for cutting was not sterilized or cleaned between specimens. A 5–15 cm piece of wood stem was removed from accessible branches from each tree or shrub. Leaves and flowers were also recovered where available for identification purposes. A picture of the whole plant, a close-up of the leaves and flowers, and a picture of the local environment were taken prior to

130

Figure 5.1 A map of modern and ancient sample provenance

Samples data and pictures are listed in Appendix III and IV. The years associated with modern (green dots [white text boxes]) and cryogenic biofacts (purple dots [purple text boxes]) indicate when the materials were sampled (either in the field or lab), not when the ice patch specimens were recovered.

131

sample removal. Samples were not identified to species during recovery, with the intent of genetically identifying them at a later date. The objective was to gather representative samples of available species similar to those identified in the alpine ice patches. Willow was targeted specifically in order to investigate the origin of the Kluane Stick (recovered from Kluane

National Park) through an assessment of the haplotype diversity in the study area. I hypothesized that prolific hybridization in willow would result in inter-species regional haplotypes (with gene flow being physically constricted by the presence of extensive ice fields and mountain ranges), which meant that species-level classifications (at least based on morphology) were unnecessary.

Samples were stored in freezer conditions each evening, and were stored either on ice or in freezers until sample preparation for DNA extraction. A physical separation between modern and ancient samples was maintained.

5.2 University of Calgary’s Ancient DNA Facility

5.2.1 Ancient Specimens

The Ancient DNA Facility at the University of Calgary was constructed in 2011 by Dr.

Brian Kooyman (a professor at the University of Calgary) and Dr. Camilla Speller (a former post-doctoral research fellow). This facility is composed of two laboratories: the main ancient

DNA laboratory is located in the Anthropology and Archaeology Department, while the post-

PCR laboratory is located in the Biological Sciences building. This physical separation is intended to minimize the potential for ancient samples to succumb to either indirect contamination or cross-contamination by amplified products in the post-PCR facility. The aDNA laboratory is separated into four workspaces: a common area, sample preparation, DNA extraction, and PCR setup (Figure 5.2). The laboratory is equipped with heap-filtered and ultraviolet (UV) irradiated ventilation, a positive airflow system, and mounted UV lights with a

132

Figure 5.2 Layout of the Ancient DNA facility at the University of Calgary.

decontamination cycle in all rooms. Tyvek full body suits are worn while in any of the three isolated wet labs (in addition to face masks and a double set of gloves [for ease of frequent glove discard]). The Tyvek suits and respirators are discarded after approximately five uses, and are individually dedicated to their respective internal wet lab. Dedicated laboratory scrubs are used for the aDNA lab, and there is a one-way movement between the aDNA and post-PCR laboratories. Clothing is changed to a different set of dedicated scrubs in an intermediary laboratory on route to the post-PCR lab. Post-PCR and aDNA clothing do not come in contact; common clothes must be washed and personnel must shower before returning to the aDNA lab after visiting Biological Sciences.

The independent researchers in the facility (including myself) have carried out contamination monitoring and laboratory sterilization throughout this project. Contamination testing was undertaken after each laboratory sterilization. After cleaning all equipment, supplies,

133

reagents, and surfaces in the facility with 100% commercial bleach (6.5% NaClO), nine open topped tubes (50 mL) were setup throughout the facility with ~10 mL of UV irradiated (30 minutes at 120 mJ/cm2) distilled water. The tubes were left open for ~30 hrs. Afterwards, the liquid was treated as an aDNA sample and processed according to the protocol outlined in

Section 5.5.1.2. These samples were extracted using a QIAquick Nucleotide Removal Kit

(QIAGEN) that was manufactured prior to kit modifications that changed the PN Buffer to PNI.

Despite manufacture claims that the buffer shows the same performance, our lab has found repeatedly that the recent manufacturer modifications have render the kit ineffective for aDNA.

The water samples were initially tested against both human and canid primers to check for mammalian contamination. This experiment was repeated with 2 mL microtubes using 1.5 mL of ultrapure water (which was again UV irradiated prior to allocation). These samples were tested against mtDNA taxa specific primers (canid, equid, human) targeting hyper variable region 1

(HVR1) in addition to universal plastid primers (rbcL and trnL) to monitor for contamination specific to each project being conducted in the facility.

5.2.2 Modern Specimens

Modern samples were processed using a ‘mobile’ DNA laboratory. Initial sample preparation was carried out in the Arctic and Plains Research Laboratory and Paleoethnobotany

Laboratory, with pulverization being conducted in the Stable Isotope Laboratory, all in the

Department of Anthropology and Archaeology, University of Calgary. DNA incubation, extraction, and PCR setup was conducted in the Residue Analysis Laboratory of the same department, although master-mix preparation for PCR was conducted in the Ancient DNA

Laboratory.

134

5.3 Primer Design

Sequences of associated genera were downloaded from Genbank as FASTA files, imported into BioEdit 7.2.5 (Hall 1999), and aligned with ClustalW (Thompson et al. 1994) or

MUSCLE (Edgar 2004a, 2004b). Primers ranging from 18–30 bp (Tm ≈ 55–65°C) were designed in BioEdit (Hall 1999) to target conserved regions flanking polymorphic loci, and tested using NetPrimer (Premier Biosoft 2014) for dimers (maximum allowance < −7 kcal/mol).

Primers were also run through BLAST (Altschul et al. 1990) to check the extent of non-specific amplification. Aligned Salix ssp. sequences, trimmed to the extent of the custom primer set, were imported into MEGA 6.0 (Tamura et al. 2013) and converted into phylogenetic trees to investigate haplotype diversity.

5.4 Sample Preparation and Decontamination

5.4.1 Ancient Samples

A Dremel™ with a burr drill bit was used to pulverize the wood specimens, with the drill bit being sterilized between each sample. A sterilized plastic tupperwear shield with hand sized holes on either end (for instrument manipulation) was used to stop sawdust from spreading in the lab; this shield was replaced for each sample to minimize cross-contamination. One pair of forceps per sample and one scalpel blade per sample were pre-sterilized and swapped between preparations. The decontamination of all equipment (except for the Dremel™, rotary extension, and work surface, which were bleach between samples), was carried out before sample preparation by physical agitation with Micro-90™, followed by rinsing and soaking in a tub of warm water with Contrad™ 70 (Decon) to soak overnight. The following day the equipment was rinsed, submerged in 100% commercial bleach (5.5% NaClO) for >2 min, rinsed twice with

135

distilled water, and UV irradiated for 30 minutes at 120 mJ/cm2. The Dremel™ and cable itself were surficially bleached and UV irradiated for 30 min at 120 mJ/cm2.

5.4.1.1 First Preparation

Prior to initiating sample preparation, the work surface was wiped down with 100% commercial bleach (5.5% NaClO) and an underpad was placed on the table under the fume hood.

The sample was placed in a UV irradiated weight boat and the bark of the sample was washed briefly in 100% commercial bleach. The sample was then lightly cleaned with a Kimwipe™, which was wetted with UV irradiated ultrapure water. A scalpel was used to remove the bark down to the cambium across half of the sample; the bark was discarded and the scalpel blade was placed in a Micro-90™ solution for post-preparation cleaning. While holding the sample with forceps, a burr drill was used to pulverize the cambium, sapwood, and heartwood of each sample into the weight boat. From this powdered wood, 0.1 g was measured and placed into a 2 mL tube, with the remaining sample placed in a second stock 15 mL tube—these samples were processed using the DNeasy protocol (Section 5.5.1.1). This procedure was repeated for each sample, with a new set of gloves, burr drill, underpad, scalpel, forceps, plastic shield, and weight boat being used for each sample. The scalpel, forceps, plastic shield and burr drill were placed in the Micro-90™ solution for cleaning while the other materials were discarded. Gloves were changed three times per sample (after setup, after pulverizing, and after clean-up) to minimize cross-contamination with objects used throughout the procedure (such as the 15 mL tubes and writing utensils).

5.4.1.2 Second Preparation

The second preparation followed the same basic procedure as the first, however a more intensive decontamination procedure was implemented to counteract exogenous DNA

136

amplifications encountered from the first extraction. Following decontamination of the work area, the samples were individually placed on sterilized SCOTT® Shop Towels and surficially bleached (100% strength, commercial). The samples were then placed into individual weight boats and UV irradiated (120 mJ/cm2) for 15 min per side. Following bark removal and pulverization as described in the first extraction, two sample weights were prepared 0.1 g (for a repeat DNeasy extraction, Section 5.5.1.1) and 1.0 g (for a MinElute extraction, Section 5.5.1.2), which were placed into 2 ml and 15 ml tubes respectively. An insufficient quantity of some samples was available for this second preparation, so certain samples were mixed with the remaining sawdust from the first preparation to ensure that there was enough sample to extract

DNA. All samples discussed in the results section are marked as either 1P, 2P, 1/2P, referring respectively to the first preparation, second preparation, or a mix of sawdust from both.

5.4.2 Modern Samples

Modern samples were pulverized using a liquid nitrogen Freezer/Mill®, which is located in the Stable Isotope Laboratory in the Department of Anthropology and Archaeology,

University of Calgary. The mill was not used for ancient specimens because of funding limitations associated with purchasing dedicated grinding vial sets for the aDNA lab, deemed potentially necessary due to the issue of confidently decontaminating the polycarbonate vials, and to a lesser extent the stainless steel impactors.

The grinder sets and manual instruments were cleaned with Micro-90™ and hot water, thoroughly scrubbed with bleach, and rinsed with double-distilled water. After bleaching and removing the outer bark with a sterilized scalpel, a second scalpel was used to cut wood flakes of cambium, sapwood, and heartwood from the specimen. These wood flakes were placed in an assembled grinder vial set that was submerged in liquid nitrogen for 2 minutes and milled twice

137

for 2 minutes each run until the sample was pulverized; the ginder sets and instruments were cleaned prior to each use. Powdered samples were stored in 15 mL vials in a freezer until DNA incubation.

5.5 DNA Incubation and Extraction

5.5.1 Ancient Samples

A lysis buffer (1.2 mL per 0.1 g sample, 5 mL per 1.0 g sample) composed of 2.5 mM N-

Phenacylthiazolium bromide (PTB, Prime Organics), 0.5M ethylenediaminetetraacetic acid

(EDTA), 0.5% sodium dodecyl sulfate (SDS), and 0.4 mg/mL proteinase K was prepared and added to each tube (2 mL for the DNeasy 0.1 g samples and 15 mL for the MinElute 1.0 g samples). EDTA chelates with calcium ions to break cell walls and stabilize the DNA, SDS stabilizes free nucleic acids, proteinase K digests protein and releases the nucleic acids, and PTB breaks crosslinks that entangles DNA in Maillard products. Together, these reagents break down the cellular matrix and release aDNA for amplification. Once the lysis buffer was added, the samples were transferred to the aDNA extraction lab and incubated at 50°C for ~24 hrs with constant agitation. Samples were then spun at 5500 rpm for 20 min, and 300–700 μL of supernatant was extracted, separating it from the dense mass of tissues.

Initially the DNeasy Plant Mini Kit (QIAGEN, Section 5.5.1.1) was used for sample extraction because of its predominant use in other studies (e.g., Deguilloux et al. 2002, 2003,

2006; Liepelt et al. 2006; Rachmayanti et al. 2006, 2009; Abe et al. 2011; Jiao et al. 2012, Tang et al. 2011; Dumolin-Lapègue 1999). However, the problems associated with small initial starting weight using the DNeasy kit described by Moore (2011) (discussed in Section 4.2.3.1) was considered to be a plausible cause of the relatively poor amplification success following the first extract. To test this hypothesis, the second preparation (with a more thorough

138

decontamination procedure [Section 5.4.1.2]) was used for two extractions: first a repeat 0.1 g extract for the DNeasy Plant Mini Kit, and second a 1.0 g extract for a Silica-Spin Column method (using the MinElute PCR Purification Kit).

For all aDNA extracts discussed here, when noted that the flow-through was discarded, this indicates that the collection tube was also discarded, and the column was placed into a new

(UV irradiated) 2 or 1.5 mL collection tube in order to minimize cross-contamination.

5.5.1.1 DNeasy Plant Mini Kit (QIAGEN)

A DNeasy Plant Mini Kit (QIAGEN, Valencia, CA) was used after the lysis pre- treatment; all buffers discussed in this paragraph are included with this commercial kit.

Modifications to the kit protocol follow Kistler (2012). The volume of supernatant extracted previously was estimated, and 0.325 volumes of Buffer P3 was mixed then incubated in the fridge for 5 min. The sample was centrifuged for 5 min at 14,000 rpm and the supernatant was pipetted into a QIAshredder mini spin column, which was centrifuged for 2 min at 14,000 rpm.

The flow-through fraction was transferred into a new 2 mL collection tube without disturbing the cell-debris pellet and 1.5 volumes of Buffer AW1 was added to the tube, which was mixed by pipetting. Initially, 650 μL of the solution was pipetted into a DNeasy mini spin column, which was centrifuged for 1 min at 8000 rpm; the flow-through was discarded. The remaining liquid was added to the spin column and centrifuged again. The spin column was placed into a new 2 mL collection tube, 500 μL of Buffer AW2 added, and centrifuged for 1 min at 8000 rpm. This step was repeated once more, but centrifuged at 14,000 rpm for 2 min; the flow-through was discarded. Samples with darkly coloured membranes were spun once more with another 500 μL of Buffer AW2 at 14,000 rpm for 2 min. The spin column was added to a new 1.5 mL microcentrifuge tube and 100 μL of Buffer AE added to membrane. Samples were incubated for

139

5 min at room temperature and centrifuged for 1 min at 8000 rpm to create the first elution. This step was repeated to create a second elution.

5.5.1.2 MinElute PCR Purification Kit (QIAGEN)

A modified silica spin-column methodology (Yang et al. 1998; Speller et al. 2010, 2012) was used for the second extraction with a MinElute PCR Purification Kit (QIAGEN, Valencia,

CA). The kit is designed for post-PCR purification, but as it retains DNA fragments over 70 bp, it has been found to be useful for aDNA extractions. The kit may also be preferable for wood because of its increased starting weight (0.5–1 g) when compared with the DNeasy Kit

(maximum starting weight: < 0.02 g for dried tissue, < 0.1 g for wet).

Following overnight incubation at 50°C in 5 mL lysis (as outlined in Section 5.5), the samples were centrifuged for 30 min, photographed, and 2–4 mL of supernatant was transferred to an Amicon Ultra-4 Centrifugal Filer Device (10,000 NMWL, Millipore, Billerica, MA). The

Amicon’s were centrifuged for >90 min (4400 rpm) until concentrated to 50–100 μl; 500 μl of

PB Buffer (0.67% [v/v] 3 M sodium acetate) was added, mixed, and transferred to MinElute Spin

Columns. These were centrifuged for 60 sec (13,000 rpm), flow-through was discarded, and 500

μl PE Buffer was added. Columns were centrifuged for 60 sec (13,000 rpm), flow-through was discarded, 300 μl PE Buffer was added, and the columns were centrifuged for 2 min (13,000 rpm). Sixty μl of EB Buffer was added to the columns, incubated for 60 sec at 65°C, and centrifuged for 60 sec (13,000 rpm)—this was repeated a second time, resulting in two elutions.

5.5.2 Modern Samples

There were no deviations from the protocol described in section 5.5.1.1 (DNeasy Kit) for the modern DNA extractions, except for conducting the work in the Paleoethnobotanical and

140

Residue Analysis Laboratories in the Department of Anthropology and Archaeology, University of Calgary, as opposed to the Ancient DNA Facility.

5.6 PCR Setup, Agarose Electrophoresis, and Sequencing

5.6.1 Ancient Samples

The first and second elutions were transferred to the PCR setup lab, and the workspace was cleaned with 100% commercial bleach (5.5% NaClO). The following master mix solution was created for PCR amplification: 1 mM MgCl2, 0.2 mM dNTP, 1.0 mg/mL Bovine Serum

Albumin (BSA), 0.3 μM forward and reverse primers, and 2 or 2.5 U AmpliTaq Gold™ Low

DNA (LD) enzyme. The master mix was distributed into PCR setup tubes at a volume of 27 μL;

3–4 μL of either the first or second elution was added to each PCR tube.

PCR tubes were transferred to the biological sciences building (in tinfoil to minimize light damage), briefly centrifuged and transferred to a PCR thermocycler (Mastercycler Personal:

Eppendorf, Hamburg, Germany). Various PCR conditions were tested, with a viable balance for the primer sets used to date being found with the following temperatures and timings: denaturation at 95°C for 30 sec; annealing at 52°C (or primer Tm − 5°C) for 30 sec, extension at

72°C for 45 sec for a total of 50 cycles (to minimize non-specific amplification). PCR conditions are detailed for each series run in the results section.

The agarose gel was made with 1 g of agarose powder, and 49 mL 1X TBE buffer. SYBR

Blue/Safe was used to fluoresce the samples at a ratio of 5 μL SYBR Blue to 5 μL of aDNA sample. A 100 bp ladder was used to gauge the fragment size with electrophoeresis being run at

100 V for 30 min; the gels were visualized using a UVP Benchtop UV-transilluminator with camera mount. Positive samples were sent to Eurofins MWG Operon, Inc., Huntsville, Alabama,

USA for sequencing with SimpleSeq for forward and reverse reads.

141

5.6.2 Modern Samples

The protocol described in 2.6.1 was modified in four ways:

1) 1–1.5 U of Taq was used instead of 2–2.5 U in the ancient extractions.

2) 2 μL of the first/second elution was added instead of 3 μL.

3) The DNA extract was added in the Paleoethnobotanical Laboratory instead of the aDNA

laboratory. (Initial PCR setup was conducted in the aDNA facility because of space

limitations for the mobile modern DNA laboratory.)

4) The PCR conditions differed because the fragment size targeted for amplification was

larger. For amplifying fragments ≥ 500 bp, an extension time of 60–180 sec was found to

produce the clearest banding during transillumination. Annealing temperatures were set at

primer Tm − 5°C.

5.7 Electropherogram Inspection and Analysis

Electropherograms received from Eurofins Genomics, Operon were edited using

Chromas Pro 1.7.5 (Technelysium Pty Ltd. 2013). The forward and reverse reads were edited together (using a reverse-compliment of the reverse read). Ambiguous peaks and the up and downstream ends were trimmed, and unknown bases were re-coded based on a visual assessment of the electropherogram. The sequences were exported to FASTA files, imported into the alignments previously created for each locus during primer design with GenBank sequences (of target genera and an outgroup). A multiple alignment was created again with the newly imported sequences using ClustalW (Thompson et al. 1994) or MUSCLE (Edgar 2004a, 2004b) through

BioEdit (Hall 1999). The sequences were imported into MEGA (Tamura et al. 2013), and converted into a phylogenetic tree. Modified or loci specific settings in MEGA or other bioinformatics software, or other modifications to this summary, are reported with each associated figure in the results chapter.

142

Chapter Six: Results

This chapter is divided into four sections: contamination testing, loci investigated, species identification, and an overview of the Kluane Stick. A sample inventory can be found in

Appendix III, with pictures of samples referenced in this chapter in Appendix IV.

Section 6.2 (Loci Investigated) is subdivided by loci; in each subsection, the amplification success for the locus, complications, and implications of the phylogenetic analysis are discussed, with locus specific phylogenetic trees presented individually. Relevant figures of the sequence alignments (demonstrating notable polymorphisms or a lack thereof) are included where necessary. Full sequence alignments are digitally available upon request; the sequence data will be uploaded at a later date to NCBI GenBank (Benson et al. 2013; Sayers et al. 2011).

Many loci were investigated initially to assess polymorphic regions, however only those that were chosen for testing are discussed here. That decision was based on adherence to the following criteria: 1) a sufficient number of Salix spp. sequences available on GenBank; 2) the locus shows evidence of population structure in Salicaceae or associated taxa (with multiple haplotypes), which may be amenable for phylogeographic analysis. Loci were prioritized by their perceived likelihood to be useful in my analysis by their adherence to these criteria.

In order to choose appropriate loci, aligned sequence data of Salix spp. (from GenBank) were subjectively assessed by the number of clades each locus identified in Salix. Additionally, the utility of the locus for aDNA analysis was also assessed in terms of size of the exon or intron.

The smaller the locus, the easier and more cost effective it would be to create overlapping primers sets for the degraded ancient specimens. Table 6.1 lists these loci and the result section in which they are discussed. Table 6.2 lists forward and reverse primers created for these loci.

143

Table 6.1 Regions Investigated for Phylogeographic Structuring in Salicaceae. Locus Section Initially Perceived* Approximate Initially Perceived* Discussed OUT** Size (bp) Phylogeographic potential atpB Insufficient Salix sequences on GenBank at the time of analysis rbcL 6.2.1 Genus 500 Poor trnL 6.2.2 Genus 700 Poor ndhF Insufficient Salix sequences on GenBank at the time of analysis rpoC1 6.2.3 Population/Species 500 Good rpl16 6.2.4 Genus 300 Poor rpl32 Insufficient Salix sequences on GenBank at the time of analysis matK 6.2.5 Species 800 Poor rbcL-atpB 6.2.6 Population/Species 700 Good psbK-psbl 6.2.7 Species 500 Good psbM-trnD Family 400 Poor psbZ-trnG Population/Species 400 Good trnS-psbZ Population/Species 400 Good petN-psbM Population/Species 500 Good rpoB-trnC Genus/Species 1200 Poor trnD-trnT 6.2.8 Population/Species 1100 Good trnH -psbA 6.2.9 Population/Species 250 Good trnQ-trnK Genus 1300 Poor matK-trnK Genus/Species 800 Poor ITS (rDNA) 6.2.10 Population/Species 600 Good atpF-atpH 6.2.11 Species 600 Good *Initially perceived refers to how the effective GenBank data was initially perceived to be for discriminating among variants in the sample set. **OTU: Operational Taxonomic Unit.

144

Table 6.2 Loci amplified with forward and reverse primers and associated PCR results. Primers (5'-3') PCR Results Target Sample Control Clean Locus Series PTF Forward Reverse Size Obj. Amplification Amplification Electro. (bp) A083 6.1 F1: GCRTTCCGAGTAACTCCTCAACC R2: AAAAGGTCTAAGGGGTAAGCTACATA 219 6/12 0/4 6/6 A A097 6.2 F3: TGTAGCTTACCCCTTAGACCTTTT R4: ATCTCTYTCAACTTGGATACCATGAG 180 2/12 0/4 2/3 A A110 " " " 0/3 0/5 CT rbcL A111 " " " 0/3 0/5 CT-UV30 A113 " " " 0/3 0/5 CT-UV30 MP11 F1: GCRTTCCGAGTAACTCCTCAACC R4: ATCTCTYTCAACTTGGATACCATGAG 399 4/4 0/1 0/4 A A257 6.2 F3: TGTAGCTTACCCCTTAGACCTTTT R4: ATCTCTYTCAACTTGGATACCATGAG 180 2/9 0/2 1/2 A A084 6.3 F1: GRATTGAGCCTTRGTATGGAAAC R2: CCATTGAGTCTCTGCACCTATCC 198 7/12 2/4 6(2)/7 A A098 6.3 " " " 5/12 1/4 4(0)/6 A A108 " " " 3/16 0/4 CT A109 " " " 0/16 0/4 CT-UV30 trnL A112 " " " 0/16 0/4 CT-UV30 A160 6.3 " " " 2/3 0/1 1/1 CT-UV10 A161 " " " 2/3 0/1 CT- UV5 145 MP9 6.3 " " " 4/4 0/1 4/4 A

A254 6.3 " " " 11/23 0/5 7/8 A

MP24 6.4 F1: TGGCAAACGGGTTGATTATT R2: GATAGCTGGAGACAAGAGATTCATAT 458 5/5 0/1 5/5 A rpoC1 MP25 6.4 " " " 4/4 0/1 3/4 A MP23 6.5 F1: ATCTAATAATCATAATAAATACAGACTTGTT R2: TGAGAGTTTCTTCTCATCCAGC 391 5/5 0/1 5/5 A rpl16 MP27 6.5 " " " 4/4 0/1 4/4 A MP28 6.5 " " " 8/13 0/4 8/8 A MP13 6.7 F1: CAATAAATATAGTTTACTAATCGTAAAGCGTTT R2: AAGAAAAAAGAAAACGGACTCGTATTC 529 3/4 0/1 3/3 A MP14 F3: AATCCTTCGCTATTGGGTGAAAGA R4: TTCTAGCATTTGACTCCGTACCACTG 587 0/4 0/1 A/PCR-T MP15 6.7 F5: TTATGTCAATGTCATTTTGATGTGTGC R6: ATTGGACAGCTCGTTGATACAAATAATA 617 4/4 0/1 4/4 A/PCR-T MP16 F1: CAATAAATATAGTTTACTAATCGTAAAGCGTTT " 1384 1/4 0/1 A/PCR-T MP21 6.7 F3: AATCCTTCGCTATTGGGTGAAAGA " 1047 5/5 0/1 5/5 A matK MP29 6.7 F1: CAATAAATATAGTTTACTAATCGTAAAGCGTTT R2: AAGAAAAAAGAAAACGGACTCGTATTC 529 3/5 0/1 3/3 A MP30 F3: AATCCTTCGCTATTGGGTGAAAGA R6: ATTGGACAGCTCGTTGATACAAATAATA 1047 0/5 0/1 A MP34 6.7 " " " 5/5 0/1 5/5 A/PCR-T MP35 " " " 4/5 0/1 A/PCR-T MP36 " " " 2/5 0/1 A/PCR-T rbcL- MP4 F1b: TCAACTAATCATAATCAGAATTTCAT R6: AATATCAAGTAAATGAATAAAAAAAAGG 465 0/6 0/1 PCR-T atpB MP6 6.8 " " " 5/5 0/1 5/5 A MP17 6.9 F1: GTTTGGCAAGCTGCTGTAAG R2: TTTGGAAAAAAAGAAAATAGATTC 447 4/4 0/1 4/4 A psbK- MP31 6.9 " " " 3/5 0/1 3/3 A psbI

Primers (5'-3') PCR Results Target Sample Control Clean Locus Series PTF Forward Reverse Size Obj. Amplification Amplification Electro. (bp) MP3 F1: TAACAGAGTGCGAGTGGTAGG R11: TCTATGTAAAGTAAATAGATTCTATCTAATTTTTTCTAT 925 0/6 0/1 PCR-T MP5 " " " 0/5 0/1 A MP7 " " " 0/4 0/1 A trnD- MP8 F9: ATTCGGTTTTTCTATATTATTATATTCTAA R10: GTAAATAGATTCTATCTAATTTTTTCT 125 0/5 0/1 A MP10 6.10 F1: TAACAGAGTGCGAGTGGTAGG R2: TTTTTTTATTGAAAGGTTGATTATC 181 4/4 0/1 4/4 A trnT MP18 6.10 F12: CAGGGAAACGAAATACAGCAT R8: TAGTGGTTCAGGACATCTCTCTTT 739 4/4 0/1 3/4 A MP19 6.10 " R13: CTCTACCACTGAGTTAAAAGGGC 1105 3/4 0/1 3/4 A MP20 6.10 F1: TAACAGAGTGCGAGTGGTAGG R8: TAGTGGTTCAGGACATCTCTCTTT 654 4/4 0/1 4/4 A MP32 6.10 " " " 4/5 0/1 4/4 A MP1 6.11 F1: AATTACCAAGATTCGAATTTHTAACATTTA R2: TATCAAGAGGGTTGGCATTGCTC 147 19/19 0/1 19/19 A MP2 6.11 F3: TGATAYAACAAGAAATTGGCG R4: CCATCTACAAATGGATAAGACTTTT 106 19/19 0/1 5/6 A trnH - MP12 F1: AATTACCAAGATTCGAATTTHTAACATTTA " 249 4/4 0/1 0/4 A psbA MP38 6.11 F5: CGCATGGTGGATTCACAAT R6: CGTAATGCTCATAATTTCCCTCTA 363 5/5 0/1 5/5 A A255 F1: AATTACCAAGATTCGAATTTHTAACATTTA R2: TATCAAGAGGGTTGGCATTGCTC 147 0/4 0/2 A256 6.11 " " 147 2/5 0/2 2 A F1: GCGGAAGGATCATTGTCG R2: ACCTGGGGTCGCAACG 146 ITS MP22 6.13 607 5/5 0/1 4/4 A MP26 6.13 " " " 4/4 0/1 4/4 A

(rDNA) MP33 6.13 " " " 3/5 0/1 3/3 A atpF- MP37 F1: ACTCGCACACACTCCCTTTCC R2: TACTTTATTGCTTAGTCTGGCTTTTATG 803 13/13 0/1 0/13 A atpH MP39 " " " 1/13 0/1 0/1 A Series: University of Calgary intra-facility PCR identification code. PTF: the figure number of the phylogenetic tree that reports the results from this series and locus. Sample Amplification: number of samples that UV Illuminated on a gel by number of samples tested. Control Amplification: number of controls (intended to be negative) that amplified by number of controls used per PCR series. Clean Electro. (Electropherogram): number of clean electropherograms (approximately ≥ 30 bp sequence from either the forward or reverse primer) by the number of samples submitted for sequencing. A value in parentheses indicates clear electropherograms for contamination test samples (which are intended to be negative). A failed DNA sequence read in this instance was either messy or blank, has many N’s, noisy peaks, or has a mid-sequence drop-off or stop. These can be caused by contamination, polymerase slippage, low quality prep, inhibitors, low DNA template concentration, heterozygosity, and secondary structures (Eurofins Genomics 2015). Obj. = Objective to date; A = Sample Amplification; CT = Contamination Testing; UVXX = UV irradiation for XX minutes.; PCR-T = testing PCR conditions.

All phylogenetic trees presented here were created using the Neighbor-Joining method

(Saitou and Nei 1987) with Salix interior NC_024681 as the reference sequence (Huang et al.

2014) unless otherwise stated. Position numbers are identified in relation to this sequence, with the comment ‘reverse-compliment’ referring to the reference sequence being a reverse- compliment, and the position number indicating 5’-3’ position of the reverse-complement reference sequence. Roots were placed on the lowermost clades on each tree, as indicated in the figure captions. The reference sequence is marked with a blue circle, aDNA extracts are marked with purple circles, and modern samples are marked with green circles. Contamination tests are marked by turquoise circles. GenBank specimens are labeled with their name and accession number. Samples amplified for this analysis are labeled with their name, recovery region (YI =

Yukon interior, AI = Alaska interior, AC = Alaska coast [Figure 5.1]), series (AXX = ancient extract; MPXX = modern plant), and the forward and reverse primer set used in PCR. The percentage of replicate trees in which the associate taxa clustered together in the bootstrap test

(2000 replicates) are show next to the branches (Flensenstein 1985); only bootstrap values greater than 50% are shown. Trees are drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Kimura 2-parameter method (Kimura 1980) and are in the units of the number of base substitutions per site. Evolutionary analyses were conducted in

MEGA6 (Tamura et al. 2013).

6.1 Contamination Testing

Contamination was detected in three of the first aDNA PCR amplifications (Series:

A083–84, A098). These include: green algae and moss contamination (Series: A083), a sample sequence corresponding to two different clades in two amplifications (Series: A084, A098), and

147

two negative control amplifications (Series: A083–84). This prompted a seven PCR amplifications (using primers designed for rbcL and trnL) to assess the state of cpDNA contamination in the aDNA facility—in addition to further human, canid, and equid contamination tests carried out by the author and other intra-laboratory researchers (not reported here). These experiments involved testing blanks and negatives from other DNA extractions, positive controls of cpDNA, and negative controls known to have mammalian mtDNA present— one negative control and one mammalian sample illuminated on an agarose gel. In order to investigate the origin of this contamination, half of the PCR premix was UV irradiated (30 minutes at 120 mJ/cm2) to test for reagent contamination—dNTPs were added after the UV cycle. It has been found that UV-irradiation is effective at removing PCR reagent contaminants

(except in cases of low concentration, short exogenous fragments [Champlot et al. 2010]). After adjusting the UV irradiation time from 30 min to 5 min through experimentation (because UV irradiation degraded the premix too severely at 30 min for the PCR reaction in Series: A109,

A111–113), the negative sample had its contamination successfully removed, while the other

(CD12 [Canidae], series A160) was found to still have Urtica dioica (stinging nettle) DNA present.

These contamination tests indicated three results. First, aDNA primers must be target- genera specific as universal cpDNA primers would be expected (and as shown here) to preferentially amplify background cpDNA (less degraded than the target sequences) that is difficult or perhaps impossible to remove in wood tissues. This necessity was identified following the amplification of green algae and moss (Section 6.2.1 and 6.2.2), and furthered with the identification of significantly divergent sequences from the same sample (Section 6.2.2).

These disparate sequences could be due to intra-laboratory human error or cross-contamination.

148

Second, cpDNA can be easily found in DNA extracts of non-plants as found in the

Canidae sample. Meaning, background cpDNA appears to be prevalent, even in samples subjected to comparatively harsh decontamination procedures (Canid decontamination: submerged for 10 min in 100% commercial bleach [5–7%] and UV-irradiated twice for 30 min).

Third, contaminant cpDNA may be present in common laboratory reagents, but can be mitigated through cautious UV-irradiation. This cpDNA contamination can be present in other laboratory samples (irrespective of tissue type), and may be present in distilled water used after bleach rinsing, or diluting solutions. Our human, dog, and horse contamination testing (Series:

A081–82, A142–143) found no evidence of animal mtDNA contamination, and none of the projects that myself or other researchers in the facility are currently undertaking have found any contamination in mammalian aDNA extracts or control amplifications.

6.2 Loci Investigated

6.2.1 rbcL (ribulose-bisphosphate carboxylase) large-chain gene (partial)

The rbcL gene was targeted in four amplifications (Series: A083, A097, MP11, A257) and three contamination tests (Series: A110, A111, A113 [Table 6.2]). Primers were designed for two non-overlapping loci (due to limitations in suitable conserved regions), which are divided in this section (into regions A and B) because of phylogenetic issues encountered in the software that could not be rectified (Figure 6.1 and Figure 6.2).

In Region A (Series: A083, Figure 6.1), all amplified products were identified as exogenous. These sequences were run through BLAST (megablast) and determined to be green algae and moss (e-value < 2e-57). The primers (F1/R2) were clearly not taxa-specific as these conserved regions appear to be deeply conserved in cpDNA, which more generally is why the

149

Figure 6.1 Phylogenetic tree of rbcL (partial): Region A (conifers and angiosperms).

This tree was created using a multiple alignment of the cpDNA rbcL gene (213 bp fragment, using primers rbcL F1/R2 [Table 6.2]). Salix interior (NC_024681) positions: 56798–57010. A root was placed on Chlorophyta (the outgroup). The analysis involved 55 nucleotide sequences, 6 of which were amplified by the author. All positions with less than 90% site coverage were eliminated, leaving 206 positions in the final dataset. Branch length = 0.78579789.

rbcL gene has been useful for DNA barcoding in plants. The contamination may have been

introduced prior to recovery, during storage, or anytime throughout the extraction, although it is

150

Figure 6.2 Phylogenetic tree of rbcL (partial): Region B (conifers and angiosperms).

This tree was created using a multiple alignment of the cpDNA rbcL gene (182 bp fragment, using primers rbcL F3/R4 [Table 6.2]). Salix interior (NC_024681) positions: 56987–57168. A root was placed on Chlorophyta (the outgroup). The analysis involved 53 nucleotide sequences, four of which were amplified by the author. All positions with less than 90% site coverage were eliminated, leaving 182 positions in the final dataset. Branch length = 0.58624307. likely that the contaminants were simply not fully removed during decontamination (which explains the presence of moss DNA).

In Region B (Figure 6.2), only two samples initially amplified (Series: A097) with low amplification and sequencing success in subsequence reactions (Series: MP11, A257). Green algae contamination was observed in a repeat amplification of IP2 using the second preparation

(a more thorough decontamination procedure [Section 5.4.1.2]) and DNeasy Plant Mini

151

Extraction Kit. None of the controls amplified. The primer sets are again clearly not sufficiently taxa-specific as indicated by the amplification of exogenous green algae DNA.

In terms of phylogeographic potential, rbcL Region A (primers F1/R2) (Figure 6.1) appears to discriminate among genera moderately effectively (with bootstrap support for major clades being > 60–70%) with an overall poor species-level identification. Notably for this study,

Salix is poorly sorted, although the genus is divided into two clades (bootstrap value >50%). The primers used to amplify this region are too non-specific, with even modern samples returning messy electropherograms (potentially caused by background amplification of algae or other non- target organisms). Region B (Figure 6.2) produces a similar phylogenetic tree to Region A, with marginally more taxa-specific primers as only a single sample amplified with green algae contamination. The locus discriminates within Salix more effectively than Region A, although the low-to-moderate support in bootstrap values (51–76%) has limited potential. Primers F1 and

R4 were designed to function together to amplify both regions in modern samples. The ineffectiveness of the sequencing reaction using these primers is believed to be due to primer F1 being too non-specific. Gymnosperm and Angiosperm specific primer sets appear to be necessary for this locus.

