Fungal Diseases of Sheep & Goats

Monograph On Fungal Diseases of sheep & goats A guide for postgraduate students in developing countries

Colonnade and Flock of Sheep Statues between the first and second pilon in Karnak temple Luxor, 123RF.com

Mohamed K. Refai, Ahmed L. El-Naggar, Nahed M. El-Mokhtar Cairo, 2017

Refai et al. (2017) Monograph On Fungal Diseases of Sheep & Goats A guide for postgraduate students in developing countries. https://www.academia.edu/manuals http://scholar.cu.edu.eg/?q=hanem/book/ https://www.researchgate.net/publication

Prof. Dr. Mohamed K. Refai Department of Microbiology, Faculty of Veterinary Medicine, Cairo University, Giza

Prof. Dr. Ahmed L. El-Naggar Animal Health Department, Desert Research Centre, Cairo

Prof. Dr. Nahed M. E l-Mokhtar Department of Mycology and Mycotoxins, Animal Health Research Institute, Dokki

Preface This monograph is dedicated to my postgraduate students who finished their theses on mycoses of sheep and goats and to all colleagues who were co-supervisors or those who helped the students. The first M.S. Thesis: Study on ringworm of sheep and goats was done by Dr. Galal Al-Assi from Jordan from which the following paper was published: 1. Fouad, S., El-Assi, J. and Refai, M. : Ringworm in sheep and goats in Egypt with special reference to experimental infection and immunization in sheep. Castellania 5, 165-167 (1977) The Ph.D. done by Ahmed Lotfy El-Naggar, was on fungi present in the reproductive organs and udder and their experimental infection in sheep and goats under desert conditions, from which the following papers were published: 2. El-Naggar, A., Ibrahim, F., Refai, M., Balata, M. and Hassan, A. : The fungal flora of genitalia and udder of sheep and goats under desert condition. Zag. Vet. J. 25, 51-57 (1997) 3. El-Naggar, A., Ahmed, Y., Ibrahim, F. and Refai, M:Mycotic abortion in small ruminants induced by Aspergillus fumigatus. J. Comp. Pathol. & Clinc. Pathol. 10, 59-76 (1997) 4. El-Naggar, A., Ahmed, Y., Ibrahim, F. and Refai, M. : Some pathological studies in the udder of small ruminants intramammarily infected with Aspergillus fumigatus and Candida albicans. J. Comp. Pathol. & Clinc. Pathol. 10, 93-104 (1997) The histopathological part of this thesis was done under the supervision of Prof. Youssef Fawzy Ahmed, National Research Center, and the immunological part was done under the supervision of Prof. Kamil N. Mettias, Animal Reproduction Research Institute, Agriculture Research Center. Three other theses, in which samples of sheep and goats were examined mycologically, were done under co-supervision of Prof. Hosam R. Kotb, Animal Reproduction Research Institute, ARC are:  Hala A. Saleh: Mycological studies on Cr.neoformansisolated from clinical cases and environment. M.S., 2005,  Hala A. Saleh: Genotypic identification and characterization of Candida albicans and Cr. neoformans from man, animals and soil with particular reference to recent approaches for their control Ph.D., 2010  Abou-Elmagd , S.: Some mycological and molecular biological studies on mixed yeast infection M.S., 2011 From these the following papers were published: 5. Hala A. Saleh, Amgad A. Moawad, Mahmoud El-Hariri, Mohamed K. Refai (2011): Prevalence of Yeasts in Human, Animals and soil sample in El-Fayoum Governorate in Egypt. Int, J. Microbiol. Res. 6. Abou-Elmagd,S, Hosam Kotb, Khalid Sabry and Mohamed Refai (2011): Prevalence of Candida albicans and Cryptococcus neoformans in animals and chickens in Quena Governorate, with special reference to RAPD-PCR patterns of the isolates. J. American Sci 7, 20-31, 2011

Galal Al Assi Ahmed Lotfy Hala Abdel Karim Sheima Abo ElMagd A study on ringworm in sheep and goats was done in collaboration with colleagues in the Department of Veterinary Medicine, which was published in 1988: 7. Abdel-Halim, M., Youssef, H., Ramadan, A. and Refai, M. : Dermatophytosis in Egyptian sheep and goats. Vet. Med. J. 36, 199-206 (1988) It is to be noted that several papers were published by Prof. Atef A. Hassan, Animal Health Research Institute, covering yeast and ringworm infections in sheep and goats as well as mycotoxins in their sera and feeds. Sheep and goat diseases were taken care of by Prof. Mohamed A. Balata, Desert Research Center – Cairo

Prof. Kamil N. Mettias Prof. H. R. Kotb Prof. A. A. Hassan Prof. M. Balata Prof. H. Youssef Prof. Youssef Fawzy

Prof. Dr. Mohamed Kamal Refai May, 2017

Previous monographs https://www.academia.edu/21679188/ http://scholar.cu.edu.eg/?q=hanem/book/ http://www.researchgate.net/publica on/293427976

1. Monograph on yeasts (updated). A guide for isolation and identification of medically important yeasts, diseases and treatment. By Mohamed Refai, Heidy Abo El-Yazid and Mahmoud El-Hariri, 2013

2. Monograph on Dermatophytes: A guide for isolation and identification of dermatophytes, diseases and treatment, By Mohamed Refai, Heidy Abo El-Yazid and Mahmoud El-Hariri, 2013

3. Monograph on mycotoxigenic fungi and mycotoxins, Mohamed Refai and Atef Hassan, 2013

4. Monograph on diphasic fungi, Mohamed Refai and Heidy Abo El-Yazid , 2014

5. Monograph on Dematiaceous fungi, Mohamed Refai, Heidy Abo El-Yazid.· May 2014.

6. Monograph on Aspergillus and Aspergillosis in man, animals and birds, Mohamed Refai, Heidy Abo El-Yazid and Atef Hassan., 2014

7. Monograph on Cryptococcus and cryptococcosis. Mohamed Refai , Mahmoud El-Hariri, Randa Alarousy, 2014

8. Monograph on the genus Penicillium, Mohamed K. Refai., Heidy Abo El-Yazid and Wael Tawakkol, 2015

9. Monograph on the genus Fusarium, Mohamed Refai and Atef Hassan and Mai Hamed, 2015

10. Monograph on Candida albicans, Mohamed Refai Mona El-Enbaawy and Atef Hassan, 2015

11. Monograph on equine mycoses and mycotoxicoses, Mohamed K Refai · Heidy Abo El Yazeed · Atef Hassan · Mahmoud El Hariri・ Feb 2016

12. Monograph on fungal diseases of cats and dogs, Mohamed Refai · Heidy Abou El-Yazeed, Mounier Abdel Haleem , Mahmoud ElHariri, Apr 2016

13. Monograph on avian mycoses and mycotoxicoses, Mohamed Refai, Amir Elbatrawi, Gamil Osman, Atef Hassan· Jun 2016

14. Monograph on fungal diseases of camelidae, Mohamed Refai, Ahmed El Naggar, Omar Tamam, Jul 2016

15. Monograph on fungal diseases of fish Part 1. Mohamed K Refai, Sherif Marouf, Rasha El Ahl, November, 2016

16. Monograph on fungal diseases of fish Part 2. Mohamed K Refai, Sherif Marouf, Rasha El Ahl, November, 2016

17. Monograph on bovine mycoses and mycotoxicoses, Mohamed Refai, Badiea Moshref, Howayda El-Shafei, Rehab Elhelw, February, 2017

18. Monograph on fungal diseases of wild animals, Mohamed K. Refai, Abd-Elhamid Z. Fahmy and Heba N. Deif, April 2017

Contents

1. Sheep and goats in Egypt 6 2. Ringworm of sheep and goats 21 3. Diseases caused by yeasts 39 3.1. Candidosis in sheep and goats 39 3.2. Cryptococcosis in sheep and goats 46 3.3. Malasseziosis in sheep and goats 60 3.4. Rhodotorulosis in sheep 68 4. Diseases caused by moulds 71 4.1. Aspergillosis in sheep and goats 71 4.2. Facial eczema in sheep 77 4.3. Pythiosis in sheep and goats 83 4.4. Conidiobolomycosis in sheep and goats 93 4.5. Pneumocystosis in sheep and goats 110 4.6. Microsporidiosis in sheep and goats 114 4.7. Scopulariopsis in sheep and goats 117 5. Diseases caused by multiple agents 120 5.1. Mycotic mastitis in sheep and goats 120 5.2. Mycotic abortion in sheep and goats 128 5.3. Mycotic pneumonia in sheep and goats 134 6. Diseases caused by algae 136 6.1. Protothecosis in sheep and goats 136 7. Keratinophilic fungi 144 8. Mycotoxins in feeds and milk of sheep and goats 148 9. References 163

1. Sheep and goats in Egypt 1.1. Sheep in Ancient Egypt

Egyptian Name: Ser Hieroglyphics:

The ancient Egyptians referred to both goats and sheep by a single term, "small cattle," thereby ignoring their considerable differences.  Sheep were not common in ancient Egypt, as wool was not of great economic importance to the Egyptians - they preferred the less hot and itchy linen and later, the lighter cotton to wool.  Sheep were kept for their meat, milk, and skins, and the flocks were used to tread seed into the fields after sowing.  Sheep tail fat - alya - was used in cooking.

The first sheep entered Egypt via Sinai, and were present in ancient Egyptian society between eight and seven thousand years ago. Ancient Egypt possessed in succession two different species of domesticated sheep, both descended from the Iranian Red Sheep.

o The older breed, (ovis longipes), had horns jutting out o The newer fat tailed sheep, (ovis platyra), which was introduced during the Middle Kingdom, had horns curled close to the head on either side.

Both kinds were most commonly domesticated sheep utilized on the reliefs of early pharaonic tombs.

Wikipedia Ovis longipes palaeoaegyptiacus Ovis platyra sheep

Barbary sheep

 Barbary sheep once resided across North Africa‟s mountainous areas, but the indigenous population is now confined to small, mostly isolated pockets.  Barbary sheep used to cover nearly all of Egypt except Sinai, but since the mid-1900s their habitat has been confined mainly to the southwest near the Libyan border and the southeast near the Sudanese border.  Barbary sheep have large curved horns and are sandy or reddish brown colored.

Aoudad or Barbary Sheep (Ammotragus lervia), Wildlife Facts

The three main breeds of sheep in Egypt are Rahmani, Osseimi and Barki:

Rahmani sheep is the largest breed, easily identifiable by its red wool and small ears.  Origin in Northern Syria and Southern Turkey.  The breed was first introduced into Egypt in the 19" Century and is named after Rahmania, a village in Beheira governorate in the north of the Nile Delta.  Population is about 250,000 head in the North and Middle of the Nile Delta.  Rahmani breed is decreasing in the face of the expansion of the Ossimi. Barki sheep is the smallest breed, with white wool and a brown neck.  Origin in North Africa in the coastal Mediterranean zone.  The breed is named after the Libyan province Barka (Cyrenaica).  Its population size is about 300,000.  The breed extends from west of Alexandria to the eastern provinces in Libya.

Osseimi sheep is slightly smaller, with white wool.  Origin in Giza, named after Ossim, a village near Cairo.  The breed is the most popular among the Nile Valley and Delta breeds and is expanding at the expense of other breeds.  Population of the Ossimi breed is over 1,000,000 head.

There are other breeds as Saidi, Sohagi, Wahati, Frafra, etc

Rahmani sheep

Barki sheep Saidi sheep

Sohagi sheep Frafra Sheep Ossimi sheep

Kenzi sheep, TripAdvisor Abo dlek sheep, Hany Mohamed Amin

All are fat-tailed sheep, long tails, filled with fat and having a function similar to the camel's hump. o Fat-tailed sheep are hardy and adaptable, able to withstand the tough challenges of desert life. o Carcass quality is good, with most of the fat concentrated in the tail region. o The wool from fat-tailed breeds is coarse and frequently has colored fibers.

Several trials have been carried out to improve lamb production by crossing local with European breeds. These trials, started early in the 1940s, used Suffolk, Hampshire, Fleisch Merino, Hungarian Merino, Finnish Landrace, and more recently Romanov breeds. Other minor trials were also carried out using Merino, Texel, and Ile-de- France.

Suffolk sheep Romanov sheep

Finnsheep Spanish sheep

Sheep are imported from several countries, mainly from Syria, Sudan, Australia and other countries, namely for sacrificing in Eid El Adha.

Australian sheep

Syrian Shami sheep Sudan desert sheep

1.2. Goats in Ancient Egypt Egyptian Name: Wndw or Wenedju Hieroglyphics:

 Descended from the wild Bezoar Goat, domesticated goats in Egypt were kept for their meat, milk, skin, and hair, which was used for making ropes, wigs, rough bags, and low-status clothing. Goat skins served as water containers and flotation devices. Goat milk was used to make butter, cheese, and yogurt.

Capra aegagrus, or Bezoar goats, are found on Creta, and other Greek islands, in Turkey, Iran, Turkmenia, Pakistan. The domestic goat is descended from the Paaang or Bezoar goat

 There were two varieties of ancient Egyptian goat - one with short scimitar- shaped horns, and one with long corkscrew-shaped horns.

 Goat meat, like mutton and pork, was the meat of the middle class and was not used for offerings to the gods or the dead.  Goats were priced as less than pigs but more than sheep, and one-tenth of that of a donkey or calf.  The goat was not associated with any god and was therefore not considered to be a sacred animal. Goat mummies wearing collars have been found in tombs, presumably favored pets. Wild goats were occasionally hunted by pharaohs and noblemen for sport.

Ten different breeds of goats can be found in Egypt.  The Barki or Sahrawiis the smallest local breed of goat.  The Zaraibi is father to the popular Anglo-Nubian goat bred for it's healthy milk.  Other local breeds include the o Sharkawi, o Wahati, o Black Sinai. o The Saidi and Egyptian Baladi goats –are the most abundant.

Sahar Ahmed et al. (2016) MITOCHONDRIAL DNA, 2016 http://dx.doi.org/10.3109/24701394.2016.1174225

Nubian doe Egypt, eXtension Zaraibi dairy goat and young in confinement Nubaria Region,

MILKING GOAT.....The Anglo-Nubian breed originated in England as a cross between the Old English Milch Goat and the Zariby and Nubian bucks imported from Egypt

Barki goats Shami or Damascus goats

1.3. Sheep in Egyptian art

Sheep statues made of faience

A stone Statue of a Ram Ancient Egypt, 18th Dynasty

Silicified wood sculpture of a Ram's head. Ancient Egyptian, Egyptian sphinx with a ram's head. A sphinx is a sculpture Pinterest

Rare Egyptian Amun-Ra Two-Headed Ram Sculpture Everything But The House This decorative two headed Egyptian ram figure is constructive of solid wood. It has been hand carved and hand painted with black red and gold paint

Granite Gneiss Ram of Amun. A figure of King Taharqa stands between the rams folded legs, symbolically placed under its divine protection Pintrest Ancient Egyptian Iron Age Pottery Zoomorphic Holy Land Pottery Clay Sheep Statue

Jewelry was important in Ancient Egypt. The rich and the poor alike wore it. Ancient Egyptians even put jewelry on the dead. They used materials like copper, gold, beads and semi-precious stones. Of course, the rich had access to more elaborate jewelry, but even the poor wore things like collar necklaces, earrings and rings--including the men.

Egyptian-Sterling-Silver-Ram-Buck-Skull-Ring Egyptian Ram Pendant Khnum Jewelry Pewter Kemetic Khnemu Talisman Amulet

Egyptian Silver Jewelry Bust of a Ram-Headed God Khnum Ring, MojoII. Ram pendant, c.1069-664BC, Louvre Museum, Paris. | my ancestry | Pinterest | Museums, the Originals and Egypt "Egyptian God Amun - Solar Ram" www.parfonova.com

GOLD RAM'S HEAD RING Unknown (Egyptian) Earring with ram's head date unknown gold ,SHIELD- RING: with Amun as crowned ram's head from tomb of QUEEN Pintrest

Necklace with human and ram's head pendants 270 BC-320 AD, Gold and Carnelian Harvard University--Boston Museum of Fine Arts Expedition Photograph © Museum of Fine Arts, Bosto

Ram's Head Amulet, Metropolitan Museum of Art. RasMarley at Flickr. fine arts, ancient world, Egypt, craft / handcraft, shield ring with ram head, on neck collar with solar disc, gold, enamel Alamy Egyptian shield ring worn by Nubian queen Amanishakheto. Winged gosdess Nut with ram head. Pintrest

This painting of Amun, one of the creator gods in Egyptian mythology, decorates a tomb in Luxor, Egypt. Amun often appears as a human figure with a ram's head. The Egyptian god Khnum, a sheep-human hybrid Macroevolution.net

1.4. Sheep and goat mummies

Ram mummy BBC Pinterest

Mummified Baby Goat Head Preserved Specimen, Pintrest 1.5. The Ram in religion of Ancient Egypt Jimmy Dunn writing as Taylor Ray Ellison The Ram was associated with perhaps some of Egypt's best known and most important gods, who like the bull, seems to have also been specifically worshipped as a temple animal. The ram was associated with various gods from Egypt's earliest periods. The ram, like the bull, was perhaps even more venerated by the ancient Egyptians for its fertility, as well as for its warlike attributes. As a temple animal at such locations as Mendes and Karnak, a single animal appears to have been cared for and treated very similar to the holiest of god's statues within the temple.

