Li Et Al. Mir-30D in Human Cancer

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Li et al. mir-30d in human cancer Table S3. The probe list down-regulated in 2008 cells by mir-30d mimic transfection Gene Probe Gene symbol Description Row set 12720 8080762 ABHD6 abhydrolase domain containing 6 23797 8092933 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 31394 8073430 ACO2 aconitase 2, mitochondrial 17019 7975598 ACOT1 acyl-CoA thioesterase 1 12466 7936028 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 18102 8056005 ACVR1 activin A receptor, type I 6966 8069676 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 8067 8052882 ADD2 adducin 2 (beta) 26555 8146687 ADHFE1 alcohol dehydrogenase, iron containing, 1 25038 7981514 AHNAK2 AHNAK nucleoprotein 2 19272 8136336 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) 17075 7931832 AKR1C2 aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3- alpha hydroxysteroid dehydrogenase, type III) 7587 8161755 ALDH1A1 aldehyde dehydrogenase 1 family, member A1 13926 8013384 ALDH3A1 aldehyde dehydrogenase 3 family, memberA1 18013 7954777 ALG10 asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) 30049 7954789 ALG10B asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast) 30449 8090291 ALG1L asparagine-linked glycosylation 1-like 11317 8047577 ALS2CR8 amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8 5576 8112596 ANKRA2 ankyrin repeat, family A (RFXANK-like), 2 22609 8030470 AP2A1 adaptor-related protein complex 2, alpha 1 subunit 14426 8107421 AP3S1 adaptor-related protein complex 3, sigma 1 subunit 26981 7983679 AP4E1 adaptor-related protein complex 4, epsilon 1 subunit 28968 8042402 APLF aprataxin and PNKP like factor 18299 8080926 ARL6IP5 ADP-ribosylation-like factor 6 interacting protein 5 32785 8143766 ARP11 actin-related Arp11 25426 8115144 ARSI arylsulfatase family, member I 6497 8052125 ASB3 ankyrin repeat and SOCS box-containing 3 27400 8026024 ASNA1 arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) 29242 8003814 ASPA aspartoacylase (Canavan disease) 24269 8128592 ATG5 ATG5 autophagy related 5 homolog (S. cerevisiae) 1 Li et al. mir-30d in human cancer 26535 8094911 ATP10D ATPase, class V, type 10D 21115 7968062 ATP12A ATPase, H+/K+ transporting, nongastric, alpha polypeptide 11781 7908940 ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 25990 8144931 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 11275 8179762 ATP6V1G2 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 27764 8124942 ATP6V1G2 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 24790 7987165 AVEN apoptosis, caspase activation inhibitor 5479 8132188 AVL9 AVL9 homolog (S. cerevisiase) 28460 8084206 B3GNT5 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 6878 7984686 BBS4 Bardet-Biedl syndrome 4 21795 7943867 BCO2 beta-carotene oxygenase 2 6964 7991080 BNC1 basonuclin 1 23563 8160260 BNC2 basonuclin 2 13063 7946680 BTBD10 BTB (POZ) domain containing 10 7629 7932542 C10orf67 chromosome 10 open reading frame 67 25835 7944751 C11orf63 chromosome 11 open reading frame 63 7064 7951781 C11orf71 chromosome 11 