6.2.2 trnL (transfer RNA-Leu) gene (partial)

The trnL gene (Figure 6.3) was targeted in four sample amplifications (Series: A084,

A098, MP9, A254) and five tests of contamination (Series: A108–109, A112, A160–161). Only one ~200 bp region was targeted using primers F1/R2 (Table 6.2). Three forms of contamination were observed. First, in Series A084 a negative and blank amplified with privet (Oleaceae) DNA

(a European semi-evergreen shrub), likely a contemporary contaminant of unknown origin.

Second, one sample (IP9) produced both Salicaceae (n = 2 [preparation 1 and 2 (Section 5.4.1.1),

152

Figure 6.3 Phylogenetic tree of trnL (partial): Conifers and angiosperms.

This tree was created using a multiple alignment of the cpDNA trnL gene (197 bp fragment, using primers trnL F1/R2 [Table 6.2]). Salix interior (NC_024681) positions: 46278–46473. A root was placed on Pteridophyte (ferns, the outgroup). The analysis involved 62 nucleotide sequences, 15 of which were amplified by the author. All positions with less than 90% site coverage were eliminated, leaving 142 positions in the final dataset. Branch length = 1.01070504.

Series: A084, A254]) and Picea sp. (n = 1 [preparation 1, Series: A098]) sequences, indicating that at least one of the sequences is contamination (likely the Picea sp. sequence from preparation 1). Finally, the Canidae sample (CD12) discussed in Section 6.1 (Contamination

Testing) was also identified using the trnL primer set. While the Oleaceae and Canidaea sequences can be excluded, it remains unclear to what extent the IP9 sample and other

153

angiosperm samples (IP10, IP4, and IP7), are contaminated. Cloning and quantitation (Cooper and Poinar 2000) may be viable means of quantifying the ratio of endogenous to exogenous

DNA in these samples. The contaminants could feasibly be pre-laboratory, cross-contamination, or intra-laboratory.

The gene classifies poorly beyond the genus level. It was also unable to differentiate

Oleaceae (aserid) from the Rosids, possibly due to long-branch attraction (convergent evolution).

The locus shows no indication of being useful in barcoding or phylogeographically discriminating within Salix. Although the primers are not specific enough to avoid contaminant background cpDNA in aDNA application, they performed well with modern samples.

6.2.3 rpoC1 (RNA polymerase C1) gene

The gene rpoC1 was amplified twice (Series: MP24, MP25) targeting one ~460 bp region using only modern Salix samples in order to assess the locus’ utility in identifying regional haplotypes (Figure 6.4). All samples amplified (except for one messy electropherograms) and no contamination was detected. Only a single polymorphism was observed (Series: MS56)—none of the modern samples could be differentiated genetically. The locus discriminates well between

Salix and Populus, with even some inter-species structuring. However, the locus is largely conserved within Salix, particularly within my Northwestern Subarctic sample set.

154

Figure 6.4 Phylogenetic tree of rpoC1: Salicaceae.

This tree was created using a multiple alignment of the cpDNA rpoC1 gene (458 bp fragment, using primers rpoC1 F1/R2 [Table 6.2]). Salix interior (NC_024681) reverse- compliment positions: 136191–136648. A root was placed on Populus (the outgroup). The analysis involved 30 nucleotide sequences, 8 of which were amplified by the author. All positions with less than 95% site coverage were eliminated, leaving 386 positions in the final dataset. Branch length = 0.02734666.

155

6.2.4 rpl16 (ribosomal protein L16) gene

The rpl16 gene (Figure 6.5) was amplified three times (Series: MP23, MP27, MP28) targeting one ~400 bp region using only modern Salix to assess the locus’ utility in identifying regional haplotypes. All but four samples (n = 17) amplified and no contamination was detected.

Figure 6.5 Phylogenetic tree of rpl16: Salicaceae.

This tree was created using a multiple alignment of the cpDNA rpl16 gene (401 bp fragment, using primers rpl16 F1/R2 [Table 6.2]). Salix interior (NC_024681) reverse- compliment positions: 72733–73123. A root was placed on Populus (the outgroup). The analysis involved 37 nucleotide sequences, 17 of which were amplified by the author. All ambiguous positions were removed for each sequence pair, leaving 401 positions in the final data set. Branch length = 0.32004297.

156

Two SNPs (single nucleotide polymorphisms) and a variable STR (short tandem repeat) were observed, while a significant number of indels (deletion or insertion mutations) were observed between the GenBank sequences and those derived from this analysis. These indels explain the well supported divergence (bootstrap value = 100) between samples collected for this study, and those available on GenBank (Figure 6.5). Despite the locus having multiple SNPs and polymorphic regions (Figure 6.6), it appears to poorly sort species within Salix (given this dataset). The polymorphisms observed in this locus may make it viable at geographically differentiating populations of Salix in the Northwestern Subarctic.

157

Figure 6.6 Multiple alignment of rpl16 (partial, cpDNA): Salicaceae.

The dataset is aligned with Salix interior (NC_024681), reverse-compliment positions: 72821– 73077. Samples amplified in this analysis are outlined in green (Yukon interior), red (Alaskan interior), blue (Alaskan coast A), and yellow (Alaskan coast B). The SNPs (72846, 73059) and STR (73003–73020) regions unique to the Yukon interior samples are highlighted in yellow. Populus is used as the outgroup. A = Adenine; C = Cytosine; T = Thymine; G = Guanine Coloured dots = An identical nucleotide to the aligned reference sequence (uppermost sequence) Dash = Indel; ? = Missing data

158

6.2.5 matK (maturase K) gene

The matK gene was used in ten amplifications (Series: MP13–16, MP21, MP29–30, and

MP34–36) to generate sequence data and to test appropriate PCR conditions for the long overlapping primer sets (Figure 6.7). Series MP14–17 were run through PCR again because of initial non-amplification with an annealing temperature increase from 52°C to 57°C, and an

Figure 6.7 Phylogenetic tree of matK: Salicaceae.

This tree was created using a multiple alignment of the cpDNA matK gene (1382 bp fragment, using overlapping primers matK F1/R2, F3/R6, and F5/R6 [Table 6.2]). Salix interior (NC_024681) reverse-compliment positions: 153262–154645. A root was placed on Populus (the outgroup). The analysis involved 44 nucleotide sequences, 11 of which were amplified by the author. All ambiguous positions were removed for each sequence pair, leaving 1382 positions in the final dataset. Branch length = 0.05117894.

159

increase in extension time from 50 sec to 180 sec. This resulted in far better amplification success in Series MP21 using primers F3/R6. A longer extension and more appropriate annealing temperature (primer Tm − 5°C) were used in subsequent PCRs with long (>500 bp) targets.

Phylogenetically, matK has a number of polymorphic loci that appear useful in identifying haplotypes on a larger geographic scale within Salix. Unfortunately for my analysis, there were no polymorphic regions observed between coastal and interior Salix. Certain regions were messy and unreadable consistently for some samples across the PCR amplifications, although it is unclear whether this is significant as these regions are highly polymorphic. Given the size of the locus (~1300 BP) and the lack of phylogeographically useful polymorphic loci, matK does not appear to be useful for an analysis of regional cpDNA structuring in my study area.

6.2.6 rbcL-atpB (ATP Synthase, beta chain subunit) intergenic spacer

The rbcL-atpB intergenic spacer was targeted in two PCR amplifications (Series: MP4,

MP6), the first of which was an experiment for optimal PCR conditions that failed, followed by a successful amplification of all samples for the target sequence (~550 bp) (Figure 6.8). Only one region was targeted using primers F1b/R6 (primers are numbered consecutively based on initial primer design targeting regions approximately 100–200 bp for a presumed utility for aDNA).

Although polymorphic regions were observed that divided Salix into two primary clades, as has been found with most other targeted loci, no polymorphisms were observed in modern samples collected from the interior and the coast across the 573 bp spacer.

160

Figure 6.8 Phylogenetic tree of rbcL-atpB: Salicaceae

This tree was created using a multiple alignment of the cpDNA rbcL-atpB intergenic spacer (573 bp fragment, using primers F1b/R6, see Table 6.2). Salix interior (NC_024681) reverse- compliment positions: 99979–100551. A root was placed on Populus (the outgroup). The analysis involved 29 nucleotide sequences, 5 of which were amplified by the author. All ambiguous positions were removed for each sequence pair, leaving 573 positions in the final dataset. Branch length = 0.07524455.

161

6.2.7 psbK-psbL (photosystem II reaction center K and L) intergenic spacer

The psbK-psbI intergenic spacer was targeted in two PCR amplifications (Series: MP17,

MP31) using primers F1/R2 to target a ~450 bp sequence (Figure 6.9). All samples amplified and no contamination was detected. The region appears to identify species competently within

Salix, given the small data set utilized, but was unable to find any polymorphic regions in the

Alaskan versus Yukon samples despite all four sharing unique indels. These include 16 SNPs, one microsatellite, and an 8 bp deletion for all samples amplified in this analysis. The phylogenetic sample set is small because there are few Salix psbK-psbI sequences available currently on GenBank. Further analysis into this locus for Salix barcoding may be useful.

Figure 6.9 Phylogenetic tree of psbK-psbL: Salicaceae.

This tree was created using a multiple alignment of the cpDNA psbK-psbL intergenic spacer (465 bp fragment, using primers psbK-I F1/R2 [Table 6.2]). Salix interior (NC_024681) positions: 5836–6300. A root was placed on Populus (the outgroup). The analysis involved 17 nucleotide sequences, 7 of which were amplified by the author. All ambiguous positions were removed for each sequence pair, leaving 456 positions in the final dataset. Branch length = 0.11685268.

162

6.2.8 trnD-trnT (transfer RNA-Tyr/Glu) intergenic spacer

The trnD-trnT intergenic spacer was used in nine PCR amplifications (Series: MP3, MP5,

MP7-8, MP10, MP18–20, MP32) (Figure 6.10). The first four amplifications failed because of

Figure 6.10 Phylogenetic tree of trnD-trnT: Salicaceae.

This tree was created using a multiple alignment of the cpDNA trnD-trnT intergenic spacer (680 bp fragment, using primers trnD-trnT F1/R2, F1/R8, F12/R8, and F12/R13 [Table 6.2]). Salix interior (NC_024681) positions: 29616–30295. A root was placed on Populus (the outgroup). The analysis involved 50 nucleotide sequences, 8 of which were amplified by the author. All positions with less than 80% site coverage were eliminated, leaving 564 positions in the final dataset. Branch length = 0.10952936.

163

problems amplifying sequences around primers F9–R11. Even in Series MP19 where a large fragment was amplified using primers F12/R13 (covering almost the entire locus), no products past primer R8 could be read on the electropherogram. These sequences were messy toward primer R13, but had a clean consensus with the other amplifications up until R8. This may be because the target sequence was too long, resulting in secondary structures during PCR, non- specific amplification of a portion of the locus, or hypervariable polymorphisms in the region.

There are many indels throughout the spacer, some of which are unique to the samples amplified for this study. However, none of these are useful in regionally differentiating any of the samples, as illustrated by the lack of spatially structured clades. The spacer also does not appear to be useful in DNA barcoding within Salix, given the sample set utilized.

6.2.9 trnH-psbA (transfer RNA-His, photosystem II reaction center A) intergenic spacer

The trnH-psbA intergenic spacer was the first region tested in my analysis for its phylogeographic potential within Salix. It was incorrectly presumed that it would be easy to find polymorphic loci capable of differentiating regional haplotypes in the study area; this is why 19 samples were sequenced initially for this locus. The region was targeted first because of the variety of clades identified when analyzing strictly GenBank sequences, as well as its small size that would be amenable for the aDNA counterpart to the modern amplifications.

Six PCR amplifications targeted this locus (Series: MP1–2, MP12, MP38, A255, A256)

(Figure 6.11). The first PCR run used a relatively large sample set (n = 19); after the overall lack of polymorphisms were discovered, all future amplifications used a maximum of 4–6 samples to save on sequencing costs. Initially, only the region amplified by primers F1/R2 was successful;

Series MP2 (F3/R4) and MP12 (F1/R4) sequences were messy (but partly salvageable). It is unclear why these primer sets were unsuccessful, as a larger primer set was subsequently

164

designed to amplify the entire locus (F5/R6 [Series: MP38]), which determined that there were no polymorphisms in the regions targeted by primers F3/R4 that would explain the messy

(seemingly contaminated) electropherograms.

Figure 6.11 Phylogenetic tree of trnH-psbA: Salicaceae.

This tree was created using a multiple alignment of the cpDNA trnH-psbA intergenic spacer (269 bp fragment, using primers F1/R2, F3/R4, F1/R4, and F5/R6 [Table 6.2]). Salix interior (NC_024681) positions: 97–365. A root was placed on Populus (the outgroup). The analysis involved 47 nucleotide sequences, 26 of which were amplified by the author. All ambiguous positions were removed for each sequence pair, leaving 269 positions in the final dataset. Branch length = 0.10100840.

165

Two SNPs were observed that distinguish between AI/ACb (Alaskan Interior and Kenai

Peninsula) and YI/ACa (Yukon Interior and Yakutat) samples given the relatively small dataset

(Figure 6.12 [see also Figure 5.1]). No other polymorphisms were identified. Two archaeological

samples were tested with primer set F1/R2, and were determined to have identical sequences to

the other YI/ACa modern specimens. Although the region shows some evidence of

phylogeographic structuring, the phylogenetic tree within Salix has low support (bootstrap values

<50%). Five attempts were made to amplify sample K12 (the Kluane Stick) with varied PCR

Figure 6.12 Multiple alignment of trnH-psbA (partial, cpDNA): Salicaceae.

The dataset is aligned with Salix interior (NC_024681), positions: 97 to 232. Samples amplified in this analysis begin with MS (modern Salix) or IP (ice patch [archaeological specimen]), with Alaskan interior samples that have a polymorphism at position 112 being outlined in blue. Populus is used as the outgroup. A = Adenine; C = Cytosine; T = Thymine; G = Guanine. Coloured dots = An identical nucleotide to the aligned reference sequence (uppermost sequence) Dash = Indel; ? = Missing data.

166

conditions and elution concentrations—none of these were successful. If they had been, this locus (combined with rpl16 and ITS [rDNA]) may have been ideal for assessing the phylogeography of the Kluane stick. The data suggests that samples IP9 and IP10 have polymorphisms consistent with the Yukon Interior.

6.2.10 ITS (internal transcribed spacer) rDNA (ribosomal DNA)

The final locus investigated where DNA could be amplified is the internal transcribed spacer (ITS), which includes a partial sequence of 18S ribosomal RNA, ITS1, 5.8S ribosomal

RNA, ITS2, and a partial sequence of 28S ribosomal RNA gene (Figure 6.13). This locus of nDNA codes for rRNA, unlike all of the other sequences presented thus far which have been cpDNA. Three PCR amplifications were carried out on this locus (Series: MP22, MP26, MP33), targeting a ~550 bp region using primers F1/R2. Despite the locus’ utility for barcoding in fungi and some plants, there appears to be little species level discrimination within Salix in this dataset

(Figure 6.13), although notably S. alaxensis and S. alba could be species identified (bootstrap value 52–92%). There are numerous polymorphic regions within this locus that may be useful for phylogeographic questions.

Secondary structures were an issue with the primer set, as three samples only amplified around the forward and reverse primers, but cut out the central target region. These samples could not be used in the phylogenetic tree (Figure 6.13), but are visible in the multiple alignment

(Figure 6.14). The SNP at position 45 in this alignment (Figure 6.14) is suggestive of regional structuring, although most of the samples had no amplification in this position. This region would likely be difficult to amplify in ancient samples due to the low copy number of nDNA, especially in wood.

167

Figure 6.13 Phylogenetic tree of ITS (rDNA), Region a: Salicaceae.

This tree was created using a multiple alignment of ITS rDNA (565 bp fragment, using primers F1/R2 [Table 6.2]). Salix interior (EU784079) was used as the aligning sequence; there is no GenBank reference sequence for ITS rDNA in Salix. A root was placed on Populus (the outgroup). The analysis involved 37 nucleotide sequences, 7 of which were amplified by the author All ambiguous positions were removed for each sequence pair, leaving 565 positions in the final dataset. Branch length = 0.11173235. Three samples were removed (MS56, MS136, MS145) because of small amplifications that inhibited phylogenetic analysis.

168

Figure 6.14 Multiple alignment of ITS1 (partial, rDNA): Salicaceae.

The dataset is aligned with Salix interior (EU784079 [see Figure 6.13]). Samples amplified in this analysis begin with MS (modern Salix) with Alaskan coast (region a) samples that have a SNP at position 45 being outlined in blue. Populus is used as the outgroup. A = Adenine; C = Cytosine; T = Thymine; G = Guanine. Coloured dots = An identical nucleotide to the aligned reference sequence (uppermost sequence) Dash = Indel; ? = Missing data.

6.2.11 atpF-atpH (ATP synthase subunit F-delta chain)

This locus was targeted in two PCR amplifications. In the first (Series: MP37), all samples amplified with positive gel illuminations (Figure 6.15). However, the electropherograms were consistently messy with the appearance of two overlapping sequences. The primer pair had a perfect ratings (100) in NetPrimer without the potential for secondary structures. The messy electropherograms would appear to be due to non-specific amplification as the primer set appears

(on BLAST) to work with most angiosperms (it may also be related to allelic variability). This was an unexpected complication with modern samples given the presumed quality and quantity of endogenous DNA in the specimens for amplification. In an attempt to mitigate this issue,

169

modified PCR conditions were tested (a shorter extension time [Series: MP39]). These modifications resulted in an inhibited reaction and limited transillumination. Further testing was not undertaken for this locus due to the concurrent discovery that the Kluane specimen (K12, see

Section 6.4) could not be amplified, the primary objective of the study.

Figure 6.15 Transilluminated agarose gel and electerogram, atpF-atpH spacer (cpDNA, Salix).

170

6.3 aDNA Species Identification

The poor amplification success and non-specific amplification of the aDNA samples has limited the taxonomic classification of the sample-set. The only unambiguous identification that can be made with some confidence is IP10, which amplified as Salicaceae three times, and once specifically as Salix (Table 6.3). IP1a amplified twice as Pinus without contaminants. IP2 amplified twice as conifer (related to Abies and as Pinus) but also had two green algae amplifications, leaving its taxonomy ambiguous. IP4 amplified only once with a sequence closely related to Linum (flax)—a contaminant given the morphology of IP4 (Appendix IV). All other samples either did not amplify (due to a lack of DNA or inhibition) or only amplified with exogenous DNA. The exogenous DNA could not be removed in the second preparation (a more

Table 6.3 Taxonomic identifications of archaeological samples by locus. Locus ID rbcL-A rbcL-B trnL trnH-psbA IP1a Pinus (DP-2, 2P) Pinus (DP-2, 2P) IP1b green algae (DP-1, 1P) Abies (DP-1, 1P) IP2 green algae (DP-1, 1P) Pinus (ME-1, 2P) green algae (DP-2, 2P) IP3 no amplification IP4 Linum (DP-1, 1P) IP5 no amplification IP6 no amplification Dryas (DP-1, 1P) IP7 green algae (DP-1, 1P) Euphorbiaceae (ME-1, 1/2P) IP8 green algae (DP-1, 1P) Picea (DP-1, 1P) IP9 Salix (DP-2, 2P) Salicaceae (x2) (DP-1, 1P) (DP-2, 2P) Salicaceae (x3) IP10 green algae (DP-1, 1P) Salix (DP-2, 1P) (DP-1, 1P) (DP-1, 1P) (ME-1, 1P) IP11 green algae (DP-1, 1P) K12 no amplification DP = DNeasy Plant Mini Kit Protocol (Section 5.5.1.1) ME = MinElute PCR Purification Kit Protocol (Section 5.5.1.2) DP/ME-(1/2) = First or second extraction with this protocol 1P, 2P, 1/2P = First preparation, second preparation, a mix of both preparations (Sections 5.4.1.1–5.4.1.2) 171

thorough decontamination procedure), which is confirmed by the amplification of green algae

DNA in sample IP2 (Series: A256 [Figure 6.2]).

6.4 Kluane Willow Stick (K12)

DNA extracts from the willow stick (Holdsworth and Lacourse 2015) recovered from

Kluane National Park could not be amplified. The sample was tested eight times with PCR modifications targeting rbcL, trnL, and trnH-psbA (Series MP254–256 [Figure 6.16]). The presence of primer dimers in two amplifications (Series: A254 [trnL], A256 [trnH-psbA] [Figure

6.16]) strongly suggests that the non-amplification is due a lack of DNA rather than inhibition, as inhibitors would also impact the formation of secondary structures. While the decontamination procedure may have removed some aDNA from the specimen, other samples that underwent the same decontamination procedure still amplified, with at least two producing tentatively supported taxonomic continuity among tested loci. The sample (referred to as K12 in the laboratory) received from Parks Canada of the Kluane Stick was a partially removed end piece fragment from the main shaft. The sample was frayed and clearly degraded. It is possible that a sample removed from a more robust portion of the shaft might harbour viable DNA. This was not the case with sample IP5 however, where a sample was removed from the bulk of the shaft yet produced no amplifications. Furthermore, the legal circumstances surrounding the specimen precluded a more destructive sampling strategy—a factor that significantly impacted the progression of the analysis with the target specimen being tested last (when the intent had been to analyze it first in order to justify continuing with the project).

The presence of wooden biofacts in alpine archaeological contexts, as well as the implications of this analysis for future ancient DNA studies from wooden artifacts and biofacts

(specifically from cryogenic deposition settings) will be discussed in the Chapter Seven.

172

Figure 6.16 Transilluminated agarose gels: Kluane Stick (K-12)

DP = DNeasy Plant Mini Kit; ME = MinElute PCR Purification Kit; 1E = 1st elution; 2E = 2nd elution. Series 254-I: PCR (Den: 95°C, 30 sec; Ann 55°C, 30 sec; Ext 72°C 45 sec; 50 cycles), Taq (2.5x), DNA 3.5 ul. Series 254-II: PCR (Den: 95°C, 30 sec; Ann 55°C, 30 sec; Ext 72°C 45 sec; 50 cycles), Taq (2.5x), DNA 3 ul. Series 255: PCR (Den: 95°C, 30 sec; Ann 57°C, 30 sec; Ext 72°C 45 sec; 50 cycles), Taq (2.5x), DNA 4 ul. Series 256-I: PCR (Den: 95°C, 30 sec; Ann 52°C, 30 sec; Ext 72°C 45 sec; 50 cycles), Taq (2x), DNA 3 ul. Series 256-II: PCR (Den: 95°C, 30 sec; Ann 57°C, 30 sec; Ext 72°C 45 sec; 50 cycles), Taq (2x), DNA 3 ul.

173

Chapter Seven: Discussion

The primary objective of this study was to investigate the antiquity of alpine glacial movement between Athapaskans on the Yukon Plateau, and Northwest Coast peoples in the vicinity of Mount Saint Elias. Genetics was used to assess the contemporary distribution of Salix in the area to direct an aDNA analysis of a Salix specimen (the Kluane Stick [K12]) recovered near Mount Logan, Kluane National Park, Canada. Ultimately, the project was unsuccessful in making a direct archaeological contribution to the record of the Northwestern Subarctic due to a lack of viable DNA in the target specimen. The discovery of extensive cpDNA contaminants, the complications of wood tissue for paleogenetics, and the unexpected lack of genetic variability between seemingly isolated modern populations of Salix further contributed to this lack of success. Despite these issues, the analysis makes two primary contributions. First, it confirms recent work that found large-scale genetic homogeneity within Salix (Percy et al. 2014), but also pinpoints three regions that may be viable markers of regional variability in this instance (with the implication that sufficiently variable loci are regionally contextual). This latter point elucidates the success of Brunsfeld et al. (2001, 2007) and implies that despite overall genus- wide genetic continuity, there is some evidence of regional inter-species spatial structuring in

Salix—suggesting that plants may yet be viable biomarkers for archaeological questions of mobility if authenticated aDNA can be obtained from the target tissue. Second, it critically evaluates the viability of paleogenetics for small wooden artifacts and biofacts recovered from a cryogenic setting using two extraction methods and two decontamination procedures. It also adds to foundational research on the tissue, facilitating future aDNA research on cryogenic wood by identifying viable and problematic aspects of the methodology. Work to date with degraded

DNA from wood has targeted logs or similarly large materials where comparatively minuscule

174

destructive analysis is of lesser concern relative to small, fragile, and culturally sensitive ice patch biofacts. Ancient DNA is viable method for researching cryogenic biofacts and artifacts, with this thesis research serving to help structure future investigations by clarifying challenging and promising avenues of study.

This final chapter is divided into three sections. First, the archaeological implications of the willow biofact from Kluane National Park will be discussed. Second, the genetic analysis conducted on modern Salix will be contextualized to evaluate the discrepancy of work to date on the genus. Third, the authenticity of the ice patch amplifications will be evaluated with a discussion of the viability of wood as a target tissue for aDNA analysis. The chapter concludes by placing this work into the contemporary context of aDNA research.

7.1 Archaeological Implications of the Willow Biofact from Kluane National Park

As it was not possible to extract aDNA from the target specimen, this analysis cannot add novel analytic insight to the antiquity of mobility between the Alaskan Coast and Yukon Interior.

This section will instead comment on the implications of the specimen for an inter-regional culture-historical framework based on its recovery location and associated radiometric date.

Holdsworth and Lacourse (2015) submit that the curvature and length of the Kluane Stick implies that it was part of a bundle for use as a ‘mattress’, a trail marker, or firewood (a practise described by de Laguna [1972:231–232)]). The biofact feasibly may have also been used for glacial travel as a walking stick for crevasse detection and safety (Section 2.3.2). Holdsworth and

Lacourse (2015) go on to suggest that a route stemming from the upper Chitina River Valley provides the most likely origin of the materials, potentially signifying an expedition route to the coast (Yakutat) that was shorter than the well documented Copper River route (e.g., Emmons

1991:175–182). They note that an origin around the Kaskawulsh Glacier (just south of Kluane

175

Lake) is possible, but arguably unlikely as less perilous routes to the coast are available to the southeast along the Alsek River. This possibility should not necessarily be eliminated however, as the recovery of a bear hide from the Kaskawulsh drainage (1110 ± 50 cal-BP [Cruikshank

2005:245, 286]) is indicative of glacier travel from this northern origin point, contemporaneous with the eastern lobe of the White River Eruptions (Section 2.1.1.2.2). Finally, Holdsworth and

Lacourse (2015) argue that a coastal origin is most unlikely given the formidable topography

(elevation gain) moving from the coast towards Mount Logan. If the route was well established

(potentially signifying a deep antiquity) with the specimen recovered by Holdsworth being a blaze of sorts (akin to Glave’s descriptions of ubiquitous trail markers [Cruikshank 2005:186; see Section 2.3]), it is reasonable to postulate that two-way travel was possible at the time despite the perceived insurmountable nature of the range. The authors (Holdsworth and Lacourse 2015) note that an isotopic assessment is underway using δ15N and δ34S to assess the geographic origin of the biofact, which may be more successful than this aDNA study if regionally disjunct isoscapes with correlated values in the target specimen can be identified.

The recovery of the Kluane specimen itself is indicative of a long-term use of glaciers as

‘highway’ travel routes in accordance with oral- and ethnohistoric data (Cruikshank 2005), and further may be suggestive of contact between interior and coastal peoples, far beyond the current archaeological dataset. A confirmation of the specimen’s origin, particularly from the coast, would have strengthened this inference. Had legal circumstances (that inverted the timeline of objectives) not been encountered, perhaps the other two associated biofacts could have been sampled with a more viable portion of the primary specimen, increasing the probability of a successful aDNA extraction. Despite this limitation, the deeper timescale for glacial travel routes is relevant to the record of both areas. The 2430 ± 20 14C BP date, or 2366–2684 cal-BP (calib

176

7.0.4, intcal13.14c [Stuiver and Reimer 1993]), may extend glacier travel (and potentially coast- interior relations in a comparatively less pronounced form than later periods) to the Middle

Pacific (1800 BCE to 200–500 CE [Ames 2003:26–30]) or Middle Period (ca. 5000–1000 14C

BP [Moss 2004]) on the Northwest Coast (Section 2.1.2.2.1) and the Middle Taye Lake Phase

(Hare 1995) or Early-Late Taiga Period (Northern Archaic Tradition [Holmes 2008]) in Southern

Yukon (Section 2.1.1.2.1). Both regions show evidence of substantial developments at the time with a horizon of notched projectile points and a decline in burins and microliths in the interior

(Sections 2.1.1.2.1–2.1.1.2.2), and an intensification of sedentism and practices associated with a developed (or developing) Northwest Coast Pattern (e.g. Matson and Coupland 1995) on the

Alaskan Panhandle (Sections 2.1.2.2.1–2.1.2.2.2). The date also correlates with a marked drop in artifact density from 2800–2300 14C BP where there is little or no evidence of hunting activity at alpine Yukon ice patch sites (Hare et al. 2012:128–132). Although the correlation may be insignificant, temporal changes in land use patterns during the Holocene (Hare et al. 2012:132), a result also noted by Potter (2008) in Central Alaska, could feasibly have a cultural component related to broadening trade or influence spheres (in addition to climate or animal distribution changes). An earlier onset of contact between coastal-interior cultural entities may also serve to explain the seemingly-rapid shift from atlatl to bow-and-arrow technology ca. 1200 14C BP from ancient and well-established inter-regional relations that precipitated both subtle and rapid technological exchange. The limited archaeological record of the Northwestern Subarctic

(Section 2.1.1), in conjunction with the environmentally impacted (from inundation and repeated glacial advances/retreats [e.g., de Laguna 1972:24-29]) Northern Northwest Coast around

Yakutat (with comparatively little archaeological research to date), severely constrains the visibility of inter-regional or inter-cultural influence prior to the White River Eruptions (ca. 1147

177

cal-BP, see Section 2.1.1.2.2 [Clague et al. 1995:1172]). With additional research, it is possible that evidence will be recovered that further substantiates the antiquity of coastal-interior interactions featured prominently in oral-narratives on the Northern Northwest Coast (Emmons

1991; de Laguna 1972; de Laguna and McClellan 1981) and Southern Yukon Interior

(Cruikshank 2005; McClellan 1975).

The other ice patch sticks provide little archaeological insight, particularly since those with amplifiable DNA were recovered by other researchers over multiple years from sites without clear archaeological associations. This may suggest that the presence of these materials

(likely the small twigs) at some ice patches are not directly related to human activities. The specimens served primarily as a test of the methodology with wood in this study; none of these materials have been radiometrically dated, although these biofacts continue to be recovered from alpine ice patches. Recently for example, a long pole with minimal modifications (a battered and cut proximal end, likely spruce or fir) was recovered from a Southern Yukon Ice Patch northeast of Whitehorse, which has been dated to 5754 ± 34 14C BP (UOC-0204 [Gregory Hare, personal communication May 28, 2015]).

7.2 Phylogeography of Salix in Yukon and Alaska

In the initial analysis design it was decided to forego morphological taxonomic identification of Salix specimens, with the intent of using DNA barcoding (Section 4.4.1) to mitigate the challenge inherit in classifying the notorious genus (Section 4.5). It was further hypothesized (based on the literature) that hybridization of the genus would create genetically disparate regional haplotypes while crosscutting species, hence reducing the necessity of taxonomic specificity in this archaeologically focused instance. The viability of population discrimination was based largely on the success of Brunsfeld et al. (1992, 2007) who identified

178

intraspecific, regionally distinct races of Salix melanopsis found in mesic forests (isolated first by the Cascadian Orogeny [2–5 mya] and more recently during the Last Glacial Maximum [26.5–19 kya]) currently distributed in the Cascades or Northern Rocky Mountains (Section 4.5.1). An expansion of the work using next-generation sequencing (Carstens et al. 2013) found evidence of complex refugia and recolonization dynamics, but maintained the partition between coastal and interior S. melanopsis.

This pattern is not mirrored in the literature. There now exists considerable evidence of extensive conservation within the plastid genome of Salicaceae (Wu 2015), particularly in Salix

(see Section 4.5.1; also Abdollahzadeh et al. 2011; Palmé et al. 2003; Percy et al. 2014; Twyford

2014), whereas sufficient variability is found in other plant taxa to allow for plastid barcoding

(e.g., Fazekas et al. 2008). Overall, the data derived from this analysis echoes Percy et al. (2014).

Among 11 amplified loci for modern Salix there was marked conservation, precluding taxonomic classification (albeit with an admittedly small sample set [n < 30]). The genetic indistinguishability among samples was unexpected given the presumed inhibition to gene flow from extensive alpine and icefield ranges, in addition to straight line distances between sampling zones (ACa, ACb, YIa, YIb, YIc, AI [Figure 5.1]) exceeding 180 km (ACa to YI), and reaching

800 km (ACb to YI). These results are congruent with those of Palmé et al. (2003) and Percy et al. (2014), and conform to the explanations advanced by Percy et al. of repeated plastid capture events, widespread hybridization, long-range seed dispersal, and trans-species selective sweeps within Salix. Fundamental differences between the biology of animals and plants has resulted in an incongruence in the efficacy of barcoding amongst eukaryotic kingdoms (Twyford 2014).

Salix exists as an exceptionally challenging case, highlighting the methodological issues inherent

179

in universal loci for barcoding in plants, but importantly these complications have illuminated evolutionary mechanisms that have shaped the genus (Percy et al. 2014:4748).

There are however some preliminary indications of regional structuring in rpl16, ITS

(rDNA), and trnH-psbA at a restricted set of variable loci that may serve to bridge the discontinuity between the work of Brunsfeld et al. (1992, 2007) and Percy et al. (2014). Four

SNPs and one STR were identified in this analysis (with the preponderance of sequence data being entirely indistinguishable). Had the target specimen from Kluane successfully amplified, these regions would have been targeted to assess the sample’s spatial origin. Irrespective of this failure, the data suggest that the initial hypothesis of inter-species hybridization creating regionally based variability is valid. The more pronounced regional disparity observed by

Brunsfeld et al. (1992, 2007) is explained by a deep temporal divergence. Although the samples in this studies’ dataset are spatially separated by hundreds of kilometers and large physical boundaries, temporally they would have diverged only recently (ca. 20,000–11,000 BP) to colonize the region beneath the Cordilleran Ice Sheet following deglaciation. The samples tested by Brunsfeld et al. (1992, 2007) were only partially impacted during the Last Glacial Maximum

(given their latitude) as they were situated mostly beyond the southern limit of glaciation, their was long term isolation of ancestral populations in glacial refugia, and their willow samples were descendants of a deeper temporal divergence (the Cascadian Orogeny). Furthermore, the Alaskan

Panhandle, Copper Plateau, and Yukon Plateau retain river valley connections. It is possible that given the documented 15 km seed dispersal range of S. cinerea (Section 4.5), and the ability for

S. nigra to spread up to 100 km in 30 years in a region without established Salix populations

(Cremer 2003:19), willows were able to rapidly colonize Alaska and the Yukon from ancestral populations that may have already had relatively little genetic variability. The genus has

180

maintained an overall lack of variation due to hybridization across the Pacific Coast Mountains through long-range seed dispersal along interconnected river valleys. The presence of variable genetics regions with preliminary evidence of regional structuring can be explained by a constraint on gene flow, rather than an absence of it. Strong selective pressures also help to explain the identical sequences obtained from samples on the Kenai Peninsula and Yukon

Plateau.

Phylogeography in Salix is challenging, but feasible. Genomic analysis is likely the only viable means of effectively identifying polymorphic loci (Carstens et al. 2013), as it is likely that plastid variability in Salix is spatially contextual. This analysis conforms to previous research, but also bridges seemingly disparate genetic evidence in the Salix literature.

7.3 Viability of aDNA from Wood

The scarcity of wood aDNA publications served as both an impetus and hindrance to this study in terms of technical challenges and protocol experimentation. Only a single specimen

(K12 [the Kluane Stick]) had an associated radiometric age (2430 ± 20 14C BP), with the ice patch sticks plausibly being as old as the ice patches themselves (Section 2.2.2). This restricts deductions as to whether non-amplification of certain specimens was temporally

(taphonomically) associated, or a result of other factors. The authenticity of the ice patch sequences is weak in reference to Cooper and Poinar’s (2000) criteria of authenticity (Section

3.2) due to the presence of exogenous plastid DNA. However, it is probable that sample IP10 is

Salix sp. due to four amplifications (with two loci) of this taxon despite a single green algae contaminant (Table 6.3). It is also probable that IP1a is Pinus sp. due to two amplifications of this genus (with two loci). The classification of IP9 and IP2 are ambiguous because of an inability to differentiate between exogenous and endogenous DNA. Sequences from the other

181

samples show no evidence of endogenous DNA. This degree of contamination was unexpected given the lack of contaminants in concurrent human and mammalian laboratory projects that myself and colleagues have undertaken in the facility—before, during, and after this study. The aDNA laboratory at the University of Calgary is physically isolated and dedicated to paleogenetics (Section 5.2), with a universal use of amplification controls for both extraction and

PCR. IP10 had reproducible results from three extractions, and IP2 was reproducible from two.

