Genetic variation in the Abies magnifica x Abies procera complex focusing on the allelic frequencies of the Abfi14 gene, specifically regarding emergence of Abies magnifica Shastensis variety

Jordan Anderson Red Fir Project Southern Oregon Univeristy

November 2013

2

Introduction

In the Pacific Northwest two mountain ranges converge almost perpendicularly at the bottom of the state of Oregon: the Klammath-Siskiyou Mountains and the Cascade Range. Following the last ice age, forests began to reemerge along these ranges. Among the various pine and madrone were several species of fir that exist to this day. Throughout the Sierra Nevadas and up into the Cascade Range we see lots of California Red Fir, or Abies magnifica. Going west into the Siskiyous these can be found as well, but perhaps more frequently we see the Noble Fir, Abies procera. To the untrained eye these trees are identical, but to the botanist there are a few key morphological characteristics that make them stand out. Both species possess relatively straight needles than bend in sharply at the base near the petiole.

Generally, A. magnifica are distinguishable by distinct four-sided needles, without grooves whereas A. procera has less distinct quadrate shape but a more distinct groove. Bark on A. procera grooved in semi- vertical columns, whereas A. magnifica has more irregularly fissured, and according to some sources more distinctly red in old trees (Jepson, 1923). Most morphological descriptors are vague however, and key traits often overlap the other species’ traits. Regardless of their phenotypic differences, these species differ definitively in their genes. But here is a case that forces scientists to reevaluate just what defines a species at all. Is such taxonomic pigeonholing even appropriate in this era of genotyping species down to the base pairs?

It’s accepted that Noble Fir and Red Fir are separate distinct species—that is not under question

(Lanner, 2010). What remains contentious is yet another Abies variety known as Shasta Red Fir, or Abies magnifica Shastensis. The taxonomic identity of this tree has been disputed for decades (Parker, 1963), having come from a separate species originally A. shastensis, to a species variety, to now, as this paper will help to show, more of a species complex. This complex represents something like a spectrum of allelic contributions from both species, expressed differently at different geographic loci, rather than one immutable species set in stone .

2 3

Crossing between species of fir does occur but it is not accomplished in nature easily (Critchfield,

1988) (Isoda, Shiraishi, Watanabe, & Kitamura, 2000). Prior research has reveal that firs endemic to the

Pacific Northwest hybridize with others to varying degrees, frequently in specific species pairs (Isoda, et al., 2000). One notable pairing of Abies species more likely to cross are A. magnifica and A. procera. The genetic mosaic observed in these pairings, and in Pacific firs in general has led botanists to refer to species pairs as “sections” or “complexes” rather than dual species or a the botanical species variety.

What we will test here how populations of A. magnifica and A. procera hybridize to form the species complex known as A. magnifica Shastensis. Previous research has postulated the crossing between Noble and California Red Fir based on genetic similarities in paternal chloroplast DNA (Oline D.

K., 2008). With this research we hope to show that relationship via similarities in allele frequencies in nuclear DNA, namely the Abfi14 gene.

We also will test how geographic distribution has caused gene flow between populations, creating unique lineages; that while these populations are distinct lineages, with local genetic similarity, they originally are the product of the hybridization of A. procera and A. magnifica (if not already one of these).

If alleles of variable length appear for samples not positively identified as A. procera or A. magnifica (i.e. variety Shastensis) we can infer that our hypothesis was correct, that indeed there is hybridization between the two species to form a species complex or sector.

If the allele ranges sampled at each site can be shown to be statistically different from each other, it will support our secondary hypothesis that each site represents a unique lineage or variety of the species complex A. magnifica shastensis.

