Ontogeny of OPN4, OPN5, Gnrh and Gnih Mrna Expression In

Home , Domestic duck, Melanopsin, OPN5, Opsin

Article Ontogeny of OPN4, OPN5, GnRH and GnIH mRNA Expression in the Posthatch Male and Female Pekin Duck (Anas platyrhynchos domesticus) Suggests OPN4 May Have Additional Functions beyond Reproduction

Brooke Van Wyk 1 and Gregory Fraley 1,2,*

1 Biology Department, Hope College, Holland, MI 49423, USA; [email protected] 2 Department of Animal Sciences, Purdue University, West Lafayette, IN 47907, USA * Correspondence: [email protected]; Tel.: +1-765-496-2725

Simple Summary: Birds perceive light differently than mammals. Unlike mammals, birds’ retinas do not participate in the non-image forming, seasonal breeding aspects of light perception. Birds have deep brain photoreceptors that are involved with the seasonal increase in fertility. Until this study, it was unknown how these brain photoreceptors developed after hatching. Our novel ﬁnding is that at least one of the photoreceptors, OPN4, is expressed at high levels on the day of hatching, which suggests that this photoreceptor has functions beyond just the reproductive system. These ﬁndings could change how we light poultry barns to improve the growth, health and welfare of our poultry species.

Citation: Van Wyk, B.; Fraley, G. Abstract: The hypothalamic–pituitary–gonadal axis (HPG) is known to be regulated by daylength Ontogeny of OPN4, OPN5, GnRH through the deep brain photoreceptor (DBP) system. The post-hatch ontogeny is not known for any and GnIH mRNA Expression in the of the DBPs. We set out to determine the ontogeny of OPN4 and OPN5 gene expression relative Posthatch Male and Female Pekin to GnRH and GnIH using qRT-PCR. Brains and serum were collected from ﬁve drakes and ﬁve Duck (Anas platyrhynchos domesticus) hens on the day of hatching (Day 0) and again at 2, 4, 6, 10, 14, 19, 25 and 31 weeks of age and Suggests OPN4 May Have Additional analyzed by qRT-PCR. Hen and drake serum was assayed for circulating levels of estradiol and Functions beyond Reproduction. testosterone, respectively. Data were analyzed between sexes over time using a repeated measures Animals 2021, 11, 1121. https:// two-way ANOVA. Interestingly, the results show that on the day of hatching (Day 0), ducks showed doi.org/10.3390/ani11041121 adult-like levels of relative OPN4, but not OPN5, gene expression. During week 10, DBP levels

Academic Editor: Michael E. Davis increased, achieving highest relative expression levels at week 19 that maintained through week 31, typically peak fertility in ducks. GnRH mRNA levels increased following the DBP expression Received: 18 March 2021 at the onset of puberty, and gonadal steroids increased after GnRH at week 14 while estradiol Accepted: 9 April 2021 preceded testosterone. GnIH mRNA levels did not appreciably change during the time course of this Published: 14 April 2021 experiment. These observations suggest that OPN4 may be active during the peri-hatch period and may have physiological roles beyond puberty and fertility. Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in Keywords: melanopsin; puberty; neonate; photoreception published maps and institutional afﬁl- iations.

1. Introduction Lighting systems in commercial poultry have come under increased scrutiny over the Copyright: © 2021 by the authors. last decade. Long daylengths are necessary in order to maintain reproduction in all poultry Licensee MDPI, Basel, Switzerland. species, and the duck is no exception [1–3]. Previous studies have attempted to understand This article is an open access article how types of lighting, intensity of light, and color spectra of light are critical to maximize distributed under the terms and the reproduction and welfare of both meat and breeder ducks [4–7]. As with all of our conditions of the Creative Commons poultry species, ducks are seasonal breeders and as such require a minimum of 14 h of light Attribution (CC BY) license (https:// per day in order to maintain fertility [8]. Despite being maintained on a long daylength, creativecommons.org/licenses/by/ there are still inexplicable drops in fertility during winter months, along with increased 4.0/).

Animals 2021, 11, 1121. https://doi.org/10.3390/ani11041121 https://www.mdpi.com/journal/animals Animals 2021, 11, 1121 2 of 10

unwanted behaviors, such as feather picking, aggression, and mislaid eggs [9–11]. In the large part, we do not understand these seasonal phenomena because there is a dearth of information in the literature about how ducks—or other birds—perceive light, not only visually but for seasonal reproduction. However, a series of deep brain photoreceptors (DBPs) have been described in the diencephalon that are involved with maintaining fertility in response to daylength in poultry. DBPs activate the hypothalamic–pituitary–gonadal axis (HPG) through a neuroendocrine cascade that involves thyroid hormone. At least four DBPs have been putatively identiﬁed in the duck, including opsin 4 and opsin 5 [7,12]. It has been shown that DBPs stimulate neurons that signal the mediobasal hypothalamus (MBH), which is used in photoperiodic time measurement. Upon stimulation, the MBH produces the type 2 deiodinase (DIO2) that converts thyoxine (T4) to triiodothyronine (T3). Conversely, during short day lengths, the MBH produces a thyroid hormone (TH)-deactivating enzyme from the DIO3 gene, which converts T4 and T3 into inactive reverse triiodothyronine, an inactive form of thyroid hormone [13]. Thyroid hormone is critical for many physiological changes associated with post-hatch development and maturation of the central nervous system (CNS). Thyroid hormone is also necessary for normal growth and CNS development, as well as the onset of puberty [14]. Puberty is deﬁned as the initial increase in GnRH secretion [15,16]. However, the temporal ontogeny of DBPs relative to hypothalamic maturation of the HPG (GnRH and GnIH) is currently unknown in any avian species. The normal development of the CNS and sexual maturation of GnRH could be driven by differential temporal expression among the DBPs. The purpose of our study was to determine the temporal expression of opsin 4 and opsin 5 as they relate to the ontogeny of GnRH and GnIH gene expression. In order to accomplish this, we euthanized male and female ducks from hatch through the age associated with peak fertility. A more thorough understanding of the expression pattern of DBPs and their respective roles prior to puberty could enable us to better understand the physiological role of light beyond just reproduction, and ultimately to design lighting systems to utilize the temporal expression of each individual DBP in order to maximize the reproductive performance, production, and welfare of Pekin ducks.