However, these sequences were not independently replicated; tests of molecular behaviour, quantitation, biochemical preservation, and cloning were also not undertaken (Cooper and Poinar

2000). In terms of associated remains, DNA has not been extracted from ancient plants at cryogenic sites in the Northwestern Subarctic. However, caribou aDNA has been successfully amplified from bones and teeth (Kuhn et al. 2010; Letts et al. 2012). The sequences from IP1a and IP10 make phylogenetic sense, as does the single Picea sequence and three Salicaceae sequences from IP9 (owing to the ambiguity in classification). Sequences from IP4 and IP7 do not make morphological sense based on the wood tissues utilized.

The overall poor authentication of sequence data from this study serve to raise questions about the viability of wood as a target tissue for aDNA, and more specifically the efficacy of the method for cryogenic wood artifacts. First, a high primer specificity is essential. Universal or taxonomically broad primer sets suffer from non-specific amplification in aDNA wood samples because of the exceptionally low quality and quantity of endogenous fragments (Section 4.3.3).

Likewise, using multiple specific primer sets to avoid morphological classification is likely not viable given the frequency of cpDNA contaminants that would amplify in each PCR. The presence of cpDNA in a canid extract emphasizes the commonality of exogenous plastid DNA despite harsh decontamination procedures. A morphological determination of genera to allow for

182

family rank specificity would greatly aid in a contaminant avoidance strategy. Even a next- generation analysis of wood tissues would likely necessitate morphologic classification to appropriately discriminate between prolific exogenous and endogenous DNA.

Second, experimental analyses are essential to quantitatively compare decontamination procedures for wood tissues, a topic that has not been addressed in the literature. It is likely that the contamination observed in this study came from pre-preparation sources. The amplification of green algae in a sample that underwent the second preparation highlights the difficulty in exogenous DNA removal, along with the importance of an avoidance strategy. The morphologic identification of target wood samples is also essential to aid in this avoidance through taxon- specific primer design.

Third, while little difference was observed between the DNeasy (0.02 g wet or 0.1 g dry maximum) and MinElute (1.0 g) protocols in terms of amplification success (given the small sample size), it is likely that a larger starting weight is significant (see Section 4.2.3.1 [Moore

2011:97]). Inhibition is an important consideration for wood tissues. Ideally, a manufacturer modification to the DNeasy kit, or an independent modification of the MinElute protocol for wood specific inhibitors, would aid future aDNA analyses. A simple means of testing the inhibitory state of an extract would be to design primers with relatively high likelihoods of secondary structures. If inhibitors are present in the samples, only the control amplifications should generate primer dimers.

Finally, the results of this study suggests that ancient DNA with Sanger sequencing is not a routinely viable method for small cryogenic artifacts. The methodology has been shown to be suitable for larger wooden materials (with morphological taxonomic classification) where sizable samples can be obtained, and there is less concern with destructive sampling (Section 4.3.3).

183

Subarctic ice patch wooden artifacts and biofacts are small, rare, and fragile. The density of wood is also low, meaning that comparatively large samples must be obtained (especially for extraction repeats and independent replication) that ultimately destroy large portions of the materials. The poor ability to authenticate DNA from these materials further invalidates the purpose of the genetic analysis. In addition, while cryogenic conditions would be expected to enhance DNA preservation (Section 3.4.1), these artifacts were able to be recovered because of seasonal freezing and thawing—a process likely contributing to substantial DNA degradation

(Hansen et al. 2006; Fraser and Strzezek 2005; Lindahl 1993b; Ross et al. 1990; Shao et al. 2012;

Shikama 1965). The freeze-thaw cycle is of greater concern for wood (due to exceptionally poor

DNA) than associated faunal materials that are more resistant to taphonomic processes. If seeds or comparatively robust plant tissues are recovered, it is likely that these would be of comparative efficacy to faunal remains.

It is important to consider the reason for conducting a destructive aDNA analysis. If it is for greater taxonomic resolution as compared with microanatomical methods, the viability of barcoding for the taxa in question must be addressed initially—as should the viability of a phylogeographic assessment in the target taxa. Given the results of this research I would consider that a refinement of decontamination and extraction protocols for wood tissues, and the use of next-generation sequencing technologies, are essential for aDNA projects targeting degraded wooden cryogenic artifacts and biofacts. Any future attempt to extract aDNA from ice patch wood specimens should involve a substantial preliminary assessment of the project’s feasibility.

While aDNA may have enormous analytic potential, particularly with ice patch faunal material, small fragile wooden artifacts or biofacts have a low viability using traditional paleogenetic

184

methods. Next-generation methods would likely alleviate many of the aforementioned complications if tissues with amplifiable DNA are identified and inhibitors are quantified.

7.4 Conclusion

Alpine ice patches and glacial sites provide ideal burial conditions for paleobiological materials. Genetically, cryogenic conditions have been found to be well suited to ancient DNA survival (e.g., Crubézy et al. 2010; Gilbert et al. 2008; Haile et al. 2009; Lambert et al. 2002).

The large quantities of well-preserved wooden artifacts recovered from ice patches in the

Northwestern Subarctic stand in stark contrast to the predominantly lithic assemblages that dominate the area’s archaeological record (Sections 2.1.1, 2.2, and Appendix I). Ice patch assemblages have already added immensely to our understandings of the regions’ chronology

(e.g. Hare et al. 2012), and highlight the critically missing data in spatial-temporally associated boreal forest assemblages. Paleogenetic methods hypothetically appear to be well suited to maximizing the analytic potential of rare cryogenic wooden artifacts and biofacts by providing an enhanced taxonomic resolution, phylogeographic potential, and an evolutionary marker.

Caribou remains from these sites have been ideal for aDNA (Kuhn et al. 2010; Letts et al. 2012), adding depth to our understanding of their evolutionary development in relation to environmental shifts such as the White River Eruptions (Section 2.1.1.2.2). Unlike osteological tissues, wood

DNA enters the record with significant degradation (Section 4.3.3), with taphonomic processes further advancing diagenesis (Section 3.4.1). Although wood tissues in this analysis have preserved because of their frozen context, they were only able to be recovered because of a seasonal freeze-thaw cycle and progressive ablation of their associated ice patch or glacier. The target specimen from Kluane National Park (the Kluane Stick) likely went through this cycle hundreds or even thousands of times given its radiometric age (Holdsworth and Lacourse 2015).

185

Freeze-thaw is problematic for any DNA sample (Hansen et al. 2006; Fraser and Strzezek 2005;

Lindahl 1993b; Ross et al. 1990; Shao et al. 2012; Shikama 1965) and becomes exceptionally so with wood aDNA, given its characteristically low DNA quality and quantity. Research in timber tracking and other applications of degraded wood DNA indicate that relatively large, robust wood fragments (relative to the cryogenic biofacts of this analysis) can be viable for paleogenetics (Abe et al. 2011; Asif and Cannon 2005; Deguilloux et al. 2002, 2003, 2004, 2006;

Dumolin-Lapègue et al. 1999; Eurlings et al. 2010; Jiao et al. 2012, 2013; Liepelt et al. 2006b;

Lowe 2007; Lowe et al. 2004, 2010; Lowe and Cross 2011; Petit et al. 1997; Rachmayanti and

Leinemann 2006; Rachmayanti 2009; Rachmayanti et al. 2009; Speirs et al. 2009; Tang et al.

2011; Tnah et al. 2009, 2011). In contrast, this study strongly suggests that small, fragile wooden artifacts and biofacts representative of most wooden ice patch materials in the Subarctic are poorly suited to traditional aDNA analysis. Furthermore, this study underscores the relevance of a taxon-specific variability in plastid DNA with the confirmation of a predominant homogeneity in modern Salix plastid and rDNA loci, loci found to be sufficiently variable in other taxa.

Despite this trend, the marginal variability observed does conform to (and bridge) seemingly disparate work in the literature (Brunsfeld et al. 2007; Percy et al. 2014). The cpDNA loci rpl16 and trnH-psbA, and the rDNA locus ITS were found to have polymorphisms that could be useful to understanding the genetic variability of modern Salix, and may also be useful for future population genetic analyses using aDNA from plants in related taxa. The presence of some regional variability partially confirms the a priori hypothesis of inter-species regional variability, and the potential plant DNA has to be useful in phylogeographic analyses used to infer archaeological mobility (if technical limitations of traditional aDNA methods [Sanger sequencing] can be overcome, or alternatively if next-generation sequencing is utilized).

186

Degradation, contamination, and inhibition were all factors in this analysis, with the unexpected contamination potential being most significant in the paleobiological samples that

PCR amplified. Advances in genetic technologies, principally next-generation sequencing, may render these wooden artifacts viable materials for investigation. Sanger sequencing would seem to be inadequate for dealing with the issues of aDNA from small wooden materials (not taxonomically identified) given the exogenous DNA potential. A combination of morphometric classification and paleogenomics would address much of the contamination challenges seemingly inherent with plant aDNA. Paleogenomics has already revitalized analyses of ancient microbiota that posed insurmountable challenges for authentication until relatively recently

(Hofreiter et al. 2015:289). Importantly, aDNA cannot replace taxonomic identification for plant tissues with the omnipresent threat of exogenous plastid DNA, but next-generation sequencing can methodologically separate endogenous and exogenous sequences when taxonomically informed.

This study emphasizes that any future aDNA analysis of wood artifacts or biofacts from ice patch or glacial sites in the Northwestern Subarctic should: 1) involve a substantial preliminary assessment of the project’s feasibility through experiments of decontamination, quantitation, and taxa-specific variability specific to the individual study; 2) be conducted with next-generation sequencing technologies; and 3), carefully consider the analytic purpose as weighed against the necessity of relatively substantial destructive analysis. Unmodified biofacts in association with wooden artifacts at these sites provide ideal tests to stage a refined preliminary analysis, but it is important to consider whether aDNA can add novel data that is not already achievable through a more cost and time effective paleo-anatomical analysis.

187

References

Abbaszadegan, M., P. Stewart, and M. LeChevallier 1999 A Strategy for Detection of Viruses in Groundwater by PCR. Applied and Environmental Microbiology 65: 444–449. Abe, H., U. Watanabe, K. Yoshida, K. Kuroda, and C. Zhang 2011 Changes in Organelle and DNA Quality, Quantity, and Distribution in the Wood of Cryptomeria japonica over Long-term Storage. IAWA Journal 32(2): 263–272. Abdollahzadeh, A., K. Osaloo, and A.A. Maassoumi 2011 Molecular Phylogeny of the Genus Salix (Salicaceae) with an Emphasize to its Species in Iran. The Iranian Journal of Botany 17(2): 244–253. Achilli, A., U.A. Perego, H. Lancioni, A. Olivieri, F. Gandini, B.H. Kashani, V. Battaglia, V. Grugni, N. Angerhofer, M.P. Rogers, R.J. Herrera, S.R. Woodward, D. Labuda, D.G. Smith, J.S. Cybulski, O. Semino, R.S. Malhi, and A. Torroni 2013 Reconciling Migration Models to the Americas with the Variation of North American Native Mitogenomes. Proceedings of the National Academy of Sciences USA 110(35): 14308–14313. Ackerman, R.E. 1968a Experimental Session: Cultural Implications of the Arctic Side-Notched Point Complex. 67th annual meeting of the American Anthropological Association, Seattle. Manuscript on file with National Park Service, Fairbanks office. 1968b The Archeology of the Glacier Bay Region, Southeastern Alaska. Washington State University, Report of Investigations No. 44. Pullman. 1996 Bluefish Caves. In American Beginnings, The Prehistory and Paleoecology of Beringia, edited by F.H. West, pp. 511–513. University of Chicago Press, Chicago, Il. 2011 Microblade Assemblages in Southwestern Alaska: An Early Holocene Adaptation. In From the Yenisei to the Yukon: Interpreting Lithic Assemblage Variability in Late Pleistocene/Early Holocene Beringia, edited by T. Goebel and I. Buvit, pp. 255–269. Texas A&M University Press, College Station. Ackerman, R. E., T. D. Hamilton, and R. Stuckenrath 1979 Early Culture Complexes on the Northern Northwest Coast. Canadian Journal of Archaeology 3: 195–209. Adovasio, J.M., D.R. Pedler, J. Donahue and R. Stuckenrath 1998 Two Decades of Debate on Meadowcroft Rockshelter. North American Archaeologist 19(4): 317–341. Ager T.A., and R.L. Phillips 2008 Pollen Evidence for Late Pleistocene Bering Land and Bridge Environments from Norton Sound, Northeastern Bering Sea, Alaska. Arctic, Antarctic, and Alpine Research, 40: 451–461.

188

Alix, C. 2006 Wood Identifications of Artifacts from the Ice Patch Sites of Southern Yukon and of Geological Specimens from the Old Crow Region. Final report to Paul Matheus, Greg Hare, and Ruth Gottardt, Yukon Tourism-Heritage Branch, Whitehorse, Yukon, in completion of contract # SS554.3128. Manuscript on file. Alix, C., P.G. Hare, T.D. Andrews, and G. MacKay 2012 A Thousand Years of Lost Hunting Arrows: Wood Analysis of Ice Patch Remains in Northwestern Canada. Arctic 65(1): 95–117. Allaby, R.G., M. Banerjee, T.A. Brown 1999 Evolution of the High Molecular Weight Glutenin Loci of the A, B, D, and G Genomes of Wheat. Genome 42(2): 296–307. Allentoft, M. E., M. Collins, D. Harker, et al. 2012 The Half-Life of DNA in Bone: Measuring Decay Kinetics in 158 Dated Fossils. Philosophical Transactions of the Royal Society B: Biological Sciences 279(1748): 4724– 33. doi:10.1098/rspb.2012.1745. Alley, R.B. 2000 The Younger Dryas Cold Interval as Viewed from Central Greenland. Quaternary Science Reviews 19(1-5): 213–226. Altschul S.F., W. Gish, W. Miller, E.W. Myers, and D.J. Lipman 1990 Basic Local Alignment Search Tool. Journal of Molecular Biology 215: 403–410. Ames, K.M. 2003 The Northwest Coast. Evolutionary Anthropology 12: 19–33. Ames, K.M., and H.D.G. Maschner 1999 Peoples of the Northwest Coast: Their Archaeology and Prehistory. London: Thames and Hudson. Anderson, D.D. 1968a A Stone Age Campsite at the Gateway to America. Scientific American 318(6): 24–33. 1968b Early Notched Points and Related Assemblages in the Western American Arctic. Paper presented at the 67th Annual Meeting of the American Anthropological Association. Seattle. 1970 Microblade Traditions in Northwestern Alaska. Arctic Anthropology 7(2): 2–16. 1984 Prehistory of North Alaska. In Handbook of North American indians: Vol. 5, Arctic, edited by D. Damas, pp. 80-93. Smithsonian Institution Press, Washington, D.C. 2008 Northern Archaic Tradition Forty Years Later: Comments. Arctic Anthropology 45(2): 169–178. Anderson-Carpenter, L.L., J.S. McLachlan, S.T. Jackson, et al. 2011 Ancient DNA from Lake Sediments: Bridging the Gap between Paleoecology and Genetics. BMC Evolutionary Biology 11(30): 1–15. doi:10.1186/1471-2148-11-30.

189

Anderson, J.R., and A.C. Nilssen 1998 Do Reindeer Aggregate on Snow Patches to Reduce Harassment by Parasitic Flies or to Thermoregulate? Rangifer 18(1): 3–17. Andrews, T.D., and G. MacKay 2012 The Archaeology and Paleoecology of Alpine Ice Patches: A Global Perspective. Arctic 65(1): iii–vi. Andrews, T.D., G. MacKay, and L. Andrew 2012 Archaeological Investigations of Alpine Ice Patches in the Selwyn Mountains, Northwest Territories, Canada. Arctic 65(1): 1–21. Angiosperm Phylogeny Group II 2003 An Update of the Angiosperm Phylogeny Group Classification for the Orders and Families of flowering plants: APG II. Botanical Journal of the Linnean Society 141: 399– 436. Argus, George W. 1986 The Genus Salix in the South Eastern United States. Systematic Botany Monographs 9: 1–170. 2004 A Guide to the Identification of Salix (Willows) in Alaska, The Yukon Territory and Adjacent Regions. Manuscript on file, Guide distributed at July 2004 workshop on willow identification, Fairbanks, AK. Manuscript on file. 2010 Salix. In: Flora of North America Editorial Committee, eds. 1993 + . Flora of North America North of Mexico. 16 + vols. Vol. 7, pp. 23–162. Flora of North America Association, New York and Oxford. Arneborg, J., J. Heinemeir, N. Lynnerup, H.I. Nielsen, N. Rud and A.E. Sveinbjornsdottir 1999 Change of Diet of the Greenland Vikings Determined from Stable Carbon Isotope Analysis and l4C Dating of Their Bones. Radiocarbon 41: 157–168. Asif, M.J., and C.H. Cannon 2005 DNA Extraction from Processed Wood: A Case Study for the Identification of an Endangered Timber Species (Gonystylus bancanus). Plant Molecular Biology Reporter 23(2): 185–192. Avise, J.C. 1986 Mitochondrial DNA and the Evolutionary Genetics of Higher Animals. Philosophical Transactions of the Royal Society B: Biological Sciences 312(1154): 325–342. doi:10.1098/rstb.1986.0011. 1989 Gene Trees and Organismal Histories: A Phylogenetic Approach to Population Biology. Evolution 43(6): 1192–1208. Avise, J.C., J. Arnold, R.M. Ball, et al. 1987 Intraspecific Phylogeography: The Mitochondrial DNA Bridge between Population Genetics and Systematics. Annual Review of Ecology and Systematics 18: 489–522.

190

Bachus, Kristy Ann 2007 Evalutation of a Novel Decontamination and DNA Recovery and Detection Method for Bacillus anthracis. Unpublished Master’s thesis, School of Criminal Justice, Michigan State University. Manuscript on file. Bamber, R. K. 1976 Heartwood: Its Function and Formation. Wood Science and Technology 10: 1–8. Barclay, David. J., Parker. E. Calkin, and Gregory C. Wiles 2001 Holocene History of Hubbard Glacier in Yakutat Bay and Russell Fiord, Southern Alaska. Bulletin of the Geological Society of America 113(3): 388–402. Barclay, David J., Julie L. Barclay, Parker E. Calkin, and Gregory C. Wiles 2006 A Revised and Extended Holocene Glacial History of Icy Bay, Southern Alaska, U.S.A. Arctic, Antarctic, and Alpine Research 38(2): 153–162. Barclay, David J., Gregory C. Wiles, and Parker E. Calkin 2009 Holocene Glacier Fluctuations in Alaska. Quaternary Science Reviews 28(21–22): 2034– 2048. Barrett, J.H., R.P. Beukens, and D.R. Brothwell 2000 Radiocarbon Dating and Marine Reservoir Correction of Viking Age Christian Burials from Orkney. Antiquity 74: 537–542. Barrie, J.V., K.W. Conway, R.W. Mathewes, H.W. Josenhans, and M.J. Johns, 1993 Suberged Late Quaternary Terrestrial Deposits and Paleoenvironments of Northern Hecate Strait, British Columbia Continental Shelf, Canada. Quaternary Internation 20: 123–129. Baselga, A., T. Fujisawa, A. Crampton-Platt, J. Bergsten, P.G. Foster, Monaghan and, A.P. Vogler 2013 Whole-Community DNA Barcoding Reveals a Spatio-Temporal Continuum of Biodiversity at Species and Genetic Levels. Nature Communications 4(1892): 1–7. doi:10.1038/ncomms2881 Baur E. 1909 Das Wesen und die Erblichkeitsverhältnisse der "Varietates albomarginatae hort." von Pelargonium zonale. Z indukt Abstammungs- u Vererbungslehre 1: 330–351. 1910 Untersuchungen über die Vererbung von Chromatophorenmerkmalen bei Melandrium, Antirrhinum und Aquilegia. Z indukt Abstammungs- u Vererbungslehre 4: 81–102. Beattie, O., B. Apland, E.W. Blake, J.A. Cosgrove, S. Gaunt, S. Greer, A.P. Mackie, K.E. Mackie, D. Straathof, V. Thorp, and P.M. Troffe 2000 The Kwäd̖ āy Dän Ts’ínch̖ i Discovery from a Glacier in British Columbia. Canadian journal of archaeology 24(1+2): 129–147. Bellwood, P. and M. Oxenham 2008 The Expansions of Farming Societies and the Role of the Neolithic Demographic Transition. In The Neolithic Demographic Transition and its Consequences, edited by J.P. Bocquet-Appel and Bar-Yosef. Springer, Netherlands.

191

Bement, Leland C., Brian J. Carter, R.A. Varney, Linda Scott Cummings, J. Byron Sudbury 2007 Paleo-Environmental Reconstruction and Bio-Stratigraphy, Oklahoma Panhandle, USA. Quaternary International 169–170: 39–50. http://dx.doi.org/10.1016/j.quaint.2006.05.034. Bendich, A.J. 1987 Why Do Chloroplasts and Mitochondria Contain So Many Copies of Their Genome? BioEssays 6: 279–282. 2004 Circular Chloroplast Chromosomes: the Grand Illusion. Plant Cell 16: 1661–1666. doi:10.1105/tpc.160771 2010 Mitochondrial DNA, Chloroplast DNA and the Origins of Development in Eukaryotic Organisms. Biology Direct 5(42): 1–8. doi:10.1186/1745-6150-5-42 Bennett, K. D., and L. Parducci 2006 DNA from Pollen: Principles and Potential. The Holocene 16(8): 1031–1034. doi:10.1177/0959683606069383. Benson D.A., M. Cavanaugh, K. Clark, I. Karsch-Mizrachi, D.J. Lipman, J. Ostell, E.W. Sayers 2013 GenBank. Nucleic Acids Research 41:D36–42. doi: 10.1093/nar/gks1195. Berger, W.H. 1990 The Younger Dryas Cold Spell—A Quest for Causes. Global and Planetary Change 89: 219–237. Bergthorsson, Ulfar, Keith L. Adams, Brendan Thomason, and Jeffrey D. Palmer 2003 Widespread Horizontal Transfer of Mitochondrial Genes in Flowering Plants. Nature 424(6945): 197–201. doi:10.1038/nature01743. Bettinger, R.L., and J.W. Eerkens, 1999 Point Typologies, Cultural Transmision, and the Spread of Bow-and-Arrow Technology in the Prehistoric Great Basin. American Antiquity 64(1): 231–242. Bever, M.R. 2001a Stone Tool Technology and the Mesa Complex: Developing a Framework of Alaskan Paleoindian Prehistory. Arctic Anthropology 38(2): 98–118. 2001b An Overview of Alaskan Late Pleistocene Archaeology: Historical Themes and Current Perspectives. Journal of World Prehistory 15(2): 125–191. Bhargava, Mili, and Ashok Sharma 2013 DNA Barcoding in Plants: Evolution and Applications of in Silico Approaches and Resources. Molecular Phylogenetics and Evolution 67(3): 631–641. doi:10.1016/j.ympev.2013.03.002. Binford, R. 1989 Styles of Style. Journal of Anthropological Archaeology 8(1): 51–67. Birks, H.J.B. 1980 Modern Pollen Assemblages and Vegetation History of the Moraines of the Klutlan Glacier and Its Surroundings, Yukon Territory, Canada. Quaternary Research 14(1): 101– 129.

192

Bock, R. 2007 Structure, Function, and Inheritance of Plastid Genomes. In Cell and Molecualr Biology of Plastids, edited by R. Bock, pp. 29–63. Springer Berlin Heidelberg. Bortenschlager, S., and K. Oeggl 2000 The Iceman and His Natural Environment: Palaeobotanical Results. Wien and New York: Springer-Verlag. Bowern, Claire 2010 Correlates of Language Change in Hunter-Gatherer and Other “Small Languages. Language and Linguistics Compass 4(8): 655–669. Bowyer, V., G.W. Kuzyk, D.E. Russell, R.S. Farnell, R.M. Gotthardt, P.G. Hare, F. Blake 1999 Caribou Remains at Thandlät: Archaeology and Paleoecology of Some Well-Preserved Sites on Ice Patches in the Southwestern Yukon. Paper presented at the 32nd Annual Conference of the Canadian Arcaheological Association, Whitehorse, Yukon. Boyd, M., C. Surette, and B. Nicholson 2006 Archaeobotanical Evidence of Prehistoric Maize (Zea Mays) Consumption at the Northern Edge of the Great Plains. Journal of Archaeological Science 33(8): 1129–1140. doi:10.1016/j.jas.2005.12.003. Boyd, M., T. Varney, C. Surette, and J. Surette 2008 Reassessing the Northern Limit of Maize Consumption in North America: Stable Isotope, Plant Microfossil, and Trace Element Content of Carbonized Food Residue. Journal of Archaeological Science 35: 2545–2556. doi:10.1016/j.jas.2008.04.008. Briggs, A.W., U. Stenzel, P.L.F. Johnson, et al. 2007 Patterns of Damage in Genomic DNA Sequences from a Neandertal. Proceedings of the National Academy of Sciences of the United States of America 104(37): 14616–21. doi:10.1073/pnas.0704665104. Broecker, W.S., G.H. Denton, R.L. Edwards, H. Cheng, R.B. Alley, and A.E. Putnam 2010 Putting the Younger Dryas Cold Event into Context. Quaternary Science Reviews 29(9– 10): 1078–1081. Brown, T.A. 1999 How Ancient DNA May Help in Understanding the Origin and Spread of Agriculture. Philosophical Transactions of the Royal Society B: Biological Sciences 354(1379): 89–98. doi:10.1098/rstb.1999.0362. Brown, T.A., R.G. Allaby, K.A. Brown, and M.K. Jones 1993 Biomolecular Archaeology of Wheat: Past, Present and Future. World Archaeology 25(1): 64–73. Brown, T.A., K. Brown 2011 Biomolecular Archaeology: An Introduction. Wiley-Blackwell, U.K. Brunsfeld, S.J., T.R. Miller, and B.C. Carstens 2007 Insights into the Biogeography of the Pacific Northwest of North America: Evidence from the Phylogeography of Salix melanopsis. Systematic Botany 32(1): 129–139.

193

Brunsfeld, Steven J., Douglas E. Soltis, and Pamela S. Soltis 1992 Evolutionary Patterns and Processes in Salix sect. Longifoliae: Evidence from Chloroplast DNA. Systematic Botany 17(2): 239–256. Brunsfeld, S.J., J. Sullivan, D.E. Soltis, and P.S. Soltis 2001 Comparative Phylogeography of Northwestern North America: A Synthesis. In Integrating Ecological and Evolutionary Processes in a Spatial Context, edited by J. Silvertown and J. Antonovicks, pp. 319–339. Oxford: Blackwell Science. Bryant, V.M. Jr., 1989 Botanical Remains in Archaeological Sites. In Interdisciplinary Workshop on the Physical-Chemical-Biological Processes Affecting Archaeological Sites, compiled by Christopher C. Mathewson, pp. 85–115. Environmental Impact Research Program Contract Report E11-89-1. U.S. Army Corps of Engineers, Washington, D.C. Bunbury, Joan, and Konrad Gajewski 2009 Postglacial Climates Inferred from a Lake at Treeline, Southwest Yukon Territory, Canada. Quaternary Science Reviews 28: 354–369. doi:10.1016/j.quascirev.2008.10.007. Bunce, M., M. Szulkin, H.R.L. Lerner, et al. 2005 Ancient DNA Provides New Insights into the Evolutionary History of New Zealand’s Extinct Giant Eagle. PLoS Biology 3(1): e9. doi:10.1371/journal.pbio.0030009. Burger, J., S. Hummel, B. Hermann, and W. Henke 1999 DNA Preservation: A Microsatellite-DNA Study On Ancient Skeletal Remains. Electrophoresis 20(8): 1722–1728. Burn, C. 2004 Permafrost. In Ecoregions of the Yukon Territory: Biophysical properties of Yukon landscapes, edited by C.A.S. Smith, J.C. Meikle and C.F. Roots, pp. 23–35. Agriculture and Agri-Food Canada, PARC Technical Bulletin No. 04-01, Summerland, British Columbia. CAFN (Champagne and Aishihik First Nations), Caracross/Tagish First Nation (CTFN), Kwanlin Dün First Nation (KDFN) and S. Greer 2001 Emergency Recovery of Artifacts from Melting Ice Patches. Final Report to Yukon Community Development Fund, February 2001. On file at Heritage Office, Champagne and Aishihik First Nations, haines Junction, Yukon Y0B 1L0. Callanan, M. 2012 Central Norwegian Snow Patch Archaeology: Patterns Past and Present. Arctic 65(1): 178–188. Campbell, L. 2004 Historical Linguistics: An Introduction, 2nd ed. Edinburgh: Edinburgh University Press. Cannon, A, and D.Y. Yang 2006 Early Storage and Sedentism On the Pacific Northwest Coast: Ancient DNA Analysis of Salmon Remains from Namu, British Columbia. American Antiquity 71(1): 123–140.

194

Cano, R. J. 1996 Analysing ancient DNA. Endeavour 20: 162–167. Cano, R.J., H.N. Poinar, N.J. Pieniazek, A. Acra, and G.O. Poinar 1993 Amplification and Sequencing of DNA from a 120–135 Million-Year-Old Weevil. Nature 363: 536–538. Cano, R., H. Poinar, and G. Poinar 1992a Isolation and Partial Characterization of DNA from the Bee Proplebeia dominicana (Apidae: Hymenoptera) in 25–40 Million Year Old Amber. Medical Science Research 20:249-51. Cano, R., H. Poinar, D. Roubik, G. Poinar 1992b Enzymatic Amplification and Nucleotide Sequencing of Portions of the 18s Rrna Gene of the Bee Proplebeia dominicana Isolated from 25–40 Million Year Old Amber. Medical Science Research 20: 619–622. Carlisle, R.C. and J. M. Adovasio, (editors) 1982 Meadowcroft: Collected papers on the archaeology of Meadowcroft Rockshelter and the Cross Creek drainage. University of Pittsburgh, Department of Anthropology. Carlson, Roy L. 2012 Issues in Athapaskan prehistory. In From the Land of Ever Winter to the American Southwest: Athapaskan Migrations, Mobility, and Ethnogenesis, edited by Deni J. Seymour, pp. 410–426. The University of Utah Press, Salt Lake City. Carrara, P.E., T.A. Ager, and J.F. Baichtal 2007 Possible Refugia in the Alexander Archipelago of Southeastern Alaska during the Late Wisconsin Glaciation. Canadian Journal of Earth Science 44: 229–244. Carstens, Bryan C., Steven J. Brunsfeld, John R. Demboski, Jeffrey M. Good, and Jack Sullivan 2005 Investigating the Evolutionary History of the Pacific Northwest Mesic Forest Ecosystem: Hypothesis Testing within a Comparative Phylogeographic Framework. Evolution; International Journal of Organic Evolution 59(8): 1639–1652. Carstens, Bryan C., Reid S. Brennan, Vivien Chua, Caroline V. Duffie, Michael G. Harvey, Rachel A. Koch, Caleb D. McMahan, Bradley J. Nelson, Catherine E. Newman, Jordan D. Satler, Glenn Seeholzer, Karine Posbic, David C. Tank, and Jack Sullivan 2013 Model Selection as a Tool for Phylogeographic Inference: An Example from the Willow Salix melanopsis. Molecular Ecology 22(15): 4014–4028. CBOL Plant Working Group 2009 A DNA Barcode for Land Plants. Proceedings of the National Academy of Sciences of the United States of America 106(31): 12794–12797. doi:10.1073/pnas.0905845106. Champlot, Sophie, Camille Berthelot, Mélanie Pruvost, E Andrew Bennett, Thierry Grange, and Eva-Maria Geigl 2010 An Efficient Multistrategy DNA Decontamination Procedure of PCR Reagents for Hypersensitive PCR Applications. PloS ONE 5(9): e13042.

195

Chan, C.X. and D. Bhattacharya 2011 Plastid Origin and Evolution, eLS. DOI: 10.1002/9780470015902.a0023639 Chandler, D.P., C.A. Wagnon, and H. Bolton 1998 Reverse Transcriptase (RT) Inhibition of PCR at Low Concentrations of Template and its Implications for Quantitative RT-PCR. Applied and Environmental Microbiology 64: 669–677. Chase, M.W., S. Zmarzty, M.D. Lledó, K.J. Wurdack, S.M. Swensen, and M.F. Fay 2002 When in Doubt, Put it in Flacourtiaceae: A Molecular Phylogenetic Analysis based on Plastid rbcL DNA Sequences. Kew Bulletin 57: 141–181. Chen, C. 2007 Techno-Typological Comparison of Microblade Cores from East Asia and North America. In Origin and Spread of Microblade Technology in Northern Asia and North America, edited by Y.V. Kuzmin, S.G. Keats, and C. Shen, pp. 7–38, Archaeology Press, Simon Fraser University, Burnaby. Chen, Dongmei, Xianxian Zhang, Hongzhang Kang, et al. 2012 Phylogeography of Quercus Variabilis Based On Chloroplast DNA Sequence in East Asia: Multiple Glacial Refugia and Mainland-Migrated Island Populations. PloS ONE 7(10): e47268. doi:10.1371/journal.pone.0047268. Chen, Jia-Hui, Hang Sun, Jun Wen, and YP Yang 2010 Molecular Phylogeny of Salix L. (Salicaceae) Inferred from Three Chloroplast Datasets and Its Systematic Implications. Taxon 59(1): 29–37. Chorev M., and L. Carmel 2012 The Function of Introns. Frontiers in Genetics 3(55): 1–15. doi:10.3389/fgene.2012.00055. Christensen, T., and J. Stafford 2005 Raised Beach Archaeology in Northern Haida Gwaii: Preliminary Results from the Cohoe Creek Site. In Haida Gwaii, Human History and Environment from the Time of Loon to the Time of the Iron People, edited by D.W. Fedje and R.W. Mathewes, pp. 245– 273. UBC Press, Vancouver. Chun E.H.L., M.H. Vaugham, A. Rich 1963 The Isolation and Characterization of DNA Associated with Chloroplast Preparations. Journal of Molecular Biology 7: 130–141. Cinq-Mars, J. 1979 Bluefish Cave I: A Late Pleistocene Eastern Beringian Cave Deposit in the Northern Yukon. Canadian Journal of Archaeology. 3: 1–32. 1985 Bluefish Caves. In Canadian encyclopedia, pp. 243–244. Hurtig, Edmonton. Cinq-Mars, J. and R.E. Morlan. 1999 Bluefish Caves and Old Crow Basin: A New Rapport. In Ice Age Peoples of North America: Environments, Origins, and Adaptations of the First Americans, edited by R. Bonnichsen and K.L. Turnmire, pp. 200-212. Corvallis: Oregon State University Press.

196

Clague, J. 2004 Late Holocene Environmental Change at Treeline in the Northern Coast Mountains, British Columbia, Canada. Quaternary Science Reviews 23(23–24): 2413–2431. Clague, J.J., S.G. Evans, V.N. Rampton, and G.J. Woodsworth 1995 Improved Age Estimates for the White River and Bridge River Tephras, Western Canada. Canadian Journal of Earth Sciences 32: 1172–1179. Clague J.J., R.W. Mathewes, T.A. Ager 2010 Environments of Northwest North America before the Last Glacial Maximum. In Entering America: Northeast Asia and Beringia before the Last Glacial Maximum, edited by D. Madsen, pp. 63–77, University of Utah Press, Salt Lake City. Clark, D.W. 1975 Prehistory of the Western Subarctic. Bulletin (Canadian Archaeological Association) 7: 76–95. 1983 Is There a Northern Cordilleran Tradition? Canadian Journal of Archaeology 7(l): 23– 48. 1991 Western Subarctic Prehistory. Canadian Museum of Civilization, Hull, Quebec. 1992 The Archaic in the Extreme Northwest of North America. Revista de arqueología Americana 5: 75–99. 2001 Microblade-Culture Systematics in the Far Interior Northwest. Arctic Anthropology 38(2): 64–80. Clark, D.W., and R.E. Morlan 1982 Western Subarctic Prehistory: Twenty Years Later. Canadian Journal of Archaeology 6: 79–93. Claudio, Milanesi, Rita Vignani, Fabrizio Ciampolini, et al. 2007 Ultrastructure and DNA Sequence Analysis of Single Fossil Sediment Cells. Caryologia 60(1-2): 129–132. doi:10.1080/00087114.2007.10589560. Collinson M., M. Boulter, P. Holmes 1993 Magnoliophyta (Angiospermae). In The Fossil Record, Vol 2, edited by M.J. Benton, pp. 811–812. Chapman & Hall, London. Commission for Environmental Cooperation 1997 Ecological Regions of North America: Toward a Common Perspective. Communications and Public Outreach Department of the CEC Secretariat, Quebec. 2014 Database of Environmental Data for North America. Electronic document. http://www.cec.org/Page.asp?PageID=924&ContentID=2336, accessed February 5, 2015. Cook, J.P. 1969 The Early Prehistory of Healy Lake, Alaska. Ph.D. dissertation, Department of Anthropology, University of Wisconsin, Madison. University Microfilms, Ann Arbor. 1996 Healy Lake. In American Beginnings: The Prehistory and Paleoecology of Beringia, edited by F.H. West, pp. 323–327. The University of Chicago Press, Chicago.