Methods

3 4

For this procedure, needle samples from sites located throughout the Siskiyou and Cascade ranges were obtained for genetic comparison, specifically allele frequency. The locations where samples were taken from included Mary’s Peak, Bigalow Lakes, Gold Lake (CA), a site along Dead Indian Memorial

Highway, a site along the Jackson County Line, Mount Ashland, and the south side of Mount Ashland, all indicated in Fig. 1. Multiple trees were randomly sampled at each site (Oline D. , 2013). They were identified as firs based on their characteristics specific to red and noble firs, namely needle shape and when available, cone bracts. This prevented any accidental inclusion of say pine but maintained a random sampling of the species complex we were after. From these samples we isolated a specific nuclear SSR gene, Abfi14, whose highly variable loci enable specific contrast between populations.

Our results were acquired through four primary steps. The first, sampling the populations of fir, is described above. Following sampling, we extracted nuclear DNA from the fir needles. This was done using the DNEasy technique, in which a pulverized needle solution was filtered through QIAshredder and

DNEasy columns to isolate the DNA molecules. RNAse enzyme was also applied to the solution prior to filtration to eliminate RNA.

Following this, the fir sample DNA was amplified using the polymerase chain reaction (PCR) process. This process cycles the DNA solution through the temperature stages ideal for denaturation, annealing and extension. This incorporated isolating DNA from the sample and subjecting it to the automated PCR process in a thermocycler that will repeat the steps above at specific temperatures 35 times. Oligonucleotide primers were added specific to the Abfi14 gene whose sequences are,

Abfi14F: (5’) ACATCAACCACTTCATGTTGC (3’)

Abfi14R: (5’) ATCTCACAATACCCCAAAAGG (3’)

Once the specific nuclear gene was amplified, the final step was to differentiate the different SSR alleles of Abfi14. This was done using gel electrophoresis with GelRed solution applied to the DNA for UV

4 5

visualization. Using the molecular weight specific markers to determine allelic length, the specific alleles

for Abfi14 for each tree sampled were procured.

Results

Allele length frequencies distributed across sample sites

Allelic Range (BP) MP DI CO BG MA SS GL

146-170 1 7 10 1 12 16 10 171+195 13 6 3 5 3 2 196-220 7 1 12 4 8 5 221-245 7 5 4 4 3 4 Table 1. Frequencies of base pair lengths (allele frequencies) distributed across sampled sites. Alleles homozygous for 221-245bp are considered A. procera, and alleles homozygous for 146-170bp are considered A. magnifica.

Frequencies of Abfi14 alleles distributed across sample sites

146-170 171+195 196-220 221-245

16

13 12 12 10 10 8 7 7 7 6

Frequency 5 5 5 4 4 4 4 3 3 3 2 1 1 1

MP DI CO BG MA SS GL Sample Site

Figure 1. Frequency histogram depicting distribution of alleles across sample sites. MP is Mary’s Peak, DI is Dead Indian Memorial Hwy, CO is County Line, BG is Bigalow Lakes, MA is Mount Ashland, SS is the South Side of Mount Ashland, and GL is Gold Lake, CA. Allele sizes are represented in base pairs (bp).

5 6

Illustration of allelic distribution based on bp size range for A. magnifica x A. procera complex

Figure 2. Illustration of allelic distribution based on size range. A. procera most strongly exhibits Abfi14 allele ranges of around 245bp, whereas A. magnifica more frequently exhibits allelic ranges closer to 146bp. The sites sampled ranged in allele length from 146-245.

Our data from exclusively Noble fir and Red fir populations (Mary’s Peak and Gold Lake, respectively) indicate the expression of the SSR Abfi14 is homozygous in one allelic size range to produce these species’ phenotypes. The presence of these alleles in non-true fir samples indicates hybridization.

Our hypothetical distribution of the hybrid A. magnifica Shastensis, based on sampling data can be seen in Fig. 2.

For these listed populations (Fig. 1) the χ2 value was 59 with 28.8 degree of freedom for 95% confidence, therefore we reject the null hypothesis. This implies that there is a statistically significant

6 7

difference between the populations sampled. In other words, we are 95% confident that the trees sampled belong to unique genetic populations.