Ram-headed Amun-Ra. Pinterest

Ram-headed-amun-pharaoh, Ferrebeekeeper - WordPress.com. Statues of Amun rams from the great forecourt of the Temple of Karnak

Amun Ra had several forms which reflected his diverse origin, but he was most often portrayed as a mighty ram or as a pharaoh with a distinctive towering headdress…or sometimes as a falcon with the sun on his head.

The very earliest gods that were depicted with ram features were probably based on the ram species known as Ovis longipes palaeoagytiaca known from predynastic times.  Khnum, an important god throughout Egypt, but especially at Elephantine, who created mankind and even gods on his potters will, was apparently depicted as this species, with its long wavy horns and heavy build, as was Banebdjedet (Ba- neb-Tetet), an early ram headed god at Mendes.  Banebdjedet was the manifestation of the Lord of Djedet, as well as the ba, or soul of another of ancient Egypt's most famous gods, Osiris.  Osiris is often depicted with a pair of ram horns attached to the base of his atef crown also from this earliest species of ram.

Later in Egyptian history, a second species of ram known as Ovis aries platyra aegyptiaca, a curved horn ram, appeared around the 12th Dynasty of Egypt's Middle Kingdom. The most important deity of Egypt's New Kingdom and later periods, Amun, seems to have been associated with this species of Ram.  Amun is sometimes referred to as "lord of the two horns" and on his splendid, gilded, wooden festival boat a ram's head adorned both its prow and stern.  As most people who have ever visited Luxor (ancient Thebes) are probably aware, the processional road to the Temple of Amun was flanked with ram headed lion sphinxes, each one guarding between its front legs a statue of the pharaoh.

There were actually a number of other gods of ancient Egypt associated with the ram, either having ram heads, or sometimes simply ram horns. These included

 Arsaphes (Herishef, Harsaphes), a god of Heracleopolis,  Kherty (or perhaps Cherti), a ram headed god that probably originated at Letopolis and had a dual nature being both hostile and protective,  Andjety, who's main cult center was at Busiris in the Delta and who was in many aspects the precursor of Osiris,  Auf (Efu Ra), who was an aspect of the sun god,  Re as a ram headed deity surmounted by a sun disk,  Harmakhet, a variant of Horus, who was the God of the dawn and of the morning sun, who was depicted in the form of a sphinx or a sphinx with the head of a ram.

Herishef. Louvre. WikiVisually Kherty , a ram headed god

Khnum in Egyptian Mythology

 Khnum was the god of fertility and procreation  Khnum as the god of procreation (reproduction) is reflected in his role of moulding the infant and its ka within the womb, giving it the breath of life and then maintaining the health of the infant child after birth.  Khnum, the Egyptian god of fertility, water and procreation, featured in the stories, myths and legends in Egyptian Mythology.  Khnum was one of the old cosmic gods described as "the maker of things which are, the creator of things which shall be, the source of created things, the father of fathers, and the mother of mothers."  Khnum was worshipped in cities throughout Upper and Lower Egypt and there were many cults dedicated to this god.  Khnum had roles of a protector of the Dead, the protector of the source of the Nile, and a protector of Ra on the solar barque and his protective roles were possibly the reasons why he was associated with so many war goddesses.  Khnum was a member of the Elephantine Triad consisting of Khnum, Satet the war goddess of the Nile inundation and their daughter Anuket, the goddess of the cataracts.  In another cult Khnum was the consort of Neith the goddess of war whose offspring was Heka the god of magic who together formed the the Triad of Latopolis.

Khnum believed to be fashioning the divine child Heka on a potter's wheel

Symbols of Khnum - The Ram Headed God

The most striking symbol of Khnum is the ram. He is depicted in ancient Egyptian Art as a ram-headed god with green skin. Green colored skin was the color of vegetation and symbolized new life, rebirth and regeneration. Khnum is credited with giving man his soul (Ka) and in the language of the ancient Egyptians the words "soul" and "ram" sounded the same, which explains the significance of the ram as the symbol of Khnum. The Latin name of the type of ram depicted is the 'Ovis longipes palaeo-aegyptiacus'. It is now extinct. But it was a type of barbary sheep that was found in the ancient Southern Egypt and Nubia. This species of ram, a domesticated sheep, was depicted on the relief's of the early tombs of Pharaohs.

2. Ringworm of sheep and goats

Ringworm is a fungal infection of the skin with a worldwide distribution. The disease is of significant economic consequence to the farmer since growth rates are affected in the active stage of infection and the disease causes hide damage.  Ringworm is most commonly recognized in lambs and kids, in which non- pruritic periocular lesions are most characteristic, although generalized skin disease may develop.  Ringworm in sheep and goats is reported to develop lesions most often on the face, chest and limbs.  Ringworm lesions are characteristically discrete, scaling patches of hair or wool loss with gray-white crust formation, some become thickly crusted with suppuration. Epidemiology  The infection spreads primarily through direct contact between animals, with clinically infected animals being the greatest source of infection.  The spores of ringworm fungi survive many months and in some cases years in the farm environment and may be transmitted either by fomites (brushes, gates, feed carts) or by asymptomatic carriers to susceptible hosts.  A natural outbreak will generally affect only younger animals, though older animals which have not previously had contact with the dermatophyte can also easily be affected due to the lack of natural immunity.

Factors that influence susceptibility of an animal to dermatophyte infection are:  Age of the animal: Young animals are by far more susceptible to infection  Crowding together young animals  Factors that decrease resistance to infection: o Poor nutrition, o Concurrent disease, o Previous use of immunosuppressive drugs.

Clinical Signs  Clinical signs vary in terms of the number and size of affected sites, but the head and neck areas are most susceptible. In addition to the multifocal nature of the disease, the individual lesions usually vary considerably in size.  The primary changes that are observed clinically are alopecia, scaling and crusting.  Lesions are characteristically greyish-white and have an ash-like surface. Their outline is circular and they are slightly raised due to the accumulation of many layers of scale and the swelling of tissues beneath due to a moderate inflammatory reaction.  In most cases, ringworm is a self-limiting disease, with the duration of infection ranging from 1 to 4 months.  The spontaneous regression is probably at least partly related to the development of immunity.

 Outbreaks of dermatomycosis in sheep were reported from o U. S. S. R (Sharapov, 1962), o Germany (Kielstein and Weller, 1965), o Britain (Pepin and Austwick, 1968), o South Africa (Scott, 1975), o France (Luffau, 1976), o Egypt (Fouad et al. 1977) o Morocco (Pandey et al. 1979)

 The most commonly isolated dermatophytes in sheep are:

1. Trichophyton verrucosum Kielstein and Weller 1965, Vanbreuseghem and Bosmans,1967, Scott,1975, Refai et al., 1976, Al-Assi, 1977, Fouad et al., 1977, Pandey et al., 1979, Ditrich and Otcenásek, 1980, Thakur et al., 1983, Power and Malone, 1987, Abdel Haleem et al., 1988, Abdel-Hafez et al., 1990, Sargison et al., 2002, Khosravi and Mahmoudi, 2003, Abou-Eisha et al. (2008), Emenuga and Oyeka, 2013, Biswas et al., 2015

2. Trichophyton mentagrophytes Al-Assi, 1977, Fouad et al., 1977, Thakur et al., 1983, Khosravi and Mahmoudi, 2003, Abou-Eisha et al. (2008), Emenuga and Oyeka, 2013, Mugnaini et al., 2013, Biswas et al., 2015

3. Trichophyton rubrum El-Said et al., 2009, Biswas et al., 2015

4. Trichophyton terrestre El-Said et al., 2009

5. Microsporum gypseum Emenuga and Oyeka, 2013, Biswas et al., 2015

6. Microsporum canis Biswas et al., 2015

 The most commonly isolated dermatophytes in goats are:

1. Trichophyton verrucosum Vanbreuseghem and Bosmans, 1967, Scott, 1975, Pandey and Mahinm 1980, Aller- Gancedo and Fernandez, 1981, Chineme et al., 1981, Thakur et al.,1982, Philpot and Arbuckle, 1983, Pal and Singh, 1983, Ali-Shtayeh et al., 1988, Karim and Abdalla, 1988, Abdel-Hafez et al., 1990, Khosravi and Mahmoudi, 2003, Abou-Eisha et al., 2008, Eljack et al., 2011, Emenuga and Oyeka, 2013, Kalaiselvi et al, 2014, Biswas et al., 2015, Pal, 2015

2. Trichophyton mentagrophytes Thakur et al.,1982, Ali-Shtayeh et al., 1988, Khosravi and Mahmoudi, 2003, Abou- Eisha et al. (2008), Emenuga and Oyeka, 2013, Biswas et al., 2015

3. Trichophyton rubrum El-Said et al., 2009, Biswas et al., 2015

4. Trichophyton terrestre El-Said et al., 2009

5. Microsporum gypseum Thakur et al.,1982, Thakur et al., 1983, Emenuga and Oyeka, 2013, Biswas et al., 2015

6. Microsporum canis Abu-Samra and Hago, 1980

7. Microsporum nanum Ali-Shtayeh et al., 1988

Trichophyton verrucosum E. Bodin, Les champignons parasites de l'homme: 121 (1902)

Trichophyton verrucosum is a zoophilic dermatophyte, inducing bovine dermatophytosis. It is transmitted to human through direct contact with contaminated cattle or its products in infected patients with inflammatory lesion in head, face etc  Trichophyton verrucosum invades hair and is one of the causes of tinea capitis especially in children  Trichophyton verrucosum can be cultured in sabouraud media containing glucose enriched with thiamine; inositol, pyridoxine, and yeast extract .  Trichophyton verrucosum skin colonization could lead to an inflammatory reaction with different severities.  Trichophyton verrucosum can reactivate the specific and nonspecific immunity reactions including cellular and humoral immunity.  The most important mechanism of active nonspecific responses to dermatophytes is macroglobulin keratinase, unsaturated transferrine and scaling of epidermis. Moreover, the accumulation of neutrophils has also been reported in inflamed epidermis in acute stages of disease.  Trichophyton verrucosum has a variety of surface antigen, which can raise different responses, such as immunostimulatory property and proliferative response on skin layers.

Description

Colony characteristics:

Trichophyton verrucosum is very slow-growing compared to other dermatophytes. In culture, it is characterized by being flat, white/cream colour, having an occasional dome, with a glabrous texture, known as the variant album, Trichophyton verrucosum var. ochraceum has a flat, yellow, glabrous colony; Trichophyton verrucosum var. discoides has a gray-white,

23 flat, and tomentose colony; and T. verrucosum var. autotrophicum is rarely seen and is associated with sheep. Under a microscope, macronidia are rare, and have a rat-tail or string bean shape, while micronidia are tear-shaped and have been only observed in laboratories when grown under enriched conditions. At 37 C (the only dermatophyte with an optimum growth temperature this high), chlamydospores become thick-walled and found in long chains. Macronidia are more commonly produced on BCP-milk solids- yeast extract agar, and only on colonies over 7 days old. Under refrigeration, it will die. Regions infected with T. verrucosum will fluoresce under a blacklight in cattle, but not in humans.

Trichophyton verrucosum young button-shaped colonies and mature culture.

Growth on T1 vitamin free agar vs T3 with inositol and thiamine.

Biochemical Reactions (BCP, SDA and Urease) oBCP: restricted/ no change/ hydrolysis oUrease: positive (variable) oVitamin requirement: thiamine and inositol oHair perforation: negative oImproved growth at 35°C

Characteristic chains of chlamydoconidia

Nutritional requirements: All strains require thiamine and approximately 80% require thiamine and inositol. There is no growth on casein vitamin free agar (T1), minimal submerged growth on T1 + inositol (T2), good growth on T1 + inositol and thiamine (T3) and good growth on T1 + thiamine only (T4). Growth at 37oC: Unlike other dermatophytes, growth is enhanced at 37oC. All strains produce typical chains of chlamydospores, often referred to as “chains of pearls”, especially when grown on BCP milk solids glucose agar at 37oC. When grown at 25oC on milk solids glucose agar a “halo”-like zone of peripheral clearing of milk solids occurs within 7 days.

Trichophyton mentagrophytes (C.P. Robin) R. Blanch., Traité de Pathologie Générale 2: 912 (1896)

On Sabouraud's dextrose agar, colonies are generally flat, white to cream in colour, with a powdery to granular surface. Some cultures show central folding or develop raised central tufts or pleomorphic suede-like to downy areas. Reverse pigmentation is usually a yellow-brown to reddish-brown colour. Numerous single-celled microconidia are formed, often in dense clusters. Microconidia are hyaline, smooth-walled, and are predominantly spherical to subspherical in shape, however occasional clavate to pyriform forms may occur. Varying numbers of spherical chlamydoconidia, spiral hyphae and smooth, thin- walled, clavate shaped, multicelled macroconidia may also be present.

Microsporum gypseum (E. Bodin) Guiart & Grigoraki, Lyon Médical 141: 377 (1928)

On Sabouraud's dextrose agar, colonies are usually flat, spreading, suede-like to granular, with a deep cream to tawny-buff to pale cinnamon coloured red surface. Many cultures develop a central white downy umbo (dome) or a fluffy white tuft of mycelium and some also have a narrow white peripheral boarder. A yellow-brown pigment, often with a central darker brown spot, is usually produced on the reverse, however a reddish-brown reverse pigment may be present in some strains. Cultures produce abundant, symmetrical, ellipsoidal, thin-walled, verrucose, 4-6 celled macroconidia. The terminal or distal ends of most macroconidia are slightly rounded, while the proximal ends (point of attachment to hyphae) are truncate. Numerous clavate shaped microconidia are also present, but these are not diagnostic.

Diagnosis

 Clinical signs of the classic lesions of ringworm. The asbestos like lesions are very typical.  Collection of samples: o epilation of hair or wool by forceps from areas of active infection. o scrapings of crust, hair or wool and scale using a scalpel blade. o the material obtained is collected in a paper envelope, sealed and labeled for transmission to the laboratory.  Direct microscopy: Skin scrapings, hairs, wool and crusts are placed on a clean slide with few drops of 10-25% KOH solution, or NaOH mixed with 5% glycerol, covered with a coverslip, heated gently and left for at least 30 minutes to 1 hour . The preparation is then pressed gently, the oozing fluid is dried and then examined microscopically for the presence of septate hyphae and arthroconidia characteristic of dermatophytes. Other formulation is 20%KOH-36% dimethyl sulfoxide, , the calcofluor white and the Congo red.

Chains of large spore ectothrix infection of hair typical of T. verrucosum. Hair mounted in10% KOH and Evans Blue and septated hyphae in skin scrapings.

Isolation:

Part of the samples is embedded into Sabouraud dextrose agar with chloramphenicol and actidione in tubes using a mycological inoculation hook, preferably at the side of the slope and at different sites. It is better to use more than one tube for each sample. The tubes are then incubated at 30oC for 1-4 weeks.

Identification Identification characters include colony texture, pigmentation, growth rate and distinctive morphological structures such as macroconidia, microconidia, spirals , chlamydospores, etc.

Histopathology:

Histopathology of skin lesions shows an inflammation of the hair follicle and surrounding tissue, with potentially visible fungal hyphae and spores either in the hair itself or in the surrounding tissue

Molecular biology Molecular biology methods have been used by the following authors Kielstein et al. (1998), Hajdúch et al. (1999), Burmester et al. (2011), Nweze (2011),Kano et al. (2014), de Hoog et al. (2016), Eckert et al. (2016), Neji et al. (2016), Ohst et al. (2016) Control  Farm premises must be disinfected between batches of animals and wooden surfaces treated with creosote ( tar-based wood paint)  Animals should be handled with gloves.  Bought-in animals should be screened for skin lesions on arrival and separated and treated until all lesions have gone. Spores may still be present. Zoonotic aspect

Dermatophytes can spread to people, especially young children, and be quite uncomfortable. Because it is highly contagious, infected cattle are prohibited from sales, shows, and interstate travel.

Reports:

Kielstein and Weller (1965) isolated Trichophyton verrucosum from cases of ringworm in sheep

Vanbreuseghem and Bosmans (1967) described ringworm caused by Trichophyton verrucosum Bodin 1902 in goats and sheep in the Republic of Somalia

Nayar et al. (1974) reported trichophytosis in sheep

Scott (1975) reported an outbreak of ringworm in Karakul sheep that occurred during 1973 among the flocks of at least 14 farmers in South West Africa and the northern Cape Province. Infections spread from one farm to another as a result of introducing infected stud rams. On one farm a few cattle, a goat and a horse developed lesions after being in contact with infected sheep. Some of the attendants handling infected sheep also contracted the disease. Strains recovered from infected animals resembled Trichophyton verrucosum morphologically, but when grown on laboratory media

28 they did not require an exogenous source of vitamins, which was found to be indispensable for strains of this species studied previously.