open reading frame 71 9582 7976571 C14orf129 chromosome 14 open reading frame 129 30343 8035886 C19orf12 chromosome 19 open reading frame 12 14918 7904244 C1orf161 chromosome 1 open reading frame 161 33102 7911897 C1orf174 chromosome 1 open reading frame 174 11724 8061019 C20orf7 chromosome 20 open reading frame 7 13640 8070411 C21orf88 chromosome 21 open reading frame 88 12591 8094550 C4orf19 chromosome 4 open reading frame 19 15166 8099912 C4orf34 chromosome 4 open reading frame 34 9812 8093456 C4orf42 chromosome 4 open reading frame 42 24984 8113113 C5orf36 chromosome 5 open reading frame 36 31140 8113097 C5orf36 chromosome 5 open reading frame 36 4816 8129193 C6orf204 chromosome 6 open reading frame 204 32989 8121547 C6orf225 chromosome 6 open reading frame 225 14247 8162624 C9orf21 chromosome 9 open reading frame 21 25535 8165630 C9orf37 chromosome 9 open reading frame 37 13746 8159984 C9orf46 chromosome 9 open reading frame 46 18600 8154416 C9orf93 chromosome 9 open reading frame 93 6673 8147112 CA13 carbonic anhydrase XIII 2 Li et al. mir-30d in human cancer 29829 8067495 CABLES2 Cdk5 and Abl enzyme substrate 2 12001 8102415 CAMK2D calcium/calmodulin-dependent protein kinase II delta 24354 7983054 CAPN3 calpain 3, (p94) 18992 7945803 CARS cysteinyl-tRNA synthetase 19719 8103922 CASP3 caspase 3, apoptosis-related cysteine peptidase 9770 7996393 CBFB core-binding factor, beta subunit 28208 8089261 CBLB Cas-Br-M (murine) ecotropic retroviral transforming sequence b 10063 7965846 CCDC53 coiled-coil domain containing 53 4692 8089544 CCDC80 coiled-coil domain containing 80 5733 8029050 CCDC97 coiled-coil domain containing 97 27457 8120719 CD109 CD109 molecule 4669 8176360 CD99 CD99 molecule 7096 8165794 CD99 CD99 molecule 15031 8016324 CDC27 cell division cycle 27 homolog (S. cerevisiae) 30771 8081838 CDGAP Cdc42 GTPase-activating protein 24878 8101031 CDKL2 cyclin-dependent kinase-like 2 (CDC2-related kinase) 26006 8105842 CENPH centromere protein H 7774 8157534 CEP110 centrosomal protein 110kDa 4267 8180257 CEP170 centrosomal protein 170kDa 33216 7925525 CEP170 centrosomal protein 170kDa 8431 7908459 CFH complement factor H 4901 8102328 CFI complement factor I 11719 8081055 CHMP2B chromatin modifying protein 2B 30307 8176234 CLIC2 chloride intracellular channel 2 28163 7910446 COG2 component of oligomeric golgi complex 2 5399 8127563 COL12A1 collagen, type XII, alpha 1 32793 8049088 COPS7B COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) 11839 8162744 CORO2A coronin, actin binding protein, 2A 24773 8168470 COX7B cytochrome c oxidase subunit VIIb 19430 8098204 CPE carboxypeptidase E 25439 7921099 CRABP2 cellular retinoic acid binding protein 2 6331 8065412 CST1 cystatin SN 10819 8035095 CYP4F11 cytochrome P450, family 4, subfamily F, polypeptide 11 6689 7915896 CYP4Z2P cytochrome P450, family 4, subfamily Z, polypeptide 2 pseudogene 6214 8133976 DBF4 DBF4 homolog (S. cerevisiae) 3 Li et al. mir-30d in human cancer 23420 8160756 DCAF12 DDB1 and CUL4 associated factor 12 30305 7918768 DENND2C DENN/MADD domain containing 2C 14191 7968890 DGKZ diacylglycerol kinase, zeta 