Discussion

Our initial hypothesis put forward that hybridization occurs between A. procera and A. magnifica. The very presence of the SR Abfi14 allele at varying lengths, both homozygous and heterozygous, suggests at the very least the hybridization of these two extant species. We hoped to validate this, claiming that if alleles of the Abfi14 gene of varied length showed up in samples not A. procera or A. magnifica (i.e. variety Shastensis) we can infer that our hypothesis was correct. These trees sampled at various locations in Southern Oregon and Northern California represent distinct genetic lineages, not one big one with minor variances. Given the nature of the Abfi14 SSR gene, no two or three specific alleles could be chosen to distinguish. But since this gene has a hypervariable locus, not limited to two or few alleles, this enables us to more specifically identify unique populations because of the super specific allele lengths. Statistical analysis of this distribution showed that these populations were indeed significantly different. Fig. 2 shows a general overlay of how these populations might overlap. The overlap (indicated by the secondary purple color) would hypothetically be where the greatest density of

Shasta Red Fir would be found.

Further research into the differentiation of California Red Fir and Noble Fir utilizing parasite specificity further indicates the likelihood of hybridization between two extant species of fir, rather than a mutated variety of A. magnifica. Using a species of mistletoe that preys specifically on Noble Fir, known as Arceuthobium tsugense, researchers from Northern Arizona University positively distinguished populations of A. procera and A. magnifica and A. magnifica varieties in northern California (Mathiasen

& Daugherty, 2008). This research also proved integral to the creation of current hypothetical distributions of Red Fir and Noble Fir for the region.

7 8

Our secondary hypothesis states the populations sampled from various geographic locations are indeed unique populations, that is, not varieties of a larger underlying population. Table 1. reports the hypothesized contribution of allele frequencies across various locations. The geographic distributions in

Fig. 2 were shown to be statistically different populations based on chi-squared test results from the frequencies recorded in Fig. 1.

Potential sources for error in this experiment are plentiful, not the least of which includes sampling error. That is, all samples taken for this experiment were carried out by separate individuals with different rules established to ensure randomization. Because of the positive results taken from the gel electrophoresis, we know that the allele frequencies are accurate. That means that for the trees sampled, the presence of the SR Abfi14 allele lengths are accurate insofar as they were reported, indicating genetic variation among our recorded samples. Therefore, it remains that our primary source of error would be in our initial sampling. For our hypothesis to be rejected, a statistically greater number of true firs from the same sampled regions would have to be shown to possess the same allele variations as present in our Shastensis varieties.

8 9

Works Cited

Critchfield, W. B. (1988). Hybridization of the California Firs. Forest Science.

Isoda, K., Shiraishi, S., Watanabe, S., & Kitamura, K. (2000). Molecular evidence of natural hybidization

between Abies veitchii and A. homolepis revealed byt chloroplast, mitochondrial, and nuclear

DNA markers. Molecular Ecology.

Jepson, W. L. (1923). A Manual of the Flowering Plants of California . San Francisco : Independent

Pressroom and Willaims Printing Company.

Lanner, R. M. (2010). Abies magnifica var. Critchfieldii, a new California red fir variety of the Sierra

Nevada. Madrono .

Liepelt, S., Bialozyt, R., & Ziegenhagen, B. (2002). Wind-dispersed pollen mediates postglacial gene flow

among refugia. PNAS.

Mathiasen, R. L., & Daugherty, C. M. (2008). Distribution of Red Fir and Noble Fir in Oreogn Based on

Dwaref Mistletoe Host Specificity. Northwest Science.

Oline, D. (2013, Fall). Genetics Laboratory Manual . Southern Oregon University.

Oline, D. K. (2008). Geographic variation in chloroplast haplotypes in the California red fir-noble fir

species complex and the status of Shasta red fir. NRC Research Press.

Parker, E. L. (1963). The Geographic Overlap of Noble Fir and Red Fir. Forest Science.

Silen, R. R., Critchfield, W. B., & Franklin, J. F. (1964). Early Verification of a Hybrid Between Noble and

California Red Firs. Forest Science.

9