Refai et al. (1976) reported ringworm in 458 out of 12672 sheep examined (3.61%) in farms in the Nile delta. Most cases were seen in the Spring (57.69%), Summer (24.07%), Autumn (18.07%) and rarely seen in Winter (0.17%). Lesions were often on the head, particularly aroud the eyes, mouth and on the ears. Trichophyton verrucosum was the only isolated dermatophytes.

Fouad et al. (1977) reported ringworm in 498 out of 7181 sheep (6.93%) and in 9 out of 803 goats (1.12%). From 507 cases examined mycologically, Trichophyton verrucosum was isolated 348 times and Trichophyton mentagrophytes 3 times. The infection was common in young animals. Experimental infection in 2 sheep with freshly isolated Trichophyton verrucosum was successful. After complete healing the sheep showed no resistance to re-infection. Trichophyton verrucosum antibodies could be detected by precipitation and haemagglutination tests both in experimentally infected sheep as well as in sheep immunized with autoclaved Trichophyton verrucosum whole mycelial antigen.

Ringworm in sheep Ringworm in a goat

T. verrucosum spores in the wool of sheep T.v. colony

Pandey et al. (1979) studied the Prevalence and distribution of ringworm by Trichophyton verrucosum in sheep in the high atlas of Morocco

Ditrich and Otcenásek (1980) found, in the group of sheep reared for blood collections, an enzootic occurrence of dermatomycosis affecting the hair on the head and back. From the pathological material obtained from the lesions of twelve animals an identical strain of Trichophyton verrucosum was cultivated which differed from common isolates of this type macromorphologically. By its ability to grow in the medium without vitamin and by its thermotolerance this isolate resembled the physiological variety T. verrucosum Bodin 1902, var. autotrophicum Scott 1976. Abu-Samra and Hago (1980) mentioned that goats and guinea pigs were found to be quite susceptible to infection with the bovine strain of Microsporum canis. The severe and characteristic annular lesions seen in goats suggested the suitability of this species as a model for future research. The lesions in both goats and guinea pigs were described in details. Trials on treatment of the experimentally induced lesions with 1% canesten cream and 6% neguvon solution were attempted. The efficacy of the drugs used was assessed on the basis of clinical observation, Wood's lamp, direct microscopy, culture and histopathology. Canesten cream produced quick and remarkable results which advocates its use in a widescale in veterinary practice. Pandey and Mahin (1980) published their observations on ringworm in goats caused by Trichophyton verrucosum.

Aller-Gancedo and Fernandez (1981) described an outbreak of ringworm caused by Trichophyton verrucosum in Murciana goats in Leon (Spain). Nine kids and one billy goat were diagnosed positive for ringworm in a herd of 104 kids 7-9 months old and two billy goats. Chineme et al. (1981) reported a case of ringworm in a young goat caused by Trichophyton verrucosum Smith (1981) reviewed caprine dermatologic problems, including ringworm. Thakur et al. (1982) reported that in an extensive survey involving 2176 goats 1.56% of goats manifested clinical lesions of ringworm infection. Animals below the age of 6 months were affected most (4.20%). The incidence of infection was higher during

31 the winter months. T. verrucosum, T. mentagrophytes and M. gypseum were isolated from the skin scrapings of 12, 4, and 2 goats respectively. It is suggested that the infected animals could be a source of disease to human population in which the zoophilic dermatophyte invasion is characterized by severe inflammatory lesions of the skin. The zoonotic importance of different dermatophytes was stressed.

Pal and Singh (1983) reported 2 goats having cutaneous lesions. Trichophyton verrucosum was isolated from one goat.

Philpot and Arbuckle (1983) incriminated Trichophyton verrucosum as the cause of ringworm infection in goats.

Thakur et al. (1983) detected, on clinical examination of 1232 sheep belonging to the urban and rural areas of Punjab (India), lesions of ringworm in 22 animals giving an incidence of 1.78%. Animals below the age of 6 months were more frequently affected (7.4%), than those above 6 months (1.03%). Culturally, T. verrucosum, T. mentagrophytes and M. gypseum could be isolated from the skin scrapings of four, two and one sheep respectively.

White and Putt (1984) reported dermatomycosis in a pig and a ram.

McKellar et al. (1987) noted ringworm in housed sheep.

Power and Malone (1987) described an outbreak of ringworm in sheep in Ireland caused by Trichophyton verrucosum. The flock consisted of 110 sheep and two separate groups within the flock were affected. Eleven of the first group of 23 sheep and five of the second group of 25 sheep showed lesions. Contact with infected cattle and fomites contaminated by the cattle are believed to have caused the outbreak. An excellent response was obtained in both infected groups by treatment with griseofulvin at a dose rate of 7.5 mg/kg daily for seven days.

Abdel-Haleem et al. (1988) examined 45 sheep and 3 goats with clinical signs of ringworm. Samples from all cases were positive microscopically and yielded Trichophyton verrucosum in cultures.Treatment was successful by topical application of 5% tincture iodine solution and feeding on fulcin feed supplement.

32 seven species which belong to 38 genera were isolated. Thirty six of these species were either well recognised agents of mycoses (Trichophyton mentagrophytes, T. verrucosum, and M. nanum), or have been frequently isolated from human and animal lesions (Arthroderma spp., Acremonium kiliense, Alternaria alternata, Aspergillus flavus, Cladosporium carionii, and several other species). These potentially pathogenic fungal species comprised 66.9% of all keratinophilic fungi found on the hair of goats. The role of this animal as a reservoir for dermatophytes and other potentially pathogenic fungi was discussed.

Karim and Abdalla (1988) isolated in the Sudan T. verrucosum from goats

Abdel-Hafez et al. (1990) collected seventy-six species belonging to 29 genera from 320 samples of cloven-hooves and horns of goats and sheep. Chrysosporium was the most common genus on the various substrates and comprehended the following species: C. asperatum, Chrysosporium anamorph of Arthroderma cuniculi, Chrysosporium anamorph of Arthroderma curreyi, C. georgii, C. indicum, C. keratinophilum, C. lobatum, C. lucknowense, C. pannicola, C. pseudomerdarium, C. queenslandicum, Chrysosporium state of Thielavia sepedonium and C. tropicum. Some interesting fungi were isolated: Myceliophthora anamorph of Arthroderma tuberculatum, Myceliophthora anamorph of Corynoascus novoguineensis, Myceliophthora anamorph of Ctenomyces serratus, Trichosporon cutaneum, Trichophyton terrestre and T. verrucosum. Also, several saprobic filamentous fungi tolerating high levels of cycloheximide were isolated of which numerous members of Acremonium, Aspergillus, Chaetomium, Fusarium, Penicillium, Scopulariopsis and several others Sargison et al. (2002) described ringworm caused by Trichophyton verrucosum--an emerging problem in sheep flocks. Khosravi and Mahmoudi (2003) reported detected dermatophytes in 21 out of 94 sheep and 15 out of 59 goat showing skin lesions. Trichophyton verrucosum was isolated from 14 sheep and 11 goats, while Trichophyton mentagrophytes was recovered from 7 sheep and 5 goats.

Al-Duboon et al. (2007) reported ringworm in sheep. Out of 4437 sheep inspected, 242 animals showed clinical signs of ringworm and were positive microscopically, while T. verrucosum was isolated from samples of 221 sheep.

Abou-Eisha et al. (2008) conducted a survey on dermatophytes among farm animals in Suez Canal Area. T. verrucosum was the main aetiological agent isolated from clinically diagnosed cattle, buffaloes, sheep, goats and horses with ringworm lesions at rates of 75%, 50%, 71.4%, 65% and 25%, respectively. Dermatophyte infections among the examined animals reached its peak obviously during autumn and winter months and the lowest rates were in summer and spring months. Young aged animals are more susceptible for dermatophytic infection than older ones. On the other hand, out of 142 apparently healthy animals examined, dermatophytes were isolated from only 10 (7.04%) animals. The isolated dermatophytes of the apparently healthy animals were T. mentagrophytes var. mentagrophytes that was isolated from cattle, sheep and goat (4% of each animal species), T. verrucosum from cattle (8%) and M. gypseum (15%) and M. canis (10%) of the examined cats.

Ringworm lesions in sheep caused by T. verrucosum, characterized by alopecia and scaling around the eye. Microscopy of T. mentagrophytes var. mentagrophytes isolated from apparently healthy goat, showing numerous spherical microconidia arranged in clusters with rare cigar shaped macroconidia (X400). Abou-Eisha et al. (2008)

El-Said et al. (2009) analyzed the mycoflora on the hair in 25 samples of each of goats and sheep collected from Libya using two isolation methods at 25℃. Seventy species and 3 varieties belonging to 31 genera were collected from the two substrates. The hairs of sheep were polluted with fungi than goat, contained high total counts and number of genera and species. Two species of true dermatophytes were isolated namely Trichophyton rubrum and T. terrestre. Eljack et al. (2011) described ringworm in one year old female Saanen goat (Capra aegagrus hircus) admitted to the Veterinary Teaching Hospital of The University of Khartoum representing a sample of a small herd that was housed by a small holder in Omdurman Locality in Khartoum State. The main clinical manifestations were different sizes of rounded raised scaling skin lesions with scabs on their tops and painul on palpation. Lesions were spread all over the body, especially on the ears, eyelids and under the base of the tail. The case was tentatively diagnosed as dermatophytosis. Skin scrapings were collected for mycological studies. Direct mounts of the scrapings were performed in 20% KOH. Cultures onto brain heart infusion agar and sub-cultures onto Sabouraud Dextrose Agar were performed . Confirmation mounts from colonies have been done. In lactophenol cotton blue Trichophyton verrucosum has been isolated.

Different size rounded , raised scaling and crusting skin lesions (A) lesions on the right thoracic wall with scabs on their tops - to expose the lesions, the hair around them was clipped out, (B) same lesions in-A showing scabs detachment after sampling, (C) Auto detachment of the scabs on the left scapular region. Eljack et al. (2011)

Direct examination of skin scrapings in 20% KOH (400x) (A) showing large numbers of endothrix spores (B) showing a hyaline hyphae inside the hair. Eljack et al. (2011)

cultures of T. verrucosum (A) Brain Heart infusion Agar culture: showing Orange, heaped, and waxy button like colony, (B) Sabouraud Dextrose Agar culture: showing a white flat powdery colony. Eljack et al. (2011)

Lactophenol cotton blue (LPCB) (400x): (A) showing chains of chlamydoconidia, (B) showing thin septate hyphae. Eljack et al. (2011)

Emenuga and Oyeka (2013) screened 4860 animals, of which 2570(52.88%) were goats and 2290(47.12%) were sheep. Of the 2570 and 2290 of goats and sheep, 80(3.11%) and 144(6.29%) had fungal lesions respectively. Prevalence of fungal infections was higher on the animals from farms than those at the markets. Infection was more prevalent in animals between 13-24 months of age. The glaborous skin was mostly affected (37.5%) in the goats, while in the sheep, the face was affected most (62.5%). Fungi recovered from the animals included Trichophyton verrucosum (19.64%), Trichophyton mentagropytes, (20.54%), Microsporum gypsum (5.80%).

Fungal infection on the glaborous skin of a goat, Fungal infection on the face of a sheep Emenuga and Oyeka (2013)

Mugnaini et al. (2013) described an outbreak of ovine ringworm that occurred in a Zerasca sheep flock, consisting of approximately 200 animals, kept in northern Tuscany (Central Italy). The subjects were divided into three separate shelters used for winter housing. Twenty-two ewes from a group of 60 adults simultaneously exhibited several circular facial lesions, with a diameter of up to 6 cm. The lesions were alopecic and erythematous, sometimes covered by crusts. The fleece was not affected by the lesions. A clinical score was assigned to the diseased animals. A score of 2 was given to sheep showing hairless areas and ⁄ or areas of thinning hair with local inflammation such as erythema and swelling, and score of 3 to sheep showing hairless areas with mild crusts, scales and ⁄ or exudates. Thirteen sheep had a score of 2, and the rest 3. The animals were kept in a shelter that had previously been used by other livestock, but had then been converted into housing for sheep. Hair samples

36 were obtained by brushing the affected areas after cleaning with absolute ethanol to avoid the growth of environmental contaminant moulds. The hair specimens were seeded onto Sabouraud Dextrose Agar (SDA), mixed with 0.05% cycloheximide and the plates were incubated at 25 _C for 10 days. The cultures were checked for mycotic growth from day 4 postinoculation. All cultured samples yielded a pure growth of T. mentagrophytes var. mentagrophytes, identifiable by macro- and microscopic features. A number of herbal products with anti-inflammatory, antiseptic and antimycotic properties for dermatological usage. The successful treatment of 13 sheep affected by ringworm due to Trichophyton mentagrophytes was achieved with a mixture consisting of essential oils (EOs) of Thymus serpillum 2%, Origanum vulgare 5% and Rosmarinus officinalis 5% in sweet almond (Prunus dulcis ) oil. The effectiveness of EOs and of the major components of the mixture (thymol, carvacrol, 1,8 cineole, a-pinene, p-cymene, c-terpinene) against the fungal clinical isolate was evaluated by a microdilution test. Thirteen animals were topically administered with the mixture twice daily for 15 days. The other sheep were administered with a conventional treatment (seven animals) or left untreated (two animals). Minimum inhibitory concentration (MIC) values were 0.1% for T. serpillum, 0.5% for O. vulgare, 2.5% for I. verum and 5% for both R. officinalis and C. limon. Thymol and carvacrol showed MICs of 0.125% and 0.0625%. A clinical and aetiological cure was obtained at the end of each treatment regimen in only the treated animals. Specific antimycotic drugs licenced for food-producing sheep are not available within the European Community. The mixture tested here appeared to be a versatile tool for limiting fungal growth/

Mugnaini et al. (2013) Kalaiselvi et al. (2014) presented a 3 months old goat kid with case history of ring like patches on the body complete alopecia, frequent itching with thick and scaly skin. Direct microscopic examination of skin scrapping with 20% KOH revealed long chains densely packed chlamydiospore found with swollen hyphae. The skin scrapping materials cultured in thiamine inositol nutrient supplement selective culture medium. Long chains of densely compacted chlamydospores present in lactophenol cotton blue staining. The goat kid recovered within a week by external antifungal and systemic antibiotic and nutritional therapy with good hygienic management.

Three month old kids with severe alopecia and dermatitis Kalaiselvi et al. (2014)

Biswas et al. (2015) determined the species of dermatophytes prevalent in sheep and goats in two large districts of West Bengal, India. Among 345 goats and 234 sheep examined for the presence of skin lesions (small, occult, scattered lesions) during 2012 to 2013, 32 and 19 animals, respectively, were found positive for characteristic skin lesions. Examination of positive skin lesions confirmed the presence of various dermatophyte species from goats and sheep (6.1% and 6.4%, respectively). Trichophyton verucossum was the most common species isolated from sheep followed by T. mentagrophytes, Microsporum gypseum, M. canis and T. rubrum. Among goats, Microsporum gypseum was the most common species isolated followed by T. verucossum, T. mentagrophytes, and T. rubrum. Lambs less than 6 months of age were found to be less susceptible to infection than the older animals. The rate of dermatophytes infection was found to be higher in the summer and autumn, as compare to spring and winter. Higher rainfall and humidity along with increased temperature was found to be most congenial for propagation of pathogens in animals and man.

Pal (2015) identified Trichopyton verrucosum in cutaneous lesions of one goat. The diagnosis was established by demonstration of dermatophytes in skin lesions by direct microscopy in 10% Potassium hydroxide solution and isolation of fungus on Sabouraud dextrose medium. The detailed morphology of dermatophytes was studied in Narayan stain. Topical application of 2% solution of Tincture Iodine was prescribed for treatment.

3. Diseases caused by yeasts 3.1. Candidosis in sheep and goats

The genus Candida comprises more than 260 species, of which Candida albicans is the most commonly recorded species in sheep and goats

 Candidosis is a fungal disease affecting the mucous membranes and the skin and may cause infection of any organ or system or systemic infections.  Candidosis is distributed worldwide in a variety of animals and is most commonly caused by Candida albicans.  Candida albicans is a polymorphic fungus which grows in both yeast and filamentous forms (Brown et al., 2012).  Candida albicans is also an opportunistic pathogen and one of the major aetiological agents of mucosal and systemic fungal infection (Brown et al., 2012). o In susceptible individuals, systemic C. albicans infections are thought to arise from organisms in the GI tract (Koh et al., 2008; Miranda et al., 2009). o As filamentous forms predominate at sites of primary epithelial infection, morphogenic transition is thought to facilitate access of C. albicans to the bloodstream and subsequent systemic spread (Gow et al., 2012). Candidosis is rarely reported in sheep and goats. The available published papers were concerned with:  Experimental candidal mastitis o in sheep (El-Naggar et al. (1997) o in goats (Singh et al., 1998)  Experimental candida abortion o in sheep (Maneenil et al., 2015, Ophelders et al., 2016)  Natural mastitis o in sheep and gaots (Abd El-Ghany et al., 1978, Abou-Elmagd et al., 2011, Hassan et al., 2012)  Occurrence in raw milk o in goats (Fadda et al., 2010)  Occurrence in rumen o in goat (Priji et al., 2013, Ilhan et al., 2016)  Evaluation of antifungal susceptibility of Candida albicans isolates recovered from goats and sheep (Brilhante et al., 2015).