104kDa 7032 7934615 DLG5 discs, large homolog 5 (Drosophila) 32686 8112822 DMGDH dimethylglycine dehydrogenase 12558 8088371 DNASE1L3 deoxyribonuclease I-like 3 17051 7918034 DPH5 DPH5 homolog (S. cerevisiae) 32946 8138977 DPY19L1 dpy-19-like 1 (C. elegans) 29514 8145470 DPYSL2 dihydropyrimidinase-like 2 18234 8020779 DSG2 desmoglein 2 7010 7910381 DUSP5P dual specificity phosphatase 5 pseudogene 24547 7965094 E2F7 E2F transcription factor 7 13494 7911096 EFCAB2 EF-hand calcium binding domain 2 28391 8108370 EGR1 early growth response 1 13422 7900051 EIF2C3 eukaryotic translation initiation factor 2C, 3 8694 8097529 ELMOD2 ELMO/CED-12 domain containing 2 20312 8078971 ENTPD3 ectonucleoside triphosphate diphosphohydrolase 3 30554 8058627 ERBB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) 21938 8041967 ERLEC1 endoplasmic reticulum lectin 1 24379 8136293 EXOC4 exocyst complex component 4 24765 8052554 FAM161A family with sequence similarity 161, member A 27968 8139160 FAM183B acyloxyacyl hydrolase (neutrophil) 14933 8005501 FAM18B2 family with sequence similarity 18, member B2 32502 8050427 FAM49A family with sequence similarity 49, member A 18545 7983991 FAM81A family with sequence similarity 81, member A 32397 8148184 FAM83A family with sequence similarity 83, member A 6309 8014825 FBXL20 F-box and leucine-rich repeat protein 20 6134 8105111 FBXO4 F-box protein 4 23970 8084947 FBXO45 F-box protein 45 11993 8052742 FBXO48 F-box protein 48 7208 8157074 FKTN fukutin 23337 8113003 FLJ11292 hypothetical protein FLJ11292 33211 7960436 FLJ44874 FLJ44874 protein 4610 7917954 FRRS1 ferric-chelate reductase 1 30846 8111739 FYB FYN binding protein (FYB-120/130) 4 Li et al. mir-30d in human cancer 29908 8175683 GABRE gamma-aminobutyric acid (GABA) A receptor, epsilon 32193 8099807 GAFA3 FGF-2 activity-associated protein 3 8593 8020903 GALNT1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) 12225 8098328 GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 5183 7917779 GCLM glutamate-cysteine ligase, modifier subunit 20797 8121749 GJA1 gap junction protein, alpha 1, 43kDa 26487 7970441 GJB2 gap junction protein, beta 2, 26kDa 28210 7984517 GLCE glucuronic acid epimerase 11782 7965941 GLT8D2 glycosyltransferase 8 domain containing 2 32945 8109344 GM2A GM2 ganglioside activator 22243 8079950 GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 13369 7946559 GNG10 guanine nucleotide binding protein (G protein), gamma 10 8176 7910520 GNPAT glyceronephosphate O-acyltransferase 20426 8114787 GNPDA1 glucosamine-6-phosphate deaminase 1 19123 8164105 GOLGA1 golgi autoantigen, golgin subfamily a, 1 5836 8078569 GOLGA4 golgi autoantigen, golgin subfamily a, 4 27561 8152355 GOLSYN Golgi-localized protein 16247 7903742 GSTM4 glutathione S-transferase mu 4 10023 8150103 GTF2E2 general transcription factor IIE, polypeptide 2, beta 34kDa 20256 7897441 H6PD hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 13503 7958158 HCFC2 host cell factor C2 32253 8096385 HERC3 hect domain and RLD 3 18929 8107164 HISPPD1 histidine acid phosphatase
Recommended publications
  • Final Copy 2018 09 25 Gaunt