2. Materials and Methods 2.1. Animals Brains from 54 ducklings/ducks were collected at Maple Leaf Farms (Leesburg, IN, USA) from breeder stock housed in commercial barns that produces Gx strain of meat birds. Three male and three female birds were randomly selected on the day of hatch (week 0), and again on weeks 2, 4, 6, 10, 14, 19, 25, and 31. All ducks were raised following industry stan- dards for heat, water, and feed. Further, all ducks were raised under fluorescent, J-lamps, which emit a full spectrum of visible light ([17]; ~5000 kelvin, ~65 lux/25.74 uW/cm2), with lights on at 0300 h (LD 18:6). Visual signs of puberty, as defined by age at first lay, typically occur reliably between 15 and 16 weeks of age [9]. The onset of puberty is defined here as the initial rise in GnRH mRNA (for review see [18]). All samples were collected between 0600 and 0800 h each day. Procedures were approved by Hope College’s IACUC (#011803R).

2.2. Tissue and RNA Collection Brains were removed from the ducks, diencephali (thalamus and hypothalamus) dissected, and immediately frozen on dry ice for transportation. Diencephali were dissected rostrally at the septomesencephalic tract, caudally at the third cranial nerve, and dorsally ~5 mm above the anterior commissure. Diencephali were stored at −80 ◦C until being processed. RNA was isolated from the diencephali using commercially available columns following the manufacturer’s recommendations (kit #75162, Qiagen, Germantown, MD, USA). RNA was stored at −80 ◦C until being used for qRT-PCR. Prior to euthanasia, blood was collected from the tibial vein and placed into serum separator tubes, centrifuged, and Animals 2021, 11, 1121 3 of 10

the serum was stored at −20 ◦C until being analyzed for circulating testosterone (T) or estradiol (E2) in drakes and hens, respectively.

2.3. qRT-PCR To complete qRT-PCR analyses, we utilized a Superscript VILO Invitrogen (Carlsbad, CA, USA) cDNA synthesis kit. Single-stranded cDNA was synthesized from 2 µg total cellular RNA using oligo(dT)16 primer and superscript II Reverse Transcriptase (Gibco BRL, Invitrogen Corp., Carlsbad, CA, USA), as recommended by the manufacturer. Five micrograms of RNA were used to perform a reverse transcription reaction using second round primers, and then second strand was synthesized using oligo(dT) primer. The 30 end specific oligonucleotide primers were designed within 300 bp from the 30 end of the transcript and used in qRT-PCR for each of the DPBs or neuropeptides (see Table1 ). Developmental reference genes (GAPDH and β-actin) were averaged and used at every time point for all gene expression analyses. The amplification profile of β-actin and GAPDH, DBPs and the neuropeptides consisted of 36 cycles each for 1 min at 95 ◦C, 30 s at 54 ◦C, and 1 min at 72 ◦C, respectively. The cycles were previously determined to be within the linear range. Final qRT-PCR was performed using the iTaq SYBR Green Supermix (BioRad Inc.; Hercules, CA, USA) following the manufacturers recommendation using a CFX96 Touch REalt Time System (BioRad Inc.; Hercules, CA, USA). Fold changes were determined following by first averaging the ct values for all samples. The delta ct was determined by taking the gene of interest average minus the β-actin average. The delta- delta ct was determined by subtracting the treatment delta ct value from the control delta ct value; fold-change was calculated by using the delta-delta ct value (x) and calculating 2−x.

Table 1. qRT-PCR primer sequences.

Target Gene Forward Reverse OPN4 CTCGCCATAGAACATCCGCA ACTGAACAGGCTACTCCCCTT DBP OPN5 TTT CTC ACC GCT GGA TCT TT CAG GCA GAT AAA GGC ATG GTG T GnRH-1 ATC GCA AAC GAA ATG GAA AG CTG GCT TCT CCT TCG ATC AG Reproductive GnIH TAA CAC CGC ATG GTA TGT GC CTC CTC TGC TCT TCC TCC AA GAPDH GGTTGTCTCCTGCGACTTCA TCCTTGGATGCCATGTGGAC Housekeeping β-actin CAC AAT GTA CCC GGG CAT CG ACA TCT GCT GGA AGG TGG AC

2.4. Hormone Analyses

T and E2 were analyzed by ELISA (Caymen Chemical, #582701 and # 501890, respectively; Ann Arbor, MI, USA). In order to validate the kit for use in ducks, 20 mL of blood was collected from drakes and hens and charcoal-stripped with 2 g of activated charcoal (Sigma Aldrich, St. Louis, MO, USA) on a shaker table for 2 h. The samples were centrifuged (4000 RPM, 15 min at room temp.) and the steroid-free serum was removed from the charcoal pellet. The steroid-free serum was then used to produce a standard curve following the manufacturer’s suggestions. For each kit, a standard curve was run using the kit’s buffer and compared to the respective standard curve produced with the steroid-free serum. Buffer vs. serum standard curves were very similar for each kit (R2 > 0.98). A pregnenolone standard curve made with either buffer or steroid-free serum produced no measurable binding suggesting that either kit would not cross-react with pregnenalone. Finally, 6 sets of triplicates of the charcoal stripped serum produced no measurable binding, indicating that the sample was steroid-free. The E2 kit’s assay range is 0.61–10,000 pg/mL and sensitivity is 20 pg/mL. Hen samples were run undiluted in duplicate following manufacturers recommendation with a ﬁnal incubation time of 60 min. The T kit assay range was 3.9–500 pg/mL and sensitivity of 6 pg/mL. Drake samples were diluted 1:4 in the kit’s assay buffer and run in duplicate following the manufacturer’s recommendation Animals 2021, 11 4 of 10

Animals 2021, 11, 1121 4 of 10 GnIH TAA CAC CGC ATG GTA TGT GC CTC CTC TGC TCT TCC TCC AA GAPDH GGTTGTCTCCTGCGACTTCA TCCTTGGATGCCATGTGGAC Housekeeping βwith-actin a ﬁnal CAC incubation AAT GTA time CCC of GGG 90 min CAT to CG achieve B ACA0 = 0.3. TCT All GCT plates GGA wereAGG TGG read AC using a Synergy Lx (Biotek, Inc. Winooski, VT 05404, USA) at 405 (T) or 414 nm (E2).