Description: Candida albicans (Robin) Berkhout 1923

Morphology

On Sabouraud's dextrose agar colonies are white to cream coloured, smooth, glabrous and yeast-like in appearance. Microscopic morphology shows spherical to subspherical budding yeast-like cells or blastoconidia, 2.0-7.0 x 3.0-8.5 um in size.

Physiological Tests: Germ Tube test + within 3 hours. Hydrolysis of Urea +,Growth on Cycloheximide medium +. Growth at 37C +, fermentation: Glucose +; Maltose +, Galactose +/-; Trehalose+/-, Sucrose (some strains +); Lactose -. Assimilation: Glucose +; Maltose +; Galactose +; Trehalose +; Sucrose (some negative);D-Xylose +; Soluble Starch +; D-Mannitol +; D-Glucitol (Delayed), Melezitose +/-; Glycerol +/-; Succinic acid +/-; L-Arabinose +/-; L-Sorbose +/-; D-Ribose (some positive); Citric acid +/-; DL-Lactic acid +/-. Potassium nitrate -; Lactose -; Ribito-

Reports: Abd El-Ghany et al. (1978) isolated Candida albicans and Candida krusei from milk samples collected from mastitic sheep and goats. Candida guilliermondii was also recovered from one clinically affected quarter of a sheep.

El-Naggar et al. (1997) induced experimental mycotic mastitis in ewes and goats. The animals were inoculated intramammary with spore suspension of Candida albicans. Development of mycotic mastitis was detected. The animals were sacrificed 25 days after infection and gross lesions were described. Pathological examination revealed extensive suppurative mycotic mastitis characterized by diffuse enlargement of milk acini which were highly infiltrated with neutrophils, macrophages, lymphocytes and giant cells. Also few aggregations of giant cells phagocytizing some fungal elements were detected. Candida albicans pseudohyphae were seen in the affected lesions.

Singh et al. (1998) conducted a study with the objectives to understand hitherto little known aspects of candidal mastitis, like its sequential pathology, pathogenesis and clinico-biochemical changes. The experiment was continued for 40 days and after infection, there was sharp fall in milk yield and Candida albicans was directly demonstrated in the milk and re-isolated from the milk and udder tissues up to 30th day after inoculation. An increase in total immunoglobulins in the milk and plasma along with increase in total plasma proteins were also observed. Haematology revealed leukocytosis and neutrophilia. Microscopically, there was acute purulent mastitis, which later became chronic, nonpurulent and interstitial with formation of

40 granulomas. It was concluded that Candida albicans was highly pathogenic to the lactating goat mammary gland even without immunosuppression or antibiotic treatment, resulting in severe irreversible tissue damage and nearly complete agalactia. Saleh (2005) isolated C. albicans from the vaginal swabs of sheep and goats with endometritis in a percentage of 33.3 % and 17.6 %, respectively. The vaginal swabs of the apparently healthy goats yielded only 4 yeast isolates, which were identified as C. albicans, Candida species, R. rubra and T. cutaneum.

Fadda et al. (2010) evaluated the occurrence of yeast microflora in raw goat's milk collected from 62 dairy farms located in different areas of Sardinia. Candida zeylanoides was the most frequently occurring species followed by different Basidiomycetous species. In the strains isolated some biochemical characteristics of technological interest were investigated and a predominance of lipolytic yeast species was found. They employed a simple method of DNA extraction that in a minimal time and with low-cost provided a high quality DNA for RAPD analysis of 32 isolates of C. zeylanoides. The primers M13 and CDU were used and at 40% of similarity, two distinct clusters were observed. The presence of C. krissii species was supposed but further molecular studies are needed to exclude the presence of an as-yet-undescribed species. Abou-Elmagd et al. (2011) isolated Candida albicans from milk samples, and from swab samples collected from the digestive tract, the respiratory and reproductive system and conjunctiva of apparently normal sheep and goats in Quena Governorate (Upper Egypt). Saleh et al. (2011) recovered Candida albicans from the throat and vagina of diseased sheep and goats in a farm in Fayoum

Hassan et al. (2012) isolated C. albicans from 32% and 24% of milk samples collected from mastitis cases of sheep and goats, respectively.

Priji et al. (2013) reported a new strain (BPU1) of Candida tropicalis isolated from the rumen of the Malabari goat, showing dual production of biosurfactant and polyhydroxybutyrate. C. tropicalis strain BPU1, a facultative anaerobe, was tuned to become an aerobe in specially designed flask, the Benjamin flask. The puffy circular colonies were smooth, white-to-cream in colour, with pseudo-filaments. The strain fermented glucose, sucrose, maltose and dextrose, but not lactose and cellulose. It assimilated (NH4 )2 SO4, peptone, glycine and arginine, but not NaNO3, as the nitrogen source. Interestingly, it utilized groundnut oil (up to 0.3%) in a specially designed basal mineral salt medium (BSM). Its capability for dual production of a biosurfactant and a polyhydroxybutyarate (PHB) was explored by various methods from the BSM-oil medium. Extracted biosurfactant from 6 day-old culture was biochemically characterized as a complex of lipid and carbohydrate with an Rf value of 0.88 by thin layer chromatography. Its PHB production was confirmed by specific staining methods with Nile blue sulphate, Sudan black B and Sudan 3. Briefly, this first-ever report gives ample physical evidence for the dual production of a glycolipid (biosurfactant) and PHB by C. tropicalis strain BPU1 on a specially designed medium, which would open up elaborate research on this yeast.

Brilhante et al. (2015) evaluated the antifungal susceptibility of Candida albicans isolates recovered from goats and sheep. Resistance to three azole drugs was observed in C. albicans. Maneenil et al. (2015) injected 107 colony-forming units of C. albicans intra- amniotically in sheep. After 2 d, animals were then randomized to: (i) intra-amniotic and fetal intraperitoneal saline with delivery after 24 h (3 d C. albicans group); (ii) intra-amniotic and fetal intraperitoneal injections of fluconazole with delivery after either 24 h (3 d C. albicans plus 1 d fluconazole group) or 72 h (5 d C. albicans plus 3 d fluconazole group). Controls received intra-amniotic injections of saline followed by intra-amniotic and fetal intraperitoneal fluconazole injections. Intra-amniotic C. albicans caused severe fetal inflammatory responses characterized by decreases in lymphocytes and platelets, an increase in posterior mediastinal lymph node weight and proinflammatory mRNA responses in the fetal lung, liver, and spleen. Fluconazole treatment temporarily decreased the pulmonary and chorioamnion inflammatory responses. Ilhan et al. (2016) identified the fungal agents in milk samples of hair goats. A total of 170 milk samples was collected from the goats with clinical and subclinical mastitis and clinically healthy animals. The samples were collected from the beginning stages of lactation on goats located in Van region, in Turkey. The samples (approximately 10 ml) were obtained in sterilised sample bottles and transferred immediately to the laboratory and California mastitis test was carried out. Milk samples were centrifuged at 4000 rpm for 10 min and sediments were cultivated on Sabouraud dextrose agar (SDA) by sterile cotton swabs. Petri dishes were incubated at both 25°C and 37°C for 5 weeks. Fungal agents were isolated from 19 (11.1%) of 170 goat milk samples. In culture, 3 (1.7%) milk samples were positive for Candida (C.) albicans, 2 (1.1%) for C. lusitaniae, 1 (0.5%) for C. parapsilosis, 1 (0.5%) for C. glabrata, 2 (1.1%) for Cryptococcus neoformans, 1 (%0.6%) for Nocardia spp., 4 (2.3%) for Penicillium spp., 3 (1.7%) for Scopulariopsis brevicaulis, 2 for (1.1%) Aspergillus fumigatus. All clinical mastitis samples were found to be negative for fungi. In conclusion, bacteria are believed to be the major cause of mastitis, but present study indicated that fungi are responsible as primarily aetiological agents of mastitis in goats. Ophelders et al. (2016) studied immunological responses and structural changes of the fetal brain in a well-established translational ovine model of intra-amniotic C. albicans infection and tested whether these potential adverse outcomes of the fetal brain were improved in utero by antifungal treatment with fluconazole. Pregnant ewes received an intra-amniotic injection of 10(7) colony-forming units C. albicans or saline (controls) at 3 or 5 days before preterm delivery at 0.8 of gestation (term ~ 150 days). Fetal intra-amniotic/intra-peritoneal injections of fluconazole or saline (controls) were administered 2 days after C. albicans exposure. Post mortem analyses for fungal burden, peripheral immune activation, neuroinflammation, and white matter/neuronal injury were performed to determine the effects of intra-amniotic C. albicans and fluconazole treatment. Intra-amniotic exposure to C. albicans caused a severe systemic inflammatory response, illustrated by a robust increase of plasma interleukin-6 concentrations. Cerebrospinal fluid cultures were positive for C. albicans in the majority of the 3-day C. albicans-exposed animals whereas no positive cultures were present in the 5-day C. albicans-exposed and fluconazole-treated animals.

Laboratory diagnosis a. Samples are collected from the affected area, e.g. skin, vaginal discharge, sputum, blood, milk, tissues etc. b. Direct microscopic examination of 10% KOH preparation or stained films by Gram, PAS etc. c. Culture on Sabouraud dextrose agar incubated at 370C and 25oC for 2-3 days. d. Germ tube test : a suspension of the suspected colony in 0.5 ml serum, incubate for 2-4 h at 370C and examine microscopically for the development of germ tubes, which extend from the cell without septum or constriction. e. Micromorphology on rice agar or corn meal agar f. Fermentation and assimilation of sugars. g. Serotyping using monospecific antisera. h. Biotyping: is based on differences in antigens, enzymatic profiles, resistance to chemical reagents and flucytosine, susceptibility to yeast killer toxins,analysis of karyotypes or DNA polymorphism. i. Serology: many serological tests using soluble cytoplasmic antigen of Candida albicans cells are used for detection of antibodies in the serum of patients suspected to be infected with Candida albicans. Serological tests commonly used are latex agglutination, immunofluorescence, immunodiffusion tests and ELISA. j. Molecular biology techniques: DNA finger printing and PCR are increasingly used in molecular epidemiology of Candia albicans isolates. k. Commercial yeast identification systems: Several kits are used for the rapid diagnosis of Candida infection. The most commonlu used systems are: 1. API-20c AUX YEAST SYSTEM a. consists of a strip containing 20 microcupules, 19 0f which contain dehydrated substrates for biochemical reactions b. identification within 48-72 h 2. UNI-YEAST TEK SYSTEM a. consists of a sealed multicompartment plate containing media used to indicate carbohydrate utilization, nitrate utilization, urease production and cornmeal agar morphology b. requires up to 7 days for complete identification 3. MICROSCAN YEAST IDEN. PANEL a. is a 96-well microtiter plate containing 27 dehydrated substrates b. utilizes chromogenic substrates to assess specific enzyme activity c. detected within 4 h 4. VITEK BIOCHEMICAL CARD a. is a 30-well disposable plastic card containing conventional biochemical tests and negative controls b. is used with the automated Auto Microbe System utilized for bacteria c. identification in 24 h 5. CHROMAGAR a. is a differential medium for isolation and identification of Candida species b. each species yield characteristic colony colour c. identification is presumptive, in 24 h 6. RAPIDID YEAST PLUS SYSTEM a. is a qualitative micromethod using conventional and chromogenic substrates b. identification within 5 h

Biochemical differentiation of the genus Candida, nitrate + species, Rieth, 1984

3.2. Cryptococcosis in sheep and goats

General: The genus Cryptococcus includes over 37 species  Only C. gattii/C. neoformans species complex is commonly considered to be pathogenic.  Conventional nomenclature includes 3 recognized varieties of Cryptococcus neoformans: o Cryptococcus neoformans var. grubii (serotype A), o Cryptococcus neoformans var. neoformans (serotype D), and o Cryptococcus neoformans var. gattii (serotypes B and C), o A hybrid of C. neoformans var. grubii and C. neoformans var. neoformans (serotype AD).  Recently, proposed changes to the taxonomy suggest that C. gattii/C. neoformans species complex should be divided into 2 distinct species, o Cryptococcus neoformans . Cryptococcus neoformans var. grubii (serotype A), . Cryptococcus neoformans var neoformans (serotypes D and AD) o Cryptococcus gattii . Cryptococcus gattii serotypes B . Cryptococcus gattii serotypes C

 Cryptococcosis is a systemic fungal disease that may affect the respiratory tract (especially the nasal cavity), CNS, eyes, and skin.  Cryptococcosis is caused by Cryptococcus neoformans or C gattii.  Cryptococcosis occurs worldwide.  Cryptococcosis route of infection is similar amongst host species, with Cryptococcus spp. acquired from the environment primarily through the inhalation of basidiospores, ingestion of desiccated yeast cells or more rarely,direct cutaneous inoculation.  Cryptococcosis in animals is usually sporadic in occurrence but outbreaks are also documented  Cryptococcosis is not zoonotic, infection does not spread between animals and humans. Both are exposed to the environmental source of infection.  Cryptococcosis symptoms vary depending on the organ systems affected by the fungus. Often, symptoms are systemic and nonspecific, such as diminished appetite, weight loss, or lethargy.  Cryptococcosis occurs in different domestic. o Dogs and cats become infected by inhalation of spores through the nasal cavity, and the infection spreads throughout the respiratory system and often reaches the nervous system. o In horses, sheep, and goats, the lesions are restricted to the respiratory system o In cattle, lesions are usually located in the mammary glands.

 In sheep and goats: the following clinical forms were reported:  Cryptococcal mastitis o Natural mastitis in goats due to Cryptococcus neoformans (Pal and Randhawa, 1976, Abd El-Ghany et al., 1978) o Experimental mastitis in goats due to Cryptococcus neoformans (Singh et al., 1994)  Cryptococcal pneumonia o in goats due to Cryptococcus neoformans (Baro et al., 1998, Gutiérrez and García Marin, 1999, Hassan et al. (2012) o in sheep due to Cryptococcus neoformans Lemos et al., 2007, Hassan et al. (2012) o in goats due to Cryptococcus gattii (Torres-Rodríguez et al., 2006, Alvarado-Ramírez et al., 2008, da Silva et al. , 2017)  Cryptococcal meningitis o in goats due to Cryptococcus gattii (Luvizotto et al., 2009, Maestrale et al., 2015) o in goats due to Cryptococcus neoformans (Stilwell and Pissarra, 2014, Maestrale et al., 2015) o in sheep due to Cryptococcus gattii (Maestrale et al., 2015) o in sheep due to Cryptococcus neoformans (Maestrale et al., 2015)  Cryptococcal abortion o in goat due to Cryptococcus gattii (Villarroe and Maggiulli (2012)

Description of species reported in sheep and goats:

Cryptococcus neoformans (Sanfelice) Vuillemin1901

After 3 days at 25 oC in 3% glucose medium, sediment is present; yeast cells are globose, usually with a single bud, but occasionally some cells may adhere, 4.0–7.0 o 4.0–7.0 lm. Bigger cells measuring up to 9 lm diameter are present, On YMoA, streak colonies are 5–6.5 mm width, smooth, moist to mucoid, shiny, creamish white, with an entire margin; cells are subglobose to globose, 4.0–6.0 lm in diameter, usually with one bud, but occasionally with two buds. On Dalmau plates only yeast cells are present. On MEA colonies measure 8–11 mm, and are pale yellowish beige (pale isabella), and becoming highly mucoid.

C. neoformans capsule images. Top row: negative stain with India ink; quick freeze deep-etch electron micrograph of a portion of the cell wall with capsule fibers extending to the left); thin section electron micrograph of three cells. Bottom row: immunoelectron micrograph of a portion of a cell (capsule fibers extending upwards) stained with gold-conjugated anticapsule antibody; differential interference contrast micrograph of a budding cell; confocal immunofluorescence micrograph with the capsule stained blue and the cell wall stained green.

Views of C. neoformans. A. Colonies grown on medium containing 0.1% L-DOPA to demonstrate melanization. Top, wild type; bottom, laccase mutant. B. Brightfield microscopy. C. Transmission electron microscopy (pseudocolored). D. Mating filaments.

Cryptococcus gattii (Vanbreuseghem & Takashio) Kwon-Chung and Boekhout, 2002 (nomen conservandum, McNeil et al., 2006)

After 3 days at 25 _C in 3% glucose medium, sediment is present; cells are globose, subglobose, ellipsoid, fusoid to ovoid, 4.0–7.0 _ 3.5–6.0 lm, usually with a single bud, but occasionally some cells may adhere. On YMoA, streak colonies are 5.0–6.0 mm width, smooth, moist to mucoid, shiny, creamish white, with an entire margin; cells are broadly ellipsoid, subglobose to globose, 4.0–6.0 lm in diameter. On Dalmau plates only yeast cells present. On MEA colonies measure approximately up to 8 mm, pale yellowish beige (pale isabella), and are highly mucoid.

