DOCSLIB.ORG

Molecular Markers Used As Genetic

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Markers Used As Genetic This file was created by scanning the printed publication. Errors identified by the software have been corrected; however, some errors may remain. Chapter 14 Applications of Molecular Marker Technologies in Popf)/us Breeding1 Maria Teresa Cervera, Marc Villar, Patricia Faivre-Rampant, Marie-Christine Goue, Marc Van Montagu, and Wout Boerjan erences to their application in forest trees including poplar. Introduction The second part focuses on Populus spp. and is an overview of current applications of molecular markers in phylogenetic analysis, genetic mapping, and marker-assisted selection. In the 17th and 18th centuries, farmers and tree-breeders in Europe selected individual trees for traits such as fast growth and . Traditional breeding work was based on the analysis of phenotypes and has provided a wealth of infor­ mation on genetic material through multigeneration pedi­ Molecular Markers Used as grees. Recent developments in DNA marker technologies have created the possibility of generating new breeding strategies. In Genetic Marker~ ·in Breeding forest trees, these technologies are developed for conifer, Euca- lyptus, and Populus breeding. • For centuries, morphological traits provided the--basis Application of molecular markers to forest tree breeding for plant breeding and contributed to the development of is dependent on the advantages and limitations of tree ge­ theoretical population genetics. The first genome maps netics. The Populus genus (poplars, cottonwoods, and aspens) were produced by analysis of genetic segregation and link­ is a good model system for the diverse disciplines of forest age between morphological markers. However, because tree biology (reviewed by Stettler et al. 1996). Populus spe­ morphological markers can be strongly influenced by the cies have considerable genetic variation; are highly heterozy­ environment and are limited in number, they are less valu­ gous; interspecific hybrids can be easily obtained through able in current breeding programs. artificial breeding techniques (Stanton and Villar 1996); and Techniques to analyze proteins (Smithies 1955) have al­ controlled sexual propagation can be conducted in a green­ lowed molecular marker identification based on protein house over approximately 3 months. Moreover, the ease of polymorphism.s (Lewontin and Hubby 1966; May 1992). vegetative propagation permits replicated clonal trials to Through developments in molecular biology, different estimate genetic and environmental components of pheno­ techniques have emerged to detect molecular markers typic variance for traits of interest; the nuclear genome is based on DNA. Using restriction endonucleases (Linn and relatively small (2C = 1.1 pg); and the chromosome number Arber 1968; Meselson and Yuan 1968) allows evaluation (2n =38) is the same for all Populus species (Bradshaw and of DNA sequence variation through the analysis of Restric­ Stettler 1993; Wang and Hall1995). tion Fragment Length Polymorphism (RFLP). In 1985, the In the first part of this chapter, we describe marker tech­ Polymerase Chain Reaction (PCR) technique was devel­ nologies common! y used in plant breeding, and provide ref- oped based on the amplification of DNA fragments using a thermostable DNA polymerase (Saiki et al. 1985, 1988). Many variants of the PCR strategy have since been estab­ lished to detect DNA polymorphism.s. The objective of the 1 Klopfenstein, N.B.; Chun, Y. W.; Kim, M.-S.; Ahuja, M.A., eds. PCR variant strategies was to increase the number of mark­ Dillon, M.C.; Carman, R.C.; Eskew, L.G., tech. eds. 1997. ers analyzed per experiment and the likelihood of identify­ Micropropagation, genetic engineering, and molecular biology ing markers that display a high Polymorphism Information of Populus. Gen. Tech. Rep. RM-GTA-297. Fort Collins, CO: Content (PIC). Since the plant genotype is analyzed directly U.S. Department of Agriculture, Forest Service, Rocky Mountain by DNA marker technology, environmental or developmen­ Research Station. 326 p. tal alterations of the phenotype have no effect. 