2.5.2.5. Statistical Statistical Analyses Analyses RelativeRelative mRNA mRNA levels levels were were analyzed analyzed ad ad hoc hoc using using a a 2-way 2-way ANOVA ANOVA at at each each age age using using MacMac JMP JMP (JMP (JMP 9; 9; SAS SAS Institute, Institute, Raleigh, Raleigh, NC, NC USA) USA) followed followed by by a a Fisher’s Fisher’s PLSD PLSD post post hoc hoc test test toto determine determine differences differences between between pairs pairs of of treatment treatment groups. groups. Endocrine Endocrine data data were were analyzed analyzed byby a a 1-way 1-way ANOVAANOVA for for each each hormone.hormone. AA ppvalue value << 0.05 was considered significant. signiﬁcant.

3.3. Results Results AdAd hochoc analyses revealed no no sex sex differences differences in in mRNA mRNA expression expression for forany any of the of neu- the neuroendocrineroendocrine elements. elements. However, However, a significant a signiﬁcant (p < (p 0.001)< 0.001) age age effect effect was was noted noted in inthe the ex- expressionpression of of OPN4, OPN4, OPN5, OPN5, and and GnRH, GnRH, but but not not GnIH, GnIH, during during post-hatch post-hatch development. development. On Onthe the day day of ofhatch, hatch, male male and and fe femalemale ducklings ducklings showed showed near-adult near-adult levels of OPN4OPN4 mRNA.mRNA. ByBy week week 4, 4, these these dropped dropped off off to to baseline, baseline, then then increased increased again again after after 10 10 weeks weeks of of age. age. OPN5 OPN5 mRNA,mRNA, on on the the other other hand, hand, remained remained at at baseline baseline levels levels from from the the day day of hatchof hatch until until week week 10 and10 and achieved achieved adult-like adult-like (as represented(as represented by peak by peak fertility fertility at ~25 at ~25 weeks) weeks) levels levels by week by week 14. GnRH14. GnRH mRNA mRNA levels levels remained remained constant constant from from hatch hatch until until just just prior prior to to week week 10, 10, at at which which timetime they they increased increased to to adult adult levels. levels. GnIH GnIH mRNA mRNA levels levels did did not not change change appreciably appreciably at at any any ageage during during this this study. study. Figure Figure1 illustrates1 illustrates these these results. results.

Melanopsin (OPN4) OPN5 AB 5 Males 5 b Females Males 4 4 Females b a 3 3 a 2 2 Expression Expression Relative mRNA mRNA Relative 1 Relative mRNA 1

0 0 0 2 4 6 1014192531 0 2 4 6 10 14 19 25 31 Age (weeks) Age (weeks)

GnRH GnIH CD 5 5 Male a Male Female Female 4 4

3 3

2 2 Expression Expression Relative mRNA mRNA Relative Relative mRNA Relative mRNA 1 1

0 0 02461014192531 0 2 4 6 10 14 19 25 31 Week of Age Week of Age

FigureFigure 1.1. OntogenyOntogeny of of relative relative mRNA mRNA expression expression of opsin of opsin 4 (OPN4; 4 (OPN4; (A)), opsin (A)), 5 opsin(OPN5; 5 ( (OPN5;B)), gonado- (B)), tropin releasing hormone (GnRH; (C)), and gonadotropin inhibitory hormone (GnIH; (D)). Relative gonadotropin releasing hormone (GnRH; (C)), and gonadotropin inhibitory hormone (GnIH; (D)). OPN4 expression was high just after hatch then dropped over the first 6 weeks of life, then once again Relative OPN4 expression was high just after hatch then dropped over the ﬁrst 6 weeks of life, then increased prior to the increase in relative GnRH mRNA expression. OPN5 expression remained low onceuntil againprior to increased the increase prior in toGnRH the increaseexpression. in relativeNo differences GnRH were mRNA observed expression. in GnIH OPN5 relative expression mRNA remainedexpression low at any until age. prior Letters to the indica increasete statistically in GnRH different expression. groups No differencesat p < 0.05. were observed in GnIH relative mRNA expression at any age. Letters indicate statistically different groups at p < 0.05. AnimalsAnimals 20212021,,11 11, 1121 55 of 1010

First eggs were were observed observed in in this this flock flock at at week week 16, 16, and and peak peak fertility, fertility, as asdetermined determined by by< 15% <15% clear clear eggs eggs at atcandling, candling, occurred occurred by by week week 25 25 (data (data not not shown due to commercialcommercial housing thatthat makes itit impossible toto tracetrace aa givengiven eggegg toto a specificspecific hen).hen). Hormone analysesanalyses showed that both TT andand EE22 concentrations were minimal from hatchhatch throughthrough weekweek 1010 inin drakes and hens, respectively. ByBy weekweek 14,14, EE22 concentrations werewere significantlysignificantly ((pp << 0.001) increasedincreased toto adultadult levelslevels in hens. However, drakes’ T concentrations beganbegan toto significantlysignificantly increaseincrease at week 14 14 ( (pp << 0.05) 0.05) but but did did not not reach reach adult-like adult-like concentrations concentrations until until week week 19 19 (p (

A 3000 b

2000 (pg/ml) 1000 a Serum Testosterone

0 0 2 4 6 10 14 19 25 31 Drake Age (weeks)