Reports: Pal and Randhawa (1976) reported caprine mastitis due to Cryptococcus neoformans.

Abd El-Ghany et al. (1978) isolated Cryptococcus neoformans from clinically mastitic sheep. Singh et al. (1994) mentioned that unilateral intramammary inoculation of 10 goats with Cryptococcus neoformans (2 x 10(6) yeast cells) resulted in the development of mastitis, with gross and microscopic lesions being restricted to the infected udder halves only and there was no dissemination of infection to the opposite uninfected udder halves as well as to other organs of the body. The experiment was continued for 40 days, with 2 animals each from the infected and control groups being killed on 5th, 10th, 20th, 30th and 40th day post-inoculation (DPI). Initial enlargement of the infected udder halves was followed by marked decrease in size leading to very small, firm and nodular udder halves. After infection, there was also sharp fall in the milk yield. Cryptococcal organisms were demonstrated in the mastitic milk and udder impression smears with special stains. C. neoformans was reisolated from the milk of the only infected udder halves up to 25th DPI. Microscopically, there was initially acute diffuse purulent mastitis which later on became chronic, characterised by marked infiltration of lymphocytes, macrophages, extensive fibrosis and development of multiple granulomas. The cryptococcal organisms could be demonstrated in the udder sections only up to 30th DPI.

Baro et al. (1998) reported the identification of 13 autochthonous strains of C. neoformans var. gattii in Spain. These strains were isolated from lung (10 samples), liver (1 sample), and brain (2 samples) tissue specimens from six goats suffering from predominantly severe pulmonary disease that were autopsied. The animals were members of five different herds of goats grazing in rural areas of the province of Ca´ceres (Extremadura, Spain). Between 1990 and 1994, there were five outbreaks, in which between 2.5 and 12% of the goats were affected. Although respiratory symptoms (pneumonia) associated with cachexia were the predominant clinical picture in all outbreaks, brain and liver involvement was also documented in three of the five outbreaks. Biotyping was performed by culturing the isolates on L- canavanine-glycine-bromothymol blue medium and testing them for the assimilation

50 of D-proline and D-tryptophan. Serotyping by agglutination tests confirmed the characterization of all strains as C. neoformans var. gattii serotype B. This is the first confirmation of the presence of this variety in Spain, with a peculiar ability to produce severe pulmonary and systemic disease in normal goats, particularly in the form of outbreaks of pneumonia in association with cachexia.

Histopathology of lung tissue from an autopsied goat showing a high number of encapsulated yeast cells inside the alveoli. Hematoxylin-eosin stain. Original magnification, 3400. Baro et al. (1998)

Gutiérrez and García Marin (1999) presented an adult Blanca-Celtibérica doe originating from a goat herd with a high prevalence of tuberculosis with respiratory signs. At necropsy, this goat had a diffuse and severe mycotic pneumonia associated with the presence of Cryptococcus neoformans concomitant with pulmonary focal caseous nodules from which Mycobacterium bovis was isolated. Microscopically, the mycotic lesion was a granulomatous pneumonia with many large foamy macrophages containing intracellular yeast bodies. The extensive mycotic changes, their granulomatous nature, and the lack of positive response to different immunologic tests for mycobacterial infection suggested an impaired immune status in this animal.

Saleh (2005) isolated Cr.neoformans isolates from the vaginal swabs of goats with endometritis at a rate of (5.9%) while, it was not recovered from sheep.

Torres-Rodríguez et al. (2006) reviewed the isolation of C. gattii reported for the first time in Europe in 5 epidemic outbreaks of cryptococcosis in goats grazing freely in west Spain grasslands. In all outbreaks, mycological studies were possible from samples obtained on necropsy of some animals dead during the epidemic. Animals belonged to various milking breeds and were grazing with variable status of health and husbandry. Goats affected by cryptococcosis showed similar respiratory symptoms, consisting in mucopurulent

nasal discharge, cough, dyspnea and progressive cachexia, causing death in a period of 2 to 4 weeks. In three outbreaks many animals also showed ataxia, midriasis, blindness and progressive paralysis. Clinical prevalence varied from 2 to 12% in the different outbreaks. It is evident that in spite of the great amplitude of geographical distribution observed for C. gattii , this species has a limited presence, possibly restricted to determined habitats, as that of infection of goats flocks in Spain.

Lemos et al. (2007) reported the anatomopathology of respiratory cryptococcosis in ovine and the recuperation and identification of Cryptococcus neoformans var. neoformans from 1-year frozen lung tissue sample. The findings from haematoxylin/eosin staining microscopy and special staining showed the destruction of the columnar respiratory epithelium architecture associated to suppuration, and the growth of spherical yeast buddings sometimes involved by clear halo produced by unstained capsular substance. The agent was identified by miniApi ID32C, while variety neoformans was further identified by culture in CGB agar. The diagnosis in stock animal suggests the involvement of an exogenous source of the agent as an alert to public health and contributes for epidemiological investigations. Alvarado-Ramírez et al. (2008) evaluated laccase activity in strains of C. gattii, serotype B isolated from immunocompetent goats that died of lung and disseminated cryptococcosis, in several outbreaks occurring in Spain. The laccase activities of these isolates were compared with those of other strains of C. gattii and C. neoformans. After fungal cell rupture, the supernatant of each isolate was analyzed for its laccase activity using as substrate an L-dopa 20 mM solution. The degree of enzymatic activity was assessed according to its absorbance at 450 nm and scored using Enzymatic Units (EU). The maximum values were observed in three strains of C. gattii from goats (EU > 12). The smallest values were observed in one environmental isolate of C. gattii serotype C (EU = 0.7). The highest recorded value for C. neoformans was 6.3 EU in a serotype A isolate from one human case of meningitis. C. gattii serotype B obtained from goats showed different degrees of laccase activity, being the highest in those isolated from severe outbreaks of cryptococcosis. This enzyme appears to represent a major, though nonexclusive, pathogenic factor for Cryptococcus gattii. Luvizotto et al. (2009) euthanized four-year-old male goat with a history of neurological disorder. It presented uncommon nodules in the brain and lungs associated with multiple abscesses, predominantly in the spleen and liver. Histological examination of brain and lung sections revealed yeast forms confirmed to be Cryptococcus gattiiafter a combination of isolation and polymerase chain reaction (PCR) procedures. Moreover, Corynebacterium pseudotuberculosis infection was diagnosed by PCR of samples from the lung, spleen and liver. The present report highlights the rare concurrent infection of C. gatti and C. pseudotuberculosis in an adult goat from São Paulo state, Brazil, and indicates the necessity of surveillance in the treatment of goats with atypical pulmonary infections associated with neurological disorders. Table 1. Sequences of oligonucleotides employed to characterized the serotype of Cryptococcus neoformans and C. gatti and molecular identification of Corynebacterium pseudotuberculosis, Luvizotto et al. (2009) Reference Description 5' to 3'sequence MVA 009 Cryptococcus gatii (genotype CNa-70-A (59-

(ATCC C) ATTGCGTCCATGTTACGTGGC-39) 24066) CNa-29-S (59- CTCTTGACGTTGGCTCTTTC-39) CNa-70-S (59- MVA 010 Cryptococcus grubii (genotype ATTGCGTCCACCAAGGAGCTC-39) (ATCC A) CNa-70-A (59- 32045) ATTGCGTCCATGTTACGTGGC-39) MVA 011 Cryptococcus (ATCC neoformans (genotype D) CNa-29-S (59- 28958) TCTTGACGTTGGCTCTTTC-39) MVA 012 29-A (59- Cryptococcus neoformans (ATCC CTACTGATGAAAACTCGCTG-39) (genotypes A and D) 48184) Corynebacterium 16S rRNA gene 16S-F MPLD1 pseudotuberculosis ACCGCACTTTAGTGTGTGTG 16S-R TCTCTACGCCGATCTTGTAT rpoB C2700F CGTATGAACATCGGCCAGGT C3130R TCCATTTCGCCGAAGCGCTG Corynebacterium. pld PLD-F MPLD2.1 Pseudotuberculosis ATAAGCGTAAGCAGGGAGCA PLD-R1 ATCAGCGGTGATTGTCTTCC PLD-R2 ATCAGCGGTGATTGTCTTCCAGG

Luvizotto et al. (2009)

Abou-Elmagd et al. (2011) isolated Cryptococcus neoformans from swab samples collected from the digestive tract and vagina of apparently normal sheep and goats in Quena Governorate (Upper Egypt). Saleh et al. (2011) recovered Cryptococcus neoformans from 2 out of 84 goats examined, one from a nasal swab and the other from a vaginal swab sample, while all sheep samples were negative.

Hassan et al. (2012) detected Cr.neoformans in 4% of of nasal discharge of sheep suffered from respiratory disorders. Villarroe and Maggiulli (2012) presented a 5-year-old dairy goat seven weeks post cesarean section for incomplete healing of the incision site. Cytology revealed cryptococcal organisms that were confirmed by the Centers for Disease Control as Cryptococcus gattii type VGIIa. Most cryptococcomas were surgically removed, but some penetrated deep in to the muscular layers and likely into peritoneum. The goat was treated daily with oral fluconazole for 6 months, and had a normal life for almost 2 years.

Incision site infected with Cryptococcus gattii type VGIIa in a 5-year-old LaMancha goat 7 weeks after undergoing a cesarean section. Granulomatous inflammation and a vaseline-like fluid were the most notable characteristics at presentation (month 2) Incision site infected with Cryptococcus gattii type VGIIa in a 5-year- old LaMancha goat 9 weeks after undergoing a cesarean section (month 3). The evolution of the granulomatous

54 inflammation is evident in comparison to 2 weeks prior (Fig. 1). Notice the presence of a strand of catgut suture (marked with an arrow) that was used during the cesarean section (day 0). Villarroe and Maggiulli (2012)

Incision site infected with Cryptococcus gattii type VGIIa in a 5-year-old LaMancha goat during debridement surgery (month 3). Notice the various muscular layers that have been debrided, and the presence of several round cryptococcomas along the incision line, the most evident being the one in the center of the picture (ventral). Intraperitoneal cryptococcomaof Cryptococcus gattii type VGIIa organisms in a La Mancha goat 16 months post- debridement surgery (month 19).Notice the large cryptococcoma(15cmdiameter)embedded in the omentum Villarroe and Maggiulli (2012)

Stilwell and Pissarra (2014) described a case of a five year old buck showing severe neurological signs, including paraplegia and strong pain reaction to touch of the hindquarters region. Treatment with antibiotics was unsuccessful and the animal was euthanized for humanitarian reasons. Postmortem examination revealed lumbar meningitis, lung nodules and caseous lymphadenitis lesions. Encapsulated Cryptococcus neoformans were identified from the lungs and meninges, showing that cryptococcal meningitis should be included in the differential diagnosis of goats showing paresis and hyperesthesia. The possibility of concurrent immunosuppression due to Corynebacterium pseudotuberculosis infection is raised. It was concluded that cryptoccocal meningitis should be included in the differential diagnosis list of goat diseases with ataxia and hyperesthesia.

Neurologic signs - buck showing signs of hind limb paralysis and self mutilation (skin excoriation on abdominal flank) due to hyperaesthesia. Histopathology exam - several round encapsulated microorganisms (yellow arrow) isolated from the lumbar meninges were identified as being Cryptococcus neoformans (HE, ×400) Stilwell and Pissarra (2014)

Maestrale et al. (2015) examined in Sardinia the brain of 555 autochthonous sheep, 50 goats, and 4 mouflons which were found affected by neurological signs. They

55 found 6 goats and one mouflon with meningoencephalitis caused by Cryptococcus sp. There was no evidence of cryptococcal infections in any of the examined sheep. MLST genotyping on Cryptococcus sp. isolates identified Cryptococcus gatti genotype AFLP4/VGI and Cryptococcus neoformans var. neoformans genotype AFLP2/VNIV. Phylogenetically, all Cryptococcus gattii isolates fell within the autochthonous animal, human and environmental Mediterranean isolate cluster, forming a distinct branch along with environmental strains from Alicante, in the southern Mediterranean coast of Spain. da Silva et al. (2017) performed a study aimed to report a case of pulmonary infection by C. gattii molecular type VGII in State of São Paulo, Brazil. A 5-year-old goat showing intermittent dry cough, ruminal tympany, anorexia, fever, tachycardia and tachypnea was presented for necropsy at the Veterinary Hospital of the School of Veterinary Medicine and Animal Sciences, São Paulo University, São Paulo, Brazil. Postmortem examination revealed numerous 2.0-6.0 cm diameter yellow gelatinous pulmonary masses. Tissues were evaluated by a combination of pathological, mycological, and molecular diagnostic techniques. Microscopically, pneumonia granulomatous, multifocal to coalescing, moderate, with many intralesional carminophilic yeasts was observed. The immunohistochemistry and mycological culture confirmed Cryptococcus spp. Internal transcribed spacers and orotidine monophosphate pyrophosphorylase nucleotide differentiation demonstrated that the isolate corresponds to the C. gattii VGII molecular subtype.

Gross lesions of lungs. a The lung was distended and pink with reddish areas and there were multiple nodular areas in right cranial and middle lobes. Bar = 4 cm. b Nodular areas containing yellow-whitish gelatinous content. Bar = 2 cm da Silva et al. (2017)

Lung photomicrography. a Well-circumscribed cavitations areas of granulomatous pneumonia associated pleomorphic, yeast structures with mucinous capsule of variable thickness which show clear and refractile halo (HE stain, bar = 25 μm). b Yeast in details with oval to round, and 5–20 μm in diameter organism‟s structure which capsule (carminophilic) stain in red inside of cavitations areas (cryptococcomas). (Mayer‟s Mucicarmin stain, bar = 50 μm). c Cryptococcal antigen was detected by immunohistochemistry using anti-Cryptococcus polyclonal antibody, 1:50,000 diluted. Positive yeast structures stained in strong brown for Cryptococcus spp. PictureMax Kit™, DAB stain, bar = 25 μm da Silva et al. (2017)

Laboratory diagnosis Samples include spinal fluid, sputum, pus , skin scrapings, urine milk etc. Microscopic examination: positive samples stained with India ink show round cells surrounded by unstained capsules. Cultures on Sabouraud dextrose agar without cycloheximide, incubated at 37oC show creamy moist colonies. Brown coloured colonies are clear on Niger-seed medium. Biochemical identification: C. neoformans does not ferment sugars, assimilates glucose,galactose,sucrose, maltose,trehalose, xylose and inositol and hydrolyses urea. Serology: During infection, capsular material is solubilized in the body, and being an antigen, it can be titrated with a specific rabbit anti-C. neoformans antiserum using latex agglutination test. A positive agglutination is diagnostic for cryptococcosis. This test is very useful in the early infection. Antibodies to C. neoformans are usually not detected at this stage, but later or on recovery, antibodies can be detected using any of the known serological tests, e.g. indirect immunoflourescent technique, haemagglutination inhibition test or ELISA. Molecular characterization: 1. Interspecies and interstrain genotyping by Inter Simple Sequence Repeat (ISSR- RAPD) 2. Nested polymerase chain reaction (nested- PCR) : Different sets of primers were used for the amplification in nested PCR , 2 external primers ( Forward primer 1 and Reverse primer II ) and 2 internal primers ( Forward primer III and Reverse primer IV) , where , the expected size of fragment amplified in all positive samples was 278 bP . 3. The RAPD pattern was used for differentiation between various strains of C. neoformans recovered from different sources using species-specific primers

Direct microscopic examination

Colonies on bird seed agar C. gattii (left) colonies of C. neoformans (right)

Biochemical examination

Biochemical characteristics of the species in the genus Cryptococcus (Kreger-van Rij (1984)

3.3. Malasseziosis in sheep and goats

Malassezia yeasts belong to normal cutaneous or mucosal microbiota of many warm- blooded vertebrates. They are recognized as opportunistic pathogens that play a significant role in the development of different human and animal diseases such as otitis externa or seborrheic dermatitis. endocrinopathies (hypothyroidism, Cushing‟s disease), immunosuppressive diseases and other skin diseases. Malassezia comprises 14 species, of which 13 Malassezia species show an absolute requirement for long fatty acid chains. These “lipid-dependent” yeasts are therefore seldom isolated in the laboratory unless specific nutrients are provided in the medium. The species M. pachydermatis is the only lipophilic yeast that may be isolated in regular media like Sabouraud dextrose agar.