101 Section Ill Molecular Biology Molecular,. Markers in an electric field and differences among alleles encoding these allozymes (Murphy et al. 1990). According to Weising et al. (1995), an ideal marker tech­ Allozyme analysis comprises: 1) preparation of tissue nology has markers: 1) with .a codominant inheritance extracts using buffers that allow protein extraction while (homo- and heterozygotic states can be discriminated); 2) maintaining enzymatic activity; 2) electrophoretic (starch that are evenly distributed throughout the genome; and or polyacrylamide gel) separation of proteins according 3) with selectively neutral behavior. Moreover, ideal to net charge and size; and 3) allozyme detection after elec­ marker technology: 1) can reveal many polymorphic loci trophoresis using specific stains. with multiple alleles; 2) is easy, fast, and inexpensive; and Allozyme analysis is easy to perform, inexpensive, and 3} is highly reproducible. technically accessible. Allozyme expression is typically Marker technologies that are currently available com­ codominant allowing discrimination between homozy­ bine some of these properties. A marker system should be gous and heterozygous loci and multiple alleles. However, selected on the basis of the genetic analysis to be per­ allozyme analysis has several drawbacks. The limited num­ formed. In the following discussion, we describe the prin­ ber of loci that can be analyzed may restrict attempts to ciples, advantages, and limitations of marker technologies locate markers associated with traits of interest, and the commonly used in poplar breeding (table 1). level of genetic polymorphism within coding sequences is Isozyme and Allozyme Markers relatively low. A new allele can be detected as a polymor­ Allozymes are enzymes encoded by different alleles of the phism only if nucleotide differences cause amino add sub­ same gene; thus, they can differ in their amino add sequence, stitutions that affect the electrophoretic mobility. protein structure, and kinetic properties. Allozyme analysis Furthermore, allozymes may be active only at a specific is based on the correlation between differences in mobility physiological stage, tissue, or cell compartment. Other limi- Table 1. Comparison of DNA marker systems (adapted from Mazur and Tingey 1995). RFLP1 RAPD2 SSR3 AFLPTM 4 Assay principle Endonuclease Amplification Amplification Selective digestion and with random of SSRs amplification of hybridization primers DNA fragments Polymorphism Single-base Single-base Repeat l~ngth Single-base type insertions or insertions or insertions or deletions deletions deletions Polymorphism Medium Medium High Medium level Number of 1-2 5-20 1 40-100 different loci assayed in a single reaction Abundance High Very high Medium Very high Dominance Codominant Dominant Codominant DominanVcodominant Amount of DNA 2-10 J.tg 10-25 ng 25-50 ng 250 ng required DNA sequence No No Yes No required Radioactive Yes/no No No Yes/no detection Cost Medium/high Low High Medium 1 Restriction Fragment Length Polymorphism 2 Random Amplified Polymorphic DNA 3 Simple Sequence Repeats 4 Amplified Fragment Length Polymorphism ,.... Registered trademark in the Benelux 102 USDA Forest Service Gen. Tech. Rep. RM-GTR-297. 1997. Applications of Molecular Marker Technologies in Populus Breeding tations, such as post-transcriptional modifications or the ers were used to study inter- and intraspecific variation in presence of isozymes with identical mobility but encoded Populus (Keirn et al. 1989; Liu and Fumier 1993b). by different loci, can hamper interpretation of the zymo­ RFLPs can also be obtained from chloroplast DNA gram (banding pattern) analysis. (cpDNA) and mitochondrial DNA (mtDNA). Two differ­ Linkage analysis of isozyme loci was performed on ent approaches are useful to study RFLPs in cytoplasmic many forest trees such as Populus spp. (Liu and Furnier DNA: 1) isolation of cp or mtDNA, digestion with restric­ 1993a}, Larix laricina (Cheliak and Pitel 1985}, Eucalyptus tion enzymes, electrophoretic separation, and visualiza­ regnans (Moran and Bell 1983), Pinus spp. (Conkle 1981), tion of RFLPs by ethidium bromide or silver staining; and Pinus radiata (Moran et al. 1983), Pinus rigida (Guries et al. 2) isolation and digestion of total DNA, electrophoretic 1978), Pinus strobus (Eckert et al. 1981), and Pinus taeda separation, and Southern blotting using total cp or mtDNA (Adams and Joly 1980). Isozyme analysis was used to iden­ or specific cp or mtDNA sequences as a probe. Various tify clones of the genus Populus (Cheliak and Dancik 1982; studies were conducted on Populus based on cpDNARFLPs Hyun et al. 1987; Liu and Fumier 1993b; Lund et al. 1992; (Mejnartowicz 1991; Rajora and Dancik 