    Final Copy 2018 09 25 Gaunt

    This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Gaunt, Jess Title: A Viral Approach to Translatome Profiling of CA1 Neurons During Associative Recognition Memory Formation General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. A Viral Approach to Translatome Profiling of CA1 Neurons During Associative Recognition Memory Formation Jessica Ruth Gaunt A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School.
  • Core Transcriptional Regulatory Circuitries in Cancer

    Core Transcriptional Regulatory Circuitries in Cancer

    Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage.
  • Stelios Pavlidis3, Matthew Loza3, Fred Baribaud3, Anthony

    Stelios Pavlidis3, Matthew Loza3, Fred Baribaud3, Anthony

    Supplementary Data Th2 and non-Th2 molecular phenotypes of asthma using sputum transcriptomics in UBIOPRED Chih-Hsi Scott Kuo1.2, Stelios Pavlidis3, Matthew Loza3, Fred Baribaud3, Anthony Rowe3, Iaonnis Pandis2, Ana Sousa4, Julie Corfield5, Ratko Djukanovic6, Rene 7 7 8 2 1† Lutter , Peter J. Sterk , Charles Auffray , Yike Guo , Ian M. Adcock & Kian Fan 1†* # Chung on behalf of the U-BIOPRED consortium project team 1Airways Disease, National Heart & Lung Institute, Imperial College London, & Biomedical Research Unit, Biomedical Research Unit, Royal Brompton & Harefield NHS Trust, London, United Kingdom; 2Department of Computing & Data Science Institute, Imperial College London, United Kingdom; 3Janssen Research and Development, High Wycombe, Buckinghamshire, United Kingdom; 4Respiratory Therapeutic Unit, GSK, Stockley Park, United Kingdom; 5AstraZeneca R&D Molndal, Sweden and Areteva R&D, Nottingham, United Kingdom; 6Faculty of Medicine, Southampton University, Southampton, United Kingdom; 7Faculty of Medicine, University of Amsterdam, Amsterdam, Netherlands; 8European Institute for Systems Biology and Medicine, CNRS-ENS-UCBL, Université de Lyon, France. †Contributed equally #Consortium project team members are listed under Supplementary 1 Materials *To whom correspondence should be addressed: [email protected] 2 List of the U-BIOPRED Consortium project team members Uruj Hoda & Christos Rossios, Airways Disease, National Heart & Lung Institute, Imperial College London, UK & Biomedical Research Unit, Biomedical Research Unit, Royal
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • RFX2 Antibody Cat

    RFX2 Antibody Cat

    RFX2 Antibody Cat. No.: 25-404 RFX2 Antibody Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human Antibody produced in rabbits immunized with a synthetic peptide corresponding a region IMMUNOGEN: of human RFX2. TESTED APPLICATIONS: ELISA, WB RFX2 antibody can be used for detection of RFX2 by ELISA at 1:1562500. RFX2 antibody APPLICATIONS: can be used for detection of RFX2 by western blot at 1 μg/mL, and HRP conjugated secondary antibody should be diluted 1:50,000 - 100,000. POSITIVE CONTROL: 1) 721_B Cell Lysate PREDICTED MOLECULAR 80 kDa WEIGHT: Properties PURIFICATION: Antibody is purified by peptide affinity chromatography method. CLONALITY: Polyclonal CONJUGATE: Unconjugated PHYSICAL STATE: Liquid September 30, 2021 1 https://www.prosci-inc.com/rfx2-antibody-25-404.html Purified antibody supplied in 1x PBS buffer with 0.09% (w/v) sodium azide and 2% BUFFER: sucrose. CONCENTRATION: batch dependent For short periods of storage (days) store at 4˚C. For longer periods of storage, store RFX2 STORAGE CONDITIONS: antibody at -20˚C. As with any antibody avoid repeat freeze-thaw cycles. Additional Info OFFICIAL SYMBOL: RFX2 ALTERNATE NAMES: RFX2, FLJ14226, ACCESSION NO.: NP_000626 PROTEIN GI NO.: 19743881 GENE ID: 5990 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References RFX2 is a member of transcription factors that contain a highly-conserved winged helix DNA binding domain. RFX2 is structurally related to regulatory factors X1, X3, X4, and X5. It is a transcriptional activator that can bind DNA as a monomer or as a heterodimer with other RFX family members. This protein can bind to cis elements in the promoter of the IL-5 receptor alpha gene.This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA BACKGROUND: binding domain.
  • Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
  • Noelia Díaz Blanco

    Noelia Díaz Blanco

    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation

    Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation

    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
  • Dedifferentiation and Neuronal Repression Define Familial Alzheimer’S Disease Andrew B