B 250 a

200

150

(pg/ml) 100

50 Serum Estradiol Levels 0 0 2 4 6 10 14 19 25 31 Hen Age (weeks)

Figure 2.2. Serum TT andand EE22concentrations concentrations in in drakes drakes and and hens, hens, respectively. respectively. (A ()A Serum) Serum T concentrations T concentra- intions drakes in drakes are at are minimal at minimal concentrations concentrations from hatchfrom hatch through through 10 weeks 10 weeks of age. of T age. concentrations T concentra- were significantlytions were significantly greater by 14greater weeks by of 14 age, weeks and againof age, significantly and again significantly increased 19 increased weeks and 19 maintainedweeks and maintained into adulthood. Letters indicate statistically significant groups, a = p < 0.05, b = p < 0.01. into adulthood. Letters indicate statistically significant groups, a = p < 0.05, b = p < 0.01. (B) Serum (B) Serum E2 concentrations were also at baseline from hatch through week 10 and were signifi- E concentrations were also at baseline from hatch through week 10 and were significantly increased cantly2 increased to adult-like concentrations by week 19. a = p < 0.001. Data suggest that gonadal todevelopment adult-like concentrations is occurring by by week week 14 19.and a may = p

4. Discussion Thus far, deepdeep brainbrain photoreceptorsphotoreceptors havehave beenbeen studiedstudied exclusivelyexclusively inin adultadult avianavian species, andand littlelittle is is known known about about the the temporal tempor developmental development of DBPs.of DBPs. In order In order to determine to deter- themine developmental the developmental expression expression of DBPs of inDBPs Pekin in ducks,Pekin ducks, diencephali diencephali from specific from specific age groups age weregroups homogenized, were homogenized, and the and RNA the was RNA extracted was extracted from that from tissue. that Usingtissue. thatUsing RNA, that qPCRRNA, wasqPCR used was to used determine to determine expression expression levels ofleve genesls of encodinggenes encoding the DBPs the for DBPs OPN5, for OPN4,OPN5, GnRHOPN4, andGnRH GnIH. and It GnIH. was expected It was expected that DBP that expression DBP expression would increase would increase prior to theprior onset to the of puberty,onset of puberty, and this expectationand this expectation was confirmed was confirmed as the levels as the of levels both DBPs of both increased DBPs increased prior to theprior increase to the inincrease GnRH. in Although GnRH. Although this study this is not study able tois not elicit able causative to elicit relationships causative relation- among theships various among mRNAs, the various it is interestingmRNAs, it to is pointinterest outing the to relative point out temporal the relative expression temporal around ex- thepression onset around of puberty the (definedonset of aspuberty the initial (defined rise in as GnRH the initial mRNA rise levels in GnRH [15,16 ]).mRNA There levels is an apparent[15,16]). There initial is increase an apparent in OPN4, initial followed increase by in OPN5, OPN4, then followed GnRH priorby OPN5, to the then increase GnRH in gonadalprior to the steroids increase and in onset gonadal of lay steroids (16 weeks), and followedonset of lay by peak(16 weeks), fertility followed (25 weeks). by peak The Animals 2021, 11, 1121 6 of 10

slightly earlier timing of E2 compared to T is somewhat in agreement with the initial onset of lay in the flock at 16 weeks, and peak fertility at 25 weeks. The relative temporal roles of each of these hypothalamic moieties has been described in other avian species [19–22]. Our most important finding, however, is that OPN4 was expressed at near-adult levels on the day of hatching, dropped to baseline until week 10 when levels again increased, at least 4 weeks earlier than the increased gonadal function as evidenced by gonadal steroid output. OPN5 remained at baseline levels until week 10, after which it also increased to adult levels by week 14. Surprisingly, no sex differences were observed during the ontogeny of DBPs. Perhaps a lighting paradigm could be developed to maximize production and welfare of birds based on the expression pattern and peak excitation energy of different DBPs. A potential new lighting paradigm would function by taking advantage of the wavelength-specificity of different DBPs. Although the effects of monochromatic light on fertility and behavior are quite species-specific, previous studies from our lab and others have indicated that monochromatic red light may have a “calming” effect on ducks [5,6,10], and that blue light increases activity, reduces fertility and may produce stress [5,6,10,23,24]. In order to maximize fertility in Pekin ducks, a combination of both red and blue light is required [10,12]. These observations are apparently contradictory given the peak excitation potential for OPN4 and OPN5. OPN5 is responsive to short wavelengths, with peak excitation at 420 nm [25]. Additionally, short wavelength light induced photoperiodic responses in quail when other photoreceptors had been eliminated [25]. Opsin 4 is maximally stim- ulated by light around 480 nm [26]. Studies in the duck have shown that elimination of OPN4 expression in the brain of drakes causes gonadal regression [27]. However, previous studies in galliforms and songbirds have suggested that longer wavelengths of light pene- trate brain tissue best and will stimulate gonadal recrudescence [28–32]. These conflicting findings emphasize the importance for future studies to better understand how the properties of light change as it passes through feathers and tissue for brain photoreception. If we can better understand the temporal expression, peak excitation energies, and physics of the light properties as it passes through tissues, then perhaps we could reverse engineer a lighting system that could reduce unwanted behaviors such as feather picking, aggression, and mislaid eggs, and prevent seasonal losses in fertility [10,17]. The brains of birds receive information about light via different mechanisms than mammals. Mammalian photoreceptivity includes retinal image and non-image forming cells. Bilateral enucleation in birds does not affect seasonal fertility or the HPG axis [33]. Gonads will either regress, or will not recrudesce, when light is prevented from penetrating the skull [30,34–36]. Thus, the DBPs have been studied as a mechanism for photoreceptivity in birds (reviewed in [37]). The activation and deactivation of DPBs have been linked to recrudescence and regression, respectively, including in the duck [12,17,20,38–40]. Fur- thermore, we have previously shown that insufficient light intensity will also decrease fertility and GnRH mRNA expression levels, a physiological function that is likely linked to reduced serum thyroid levels [7]. However, the increased OPN4 mRNA expression levels at hatching compared to OPN5, GnRH and GnIH mRNAs, and gonadal steroid levels, suggest that OPN4 may have other functions beyond reproduction, but perhaps still linked to the well-established relationship with the thyroid axis [19,37,41–46]. We have previously demonstrated that there are seasonal losses in fertility and an increase in mislaid eggs [7,17]. Perhaps a better understanding of early post-hatch expression of DBPs could enable us to better design lighting systems to prevent these two production and welfare issues, respectively. Early physiological functions of DBPs could involve their established relationship with thyroid hormones. Thyroid hormones in birds have numerous functions including weight gain, fattening, and muscle hypertrophy to prepare birds for migration [47]. Type 2 iodothyronine deiodinase (DIO2), which converts T4 to T3 in birds [37,45,48], is induced by photostimulation [49]. DIO2 activity is increased specifically in the diencephalon [49] during long day stimulation compared to short days. Activation of the hypothalamic-pituitary-thyroid axis has long been suggested as a necessary component of DBP function [19,37,41–46]; however, this Animals 2021, 11, 1121 7 of 10