1995a, 1995b) and Raj?ra 1988, 1989a; Rajora and Zsuffa 1989}. mtDNA RFLPs (Barrett et al. 1993; Radetzky 1990). Restriction Fragment Length Polymorphism (RFLP) Polymerase Chain Reaction (PCR) Technologies RFLP analysis, a DNA-based marker technology used Many variant methods have been developed since the in plant breeding and plant genetics (Neale and Williams invention of PCR technology in 1985 (Innis et al. 1990); 1991; Tanksley et al. 1989}, is based on polymorphism ob­ some allow detection of DNA polymorphisms. served after DNA digestion with 1 or more restriction en­ Random Amplified Polymorphic DNA (RAPD) mark­ zymes. Resulting fragments are electrophoretically ers are generated by PCR amplification using arbitrary separated in agarose
Load more

Recommended publications
  • Restriction Enzyme Digestion Of
    Exercise 21 RESTRICTION ENDONUCLEASE DIGESTION OF DNA AND RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP) Introduction Present-day DNA technology is partially dependent upon the ability of investigators to cut DNA molecules at specific sites with enzymes called restriction endonucleases or restriction enzymes. The most useful of these enzymes, which occur naturally within bacteria, recognize particular "target" or recognition sequences (restriction sites) within a DNA double helix, and catalyze the cleavage of the DNA (breaking of phosphodiester bonds) at or near those sequences leaving 5’-P and 3’-OH termini. The result of this activity may be the formation of linear segments from closed loops (plasmids) or the formation of discrete DNA fragments of defined length and base sequence. In either case, the ability to selectively cut DNA in this manner is often useful in the manipulation of DNA for scientific purposes. Among the best-studied restriction endonucleases are those categorized as type II. The activity of type II restriction enzymes in vivo (as they occur naturally within bacterial cells) is coupled with that of modification enzymes to form restriction/modification systems (Type II R-M systems). The restriction enzymes enable bacteria to catabolize segments of “foreign” DNA that have entered their cells and provide at least some protection against infection by bacteriophages, (since phage DNA is often degraded by their activity). They also probably play a significant role in maintaining species specificity with regard to DNA exchange. Recall that naturally occurring genetic exchange mechanisms function with highest efficiency when the exchange occurs between closely related organisms, and that foreign DNA is usually degraded.
    [Show full text]
  • Mutant Germplasm Characterization Using Molecular Markers
    TRAINING COURSE SERIES No. 19 Mutant Germplasm Characterization using Molecular Markers A Manual Prepared by the Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture INTERNATIONAL ATOMIC ENERGY AGENCY, VIENNA, 2002 The originating Section of this publication in the IAEA was: Plant Breeding and Genetics Section International Atomic Energy Agency Wagramer Strasse 5 P.O. Box 100 A-1400 Vienna, Austria MUTANT GERMPLASM CHARACTERIZATION USING MOLECULAR MARKERS A MANUAL IAEA, VIENNA, 2002 IAEA-TCS-19 ISSN 1018–5518 © IAEA, 2002 Printed by the IAEA in Austria October 2002 EDITORIAL NOTE The use of particular designations of countries or territories does not imply any judgement by the publisher, the IAEA, as to the legal status of such countries or territories, of their authorities and institutions or of the delimitation of their boundaries. The mention of names of specific companies or products (whether or not indicated as registered) does not imply any intention to infringe proprietary rights, nor should it be construed as an endorsement or recommendation on the part of the IAEA. FAO/IAEA Interregional Training Course on Mutant Germplasm Characterization FOREWORD 1 FOREWORD Plant biotechnology applications must not only respond to the challenge of improving food security and fostering socio-economic development, but in doing so, promote the conservation, diversification and sustainable use of plant genetic resources for food and agriculture. Nowadays the biotechnology toolbox available to plant breeders offers several new possibilities for increasing productivity, crop diversification and production, while developing a more sustainable agriculture. This training course focuses on one of the most promising set of techniques used in modern crop improvement programmes, i.e.