Malassezia pachydermatis (Weidman) C.W. Dodge, Medical mycology. : 370 (1935)

Synonyms: ≡Torulopsis pachydermatis (Weidman) Krassiln. ≡Pityrosporum pachydermatis Weidman, Rep. Lab. Mus. Comp. Path. Zool. Soc. Philad.: 36 (1925) ≡Cryptococcus pachydermatis (Weidman) Nann., Repert sist dei miceti 4: 345 (1934) =Pityrosporum rhinocerosum Sabour. =Pityrosporum canis Gustafson, Otitis externa in the Dog, Stockholm: 46 (1955)

Cultural characteristics

The growth patterns of Malassezia pachydermatis shows poor growth on Blood Agar and DTM after 72 h at 37 oC, but grows well on SDA, YM and modified malt extract agar after 48 h at 37 oC. On the surface of plates two colony forms are observed: (a) white-creamy, matt, smooth, moist colonies, 0.5-1 mm in diameter (35 strains); and (b) dark creamy, dry, fragile (hard to suspend) colonies, 0.2-0.8 mm in diameter. Both types of colonies firmly adhere to the agar surface and assume a dark-brownish colour with age. On BA, a poor growth of pin-point sized colonies is observed after 3-4 days. These colonies are non-haemolytic, but the agar around them shows a dark discolouration. Biochemical characteristics: None of the carbohydrates is fermented. After 48 h glucose is assimilated by all strains, mannitol and sorbitol assimilation is variable. All strains assimilate peptone but none assimilate (NH4)2S04K, N0 3 or ethanol. Urease test on Christensen's agar rapidly gives a positive result, within 24 h at 37 "C. Indole is negative, catalase variable, lecithinase activity on eggyolk positive strong peroxidase activity and negative coagulase (either on a slide or in a tube)

Malassezia pachydermatis, colonies on SDA (left, ww.scienceopen.com) and on Potato dextrose agar (right, www.pf.chiba-u.ac.jp), supplemented with chloramphenical at 25℃ for 14 days

Malassezia pachydermatiswww.pfdb.net (Y. Nishiyam) www.studyblue.com

Malassezia slooffiae E. Guého, J. Guillot & Midgley, Antonie van Leeuwenhoek 69: 351 Colony characteristics of M. furfur, M. japonica, and M. slooffiae on CHROM were observed after incubation at 32°C for 4 days. Colonies of M. furfur were large, pale pink, and wrinkled and did not produce precipitates. Colonies of M. japonica were larger (2 to 5 mm) than those of M. slooffiae (<1 mm). Their sizes were measured in well-isolated single colonies.

Malassezia slooffiae PFDB

J. Clin. Microbiol. November 2007 vol. 45 no. 11 3737-3742

Reports: Pin (2004) presented a 6-year-old female goat with a seborrhoeic dermatosis of 5 months duration. The condition developed following a severe enteritis associated with weight loss. Dermatological examination showed a generalized greasy seborrhoeic dermatosis, which spared the head and extremities of the limbs. Microscopic examination of impression smears of lesional skin revealed numerous yeasts typical of Malassezia sp. Culture on Sabouraud's dextrose agar yielded Malassezia pachydermatis growth. Histopathological examination of haematoxylin/eosin and safranin (HES) stained sections of biopsies showed mild lymphocytic superficial perivascular hyperplastic dermatitis. Numerous budding yeasts were visible both on the surface, and follicular keratin, in HES and periodic acid Schiff (PAS) stained sections. A dramatic response was observed after 1 week of a topical anti-Malassezia treatment, and the resolution of the condition was complete after 4 weeks

View of the trunk of the goat showing a generalized seborrhoeic dermatosis. Pin (2004), Closer view of the trunk showing the greasy seborrhoea, the dull coat and the multifocal alopecia. Pin (2004)

Photomicrograph of an impression smear from lesional skin showing oval-shaped yeasts with unipolar budding and a distinct collarette, typical of Malassezia sp. (×1000, eosin-blue-RAL 555). Pin (2004) Photomicrograph showing a lymphocytic superficial, perivascular, hyperplastic, and spongiotic dermatitis (×63, HES). Pin (2004)

Photomicrograph showing numerous budding yeasts in follicular keratin (×1000, HES). Pin (2004) View of the trunk of the goat, 7 weeks after the diagnosis and treatment, showing normal coat. Pin (2004)

Uzal et al. (2007) euthanized an adult male Pygmy goat with a history of losing hair and declining body condition, and a complete diagnostic work-up was performed. The animal showed diffuse alopecia on the dorsal and lateral sides of thorax and abdomen, proximal legs, neck and face. Histology revealed diffuse orthokeratotic hyperkeratosis, epidermal hyperplasia and perivascular dermatitis. Broad-based budding yeasts and hyphae were visible in the keratin layer. Malassezia slooffiae was identified in the skin by polymerase chain reaction amplification of part of the large subunit rRNA gene using broad-range fungal primers and DNA sequencing. This is the first report of M. slooffiae-associated dermatitis in goats.

Carcass of a goat with Malassezia slooffiae dermatitis showing extensive alopecia and crusts of body and limbs. Uzal et al. (2007). Skin of a goat with Malassezia slooffiae dermatitis. There is severe hyperkeratosis and plugging of hair follicles. Haematoxylin and eosin. Bar 100 µm. Uzal et al. (2007)

Hide Plugged hair follicle of a goat with Malassezia slooffiae dermatitis. There is a large number of hyphae and yeasts. Gomori's methenamine silver. Bar 40 µm. Uzal et al. (2007)Hide Skin scraping of a goat with Malassezia slooffiae dermatitis. Numerous small, oval-shaped yeasts, many with buds arising from a broad base. Periodic-acid Schiff. Bar 20 µm. Uzal et al. (2007)

Phylogenetic relationship of caprine skin amplicon to recognized Malassezia species based on partial sequence of the large subunit rRNA gene. The percentages above the branches indicate bootstrap values (1000 replications) from a neighbour-joining analysis. Tilletiopsis fulvescens(AJ235281) was used as the outgroup. Uzal et al. (2007)

Eguchi-Coe et al. (2011) identified histopathology submissions from 28 goats with dermatological disease in an archival search of pathology files. Microscopic sections of skin biopsy specimens were examined for the presence of Malassezia spp. organisms. Six cases with many Malassezia yeasts were identified histopathologically. Based on the extent of clinical disease, three cases were regarded as localized and three were generalized infections. Clinical findings included alopecia with dry seborrhoea (four cases), greasy seborrhoea (one case), and no clinical findings specific to localized Malassezia infection when concurrent bacterial infection was present (one case). Mild pruritus was reported in two cases of generalized infection. No breed predilection was apparent. Three cases were male and three were female. Malassezia dermatitis occurred in goats from 10 months to 13 years of age. Three of six cases had concurrent bacterial infection. Skin lesions resolved following topical antifungal therapy in the two goats that were treated. Histopathological findings in all cases were severe follicular and epidermal orthokeratotic hyperkeratosis with minimal epithelial change and mild superficial perivascular to interstitial nonsuppurative inflammation. Numerous budding yeasts were visible within the stratum corneum of all cases; however, Malassezia was not isolated in the three cases in which culture was attempted. Based upon these findings, the authors suggested that the diagnosis Malassezia dermatitis in goats is most likely to be made by cytological examination of skin impressions or by examination of skin biopsy samples.

Trunk of a 10-month-old castrated male Toggenburg goat with generalized Malassezia dermatitis (case 1). The goat‟s head is to the right. There is patchy alopecia, especially of the dorsum. Eguchi-Coe et al. (2011) Closer view of affected skin from a 10-month-old castrated male Toggenburg goat with generalized Malassezia dermatitis (case 1). There are numerous scales indicative of dry seborrhoea Eguchi-Coe et al. (2011)

Seborrhoeic skin from a 1-year-old castrated male Alpine goat with generalized Malassezia dermatitis (case 2). The epidermal thickness is normal, but there is severe epidermal and follicular orthokeratotic hyperkeratosis. Numerous basophilic yeasts are visible within the superficial follicular keratin. Haematoxylin and eosin. Scale bar represents 240 μ. Stratum corneum from a 6-year-old castrated male Nubian goat with localized Malassezia dermatitis (case 3). Numerous yeasts that are often budding are present. Yeasts occasionally form short chains, but no hyphae are present. Giemsa. Scale bar represents 30 μm Eguchi-Coe et al. (2011)

Zia et al. (2015) performed a study aimed at detection and species-level identification of the Malassezia yeasts in domestic animals and aquatic birds by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Samples were collected using tape strips and swabs from 471 animals including 97 horses, 102 cattle, 105 sheep, 20 camels, 60 dogs, 30 cats, 1 hamster, 1 squirrel, 50 aquatic birds and 5 turkeys. Tape-strip samples were examined by direct microscopy. All samples were inoculated on modified Leeming and Notman agar medium. DNA extracted from the yeast colonies was amplified by PCR using primers specific for 26S rDNA. Malassezia yeasts were detected at the following frequencies: 15.46% in horses, 12.74% in cattle, 12.38% in sheep, 28.33% in dogs, 26.66% in cats and 26% in aquatic birds. Eighty colonies of 6 species were identified as Malassezia globosa 41.25%, M. furfur 22.5%, M. restricta 15%, M.sympodialis 15%, M/ pachydermatis 5% and M/ slooffiae 1.25%.

Electrophoresis of PCR-amplification products. As can be seen, all samples yielded a single band of approximately 580 bp. 1: Negative control; 2, 3: M. globosa; 4: M. restricta; 5: Mixture of M. globosa and M. sympodialis; 6: M. furfur; 7: M. sympodialis; 8: M. restricta; 9: Molecular marker No. 9 Zia et al. (2015)

Electrophoresis of PCR-RFLP products after restriction digestion of the products with Hin6I. 1: Molecular marker No. 9; 2, 3: M. globosa; 4: M. restricta, 5: Mixture of M. globosa and M. sympodialis; 6: M. furfur; 7: M. pachydermatis; 8: M. restricta

Laboratory diagnosis: Direct microscopic examination O Cotton swab smears, skin scrapings, direct impression smears, and acetate tape impressions are all routinely used to identify M. pachydermatis cytologically. Smears are fixed then stained with a modified Wright‟s stain or ink O The tape is not fixed, stained with a modified Wright‟s stain or ink

O The stained tape is then applied to a glass slide with the adhesive side down. O The slide is examined under oil immersion, looking for unipolar budding yeast that are described as peanut-, footprint-, or bottle-shaped organisms

Histopathologic examination O histopathologic examination has a low sensitivity in detecting Malassezia species, because the yeast are removed from the skin surface during processing. O histopathology may sometimes show the yeasts on the surface of the epidermis and in the infundibula, particularly in PAS stained sections (although they are occasionally visible on HE stained sections).

Isolation on Sabouroud Dextrose Agar, with and without lipid supplementation O Colonies are sub-cultured in modified Dixon‟s agar for identification at the species level. O The morphological identification criteria used to identify Malassezia spp. are the cell shape, size, and the budding pattern. o Lipid-dependent species are identified by the Tween assimilation method (i.e. 20, 40, 60, 80). O Catalase reaction, tryptophan, cremophor assimilation tests and esculin splitting were used as additional tests to differentiate the species.

Molecular diagnosis Polymerase chain reaction (PCR) and restriction endonuclease analyses (REA) which usually involve amplification and subsequent restriction of portions of the highly variable ribosomal RNA gene are potentially applicable for routine laboratory use  Specific molecular methods have also been developed for the identification of Malassezia isolates, such as o pulsed-field gel electrophoresis (PFGE), o random amplification of polymorphic DNA (RAPD), o DNA sequence analysis, o restriction analysis of PCR amplicons of ribosomal sequences, o amplified fragment length polymorphism (AFLP), o denaturing gradient gel electrophoresis (DGGE), and o terminal fragment length polymorphism (tFLP)

3.4. Rhodotorulosis in sheep

 Rhodotorula is a common environmental yeast that is found in air, soil, lakes, ocean water, milk, and fruit juice.  Rhodotorula species, part of the Basidiomycota phylum, colonise plants, humans, and other mammals.  The genus Rhodotorula includes eight species, of which R. mucilaginosa, R. glutinis, and R. minuta were reported to cause mastitis in ruminants  Rhodotorula produces pink to red colonies and blastoconidia that are unicellular lacking pseudohyphae and hyphae  Rhodotorula spp. have been recognised as emerging yeast pathogens in humans in the last two decades. While no cases of Rhodotorula infection were reported in the medical literature before 1985, the number of infections increased after that time, most likely because of the wider use of intensive treatments and central venous catheters

 R. mucilaginosa is commonly isolated from foods and beverages. Several studies have reported the presence of R. mucilaginosa in peanuts, apple cider, cherries, fresh fruits, fruit juice, cheese, sausages, edible molluscs, and crustaceans.  Among the few references about the pathogenicity of Rhodotorula spp. in animals, there are o several reports of an outbreak of skin infections in chickens and a report of a lung infection in sheep, both caused by R. mucilaginosa o Rhodotorula was reported as the causative agent of epididymitis, skin lesions in a sea lion, and dermatitis in a cat that had crusted lesions and mastitis o Duarte et al. have shown the presence of fungi in the ear canal of 45 cattle with external parasitic otitis. The 45 cultures in Sabouraud dextrose medium revealed the growth of the genus Malassezia in 31 (68.9%) of the 45 cultures, seven (15.5%) yeasts of the genus Candida, five (11.1%) R. mucilaginosa, and two (4.4%) fungi of the genus Aspergillus. o Some authors have reported the Rhodotorula genus as a colonising agent in the oropharynx and cloaca of ostriches, in faecal samples and the cloaca of wild birds and pigeons in urban and suburban areas, in the ear canals of adult cattle with parasitic otitis, in healthy rhesus monkeys, genital tract of healthy female camels, and in healthy cats

Rhodotorula mucilaginosa (A. Jörg.) F.C. Harrison, Transactions of the Royal Society of Canada 22: 191 (1928)

Synonyms: =Torula mucilaginosa A. Jörg., Mikroorg. Gärungsind., ed. 5: 402 (1909) =Torulopsis mucilaginosa (A. Jörg.) Cif. & Redaelli, Crittogamico di Pavia 2: 256 (1926) =Saccharomyces ruber Demme, Ann. Microgr.: 555 (1889)

=Cryptococcus mena Fontoyn. & H. Boucher, Ann. Dermatol. Syph.: 213 (1923) =Blastodendrion carbonei Cif. & Redaelli, Crittogamico di Pavia 2: 147 (1926) =Eutorulopsis dubia Cif. & Redaelli, Atti Crittogamico di Pavia 2: 213 (1926) =Mycotorula pulmonalis Cif. & Redaelli, Crittogamico di Pavia 2: 209 (1926) =Cryptococcus pararoseus Castell., Archives of Dermatology and Syphilology 16 (4): 383-425 (1927) =Rhodotorula rubra var. curvata Lodder, Afdeling Natuurkunde 32: 82 (1934 =Rhodotorula rubra var. longa Lodder, Afdeling Natuurkunde 32: 77 (1934)

Morphology:

Colony;-5% malt extract agar: (after 3 days) ovoid to spherical, 2-8 x 2-12 um, reproduction by multilateral budding, singly, pairs, short chains, small clusters, pink color rings. -Malt extract agar: (after 1 month) orange to pink to coral colored colonies. Cross section is flat, surface varies from smooth to rugoid and dull to glistening. Margin is entire -Cornmeal agar: (after 1 month) pseudomycelium is absent or rudimentary, chains of elgate cells-Subouraud dextrose agar: orange-pink, smooth-rugoid, dull-glistening, usually pigmented (pinkish) color. Reproduction: Cell: reproduces by budding; Spherical to elongate, simple pseudohyphae may be formed by some cells, no sexual cycles, no blallistoconidia. Liquid Growth: moderate pink ring may form.

Physiological Traits: Fermentation: absent. Assimilation: Glucose, Ribose, D-Xylose, Arabinose, Sucrose, Trehalose, Raffinose, Xylitol, Succintate; variable use of: Galactose, Sorbose, Arabinose, Rhamnose, Maltose, Cellobiose, Salicin, Arbutin, Mlezitiose, Citrate, Lactate, Gluconate, Galactitol, Mannitol, Glucitol, Arabinitol, Glycerol, Ethanol; variable assimilation of nitrate and nitrite; uses tryptophan as sole N source; variable use of ethylamine, lysine and cadaverine as sole N source; No growth in vitamin-free medium, requires thiamin. Growth 35, 37 C: variable. Growth Sensitivities: variable for growth on cycloheximide, high NaCl and high glucose. Chromosome bands: 10 reported. Obligate aerobic yeast that contains a high concentration of carotenoid pigment. Urease positive

Rhodotorula mucilaginosa colonies commons.wikimedia.org

Report:

Monga and Garg (1980) reported a case of pulmonary infection due to Rhodotorula rubra in a sheep based upon isolation and histopathological demonstration of the fungus is described. A local, non-descript, 4 years ewe died suddenly after showing signs of respiratory distress on a Government Sheep Breeding Farm. The post mortem examination revealed the presence of some casmus suppurative nodules in lungs and liver, other organs appeared normal. These lesions were collected for cultural and histopathological examinations. Lung and Lver pieces showing lesions were cultured aerobically on 10 % sheep blood agar plates and Sabouraud dextrose agar slants. Haemotoxilin-Eosin (HE) and Gomori-Methenamine Silver (GMS) stained lung and liver sections were examined for histopathological lesions and fungal cells, respectively. Purified colonies were examined for their morphological, cultural and biochemical characters. The assimilation tests of various carbon compounds were performed as per technique of Beijerinck (Hunter and Cooper 1974). Identification of the isolate was done according to “Key to the species of the genus Rhodotorwla” suggested by Phaff and Ahearn (Lodder, 1970).