has not been directly confirmed in the duck. Thyroid hormones are closely related to the hatching process, particularly in precocial species such as ducks. The necessity of thyroid hormone secretion for normal development of the central nervous system has been well established for nearly a century. It may be possible that activation of OPN4 at hatch leads to the increase in thyroid activity to aide in the development of the CNS; however, this cannot be ascertained from this study alone. Sex differences in post-hatch thyroid hormone levels have been shown in zebra finches, however not in precocial species [50], which is somewhat in agreement with the lack of sex differences that we observed in this experiment in DBP expression. However, a large peri-hatch increase in hypothalamic–pituitary–thyroid axis activity is seen in precocial, but not altricial species [51]. Increased thyroid hormone levels around hatch have been associated with the critical period of post-hatch imprinting, and exogenous T3 at this time can enhance imprinting and learning in chicks [52]. Although the relationship of peri-hatch thyroid hormones and imprinting and learning in Pekin ducks is unknown, it has been demonstrated that increased thyroid hormones near the end of incubation are involved in cholinergic- and adrenergic-mediated regulation of cardiovascular development [53,54], as well as the initial thermoregulatory responses to cooling at hatch, and ultimately thermoregulation [55–57]. Thus, the potential link between DBP expression and the hypothalamic-pituitary-thyroid system may have important impacts upon the behavior, welfare and physiological function of our domestic poultry species beyond the reproductive system. The purpose of this experiment was to highlight expression patterns of OPN4 and OPN5, however, a determination of the physiological role of these expression patterns is beyond the scope of this study. Seasonal variations have been observed in GnRH neuronal activity, and prior to puberty in birds [58]. GnRH mRNA expression is increased during the breeding season and is decreased during gonadal regression [59,60]. Gonadal regression can be induced by numerous factors, including an increased hypothalamic GnIH activity [61,62]. In birds, GnIH is thought to inhibit gonadotropin release and sexual behavior [62–64], and stimulates feeding in numerous avian species, [65–67] and the duck is no exception [62]. However, previous studies from our lab have also revealed few to no GnIH mRNA changes associated with changes in light or gonadal status [12]. It is possible that our current study had insufficiently small time increments in order to resolve small changes in DBP or GnIH mRNAs; previous studies have shown that gonadal development requires the interplay of numerous DBPs [12,19,27,68]. It is likely that DBP stimulation does not lead to the activation or deactivation of GnIH neurons. Little evidence in the duck suggests that GnIH plays a role in pubertal timing [62]. However, growing evidence in other avian species suggests that it may provide a regulatory mechanism for HPG function during times of stress [14,69,70]. It is likely that the primary role of this neuropeptide has yet to be elucidated.

5. Conclusions Melanopsin (OPN4), but not OPN5, mRNA is expressed at near adult-like levels in both the hen and drake Pekin duckling at hatch. The neonatal expression of this DBP suggests that it may have further physiological roles beyond reproduction.

Author Contributions: Conceptualization, G.F.; methodology, G.F. and B.V.W.; software, G.F. and B.V.W.; validation, G.F. and B.V.W. formal analysis, G.F. and B.V.W.; investigation, G.F. and B.V.W.; resources, G.F.; data curation, G.F. and B.V.W.; writing—original draft preparation, G.F. and B.V.W.; writing—review and editing, G.F. and B.V.W.; visualization, G.F. and B.V.W.; supervision, G.F.; project administration, G.F.; funding acquisition, G.F. All authors have read and agreed to the published version of the manuscript. Funding: This project was supported by Agriculture and Food Research Initiative Competitive Grant no. 2018-67016-27616 from the USDA National Institute of Food and Agriculture. Institutional Review Board Statement: This project was approved by the Hope College Animal Care and Use Committee (HCACUC #011803R). Animals 2021, 11, 1121 8 of 10

Data Availability Statement: The data presented in this study are available on request from the corresponding author. Acknowledgments: The authors wish to thank Maple Leaf Farms, Inc. for their support of this research. This project was supported by Agriculture and Food Research Initiative Competitive Grant no. 2018-67016-27616 from the USDA National Institute of Food and Agriculture. Conﬂicts of Interest: The authors have no conﬂict to report.