    [Show full text]
  • DNA Methylation Analysis: Choosing the Right Method
    biology Review DNA Methylation Analysis: Choosing the Right Method Sergey Kurdyukov 1,* and Martyn Bullock 2 Received: 8 July 2015; Accepted: 22 December 2015; Published: 6 January 2016 Academic Editor: Melanie Ehrlich 1 Genomics Core facility, Kolling Institute of Medical Research, University of Sydney, Sydney 2065, Australia 2 Cancer Genetics Laboratory, Kolling Institute of Medical Research, University of Sydney, Sydney 2065, Australia; [email protected] * Correspondence: [email protected]; Tel.: +61-299-264-756 Abstract: In the burgeoning field of epigenetics, there are several methods available to determine the methylation status of DNA samples. However, choosing the method that is best suited to answering a particular biological question still proves to be a difficult task. This review aims to provide biologists, particularly those new to the field of epigenetics, with a simple algorithm to help guide them in the selection of the most appropriate assay to meet their research needs. First of all, we have separated all methods into two categories: those that are used for: (1) the discovery of unknown epigenetic changes; and (2) the assessment of DNA methylation within particular regulatory regions/genes of interest. The techniques are then scrutinized and ranked according to their robustness, high throughput capabilities and cost. This review includes the majority of methods available to date, but with a particular focus on commercially available kits or other simple and straightforward solutions that have proven to be useful. Keywords: DNA methylation; 5-methylcytosine; CpG islands; epigenetics; next generation sequencing 1. Introduction DNA methylation in vertebrates is characterized by the addition of a methyl or hydroxymethyl group to the C5 position of cytosine, which occurs mainly in the context of CG dinucleotides.
    [Show full text]
  • Facioscapulohumeral Muscular Dystrophy FSHD International
    Facioscapulohumeral Muscular Dystrophy FSHD International Research Consortium Research Workshop Meeting 2005 Tuesday, October 25, 2005 10 a.m. – 6:30/7:00 p.m. The Sheraton City Centre Hotel 150 West 500 South Salt Lake City, UT 84101 USA Smokehouse through Harvest Room(s) Chair: Silvère van der Maarel, Ph.D. Organizers: Daniel Paul Perez Silvère van der Maarel, Ph.D. William R. Lewis, M.D. Sponsored by: FSH Society, Inc. Facioscapulohumeral Muscular Dystrophy Society, Inc. Muscular Dystrophy Association (MDA USA) Association Française Contre les Myopathies (AFM) 1 FSHD INTERNATIONAL RESEARCH CONSORTIUM RESEARCH WORKSHOP MEETING 2005 PROGRAM SCHEDULE AND OUTLINE 9:55-10-00 a.m. OPENING REMARKS & CHARGE FOR THE MEETING 10:00-11:00 a.m. PLATFORM PRESENTATION(S) I DUX and DUXC 10:00-10:15 a.m. Cellular Toxicity of DUX4 Depends on Nuclear Localization. 10:15-10:30 a.m. Over-expression of the Double Homeodomain Protein DUX4c in FSHD Muscle. MODEL SYSTEMS 10:30-10:45 a.m. Studying the Over-expression of FRG1 in Transgenic Mice. 10:45-11:00 a.m. The Facioscapulohumeral Dystrophy (FSHD) as an Example of Position-effect Pathology? 11:00-12:15 p.m. PLATFORM PRESENTATION(S) II MECHANISM(S) 11:00-11:15 a.m. RNA-FISH: An Approach to Single Cell Gene Expression in FSHD. 11:15-11:30 a.m. Chromatin Accessibility in D4Z4 Arrays by In Vivo DNaseI-Sensitivity Assay. 11:30-11:45 a.m. D4Z4 DNA Methylation Studies in FSHD. 11:45-12:00 noon HP1/Cohesin-containing Heterochromatin Structure at Chromosome 4q is Disrupted in FSHD.