197

Cooper, A., and C.B. Stringer 2013 Paleontology. Did the Denisovans cross Wallace’s Line? Science (New York, N.Y.) 342(6156): 321–323. doi:10.1126/science.1244869. Cooper, A., and H.N. Poinar 2000 Ancient DNA: Do It Right or Not At All. Science 289(5482): 1139. doi:10.1126/science.289.5482.1139b. Cooper, David J. 2014 White Spruce Above and Beyond Treeline in the Arrigtech Peaks Region, Brooks Range, Alaska. Arctic 39(3): 247–252. Cooper, H.K. 2006 Copper and Social Complexity: Frederica de Laguna’s Contribution to Our Understanding of the Role of Metals in Native Alaskan Society. Arctic Anthropology 43(2): 148–163. 2011 The Life (Lives) and Times of Native Copper in Northwest North America. World Archaeology 43(2): 252–270. Corr, L.T., M.P. Richards, C. Grier, A. Mackie, O. Beattie, and R.P. Evershed 2009 Probing Dietary Change of the Kwädąy Dän Ts’ìnchį Individual, an Ancient Glacier Body from British Columbia: II. Deconvoluting Whole Skin and Bone Collagen δ13C Values via Carbon Isotope Analysis of Individual Amino Acids. Journal of Archaeological Science 36(1): 12–18. Corr, L.T., M.P. Richards, S. Jim, S.H. Ambrose, A. Mackie, O. Beattie, and R.P. Evershed 2008 Probing Dietary Change of the Kwädąy Dän Ts’ìnchį Individual, an Ancient Glacier Body from British Columbia: I. Complementary Use of Marine Lipid Biomarker and Carbon Isotope Signatures as Novel Indicators of a Marine Diet. Journal of Archaeological Science 35(8): 2102–2110. Cremer, Kurt W. 1999 Willow Management for Australian Rivers. Natural Resource Management, Special Issue, Dec. 1999, pp 1–22. 2003 Introduced Willows Can Become Invasive Pests in Australia. Biodiversity 4(4): 17–24. Cronin, Matthew A., Michael D. Macneil, and John C. Patton 2005 Variation in Mitochondrial DNA and Microsatellite DNA in Caribou (Rangifer tarandus) in North America. Journal of Mammalogy 86(3): 495–505. Crowther, Alison, Michael Haslam, Nikki Oakden, Dale Walde, Julio Mercader 2014 Documenting Contamination in Ancient Starch Laboratories. Journal of Archaeological Science 49: 90–104. http://dx.doi.org/10.1016/j.jas.2014.04.023. Crubézy, Eric, Sylvain Amory, Christine Keyser, Caroline Bouakaze, Martin Bodner, Morgane Gibert, Alexander Röck, Walther Parson, Anatoly Alexeev, and Bertrand Ludes 2010 Human Evolution in Siberia: from Frozen Bodies to Ancient DNA. BMC Evolutionary Biology 10: 25.

198

Cruikshank, J. 1985 Contributions to the Oral History of the Kusawa Lake Region, Yukon Territory, from Mrs. Annie Ned. Report prepared for Archaeological Survey of Canada, National Museum of Man, National Museums of Canada. Available at the Yukon Heritage Branch, Box 2703, Whitehorse, Yukon Y1A 2C6, Canada. 2001 Glaciers and Climate Change: Perspectives from Oral Tradition. Arctic 54(4): 377–393. 2005 Do Glaciers Listen? Local Knowledge, Colonial Encounters, & Social Imagination. UBC Press, Vancouver, B.C. CSIRO 2011 War on Willows. Electronic document, http://www.csiro.au/Organisation- Structure/Divisions/Plant-Industry/WarWillows.aspx, accessed March 30, 2015. Cwynar, L.C. 1988 Late Quaternary Vegetation History of Kettlehole Pond, Southwestern Yukon. Canadian Journal of Forest Research 18(10): 1270–1279. doi: 10.1139/x88-196. Dauby, Gilles, Jérôme Duminil, Myriam Heuertz, and Olivier J. Hardy 2010 Chloroplast DNA Polymorphism and Phylogeography of a Central African Tree Species Widespread in Mature Rainforests: Greenwayodendron suaveolens (Annonaceae). Tropical Plant Biology 3(1): 4–13. doi:10.1007/s12042-010-9041-6. Danby, Ryan K., and David S. Hik 2007a Evidence of Recent Treeline Dynamics in Southwest Yukon from Aerial Photographs. Arctic 60(4): 411–420. 2007b Variability, Contingency and Rapid Change in Recent Subarctic Alpine Tree Line Dynamics. Journal of Ecology 95(2): 352–363. Davis, C. 1975 Some Notes On Plateau Athapaskan. In Proceedings of the Northern Athapaskan Conference 1971, vol. 2, pp. 619–29. National Museum of Man Mercury Series No. 27, Canadian Ethnology Service Paper. Ottawa: Canadian Museum of Civilization. Davis, S.D. 1990 Prehistory of Southeastern Alaska. In Handbook of North American Indians, vol. 7, Northwest Coast, edited by W.P. Suttles, pp 197–202. Washington, D.C., Smithsonian Instution Press. Decaëns, Thibaud, David Porco, Rodolphe Rougerie, George G. Brown, and Samuel W. James 2013 Potential of DNA Barcoding for Earthworm Research in Taxonomy and Ecology. Applied Soil Ecology 65: 35–42. doi:10.1016/j.apsoil.2013.01.001. Deguilloux, Marie-France, L. Bertel, A. Celant, M.H. Pemonge, L. Sadori, D. Magri, R.J. Petit 2006 Genetic Analysis of Archaeological Wood Remains: First Results and Prospects. Journal of Archaeological Science 33(9): 1216–1227. doi:10.1016/j.jas.2005.12.012. Deguilloux, Marie-France, Marie-Hélène Pemonge, and Rémy J. Petit 2004 DNA-Based Control of Oak Wood Geographic Origin in the Context of the Cooperage Industry. Annals of Forest Science 61: 97–104.

199

Deguilloux, Marie-France, Marie-Hélène Pemonge, L. Bertel, A. Kremer, and R. J. Petit 2003 Checking the Geographical Origin of Oak Wood: Molecular and Statistical Tools. Molecular Ecology 12(6): 1629–1636. doi:10.1046/j.1365-294X.2003.01836.x. Deguilloux, Marie-France, Marie-Hélène Pemonge, and Rémy J. Petit 2002 Novel Perspectives in Wood Certification and Forensics: Dry Wood as a Source of DNA. Philosophical Transactions of the Royal Society B: Biological Sciences 269(1495): 1039–46. doi:10.1098/rspb.2002.1982. Demeke, T. and R.P. Adams 1992 The Effects of Plant Polysaccharides and Buffer Additives On PCR. Biotechniques 12: 332–334. Derry, D.E. 1975 Later Athapaskan Prehsitory: A Migration Hypothesis. Western Canadian Journal of Anthropology 5(3–4): 134–147. DellaSala, D., L. Craighead, and R. Hagenstein 2015 Northern Pacific Coastal Forests. World Wildlife Fund, Online database of global ecoregions. Electronic document, https://www.worldwildlife.org/ecoregions/na0520, accessed January 30, 2015. DeSalle, Rob 2006 Species Discovery Versus Species Identification in DNA Barcoding Efforts: Response to Rubinoff. Conservation Biology: The Journal of the Society for Conservation Biology 20(5): 1545–7. doi:10.1111/j.1523-1739.2006.00543.x. DeSalle, Rob, J. Gatesy, W. Wheeler, and D. Grimaldi 1992 DNA Sequences from a Fossil Termite in Oligo-Miocene Amber and Their Phylogenetic Implications. Science 257(5078): 1933–1936. Diamond, J. 2002 Evolution, Consequences and Future of Plant and Animal Domestication. Nature 418: 700–707. Dickson, J.H., and P. Mudie 2008 The Life and Death of Kwäday Dän Ts’ìnchí, an Ancient Frozen Body from British Columbia: Clues from Remains of Plants and Animals. Northern Review 28: 27–50. Dickson, J.H., M.P. Richards, R.J. Hebda, P.J. Mudie, O. Beattie, S. Ramsay, N.J. Turner, B.J. Leighton, J.M. Webster, N.R. Hobischak, G.S. Anderson, P.M. Troffe, and R.J. Wigen 2004 Kwäday Dän Ts’ìnchí, the First Ancient Body of a Man from a North American Glacier: Reconstructing His Last Days by Intestinal and Biomolecular Analyses. The Holocene 14(4): 481–486. Dillehay, T.D. 1989 Monte Verde: A Late Pleistocene Settlement in Chile. Smithsonian Institution Press, Washington.

200

Dillehay, T.D, C. Ramírez, M. Pino, M.B. Collins, J. Rossen, and J.D. Pino-Navarro 2008 Monte Verde: Seaweed, Food, Medicine, and the Peopling of South America. Science 320(5877): 784–786. Di Pinto, Angela, Pietro Di Pinto, Valentina Terio, et al. 2013 DNA Barcoding for Detecting Market Substitution in Salted Cod Fillets and Battered Cod Chunks. Food Chemistry 141(3): 1757–1762. doi:10.1016/j.foodchem.2013.05.093. Dixon, E.J. 1985 Cultural Chronology of Central Interior Alaska. Arctic Anthropology 22(1): 47–66. 1999 Bones, Boats, and Bison: Archaeology and the First Colonization of Western North America. University of New Mexico Press, Albuquerque. 2011 Arrows, Atlatls, and Cultural-Historical Conundrums. In From the Yenisei to the Yukon: Interpreting Lithic Assemblage Variability in Late Pleistocene/Early Holocene Beringia, edited by T. Goebel and I. Buvit, pp. 362–370. Texas A&M University Press, College Station. Dixon, E.J., W.F. Manley, and C.M. Lee 2005 The Emerging Archaeology of Glaciers and Ice Patches: Examples from Alaska’s Wrangell-St. Elias National Park and Preserve. American Antiquity 70(1): 129–143. Dixon, R.M.W. 1997 The Rise and Fall of Languages. Cambridge: Cambridge University Press. Donald, L. 2003 The Northwest Coast as a Study Area: Natural, Prehistoric, and Ethnographic Issues. In Emerging from the Mist: Studies in Northwest Coast Culture History, edited by R.G. Matson, G. Coupland, and Q. Mackie, pp. 289–327. UBC Press, Vancouver, BC. Duminil, J., and M. Di Michele 2009 Plant Species Delimination: A Comparison of Morphological and Molecular Markers. Plant Biosystems 143(3): 528–542. Dumond, D.E. 1969 Toward a Prehistory of the Na-Dene, with a General Comment on Population Movements among Nomadic Hunters. American Anthropologist 71(5): 857–863. 2011 Technology, Typology, and Subsitence: a Partly Contrarian Look at the Peopling of Beringia. In From the Yenisei to the Yukon: Interpreting Lithic Assemblage Variability in Late Pleistocene/Early Holocene Beringia, edited by T. Goebel and I. Buvit, pp. 345–361. Texas A&M University Press, College Station. Dumond, D.E., W. Ham, and R. Stuckenrath 1976 Archaeology and Prehistory On the Alaska Peninsula. Anthropological Papers of the University of Alaska 18(1): 17–29. Dumolin-Lapègue, S, M H Pemonge, L Gielly, P Taberlet, and R J Petit 1999 Amplification of Oak DNA from Ancient and Modern Wood. Molecular Ecology 8(12): 2137–2140.

201

Dunmore, J., and de Brossard, M. 1985 Le Voyage de Lapérouse, 1785–1788. 2 Vols. Paris: Imprimerie Nationale. Dyck, Ian, and Richrd E. Morlan 1995 The Sjovold Site: A River Crossing Campsite in the Northern Plains. Mercury Series Archaeological Survey of Canada Paper No. 151. Canadian Museum of Civilization, Hull, Québec. Dyen, Isadore, and David F. Aberle 1974 Lexical Reconstruction: The Case of the Proto-Athapaskan Kinship System. Cambridge: Cambridge University Press. Dyke, A.S. 2004 An Outline of North American Deglaciation with Emphasis On Central and Northern Canada. In Quaternary Glaciations – Extent and Chronology, Vol. 2, Part 2: North America, edited by J. Ehlers, and P.L. Gibbard. Elsevier Science and Technology, Amsterda, N.L.D. Eckhart, L., J. Bach, J. Ban, and E. Tschachler 2000 Melanin Binds Reversibly to Thermostable DNA Polymerase and Inhibits its Activity. Biochemical and Biophysical Research Communications. 271: 726–730. Edgar, R.C. 2004a MUSCLE: Multiple Sequence Alignment with High Accuracy and High Throughput. Nucleic Acids Research 32(5):1792–1797. 2004b MUSCLE: A Multiple Sequence Alignment Method with Reduced Time and Space Complexity. BMC Bioinformatics 5: 113. Eerkens, J.W., and R.L. Bettinger 2001 Techniques for Assessing Standardization in Artifact Assemblages: Can We Scale Material Variability? American Antiquity 66(3): 493–504. Eerkens, J.W., and C.P. Lipo 2005 Cultural Transmission, Copying Errors, and the Generation of Variation in Material Culture and the Archaeological Record. Journal of Anthropological Archaeology 24: 316– 334. Egg, M., and K. Spindler 2009 Kleidung und Ausrüstung der kupferzeitlichen Gletschermumie aus den Ötztaler Alpen. Der Mann im Eis 6. Mainz: Verlag des Römisch-Germanischen Zentralmuseums. Elbaum, R., C. Melamed-Bessudo, N. Tuross, A.A. Levy, and S. Weiner 2009 New Methods to Isolate Organic Materials from Silicified Phytoliths Reveal Fragmented Glycoproteins but No DNA. Quaternary International 193(1–2): 11–19. Elias, S.A., S.K. Short, C.H. Nelson, and H.H. Birks 1996 Life and Times of the Bering Land Bridge. Nature 382: 60–63. Eliet, J.R., and S.A. Harbison 2006 The Development of a DNA Analysis System for Pollen. International Congress Series 1288: 825–827. doi:10.1016/j.ics.2005.09.012.

202

Emmons, George Thorton 1991 The Tlingit Indians. Edited with additions by Frederica de Laguna and Jean Low. University of Washington Press and American Museum of Natural History, Seattle, London, and New York. Erickson, David L., Bruce D. Smith, Andrew C. Clarke, Daniel H. Sandweiss, and Noreen Tuross 2005 An Asian Origin for a 10,000-Year-Old Domesticated Plant in the Americas. Proceedings of the National Academy of Sciences of the United States of America 102(51): 18315–20. doi:10.1073/pnas.0509279102. Esdale, J.A. 2008 A Current Synthesis of the Northern Archaic. Arctic Anthropology 45(2): 3–38. Eurlings, Marcel C.M., Henry Heuveling van Beek, and Barbara Gravendeel 2010 Polymorphic Microsatellites for Forensic Identification of Agarwood (Aquilaria crassna). Forensic Science International 197(1–3): 30–34. Eurofins Genomics 2015 DNA Sequencing Troubleshooting Guide. Electronic document, http://www.operon.com/services/dna-sequencing/troubleshooting.pdf. Accessed: March 12, 2015. Fang, Zhen-Fu 1987 On the Distribution and Origin of Salix in the World. Phytotax Sin 25:307-312. Farbegd, O. 1972 Pilefunn frå Oppdalsfjella [Arrow finds from the Oppdal Mountains]. Det Kgl. Norske Videnskabers Selskab, Museet, Miscellanea 5. Trondheim, Norway. 105–117. Summary in English (105–109). 1983 Snøfonner, pilefunn og dyregraver [Snow patches, arrow finds and pitfalls]. Det Kgl. Norske Videnskabers Selskab, Museet, Rapport A 1983:5. 7–46. 1991 Gamle jaktpiler i snøfonner [Old hunting arrows on snow patches]. Bom i jakta arkeologisk fulltreff [Hunting miss–archaeological bull’s-eye]. SPOR No. 2. 4–10. Farnell, R., P.G. Hare, E. Blake, V. Bowyer, C. Schweger, S. Greer, and R. Gotthardt 2004 Multidisciplinary Investigations of Alpine Ice Patches in Southwest Yukon, Canada: Paleoenvironmental and Paleobiological Investigations. Arctic 57(3): 247–259. Fast, P.A. 1990 Naatsilanei and Ko’Ehdan: A Semiotic Analysis of Two Alaska Native Myths. Master’s Thesis, Anthropology and English, University of Alaska Anchorage. Fazekas, Aron J., Kevin S. Burgess, Prasad R. Kesanakurti, Sean W. Graham, Steven G. Newmaster, Brian C. Husband, Diana M. Percy, Mehrdad Hajibabaei, and Spencer C.H. Barrett 2008 Multiple Multilocus DNA Barcodes from the Plastid Genome Discriminate Plant Species Equally Well. PloS ONE 3(7): e2802.

203

Fazekas A.J., P.R. Kesanakurti, K.S. Burgess, D.M. Percy, S.W. Graham, S.C. Barrett, S.G. Newmaster, M. Hajibabaei, B.C. Husband 2009 Are Plant Species Harder to Discriminate than Animal Species Using DNA Barcoding Markers? Molecular Ecological Resources, 9: 130–139. doi: 10.1111/j.1755- 0998.2009.02652.x. Fedje, D.W., and T. Christensen 1999 Modeling Paleoshorelines and Locating Early Holocene Coastal Sites in Haida Gwaii. American Antiquity 64(4): 635–652. Fedje, D.W., and H. Josenhans 2000 Drowned Forests and Archaeology On the Continental Shelf of British Columbia, Canada. Geology 28: 99–102. Fedje, D. W., T. Christensen, H. Josenhans, J. Strang, and J. B. McSporran 2005 Millennial Tides and Shifting Shores: Archaeology on a Dynamic Landscape. In Haida Gwaii, Human History and Environment from the Time of Loon to the Time of the Iron People, edited by D.W. Fedje and R.W. Mathewes, pp. 163–186. UBC Press, Vancouver. Fedje, D.W, H. Josenhans, J.J. Clague, J.V. Barrie, D. Archer, and J.R. Southon 2005 Hecate Strait Paleoshorelines. In Haida Gwaii, Human History and Environment from the Time of Loon to the Time of the Iron People, edited by D.W. Fedje and R.W. Mathewes, pp. 21–37. UBC Press, Vancouver. Fedje, D.W., W. Mackie, N. Smith, and D. Mclaren 2011 Function, Visibility, and Interpretation of Archaeological Assemblages at the Pleistocene/Holocene Transition in Haida Gwaii. In From the Yenisei to the Yukon: Interpreting Lithic Assemblage Variability in Late Pleistocene/Early Holocene Beringia, edited by T. Goebel and I. Buvit, pp. 323–344. Texas A&M University Press, College Station. Fedje, D.W., M.P. Magne, and T. Christensen 2005 Test Excavations at Raised Beach Sites in Southern Haida Gwaii and Their Significance to Northwest Coast Archaeology. In Haida Gwaii, Human History and Environment from the Time of Loon to the Time of the Iron People, edited by D. W. Fedje and R. W. Mathewes, pp. 204–244. UBC Press, Vancouver. Fenn, M.E., T.G. Huntington, S.B. McLaughlin, C. Eagar, A. Gomez, and R.B. Cook 2006 Status of Soil Acidification in North America. Journal of Forest Science 52: 3–13. Festa-Bianchet, M., J.C. Ray, S. Boutin, S.D. Côté, and A. Gunn 2011 Conservation of Caribou (Rangifer tarandus) in Canada: An Uncertain Future. Canadian Journal of Zoology 89(5): 419–434. Finkeldey, R., Y. Rachmayanti, and O. Gailing 2007 Molecular Genetic Tools for the Identification of the Origin of Wood. In Wood Production, Wood Technology, and Biotechnological Impacts, edited by U. Kües, pp. 143– 158. Goettinger Universitaetsverlag, Goettingen, Germany.

204

Fladmark, K.R. 1982 An Introduction to the Prehistory of British Columbia. Canadian Journal of Archaeology 6:95–156. Flenniken, J.J. 1987 The Paleolithic Dyuktai Pressure Blade Technique of Siberia. Arctic Anthropology 24(2): 117–132. Flensenstein J. 1985 Confidence Limits on Phylogenies: An Approach Using the Bootstrap. Evolution 39: 783–791. Foley, B.P., M.C. Hansson, D.P. Kourkoumelis, and T.A. Theodoulou 2012 Aspects of Ancient Greek Trade Re-Evaluated with Amphora DNA Evidence. Journal of Archaeological Science 39(2): 389–398. doi:10.1016/j.jas.2011.09.025. Foster, Michael K. 1996 Language and Culture History of North America. In Handbook of North American Indians, vol. 17, edited by Ives Goddard, pp. 64–110. Washington, DC: Smithsonian Institution. Fraser, L., and J. Strzezek 2005 Effects of Freezing-Thawing on DNA Integrity of Boar Spermatozoa Assessed by the Neutral Comet Assay. Reproduction in Domestic Animals 40(6): 530–536. Free, J. B. 1970 Insect Pollination of Crops. Academic Press. London. Freeland, J.R., H. Kirk, S.D. Petersen 2011 Molecular Ecology: Second Edition. Wiley-Blackwell, U.K. Frison, G.C. 1978 Prehistoric Hunters of the High Plains. Academic Press, New York. Fritz, G.J. 2005 Paleoethnobotanical Methods and Applications. In Handbook of Archaeological methods, Vol. II, edited by H.D.G. Maschner and C. Chippindale, pp. 773–834. Alta Mira Press, New York. Funk, Daniel J., and Kevin E. Omland 2003 Species-Level Paraphyly and Polyphyly: Frequency, Causes, and Consequences, with Insights from Animal Mitochondrial DNA. Annual Review of Ecology, Evolution, and Systematics 34(1): 397–423. doi:10.1146/annurev.ecolsys.34.011802.132421. Galloway, J.M., J. Adamczewski, D.M. Schock, T.D. Andrews, G. MacKay, V.E. Bowyer, T. Meulendyk, B.J. Moorman, and S.J. Kutz 2012 Diet and Habitat of Mountain Woodland Caribou Inferred from Dung Preserved in 5000- Year-Old Alpine Ice in the Selwyn Mountains, Northwest Territories, Canada. Arctic 65(1): 59–79. Giddings, J.L., Jr. 1964 The Archeology of Cape Denbigh. Brown University Press, Providence.

205

Gignoux, C.R., B.M. Henn, and J.L. Mountian 2011 Rapid, Global Demographic Expansions after the Origins of Agriculture. Proceedings of the National Academy of Sciences 108: 6055–6049. Gilbert, M.T.P., H-J. Bandelt, M. Hofreiter, and I. Barnes 2005 Assessing Ancient DNA Studies. Trends in Ecology & Evolution 20(10): 541–544. doi:10.1016/j.tree.2005.07.005. Gilbert, M.T.P., T. Kivisild, B. Grønnow, et al. 2008 Paleo-Eskimo mtDNA Genome Reveals Matrilineal Discontinuity in Greenland. Science 320(5884): 1787–9. doi:10.1126/science.1159750. Glave, E.J. 1980 The Alaska Expedition. Frank Leslie’s Illustrated Newspaper 70:84, 86, 87, 266, 286– 287, 310, 328, 332, 352, 374–376, 396-97, 485, 572. 1891 The Alaska Expedition. Frank Leslie’s Illustrated Newspaper 71:414, 438. 1892a Pioneer Packhorses in Alaska. 1: The Advance. Century Illustrated Monthly Magazine 44(5): 671–82. New York and London. 1892b Pioneer Packhorses in Alaska. 2: The Return to the Coast. Century Illustrated Monthly Magazine 44(6): 869–81. New York and London. Glenn, J.W. 1955 The Crop of Polycrystalline Ice. Proceedings of the Royal Society of London Series: A, 228: 519–538. Goddard, I. 1996 The Classification of the Native Languages of North America. In Handbook of North American Indians, vol 17, Languages, edited by I. Goddard, pp. 290–323. Washington, DC: Smithsonian Institution. Goebel, T. 2004 The Search for a Clovis Progenitor in Sub-Arctic Siberia. In Entering America: Northeast Asia and Beringia before the Last Glacial Maximum, edited by D.B. Madsen, pp. 311–356. University of Utah Press, Salt Lake City. Goebel, T., and I. Buvit 2011a Introducting the Archaeological Record of Beringia. In From the Yenisei to the Yukon: Interpreting Lithic Assemblage Variability in Late Pleistocene/Early Holocene Beringia, edited by T. Goebel and I. Buvit, pp. 1–32. Texas A&M University Press, College Station. Goebel, T., and I. Buvit (editors) 2011b From the Yenisei to the Yukon: Interpreting Lithic Assemblage Variability in Late Pleistocene/Early Holocene Beringia. Texas A&M University Press, College Station. Goebel, T., R. Powers, and N. Bigelow 1991 The Nenana Complex of Alaska and Clovis Origins. In Clovis Origins and Adaptations, edited by R. Bonnichsen and K.L. Turnmire, pp 49–79. Center for the Study of the First Americans, Oregon State University. Corvallis.

206

Goebel, T., H.L. Smith, L. DiPietro, M.R. Waters, B. Hockett, K.E. Graf, R. Gal, S.B. Slobodin, R.J. Speakman, S.G. Driese, and D. Rhode 2013 Serpentine Hot Springs, Alaska: Results of Excavations and Implications for the Age and Significance of Northern Fluted Points. Journal of Archaeological Science 40(12): 4222– 4233. Goebel, T., M.R. Waters, and M. Dikova 2003 The Archaeology of Ushki Lake, Kamchatka, and the Pleistocene Peopling of the Americas. Science 301(5632): 501–505. Goebel, T., M.R. Waters, and D.H. O’Rourke 2008 The Late Pleistocene Dispersal of Modern Humans in the Americas. Science 319(5869): 1497–502. Golenberg E.M., D.E. Giannasi, M.T. Clegg, C.J. Smiley, M. Durbin, D. Henderson, and G. Zurawski 1990 Chloroplast DNA Sequence from a Miocene Magnolia Species. Nature 344(6267): 656– 658. Golenberg, E.M. 1991 Amplification and Analysis of Miocene Plant Fossil DNA. Philosophical transactions of the Royal Society of London. Series B, Biological sciences 333(1268): 419–27. doi:10.1098/rstb.1991.0092. Gonzalez, M.A. 2002 Continental Divides in North Dakota and North America. North Dakota Geological Survey Newsletter 30(1): 1–7. Gotthardt, R.M. 1990 The Archaeological Sequence in the Northern Cordillera: A Consideration of Typology and Traditions. Occasional Papers in Archaeology No.1. Tourism Yukon, Heritage Branch, Hudē̜ Hudā̈ n Series. Whitehorse. 1993 Preliminary Archaeological Inventory Proposed Tombstone Mountain Territorial Park. On file with Heritage Branch, Government of Yukon, Whitehorse. Green, R.E, A.W. Briggs, J. Krause, et al. 2009 The Neandertal Genome and Ancient DNA Authenticity. The EMBO journal 28(17): 2494–502. doi:10.1038/emboj.2009.222. Green, R.E., J. Krause, A.W. Briggs, et al. 2010 A Draft Sequence of the Neandertal Genome. Science (New York, N.Y.) 328(5979): 710– 22. doi:10.1126/science.1188021. Green, R.E., J. Krause, S.E. Ptak, A.W. Briggs, M.T. Ronan, J.F. Simons, L. Du, M. Egholm, J.M. Rothberg, M. Paunovic, and S. Paabo 2006 Analysis of One Million Base Pairs of Neanderthal DNA. Nature 444: 330–336, doi:10.1038/nature05336.

207

Greer, S.C. 1983 Site Locations and Archaeologically Significant Areas in the Southern Lakes District, Yukon Territory. On file, Archaeological Survey of Canada, Canadian Museum of Civilization. Hull. 1986 Kusawa Lake Archaeology: Management, Research and Interpretation. Report prepared for the Archaeological Survey of Canada, National Museum of Man, National Museums of Canada and Parks Planning, Department of Renewable Resources, Government of Yukon. Available at the Yukon Heritage Branch, Box 2703, Whitehorse, Yukon Y1A 2C6, Canada. 1993 A Southern Yukon Mid-Holocene Cultural Complex. Canadian Journal of Archaeology 17: 26–42. Gregory, T.R. 2005 DNA Barcoding Does Not Compete with Taxonomy. Nature 434(7037): 1067. doi:10.1038/4341067a. Gugerli, Felix, Laura Parducci, and Rémy J. Petit 2005 Ancient Plant DNA: Review and Prospects. The New phytologist 166(2): 409–418. doi:10.1111/j.1469-8137.2005.01360.x. Guicking, Daniela, Brigitte Fiala, Frank R. Blattner, et al. 2011 Comparative Chloroplast DNA Phylogeography of Two Tropical Pioneer Trees, Macaranga Gigantea and Macaranga pearsonii (Euphorbiaceae). Tree Genetics & Genomes 7(3): 573–585. doi:10.1007/s11295-010-0357-z. Gutiérrez, G., and A. Marin 1998 The Most Ancient DNA Recovered from an Amber-Preserved Specimen May Not Be as Ancient as It Seems. Molecular Biology and Evolution 15(7): 926–929. Hafner, A. 2012 Archaeological Discoveries on Schnidejoch and at Other Ice Sites in the European Alps. Arctic 65(1): 189–202. Hagelberg, E., B. Sykes, and R. Hedges 1989 Ancient Bone DNA Amplified. Nature 342: 485. Hagenstein, R. and T. Ricketts 2015 Copper Plateau Taiga. World Wildlife Fund, Online database of global ecoregions. Electronic document, https://www.worldwildlife.org/ecoregions/na0604, accessed January 30, 2015. Hagenstein, R., T. Ricketts, J. Peepre, M. Sims, K. Kavanagh and G. Mann 2015 Interior Alaska-Yukon Lowland Taiga. World Wildlife Fund, Online database of global ecoregions. Electronic document, https://www.worldwildlife.org/ecoregions/na0607, accessed January 30, 2015. Haile, J., R. Holdaway, K. Oliver, et al. 2007 Ancient DNA Chronology Within Sediment Deposits: Are Paleobiological Reconstructions Possible and Is DNA Leaching a Factor? Molecular Biology and Wvolution 24(4): 982–9. doi:10.1093/molbev/msm016.

208

Haile, J., D.G. Froese, R.D.E. MacPhee, R.G. Roberts, L.J. Arnold, A.V. Reyes, M. Rasmussen, R. Nielsen, B.W. Brook, S. Robinson, M. Demuro, M.T.P. Gilbert, K. Munch, J.J. Austin, A. Cooper, I. Barnes, P. Moller, and E. Willerslev 2009 Ancient DNA Reveals Late Survival of Mammoth and Horse in Interior Alaska. Proceedings of the National Academy of Sciences USA 106(52): 22352–22357. doi:10.1073/pnas.0912510106 Hajibabaei M., D.H. Janzen, J.M. Burns, W. Hallwachs, P.D.N. Hebert 2006 DNA Barcodes Distinguish Species of Tropical Lepidoptera. Proceedings of the National Academy of Sciences USA 103: 968–971. Hall, T.A. 1999 BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. Hansen, Anders J., David L. Mitchell, Carsten Wiuf, Lakshmi Paniker, Tina B. Brand, Jonas Binladen, David A. Gilichinsky, Regin Rønn, and Eske Willerslev 2006 Crosslinks Rather Than Strand Breaks Determine Access to Ancient DNA Sequences from Frozen Sediments. Genetics 173(2): 1175–1179. Hansen, A.K., L.K. Escobar, L.E. Gilbert, and R.K. Jansen 2007 Paternal, Maternal, and Biparental Inheritance of the Chloroplast Genome in Passiflora (Passifloraceae): Implications for Phylogenetic Studies. American Journal of Botany 94(1): 42–46. Hardig, T.M., S.J. Brunsfeld, R.S. Fritz, M. Morgan, C.M. Orians 2000 Morphological and Molecular Evidence for Hybridization and Introgression in a Willow (Salix) Hybrid Zone. Molecular Ecology 9: 9–24. Hare, P.G. 1995 Holocene Occupations in the Southern Yukon: New Perspectives from the Annie Lake Site. Occasional Papers in Archaeology Vol. 5. Heritage Branch, Government of the Yukon, Whitehorse. Hare, P.G., S. Greer, R. Gotthardt, R. Farnell, V. Bowyer, C. Schweger, and D. Strand 2004 Ethnographic and Archaeological Investigations of Alpine Ice Patches in Southwest Yukon, Canada. Arctic 57(3): 260–272. Hare P.G., S. Greer, R.M. Gotthardt, and D. Strand 2001 What’s the Point? New Insights into Projectile Technology from Ice Patches in Southern Yukon. Paper presented at the 34th Annual Conference of the Canadian Archaeological Association, Banff, Alberta. 2005 The Effect of the White River Ash on the Archaeological Record—a View from the Yukon Alpine. Paper presented at the Rapid Landscape Change and Human Response in the Arctic and Sub-Arctic interdisciplinary meeting, Whitehorse, Yukon, Canada. Hare, P.G., S. Greer, H. Jones, R. Mombourquette, J. Fingland, M. Nelson, and J. Shorty 2011 The Frozen Past: The Yukon Ice Patches. Yukon Tourism and Culture, Government of Yukon. Electronic document, accessed March 30, 2015. http://www.tc.gov.yk.ca/publications/The_Frozen_Past_the_Yukon_Ice_Patches_2011.pdf

209

Hare, P.G., C.D. Thomas, T.N. Topper, and R.M. Gotthardt 2012 The Archaeology of Yukon Ice Patches: New Artifacts, Observations, and Insights. Arctic 65(1): 118–135. Hart, C.J.R. and J.K. Radloff 1990 Geology of Whitehorse, Alligator Lake, Fenwick Creek, Carcross and part of Robinson Map Areas (105D/11, 6, 3, 2, & 7). Indian and Northern Affairs Canada: Yukon Region Open File 1990–1994. Whitehorse, Yukon. Hartnup, K., L. Huynen, R.T. Kanawa, et al. 2011 Ancient DNA Recovers the Origins of Māori Feather Cloaks. Molecular Biology and Evolution 28(10): 2741–50. doi:10.1093/molbev/msr107. Hassel K., R. Segreto, and T. Ekrem 2013 Restricted Variation in Plant Barcoding Markers Limits Identification in Closely Related Bryophyte Species. Molecular Ecology Resources, 13: 1047–1057. Haynes, G., D.G. Anderson, C.R. Ferring, S.J. Fiedel, D.K. Grayson, C.V. Haynes, V.T. Holliday, B.B. Huckell, M. Kornfeld, D.J. Meltzer, J. Morrow, T. Surovell, N.M. Waguespack, P. Wigand, and R.M. Yohe 2007 Comment on “Redefining the Age of Clovis: Implications for the Peopling of the Americas”. Science 317(5836): 320. Heaton, T.H., and F. Grady 2003 The Late Wisconsin Vertebrate History of Prince of Wales Island, Southeast Alaska. In Ice Age Cave Faunas of North America, edited by B.W. Schubert, J.I. Mean, and R.W. Grahm, pp. 17–53. Indiana University Press, Bloomington. Heaton, T.H., S.L. Talbot, and G.F. Shields 1996 An Ice Age Refigium for Large Mammals in the Alexander Archipelago, Southeastern Alaska. Quaternary Research 46: 186–192. Hebert, P.D.N., A. Cywinska, S.L. Ball, and J.R. DeWaard 2003 Biological Identifications Through DNA Barcodes. Philosophical Transactions of the Royal Society B: Biological Sciences 270(1512): 313–21. doi:10.1098/rspb.2002.2218. Hebert P.D.N., S. Ratnasingham, J.R. DeWaard 2003 Barcoding Animal Life: Cytochrome C Oxidase Subunit 1 Divergences among Closely Related Species. Philosophical Transactions of the Royal Society B: Biological Sciences 270: S596–S599. Herbert, P.D.N., M.Y. Stoeckle, T.S. Zemlak, C.M. Francis 2004 Identification of Birds through DNA Barcodes. Public Library of Science Biology 2: 1657–1663. Hebblewhite, M., C. White, and M. Musiani 2010 Revisiting Extinction in National Parks: Mountain Caribou in Banff. Conservation Biology 24(1): 341–344.