A section of the sheep's lung, stained with Gomori Methenamine Silver technique showing Rhodotorula yeast cells in the alveoli. X 430. Monga and Garg (1980)

4. Diseases caused by moulds 4.1. Aspergillosis in sheep and goats

The genus Aspergillus includes over 185 species. Around 20 species have so far been reported as causative agents of opportunistic infections in man and animals. Among these, Aspergillus fumigatus is the most commonly isolated species. Naturally or experimentally induced aspergillosis in sheep and goats were:

 Mycotic abortion o induced experimentallv in sheep, by Aspergillus fumigatus spores (Cysewski and Pier. 1968: Pier, Cvsewski and Richard, 1972, Day and Corbel, 1974, El-Naggar et al, 1997) o induced experimentallv in goats by Aspergillus fumigatus (Mandal and Gupta,1994)  Mycotic pneumonia o reported in lambs (Fragner et al., 1970, Young, 1970, Rehbinder , 1977) o induced experimentally in goats by intratracheal inoculation with Aspergillus fumigatus spores (Mandal and Gupta, 1993)  Mycotic mastitis o reported in ewes by Aspergillus species (Garcia et al., 2004) o reported in goats by Aspergillus fumigatus (Jensen et al.,1996, Pérez et al., 1998 and 1999) o reported in goats by zygomycetes (Jensen et al.,1996) o induced experimentally in ewes by Aspergillus fumigatus (Las Heras et al., 2000) o induced experimentally in goats by Aspergillus fumigatus (Mandal and Gupta,1993)  Chronic and granulomatous aspergillosis of the lower jaw reported in goat by Aspergillus spp. (Tontis, 1993)  Systemic aspergillosis reported in ewes (Chihaya et al., 1980, Pérez et al. , 1999)  Nasal and cutaneous aspergillosis reported in goat. Aspergillus niger (do Carmo et al, 2015) Aetiology

Aspergillus fumigatus was the main species isolated from sheep and goats and rarely other species such as A. niger

Aspergillus fumigatus Fresenius, 1863.

Description Colony diam (7 d): CYA25: 21-67 mm; MEA25: 25-69 mm; YES25: 48-74 mm; OA25: 34-62 mm, CYA37: 60-75 mm, CREA: poor growth, no or very weak acid production. Colour: greyish turquoise or dark turquoise to dark green to dull green. Reverse colour (CYA): creamy, yellow to orange. Colony texture: velutinous, st. floccose. Conidial head: columnar. Conidiation: abundant, rarely less abundant. Stipe:

50-350 × 3.5-10 μm. Vesicle diam, shape: 10-26 μm, pyriform to subclavate, sometimes subglobose, but rarely globose. Conidia length, shape, surface texture: 2- 3.5(-6) μm, globose to ellipsoidal, smooth to finely rough

Reports: Cysewski and Pier (1968) described pathologic changes in mycotic abortion in ewes produced by Aspergillus fumigatus Fragner et al. (1970) reported bronchopulmonary aspergillosis in lambs. Young (1970) reported pulmonary aspergillosis in lambs. Pier et al. (1972) reported mycotic abortion in ewes produced by Aspergillus fumigatus experimentally by intravascular and intrauterine inoculation. Day and Corbel (1974) observed no significant changes in relation to infection in the haemoglobin concentration, erythrocyte sedimentation rate, packed cell volume, mean corpuscular haemoglobin concentration or erythrocyte morphology of sheep inoculated with Aspergillus fumigatus spores. There was little evidence of changes in total leucocyte count in most sheep in the first few weeks following inoculation, although those animals receiving larger inocula showed signs of an increasing leucocytosis at the terminal phase of gestation. This increase was even more pronounced at the time of lambing or abortion. Compared with uninoculated pregnant controls, the mean relative neutrophil counts of the inoculated sheep tended to increase during the later stages of gestation and showed highly significant increases at the time of lambing or abortion. Both total leucocyte and relative neutrophil counts

72 were significantly higher in those sheep showing signs of placental infection than in those inoculated animals with no evidence of placentitis. There was some evidence of a relationship between the dose of A. fumigatus conidia inoculated and the severity of infection as indicated by the number of animals aborting, extent of placental involvement and reduction in mean gestation period. Irrespective of inoculum size, only a proportion of inoculated animals developed detectable placentitis. Rehbinder (1977) described a case of mycotic granulomatous pneumonia due to Aspergillus sp. The route of infection was discussed. Chihaya et al. (1980) described an ovine case of generalized aspergillosis with alimentary lesions. Mandal and Gupta (1993a) induced characteristic gross and microscopic lesions via intratracheal inoculation of goats with Aspergillus fumigatus spores. The lesions were restricted to lungs and there was no dissemination of infection to other tissues of the body except liver in one goat 16 days after infection. The experiment was continued for 37 days. Gross changes in lungs were observed up to the 24th day postinfection. The lesions, in general, included congestion and oedema in the first 6 days followed by the development of varying greyish-white nodules in the lungs. Microscopic changes consisted of granulomatous reaction with well developed granulomas in lungs. Hyphae and conidiophores with fruiting bodies of Aspergillus fumigatus could be demonstrated in sections up to 24 days of infection. Reisolation of the fungus consistently was achieved up to 24 days. It was concluded that intratracheal inoculation of Aspergillus fumigatus spores in goats leads to pulmonary aspergillosis up to 24 days. Mandal and Gupta (1993b) inoculated Aspergillus fumigatus spores in 31 (including ten lactating) healthy goats divided into 3 groups viz. intravenous (I/V), intratracheal (I/T) and intramammary (I/M). Two animals were kept as control for each group. Clinical aspergillosis developed and was more severe and fatal in consequence in I/V group than those of other groups. Respiratory symptoms appeared and persisted in both I/V and I/T groups. Acute mastitis developed in the right infected udder halves only with a brief and transitory illness in all goats of I/M group and marked discrepancy in size between right inoculated and left uninfected udder halves was observed. Haematological examination revealed significant decrease of haemoglobin concentration and significant increase in both TLC and DLC (neutrophilia) in I/V group but no marked haematological change was observed in I/T and I/M groups. Mycological isolation in pure culture, demonstration of fungus in the impression smears by lactophenol cotton blue staining and in histological sections by PAS and GSM methods were achieved in the lungs, kidneys, heart, liver, spleen and abomasum in I/V group, in the lungs and occasionally in the mediastinal lymph node and liver in I/T group and in the right infected udder halves and their milk/secretions in I/M group. Tontis (1993) described a case of chronic and granulomatous proliferation in the lower jaw of a six-year-old female Saanen goat due to Aspergillae spp. Within the granulomatous lesion, foreign body and Langhans type giant cells were present in addition to the common granuloma components, such as lymphocytes, epithelioid cells and fibroblasts. Hyphae with a configuration typical of Aspergillae spp. could be demonstrated within the lesions by the use of special stains. The prognosis of this disease in the advanced stage is poor.

Mandal and Gupta (1994) performed an intramammary inoculation of goats with Aspergillus fumigatus spores which resulted in the development of mastitis with characteristic gross and microscopic lesions. The mastitis and the lesions were restricted to the infected udder halves only and there was no dissemination of infection to other tissues of the body. The experiment was continued for 45 days. Gross changes in the infected udder were observed up to the 45th day post-infection. The lesions, in general, included variable sized abscesses in the first 15 days followed by development of varying sized greyish-white nodules in the infected udders. Microscopic changes consisted of granulomatous reaction with well developed granulomas in the infected udders. Hyphae and spores of Aspergillus fumigatus could be demonstrated in sections of the infected udders up to 45 days after infection. Reisolation of the fungus consistently was achieved up to 45 days. It is concluded that intramammary inoculation of Aspergillus fumigatus spores in goats leads to chronic granulomatous mastitis. Jensen et al. (1996) reported mycotic mastitis in 27 out of 73 goats on a dairy farm, in the post-partum period. Purulent mammary secretion, progressive induration of the affected glands, slight fever and weight loss were observed. As treatment produced no improvement within 2-3 weeks, all diseased animals were slaughtered. At postmortem examination, widespread acute and chronic mycotic lesions were seen throughout the affected glands. Infection was thought to have spread through the milk ducts as an ascending infection resulting from prophylactic intramammary treatment with antibiotic before parturition. In all lesions, aspergillus hyphae were identified by indirect immunofluorescent labelling, which gave a strong and uniform reaction with polyclonal and monoclonal antibodies to Aspergillus fumigatus. In a single granulomatous lesion, zygomycotic hyphae were also identified immunohistochemically. At terminal swellings of aspergillus hyphae, "yeast-like bodies" were produced, a phenomenon which seems to be associated with special, but unknown, circumstances. El-Naggar et al. (1997) induced mycotic abortion experimentally in pregnant ewes. Twelve animals were inoculated i.v. with 10 ml of Aspergillus fumigatus spore suspension containining 2x107 viable spores and 4 pregnant animals were kept as control. All experimental animals aborted between 20-30 and 19-29 days postinfection in ewes and goats, respectively. Uteri, maternal and foetal placenta and foetal tissues showed thrombosis, extensive necrosis, infarctions and invasion with Aspergillus fumigatus hyaphae. Skin lesions of aborted foeti were detected. Mycotic granulomatous inflammation was recorded in the lungs, brains, spleens and kidnyes.

AF-1, which reacts specifically with Aspergillus hyphae, identified the causative agent in histologic sections of the different affected tissues. The etiologic diagnosis was further supported by the isolation of Aspergillus fumigatus in pure culture from affected tissues and from eight samples of mammary secretions. Pérez et al. (1999) described two cases of systemic aspergillosis in dairy sheep from a flock in which fungal mastitis appeared subsequent to the antibiotic treatment of animals before parturition. Lesions characterized by necrosis and a pyogranulomatous exudate were observed in the mammary glands, supramammary and mediastinal lymph nodes, kidneys, lung, liver, heart, fore-stomachs and brain. The intense vasculitis with thrombosis observed in various organs, but especially in the mammary glands, suggested a haematogenous dissemination of the infection from this organ. The aetiological diagnosis was accomplished by the immunohistochemical staining of the fungal structures seen in the histological sections by the specific Aspergillus monoclonal antibody Mab-WF-AF-1 together with the isolation of Aspergillus fumigatus in pure culture from affected tissues. Las Heras et al. (2000) carried out an Intramammary Aspergillus fumigatus infection in dairy ewes associated with antibiotic dry therapy Garcia et al. (2004) compared three techniques for the diagnosis of mammary aspergillosis in ewes: indirect ELISA to detect the level of anti-Aspergillus IgG in serum, determination of galactomannan (Platelia procedure), and detection of DNA of Aspergillus in serum by a nested PCR. Twenty sera from proven cases of aspergillosis in ewes were positive using ELISA (100%), 80% were positive using PCR, but only 55% were positive using Platelia. All 20 control sera were negative using ELISA and PCR, whereas using Platelia methodology one was positive and the other doubtful. The detection of antibody by ELISA in sera is therefore a reliable criterion for the diagnosis of mammary aspergillosis in ewes. Platelia showed the same deficiencies reported in humans, with the appearance of false positives and negatives. The use of PCR was promising and might have valuable application in human medicine. Dehkordi et al. (2012) performed a study for detection of Aspergillus species (A. fumigatus, A. flavus, A. niger and A. terreus) in aborted bovine, ovine, caprine and camel foeti by real-time PCR in Iran. After modification of real-time PCR on abomasal contents, from the total number of 970 samples, 141 (14.53%) gave positive results for Aspergillus species. Of them, 62 (17.71%), 33 (14.04%), 27 (12.05%) and 19 (11.8%) positive specimens were detected in bovine, ovine, caprine and camel foetuses respectively. Statistical analysis showed significant differences between bovine and camel and bovine and caprine aborted foetuses. Aspergillus abortion was the most prevalent in cattle whereas camels tended to be the most resistant. This study was the first report of direct identification of Aspergillus species by real-time PCR in aborted bovine, ovine, caprine foetuses in Iran and camel foetuses in the world. do Carmo et al. (2015) reported nasal and cutaneous aspergillosis in an adult goat. The clinical signs were severe respiratory distress due to partial nasal obstruction, bilateral mucopurulent nasal discharge, skin nodules on the ears and dorsal nasal region and focal depigmentation of the ventral commissure of the right nostril. At necropsy examination, sagittal sectioning of the head revealed a yellow irregular mass extending from the nasal vestibule to the frontal portion of the nasal cavity. Microscopically, there was pyogranulomatous rhinitis and dermatitis, with numerous

75 intralesional periodic acid-Schiff-positive fungal hyphae morphologically suggestive of Aspergillus spp. Aspergillus niger was isolated by microbiological examination.

Diagnosis:

Serology. Tests that can detect serum antibodies against Aspergillus species include Agar gel immunodiffusion (AGID), complement fixation, and ELISA techniques.

Histopathology. e direct evidence of fungal hyphae

lymphocytes and plasma cells. Aspergillus species in urine, blood, synovial fluid, lymph node, bone or intervertebral disk material etc.

Isolation of fungi.

Most Aspergillus sp. grow relatively rapidly (typically within 48 hr) and on most microbiological media including both mycological media such as Sabouraud‟s agar and blood agars used for general bacteriological culture. Identification of cultures of most species Aspergillus is generally straightforward by colony and microscopic morphology.

Molecuar identification of aspergilli

Sequencing of genes, such as actin, calmodulin, ITS, rodlet A (rodA) and/or β-tubulin (βtub), has been used to distinguish A. fumigatus from related species. Multilocus sequence typing can alternatively be used for the identification of those related species, which is a strategy that also involves sequencing of several gene fragments. A few other techniques, such as random amplified polymorphic DNA, restriction fragment length polymorphisms and a new proposed microsphere-based Luminex assay, may enable molecular identification of A. fumigatus without sequencing

4.2. Facial eczema in sheep and goats

(pithomycotoxicosis, photodermatitis)

 Facial eczema (pithomycotoxicosis) has been known in New Zealand for over 100 years  Facial eczema is a seasonal hepatogenous photosensitisation of ruminants grazing pasture in which there has been accelerated sporulation of Pithomyces chartarum  Facial eczema is caused by sporidesmin, a toxin produced by Pithomyces chartarum, growing on litter at the base of pasture and sporing profusely under warm moist conditions in late summer and autumn, which was found only 50 years ago.  Facial eczema outbreaks have been most severe in New Zealand  Facial eczema has been reported from an increasing number of countries with warm temperate climates in which ruminants are intensively grazed on pasture.  Sporidesmin, when eaten by sheep, cattle, goats or deer, causes liver injury with inflammation and blockage of bile ducts.  Phylloerythrin, a photodynamic breakdown product of chlorophyll, is no longer excreted but circulates in the blood, causing lesions of unpigmented skin when the affected animal is exposed to sunlight.  Lesions appear at least a week after sporidesmin has been ingested  Control of facial eczema in the field by o avoiding toxic pasture, detected by P. chartarum spore counts on herbage, o reducing P. chartarum pasture populations by spray application of substituted thiabendazole fungicides, o protecting animals with oral doses of zinc at close to toxic levels.  Sheep vary widely in their sensitivity to sporidesmin, either under field conditions in facial eczema outbreaks or when dosed orally with sporidesmin, and breeding resistant animals by selection after sporidesmin challenge is the best long-term control method at present.

Taxonomy and morphology  Pithomyces chartarum was originally described as o Sporidesmium chartarum Berk. & Curt. 1874, then as o Sporidesmium echinulatum Speg. 1879, as o Sporidesmium bakeri Syd. 1914, as o Scheleobrachea echinulata (Speg.) Hughes 1958 and as o Piricauda chartarum (Berk. & Curt.) R.T. Moore 1959.  Ellis( 1960) redefined the genus Pithomyces Berk. & Curt, and brought into it species characterised by rough (verruculose to echinulate), usually muriform (with both longitudinal and transverse septa), conidia (spores) borne singly on simple conidiophores which fractured, liberating mature spores with a characteristic frill at the spore base, the remains of the conidiophore.  Pithomyces chartarum was characterised by hand grenade shaped spores with longitudinal septa and usually three transverse septa, 18 × 29 × 10-17µm

Signs in Sheep  The first signs in sheep are drooping ears and swollen eyes, so the sheep may be effectively blind.  Affected sheep shake their heads and rub their eyes on fence posts and gates, which causes sores and bleeding.  Sheep are desperate to find shade and are loathe to come out to eat or drink.  Their lesions are often attacked by blowflies.  Badly affected sheep stop eating and often die very quickly.  On post-mortem they have abnormal hard misshapen livers and jaundiced fat.

A sheep showing clinical symptoms of facial eczema Wikipedia , Ovine Facial Eczema? | The Collie Farm

Sheep gall bladder punctured to show bile and healthy bile duct entering the liver tissue, Sheep's liver cut through centre Dr Clive Dalton

The genus Pithomyces The genus Pithomyces contains 15 species commonly found on litter and soil, however, one species, Pithomyces chartarum is often involved with facial eczema of sheep.