    [Show full text]
  • Solutions for Recombinant DNA Unit Exam
    Solutions for Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the first G. Does cleavage by BamHI result in a 5’ or 3’ overhang? What is the sequence of this overhang? 5’ GGATCC 3’ 3’ CCTAGG 5’ Cleavage by BamHI results in a 5’ overhang as seen here: 5’ G 3’ CCTAG b) BclI cleaves after the first T. Does cleavage by BclI result in a 5’ or 3’ overhang? What is the sequence of this overhang? 5’ TGATCA 3’ 3’ ACTAGT 5’ 5’ T Cleavage by BclI results in a 5’ overhang as seen here: 3’ ACTAG c) You are given the DNA shown below. 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ i) If this DNA was cut with BamHI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. 5’ ATTGAG 3’ 5’ GATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAG 5’ 3’ GCATTACACAGGACTAGTGCGAGGTGC 5’ ii) If the DNA shown above was cut with BclI, how many DNA fragment would you expect? Write out the sequence of these double-stranded DNA fragments. 5’ ATTGAGGATCCGTAATGTGTCCT 3’ 5’ GATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAG 5’ 3’ TGCGAGGTGC 5’ d) You can ligate the smaller restriction fragment produced in (c, i) to the smaller restriction fragment produced in (c, ii). Write out the sequence of the resulting recombinant fragment. 5’ ATTGAGGATCACGCTCCACG 3’ 3’ TAACTCCTAGTGCGAGGTGC 5’ e) Could you cut the fragment from (d) with either BamHI or BclI? Explain.
    [Show full text]
  • (PCR-RFLP) and Gel Electrophoresis – Valuable Tool for Genotyping and Genetic Fingerprinting
    18 Restriction Fragment Length Polymorphism Analysis of PCR-Amplified Fragments (PCR-RFLP) and Gel Electrophoresis – Valuable Tool for Genotyping and Genetic Fingerprinting Henrik Berg Rasmussen Institute of Biological Psychiatry, Mental Health Centre Sct. Hans, Copenhagen University Hospitals, Roskilde, Denmark 1. Introrduction PCR-restriction fragment length polymorphism (RFLP)-based analysis, also known as cleaved amplified polymorphic sequence (CAPS), is a popular technique for genetic analysis. It has been applied for the detection of intraspecies as well as interspecies variation. There exist several techniques that are related with PCR-RFLP and also involve gel electrophoresis including techniques for DNA fingerprinting and expression profiling. This chapter describes PCR-RFLP and related techniques. 1.1 Genetic variation There are different types of genetic variations. The so-called small-scale genetic variation includes single nucleotide polymorphisms (SNPs), multi-nucleotide polymorphisms (MNPs) and microindels. MNPs are multiple, consecutive nucleotide variations of a single common length such as double nucleotide polymorphisms (DNPs) and triple nucleotide polymorphisms (TNPs) with two and three variable nucleotides, respectively (Figure 1). Microindels are deletions, duplications and combinations thereof involving the gain or loss of 1 to 50 nucleotides (Gonzalez et al., 2007). The human genome contains more than 3 million SNPs located with an average distance of approximately 1000 bp (International HapMap Consortium 2005, Levy et al., 2007). The frequency of DNPs and TNPs, the most common forms of MNPs, amounts to ∼1% of the total number of SNPs (Rosenfeld et al., 2010). Most likely, the genome-wide occurrence of small insertions and deletions has been underestimated, probably reflecting an inaccuracy of the current sequencing techniques (Krawitz et al., 2010).
    [Show full text]
  • Diverse Topics
    Diverse Topics APPLICATION OF DNA POLYMORPHISMS TO THE FORENSIC EXAMINATION OF DRIED BLOOD STAINS M. Baird, E. Kanter, *R. Shaler, and I. Balazs (Lifecodes Corporation, Elmsford, New York 10523, *Office of the Chief Medical Examiner, 520 Fifth Avenue, New York, New York 10016, U.S.A.) Abstract We have examined the possibility of using DNA purified from dried blood stains for the analysis of restriction fragment length polymorphisms. High molecular weight DNA was recovered from blood dried on cotton cloth, aged from one day to three years. These DNA samples were digested with restriction endonucleases, separated by agarose gel electrophoresis and hybridized to recombinant DNA probes that recognize two different highly polymorphic DNA sequences. A set of controlled samples was aged at room temperature for up to 28 days. The polymorphic DNA pattern observed with each probe remained the same at all time points. The patterns of DNA polymorphisms observed in the two and three year old dried blood stains was consistent with patterns observed in the general population. These results indicate that DNA recovered from dried blood stains can be used for identification purposes. Introduction The analysis of dried blood stains to help determine identity presently relies on the examination of polymorphic proteins and cellular antigens (1,2). Methods to detect nucleotide sequence polymorphisms within DNA are presently available. Using specific restriction endonucleases and defined probes, many heritable restriction fragment length polymorphisms (RFLPs) have been described (3,4). This report investigates the recovery and RFLP analysis of DNA from dried blood stains. MaterialsandMethods Sources of Dried Blood Samples Dried bloodstains were prepared by applying 6 one cc aliquots of freshly drawn blood to sections of cotton cloth or to the bottoms of glass beakers.