210

Henson, J.M. and R. French 1993 The Polymerase Chain Reaction and Plant Disease Diagnosis. Annual Review of Phytopathology 31: 81–109. Herrmann, B., and S. Hummel 1994 Ancient DNA: Recovery and Analysis of Genetic Material from Paleontological, Archaeological, Museum, Medical, and Forensic Specimens. Springer-Verlag, New York. Higuchi, R., B. Bowman, M. Freiberger, O.A. Ryder, and A.C. Wilson 1984 DNA Sequences from the Quagga, an Extinct Member of the Horse Family. Nature 312(15): 282–284. Holdsworth, G. and T. Lacourse 2015 Discovery of Mid Third Millennium B.P. Wood at ‘Ogilvie Pass’ in the St. Elias Mountains of Canada. Manuscript on File. Arctic Institute of North America, University of Calgary, Calgary, AB, Canada. Hoffecker, J.F. and S.A. Elias 2007 Human Ecology of Beringia. Columbia University Press, New York. Hofreiter, M., D. Serre, H.N. Poinar, M. Kuch, and S. Pääbo 2001 Ancient DNA. Nature Reviews. Genetics 2(5): 353–359. doi:10.1038/35072071. Hoijer, H. 1956 Athapaskan Kinship Systems. American Anthropologist 58: 309–333. Hollingsworth P.M., S.W. Graham, D.P. Little DP 2011 Choosing and Using a Plant DNA Barcode. PLoS ONE 6: e19254. Holly, D.H. Jr. 2002 Subarctic “Prehistory” in the Anthropological Imagination. Arctic Anthropology 39(1– 2): 10–26. Holmes, C.E. 1996 Broken Mammoth. In American Beginnings: The Prehistory and Paleoecology of Beringia, edited by F.H. West, pp. 312–318. The University of Chicago Press, Chicago. 2001 Tanana River Valley Archaeology Circa 14,000 to 9000 BP. Arctic Anthropology 38(2): 154–170. 2008 The Taiga Period: Holocene Archaeology of the Northern Boreal Forest, Alaska. Alaska Journal of Anthropology 6(1): 69–82. 2011 The Beringian and Transitional Periods in Alaska: Technology of the East Beringian Tradition as Viewed from Swan Point. In From the Yenisei to the Yukon: Interpreting Lithic Assemblage Variability in Late Pleistocene/Early Holocene Beringia, edited by T. Goebel and I. Buvit, pp. 179-191. Texas A&M University Press, College Station. Höpfel, F., W. Platzer, W., and K. Spindler 1992 Der Mann im Eis. Bericht über das Internationale Symposium 1992 in Innsbruck. Innsbruck: Eigenverlag der Uni Innsbruck.

211

Hu, F.S., L.B. Brubaker, and P.M. Anderson 1996 Boreal Ecosystem Development in the Northwestern Alaska Range since 11,000 yr BP. Quaternary Research 45: 188–201. Huang, D.I., C.A. Hefer, N. Kolosova, C.J. Douglas, and Q.C. Cronk 2014 Whole Plastome Sequencing Reveals Deep Plastid Divergence and Cytonuclear Discordance between Closely Related Balsam Poplars, Populus balsamifera and P. trichocarpa (Salicaceae). New Phytologist 204(3): 693–703. Hughes, O.L. 1990 Surficial Geology and Geomorphology Aishihik Lake, Yukon Territory. Geological Survey of Canada. Paper 87–29. Energy, Mines and Resources Canada. Ottawa, Ontario. Hughey, J.R., M. Du, Q. Li, M. Michalodimitrakis, and G. Stamatoyannopoulos 2012 A Search for β Thalassemia Mutations in 4000 Year Old Ancient DNAs of Minoan Cretans. Blood Cells, Molecules & Diseases 48(1): 7–10. doi:10.1016/j.bcmd.2011.09.006. Huggett, J.F., T. Novak, J.A. Garson, C. Green, S.D. Morris- Jones, R.F. Miller, and A. Zumla 2008 Differential Susceptibility of PCR Reactions to Inhibitors: An Important and Unrecognised Phenomenon. BMC Research Notes 1: 70. Hummel, S. 2003 Ancient DNA Typing - Methods, Strategies and Applicalicationes.Springer Verlag: Berlin, Heidelber, New York. Hunan Medical College 1980 Study of an Ancient Cadaver in Mawangtui Tomb No. 1 of the Han Dynasty in Changsha. Beijin: Ancient Memorial Press, 184–187. Hunley, J., and J.C. Long 2005 Gene Flow Across Linguistic Boundaries in Native North American Populations. Proceedings of the National Academy of Sciences 102: 1312–1317. Ion, P.G., and G.P. Kershaw, 1989 The Selection of Snow Patches as Relief Habitat by Woodland Caribou (Rangifer tarandus caribou), Macmillan Pass, Selwyn/Mackenzie Mountains, N.W.T., Canada. Arctic and Alpine Research 21(2): 203–211. Irving, W.N. and J. Cinq-Mars 1974 A Tentative Archaeological Sequence for Old Crow Flats, Yukon Territory. Arctic Anthropology 11(supplement): 65–81. Irwin, H.T. and H.M. Wormington 1970 Paleo-Indian Tool Types in the Great Plains. American Antiquity 35(1): 24–34. Isagi, Y., and Y. Suyama 2011 Single Pollen Genotyping. Springer, New York.

212

Ives, J.W. 1990 A Theory of Northern Athapaskan Prehistory. Westview Press and University of Calgary Press, Calgary, Alberta. 2008 Review of "Athapaskan Migrations: The Archaeology of Eagle Lake, British Columbia". Canadian Journal of Archaeology 32: 153–159. Janowicz, Ric. 2004 Watersheds and Hydrologic Regions. In Ecoregions of the Yukon Territory: Biophysical properties of Yukon landscapes, edited by C.A.S. Smith, J.C. Meikle and C.F. Roots, pp. 15–18. Agriculture and Agri-Food Canada, PARC Technical Bulletin No. 04-01, Summerland, British Columbia. Jiao, L., Y. Yin, F. Xiao, Q. Sun, K. Song, and X. Jiang 2012 Comparative Analysis of Two DNA Extraction Protocols from Fresh and Dried Wood of Cunninghamia lanceolata (Taxodiaceae). IAWA Journal 33(4): 441–456. Jiao, Lichao, Yafang Yin, Yeming Cheng, and Xiaomei Jiang 2013 DNA Barcoding for Identification of the Endangered Species Aquilaria sinensis: Comparison of Data from Heated or Aged Wood Samples. Holzforschung(1): 1–8. John, M.E. 1992 An Efficient Method for Isolation of RNA and DNA from Plants Containing Polyphenolics. Nucleic Acids Research 20: 2381. Johnstone, R.A., and G.D.D. Hurst 1996 Maternally Inherited Male‐Killing Microorganisms May Confound Interpretation of Mitochondrial DNA Variability. Biological Journal of the Linnean Society 58: 453–470. Judd, W.S. 1997 The Flacourtiaceae in the Southeastern United States. Harvard Papers in Botany 10: 65– 79. Kasem, S., N. Rice, and R.J. Henry 2008 DNA Extraction from Plant Tissue. In Plant Genotyping II: SNP technology, edited by R.J. Henry, pp. 219–271. CABI, London. Katzenberg, M.A., G. Oetelaar, J. Oetelaar, et al. 2005 Identification of Historical Human Skeletal Remains: A Case Study Using Skeletal and Dental Age, History and DNA. International Journal of Osteoarchaeology 15(1): 61–72. doi:10.1002/oa.748. Kaufman, D.S., and W.F. Manley 2004 Pleistocene Maximum and Late Wisconsian Glacier Extents Across Alaska, U.S.A. In Quaternary Glaciations Extent and Chronology. Part 2: North America, edited by J. Ehlers and P.L. Gibbard, pp. 9–27. Elsevier, Amsterdam. Keenan, T.J., and L.C. Cwynar 1992 Late Quaternary History of Black Spruce and Grasslands in Southwest Yukon Territory. Canadian Journal of Botany 70: 1336–1345. doi:10.1139/b92-168.

213

Keigwin, L.D., J.P. Donnelly, M.S. Cook, N.W. Driscoll, and J. Brigham-Grette 2006 Rapid Sea-Level Rise and Holocene Climate in the Chukchi Sea. Geology 34(10): 861. Keith, G. 1890 Letters to Mr. Roderic McKenzie, 1807–1817. The Mackenzie River and Great Bear Lake Departments. In Les bourgeois de la Compagnie du Nord-Ouest, Volume II, pp. 5– 132. Quebec: De LÌmprimerie Générale A. Coté. Kelly, E.F., R.G. Amundson, B.D. Marino, and M.J. DeNiro 1991 Stable Isotope Ratios of Carbon in Phytoliths as a Quantitative Method of Monitoring Vegetation and Climate Change. Quaternary Research 35:222–233. Kemp, Brian M., and David Glenn Smith 2005 Use of Bleach to Eliminate Contaminating DNA from the Surface of Bones and Teeth. Forensic Science International 154: 53–61. Kemp, B.M., and D.G. Smith 2010 Ancient DNA Methodology: Thoughts from Brian M. Kemp and David Glenn Smith on “Mitochondrial DNA of Protohistoric Remains of an Arikara Population from South Dakota”. Human Biology 82(2): 227–238. doi:10.3378/027.082.0207. Kemp B.M., C. Monroe, and D.G. Smith 2006 Repeat Silica Extraction: A Simple Technique for the Removal of PCR Inhibitors from DNA Extracts. Journal of Archaeological Science 33: 1680–1689. Kerr, Kevin C. R., Mark Y. Stoeckle, Carla J. Dove, et al. 2007 Comprehensive DNA Barcode Coverage of North American Birds. Molecular Ecology Notes 7(4): 535–543. Kimura M. 1980 A Simple Method for Estimating Evolutionary Rate of Base Substitutions through Comparative Studies of Nucleotide Sequences. Journal of Molecular Evolution 16: 111– 120. Kimura, M. 1983 The Neutral Theory of Molecular Evolution. Cambridge University Press, Cambridge. King, G.A., M.T.P. Gilbert, E. Willerslev, M.J. Collins, and H. Kenward 2009 Recovery of DNA from Archaeological Insect Remains: First Results, Problems and Potential. Journal of Archaeological Science 36(5): 1179–1183. doi:10.1016/j.jas.2009.01.006. King, Megan 2012 The Distribution of Paleoindian Debitage from the Pleistocene Terrace at the Topper Site: An Evaluation of a Possible Pre-Clovis Occupation (38AL23). Master’s Thesis, University of Tennessee. Manuscript on File. Kistler, L. 2012 Ancient DNA Extraction from Plants. In Ancient DNA: Methods and Protocols, edited by B. Shapiro and M. Hofreiter. Humana Press, New York.

214

Kitchen, A., M.M. Miyamoto, and C.J. Mulligan 2008 A Three-Stage Colonization Model for the Peopling of the Americas. PloS ONE 3(2): e1596. Kobayashi, T. 1970 Microblade Industries in the Japanese Archipelago. Arctic Anthropology 7(2): 38–58. Krajick, K. 2002 Melting Glaciers Release Ancient Relics. Science 296: 454–456. Krause, J., Q. Fu, J.M. Good, et al. 2010 The Complete Mitochondrial DNA Genome of an Unknown Hominin from Southern Siberia. Nature 464(7290):894–897. doi:10.1038/nature08976. Krauss, M.E. 1973 Na-Dene, In Linguistics in North America, Current Trends in Linguistics, vol 10, edited by T.A. Sebeok, pp. 903–978. The Hague: Mouton. 1979 Na-Dene and Eskimo-Aleut. In The Languages of Native America: Current Trends in Linguistics, vol. 19, edited by Thomas A. Sebeok, pp. 903–78. The Hague: Mouton. Krauss, Michael, Gary Holton, Jim Kerr, and Colin T. West 2011 Indigenous Peoples and Languages of Alaska. Fairbanks and Anchorage: Alaska Native Language Center and UAA Institute of Social and Economic Research. Electronic data. http://www.uaf.edu/anla/collections/map/, accessed March 28, 2015. Kress, W. John, and David L. Erickson 2007 A Two-Locus Global DNA Barcode for Land Plants: the Coding rbcL Gene Complements the Non-Coding trnH-psbA Spacer Region. PloS ONE 2(6): e508. doi:10.1371/journal.pone.0000508. Kress, W. John, Kenneth J. Wurdack, Elizabeth A. Zimmer, Lee A. Weigt, and Daniel H. Janzen 2005 Use of DNA Barcodes to Identify Flowering Plants. Proceedings of the National Academy of Sciences of the United States of America 102(23): 8369–8374. doi:10.1073/pnas.0503123102. Krings, M., A. Stone, and R.W. Schmitz 1997 Neandertal DNA Sequences and the Origin of Modern Humans. Cell 90: 19–30. Kuhn, T.S., K.A. McFarlane, P. Groves, A.Ø. Mooers, and B. Shapiro 2010 Modern and Ancient DNA Reveal Recent Partial Replacement of Caribou in the Southwest Yukon. Molecular Ecology 19(7): 1312–1323. Kunz, Michael L., Michael Bever, Constance Adkins 2003 The Mesa Site: Paleoindians Above the Arctic Circle. BLM-Alaska Open File Report 86, April. U.S. Department of the Interior. On file from the Bureau of Land Management- Alaska.

215

Kunz, M.L. and R.E. Reanier 1994 Paleoindians in Beringia: Evidence from Arctic Alaska. Science 263: 660–662. 1995 The Mesa Site: A Paleoindian Hunting Lookout in Arctic Alaska. Arctic Anthropology 32(1): 5–30. 1996 The Mesa Site, Iteriak Creek. In American Beginnings: the Prehistory and Paleoecology of Beringia, edited by F.H. West, pp. 497-504. University of Chicago Press, Chicago. Kuzmina, Svetlana, Scott Elias, Paul Matheus, John E. Storer, Andrei Sher 2008 Paleoenvironmental Reconstruction of the Last Glacial Maximum, Inferred from Insect Fossils from a Tephra Buried Soil at Tempest Lake, Seward Peninsula, Alaska. Paleogeography, Paleoclimatology, Paleoecology 267: 245–255. Kuzyk, G.W., D.E. Russell, R.S. Farnell, R.M. Gotthardt, P.G. Hare, and E. Blake 1999 In Pursuit of Prehistoric Caribou on Thandlät, Southern Yukon. Arctic 52(2): 214–219. Lacourse, T., and K. Gajewski 2000 Late Quaternary Vegetation History of Sulphur Lake, Southwest Yukon Territory, Canada. Arctic 53: 27–35. de Laguna, F. 1960 The Story of a Tlingit Community: A Problem in the Relationship between Archeological, Ethnological, and Historical Methods. Smithsonian Institution Bureau of American Ethnology Bulletin, 172. Washington D.C.: U.S. Government Printing Office. 1972 Under Mount Saint Elias: The History and Culture of the Yakutat Tlingit. Washington, D.C. Smithsonian Contributions to Anthropology, 7. 3 vols. Smithsonian Institution Press, Washington, D.C. 1990 Eyak. In Handbook of North American Indians, vol. 7, Northwest Coast, edited by Wayne P. Suttles, pp. 189–196. Washington, D.C.: Smithsonian Institution Press. de Laguna, F., and C. McClellan. 1981 Ahtna. In Handbook of North American Indians, vol. 6, Subarctic, edited by J. Helm, pp. 641–63. Smithsonian Insitution, Washington, DC. de Laguna, F., F.A. Riddel, D.F. McGeein, K.S. Lane, J.A. Freed, and C. Osborne 1964 Archaeology of the Yakutat Bay Area, Alaska. Bureau of American Ethnology, Bulletin 192. Lambert, D.M., P.A. Ritchie, C.D. Millar, B. Holland, A.J. Drummond, and C. Baroni 2002 Rates of Evolution in Ancient DNA from Adelie Penguins. Science 295: 2270–2273. Larson, G., U.Albarella, K. Dobney, et al. 2007 Ancient DNA, Pig Domestication, and the Spread of the Neolithic into Europe. Proceedings of the National Academy of Sciences of the United States of America 104(39): 15276–15281. doi:10.1073/pnas.0703411104. Lawrence, D.M., A.G. Slater, R.A. Tomas, M.M. Holland, and C. Deser 2008 Accelerated Arctic Land Warming and Permafrost Degradation During Rapid Sea Ice Loss. Geophysical Research Letters 35, L11506, doi:10.1029/2008GL033985.

216

Leavitt, Steven D., Theodore L. Esslinger, Eric Steen Hansen, et al. 2013 DNA Barcoding of Brown Parmeliae (Parmeliaceae) Species: A Molecular Approach for Accurate Specimen Identification, Emphasizing Species in Greenland. Organisms Diversity & Evolution 14(1): 11–20. doi:10.1007/s13127-013-0147-1. Le Blanc, R.J. and M.J. Wright 1990 Macroblade Technology in the Peace River Region of Northwestern Alberta. Canadian Journal of Archaeology 14: 1–12. Lee, C.M. 2012 Withering Snow and Ice in the Mid-Latitudes: A New Archaeological and Paleobiological Record for the Rocky Mountain Region. Arctic 65(1):165–177. Lee, D.J., T.K. Blake, and S.E. Smith 1988 Biparental Inheritance of Chloroplast DNA and the Existence of Heteroplasmic Cells in Alfalfa. Theoretical and Applied Genetics 76(4): 545–549. doi:10.1007/BF00260905. Lee, R.W., and C. Lemieux 1986 Biparental Inheritance of Non-Mendelian Gene Markers in Chlamydomonas moewusii. Genetics 113: 589–600. Lees, D.C., A.Y. Kawahara, R. Rougerie, et al. 2013 DNA Barcoding Reveals a Largely Unknown Fauna of Gracillariidae Leaf Mining Moths in the Neotropics. Molecular Ecology Resources. doi:10.1111/1755-0998.12178. Leonard, J.A., R.W. Wayne, J. Wheeler, et al. 2002 Ancient DNA Evidence for Old World Origin of New World Dogs. Science (New York, N.Y.) 298(5598): 1613–1616. doi:10.1126/science.1076980. Lerbekmo, J.F. 2008 The White River Ash: Largest Holocene Plinian Tephra. Canadian Journal of Earth Sciences 45(6): 693–700. Lerbekmo, J.F. and F.A. Campbell 1969 Distribution, Composition, and Source of the White River Ash, Yukon Territory. Canadian Journal of Earth Sciences 6(1): 109–116. Lerbekmo, J.F., J.A. Westgate, D.G.W. Smith, and G.H. Denton 1975 New Data on the Character and History of the White River Volcanic Eruption, Alaska. In Quaternary Studies, edited by R.P. Suggate and M.M. Cresswell, pp. 203–209. Wellington: The Royal Society of New Zealand. Letts, B., T.L. Fulton, M. Stiller, T.D. Andrews, G. MacKay, R. Popko, and B. Shapiro 2012 Ancient DNA Reveals Genetic Continuity in Mountain Woodland Caribou of the Mackenzie and Selwyn Mountains, Northwest Territories, Canada. Arctic 61(1): 80–94. Liepelt, Sascha, Christoph Sperisen, Marie-France Deguilloux, Remy J Petit, Roy Kissling, Matthew Spencer, Jacques-Louis de Beaulieu, Pierre Taberlet, Ludovic Gielly, and Birgit Ziegenhagen 2006 Authenticated DNA from Ancient Wood Remains. Annals of Botany 98(5): 1107–1111. doi:10.1093/aob/mcl188.

217

Lilly, J.W., M.J. Havey, S.A. Jackson, and J. Jiang 2001 Cytogenomic Analyses Reveal the Structural Plasticity of the Chloroplast Genome in Higher Plants. Plant Cell 13: 245-254. DOI 10.1105/tpc.13.2.245. Lindahl, T. 1993a Recovery of Antediluvian DNA. Nature 365: 700. doi:10.1038/365700a0. 1993b Instability and Decay of the Primary Structure of DNA. Nature 362(6422): 709–715. Lindahl, T., and O. Karlstrom 1973 Heat-Induced Depyrimidination of Deoxyrobonucleic Acid in Neutral Solution Biochemistry 12: 5151–5154. Lindahl, T., and B. Nyberg 1972 Rate of Depurination of Native Deoxyribonucleic Acid. Biochemistry 11: 3610–3618. Liu, C., H.M. Park, M.V. Monsalve, and D.D.Y. Chen 2010 Free Fatty Acids Composition in Adipocere of the Kwäday Dän Ts’ìnchí Ancient Remains Found in a Glacier. Journal of Forensic Sciences 55(4): 1039–1043. Liu, Huan-Zhen, Yasunori Takeichi, Koichi Kamiya, and Ko Harada 2012 Phylogeography of Quercus phillyraeoides (Fagaceae) in Japan as Revealed by Chloroplast DNA Variation. Journal of Forest Research 18(4): 361–370. doi:10.1007/s10310-012-0357-y. Lloyd, Andrea H., and Christopher L. Fastie 2002 Spatial and Temporal Variability in the Growth and Climate Response of Treeline Trees in Alaska. Climatic Change 52: 481–509. 2003 Recent Changes in Treeline Forest Distribution and Structure in Interior Alaska. Écoscience 10(2): 176–185. Loeb, L.A., and B.D. Preston 1986 Mutagenesis by Apurinic/Apyrimidinic Sites. Annual Review of Genetics 20: 201–230. Lorenz, J.G., and D.G. Smith 1996 Distribution of Four Founding mtDNA Haplogroups Among Native North Americans. American Journal of Physical Anthropology 101: 307–329. Lorenzen, E.D., D. Nogués-Bravo, L. Orlando, J. Weinstock, J. Binladen, K.A. Marske, A. Ugan, M.K. Borregaard, M.T.P. Gilbert, R. Nielsen, S.Y.W. Ho, T. Goebel, K.E. Graf, D. Byers, J.T. Stenderup, M. Rasmussen, P.F. Campos, J.A. Leonard, K.-P. Koepfli, D. Froese, G. Zazula, T.W. Stafford, K. Aaris-Sørensen, P. Batra, A.M. Haywood, J.S. Singarayer, P.J. Valdes, G. Boeskorov, J.A. Burns, S.P. Davydov, J. Haile, D.L. Jenkins, P. Kosintsev, T. Kuznetsova, X. Lai, L.D. Martin, H.G. McDonald, D. Mol, M. Meldgaard, K. Munch, E. Stephan, M. Sablin, R.S. Sommer, T. Sipko, E. Scott, M.A. Suchard, A. Tikhonov, R. Willerslev, R.K. Wayne, A. Cooper, M. Hofreiter, A. Sher, B. Shapiro, C. Rahbek, and E. Willerslev 2011 Species-Specific Responses of Late Quaternary Megafauna to Climate and Humans. Nature 479(7373): 359–364. Lowdon, J.A., R. Wilmeth, and W. Blake Jr. 1973 Geological Survey of Canada Radiocarbon Dates XIV, GSC Paper 74 - 7: 8.

218

Lowe, A.J., and H.B. Cross 2011 The Application of DNA Methods to Timber Tracking and Origin Verification. IAWA Journal 32(2): 251–262. Lowe, A.J., K.N. Wong, Y.-S. Tiong, S. Iyerh, and F.-T. Chew 2010 A DNA Method to Verify the Integrity of Timber Supply Chains: Confirming the Legal Sourcing of Merbau Timber from Logging Concession to Sawmill. Silvae Genetica 59(6): 263–268. Lowe, Andrew 2007 Can We Use DNA to Identify the Geographic Origin of Tropical Timber? In Proceedings of the International Workshop “Fingerprinting Methods for the Identification of Timber Origins”, pp. 15–19. Lowe, Andrew, Robert Munro, S.A.M Samuel, and Joan Cottrell 2004 The Utility and Limitations of Chloroplast DNA Analysis for Identifying Native British Oak Stands and for Guiding Replanting Strategy. Forestry 77(4): 335–347. Lyman, R.L., T.L. VanPool, and M.J. O'Brien 2008 Variation in North American dart points and arrow points when one or both are present. Journal of Archaeological Science 35(1): 2805–2812. Mackie, A.P., and I.D. Sumpter 2005 Shoreline Settlement Patterns in Gwaii Haanas during the Early and Late Holocene. In Haida Gwaii, Human History and Environment from the Time of Loon to the Time of the Iron People, edited by D.W. Fedje and R.W. Mathewes, pp. 337–371. UBC Press, Vancouver. MacNeish, R.S. 1959 A Speculative Framework of Northern North American Prehistory as of April 1959. Anthropologica 1(1–2): 7–23. 1964 Investigations in Southwest Yukon: Archaeological Excavations, Comparisons and Speculations. Papers of the R.S. Peabody Foundation for Archaeology 6(2):xiii, 199-488. Phillips Academy. Andover. Magne, M.P.R. 2004 Technological Correlates of Gwaii Haanas Microblades. Lithic Technology 29(2): 91– 118. 2012 Modeling Athapaskan Migrations. In From the Land of Ever Winter to the American Southwest: Athapaskan Migrations, Mobility, and Ethnogenesis, edited by D.J. Seymour, pp. 356–376. The University of Utah Press, Salt Lake City. Magne, M.P.R., and D. Fedje 2007 The Spread of Microblade Technology in Northwestern North America. In Origin and Spread of Microblade Technology in Northern Asia and North America, edited by Y.V. Kuzmin, S.G. Keates, and C. Shen. Simon Fraser University, Archaeology Press, Burnaby, B.C.

219

Magne, M.P.R., and R.G. Matson 1982 Identification of “Salish” and “Athapaskan” Side-Notched Projectile Points from the Interior Plateau of British Columbia. In Approaches to Algonquian Archaeology, edited by Margaret Hanna and Brian Kooyman, pp. 57–79. University of Calgary Archaeology Association, Calgary. 1987 Projectile Point and Lithic Assemblage Ethnicity in Interior British Columbia. In Ethnicity and Culture, edited by Reginald Auger, Margaret Glass, Scott MacEachern, and Peter McCartney, pp. 227–43. University of Calgary Archaeological Association, Calgary. 2010 Moving on: Expanding Perspectives on Athapaskan Migration. Canadian Journal of Archaeology 34: 212–239. Malhi, R.S. 2012 DNA Evidence of a Prehistoric Athapaskan Migration from the Subarctic to the Southwest of North America. In From the Land of Ever Winter to the American Southwest: Athapaskan Migrations, Mobility, and Ethnogenesis, edited by D.J. Seymour, pp. 241–248. The University of Utah Press, Salt Lake City. Malhi, R.S., A. Gonzales-Oliver, K.B. Schroeder, B.M. Kemp, J.A. Greenberg, S.Z. Dobrowski, D.G. Smith, A. Resendez, T. Karafet, M. Hammer, S. Zegura, and T. Brovko 2008 Distribution of Y Chromosomes Among Native North Americans: A Study of Athapaskan Population History. American Journal of Physical Anthropology 137(4): 412– 424. Malhi, R.S., H.M. Mortensen, J.A. Eshleman, J.G. Lorenz, F.A. Kaestle, J.R. Johnson, C. Gordodesky, and D.G. Smith 2003 Native American mtDNA Prehistory in the American Southwest. American Journal of Physical Anthropology 120: 108–124. Malhi, R.S., and D.G. Smith 2002 Brief Communication: Haplogroup X Confirmed in Prehistoric North America. American Journal of Physical Anthropology 119(1): 84–86. Mangerud, J. 1972 Radiocarbon Dating of Marine Shells, Including a Discussion of Apparent Ages of Recent Shells from Norway. Boreas 1: 143–72. Marais, D.L. Des, A.R. Smith, M.D. Britton, and K.M. Pryer 2003 Phylogenetic Relationships and Evolution of Extant Horsetails, Equisetum, based on Chloroplast DNA Sequence Data (rbcL and trnL‐F). International Journal of Plant Science 164(5): 737–751. Margold, M., K.N. Jansson, J. Kleman, and A.P. Stroeven 2013a Late-Glacial Ice Dynamics of the Cordilleran Ice Sheet in Northern British Columbia and Southern Yukon Territory: Retreat Pattern of the Liard Lobe Reconstructed from the Glacial Landform Record. Journal of Quaternary Science 28(2): 180–188.

220

Margold, M., K.N. Jansson, J. Kleman, A.P. Stroeven, and J.J. Clague 2013b Retreat Pattern of the Cordilleran Ice Sheet in Central British Columbia at the End of the Last Glaciation Reconstructed from Glacial Meltwater Landforms. Boreas 42(4): 830– 847. Marshall, E. 2001 Pre-Clovis Sites Fight for Acceptance. Science 291(5509): 1730–1732. Martini, I.P. 2007 Deglaciation Stages of the Laurentide Ice Sheet in Canada and Related Glaciomarine and Glaciolacustrine Deposits. Review of Selected Features. Xeográfica: Revista de Xeografía, Territorio e Medio Ambiente 7: 49–73. Maschner, H., and O.K. Mason 2013 The Bow and Arrow in Northern North America. Evolutionary Anthropology 22(3): 133–138. Mashiotta, T.A., L.G. Thompson, and M.E. Davis 2004 The White River Ash: New Evidence from the Bona-Churchill Ice Core Record. Paper presented at the American Geophysical Union, Fall Meeting. San Francisco, California. Mateiu, L.M., and B.H. Rannala 2008 Bayesian Inference of Errors in Ancient DNA Caused by Postmortem Degradation. Molecular Biology and Evolution 25(7): 1503–1511. doi:10.1093/molbev/msn095. Matson, R.G., and G. Coupland 1995 The Prehsitory of the Northwest Coast. San Diego: Academic Press. Matson, R.G., and M.P.R. Magne 2004 Identifying Athapaskans at Eagle Lake, British Columbia. In Ancient and Historic Lifeways in North America’s Rocky Mountians: Proceedigns of the 2003 Rocky Mountian Anthropological Conference, Estes Park, Colorado, edited by Robert H. Brunswig and William B. Butler, pp. 23–37. Department of Anthropology, University of Northern Colorado, Greeley. 2007 Athapaskan Migrations: The Archaeology of Eagle Lake, British Columbia. University of Arizona Press. Tucson, Arizona. Matsuki, Y., Y. Isagi, and Y. Suyama 2006 The Determination of Multiple Microsatellite Genotypes and DNA Sequences from a Single Pollen Grain. Molecular Ecology Notes 7(2): 194–198. doi:10.1111/j.1471- 8286.2006.01588.x. McAvoy, J.M. and L.D. McAvoy 1997 Archaeological Investigations of Site 44SX202, Cactus Hill, Sussex County, Virginia. Virginia Department of Historic Resources, Research Report Series No. 8, Richmond.

221

McClellan, C. 1964 Culture Contacts in the Early History Period in Northwestern North America. Arctic Anthropology 2(2): 3–15. 1967 Through Native Eyes: Indian Accounts of Events in the istory of the American Northwest. Unpublished manuscript in Archives of the National Museum of Man. Ottawa. 1975 My Old People Say: An Ethnographic Survey of Southern Yukon Territory. Publications in Ethnology 6. Ottawa: National Museums of Canada. McCullough, Karen M. (editor) 2012 The Archaeology and Paleoecology of Alpine Ice Patches, Arctic. Journal of the Arctic Institute of North America Vol. 65, No. 1. University of Calgary, Calgary. McLaren, Duncan, Rebecca J. Wigen, Quentin Mackie, Daryl W. Fedje 2005 Bear Hunting at the Pleistocene/Holocene Transition on the Northern Northwest Coast of North America. Canadian Zooarchaeology 22: 3–29. McNeely, R., A.S. Dyke, and J.R. Southon 2006 Canadian Marine Reservoir Ages, Preliminary Data Assessment, Open File 5049, pp. 3. Geological Survey Canada. Meiklejohn, Kelly A., James F. Wallman, and Mark Dowton 2013 DNA Barcoding Identifies All Immature Life Stages of a Forensically Important Flesh Fly (Diptera: Sarcophagidae). Journal of Forensic Sciences 58(1): 184–187. doi:10.1111/j.1556-4029.2012.02220.x. Melton, T., and K. Nelson 2001 Forensic Mitochondrial DNA Analysis: Two Years of Commercial Casework Experience in the United States. Croatian Medical Journal 42(3): 298–303. Meulendyk, T., B.J. Moorman, T.D. Andrews, and G. MacKay 2012 Morphology and Development of Ice Patches in Northwest Territories, Canada. Arctic 61(1): 43–58. Meyer, Christopher P., and Gustav Paulay 2005 DNA Barcoding: Error Rates Based on Comprehensive Sampling. PLoS Biology 3(12): e422. doi:10.1371/journal.pbio.0030422. Meyer, Matthias, Qiaomei Fu, Ayinuer Aximu-Petri, Isabelle Glocke, Birgit Nickel, Juan-Luis Arsuaga, Ignacio Martínez, Ana Gracia, José María Bermúdez de Castro, Eudald Carbonell, and Svante Pääbo 2014 A Mitochondrial Genome Sequence of a Hominin from Sima de los Huesos. Nature 505(7483): 403–406. Meyer, M., M. Kircher, M-T. Gansauge, et al. 2012 A High-Coverage Genome Sequence from an Archaic Denisovan Individual. Science (New York, N.Y.) 338(6104): 222–226. doi:10.1126/science.1224344.

222

Milanesi, C., R. Vignani, F. Ciampolini, et al. 2006 Ultrastructure and DNA Sequence Analysis of Single Concentricystis Cells from Alta Val Tiberina Holocene Sediment. Journal of Archaeological Science 33(8): 1081–1087. doi:10.1016/j.jas.2005.11.014. Mitchell, D., E. Willerslev, and A. Hansen 2005 Damage and Repair of Ancient DNA. Mutation Research 571(1–2): 265–276. doi:10.1016/j.mrfmmm.2004.06.060. Mobley, C.M. 1991 The Campus Site: A Prehistoric Camp at Fairbanks, Alaska. University of Alaska Press, Fairbanks. Mochanov, Y.A. 1977 Drevneishie Etapy Zaseleniia Chelovekom Severo-Vostochnoi Azii. Nauka, Novosibrisk. 1978 Stratigraphy and Absolute Chronology of the Paleolithic of Northeast Asia. In Earyl Man in America from a Cirum-Pacific Perspective, edited by A.L. Bryan, pp. 67. Occasional Papers 1, Department of Anthropology University of Alberta, Archaeological Researchers International Ltd., Edmonton. Mochanov, Y.A. and S.A. Fedoseeva 1996 Dyuktai Cave. In American Beginnings: The Prehistory and Palaeoecology of Beringia, edited by F.H. West, pp. 164–173. University of Chicago Press, Chicago. Monsalve, M.V., A.C. Stone, C.M. Lewis, A. Rempel, M. Richards, D. Straathof, and D.V. Devine 2002 Brief Communication: Molecular Analysis of the Kwäd̖ āy Dän Ts’ínch̖ i Ancient Remains Found in a Glacier in Canada. American Journal of Physical Anthropology 119(3): 288–291. Moodie, D.W., A.J.W. Catchpole, and K. Abel 1992 Northern Athapaskan Oral Traditions and the White River Volcano. Ethnohistory 39: 169–180. Moore, Jason 2011 Comparative Study of Ancient DNA Extraction Methods for Arcaheolgoical Plant Remains. Unpublished Ph.D. dissertation, Department of Archaeology, Simon Fraser University, Burnaby. Morice, A.G. 1890 The Western Denes: Their Maners and Customs. In Proceedings of the Canadian Institute for 1888-1889, 3(7): 109–74. 1893 Are the Carrier Socilogy and Mythology Indigenous or Exotic? In Proceedings and Transactions of the Royal Society of Canada for the Year 1892 1-2(10): 109–26. 1895 Notes Archaeological, Industrial and Sociological on the Western Denes with an Ethnographical Sketch of the Same. Transactions of the Canadian Institute (Toronto 4): 1– 222.