    Dedifferentiation and Neuronal Repression Define Familial Alzheimer’S Disease Andrew B

    bioRxiv preprint doi: https://doi.org/10.1101/531202; this version posted November 18, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International licenseCaldwell. et al. BIORXIV/2019/531202 Dedifferentiation and neuronal repression define Familial Alzheimer’s Disease Andrew B. Caldwell1, Qing Liu2, Gary P. Schroth3, Douglas R. Galasko2, Shauna H. Yuan2,8, Steven L. Wagner2,4, & Shankar Subramaniam1,5,6,7* Affiliations 1Department of Bioengineering, University of California, San Diego, La Jolla, CA, USA. 2Department of Neurosciences, University of California, San Diego, La Jolla, CA, USA. 3Illumina, Inc., San Diego, CA, USA. 4VA San Diego Healthcare System, La Jolla, CA, USA. 5Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, CA, USA. 6Department of Nanoengineering, University of California, San Diego, La Jolla, CA, USA. 7Department of Computer Science and Engineering, University of California, San Diego, La Jolla, CA, USA. 8Present Address: N. Bud Grossman Center for Memory Research and Care, Department of Neurology, University of Minnesota, Minneapolis, MN, USA; GRECC, Minneapolis VA Health Care System, Minneapolis, MN, USA. *Correspondence: Correspondence and requests for materials should be addressed to S.S. ([email protected]). Abstract Early-Onset Familial Alzheimer’s Disease (EOFAD) is a dominantly inherited neurodegenerative disorder elicited by over 300 mutations in the PSEN1, PSEN2, and APP genes1. Hallmark pathological changes and symptoms observed, namely the accumulation of misfolded Amyloid-β (Aβ) in plaques and Tau aggregates in neurofibrillary tangles associated with memory loss and cognitive decline, are understood to be temporally accelerated manifestations of the more common sporadic Late-Onset Alzheimer’s Disease.
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation

    (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation

    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
  • DNA Ism1 823

    DNA Ism1 823

    DNA ism1 823 ATGTTGCGACTGGCAGCGGAGCTTCTGCTTCTCCTGGGACTGCTCCTCCTCACCCTGCAC 882 uninjected_emb1 ATGTTGCGACTGGCAGCGGAGCTTCTGCTTCTCCTGGGACTGCTCCTCCTCACCCTGCAC ism1_T3_emb1.1 ATGTTGCGACTGGCAGCGGAGCTTCTGCTTCTCCTGGGACTGCTCCTCCTCACCCTGCAC ism1_T3_emb1.2 ATGTTGCGACTGGCAGCGGAGCTTCTGCTTCTCCTGGGACTGCTCCTCCTCACCCTGCAC ism1_T3_emb1.3 ATGTTGCGACTGGCAGCGGAGCTTCTGCTTCTCCTGGGACTGCTCCTCCTCCTCATACAG ism1_T3_emb1.4 ATGTTGCGACTGGCAGCGGAGCTTCTGCTTCTCCTGGGACTGCTCCTCCTCCTCATACAG ism1 883 ATCACTGTGCTCCGAGGCAGCCCCGATAGCTCCTCCAACTCCAGCCACAGCCTCATACAG 942 uninjected_emb1 ATCACTGTGCTCCGAGGCAGCCCCGATAGCTCCTCCAACTCCAGCCACAGCCTCATACAG ism1_T3_emb1.1 ATCACTGTGCTCCGAG------------------------CCAGCCACAGCCTCATACAG ism1_T3_emb1.2 ATCACTGTGCTCCGAGGCAGCCCCGAT----------ACTCCAGCCACAGCCTCATACAG ism1_T3_emb1.3 GTCAGTCCATTCCATTCCA---CATACAGGTCAGTCCATTCCACATACAGGT-----CAG ism1_T3_emb1.4 GTCAGTCCATTCCATTCCA---CATACAGGTCAGTCCATTCCACATACAGGT-----CAG ism1 943 GTCAGTCCATTCCACATACAG 964 uninjected_emb1 GTCAGTCCATTCCTCATACAG ism1_T3_emb1.1 GTCAGTCCATTCCACATACAG ism1_T3_emb1.2 GTCAGTCCATTCCACATACAG ism1_T3_emb1.3 TCCATTCCATTCCACATACAG ism1_T3_emb1.4 TCCATTCCATTCCACATACAG mRNA ism1 1 MLRLAAELLLLLGLLLLTLHITVLRG^SPDSSSNSSHSLIQVSPFHIQ… uninjected_emb1 MLRLAAELLLLLGLLLLTLHITVLRG^SPDSSSNSSHSLIQVSPFHIQ… ism1_T3_emb1.1 MLRLAAELLLLLGLLLLTLHITVLRV-------SSHSLIQVSPFHIQ… ism1_T3_emb1.2 MLRLAAELLLLLGLLLLTLHITVLRG^SPD---YSSHSLIQVSPFHIQ… ism1_T3_emb1.3 MLRLAAELLLLLGLLLLLIQVSP^FHSISYRSVHSTYRF-QSIPFHIQ ism1_T3_emb1.4 MLRLAAELLLLLGLLLLLIQVSP^FHSISYRSVHSTYRF-QSIPFHIQ Human ISM1 MVRLAAELLLLLGLLLLTLHITVLRG^SGA
  • Curcumin Alters Gene Expression-Associated DNA Damage, Cell Cycle, Cell Survival and Cell Migration and Invasion in NCI-H460 Human Lung Cancer Cells in Vitro