    [Show full text]
  • Glossary of Biotechnology and Genetic Engineering 1
    FAO Glossary of RESEARCH AND biotechnology TECHNOLOGY and PAPER genetic engineering 7 A. Zaid H.G. Hughes E. Porceddu F. Nicholas Food and Agriculture Organization of the United Nations Rome, 1999 – ii – The designations employed and the presentation of the material in this document do not imply the expression of any opinion whatsoever on the part of the United Nations or the Food and Agriculture Organization of the United Nations concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. ISBN: 92-5-104369-8 ISSN: 1020-0541 All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, without the prior permission of the copyright owner. Applications for such permission, with a statement of the purpose and extent of the reproduction, should be addressed to the Director, Information Division, Food and Agriculture Organization of the United Nations, Viale delle Terme di Caracalla, 00100 Rome, Italy. © FAO 1999 – iii – PREFACE Biotechnology is a general term used about a very broad field of study. According to the Convention on Biological Diversity, biotechnology means: “any technological application that uses biological systems, living organisms, or derivatives thereof, to make or modify products or processes for specific use.” Interpreted in this broad sense, the definition covers many of the tools and techniques that are commonplace today in agriculture and food production. If interpreted in a narrow sense to consider only the “new” DNA, molecular biology and reproductive technology, the definition covers a range of different technologies, including gene manipulation, gene transfer, DNA typing and cloning of mammals.
    [Show full text]
  • Genetic Analysis and Molecular Characterization Of
    Genetic analysis and molecular characterization of RFLP DNA markers in barley (Hordeum Vulgare L.) by Jeong Sheop Shin A thesis submitted in partial fulfillment of the requirements of the degree of Doctor of Philosophy in Crop and Soil Science Montana State University © Copyright by Jeong Sheop Shin (1988) Abstract: Single or low copy number DNA clones from random genomic DNA libraries using the plasmid vector pBR322 and the phage EMBL4 were constructed using DNA from barley (Hordeum vulgare L.). This work was done to provide a relatively large number of genetic markers and to characterize the level of genetic variation in the barley genome. Selected genomic clones and cDNA clones were used to probe the barley genome for the presence of restriction fragment length polymorphisms (RFLPs). This methodology is based upon fragment size differences of defined length that are produced when DNA is cleaved by restriction endonucleases. A multiple recessive marker stock and a relatively distantly related cultivar 'Apex' were selected as parents in a cross to map the genomic location of seventeen RFLP loci. Nine genomic clones and seven cDNA clones produced clear polymorphisms using at least one restriction endonuclease. The majority of selected genomic clones showed polymorphisms using two or more restriction endonucleases. This suggests that the variation observed among barley lines is due to insertion/deletion or rearrangement events rather than point mutations. Utilizing selected single or low copy clones as probes, it was confirmed that polymorphisms are readily detectable among cultivars of barley. Seventeen polymorphic DNA sequences were mapped relative to seventeen previously mapped marker loci.
    [Show full text]
  • Applications of Restriction Fragment Length Polymorphism
    ANNALS OF CLINICAL AND LABORATORY SCIENCE, Vol. 21, No. 4 Copyright © 1991, Institute for Clinical Science, Inc. Applications of Restriction Fragment Length Polymorphism SHESHADRI NARAYANAN, Ph .D. Department of Pathology, New York Medical College/Metropolitan Hospital Center, New York, NY 10029 ABSTRACT The availability of a variety of restriction endonuclease enzymes that cleave deoxyribonucleic acid (DNA) at specific sites has made it possible to identify the presence of polymorphic regions in the isolated fragments. Such restriction fragment length polymorphism (RFLP) results owing to a variation in the number of tandem repeats (VNTR) of a short DNA segment. These VNTR sequences can uniquely specify an individual and, as such, are used in DNA fingerprinting and in paternity testing. Restriction frag­ ment length polymorphism may be found close to a disease gene, and, as such, can be used as a genetic disease marker. Certain criteria need to be fulfilled, however, for RFLP to be useful as a genetic disease marker, such as its closeness to the disease gene. Materials and methodology for detect­ ing RFLP are reviewed with the current emphasis on amplification proce­ dures utilizing the polymerase chain reaction (PCR). Introduction nucleases can recognize specific DNA sequences four to six bases long. The evi­ The discovery of enzymes in bacteria dence for the existence of restriction that cleave the DNA of a foreign intruder enzymes in bacteria emerged in the is a mechanism by which bacteria pro­ 1960s and was followed up in 1970 by the tects itself from outside attack, such as isolation and purification of a restriction invasion by virus.