223

Moritz, Craig, and Carla Cicero 2004 DNA Barcoding: Promise and Pitfalls. PLoS Biology 2(10): e354. doi:10.1371/journal.pbio.0020354. Morlan, R.E. 1967 The Preceramic Period of Hokkaido: an Outline. Arctic Anthropology 4(1): 164–220. 2003 Current Perspective on the Pleistocene Archaeology of Eastern Beringia. Quaternary Research 60(1): 123–132. Morrison, D.A. 1987 The Middle Prehistoric Period and the Archaic Concept in the Mackenzie Valley. Canadian Journal of Archaeology 11: 49–74. Moss, M.L. 1998 Northern Northwest Coast Regional Overview. Arctic Anthropology 35(1): 88–111. 2004 The Status of Archaeology and Archaeological Practice in Southeast Alaska in Relation to the Larger Northwest Coast. Arctic Anthropology. 41(2): 177–196. Moss, M. L., J. M. Erlandson, R. S. Byram, and R. E. Hughes 1996 The Irish Creek Site: Evidence for a Mid-Holocene Microblade Component on the Northern Northwest Coast. Canadian Journal of Archaeology 20: 75–92. Mosseler A. 1990 Hybrid Performance and Species Crossability Relationships in Willows (Salix). Canadian Journal of Botany 68: 2329–2338. Mosseler, A. and C. S. Papadopol 1989 Seasonal Isolation as a Reproductive Barrier Amongst Sympatric Salix Species. Canadian Journal of Botany 67: 2563–2570. Mosseler, A. and L. Zsuffa 1989 Sex Expression and Sex Ratios in Intra- and Interspecific Hybrid Families of Salix l. silvae. Genetica 38: 12–17. Motyka, R.J., and J.E. Begét 1996 Taku Glacier, Southeast Alaska, U.S.A.: Late Holocene History of a Tidewater Glacier. Arctic and Alpine Research 28(1): 42–51. Mullen, P.O. 2012 An Archaeological Test of the Effects of the White River Ash Eruptions. Arctic Anthropology 49(1): 35–44. Mullis, K.B., and F.A. Faloona 1987 Specific Synthesis of DNA in Vitro Via a Polymerase Catalyzed Chain Reaction. Methods in Enzymology 155: 335–50. doi:10.1016/0076-6879(87)55023-6. Mullis, K.B., F.A. Faloona, S.J. Scharf, et al. 1986 Specific Enzymatic Amplification of DNA in Vitro: The Polymerase Chain Reaction. Methods in Enzymology 155: 335–50. doi:10.1016/0076-6879(87)55023-6.

224

Murchie, T.J. 2013 One Gun Phase Points: A Reassessment of the Late Side-Notched Projectile Point System in Alberta. Canadian Journal of Archaeology 37(2): 248–273. Myers-Smith I.H., B.C. Forbes, M. Wilmking, M.Hallinger, T. Lantz, D. Blok, K.D. Tape, M. Macias-Fauria, U. Sass-Klaassen, E. Lévesque, S. Boudreau, P. Ropars, L. Hermanutz, A. Trant, L.S. Collier, S. Weijers, J. Rozema, S.A. Rayback, N.M. Schmidt, G. Schaepman-Strub, S. Wipf, C. Rixen, C.B. Ménard, S. Venn, S. Goetz, L. Andreu-Hayles, S. Elmendorf, V. Ravolainen, J. Welker, P. Grogan, H.E. Epstein and D.S. Hik 2011 Shrub Expansion in Tundra Ecosystems: Dynamics, Impacts and Research Priorities. Environmental Research Letters 6(4): 045509. Nabors, M.W. 2004 Introduction to Botany. Pearson Education Inc., Benjamin Cummings, San Francisco, CA. Nakazawa, Fumio, Jun Uetake, Yoshihisa Suyama, et al. 2013 DNA Analysis for Section Identification of Individual Pinus Pollen Grains from Belukha Glacier, Altai Mountains, Russia. Environmental Research Letters 8(1): 014032. doi:10.1088/1748-9326/8/1/014032. Nettle, Daniel 1999 Linguistic Diversity. New York: Oxford University Press. Neumann, A. 1981 Die Mitteleuropaeischen Salix-Arten (The Central European Species of Salix). Mitteilungen der Forstlichen Bundes-Versuchsanstalt Wien, pp 152, Heft. Neustupa, Jiří, and Pavel Škaloud 2010 Diversity of Subaerial Algae and Cyanobacteria Growing on Bark and Wood in the Lowland Tropical Forests of Singapore. Plant Ecology and Evolution 143(1): 51-62. doi:10.5091/plecevo.2010.417 Newsholme, Christopher 2002 Willows: The Genus Salix. B.T. Batsford Ltd, London. Noss, R., J. Strittholt, G. Orians, J. Adams, K. Kavanagh, M. Sims, G. Mann 2015 Central Pacific Coastal Forests. World Wildlife Fund, Online database of global ecoregions. Electronic document, https://www.worldwildlife.org/ecoregions/na0510, accessed January 30, 2015. O'Brien, Michael J., Matthew T. Boulanger, Mark Collard, Briggs Buchanan, Lia Tarle, Lawrence G. Straus, and Metin I. Eren 2014 On Thin Ice: Problems With Stranford and Bradley’s Proposed Soultrean Colonisation of North America. Antiquity 88: 606–624. O'Brien, M.J., and R.L. Lyman (editors) 2003 Style, Function and Transmission: Evolutionary Archaeological Perspectives. Foundations of Archaeological Inquiry, The University of Utah Press, Salt Lake City.

225

O'Donoghue, M. and J. Staniforth 2004 Wildlife-Mammals. In Ecoregions of the Yukon Territory: Biophysical Properties of Yukon Landscapes, edited by C.A.S. Smith, J.C. Meikle and C.F. Roots, pp. 42–45. Agriculture and Agri-Food Canada, PARC Technical Bulletin No. 04-01, Summerland, British Columbia. O'Fallon, B.D, and L. Fehren-Schmitz 2011 Native Americans Experienced a Strong Population Bottleneck Coincident with European Contact. Proceedings of the National Academy of Sciences USA 108(51): 1–5. doi:10.1073/pnas.1112563108. Opel, K.L., D. Chung, and B.R. McCord 2010 A Study of PCR Inhibition Mechanisms Using Real Time PCR. Journal of Forensic Science 55: 25–33. O'Rourke, D.H, and J.A. Raff 2010 The Human Genetic History of the Americas: the Final Frontier. Current Biology 20(4): R202–7. Orr, P.C. 1962 The Arlington Spring Site, Santa Rosa Island, California. American Antiquity 27(3): 417–419. Pääbo, S. 1985a Preservation of DNA in Ancient Egyptian Mummies. Journal of Archaeological Science 12(6): 411–417. doi:10.1016/0305-4403(85)90002-0. 1985b Molecular Cloning of Ancient Egyptian Mummy DNA. Nature 314(6012): 644–645. doi:10.1038/314644a0. 1993 Ancient DNA Scientific America 269:86-92. Pääbo, S., R. Higuchi, and A. Wilson 1989 Ancient DNA and the Polymerase Chain Reaction. Journal of Biological Chemestry 264:9709-12. Palmé, A. 2003 Evolutionary History and Chloroplast DNA Variation in Three Plant Genera: Betula, Corylus and Salix. the Impact of Post-Glacial Colonisation and Hybridisation. Acta Universitatis Upsaliensis. Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology, Uppsala. Palmé, A.E, V. Semerikov, and M. Lascoux 2003 Absence of Geographical Structure of Chloroplast DNA Variation in Sallow, Salix caprea L. Heredity 91(5): 465–474. doi:10.1038/sj.hdy.6800307.

226

Papagrigorakis, M.J., C. Yapijakis, P.N. Synodinos, and E. Baziotopoulou-Valavani 2006a DNA Examination of Ancient Dental Pulp Incriminates Typhoid Fever as a Probable Cause of the Plague of Athens. International Journal of Infectious Diseases 10(3): 206– 214. doi:10.1016/j.ijid.2005.09.001. 2006b Insufficient Phylogenetic Analysis May Not Exclude Candidacy of Typhoid Fever as a Probable Cause of the Plague of Athens (reply to Shapiro et al.). International Journal of Infectious Diseases 10(4): 334–335. doi:10.1016/j.ijid.2006.02.006. Parducci, L, Y Suyama, M Lascoux, and K D Bennett 2005 Ancient DNA from Pollen: A Genetic Record of Population History in Scots Pine. Molecular Ecology 14(9): 2873–2882. doi:10.1111/j.1365-294X.2005.02644.x. Patterson, L.W. 1992 Current Data on the Early Use of the Bow and Arrow in Southern North America. La Tierra 19: 6–15. Payn, Kitt G., William S. Dvorak, and Alexander a. Myburg 2007 Chloroplast DNA Phylogeography Reveals the Island Colonisation Route of Eucalyptus urophylla (Myrtaceae). Australian Journal of Botany 55(7): 673. doi:10.1071/BT07056. Pearsall, Deborah M. 2008 Paleoethnobotany: A Handbook of Procedures, second edition. Emerald Group Publishing Limited, Howard House, Bingley. Peck, Trevor R. 2011 Light from Ancient Campfires: Archaeological Evidence for Native Lifeways on the Northern Plains. Athabasca University Press, Alberta. Percy, D.M., G.W. Argus, Q.C. Cronk, A.J. Fazekas, P.R. Kesanakurti, K.S. Burgess, B.C. Husband, S.G. Newmaster, S.C.H. Barrett, and S.W. Graham 2014 Understanding the Spectacular Failure of DNA Barcoding in Willows (Salix): Does this Result from a Trans-Specific Selective Sweep? Molecular Ecology 23: 4737–4756. Percy, D.M., A.M. Garver, W.L. Wagner, H.F. James, C.W. Cunningham, S.E. Miller, and R.C. Fleischer 2008 Progressive Island Colonization and Ancient Origin of Hawaiian metrosideros (Myrtaceae). Philosophical Transactions of the Royal Society B: Biological Sciences, 275: 1479–1490. doi:10.1098/rspb.2008.0191. Perego, U.A., A. Achilli, N. Angerhofer, M. Accetturo, M. Pala, A. Olivieri, B.H. Kashani, K.H. Ritchie, R. Scozzari, Q.-P. Kong, N.M. Myres, A. Salas, O. Semino, H.-J. Bandelt, S.R. Woodward, and A. Torroni 2009 Distinctive Paleo-Indian Migration Routes from Beringia Marked by Two Rare mtDNA Haplogroups. Current Biology 19(1): 1–8. Peterson, B.J., and B. Fry 1987 Stable Isotopes in Ecosystem Studies. Annual Reviews of Ecological Systems 18: 293– 320.

227

Peterson, B.J., R.W. Howarth, and R.H. Garritt 1985 Multiple Stable Isotopes Used to Trace the Flow of Matter in Estuarine Food Webs. Science Organic 227: 1361–1363. Petersen, G., B. Johansen, and O. Seberg 1996 PCR and Sequencing from a Single Pollen Grain. Plant Molecular Biology 31(1): 189– 191. Phillips, P. 1958 Application of the Wheat-Gifford-Wasley Taxonomy to Eastern Ceramics. American Antiquity 24(2): 117–125. Petit, R.J., E. Pineau, B. Demesure, R. Bacilieri, A. Ducousso, and A Kremer 1997 Chloroplast DNA Footprints of Postglacial Recolonization by Oaks. Proceedings of the National Academy of Sciences of the United States of America 94(18): 9996–10001. Piperno, D.R. and K.E.Stothert 2003 Phytolith Evidence for Early Holocene Cucurbita Domestication in Southwest Ecuador. Science 299:1054. Pisaric, Michael F. J., Catherine Holt, Julian M. Szeicz, Tammy Karst, and John P. Smol 2003 Holocene Treeline Dynamics in the Mountains of Northeastern British Columbia, Canada, Inferred from Fossil Pollen and Stomata. The Holocene 13: 161–173. Poinar, G. 1994 The Range of Life in Amber: Significance and Implications in DNA Studies. Experientia 50: 536–42. Poinar, H., R. Cano, and G. Poinar 1993 DNA from an Extinct Plant. Nature 363: 677. Pollmann, B., S. Jacomet, and A. Schlumbaum 2005 Morphological and Genetic Studies of Waterlogged Prunus Species from Roman Vicus Tasgetium (Eschenz, Switzerland). Journal of Archaeological Science 32: 1471–1480. Potter, B.A. 2005 American Paleo-Arctic Tradition. In Encyclopedia of the Arctic: Volumes 1, 2, and 3. Edited by Mark Nuttall, pp. 76-78. Routledge, New York, NY. 2008 Radiocarbon Chronology of Central Alaska: Technological Continuity and Economic Change. Radiocarbon 50(2): 181–204. Poulakakis, N., A. Tselikas, I. Bitsakis, M. Mylonas, and P. Lymberakis 2007 Ancient DNA and the Genetic Signature of Ancient Greek Manuscripts. Journal of Archaeological Science 34(5): 675–680. doi:10.1016/j.jas.2006.06.013. Powell, H.A., C.M. Gooding, S.D. Garrett, B.M. Lund, and R.A. McKee 1994 Protease Inhibition of the Detection of Listeria Monocytogenes in Milk Using the Polymerase Chain Reaction. Letters in Applied Microbiology 18: 59–61. Powers, W.R., and J.F. Hoffecker 1989 Late Pleistocene Settlement in the Nenana Valley, Central Alaska. American Antiquity 54(2): 263–287. 228

Premier Biosoft International 2014 NetPrimer (software). Copyright 1994–2014. Provan J., W. Powell, P.M. Hollingsworth 2001 Chloroplast Microsatellites Provide a General Source of Polymorphic DNA Markers for the Chloroplast Genome. Trends in Ecology and Evolution 16: 142–147. Prüfer, Kay, Fernando Racimo, Nick Patterson, Flora Jay, Sriram Sankararaman, Susanna Sawyer, Anja Heinze, Gabriel Renaud, Peter H. Sudmant, Cesare de Filippo, Heng Li, Swapan Mallick, Michael Dannemann, Qiaomei Fu, Martin Kircher, Martin Kuhlwilm, Michael Lachmann, Matthias Meyer, Matthias Ongyerth, Michael Siebauer, Christoph Theunert, Arti Tandon, Priya Moorjani, Joseph Pickrell, James C Mullikin, Samuel H Vohr, Richard E Green, Ines Hellmann, Philip L.F. Johnson, Hélène Blanche, Howard Cann, Jacob O. Kitzman, Jay Shendure, Evan E. Eichler, Ed S. Lein, Trygve E Bakken, Liubov V. Golovanova, Vladimir B. Doronichev, Michael V. Shunkov, Anatoli P. Derevianko, Bence Viola, Montgomery Slatkin, David Reich, Janet Kelso, and Svante Pääbo 2014 The Complete Genome Sequence of a Neanderthal from the Altai Mountains. Nature 505(7481): 43–49. Pyke, Kevin 2007 Plastid Biogenesis and Differentiation. In Cell and Molecualr Biology of Plastids, edited by R. Bock, pp. 1–28. Springer Berlin Heidelberg. Rainville, R.A., and K. Gajewski 2012 Holocene Environmental History of the Aishihik Region, Yukon, Canada. Canadian Journal of Earth Sciences 50: 397–405. Rand, A.L. 1945 Mammals of the Yukon, Canada. National Museum of Canada Bulletin 100. Ottawa: King’s Printer. Rachmayanti, Yanti 2009 Isolation of DNA from Unprocessed and Processed Wood of Dipterocarpaceae. Unpublished Ph.D. dissertation, Department of Forest Genetics and Forest Tree Breeding, University of Göttingen. Manuscript on file. Rachmayanti, Yanti, and Ludger Leinemann 2006 Extraction, Amplification and Characterization of Wood DNA from Dipterocarpaceae. Plant Molecular Biology 24: 45–55. Rachmayanti, Yanti, Ludger Leinemann, Oliver Gailing, and Reiner Finkeldey 2009 DNA from Processed and Unprocessed Wood: Factors Influencing the Isolation Success. Forensic Science International: Genetics 3(3): 185–92. doi:10.1016/j.fsigen.2009.01.002. Ramírez, José Luis, and Sergio R.S. Cevallos‐Ferriz 2000 Leaves of Salicaceae (Salix and Populus) from Oligocene Sediments Near Tepexi de Rodríguez, Puebla, Mexico, International Journal of Plant Sciences 161(3): 521–534.

229

Rasmussen, M., S.L. Anzick, M.R. Waters, P. Skoglund, M. DeGiorgio, T.W. Stafford, S. Rasmussen, I. Moltke, A. Albrechtsen, S.M. Doyle, G.D. Poznik, V. Gudmundsdottir, R. Yadav, A.-S. Malaspinas, S.S. White, M.E. Allentoft, O.E. Cornejo, K. Tambets, A. Eriksson, P.D. Heintzman, M. Karmin, T.S. Korneliussen, D.J. Meltzer, T.L. Pierre, J. Stenderup, L. Saag, V.M. Warmuth, M.C. Lopes, R.S. Malhi, S. Brunak, T. Sicheritz-Ponten, I. Barnes, M. Collins, L. Orlando, F. Balloux, A. Manica, R. Gupta, M. Metspalu, C.D. Bustamante, M. Jakobsson, R. Nielsen, and E. Willerslev 2014 The Genome of a Late Pleistocene Human from a Clovis Burial Site in Western Montana. Nature 506(7487): 225–229. Ratnasingham, Sujeevan and Paul D.N. Hebert 2007 BOLD: The Barcode of Life Data System (http://www.barcodinglife.org). Molecular Ecology Notes 7: 355–364. doi: 10.1111/j.1471-8286.2007.01678.x. 2013 A DNA-Based Registry for All Animal Species: the Barcode Index Number (BIN) System. PloS ONE 8(7): e66213. doi:10.1371/journal.pone.0066213. Reboud, X., and C. Zeyl 1994 Organelle Inheritance in Plants. Heredity 72: 132–140. Rechinger, K.H. 1992 Salix Taxonomy in Europe – Problems, Interpretations, Observations. Proceedings of the Royal Society of Edinburgh, 98B: 1–12. Reedy-Maschner, Katherine L., and Herbert D. G. Maschner 1999 Marauding Middlemen: Western Expansion and Violent Conflict in the Subarctic. Ethnohistory 46(4): 703–743. Reich, D., R.E. Green, M. Kircher, et al. 2010 Genetic History of an Archaic Hominin Group from Denisova Cave in Siberia. Nature 468(7327): 1053–1060. doi:10.1038/nature09710. Rice, Keren 2012 Linguistic Evidence Regarding the Apachean Migration. In From the Land of Ever Winter to the American Southwest: Athapaskan Migrations, Mobility, and Ethnogenesis, edited by Deni J. Seymour, The University of Utah Press, Salt Lake City. Richards, M.P., S. Greer, L.T. Corr, O. Beattie, A. Mackie, R.P. Evershed, A. von Finster, and J. Southon 2007 Radiocarbon Dating and Dietary Stable Isotope Analysis of Kwaday Dän Ts’inchí. American Antiquity 72(4): 719–733. Richards, M.P., and R.E.M. Hedges 1999 Stable Isotope Evidence for Similarities in the Types of Marine Foods Used by Late Mesolithic Humans at Sites Along the Atlantic Coast of Europe. Journal of Archaeological Science 26: 717–722.

230

Richards, M.P., and J.A. Sheridan 2000 New AMS Dates on Human Bone from Mesolithic Oronsay. Antiquity 74: 313–315. Richter, D.H., S.J. Preece, R.G. McGimsey, and J.A. Westgate 1995 Mount Churchill, Alaska: Source of the Late Holocene White River Ash. Canadian Journal of Earth Sciences 32: 741–748. Richter, D.H., D.S. Rosenkrans, and M.J. Steigerwald 1995 Guide to the Volcanoes of the Western Wrangell Mountains, Alaska—Wrangell-St. Elias National Park and Preserve. U.S.G.S. Bulletin, 2072. Washington, D.C.: U.S. Government Printing Office. Rignot, E., J.L. Bamber, M.R. Van den Broeke, C. Davis, Y. Li, J. Van de Berg, and E. Van Meijgaard 2008 Recent Antarctic Ice Mass Loss from Radar Interferometry and Regional Climate Modelling. Nature Geoscience 1: 106–110, doi:10.1038/ngeo102. Rignot, E., and R.H. Thomas 2002 Mass Balance of Polar Ice Sheets. Science 297: 1502–1506, doi:10.1126/science.1073888. Robinson S.D. 2001 Extending the Late Holocene White River Ash Distribution, Northwestern Canada. Arctic, 54: 157–161. Robinson, S.W. and G. Thompson 1981 Radiocarbon Corrections for Marine Shell Dates with Application to Southern Pacific Northwest Coast Prehistory: Syesis 14: 45–57. Rogers, S., and Z. Kaya 2006 DNA from Ancient Cedar Wood from King Midas Tomb, Turkey, and Al-Alsa Mosque, Israel. Silvae Genetica 5(2): 54–62. Rose, C.L., B.G. Marcot, T.K. Mellen, J.L. Ohmann, K.L. Waddell, D.L. Lindley, and B. Schreiber 2001 Decaying Wood in Pacific Northwest Forests: Concepts and Tools for Habitat Management. In Wildlife-Habitat Relationships in Oregon and Washington, edited by D. H. Johnson and T. A. O'Neil, pp. 580–623. Oregon State University Press, Corvallis OR. Ross, K.S., N.E. Haites, and K.F. Kelly 1990 Repeated Freezing and Thawing of Peripheral Blood and DNA in Suspension: Effects on DNA Yield and Integrity. Journal of Medical Genetics 27(9): 569–570. Rossen, L., P. Norskov, K. Holmstrom, and O.F. Rasmussen 1992 Inhibition of PCR by Components of Food Samples, Microbial Diagnostic Assays and DNA-Extraction Solutions. International Journal of Food Microbiology 17: 37–45. Rubinoff, Daniel 2006a DNA Barcoding Evolves into the Familiar. Conservation Biology 20(5): 1548–1549. 2006b Essays: Utility of Mitochondrial DNA Barcodes in Species Conservation. Conservation Biology 20(4): 1026–1033. doi:10.1111/j.1523-1739.2006.00372.x.

231

Rubinoff, Daniel, Stephen Cameron, and Kipling Will 2006 A Genomic Perspective on the Shortcomings of Mitochondrial DNA for “Barcoding” Identification. The Journal of Heredity 97(6): 581–94. doi:10.1093/jhered/esl036. Ruhlen, Merritt 1998 The origin of the Na-Dene. Proceedings of the National Academy of Sciences USA 95: 13994–13996. Sackett, J.R. 1982 Approaches to Style in Lithic Archaeology. Journal of Anthropological Archaeology 1: 59–112. 1985 Style and Ethnicity in the Kalahari: A Reply to Wiessner. American Antiquity 50: 154– 159. 1986 Style, Function, and Assemblage Variability: A Reply to Binford. American Antiquity 51(3): 628–634. 1990 Style and Ethnicity in Archaeology: The Case for Isochrestism. In The Uses of Style in Archaeology, edited by M.W. Conky and C.A. Hastorf, pp. 33–43. Cambridge University Press, Cambridge. Sager R. and M.R. Ishida 1963 Chloroplast DNA in Chlamydomonas. Proceedings of the National Academy of Sciences 50: 725–730. Saiki, R.K., D.H. Gelfand, S. Stoffel, et al. 1988 Primer-Directed Enzymatic Amplification of DNA with a Thermostable DNA Polymerase. Science (New York, N.Y.) 239(4839): 487–491. Saitou, N., and M. Nei 1987 The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Molecular Biology and Evolution 4: 406–425. Sanger, D. 1968 The High River Microblade Industry, Alberta. Plains Anthropologist 13(41): 190–208. Sano, Katsuhiro 2007 Emergence and Mobility of Microblade Industries in the Japanese Islands. In Origin and Spread of Microbalde Technology in Northeastern Asia and North America, edited by Yaroslav V. Kuzmin, Susan G. Keates, and Chen Shen, pp. 79–90. Archaeology Press, Simon Fraser University, Burnaby, British Columbia. Santos, J.A., L.J. Cunha, C.E. Cordova, and G.C. Wiles 2010 Holocene Glacial History of College Fjord, South-Central Alaska. Polar Geography 33: 101–114. Sato, H. and T. Tsutsumi 2007 The Japanese Microblade Industries: Technology, Raw Material Procurement, and Adaptations. In Origin and Spread of Microblade Technology in Northern Asia and North America, edited by Y.V. Kuzmin, S.G. Keates, and C. Shen, pp. 53–78. Archaeology Press, Simon Fraser University, Burnaby, B.C.

232

Sayers E.W., T. Barrett, D.A. Benson, S.H. Bryant, K. Canese, V. Chetvernin, D.M. Church, M. DiCuccio, R. Edgar, S. Federhen, M. Feolo, L.Y. Geer, W. Helmberg, Y. Kapustin, D. Landsman, D.J. Lipman, T.L. Madden, D.R. Maglott, V. Miller, I. Mizrachi, J. Ostell, K.D. Pruitt, G.D. Schuler, E. Sequeira, S.T. Sherry, M. Shumway, K. Sirotkin, A. Souvorov, G. Starchenko, T.A. Tatusova, L. Wagner, E. Yaschenko, J. Ye 2011 Database Resources of the National Center for Biotechnology Information. Nucleic Acids Research 39: D38–51. Schurr, T.G., and S.T. Sherry 2004 Mitochondrial DNA and Y Chromosome Diversity and the Peopling of the Americas: Evolutionary and Demographic Evidence. American Journal of Human Biology 16(4): 420–439. Serrouya, R., and H.U. Wittmer 2010 Imminent Extinctions of Woodland Caribou from National Parks. Conservation Biology 24(2): 363–364, doi:10.1111/j.1523-1739.2010.01454.x. Seymour, Deni J. 2012 “Big Trips” and Historic Apache Movement and Interaction: Models for Early Athapaskan Migrations. In From the Land of Ever Winter to the American Southwest: Athapaskan Migrations, Mobility, and Ethnogenesis, edited by Deni J. Seymour, pp. 377– 409. The University of Utah Press, Salt Lake City. Schoch, Conrad L, Keith a Seifert, Sabine Huhndorf, et al. 2012 Nuclear Ribosomal Internal Transcribed Spacer (ITS) Region as a Universal DNA Barcode Marker for Fungi. Proceedings of the National Academy of Sciences of the United States of America 109(16): 6241–6246. doi:10.1073/pnas.1117018109. Schlumbaum, A., M. Tensen, V. Jaenicke-Després 2007 Ancient Plant DNA in Archaeobotany. Vegitation History and Archaeobotany 17(2): 234–244. Schlumbaum, A., S. van Glabeke, and I. Roldan-Ruiz 2008 Towards the Onset of Fruit Tree Growing North of the Alps: Ancient DNA from Waterlogged Apple (Malus sp.) Seed Fragments. Annals of Anatomy doi:10.1016/J.aanat.2011.03.004. Schrader, C, a Schielke, L Ellerbroek, and R Johne 2012 PCR Inhibitors—Occurrence, Properties and Removal. Journal of Applied Microbiology 113(5): 1014–26. doi:10.1111/j.1365-2672.2012.05384.x. Shao, Wen, Sonny Khin, and William C. Kopp 2012 Characterization of Effect of Repeated Freeze and Thaw Cycles on Stability of Genomic DNA Using Pulsed Field Gel Electrophoresis. Biopreservation and Biobanking 10(1): 4– 11.

233

Shapiro, B., A.J. Drummond, A. Rambaut, M.C. Wilson, P.E. Matheus, A.V. Sher, O.G. Pybus, M.T.P. Gilbert, I. Barnes, J. Binladen, E. Willerslev, A.J. Hansen, G.F. Baryshnikov, J.A. Burns, S. Davydov, J.C. Driver, D.G. Froese, C.R. Harington, G. Keddie, P. Kosintsev, M.L. Kunz, L.D. Martin, R.O. Stephenson, J. Storer, R. Tedford, S. Zimov, and A. Cooper 2004 Rise and Fall of the Beringian Steppe Bison. Science 306(5701): 1561–1565. Shapiro, B., and M. Hofreiter 2010 Analysis of Ancient Human Genomes: Using Next Generation Sequencing, 20-Fold Coverage of the Genome of a 4,000-Year-Old Human from Greenland Has Been Obtained. BioEssays: News and Reviews in Molecular, Cellular, and Developmental Biology 32(5): 388–91. doi:10.1002/bies.201000026. Shapiro, B., A. Rambaut, and M.T.P. Gilbert 2006 No Proof That Typhoid Caused the Plague of Athens (a Reply to Papagrigorakis et al.). International Journal of Infectious Diseases 10(4): 334–335. doi:10.1016/j.ijid.2006.02.006. Shepherd, M., M. Cross, R.L. Stokoe, L.J. Scott, and M.E. Jones 2002 High-Throughput DNA Extraction from Forest Trees. Plant Molecular Biology Reporter 20(4): 425–425. Shetelig, H. 1917 Nye jernalderfund paa Vestlandet [A new Iron Age find from Vestlandet]. Bergens Museums Årbok 1916–1917. Shikama, K 1965 Effect of Freezing and Thawing on the Stability of Double Helix of DNA. Nature 207(996): 529–530. Shinkwin, A.D. 1979 Dakah De 'Nin's Village and the Dixthada Site. A contribution to Northern Athapaskan Prehistory. National Museum of Man Mercury Series, Archaeological Survey of Canada, Paper No. 91. Ottawa. Shugar, Dan H., Ian J. Walker, Olav B. Lian, Jordan B.R. Eamer, Christina Neudorf, Duncan McLaren, and Daryl Fedje 2014 Post-Glacial Sea-Level Change along the Pacific Coast of North America. Quaternary Science Reviews 97: 170–192. Sipahioglu, H.M., M. Usta, and M. Ocak 2006 Use of Dried High-Phenolic Laden Host Leaves for Virus and Viroid Preservation and Detection by PCR Methods. Journal of Virological Methods 137: 120–124. Smith, D.G., J.G. Lorenz, B.K. Rolfs, R.L. Bettinger, B. Green, J. Eshleman, B. Schultz, and R.S. Malhi 2000 Implications of the Distribution of Albumin Naskapi and Albumin Mexico for New World Prehistory. American Journal of Physical Anthropology 111: 557–572.

234

Smith, C.A.S., J.C. Meikle, and C.F. Roots (editors) 2004 Ecoregions of the Yukon Territory: Biophysical properties of Yukon landscapes. Agriculture and Agri-Food Canada, PARC Technical Bulletin No. 04-01, Summerland, British Columbia. Smith, S., J. Peepre, K. Kavanagh, M. Sims, G. Mann 2015 Yukon Interior Dry Forests, World Wildlife Fund. Electronic document, https://www.worldwildlife.org/ecoregions/na0617, accessed March 31, 2015. Soon, W., and S.H. Yaskell 2003 Year Without a Summer. Mercury 32(3): 13–22. Southon, J.R., and D. Fedje 2003 A Post-Glacial Record of 14C Reservoir Ages from the British Columbia Coast. Canadian Journal of Archaeology 27: 95–111. Spaulding, A.C. 1946 Northeastern Archaeology and General Trends in the Northern Forest Zone. In Man in Northeastern North America, edited by F. Johnson, pp. 143–167. Philips Academy: Andover. Speirs, A.K., G. McConnachie, and A.J. Lowe 2009 Chloroplast DNA from 16th Century Waterlogged Oak in a Marine Environment: Initial Steps in Sourcing the Mary Rose Timbers. In Archaeological Science under a Microscope: Studies in Residue and Ancient DNA Analysis in Honour of Thomas H. Loy, edited by M. Haslam, G. Robertson, A. Crowther, S. Nugent, and L. Kirkwood, pp. 175–189. ANU E Press, Canberra, Australia. Speller, C.F. 2005 One Fish, Two Fish, Old Fish, New Fish: Investigating Differential Distribution of Salmon Resources in the Pacific Northwest through Ancient DNA Analysis. Unpublished Master’s Thesis, Simon Fraser University. Speller, Camilla F., Brian M. Kemp, Scott D. Wyatt, Cara Monroe, William D. Lipe, Ursula M. Arndt, and Dongya Y. Yang 2010 Ancient Mitochondrial DNA Analysis Reveals Complexity of Indigenous North American Turkey Domestication. Proceedings of the National Academy of Sciences USA 107(7): 2807–2812. Speller, C.F., L. Hauser, D. Lepofsky, J. Moore, A.T. Rodrigues, M.L. Moss, I. McKechnie, and D.Y. Yang 2012 High Potential for Using DNA from Ancient Herring Bones to Inform Modern Fisheries Management and Conservation. PLoS ONE, 7(11): e51122. doi:10.1371/journal.pone.0051122. Speller, C.F., D.Y. Yang, and B. Hayden 2005 Ancient DNA Investigation of Prehistoric Salmon Resource Utilization at Keatley Creek, British Columbia, Canada. Journal of Archaeological Science 32(9): 1378–1389. doi:10.1016/j.jas.2005.03.016.

235

Spindler, K., E. Rastbichler-Zissernig, H. Wilfing, D. zur Nedden, and H. Nothdurfter 1995 Neue Funde und Ergebnisse. Der Mann im Eis/The man in the Ice 2. Mainz: Verlag des Römisch-Germanischen Zentralmuseums. Spindler, K., H. Wilfing, E. Rastbichler-Zissernig, D. zur Nedden, and H. Nothdurfter, 1996 Human Mummies: A Global Survey of Their Status and the Techniques of Conservation. The Man in the Ice. Wein: Springer-Verlag. Stanford, D. and B. Bradley 2012 Across Atlantic Ice: The Origin of America’s Clovis Culture. Berkeley: University of California Press. Stankiewicz, B.A., H. Poinar, D.E.G. Briggs, R.P. Evershed, and G. Poinar 1998 Chemical Preservation of Plants and Insects in Natural Resins. Philosophical Transactions of the Royal Society B: Biological Sciences 265: 641–647. Starr J.R., R.F. Naczi, and B.N. Chouinard 2009 Plant DNA Barcodes and Species Resolution in Sedges (Carex, Cyperaceae). Molecular Ecology Resources, Suppl. s1, 151–163. Steele, J., and G. Politis 2009 AMS 14C Dating of Early Human Occupation of Southern South America. Journal of Archaeological Science 36(2): 419–429. Stone, A.C., J.E. Starrs, and M. Stoneking 2001 Mitochondrial DNA Analysis of the Presumptive Remains of Jesse James. Journal of Forensic Sciences 46(1): 173–176. Stoneking, M., and J. Krause 2011 Learning About Human Population History from Ancient and Modern Genomes. Nature Reviews Genetics 12(9): 603–614. doi:10.1038/nrg3029. Stothers, R.B. 1984 The Great Tambora Eruption in 1815 and Its Aftermath. Science 224 (4654): 1191–1198. doi:10.1126/science.224.4654.1191. Stuart, G.S.L. 1986 An Archaeological and Paleoenvironmental Correlation for the Kluane – Aishhik Area, Southwest Yukon, Canada. Unpublished master’s thesis. University of Calgary, Department of Archaeology. Calgary, Alberta. Manuscript on file. Stuart, G.S.L., J.W. Helmer, and L.V. Hills 1989 The Holocene Paleoecology of Jenny Lake Area, Southwest Yukon, and Its Implications for Prehistory. Arctic 42: 347–353. Stuiver, M. and T.F. Braziunas 1993 Modeling Atmospheric 14C Influences and 14C Ages of Marine Samples to 10,000 BC. Radiocarbon 35(1): 137–191.

236

Stuiver, M., and P.J. Reimer 1993 Extended 14C Database and Revised CALIB Radiocarbon Calibration Program. Radiocarbon 35: 215–230. 2014 CALIB Radiocarbon Calibration Program 7.0. http://calib.qub.ac.uk/calib/. Su, X. and A. Gibor 1988 A Method for RNA Isolation from Marine Macro-Algae. Analytical Biochemistry 174: 650–657. Sugiura, M. 1989 The Chloroplast Chromosomes in Land Plants. Annual Review of Cell Biology 5: 51–70. 1992 The Chloroplast Genome. Plant Molecular Biology 19: 149–168. Sujeevan, R., and D.N. Paul 2007 BOLD: The Barcode of Life Data System. Molecular Ecology Notes 7: 355–364. doi:10.1111/j.1471-8286.2006.01678.x. Suyama, Y., K. Kawamuro, I. Kinoshita, et al. 1996 DNA Sequence from a Fossil Pollen of Abies spp. From Pleistocene Peat. Genes & Genetic Systems 71(3): 149–149. Swanston, T., M. Haakensen, H. Deneer, and E.G. Walker 2011 The Characterization of Helicobacter pylori DNA Associated with Ancient Human Remains Recovered from a Canadian Glacier. PloS ONE 6(2): e16864. Swanton, J. R. 1909 Tlingit Myths and Texts. Washington, DC: Government Printing Office. 1938 Historic Use of the Spear-Thrower in Southeastern North America. American Antiquity 4: 356–358. Taberlet, P., L. Gielly, G. Pautou, and J. Bouvet 1991 Universal Primers for Amplification of Three Non-Coding Regions of Chloroplast DNA. Plant Molecular Biology 17(5): 1105–1109. Taberlet, Pierre, Eric Coissac, François Pompanon, et al. 2007 Power and Limitations of the Chloroplast trnL (UAA) Intron for Plant DNA Barcoding. Nucleic Acids Research 35(3): e14. doi:10.1093/nar/gkl938. Tamura K., G. Stecher, D. Peterson, A. Filipski, and S. Kumar 2013 MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution 30: 2725–2729. Tang, Xiaoshu, Guangjie Zhao, and Liyan Ping 2011 Wood Identification with PCR Targeting Noncoding Chloroplast DNA. Plant Molecular Biology 77(6): 609–617. doi:10.1007/s11103-011-9837-2. Taylor, Adam M., Barbara L. Garner, and Jeffrey J. Morrell 2002 Heartwood Formation and Natural Durability—a Review. Wood and Fiber Science. 34: 587–611.