    Curcumin Alters Gene Expression-Associated DNA Damage, Cell Cycle, Cell Survival and Cell Migration and Invasion in NCI-H460 Human Lung Cancer Cells in Vitro

    ONCOLOGY REPORTS 34: 1853-1874, 2015 Curcumin alters gene expression-associated DNA damage, cell cycle, cell survival and cell migration and invasion in NCI-H460 human lung cancer cells in vitro I-TSANG CHIANG1,2, WEI-SHU WANG3, HSIN-CHUNG LIU4, SU-TSO YANG5, NOU-YING TANG6 and JING-GUNG CHUNG4,7 1Department of Radiation Oncology, National Yang‑Ming University Hospital, Yilan 260; 2Department of Radiological Technology, Central Taiwan University of Science and Technology, Taichung 40601; 3Department of Internal Medicine, National Yang‑Ming University Hospital, Yilan 260; 4Department of Biological Science and Technology, China Medical University, Taichung 404; 5Department of Radiology, China Medical University Hospital, Taichung 404; 6Graduate Institute of Chinese Medicine, China Medical University, Taichung 404; 7Department of Biotechnology, Asia University, Taichung 404, Taiwan, R.O.C. Received March 31, 2015; Accepted June 26, 2015 DOI: 10.3892/or.2015.4159 Abstract. Lung cancer is the most common cause of cancer CARD6, ID1 and ID2 genes, associated with cell survival and mortality and new cases are on the increase worldwide. the BRMS1L, associated with cell migration and invasion. However, the treatment of lung cancer remains unsatisfactory. Additionally, 59 downregulated genes exhibited a >4-fold Curcumin has been shown to induce cell death in many human change, including the DDIT3 gene, associated with DNA cancer cells, including human lung cancer cells. However, the damage; while 97 genes had a >3- to 4-fold change including the effects of curcumin on genetic mechanisms associated with DDIT4 gene, associated with DNA damage; the CCPG1 gene, these actions remain unclear. Curcumin (2 µM) was added associated with cell cycle and 321 genes with a >2- to 3-fold to NCI-H460 human lung cancer cells and the cells were including the GADD45A and CGREF1 genes, associated with incubated for 24 h.