References 1. Benoit, J.; Assenmacher, I.; Walter, F.X. Gonadotropic activity of the hypophysis of the domestic duck during seasonal testicular regression and prepuberty. C. R. Seances. Soc. Biol. Fil. 1950, 144, 1403–1407. [PubMed] 2. Benoit, J.; Assenmacher, I.; Brard, E. Action of prolonged permanent lighting on the testicular development of the Pekin duck. Arch. Anat. Microsc. Morphol. Exp. 1959, 48, 5–11. [PubMed] 3. Benoit, J.; Assenmacher, I. Hypothalamo-hypophyseal relationship and its role in gonadostimulation in domestic duck. J. Physiol. 1951, 43, 643–645. 4. Wells, M.C.; Lehner, P.N.; Bolen, E.G.; Rylander, M.K. Comparison of scotopic sensitivity in diurnal (Anas platyrhynchos) and crepuscular (Dendrocygna autumnalis) ducks. J. Comp. Physiol. Psychol. 1975, 88, 940–944. [CrossRef] 5. Campbell, C.L.; Colton, S.; Haas, R.; Rice, M.; Porter, A.; Schenk, A.; Meelker, A.; Fraley, S.M.; Fraley, G.S. Effects of different wavelengths of light on the biology, behavior, and production of grow-out Pekin ducks. Poult. Sci. 2015, 94, 1751–1757. [CrossRef] 6. House, G.; Sobotik, E.; Nelson, J.; Archer, G. The effect of raising Pekin ducks two spectra of LED light on production, stress, and behavior. In Proceedings of the Poultry Science Association Annual Meeting, San Antonio, TX, USA, 23–26 July 2018; p. 347. 7. Porter, L.; Porter, A.; Potter, H.; Alenciks, E.; Fraley, S.M.; Fraley, G.S. Low light intensity in Pekin duck breeder barns has a greater impact on the fertility of drakes than hens. Poult. Sci. 2018, 97, 4262–4271. [CrossRef] 8. Benoit, J. The Role of the Eye and of the Hypothalamus in the Photostimulation of Gonads in the Duck. Ann. N. Y. Acad. Sci. 1964, 117, 204–216. [CrossRef] 9. Cherry, P.; Morris, T.R. Domestic Duck Production: Science and Practice; CABI: Wallingford, UK; Oxfordshire, UK; Cambridge, MA, USA, 2008; ISBN 9780851990545. 10. Haas, R.; Alenciks, E.; Frazier, K.; Fraley, G.S. The Maintenance of Reproductive Status in Pekin Drakes Requires Both Red and Blue Wavelengths of Light: Relationship to Opsin-Related Proteins in the Hypothalamus. Poult. Sci. 2017, 96, 2908–2919. [CrossRef] 11. Colton, S.; Fraley, G.S. The effects of environmental enrichment devices on feather picking in commercially housed Pekin ducks. Poult. Sci. 2014, 93, 2143–2150. [CrossRef] 12. Haas, R.; Alenciks, E.; Meddle, S.; Fraley, G.S.S.S. Expression of deep brain photoreceptors in the Pekin drake: A possible role in the maintenance of testicular function. Poult. Sci. 2017, 138, 118–123. [CrossRef] 13. Guh, Y.-J.; Tamai, T.K.; Yoshimura, T. The underlying mechanisms of vertebrate seasonal reproduction. Proc. Jpn. Acad. Ser. B 2019, 95, 343–357. [CrossRef] 14. Ubuka, T.; Bentley, G.E.; Tsutsui, K. Neuroendocrine regulation of gonadotropin secretion in seasonally breeding birds. Front. Neurosci. 2013, 7, 38. [CrossRef] 15. Johnson, P.A.; Van Tienhoven, A. Investigations of the signiﬁcance of the crepuscular LH peak in the ovulatory cycle of the hen (Gallus domesticus). J. Endocrinol. 1984.[CrossRef] 16. Johnson, A.L.; Van Tienhoven, A. Plasma Concentrations of Six Steroids and LH During the Ovulatory Cycle of the Hen, Gallus domesticus1. Biol. Reprod. 1980.[CrossRef][PubMed] 17. Porter, L.; Alenciks, E.; Fraley, G.S. Gonadal regression elicited in Pekin duck drakes and hens associated with supplemental light from kerosene lanterns during the winter months. In Proceedings of the Poultry Science Association Annual Meeting, San Antonio, TX, USA, 23–26 July 2016; p. 195. 18. Van Tienhoven, A. No Title. In Reproductive Physiology of Vertebrates; Cornell University Press: New York, NY, USA, 1983; pp. 80–94. 19. Yoshimura, T. Neuroendocrine mechanism of seasonal reproduction in birds and mammals. Anim. Sci. J. 2010, 81, 403–410. [CrossRef][PubMed] 20. Kang, S.W.; Kuenzel, W.J. Deep-brain photoreceptors (DBPs) involved in the photoperiodic gonadal response in an avian species, Gallus gallus. Gen. Comp. Endocrinol. 2015, 211, 106–113. [CrossRef][PubMed] 21. Nakane, Y.; Yoshimura, T. Deep brain photoreceptors and a seasonal signal transduction cascade in birds. Cell Tissue Res. 2010, 342, 341–344. [CrossRef][PubMed] 22. Kuenzel, W.J. The search for deep encephalic photoreceptors within the avian brain, using gonadal development as a primary indicator. Poult. Sci. 1993, 72, 959–967. [CrossRef][PubMed] 23. House, G.M.; Sobotik, E.B.; Nelson, J.R.; Archer, G.S. A comparison of white/red and white/blue LED light ﬁxtures on Pekin duck production, stress and behaviour. Br. Poult. Sci. 2021.[CrossRef][PubMed] Animals 2021, 11, 1121 9 of 10