237

Technelysium Pty Ltd. 2013 ChromasPro Version 1.7.5. Copyright 2003–2013. Tewari K.K., and S.G. Wildman 1966 Chloroplast DNA from Tobacco Leaves. Science 153: 1269–1271. The 1000 Genomes Project 2010 A Map of Human Genome Variation from Population-Scale Sequencing. Nature 467(7319): 1061–1073. doi:10.1038/nature09534. Thiébaut, Mélanie 2002 A Foliar Morphometric Determination of Very Fragmentary Salix Remains from a Late Miocene Locality, Sé, Western Hungary, Review of Palaeobotany and Palynology, 121(2): 77–90. http://dx.doi.org/10.1016/S0034-6667(02)00074-X. Thompson, J.D., D.G. Higgins, and T.J. Gibson 1994 CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment through Sequence Weighting, Position Specific Gap Penalties and Weight Matrix Choice. Nucleic Acids Research 22(22): 4673–4680. Tnah, Lee Hong, Soon Leong Lee, Kevin K.S. Ng, Naoki Tani, Subha Bhassu, and Rofina Yasmin Othman 2009 Geographical Traceability of an Important Tropical Timber (Neobalanocarpus heimii) Inferred from Chloroplast DNA. Forest Ecology and Management 258(9): 1918–1923. Tnah, Lee Hong, Soon Leong Lee, Kevin Kit Siong Ng, Subha Bhassu, and Rofina Yasmin Othman 2011 DNA Extraction from Dry Wood of Neobalanocarpus heimii (Dipterocarpaceae) for Forensic DNA Profiling and Timber Tracking. Wood Science and Technology 46(5): 813– 825. Torroni, A., T.G. Schurr, M.F. Cabell, M.D. Brown, J.V. Neel, M. Larsen, M, D.G. Smith, C.M Vullo, and D.C. Wallace 1993 Asian Affinities and Continental Radiation of the Four Founding Native American mtDNAs. American Journal of Human Genetics 53(3): 563–590. Trüssel, Barbara L., Roman J. Motyka, Martin Truffer, and Christopher F. Larsen 2013 Rapid Thinning of Lake-Calving Yakutat Glacier and the Collapse of the Yakutat Icefield, Southeast Alaska, USA. Journal of Glaciology 59(213): 149–161. Tuovinen, V., M. Svensson, A. Kubartova, E. Ottosson, J. Stenlid, G. Thor, A. Dahlberg 2015 No Support for Occurrence of Free-Living Cladonia Mycobionts in Dead Wood, Fungal Ecology, 140: 130–132. http://dx.doi.org/10.1016/j.funeco.2014.12.003. Twiddle, C.L., and M.J. Bunting 2010 Experimental Investigations into the Preservation of Pollen Grains: A Pilot Study of Four Pollen Types. Review of Palaeobotany and Palynology 162(4): 621–630. doi:10.1016/j.revpalbo.2010.08.003.

238

Twyford, Alex D. 2014 Testing Evolutionary Hypotheses for DNA Barcoding Failure in Willows. Molecular Ecology 23: 4674–4676. Urmann, D. 2009 Decadal Scale Climate Variability During the Last Millennium as Recorded by the Bona Churchill and Quelccaya Ice Cores. Unpublished Ph.D. dissertation, Department of Geology, Ohio State University. VanderHoek, R., E.J. Dixon, N.L. Jarman, and R.M. Tedor 2012 Ice Patch Archaeology in Alaska: 2000–10. Arctic 65: 153–164. VanderHoek, R., R.M. Tedor, and J.D. McMahan 2007a Cultural Material Recovered from Ice Patches in the Denali Highway Region, Central Alaska, 2003–2005. Alaska Journal of Anthropology 5(2): 185–200. 2007b Ice Patch Research and Monitoring in the Denali Highway Region, Central Alaska, 2003–2005. Alaska Journal of Anthropology 5(2): 67–86. Wahl, Herb. 2004 Climate. In Ecoregions of the Yukon Territory: Biophysical properties of Yukon landscapes, edited by C.A.S. Smith, J.C. Meikle and C.F. Roots, pp. 19–23. Agriculture and Agri-Food Canada, PARC Technical Bulletin No. 04-01, Summerland, British Columbia. Wakasugi, T., T. Nagai, M. Kapoor, M. Sugita, M. Ito, S. Ito, J. Tsudzuki, K. Nakashima, T. Tsudzuki, Y. Suzuki, A. Hamada, T. Ohta, A. Inamura, K. Yoshinaga, M. Sugiura 1997 Complete Nucleotide Sequence of the Chloroplast Genome from the Green Alga Chlorella vulgaris: The Existence of Genes Possibly Involved in Chloroplast Division. Proceedings of the National Academy of Sciences 94: 5967–5972. Walde, D.A. 2012 Finding and Not Finding Athapaskans in the Archaeological Record Using Percentage Stratigraphy. In From the Land of Ever Winter: Athapaskan Migrations from the Subarctic to the American Southwest, edited by D. Seymour, pp. 198–224. University of Utah Press, Salt Lake City. 2014 Concerning the Atlatl and the Bow: Further Observations Regarding Arrow and Dart Points in the Archaeological Record. American Antiquity 79(1): 156–161. Walde, K. 1994 Archaeological Salvage Programmme at KaVn-2, KbVo-1, KbVo-2 and KdVo-3. Alaska Highway, Shakwak Project. Segments 16A, 17A and 18B, Beaver Creek Area, S.W. Yukon. Permit Report 93-3ASR. On file with Archaeological Survey of Canada. Canadian Museum of Civilization. Hull. Wan, C.Y. and T.A. Wilkins 1994 A Modified Hot Borate Method Significantly Enhances the Yield of High-Quality RNA from Cotton (Gossypium hirsutum L.). Analytical Biochemistry 223: 7–12.

239

Wang, H-L., Z-Y. Yan, D-Y. Jin 1997 Re-Analysis of Published DNA Sequence Amplified from Cretaceous Dinosaur Egg Fossil. Molecular Biology and Evolution 14: 589–91. Wang, X.-C. 1989 Post-Glacial Vegetation History of the Aishihik Basin and Its Vicinity, Southwest Yukon Territory: a Palynological Perspective. Ph.D. Thesis, Department of Geology, University of Ottawa, Ottawa, Ontario. Wang, X.-C., and M.-A. Geurts 1991a Late Quaternary Pollen Records and Vegetation History of the Southwest Yukon Territory: A Review. Géographie Physique Et Quaternaire, 45: 175–193. 1991b Post-Glacial Vegetation History of the Ittlemit Lake Basin, Southwest Yukon Territory. Arctic 44: 23–30. Ward, R.D., T.S. Zemlak, B.H. Innes, P.R. Last, P.D.N. Hebert 2005 DNA Barcoding Australia’s Fish Species. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 360: 1847–1857. Washburn, A.L. 1979 Geocryology. London: Edward Arnold. Waters, M.R., S.L. Forman, T.A. Jennings, L. C. Nordt, S.G. Driese, J.M. Feinberg, J.L. Keene, J. Halligan, A. Lindquist, J. Pierson, C.T. Hallmark, M.B. Collins, and J.E. Wiederhold 2011 The Buttermilk Creek Complex and the Origins of Clovis at the Debra L. Friedkin Site, Texas. Science 331(6024): 1599–1603. Waters, M.R., and T.W. Stafford 2007a Response to Comment on “Redefining the Age of Clovis: Implications for the Peopling of the Americas.” Science 317(5836): 320c. 2007b Redefining the Age of Clovis: Implications for the Peopling of the Americas. Science 315(5815): 1122–1126. Waters, M.R., T.W. Stafford, B. Kooyman, and L.V. Hills 2015 Late Pleistocene Horse and Camel Hunting at the Southern Margin of the Ice-Free Corridor: Reassessing the Age of Wally’s Beach, Canada. Proceedings of the National Academy of Sciences 112(14): 4263–4267. Watt, Kathryn E. 2003 Decontamination Techniques in Ancient DNA Analysis. Unpublished Ph.D. dissertation, Department of Archaeology, Simon Fraser University. Wayne, R.K., J.A. Leonard, and A. Cooper 1999 Full of Sound and Fury: the Recent History of Ancient DNA. Annual Review of Ecology and Systematics 30: 457–477. Wei, T., G. Lu, and G. Clover 2008 Novel Approaches to Mitigate Primer Interaction and Eliminate Inhibitors in Multiplex PCR, Demonstrated Using an Assay for Detection of Three Strawberry Viruses. Journal of Virological Methods 151: 132–139.

240

Weising, K., H. Nybom, K. Wolff, and G. Kahl 2005 DNA Fingerprinting in Plants: Principles, Methods and Applications, second ed. CRC Press, London. Wentzel, W.F. 1889 Letters to the Hon. Roderic Mckenzie, 1807–1824. In Les bourgeois de la Compagnie du Nord-Ouest, Volume 1, edited by L.R. Masson, pp. 67–153. Quebec: De LÌmprimerie Générale A. Coté. West, F.H. 1967 The Donnelly Ridge Site and the Definition of an Early Core and Blade Complex in Central Alaska. American Antiquity 32(3): 360–379. 1981 The Archaeology of Beringia. Columbia University Press, New York. 1996 The Archaeological Evidence. In American Beginnings: The Prehistory and Paleoecology of Beringia, edited by F. H. West, pp. 537–559. University of Chicago Press, Chicago. West, K.D., and J.A. Donaldson 2001 Resedimentation of the Late Holocene White River Tephra, Yukon Territory and Alaska. In Yukon Exploration and Geology, edited by D.S. Edmond, L.H. Weston, and L.L. Lewis, pp. 239–248. Exploration and Geological Service Division, Yukon Region, Indian and Northern Affairs, Canada. Wheat, J.B., J.C. Gifford, and W.W. Wasley 1958 Ceramic Variety, Type Cluster, and Ceramic System in Southwestern Pottery Analysis. American Antiquity 24(1): 34–47. White, J. E. J. 1994 The Possible Effects of Cultivated Introductions on Native Willows in Britain. Proceedings of the Common Ground of Wild and Cultivated Plants, pp. 113–118. Whittmire, C.M. 2000 Vegetative and Fire History of the Area Surrounding Keyhole Pond, Yukon Territory. Unpublished M.Sc. Thesis, Department of Biology, University of Regina, Regina, Saskatchewan. Whitworth, T L, R D Dawson, H Magalon, and E Baudry 2007 DNA Barcoding Cannot Reliably Identify Species of the Blowfly Genus Protocalliphora (Diptera: Calliphoridae). Philosophical Transactions of the Royal Society B: Biological Sciences 274(1619): 1731–1739. doi:10.1098/rspb.2007.0062. Wiemers, Martin, and Konrad Fiedler 2007 Does the DNA Barcoding Gap Exist? a Case Study in Blue Butterflies (Lepidoptera: Lycaenidae). Frontiers in Zoology 4(8): 1–16. doi:10.1186/1742-9994-4-8. Wiessner, P. 1983 Style and Social Information in Kalahari San Projectile Points. American Antiquity 48(2): 253–276.

241

Wilbur, A.K., A.S. Bouwman, A.C. Stone, et al. 2009 Deficiencies and Challenges in the Study of Ancient Tuberculosis DNA. Journal of Archaeological Science 36(9): 1990–1997. doi:10.1016/j.jas.2009.05.020. Wilkins, T.A. and L.B. Smart 1996 Isolation of RNA from Plant Tissue. In A Laboratory Guide to RNA: Isolation, Analysis, and Synthesis, edited by P.A. Krieg, pp. 21–42. New York: Wiley-Liss, Inc. Willerslev, E., E. Cappellini, W. Boomsma, et al. 2007 Ancient Biomolecules from Deep Ice Cores Reveal a Forested Southern Greenland. Science (New York, N.Y.) 317(5834): 111–114. doi:10.1126/science.1141758. Willerslev, E., A.J. Hansen, J. Binladen, et al. 2003 Diverse Plant and Animal Genetic Records from Holocene and Pleistocene Sediments. Science (New York, N.Y.) 300(5620): 791–795. doi:10.1126/science.1084114. Willey, G.R., and P. Phillips 1958 Method and Theory in American Archaeology. University of Chicago Press, Chicago. Wilson, D.G. 1984 The Carbonisation of Weed Seeds and Their Representation in Macrofossil Assemblages. In Plants and Ancient Man: Studies in Paleoethnobotany, edited by William van Zeist and W.A. Casparie, pp. 199–206. A.A. Balkema, Rotterdam. Wilson, M.C., J. Visser, and M.P.R. Magne 2011 Microblade Cores from the Northwestern Plains at High River, Alberta, Canada. Plains Anthropologist 56(217): 23–36. Wobst, H.M. 1977 Stylistic Behaviour and Information Exchange. In Cleland, Charles. For the Director: Research Essays in Honor of James B. Griffin, pp. 317–342. Anthropological Papers: University of Michigan. Wollstein, Andreas, Oscar Lao, Christian Becker, et al. 2010 Demographic History of Oceania Inferred from Genome-Wide Data. Current Biology 20(22): 1983–92. doi:10.1016/j.cub.2010.10.040. Woodward, S.R., N.J. Weyand, and M. Bunnell 1994 DNA Sequence from Cretaceous Period Bone Fragments. Science 266(5188): 1229– 1232.

242

Workman, W.B. 1974 The Cultural Significance of a Volcanic Ash Which Fell in the Upper Yukon Basin About 1400 Years Ago. In International Conference on the Prehistory and Paleoecology of Western North American Arctic and Subarctic, edited by S. Raymond and P. Schledermann, pp. 239–261, Archaeological Association, Department of Archaeology, University of Calgary, Calgary. 1978 Prehistory of the Aishihik-Kluane area, South-west Yukon Territory. National Museum of Man Mercury Series No. 74. Archaeological Survey of Canada, Ottawa. 1979 The Significance of Volcanism in the Prehistory of Subarctic North America. In Volcanic Activity and Human Ecology, edited by P.D. Sheets, and D.K. Grayson, pp. 339– 371, Academic Press, New York. World Wildlife Fund 2015a World Wildlife Fund, Online database of global ecoregions. Electronic document, https://www.worldwildlife.org/biome-categories/terrestrial-ecoregions, accessed January 30, 2015. 2015b Boreal forests/Taiga. World Wildlife Fund, Online database of global ecoregions. Electronic document, https://www.worldwildlife.org/biomes/boreal-forests-taiga, accessed January 30, 2015. Wright, P.J. 2010 Methodological Issues in Paleoethnobotany: A Consideration of Issues, Methods, and Cases. In Integrating Zooarchaeology and Paleoethnobotany: A Consideration of Issues, Methods, and Cases, edited by A.M. VanDerwarker and T.M. Peres, 36–64. Wu, Zhiqiang 2015 The New Completed Genome of Purple Willow (Salix purpurea) and Conserved Chloroplast Genome Structure of Salicaceae. Journal of Nature and Science 1(3): 1–2. Wygal, B.T. 2011 The Microblade/Non-Microblade Dichotomy: Climatic Implications, Toolkit Variability, and the Role of Tiny Tools in Eastern Beringia. In From the Yenisei to the Yukon: Interpreting Lithic Assemblage Variability in Late Pleistocene/Early Holocene Beringia, edited by T. Goebel and I. Buvit, pp. 234–254. Texas A&M University Press, College Station. Xie, Xiu-Feng, Hai-Fei Yan, Feng-Ying Wang, et al. 2012 Chloroplast DNA Phylogeography of Primula ovalifolia in Central and Adjacent Southwestern China: Past Gradual Expansion and Geographical Isolation. Journal of Systematics and Evolution 50(4): 284–294. doi:10.1111/j.1759-6831.2012.00204.x. Yang, D.Y., J.R. Woiderski, and J.C. Driver 2005 DNA Analysis of Archaeological Rabbit Remains from the American Southwest. Journal of Archaeological Science 32(4): 567–578. doi:10.1016/j.jas.2004.11.010. Yang, D.Y., B. Eng, J.S. Waye, J.C. Dudar, and S.R. Saunders 1998 Improved DNA Extraction from Ancient Bones Using Silica-Based Spin Columns. American Journal of Physical Anthropology 105: 539–543.

243

Young, G. 2000 Wood Identifications of Artifacts Recovered with Kwäday Dän Ts'ìnchi. Canadian Conservation Institute Report 76622. Unpublished manuscript. Available at the Government of Yukon Heritage Branch, Whitehorse, Yukon Y1A 2C6. Younie, A.M., R.J. Le Blanc, and R.J. Woywitka 2010 Little Pond: A Microblade and Burin Site in Northeastern Alberta. Arctic Anthropology 47(1): 71–93. Yukon Ecoregions Working Group 2004a Boreal Cordillera Ecozone. In Ecoregions of the Yukon Territory: Biophysical properties of Yukon landscapes, edited by C.A.S. Smith, J.C. Meikle and C.F. Roots, pp. 157–256. Agriculture and Agri-Food Canada, PARC Technical Bulletin No. 04-01, Summerland, British Columbia. 2004b Taiga Cordillera Ecozone. In Ecoregions of the Yukon Territory: Biophysical properties of Yukon landscapes, edited by C.A.S. Smith, J.C. Meikle and C.F. Roots, pp. 95–156. Agriculture and Agri-Food Canada, PARC Technical Bulletin No. 04-01, Summerland, British Columbia. Zemp, M., M. Hoelzle, and W. Haeberli 2009 Six Decades of Glacier Mass-Balance Observations: A Review of the Worldwide Monitoring Network. Annals of Glaciology 50: 101–111. Zheng, H-X., S. Yan, Z-D. Qin, and L. Jin 2012 MtDNA Analysis of Global Populations Support That Major Population Expansions Began Before Neolithic Time. Scientific Reports 2(745): 1–8. doi:10.1038/srep00745. Zischler, H., M. Hoss, O. Handt, A. von Haeseler, A.C. van der Kuyl, et al. 1995 Detecting Dinosaur DNA. Science 268:1192. Zischler, H., H. Geisert, A. von Haeseler, and S. Pääbo 1995 A Nuclear ‘Fossil’ of the Mitochondrial D-Loop and the Origin of Modern Humans. Nature 378: 489–92. Zotz G., K. Wilhelm, and A. Becker 2011 Heteroblasty – a Review. The Botanical Review, 77: 109–151.

244

Appendix I: The Early Periods of the Northwestern Subarctic and Northern Northwest Coast

I.5 The Northwestern Subarctic

I.5.1 The Earliest Inhabitants of Beringia (Table I.1)

The Beringian Period is marginally represented in the thesis study area because much of

Southern Yukon remained glaciated (Figure I.1) until ca. 10,900 cal-BP (Rainville and Gajweski

2012:402). Regardless, it is useful to discuss the period as there is evidence of habitation in

Central and Northern Yukon, and the culture groups in adjacent regions of the Northwestern

Subarctic are responsible for Southern Yukon’s habitation following the glacial retreat. Both

Alaskan periods are discussed together here; the cultural-historic variant in Southern Yukon (the

Northern Cordilleran Tradition) appears to be a derivative from Alaska (likely Chindadn or

Nenana).

The Cordilleran ice sheet is considered to have withdrawn from Southern Yukon between

10,000 and 8000 BP (Hart and Radloff 1990:3), with the draining of proglacial lakes by 8000–

7100 BP at the latest (Hughes 1990:13). Rainville and Gajewski (2012) found earlier evidence of birch-shrub (Betula) tundra in the southern Yukon ca. 10,900 cal-BP, and the establishment of spruce (Picea glauca) forests by ca. 10,200 cal-BP. This adds to other work in Southern Yukon that has found a boreal forest present around Kluane Lake, Aishihik, Nisling-Ittlemit regions, and the British Columbia border by ca. 8300–10,400 cal-BP (Bunbury and Gajewski 2009; Cwynar

1988; Keenan and Cwynar 1992; Lacourse and Gajewski 2000; Stuart et al. 1989; Wang 1989;

Wang and Geurts 1991a, 1991b; Whittmire 2000). The regional specifics of boreal colonization in formerly glaciated areas will likely improve as detailed models of the glacial ablation throughout the Cordillera are produced (e.g., Margold et al. 2013a). Given the paleoglacial data

245

Table I.1 Northwestern Subarctic cultural-historic framework of the Beringian-to-Early Periods. Alaskan Interior: Holmes (2001, 2008, 2011) Period Tradition Phase Phase 1: Swan Point & Dyuktai 1. Beringian Period 1.1 East Beringian Tradition >13,500 cal-BP Late Pleistocene to 13,000 cal-BP >11,500 cal-BP Phase 2: Chindadn & Nenana 13,500–11,000 cal-BP 2.1 East Beringian Tradition Phase 1: Chindadn & Nenana 2. Transitional Period >11,500 cal-BP 13,500–11,000 cal-BP 13,000–9,000 cal-BP 2.2 Denali (American Paleoarctic) - 11,500–8500 cal-BP Southern Yukon: Hare (1995) 1. Northern Cordilleran Tradition ca. 10,000–7100 14C BP Relevant Cultural-Historic Entities Entity Spatial Extent Age Characteristics* Literature Northeast ca. 30,000– Bifaces, burins, blades, microblades, wedge-shaped Mochanov and Dyuktai Siberia 11,000 BP microblade cores, megafauna. Fedoseeva 1996 Yubetsu Northern ca. 14,000 BP Microblade manufacturing technique. Sano 2007 Technique Japan (American) Specialized wedge-shaped microblade cores to create ca. 13,500– Anderson 1968a; Paleoarctic Alaska, Yukon regular, parallel-sided microblades and blades. Original 2000 BP Potter 2005 tradition definition encompasses many archaeological entities. Divided into East Beringian and Late Beringian, does not Beringian ca. 35,000– Holmes 2001; West Beringia recognize Nenana, instead refers to these sites as “non- Tradition 9500 BP 1981, 1996 microblade” Denali. East Beringian >11,500 cal- Includes Dyuktai, Swan Point, Chindadn, and Nenana Beringia Holmes 2001, 2008 Tradition BP complexes, but NOT Denali. Swan Point, Late Healy Lake, Beringia Pleistocene Sites with microblades and burins, reminiscent of Dyuktai. Holmes 2001 Gerstle River to Holocene Broken Late Mammoth, Beringia Pleistocene Early sites without microblades Holmes 2001 Mead to Holocene Distinctive thin, teardrop bifacial knives or points, Chindadn ca. 13,500– Cook 1969, 1996; Alaska triangular to sub-tranguloid points, microblades, likely Complex 11,500 cal-BP Holmes 2001 technological descendent of Dyuktai. Goebel et al. 1991; Nenana ca. 13,500– Non-microblades, often conflated with Chindadn. Possible Alaska Holmes 2001; Powers Complex 11,500 cal-BP antecedent to Paleoindian Tradition. and Hoffecker 1989 Goebel et al. 1991; Clovis Complex North ca. 13,000 ± Distinct fluted bifacial points, blades, megafauna, Rasmussen et al. or Tradition America 200 cal-BP continental distribution. 2014; Waters and Stafford 2007a Technological similarities to Northeast Asian and Beringian ca. 11,500– Holmes 2001, 2008; Denali Complex Alaska traditions, but with a novel Campus technique for 8500 cal-BP West 1967 microblade technologies; part of ‘Alaskan Prodigy’. Northern Large informal core and blade technology (no microblades), Southern ca. 10,000– Clark 1983; Gotthardt Cordilleran round- and straight-based lanceolate points, bi-points, Yukon 7100 14C BP 1990; Hare 1995 Tradition possibly burins. Likely descendent of Nenana. Distinctive lanceolate projectile points, high level of Paleoindian ca. 11,500– Frison 1978; Irwin and The Americas technological expertise, blades. Includes: Clovis, Folsom, Tradition 8500 14C BP Wormington 1970 Agate Basin, Hell Gap, Eden. ca. 11,700– Large unfluted lanceolate points, no blades. Part of Kunz et al. 2003; Kunz Mesa Complex Arctic Alaska 9700 14C BP Paleoindian Tradition. and Reanier 1994 *Defining characteristics vary significantly by researcher, these should be taken as approximations. Holmes (2001, 2008, 2011) and Hare (1995) are principle sources. See Figure 2.6 for a compiled figure of culture-historic frameworks. 246

Figure I.1 Deglaciation of Northwestern North America.

Glacial extent based on georeferenced tracings from Dyke (2004). currently available, it is unlikely that the first migrants into the New World traveled through

Southern Yukon, although there is the possibility of glacial travel as documented orally and ethnohistorically (Section 2.3). The Cordilleran and Laurentide ice sheets merged east of the

Mackenzie Mountains (Margold et al. 2013b) during the Last Glacial Maximum, in the area east of the continental divide (e.g., Gonzalez 2002). This left the development of the ice-free corridor 247

primarily within Northern and Central Yukon and the Western Northwest Territories (Dyke

2004).

Alaska has the most developed culture-historical framework of the western subarctic.

Historically, this is related to an emphasis on finding evidence for the peopling of North

America, where Alaska (and the Yukon to a lesser extent) has long been considered the key to this objective (e.g., Bever 2001b). Despite the amount of research that has been conducted in

Subarctic Alaska, there remains considerable debate regarding the area’s cultural-historical chronology. Holmes (2001) redefined the aforementioned periods as an attempt to modernize the framework with more recent data, and to create more consistency in the archaeological entities that had been repurposed beyond the initial defining characteristics. The entities of this period will be discussed in a relatively brief manner in this section, as the nuances of the archaeological delineations are beyond the scope of this work. Broadly, the earliest occupations in eastern

Beringia tend to include sites with burins and microblades of Asian origin (although some sites notably lack micro- or macroblades), which are often used to tie the materials with Dyuktai culture in Siberia (Mochanov and Fedoseeva 1996). This is followed by the development of new regionally specific microblade and burin technologies (ergo the “Alaskan prodigy” [Holmes

2008]), as well as bifacial knives and large Clovis-like paleoindian point forms.

The Beringian Period (Late Pleistocene to ca. 13,000 cal-BP) is defined by Holmes

(2001:156) as human habitation of the Northwestern Area (with emphasis on Alaska) before the establishment of the boreal forest, and while there remained a land connection between Alaska and Siberia (Figure 2.6). Within this environmentally delineated period, Holmes defines the East

Beringian Tradition (which extends into the subsequent Transitional Period). The tradition is a derivative of West’s (1981, 1996) ‘Beringian Tradition’, but without grouping all assemblages in

248

the area under the Denali complex umbrella (West 1996:550) with non-microblade Denali variants. The more neutral East Beringian Tradition is divided into two intervals or phases

(Dumond 2011:351; Holmes 2001:162, 2011). The first, older than 13,500 BP, refers to the earliest Northeast Asian inhabitants of Alaska and Northern Yukon (archaeologically identified as Dyuktai) who poses unmistakable Asian technologies—blades and microblades produced with the Dyuktai or Yubetsu techniques (Flenniken 1987; Kobayashi 1970; Morlan 1967:177; Sato and Tsutsumi 2007:57). The second, between 13,500 BP and 11,500 BP, includes the Chindadn and Nenana complexes (Holmes 2001:162). This second phase of the East Beringian Tradition begins near the end of the Beringian Period, and continues into the Transitional Period, with the

Younger Dryas stadial (a period of cold climatic conditions and drought) being considered important for culture-material changes occurring at the time. Five archaeological entities have been defined during this second phase of the East Beringian Tradition: the American Paleoarctic

Tradition (Anderson 1968a, 1984), Denali (West 1967, 1996), Chindadn (Cook 1969, 1996),

Nenana (Powers and Hoffecker 1989), and Mesa (Kunz and Reainer 1994). The appearance of bifacial technology and the presence or absence of microblades are central aspects of this phase.

Where microblades are present, there is a transition from the Yubetsu and Diuktai technique to the Campus technique (Anderson 1970; Mobley 1991; West 1967). The dichotomy between bifacial and microblade technologies (related directly to the Nenana and Denali complexes) is an important problem that continues to drive research and discussion in Beringian archaeology

(Goebel and Buvit 2011a:14). Blade, microblade, and microlithic technologies had been conflated by some archaeologists (West 1967; Anderson 1970), a practise later critiqued by others; Irving and Cinq-Mars (1974:77), Clark and Morlan (1982:81), Clark (1983) and

Gotthardt (1990:263) all considered macroblade (also referred to simply ‘blade’) technology to

249

be a hallmark of a pre-micro lithic technological tradition that they identified as Northern or

Arctic Cordilleran, following MacNeish (1964:285). Goebel et al. (1991) also include blades as one of the key artifacts in their 11,000 BP pre-microlithic Nenana complex. They suggest that the large core and blade industry of the Nenana complex shows a high degree of similarity to

Clovis blade technology, and they posit a direct relationship between the two Paleoindian complexes.

Following The Beringian Period is the Transitional Period (ca. 13,000–9,000 cal-BP)

(Holmes 2001, 2008, 2011), when Northeast Asian Dyuktai (Chen 2007, Kobayashi 1970) descendants living in America, are slowly cut-off from their Siberian contemporaries due to an inundation of Beringia, and when North American populations develop their own technological trajectory at the onset of the Holocene. These archaeological manifestations transition into the

“Alaskan prodigy”: the American Paleoarctic Tradition and Denali Complex. This transition separates what Holmes (2001, 2008) believes to be New World modifications of Asian traditions that later give rise to Alaskan microblade-core technology.

The periods defined by Holmes (2001, 2008, 2011) have a strong basis in paleoenvironmental shifts; for this reason one could argue a case to modify the end date of the

Beringian Period based on alternative evidence for an inundation of the Bering land Bridge by

12,000 BP (Keigwin et al. 2006) or 11,000 BP (Elias et al. 1996). Holmes (2001:156) also mentions the beginnings of megafauna extinction around this time as justification for the termination date, although recent work by Lorenzen et al. (2011) has investigated modes of extinction for a variety of New World fauna and found that the process seems to have been species-specific, related to longer lasting trends, and more complex than previous models have allowed. The more significant reason for this chosen end date is the onset of the Younger Dryas

250

(Holmes 2008:70) ca. 12,900–11,700 BP (Broecker et al. 2010; see also Alley 2010), which has been reinterpreted to be later in time from its initial delineation of 11,000–10,000 BP (Berger

1990). This correlates with the newly defined Clovis range of 13,000 ± 200 cal-BP in the

Americas (Waters and Stafford 2007a, 2007b), although the earliest Clovis sites discovered to date have been located much further south. Beyond the defining environmental range, the movement from the Beringian Period to Transitional Period is regarded as one of regional differentiation in material culture in Alaska. Holmes (2008) argues that this environmental shift precipitated the development of the Nenana and Mesa complexes (North Alaskan bifacial lithic sites most commonly without microblades), in addition to the development of the American

Paleoarctic Tradition (Northwest Alaska) and Denali Complexes (Central Alaska, both microblade traditions). Understanding the spatial-temporal and culture-historical differences between microblade and non-microblade technological traditions in Alaska has been challenging and contentious (see Anderson 1970; Ackerman 2011; Clark 2001; Dumond 2011: Goebel and

Buvit 2011a; Wygal 2011). Some explanations for the variability in technological traditions include contemporaneous cohabiting groups, differences in site type (e.g., seasonality, specialization), temporal change or discontinuities, intra-assemblage variability obscured by recovery bias (e.g., sample size), or distinct populations with non-contemporaneous periods of occupation (potentially including language and genetic haplotypes [see Goebel and Buvit

2011a:14–20]). A historic lack of communication between Canadian, American, and Russian archaeologists has likely lead to the discontinuity in cultural-historical chronologies for Beringia, a point noted by Clark (2001:77) and Goebel and Buvit (2011:22).

251

An important aspect related to microblade and non-microblade complexes in the

Northwestern Subarctic is the development of Clovis technology, which has historically been regarded as the ancestral cultural-historic entity of Native Americans.

I.5.1.1 Clovis, Pre-Clovis, Microblades, and Non-Microblades: Implications on Models of the Peopling

The emerging data of pre-Clovis occupations, new evidence of a complex, multi-stage, and lengthy peopling of the New World, and the spatial-temporal distribution of well-defined

Clovis sites predominantly south of the Subarctic has driven recent reassessments of the initial peopling of the New World, which is of direct relevance to Alaska, Yukon, and British Columbia during the Late Pleistocene and Early Holocene. The conventionally held dates of 11,500 14C BP for a Clovis-first occupation in the Americas were challenged by Waters and Stafford (2007a) who used more precise AMS 14C ages to produce a date range of 11,050–10,800 14C BP for

Clovis, with a calibrated calendar range falling around 13,000 ± 200 cal-BP (Waters and Stafford

2007a:1123 [see also Haynes et al. 2007; Waters and Stafford 2007b]). The Clovis-first date of

11,500 14C BP has traditionally been viewed as the onset of North Americas peopling through the ice free corridor, however it seems as if there is now sufficient evidence to presume that there were pre-Clovis inhabitants in the New World. A subset of sites with this evidence include

Meadowcroft Rockshelter (Adovasio et al. 1998; Carlisle and Adovasio 1982), Cactus Hill

(McAvoy and McAvoy 1997), Monte Verde (Dillehay 1989; Dillehay et al. 2008), Bluefish

Caves (Ackerman 1996; Cinq-Mars 1979; Cinq-Mars and Morlan 1999), Topper (Marshall 2001;

King 2012), Debra L. Friedkin (Waters et al. 2011), and Wally’s Beach (Waters et al. 2015)—the controversy regarding the validity of these remains site specific. Additional evidence comes from a variety of other early dated sites in South America (Steele and Politis 2009) and paleogenetic

252

evidence of a more nuanced colonization model (e.g., Achilli et al. 2013; Kitchen et al. 2008).

This is also supported by the aDNA analysis of Anzick boy (male infant, 10,705 ± 35 14C yr BP,

12,707–12,556 cal-BP), the only recovered Clovis burial to date, located in western Montana, with associated Clovis style tools (Rasmussen et al. 2014). Rasmussen et al. (2014) were able to refute the controversial (e.g., O'Brien et al. 2014) Solutrean hypothesis of a European origin for

Clovis (Stanford and Bradley 2012) by demonstrating that all indigenous Americans are descendants of Siberian populations in Northeast Asia during the Upper Paleolithic (50,000–

10,000 BP). The authors also found a deep divergence in Native American populations prior to

Anzick-1 individual, as the Clovis specimen’s DNA is more closely related to South Americans than the North American Native groups tested (Algonquin, Cree, Ojibwa, and Yaqui). Two hypotheses are consistent with this data: Anzick-1 is part of the South American lineage that had diverged earlier from what would become the North American population; or, that this individual lived around the time of the divergence between North and South Americans, where subsequent

Native North Americans experienced gene flow from a more basal lineage in North America,

Beringia, or Northeast Asia, leading to their seemingly earlier divergence. Ultimately,

Rasmussen et al. (2014) have shown genetically that Clovis is a descendent group a few thousand years removed from the First Colonizers of the Americas, which is consistent with the

Pleistocene archaeological data recovered to date from Beringia. Given the known extent of the ice sheets in the Late Pleistocene (e.g., Dyke 2004; Martini 2007:54), the multistage habitation of

Beringia (including Alaska and Yukon) proposed by Kitchen et al. (2008) makes sense in light of the new genetic data, and accounts for the early dates initially reported for Bluefish Caves and

Old Crow (Morlan 2003).

253

Some of the earliest and well supported archaeological evidence for American

Pleistocene occupations comes from the Western Subarctic at Swan Point, Mead, and Broken

Mammoth in the Tanana River Valley in Central Alaska (Goebel et al. 2008:1498) where there is evidence of occupation dating to 14,000 BP (Holmes 2001). Although the archaeological ties between Russia and Alaska are well supported, the material correlates are complex (e.g., Goebel et al. 2003). The data suggest that the movement of people into North America, and into what will become the Subarctic, was far more disjointed than traditional interpretations would allow.

The discovery of fluted points in the Serpentine Hot Springs area of Alaska are an example of this complexity. These points have been recovered from relatively secure contexts, dating to

12,400–9000 cal-BP (Goebel et al. 2013). They are argued by the authors to not be Clovis materials (Goebel et al. 2013:4231), but rather that they share morphological similarities with late Paleoindian points from temperate North America. Goebel et al. (2013:4232) suggests that these materials are too young to represent an actual technological predecessor to Clovis, but are rather the result of a northward movement of people or ideas from south of the ice-sheets and hence are a descendent cultural-historic entity of Clovis. This hypothesis is based on paleogenetic models that found a dispersion of plains bison into the Northwestern Subarctic after the Last Glacial Maximum (Shapiro et al. 2004), which Goebel et al. (2013) argue could have resulted in a movement of people north again through the ice-free corridor. Goebel et al.