    [Show full text]
  • Glossary a Ablation: Elimination Or Removal Absorption: When Digested Food Moves from the Digestive Tract Into the Blood Stream
    Glossary A Ablation: elimination or removal Absorption: When digested food moves from the digestive tract into the blood stream. ACE (angiotensin-converting enzyme) inhibitor: a medication that lowers blood pressure. Acquired genetic mutation: See: somatic cell genetic mutation Acute: Sharp. Strong. A reaction or illness that occurs strongly but only lasts for a short time. Additive genetic effects: When the combined effects of alleles at different loci are equal to the sum of their individual effects. See also: anticipation, complex trait Adenine (A): A nitrogenous base, one member of the base pair AT (adenine-thymine). See also: base pair, nucleotide Adduction: A movement of a body part towards the midline of the body. Adrenaline: A hormone that activates in certain situations, usually when you are scared or in an emergency. It speeds up the reactions in your body. Affected relative pair: Individuals related by blood, each of whom is affected with the same trait. Examples are affected sibling, cousin, and avuncular pairs. See also: avuncular relationship Aggregation technique: A technique used in model organism studies in which embryos at the 8-cell stage of development are pushed together to yield a single embryo (used as an alternative to microinjection). See also: model organisms Allele: Alternative form of a genetic locus; a single allele for each locus is inherited from each parent (e.g., at a locus for eye color the allele might result in blue or brown eyes). See also: locus, gene expression Allergy: When your body is sensitive to something, like pollen, foods, animals, or drugs, you may have a reaction such as sneezing, itching, and skin rashes.
    [Show full text]
  • Characterization of a Meiotic Crossover in Maize Identified by a Restriction Fragment Length Polymorphism-Based Method
    Copyright 6 1996 by the Genetics Society of America Characterization of a Meiotic Crossover in Maize Identified by a Restriction Fragment Length Polymorphism-Based Method Marja C. P. Timmermans,’ 0. Prem Das* and Joachim Messing Waksman Institute, Rutgers university, Piscataway, New Jersey 08855-0759 Manuscript received March 6, 1996 Accepted for publication May 3, 1996 ABSTRACT Genetic map lengths do not correlate directlywith genome size, suggesting that meiotic recombination is not uniform throughout the genome. Further, the abundanceof repeated sequences in plant genomes requires that crossing over is restricted to particular genomic regions. Weused a physical mapping approach to identify these regions without the bias introducedby phenotypic selection. This approach is based on the detectionof nonparental polymorphisms formedby recombination between polymorphic alleles. In an F2 population of 48 maize plants, we identified a crossover at two of the seven restriction fragment length polymorphism loci tested. Characterization of one recombination event revealedthat the crossover mapped withina 534bp region of perfect homology between the parental alleles embedded in a 2773-bp unique sequence.No transcripts from this region could detected.be Sequences immediately surrounding thecrossover site were not detectably methylated, except SstIfor sitean probably methylated via non-CpC or CpXpG cytosine methylation. Parental methylation patterns at this SstI site and at the flanking repetitive sequences were faithfully inherited by the recombinant allele. Our observations suggest that meiotic recombination in maize occurs between perfectly homologous sequences, within unmethylated, nonrepetitive regionsof the genome. ECOMBINATION isan importantaspect of meiosis The currentunderstanding of recombination mecha- R in most eukaryotic organisms. It ensures proper nisms stems largely from geneticand molecular studies chromosome disjunction during the reductional divi- in bacteria and fungi (PETESet al.
    [Show full text]