24. Zhu, H.X.X.; Hu, M.D.; Guo, B.B.B.; Qu, X.L.L.; Lei, M.M.M.; Chen, R.; Chen, Z.; Shi, Z.D.D. Effect and molecular regulatory mechanism of monochromatic light colors on the egg-laying performance of Yangzhou geese. Anim. Reprod. Sci. 2019, 204, 131–139. [CrossRef] 25. Nakane, Y.; Ikegami, K.; Ono, H.; Yamamoto, N.; Yoshida, S.; Hirunagi, K.; Ebihara, S.; Kubo, Y.; Yoshimura, T. A mammalian neural tissue opsin (Opsin 5) is a deep brain photoreceptor in birds. Proc. Natl. Acad. Sci. USA 2010, 107, 15264–15268. [CrossRef] [PubMed] 26. Bailes, H.J.; Lucas, R.J. Human melanopsin forms a pigment maximally sensitive to blue light (λmax ≈ 479 nm) supporting activation of Gq/11 and Gi/o signalling cascades. Proc. R. Soc. B Biol. Sci. 2013, 280, 20122987. [CrossRef] 27. Potter, H.; Alenciks, E.; Frazier, K.; Porter, A.; Fraley, G.S.S. Immunolesion of melanopsin neurons causes gonadal regression in Pekin drakes (Anas platyrhynchos domesticus). Gen. Comp. Endocrinol. 2017.[CrossRef][PubMed] 28. Glass, J.D.; Lauber, J.K. Sites and action spectra for encephalic photoreception in the Japanese quail. Am. J. Physiol 1981, 240, R220–R228. [CrossRef] 29. Menaker, M. Extraretinal light perception in the sparrow, I. entrainment of the biological clock. Proc. Natl. Acad. Sci. USA 1968, 59, 414–421. [CrossRef][PubMed] 30. Underwood, H.; Menaker, M. Photoreception in sparrows: Response to photoperiodic stimuli. Science 1970, 169, 893. 31. Benoit, J.M. Chronobiologic study in the domestic duck. II. Physiological mechanism of the chronobiologic action of visible light on the gonads of the male duck. Chronobiologia 1978, 5, 158–168. 32. Wang, G.; Ramenofsky, M.; Wingfield, J.C. Apparent dissociation of photoperiodic time measurement between vernal migration and breeding under dim green light conditions in Gambel’s white-crowned sparrow Zonotrichia leucophrys gambelii. Curr. Zool. 2013, 59, 349–359. [CrossRef] 33. Oliver, J.; Bayle, J.D. Brain photoreceptors for the photo-induced testicular response in birds. Experientia 1982, 38, 1021–1029. [CrossRef] 34. Menaker, M.; Roberts, R.; Elliott, J.; Underwood, H. Extraretinal light perception in the sparrow. 3. The eyes do not participate in photoperiodic photoreception. Proc. Natl. Acad. Sci. USA 1970, 67, 320–325. [CrossRef] 35. Underwood, H.; Menaker, M. Photoperiodically significant photoreception in sparrows: Is the retina involved? Science 1970, 167, 298–301. [CrossRef][PubMed] 36. Underwood, H.; Menaker, M. Extraretinal light perception: Entrainment of the biological clock controlling lizard locomotor activity. Science 1970, 170, 190–193. [CrossRef][PubMed] 37. Li, H.; Kuenzel, W.J. A possible neural cascade involving the photoneuroendocrine system (PNES) responsible for regulating gonadal development in an avian species, Gallus gallus. Brain Res. Bull. 2008, 76, 586–596. [CrossRef][PubMed] 38. Halford, S.; Pires, S.S.; Turton, M.; Zheng, L.; Gonzalez-Menendez, I.; Davies, W.L.; Peirson, S.N.; Garcia-Fernandez, J.M.; Hankins, M.W.; Foster, R.G. VA opsin-based photoreceptors in the hypothalamus of birds. Curr. Biol. 2009, 19, 1396–1402. [CrossRef][PubMed] 39. Saldanha, C.J.; Silverman, A.J.; Silver, R. Direct innervation of GnRH neurons by encephalic photoreceptors in birds. J. Biol. Rhythm. 2001, 16, 39–49. [CrossRef][PubMed] 40. Vigh, B.; Vigh-Teichmann, I. Actual problems of the cerebrospinal fluid-contacting neurons. Microsc. Res. Tech. 1998, 41, 57–83. [CrossRef] 41. Kuenzel, W.J.; Kang, S.W.; Zhou, Z.J. Exploring avian deep-brain photoreceptors and their role in activating the neuroendocrine regulation of gonadal development. Poult. Sci. 2015, 94, 786–798. [CrossRef] 42. Scott, S.M.; Alm, J.; Fisher, D.A. Effect of thyroid hormone and sex status on epidermal growth factor concentrations in the submandibular gland of a congenitally hypothyroid mouse model. J. Dev. Physiol. 1986, 8, 461–466. 43. Wilson, F.E. A test of the hypothesis that T3 is the “seasonality” thyroid hormone in American tree sparrows (Spizella arborea): Intracerebroventricular infusion of iopanoic acid, an inhibitor of T3 synthesis and degradation. J. Comp. Physiol. B 2001, 171, 113–119. [CrossRef] 44. Scanes, C.G.; Jallageas, M.; Assenmacher, I. Seasonal variations in the circulating concentrations of growth hormone in male Peking duck (Anas platyrhynchos) and teal (Anas crecca); correlations with thyroidal function. Gen. Comp. Endocrinol. 1980, 41, 76–79. [CrossRef] 45. Wilson, F.E.; Reinert, B.D. The timing of thyroid-dependent programming in seasonally breeding male American tree sparrows (Spizella arborea). Gen. Comp. Endocrinol. 1996, 103, 82–92. [CrossRef][PubMed] 46. Kosonsiriluk, S.; Mauro, L.J.; Chaiworakul, V.; Chaiseha, Y.; El Halawani, M.E. Photoreceptive oscillators within neurons of the premammillary nucleus (PMM) and seasonal reproduction in temperate zone birds. Gen. Comp. Endocrinol. 2013, 190.[CrossRef] [PubMed] 47. Pérez, J.H.; Furlow, J.D.; Wingfield, J.C.; Ramenofsky, M. Regulation of vernal migration in Gambel’s white-crowned sparrows: Role of thyroxine and triiodothyronine. Horm. Behav. 2016, 84, 50–56. [CrossRef][PubMed] 48. Reinert, B.D.; Wilson, F.E. The thyroid and the hypothalamus-pituitary-ovarian axis in American tree sparrows (Spizella arborea). Gen. Comp. Endocrinol 1996, 103, 60–70. [CrossRef][PubMed] 49. Mishra, I.; Bhardwaj, S.K.; Malik, S.; Kumar, V. Concurrent hypothalamic gene expression under acute and chronic long days: Implications for initiation and maintenance of photoperiodic response in migratory songbirds. Mol. Cell. Endocrinol. 2017, 439, 81–94. [CrossRef][PubMed] Animals 2021, 11, 1121 10 of 10