(2008:1499) elude to a multifaceted migration in another way because of alleged Pleistocene archaeological evidence at the Arlington Spring Site on Santa Rosa Island, California (Waters and Stafford 2007:1125; Orr 1962). They argue that recent geologic evidence indicates that the coastal route may have become traversable by watercraft earlier than the ice free corridor—this in turn promotes a coastal migration model that itself has gained much support in recent years

254

(e.g., O’Rourke and Raff 2010; Perego et al. 2009; Schurr and Sherry 2004). A biotically viable coastal route could have been available 2,000 years earlier than the ice free corridor (Carrara et al. 2007; Heaton and Grady 2003; Heaton et al. 1996; Kaufman and Manley 2004, Fedje et al.

2011), which would support hypotheses of a separate development of bifacial complexes

(eventually developing into Clovis) south of the ice sheets, and a northward movement of these peoples into Beringia once the ice free corridor had become viable (e.g. Hoffecker and Elias

2007:131).

With the evidence of complex migration patterns of people into Beringia and the

Americas, previous debates regarding microblade and macroblade technologies begin to take on a new form. Although it is often noted that the earliest evidence of human habitation in the New

World had microblade materials similar to Dyuktai technologies in Asia, there is also the presence of early non-microblade sites in the area. Hare (1995:84-85,105) discusses the varying interpretations of blade and microblade technologies to argue for the use of the Northern

Cordilleran Tradition in Southern Yukon (Hare 1995:105-111). Gotthardt (1990:234) found differences in fundamental reduction strategies among blade and microblade technologies in

Northern Yukon, and proposed the Northern Cordilleran Tradition to categorize these materials

(Gotthardt 1990:263). Goebel et al. (1991) later argued for the Nenana Complex (>11,000 BP) as a large core and blade industry (non-microblade) to mark the earliest human occupation of the

Americas. The presence of microlithic technology at Bluefish Caves (Cinq-Mars 1985), as well as the lack of blades but presence of lanceolate points at the Mesa site dating to 11,000 BP (Kunz and Reanier 1994, 1995, 1996), further complicate archaeological chronologies in the region.

This complexity is exacerbated by inter-researcher inconsistencies. Some choose to conflate blade and microblade technologies (West 1967, Anderson 1970), while others believe that

255

macroblade technology is very different from microblade technology, and an important hallmark of a pre-microlithic tradition (Irving and Cinq-Mars 1974:77; Clark and Morlan 1982:81; Clark

1983; Gotthardt 1990:263). Even when microblade using groups are being discussed, the variation in technological traditions becomes a factor, for example, the differences in subarctic microblades versus those of the Paleoeskimo Arctic Small Tool tradition (ASTt) (Giddings

1964). One aspect of the problem is the spatial-temporal waxing and waning of technological traditions in the Subarctic (Clark 1992:79), making traditional culture-histories tied to typological frequency distributions somewhat chaotic.

I.5.1.1.1 A Note on the Classificatory Reliance on Microblades

I have discussed the issues of basing culture-historical entities on single typological systems elsewhere (Murchie 2013), which is a central problem in the Subarctic because the presence (and associated characteristics) or absence of microblades are used as a defining characteristics of most regional archaeological entities. Clark (2001:66) argues that microblades are not simply an artifact however, but rather the reflection of a complex and highly specialized tool manufacturing system that was wide spread and extremely long lasting (the Campus or

Denali core preparation technique seems to have been utilized for nine millennia). This argument is used by Clark (2001) to stress the importance and utility of microblades for archaeological classifications. The efficiency of both micro- and macroblade technologies (in terms of lithic waste) when compared with bifacial reduction strategies is a relevant factor, as Clark (2001) suggests that it is an adaptive advantage for those in Polar or Subarctic regions with limited access to lithic sources. This is used to support Clark’s (2001) claims that microblades are representations of tool systems rather than individual artifacts, making them important in culture- historical classification. There would appear to be a lack of research defining quantifiable criteria

256

beyond nominal categories to support claims that either the macro- or microblades or the blade- cores themselves have diagnostic and predictable differences between regions in the Subarctic.

Goebel et al. (1991) statistically assessed Denali, Nenana, and Clovis assemblages in Alaska, but do so by using nominal level data to characterize the numbers of predefined tool types. This analysis would be more powerful if ratio level data used to construct the nominal categories was analyzed to see if there are differences in individual specimens that follow the tool type designations and population assignments, rather than comparing the proportions of tool types between populations. It is also worth questioning how valuable the microblade is as a temporally discriminatory marker when there have been sites reported in Alaska with dates as young as

1000 CE with microblade components (Shinkwin 1979, see Hare 1995:113) (the absence of these being a defining characteristic of the terminal date for the Little arm Phase), in addition to their spread throughout the entire Northwestern Subarctic, the Northern Northwest Coast and the

Northern Plains (e.g., Magne and Fedje 2007; Magne 2004; Sanger 1968; Wilson et al. 2011;

Younie et al. 2010).

I.5.1.2 The Early Period in Southern Yukon: The Northern Cordilleran Tradition (ca. 10,000–7100 BP)

In terms of Southern Yukon, Hare (1995:105–111) argues for the utility of the Northern

Cordilleran Tradition or Northern Cordilleran Cultures (bifacial projectiles including fluted and lanceolate points, macroblades, and an absence of microblades) based on the stratigraphic context of Nenana-like materials (macroblades) preceding microliths at the Annie Lake site

(JcUr-3). Hare (1995:109) argues that the earliest artifacts are more similar to Nenana complex materials from Alaska (Goebel et al. 1991) than Paleoindian points from Northern Alberta (Le

Blanc and Wright 1990), suggesting a non-microblade tradition (Nenana or Chindadn-like)

257

moving south into Southern Yukon following the glacial retreat, rather than a northward migrating Plano influence (Clark 1991:44). Goebel et al. (1991:74) posit that the Nenana complex is directly related to Clovis through a similarity in macroblade technologies; whether the materials in Southern Yukon are ultimately derived from the north or the south depends on questions of the spatial origins of the Nenana Complex, or Northern Cordilleran Cultures as a whole.

It should be noted that only a single macroblade was recovered in a secure context from

Annie Lake; the issue of sample size is acknowledge by Hare (1995:109). Hare’s (1995) claim of a non-microblade tradition in Southern Yukon following the glacial retreat is not solely based on the single component from Annie Lake, but also from materials excavated by Walde (1994:27) and other non-microblade sites that were unpublished at the time. Hare (1995:129–131) emphasises that the four oldest sites in Southern Yukon (Canyon JfVg-1, Beaver Creek KaVn-2,

Moosehide LaVk-2 and basal Annie Lake JcUr-3) lack microblades. It seems reasonable to refer to the earliest materials in the Yukon as Northern Cordilleran following Hare (1995), although as the evidence is scant, the discovery of any new site dated to this period could substantially alter this designation. The relative lateness of this non-microblade tradition may suggest that non- microblade groups from Alaska migrated into Southern Yukon, and were then replaced themselves, or had their technological traditions replaced by microblade techniques by ca. 7000 BP (based on the data from the Annie Lake site [Hare 1995:111]). Aside from Bluefish

Caves (which was situated in an unglaciated area of the Northwest), this site has the earliest dated microblade component in Subarctic Yukon.

258

I.5.2 The Boreal Forest and the Expansion of Microblade Technologies (Table I.2)

Table I.2 Northwestern Subarctic cultural-historic framework of the Early-to-Middle Period. Alaskan Interior: Holmes (2001, 2008) Period Tradition 1.1 Denali (American Paleoarctic) 1. Early Taiga Period 11,500–8500 cal-BP 9500–6000 cal-BP 1.2 Transitional Northern Archaic Tradition 8500–6000 cal-BP Southern Yukon: Hare (1995), Workman (1978) Tradition Phase or Complex 1. Unnamed Tradition 1.1 Little Arm Phase Early Holocene to ca. 5000 14C BP ca. 7100–4500 14C BP 2. Northern Archaic Tradition 2.1 Annie Lake Complex ca. 5000 14C BP to contact ca. 5100–4400 14C BP Relevant Cultural-Historic Entities Entity Spatial Extent Age Characteristics Literature Microblades, burins, debatably a local Clark 1992; Southwest ca. 7100– Paleoindian/Paleoarctic hybrid that also includes Little Arm Phase Hare 1995; Yukon 4500 14C BP round-based projectile points, unifacial end Workman 1978 scrapers. Anderson 1968, Asymmetrical side-notched projectile points, ca. 8000– 2008; Clark 1992, unifacial knives and end scrapers, originally Northern Archaic Tradition Alaska, Yukon 6000 to 1200 Holmes 2008; defined as lacking microblades and often lacking cal-BP Morrison 1987; macroblades, similarities to Plains entities. Workman 1978 Diagnostic deeply basally concaved lanceolate South-Central ca. 5100– points of high quality, thinness, and made on Greer 1993; Annie Lake Complex Yukon 4400 14C BP good quality lithic materials, with a debitage Hare 1995 profile suggesting extensive curation. ca. 4200– Deeply basally concaved lanceolate dart points, see Peck 2011:119– McKean Complex Northern Plains 3500 BP also associated with Duncan and Hanna Points . 223 Wedge-shaped, tabular, and ‘pencil-shaped’ ca. 3500– microblade cores and microblades, burins, end Dixon 1985:53, 57– Late Denali Complex Alaska, Yukon 1500 14C BP scrapers, notched and lanceolate projectile 59 points. Tongue-shaped polyhedral, conical and tabular cores, microblades, burins, often notched or Northwest Microblade Northwestern ca. 7500– MacNeish 1959, stemmed points, plano-convex end-scrapers, Tradition Subarctic 1200 14C BP 1964 large bifaces, economy based on lake fishing and forest animal hunting. *Defining characteristics vary significantly by researcher, these should be taken as approximations. Holmes (2001, 2008, 2011) and Hare (1995) are principle sources. See Figure 2.6 for a compiled figure of culture-historic frameworks.

Following Workman (1978), the Little Arm Phase is characterized by microblades, and is associated with an ‘Unnamed Tradition’ that precedes the Northern Archaic (discussed in

Section 2.1.1.2.1). Workman’s Little Arm Phase serves as a Paleoindian (Northern Cordilleran)

259

and microlithic hybrid, with defining characteristics including: microblades from both tabular and wedge-shaped cores, a variety of burins, geometric round based projectile points, and bifaces

(Workman 1978:402). The first site that Workman (1978:407–409) identities as Little Arm

(Canyon Site) has a date of ca. 7100 14C BP, although no microlithics were recovered. Clark

(1992:78) argues that the Little Arm phase is a local Paleoindian variant rather than a hybrid.

Aside from being a chronological marker, the phase has relatively low utility, as the broad defining characteristics subsume all contemporary sites in the Boreal Cordillera. This problem is further exacerbated by the long duration of the phase, which arguably exceeds the ‘phase’ definition as proposed by Willey and Phillips (1958:22–24). Workman (1978:403) acknowledges these issues and notes that the scant radiocarbon data is largely to blame for the low resolution of the temporal framework. It serves as an example of chronological issues faced by subarctic archaeology: culture-histories tends to so generalized that only major technological shifts can be identified (see also Section 2.1.1.2).

Hare (1995:130) modified Workman’s (1978:402–415) start date from 8000 to ca. 7100 BP to account for the stratigraphic distribution of blades and microblades recovered from Annie Lake. Hare (1995) also restricted Workman`s (1978:402–415) definition of Little

Arm to make microblades a defining characteristic. There are issues with this however, as microblades are identified in the subsequent Archaic Period, just to a notably lesser extent. Hare

(1995:111-113) acknowledges this problem and further discusses issues with the phase’s temporal delineation in regards to the frequent rejection of 14C dates that fall outside the perceived appropriate range for the region (e.g., Workman 1978:256, 403; Lowdon et al. 1973;

Gotthardt 1990:41, 237). Hare’s (1995) recourse for these foundational problems with the phase is to suggest further field work to define the spatial and temporal divisions of technological

260

traditions in the region. Southern Yukon’s local sequence range for Little Arm is of comparable utility to Clark’s (1991:43) long period (era) of 7000–1300 BP, or the environmentally based

Early-Middle-Late Taiga Periods as defined by Holmes (2008). Although the environmental delineation of a boreal forest movement into the Subarctic is arguably weakly correlated with an observable archaeological shift, it is in my opinion the most appropriate framework considering the lack of secure dates overall, suggesting the most utility for the Taiga framework as proposed by Holmes (2001, 2008).

Greer (1993) and Hare (1995) both support the defining of a local (Southern Yukon) mid-

Holocene technological complex between Little Arm and the Taye Lake Phase called the Annie

Lake Complex. Greer (1993:26) identified a distinctive Annie Lake point type characterised by a basal concavity greater than 1.5 mm. Lithic tools from this local complex are of high quality

(consistent flaking of high workmanship), thinness, and made on good quality lithic materials, with a debitage profile suggesting extensive curation (Hare 1995:132). This is notably contrasted by initial definitions of the Northern Archaic by Anderson (1968a:21, 1968b) of crude workmanship, minimal retouch, and poor quality, coarse-grained lithics. Hare (1995:67–68) supports Greer’s (1993:26) older end date of 4900–4400 BP as an approximate bracket for the complex. Greer (1993:39) suggested diffusion to account for the perceived similarities between the Annie Lake points and those of McKean on the Northern Plains, and Shuswap Type 2 on the

British Columbia Plateau. The small number of these points makes it questionable how regionally significant the point type was, but would certainly provide an interesting perspective on dart point development in the area. Hare (1995:115–125) discusses explanations for this point type and the associated assemblage of the Complex. It seems reasonable to suspect that these materials do represent a unique local development. A potentially useful future analysis could

261

involve statistically assessing early Subarctic points in the region combined with percentage stratigraphy to assess temporal change (see Walde 2012). I suspect that important new insights into the development of these lithic remains could be identified, which would also allow for the development of a regional type-variety system (e.g., Phillips 1958:120; Wheat et al. 1958:36).

In terms of a larger spatial scope, Clark (1991:43–55) discusses the areal sequence as

Paleoarctic microblade using peoples (Clark’s term for descendants of microblade peoples from the Beringian and Transitional Periods in Holmes’ [2008] classification) being supplanted or absorbed by Northern Cordilleran (Tradition) people in the region using bifacial technologies.

Clark (1991) considers the Paleoarctic group to have moved across Northern British Columbia and into Northern Alberta, while southern Paleoindian people (utilizing Plano projectile points from the Northern Plains) moved north into the North-Central area (as spatially defined in Figure

2.5). Clark (1991) tends to account for technological changes by migration, rather than diffusion.

He argues that Paleoarctic culture persisted until about 4500–4000 BP when it was replaced by the Northern Archaic Tradition, or by a kind of hybrid type. Alternatively, Holmes (2008:71–72) defines the onset of the Taiga Period with the establishment of a boreal forest in the

Northwestern Subarctic, with a date range between 9900–6000 cal-BP for the Early Taiga, prior to the transition into the Northern Archaic. There is an approximately 2000 year gap of sites between 8000–6000 BP where there are almost no dated archaeological sites in the Alaskan boreal forest, which may be due to a population decrease (Holmes 2008). Holmes (2008) classifies the Early Taiga Period as containing the end of the American Paleoarctic Tradition and the Denali Complex, which enter a ‘Transitionary Period’ before the Archaic. The lack of sites has resulted in this Transitionary Period being poorly understood across much of the

Northwestern Subarctic.

262

I.6 The Northern Northwest Coast

I.6.1 Early Period (ca. 11,000–5000 14C BP [Moss 2004])

Paleoenvironmental evidence suggests that movement along the coast was possible by

16,000 BP (Clague et al. 2010); this has yet to be supported archaeologically, but there is evidence of human occupation on the coast by the end of the Pleistocene (McLaren et al. 2005).

The lack of sites may be related to archaeological visibility, or be an aspect of technological development at the time—this route would require high-latitude marine adaptations for which we have no evidence anywhere in Beringia during the Late Pleistocene (Ames 2003).

Archaeological visibility of the Pleistocene and Early Holocene on the Northwest Coast is a significant impediment to understanding culture-history (Fedje et al. 2011:323–324). Early

Postglacial to Early Holocene (ca.14,490–10,900 cal-BP) shorelines are deeply inundated.

Shorelines from ca. 10,740–10,630 cal-BP are comparable to modern levels (although these deposits are significantly disturbed from repeated marine transgressions and regressions), and those from 10,500–7500 cal-BP are hidden as far as 2 km into the rainforest. Underwater archaeological surveys have had limited success to date, although a site 53 mbsl was identified potentially dating to ca. 11,500 cal-BP (Fedje and Josenhans 2000; Fedje et al. 2011:324). Karst

Cave components on the southern end of the Haida Gwaii archipelago have been dated to

10,600–10,000 14C BP (12,700-11,500 cal-BP), and several mid-Holocene sites have been identified in inland (near the paleo-shoreline) Haida Gwaii (e.g., Christensen and Stafford 2005;

Fedje and Christensen 1999; Fedje, Magne, and Christensen 2005; Mackie and Sumpter 2005).

The earliest sites identified in this region are found in the Alexander Archipelago:

Ground Hog Bay 2, Hidden Falls, Chuck Lake (Locality 1), Thorn River, and On-Your-Knees

263

Cave (49-PET-408) (see Moss 1998:92). Human remains dated to 9730 ± 60 and

9880 ± 50 14C BP, along with a bone flaker dated to 10,300 ± 50 14C BP, have been recovered from On-Your-Knees Cave (Dixon 1999). Microblades and microliths are a predominant feature of the Early Period on the Northern Coast, with the absence of bifaces distinguishing the materials from the Central and Southern Coasts (Ames 2003:23). As a notable exception to this, the Kinggi Complex (Fedje, Magne, and Christensen 2005; Fedje et al. 2011:327) in Haida

Gwaii is defined by the presence of bifaces and projectile points, but the absence of microblades.

The presence or absence of microblades for archaeological entities is again a common character trait for culture-historic frameworks in the area (see Appendix I); temporally extensive microblade use is also a feature on the Northwest Coast, with sites dating to 5,000 BP containing microblade assemblages in the absence of ground slate technology (Moss et al. 1996).

Microblades production peaks at Namu 6000–5000 14C BP (Moss 2004:184), further adding to the uneven spatial-temporal distribution of this enigmatic technological system. The earliest inhabitants of the Northern Northwest Coast would have had boats, as we can tell from the long- distance movement of obsidian. Further, a proportion of fish in the faunal assemblages of Early

Period sites could only have been harvested by boat (Ames 2003:23). It seems likely that people at this time were highly mobile, with low population densities.

264

Appendix II: The Athapaskan Migrations

On a continental scale, the White River Ashfalls are often cited as an environmental trigger for the Athapaskan migrations south from the Northwestern Subarctic (e.g., Derry 1975;

Magne 2012; Matson and Magne 2007; Workman 1974, 1979). The idea was first published by

Workman (1974, 1979) and Derry (1975) who saw a temporal connection between glottochronological estimates of a proto-Athapaskan divergence (Davis 1975; Krauss 1973;

Hoijer 1956), the catastrophic proportion of the eruptions, and a spatial tie with the long evident origins of Athapaskan language groups in the American Southwest and along the Northwest

Coast (e.g., Dyen and Aberle 1974; Foster 1996; Goddard 1996; Morice 1890, 1893, 1895).

There is a scholarly consensus of the close relationship between the Apachean (southern),

Pacific, and Northern Athapaskans, as there is consensus that non-Subarctic Athapaskan speakers arrived in their historic geographic locations because of a southern migration of northern boreal peoples. All other factors of the migration including timing, routes, motivations, size, degrees of acculturation, and archaeological ethnic identifiers remain contentious (Carlson

2012; Seymour 2012). Arguably, the glottochronological and lexicostatistical estimates are the most contentious evidence because of concerns with the method’s base assumptions—and as a result, its accuracy (L. Campbell 2004:204–210). The perceived validity of the method is still in flux, with positions ranging from complete rejection (for discussion see L. Campbell 2004:204–

210) to a cautionary acceptance (Davis 1975; Krauss 1973, 1979; Foster 1996), with many linguists and archaeologists accepting the values as rough guesstimations that are largely inconsequential. Part of the rejection of the method from archaeologists and historians came from misunderstandings of its accuracy, which led to an unfounded wider rejection of other historical linguistic methods (L. Campbell 2004). Some propose that glottochronology retains

265

utility in sedentary societies (Dixon 1997; Nettle 1999), although the rate of change for language is highly complex (Bowern 2010; Rice 2012). Given the skepticism among experts in the field, it seems inappropriate to place significant weight on the dates derived from the method.

Matson and Magne (2007:132–135) are less skeptical of the method’s validity, but do acknowledge the controversy and shortcomings. Most importantly, they provide a thorough set of complimentary evidence to support their model of Athapaskan migrations based on long term excavations carried out during the Eagle Lake Project in Southern-Interior British Columbia.

Using a variety of methods and a large and varied dataset, they argue that Athapaskan ethnicity can be identified at Eagle Lake sites, which are contrasted with other local sites (at the Mouth of the Chilcotin) where a continuation of the local sequence (the Kamloops Horizon) can be seen archaeologically. Their statistical lithic analysis had 80–90% success at correctly identifying projectile point ethnicity between arguably Athapaskan materials and those from the locally developed archaeological entity—the Plateau Pithouse Tradition (Matson and Magne 2007:114).

This is supported by previous investigations that emphasized assemblage proportions as opposed to the metric measurements used in this instance (Magne and Matson 1982, 1987; Matson and

Magne 2004). This is a fortunate but surprising result considering the difficulty in ethnically finding Athapaskans in other archaeological areas (e.g., Walde 2012). Matson and Magne’s

(2007:103–130) other statistical investigations of Athapaskan and Plateau Pithouse materials found further evidence of distinguishability. As Ives (2008:157) notes however, a morphometric definition of the Kavik point types would have been very helpful. Magne and Matson (2010) acknowledge the omission of similar important information (such as lithic type analyses) as an unfortunate consequence of a >30% manuscript size reduction by the publisher (Magne and

Matson 2010:214). This is related to other criticisms laid by Ives (2008) as to the relative

266

weakness of the continental scale aspect of Athapaskan migration models posed by Magne and

Matson (2010) when compared with the robustness of the treatment given to sites in the British

Columbian interior. This is to be expected given the scale of the archaeological data in the latter half of the work. However, the omission of a contemporary paleogenetic discussion of research directly relevant to the topic in both their initial book (Matson and Magne 2007) and journal article (Magne and Matson 2010) does detract from the model to some degree (relevant genetic work includes: Hunley and Long 2005; Lorenz and Smith 1996; Malhi 2012; Malhi et al. 2003,

2008; Smith et al. 2000).

I agree with Ives’ (1990:42–45) hesitation in asserting that the White River Eruptions are an inciting event that precipitated the Athapaskan migrations, particularly when the glottochronological estimates are of questionable accuracy and precision. Evidence of movement out of the devastated areas (Mullen 2012) and a partial replacement of local caribou herds (Kuhn et al. 2010) are convincing lines of evidence, but it seems unlikely that the actual motivation behind the migration could ever be known. Ives (1990:45) recommends remaining open to the plausible notion of the White River Eruptions as a trigger mechanism, but also to acknowledge that the eruptions may have only been contributing or coincidental factors. I think this advice remains sound, and although Matson and Magne (2007; Magne and Matson 2010; Magne 2012) have developed a thorough, well-supported model that continues to build with new evidence, more data are required in adjacent regions where we can methodologically identify migrating

Athapaskan components in other archaeological settings.

267

Appendix III: Sample Proveniences

Table III.1 Modern plant samples. ID Region Location Field ID masl 1 Boreal Forest - Yukon Mt. Grainger (Helicopter, Ice Patch) willow/shrub 1256.91 2 Boreal Forest - Yukon Mt. Grainger (Helicopter, Ice Patch) willow/shrub 1257.08 3 Boreal Forest - Yukon Mt. Grainger (Helicopter, Ice Patch) spruce 1258.38 4 Boreal Forest - Yukon Mt. Grainger (Helicopter, Ice Patch) spruce 1257.01 5 Boreal Forest - Yukon Mt. Grainger (Helicopter, Ice Patch) willow/shrub 1258.37 6 Boreal Forest - Yukon Mt. Grainger (Helicopter, Ice Patch) willow/shrub 1260.46 7 Boreal Forest - Yukon Mt. Grainger (Helicopter, Ice Patch) spruce 1262.37 8 Boreal Forest - Yukon Mt. Grainger (Helicopter, Ice Patch) willow 1262.24 9 Boreal Forest - Yukon Mt. Grainger (Helicopter, Ice Patch) willow 1262.35 10 Boreal Forest - Yukon Mt. Grainger (Helicopter, Ice Patch) spruce 1262.32 11 Boreal Forest - Yukon Big Bend (Helicopter, Ice Patch) willow 1417.31 12 Boreal Forest - Yukon Big Bend (Helicopter, Ice Patch) willow 1403.25 13 Boreal Forest - Yukon Big Bend (Helicopter, Ice Patch) willow 1402.10 14 Boreal Forest - Yukon Big Bend (Helicopter, Ice Patch) willow 1401.62 15 Boreal Forest - Yukon Big Bend (Helicopter, Ice Patch) shrub 1402.42 16 Boreal Forest - Yukon Big Bend (Helicopter, Ice Patch) spruce 1400.12 17 Boreal Forest - Yukon Big Bend (Helicopter, Ice Patch) willow 1394.61 18 Boreal Forest - Yukon Big Bend (Helicopter, Ice Patch) spruce 1386.38 19 Boreal Forest - Yukon Big Bend (Helicopter, Ice Patch) willow 1386.91 20 Boreal Forest - Yukon Big Bend (Helicopter, Ice Patch) willow 1381.43 21 Boreal Forest - Yukon Aligator Lake (Helicopter, Ice Patch) willow 1360.71 22 Boreal Forest - Yukon Aligator Lake (Helicopter, Ice Patch) willow 1355.63 23 Boreal Forest - Yukon Aligator Lake (Helicopter, Ice Patch) willow 1355.24 24 Boreal Forest - Yukon Aligator Lake (Helicopter, Ice Patch) willow 1347.80 25 Boreal Forest - Yukon Aligator Lake (Helicopter, Ice Patch) no ID 1339.08 26 Boreal Forest - Yukon Aligator Lake (Helicopter, Ice Patch) no ID 1339.27 27 Boreal Forest - Yukon Aligator Lake (Helicopter, Ice Patch) no ID 1344.88 28 Boreal Forest - Yukon Aligator Lake (Helicopter, Ice Patch) no ID 1349.48 29 Boreal Forest - Yukon Aligator Lake (Helicopter, Ice Patch) no ID 1347.30 30 Boreal Forest - Yukon Aligator Lake (Helicopter, Ice Patch) no ID 1346.21 31 Boreal Forest - Yukon Kusawa Lake willow 676.92 32 Boreal Forest - Yukon Kusawa Lake spruce 677.03 33 Boreal Forest - Yukon Kusawa Lake willow 676.89 34 Boreal Forest - Yukon Kusawa Lake willow 676.57 35 Boreal Forest - Yukon Kusawa Lake willow 682.16 36 Boreal Forest - Yukon Kusawa Lake spruce 682.22 37 Boreal Forest - Yukon Kusawa Lake no ID 680.79 38 Boreal Forest - Yukon Kusawa Lake willow 682.10 39 Boreal Forest - Yukon Kusawa Lake birch 682.73

268

ID Region Location Field ID masl 40 Boreal Forest - Yukon Highway, Taye Lake willow 720.27 41 Boreal Forest - Yukon Highway, Taye Lake no ID 720.50 42 Boreal Forest - Yukon Highway, Taye Lake spruce 720.45 43 Boreal Forest - Yukon Highway, Taye Lake no ID 719.90 44 Boreal Forest - Yukon Highway, Taye Lake willow 721.10 45 Boreal Forest - Yukon Highway, Taye Lake spruce 722.02 46 Boreal Forest - Yukon Highway, Taye Lake no ID 721.80 47 Boreal Forest - Yukon South Kluane no ID 797.35 48 Boreal Forest - Yukon South Kluane no ID 797.80 49 Boreal Forest - Yukon South Kluane no ID 796.67 50 Boreal Forest - Yukon South Kluane no ID 797.38 51 Boreal Forest - Yukon South Kluane no ID 794.74 52 Boreal Forest - Yukon South Kluane no ID 796.98 53 Boreal Forest - Yukon South Kluane no ID 795.52 54 Boreal Forest - Yukon Middle Kluane birch/aspen 812.62 55 Boreal Forest - Yukon Middle Kluane spruce 811.98 56 Boreal Forest - Yukon Middle Kluane willow 812.05 57 Boreal Forest - Yukon Middle Kluane willow 811.73 58 Boreal Forest - Yukon Middle Kluane birch 812.29 59 Boreal Forest - Yukon Middle Kluane willow 812.05 60 Boreal Forest - Yukon Middle Kluane spruce 811.91 61 Coastal Rain Forest - Alaska Russel Fjord willow 4.34 62 Coastal Rain Forest - Alaska Russel Fjord birch 5.49 63 Coastal Rain Forest - Alaska Russel Fjord willow 2.76 64 Coastal Rain Forest - Alaska Russel Fjord willow 3.14 65 Coastal Rain Forest - Alaska Russel Fjord willow 3.98 66 Coastal Rain Forest - Alaska Russel Fjord willow 2.99 67 Coastal Rain Forest - Alaska Russel Fjord willow 2.30 68 Coastal Rain Forest - Alaska Russel Fjord willow 0.46 69 Coastal Rain Forest - Alaska Russel Fjord willow 0.44 70 Coastal Rain Forest - Alaska Russel Fjord willow 1.42 71 Coastal Rain Forest - Alaska Russel Fjord spruce 6.09 72 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 44.25 73 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 45.62 74 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake spruce 45.62 75 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 45.61 76 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 46.48 77 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 45.01 78 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake spruce 45.67 79 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 46.22 80 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 46.38 81 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 45.45

269

ID Region Location Field ID masl 82 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 46.16 83 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 45.26 84 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake spruce 45.73 85 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 46.09 86 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 50.51 87 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 50.59 88 Coastal Rain Forest - Alaska Situk Lake and Mountian Lake willow 50.67 89 Coastal Rain Forest - Alaska Harlequin Lake willow 28.95 90 Coastal Rain Forest - Alaska Harlequin Lake willow 28.60 91 Coastal Rain Forest - Alaska Harlequin Lake willow 30.02 92 Coastal Rain Forest - Alaska Harlequin Lake Sprice 29.45 93 Coastal Rain Forest - Alaska Harlequin Lake willow 29.49 94 Coastal Rain Forest - Alaska Harlequin Lake willow 28.45 95 Coastal Rain Forest - Alaska Harlequin Lake willow 28.46 96 Coastal Rain Forest - Alaska Harlequin Lake willow 29.62 97 Coastal Rain Forest - Alaska Harlequin Lake willow 29.52 98 Coastal Rain Forest - Alaska Harlequin Lake spruce 29.54 99 Coastal Rain Forest - Alaska Harlequin Lake willow 28.19 100 Coastal Rain Forest - Alaska Harlequin Lake willow 29.47 101 Coastal Rain Forest - Alaska Harlequin Lake spruce 27.88 102 Coastal Rain Forest - Alaska Cannon Beach willow 2.11 103 Coastal Rain Forest - Alaska Cannon Beach spruce 3.30 104 Coastal Rain Forest - Alaska Cannon Beach willow 3.54 105 Coastal Rain Forest - Alaska Lower Situk willow -2.20 106 Coastal Rain Forest - Alaska Lower Situk willow -0.32 107 Coastal Rain Forest - Alaska Lower Situk spruce -0.76 108 Coastal Rain Forest - Alaska Lower Situk no id 1.08 109 Coastal Rain Forest - Alaska Wrangell-St. Elias willow 1.65 110 Coastal Rain Forest - Alaska Wrangell-St. Elias willow 1.78 111 Coastal Rain Forest - Alaska Wrangell-St. Elias willow 1.25 112 Coastal Rain Forest - Alaska Wrangell-St. Elias willow 4.42 113 Coastal Rain Forest - Alaska Wrangell-St. Elias no id 4.50 114 Coastal Rain Forest - Alaska Wrangell-St. Elias no id 2.89 115 Coastal Rain Forest - Alaska Wrangell-St. Elias no id 2.62 116 Coastal Rain Forest - Alaska Wrangell-St. Elias no id 2.61 117 Coastal Rain Forest - Alaska Wrangell-St. Elias no id 1.59 118 Coastal Rain Forest - Alaska Wrangell-St. Elias no id 2.51 119 Coastal Rain Forest - Alaska Wrangell-St. Elias no id 2.79 120 Coastal Rain Forest - Alaska Wrangell-St. Elias no id 3.10 121 Coastal Rain Forest - Alaska Wrangell-St. Elias no id 2.60 122 Boreal Forest - Alaska Squirrel Creek willow 468.47 123 Boreal Forest - Alaska Squirrel Creek willow 465.76

270

ID Region Location Field ID masl 124 Boreal Forest - Alaska McCarthy Road 1 willow 299.97 125 Boreal Forest - Alaska McCarthy Road 2 willow 451.29 126 Boreal Forest - Alaska Kennicott willow 656.16 127 Boreal Forest - Alaska Kennicott willow 643.39 128 Boreal Forest - Alaska Kennicott willow 643.17 129 Boreal Forest - Alaska Kennicott willow 644.33 130 Boreal Forest - Alaska Kennicott willow 657.13 131 Boreal Forest - Alaska Kennicott willow 652.29 132 Boreal Forest - Alaska Kennicott willow 650.69 133 Boreal Forest - Alaska McCarthy willow 417.10 134 Boreal Forest - Alaska McCarthy willow 416.20 135 Boreal Forest - Alaska McCarthy Road 3 willow 415.54 136 Boreal Forest - Alaska McCarthy Road 3 willow 414.63 137 Boreal Forest - Alaska McCarthy Road 3 willow 416.70 138 Boreal Forest - Alaska McCarthy Road 4 willow 380.55 139 Boreal Forest - Alaska McCarthy Road 4 willow 384.23 140 Boreal Forest - Alaska McCarthy Road 4 willow 384.43 141 Boreal Forest - Alaska McCarthy Road 4 willow 384.45 142 Coastal Rain Forest - Alaska Seward, Kenai Peninsula willow 114.23 143 Coastal Rain Forest - Alaska Seward, Kenai Peninsula willow 114.23 144 Coastal Rain Forest - Alaska Seward, Kenai Peninsula willow 99.01 145 Coastal Rain Forest - Alaska Seward, Kenai Peninsula willow 99.95 Samples in bold were genetically processed in this analysis.

Table III.2 Ancient plant samples from Southwestern Yukon. ID Weight (g) Stick Size Recovery Site Traditional Territory 1a 1.78 Medium IP 74 Big Bend Carcross Tagish, Kwanlin Dun

1b 1.29 Medium IP 74 Big Bend Carcross Tagish, Kwanlin Dun 2 1.64 Large IP 82 Scurvy Creek Teslin Tlingit 3 1.01 Small IP 73 (JiUl-1) Fannin Ta’an Kwachan 4 1.91 Large IP 29 (JbVa-2) Sandpiper Carcross-Tagish, Champagne-Aishihik 5 1.48 Large IP 29 (JbVa-2) Sandpiper Carcross-Tagish, Champagne-Aishihik 6 1.10 Small IP 91 Ruby Peak Kluane First Nation, Champagne Aishihik 7 1.05 Small IP 13 (JdUt-17) Granger Kwanlin Dun 8 1.80 Small IP 13 (JdUt-17) Granger Kwanlin Dun 9 2.04 Small IP 37 (JcUu-1) Friday Kwanlin Dun, Carcross Tagish 10 1.20 Small IP 13 (JdUt-17) Granger Kwanlin Dun 11 2.03 Small JgVe-1 - 12 1.60 Large Quintino Sella Glacier Kluane First Nation, Champagne Aishihik

271

Appendix IV: Sample Photographs

Figure IV.1 Paleobiological sample pictures (IP1a–IP9)

272

Figure IV.2 Paleobiological sample pictures (IP10–K12)

273

Figure IV.3 Modern Salix sample pictures (MP5–MP67).

Orange text box = Yukon Interior; Red text box = Alaskan Coast (Region A).

274

Figure IV.4 Modern Salix sample pictures (MP83–MP145).

Red text box = Alaskan Coast (Region A); Turquoise text box = Alaskan Interior; Yellow text box = Alaskan Coast (Region B).

275