50. Yamaguchi, S.; Hayase, S.; Aoki, N.; Takehara, A.; Ishigohoka, J.; Matsushima, T.; Wada, K.; Homma, K.J. Sex differences in brain thyroid hormone levels during early post-hatching development in zebra finch (Taeniopygia guttata). PLoS ONE 2017, 12, e0169643. [CrossRef] 51. Schew, W.A.; McNabb, F.M.; Scanes, C.G. Comparison of the ontogenesis of thyroid hormones, growth hormone, and insulin-like growth factor-I in ad libitum and food-restricted (altricial) European starlings and (precocial) Japanese quail. Gen. Comp. Endocrinol. 1996, 101, 304–316. [CrossRef] 52. Yamaguchi, S.; Aoki, N.; Kitajima, T.; Iikubo, E.; Katagiri, S.; Matsushima, T.; Homma, K.J. Thyroid hormone determines the start of the sensitive period of imprinting and primes later learning. Nat. Commun. 2012.[CrossRef] 53. Sirsat, T.S. The Role of Thyroid Hormone Across Avian Development Spectrum: Investigations on Systemic Development, Metabolism and Ontogeny of Endothermy; University of North Texas: Denton, YX, USA, 2017. 54. Sirsat, T.S.; Crossley, D.A.; Crossley, J.L.; Dzialowski, E.M. Thyroid hormone manipulation influences development of cardiovascular regulation in embryonic Pekin duck, Anas platyrhynchos domestica. J. Comp. Physiol. B Biochem. Syst. Environ. Physiol. 2018. [CrossRef] 55. Spiers, D.E.; McNabb, R.A.; McNabb, F.M.A. The development of thermoregulatory ability, heat seeking activities, and thyroid function in hatchling Japanese quail (Coturnix coturnix japonica). J. Comp. Physiol. 1974.[CrossRef] 56. Olson, J.M.; McNabb, F.M.A.; Jablonski, M.S.; Ferris, D.V. Thyroid development in relation to the development of endothermy in the red-winged blackbird (Agelaius phoeniceus). Gen. Comp. Endocrinol. 1999.[CrossRef] 57. Anne McNabb, F.M.; Olson, J.M. Development of thermoregulation and its hormonal control in precocial and altricial birds. Avian Poult. Biol. Rev. 1996, 7, 111–125. 58. McNaughton, F.J.; Dawson, A.; Goldsmith, A.R. Puberty in birds: The reproductive system of starlings does not respond to short days until birds are fully grown. J. Endocrinol. 1992.[CrossRef][PubMed] 59. Dawson, A.; King, V.M.; Bentley, G.E.; Ball, G.F. Photoperiodic control of seasonality in birds. J. Biol. Rhythms 2001, 16.[CrossRef] [PubMed] 60. MacDougall-Shackleton, S.A.; Stevenson, T.J.; Watts, H.E.; Pereyra, M.E.; Hahn, T.P. The evolution of photoperiod response systems and seasonal GnRH plasticity in birds. Integr. Comp. Biol. 2009, 49, 580–589. [CrossRef][PubMed] 61. Bentley, G.E.; Ubuka, T.; McGuire, N.L.; Calisi, R.; Perfito, N.; Kriegsfeld, L.J.; Wingfield, J.C.; Tsutsui, K. Gonadotrophin-inhibitory hormone: A multifunctional neuropeptide. J. Neuroendocr. 2009, 21, 276–281. [CrossRef] 62. Fraley, G.S.S.; Coombs, E.; Gerometta, E.; Colton, S.; Sharp, P.J.J.; Li, Q.; Clarke, I.J.J. Distribution and sequence of gonadotropin- inhibitory hormone and its potential role as a molecular link between feeding and reproductive systems in the Pekin duck (Anas platyrhynchos domestica). Gen. Comp. Endocrinol. 2013, 184, 103–110. [CrossRef] 63. Shimizu, M.; Bedecarrats, G.Y. Activation of the chicken gonadotropin-inhibitory hormone receptor reduces gonadotropin releasing hormone receptor signaling. Gen. Comp. Endocrinol. 2010, 167, 331–337. [CrossRef] 64. Tsutsui, K.; Saigoh, E.; Ukena, K.; Teranishi, H.; Fujisawa, Y.; Kikuchi, M.; Ishii, S.; Sharp, P.J. A novel avian hypothalamic peptide inhibiting gonadotropin release. Biochem. Biophys. Res. Commun. 2000, 275, 661–667. [CrossRef] 65. Ubuka, T.; McGuire, N.L.; Calisi, R.M.; Perfito, N.; Bentley, G.E. The control of reproductive physiology and behavior by gonadotropin-inhibitory hormone. Integr. Comp. Biol. 2008, 48, 560–569. [CrossRef] 66. McConn, B.; Wang, G.; Yi, J.; Gilbert, E.R.; Osugi, T.; Ubuka, T.; Tsutsui, K.; Chowdhury, V.S.; Furuse, M.; Cline, M.A. Gonadotropin-inhibitory hormone-stimulation of food intake is mediated by hypothalamic effects in chicks. Neuropeptides 2014, 48, 327–334. [CrossRef] 67. Tobari, Y.; Son, Y.L.; Ubuka, T.; Hasegawa, Y.; Tsutsui, K. A New Pathway Mediating Social Effects on the Endocrine System: Female Presence Acting via Norepinephrine Release Stimulates Gonadotropin-Inhibitory Hormone in the Paraventricular Nucleus and Suppresses Luteinizing Hormone in Quail. J. Neurosci. 2014, 34, 9803–9811. [CrossRef] 68. Ramesh, R.; Kuenzel, W.J.; Buntin, J.D.; Proudman, J.A. Identification of growth-hormone- and prolactin-containing neurons within the avian brain. Cell Tissue Res. 2000, 299, 371–383. [CrossRef] 69. Ernst, D.K.; Lynn, S.E.; Bentley, G.E. Differential response of GnIH in the brain and gonads following acute stress in a songbird. Gen. Comp. Endocrinol. 2016, 227, 51–57. [CrossRef] 70. Calisi, R.M.; Rizzo, N.O.; Bentley, G.E. Seasonal differences in hypothalamic EGR-1 and GnIH expression following capture- handling stress in house sparrows (Passer domesticus). Gen. Comp. Endocrinol. 2008, 157, 283–287. [CrossRef]