Pithomyces chartarum (Berk. & M.A. Curtis) M.B. Ellis (1960)

Synonyms: Sporidesmium chartarum Berk. & M.A. Curtis (1874) Piricauda chartarum (Berk. & M.A. Curtis) R.T. Moore (1959) Sporidesmium bakeri Syd. & P. Syd. (1914)

Colonies are fast growing, dark grey to black, suede-like to downy and produce darkly pigmented, multicellular conidia (phragmo- or dictyoconidia) formed on small peg-like branches of the vegetative hyphae. Conidia are broadly elliptical, pyriform, oblong, and commonly echinulate or verrucose. Spores (conidia) produced at the apex of short side branches of the vegetative filaments, dark brown, 2- to several-celled. When the spores are released they retain a small portion of the cell that produced them. The spores of P. chartarum, the most commonly isolated species, have both longitudinal and transverse walls.

Reports:

Mortimer and Stanbridge (1968) detected sporidesmin in bile within 10 minutes of oral administration. It reached a maximum level of approximately 20 μg./ml. over the period 2 to 8 hours after administration and had been largely excreted at 24 hours. It was also detected and assayed in urine, where maximum levels of 2 to 4 μg./ml. were reached 12 hours after administration. Maximum levels of 0·2 to 0·4 μg./ml. were found in serum from 0·25 to 12 hours after administration. From these levels it was calculated that there is a tenfold concentration of toxin in its excretion from serum to urine and a hundredfold concentration in its excretion from serum to bile. These relative concentrations of this highly cytotoxic s substance in bile and urine would account for the localisation of severe lesions to the biliary system and for less severe lesions in the lower urinary tract. They were unable to detect sporidesmin or a toxic metabolite in milk of dosed animals.

Marasas et al. (1972) reported facial eczema in sheep in South Africa for the first time. Smith and Embling (1991) fed groups of six goats orally with sporidesmin at rates of 0.3, 0.6, 1.2 and 2.4 mg of sporidesmin per kg body weight and their responses up to 6 weeks later were compared with those of sheep dosed at the same time. Clinical facial eczema and pathological lesions similar to those found in sheep were found in all the goat breeds, but at higher dose rates of sporidesmin than those which caused equivalent lesions in sheep. Saanens were the most susceptible goat breed, requiring 2-4 times as much sporidesmin as sheep to achieve similar effects. G4 and feral goats required 4-8 times the sheep dose of sporidesmin to obtain similar responses. Gamma-glutamyltransferase reached its highest serum levels after 20 days

79 while glutamate dehydrogenase and aspartate aminotransferase reached their highest levels between 10 and 20 days. Alkaline phosphatase did not rise consistently to high levels in affected goats. The elevation in aspartate aminotransferase levels tended to be early and transient; glutamate dehydrogenase early and prolonged; gamma- glutamyltransferase late and prolonged, and alkaline phosphatase late and minor. There was considerable individual variation in the time at which elevations occurred and the levels which enzymes reached. Cholesterol and bilirubin levels were high if liver injury was severe.

Facial eczema in goats, Dr Clive Dalton

Smith (2000) conducted 2 experiments. In Experiment A, sporidesmin-A was administered orally to groups of 16 sheep at daily dose rates of approximately 0.0042, 0.0083 and 0.0167 mg/kg bodyweight for 48 days. In Experiment B, the highest of these doses was administered orally for 3, 6, 12, 24 or 48 consecutive days. Parameters of production, clinical findings, organ weights and pathological findings were recorded. In Experiment A, severe liver lesions and photosensitisation were evident as early as 18 days after commencement of daily low-dose administration of sporidesmin, and were associated with significant bodyweight loss. Significant bodyweight loss also occurred in non-photosensitised sporidesmin-treated sheep. Bodyweight reductions were associated with reduced carcass weights and skin weights in treated animals. Sporidesmin administration was also associated with reduced bodyweight gains and pathological changes of the liver, kidney, hepatic lymph nodes, thymus, adrenal gland, heart and spleen. In Experiment B, only moderate changes occurred in a few sheep in the groups dosed with sporidesmin at 0.0167 mg/kg for 3 or 6 days, but major changes were frequently recorded in animals dosed at this rate for 12 days or longer. These comprised changes in the liver and other organs, and photosensitisation typical of the disease, facial eczema. Results are discussed in relation to animal welfare and economic issues associated with this disease. It was concluded that sporidesmin caused significant clinical and sub-clinical disease and reduced animal production at relatively low daily dose rates. The effects of repeated daily low-dose administration of sporidesmin appear to be cumulative.

There was considerable variation in susceptibility between individual animals. These results emphasise the considerable production losses and animal welfare effects associated with sporidesmin toxicity in sheep. Pinto et al. (2005) mentioned that outbreaks of pithomycotoxicosis (facial eczema), a hepatogenous photosensitisation caused by the mycotoxin sporidesmin, have affected ruminants in the Azores Islands of Portugal after warm, humid periods during late summer and autumn. Twenty-two outbreaks were recorded in cattle between 1999 and 2001, affecting 11.4 per cent of the animals in the affected herds, and in 2000 there was an outbreak in one sheep flock in which more than 20 per cent of the sheep died. The clinical signs included decreases in milk production, weight loss, photosensitisation and its sequelae, including death. The animals had high activities of gamma glutamyltransferase in their serum, and icterus and severe liver disease, including biliary hyperplasia and fibrosis, were found postmortem. The characteristic spores of the toxigenic saprophytic fungus Pithomyces chartarum were found on grass; all 381 isolates of the fungus were toxigenic for sporidesmin by elisa, and the results were confirmed by high-performance liquid chromatography analysis. Cattle from farms at greatest risk of pithomycotoxicosis were protected by supplementing their concentrate feed with zinc oxide, or using a slow-release intraruminal zinc bolus. van Wuijckhuise et al. (2006) mentioned that between mid September and the beginning of November 2005, the Animal Health Service (AHS) received thirteen reports of farms on which several animals showed severe symptoms of solar eczema. Blood chemistry showed very high levels of GOT/AST and GGT indicative of severe liver damage. Farm visits to eight farms showed that the animals--previous to the start of the symptoms--had been grazing 24 hours/day and received no additional feed. Ingestion of poisonous plants or medications was considered unlikely to have caused the liver damage, and liver fluke infections were present on only two farms. Microscopic examination of specimens of grass revealed the presence of spores of Pithomyces chartarum in samples taken from six of nine farms. This fungus produces the mycotoxin sporidesmin, which causes severe liver damage and pithomycotoxicosis (facial eczema). This article is the first to describe Pithomyces chartarum in cattle in mainland Europe.

Ozmen et al. (2008) diagnosed 22 sheep from 5 different flocks consisting of approximately 150-200 animals each with facial eczema in September 2005, in southwest Turkey. Photophobia, corneal opacity, severe ulcers of the facial skin, especially localized around the eyes and mouth, and 3% mortality were the most prominent clinical symptoms. GGT levels of the animals were very high and varying between 261- 328 U/l. While the activities of ALT and total bilirubin were elevated and AST was normal in affected sheep. Total bilirubin level was higher than normal. Seven of the 22 sheep were euthanatized and necropsy was performed on all of these animals. Severe icterus, hepatomegaly, enlarged gallbladder, congestion of mesenteric vessels were the common necropsy findings. Histopathological changes of the liver included necrosis of the hepatocytes, cholangiohepatitis characterized by mononuclear inflammatory cell infiltrate in the portal area and mild to severe fibrosis around bile ducts. A diagnosis of sporidesmin toxicosis was made based on the histopathology of the livers, the elevation in liver enzymes, and the development of cutaneous lesions consistent with photosensitization and high spore counts in the ruminal contents. Surviving sheep were treated with procaine penicillin +

81 dihidrostreptomycin sulfate, multivitamin complexes and flunixin meglumine. Additionally, zinc sulphate was also given at a dose of 6 gr per 100 lt drinking water for 28 days. All treated sheep recovered. Pasture spore counts were between 96,300- 267,500 spores/g grass.

Characteristic skin lesions in a sheep suffering from facial eczema, case 4. Another acutely affected sheep, case 5, severe oedema and ulcers on the face skin Ozmen et al. (2008)

Abdominal visceral organs, case 2, severe icterus, severely affected liver and swollen gallbladder. Liver, sheep, case 2, cholangiohepatitis characterised by mononuclear inflammatory cell infiltration, HE, Bar = 200 μm Ozmen et al. (2008)

sheep, case 2, necrosis at the hepatocytes and fibrous tissue proliferation; HE, Bar = 50 μm A sheep recovered from facial eczema, case 19, 15th days after starting the treatment Ozmen et al. (2008)

4.3. Pythiosis in sheep and goats

 Pythium is a genus of parasitic oomycotes that includes more than 120 species, most of them pathogens of plants  Pythium insidiosum is an important pathogen species in mammals.  Pythium insidiosum causes fast-growing clinical conditions leading to death.  Pythiosis develops when open wounds are infected by the zoospores of Pythium, which are chemotactically attracted to decayed organic matter in the wounds.  Pythiosis is more prevalent in tropic and subtropic regions because P. insidiosum needs warm water to maintain its life cycle.  Pythiosis outbreaks occur during summers and in those animals that have closer contact with floodplains.  Pythiosis is characterized histologically, by eosinophilic granulomatous inflammation.  Pythiosis has been reported in several species of domestic animals, mainly equines, dogs amd cats.  Pythiosis has been described in humans, so it is important to keep track of regions with water reservoirs, as there is the possibility of weir contamination in farms.  Pythiosis has been reported in sheep o the ulcerative cutaneous form has been verified (Tabosa et al. 2004). o metastasis can develop as well, affecting lymph nodes and lungs (Souza et al. 2008). o cases of granulomatous rhinitis were verified with the destruction of the hard palate, and reaching the nasal vestibule, resulting in a fistula (Santurio et al. 2008; Souza et al. 2008, Portela et al. 2010, Carrera et al. 2013). o Microscopically, it is characterized by the development of granulomatous lesions, where it is possible to observe necrotic tissue,Splendore-Hoeppli phenomenon and inflammatory infiltration (Carrera et al. 2013).

Diagnosis:

Wet mounts: The collected tissue from the infected areas is sent to the laboratory in sterile distilled water at room temperature. Pieces of the tissue are placed with 10% KOH on a clean slide. The finding of sparsely septate hyphae may be indicative of P. insidiosum, or other fungal pathogen (zygomycetes).

Culture: To isolate this organism it is important to remember that P. insidiosum is severely inhibited by low temperatures. Thus, transportation of the biopsy tissue in ice will decrease the chance to isolate this pathogen in culture. Samples, therefore, should be sent to the laboratory in sterile water at room temperature. Small pieces of the biopsy tissue should be placed onto Sabouraud dextrose agar plates and incubated at 37C, the ideal temperature for P. insidiosum primary isolation. Pythium insidiosum grows rapidly at 37C, but incubation at room temperature delays its growth rate.

Small colonies should be observed around the tissue sample after 24 to 48 hours at 37C. At 5 days the plate will be filled with submerged filamentous fungi-like growth. Microscopically, hyphae without sporulation are observed. To identify P. insidiosum the formation of zoospores must be induced in water cultures with, grass leaves, with specific ionic strength. Sporangia containing zoospores (asexual stage) will be observed at edges of the grass. The production of oogonium (sexual stage) is rare.

Histopathology: Tissue sections of the biopsy samples in H&E stains show a typical eosinophilic inflammatory reaction. The hyphae of P. insidiosum, however, are difficult to observe with this stain. Silver stain and Periodic Acid-Schiff (PAS) are suggested for the proper identification of the hyphal elements of P. insidiosum in tissue

Serology: Several serologic tests have been developed to diagnose pythiosis in humans and animals a. Complement fixation for the diagnosis of equine pythiosis was developed in Australia. It is a sensitive test but lacked specificity. This test is no longer in use in the laboratories dealing with P. insidiosum. b. Immunodiffusion (ID) has been the most widely employed serological test to diagnose pythiosis in humans and animals. The test is very specific but it has demonstrated a low level of sensitivity. The finding that the sera from some humans and dogs with proven pythiosis gave negative results indicated that the diagnosis using ID has to be confirmed with a more sensitive test. c. Enzyme-Linked Immunosorbent Assay (ELISA) was developed to be overcome the drawbacks of the ID test. The ELISA for P. insidiosum is specific and sensitive. This assay detected all proven cases of pythiosis in humans and dogs which were negative by the ID. It also has been proven to be helpful in detecting cat, cattle, and equines infected with Pythium insidiosum. d. Immunoperoxidase assay was developed to specifically detect the hyphae of P. insidiosum in the biopsy tissue from humans and animals. The technique uses peroxidase labeled polyclonal antibodies against P. insidiosum to bind to the hyphae in infected tissue. The tissue sections are examined microscopically to visually identify the stained hyphae. e. Fluorescent antibody technique was developed to diagnosis pythiosis from fixed tissue samples and to identify P. insidiosum from culture. The technique specifically detected P. insidiosum hyphae and gave negative results when tested against Entomophthorales and Mucorales zygomycetes.

Nested PCR assay based on ITS sequences was developed by Grooters & Gee (2002).

Aetiology:

Pythium insidiosum De Cock, L. Mendoza, A.A. Padhye, Ajello & Kaufman, Journal of Clinical Microbiology 25 (2): 345 (1987) Synonym: =Hyphomyces destruens C.H. Bridges & C.W. Emmons, Journal of the American Veterinary Medical Association 138 (11): 588 (1961)

Classification Chromista, Oomycota, Oomycetes, Pythiales, Pythiaceae, Pythium

Description Cultures (CMA) expanding, white, flat, submerged. Hyphae 4-6 ?m wide, irregularly branched (branches 2.5-4.0 ?m diam), sparsely septate in wider hyphae, locally disarticulating. Club-shaped appressoria present. Zoosporangia undifferentiated, filamentous, with two lateral flagella. Sexual organs (Oogonia) intercalary, subspherical, 23-30 ?m wide. Antheridia produced from adjacent hyphae, clavate, terminally up to 10 ?m wide.Optimal development at 35°C, maximum growth temperature 45°C.

Culture of P. insidiosum. Mycology online Colony of P. insidiosum (4 days old) on SGA

Reports: Tabosa et al. (2004) diagnosed 2 outbreaks of cutaneous pythiosis caused by Pythium insidiosum in two herds of crossbred hair wool sheep of different ages in the semiarid region of Northeastern Brazil. In one herd of 120 sheep, 40 were affected. The other outbreak affected six sheep out of 80. Local swellings with ulcerative lesions were observed in the limbs and abdominal and prescapular regions. Three sheep were necropsied. Two of them had lung metastasis characterized by multifocal nodules measuring 0.5–2 cm. In one animal, the prescapular lymph node was also affected. In another, the cutaneous lesion extended to the sesamoid bone. Microscopically, there were multifocal granulomas with intralesional P. insidiosum hyphae and SplendoreHoeppli material surrounding the hyphae. The diagnosis was based on the histologic lesions, immunohistochemical identification, and culture of the etiologic agent. One sheep treated with potassium iodide recovered. Standing in swampy water

85 for long periods in a warm aquatic environment seems to be the reason for the high prevalence of the disease.

Right hind limb; sheep No. 4. An ulcerated lesion is observed in the region of the metatarsus Sheep No. 4. A swelling measuring 6.8 cm craniocaudally and 11.5 cm dorsoventrally, with an ulcerated area is observed in the left prescapular region. 3. Sheep No. 1. Dermis below an ulcerated lesion. A granuloma containing hyphaelike structures (black arrow) surrounded by eosinophilic Splendore-Hoeppli material and numerous eosinophils was observed. This central area is surrounded by epithelioid macrophages. A giant cell is also observed (arrow head). HE. 4. Sheep No. 1. Dermis below an ulcerated lesion. Thick-walled, irregularly branched, occasionally septate hyphae observed at the center of a granuloma. Gomori methenamine silver. Tabosa et al. (2004)

Gaastra et al. (2010) mentioned that Pythium insidiosum is an oomycete pathogenic in mammals. The infection occurs mainly in tropical and subtropical areas, particularly in horses, dogs and humans. Infection is acquired through small wounds via contact with water that contains motile zoospores or other propagules (zoospores or hyphae). The disease, though described as emerging has in fact already been described since 1884. Depending on the site of entry, infection can lead to different forms of pythiosis i.e. a cutaneous, vascular, ocular, gastrointestinal and a systemic

87 form, which is rarely seen. The infection is not contagious; no animal–animal or animal–human transmission has been reported so far. Therapy includes radical surgery, antifungal drugs, immunotherapy or a combination of these therapies. The prevention to contract the disease in endemic areas is difficult. Avoiding stagnant waters could be of help, although the presence of P. insidiosum on grass and soil in enzootic areas renders this practice useless.

A five days old culture of Pythium insidiosum at 37 8C grown on 2% Sabouraud dextrose agar (Panel A). P. insidiosum from plate cultures showing sparsely septate hyphae in lactophenol blue (20_) (Panel B). Gaastra et al. (2010)

In Panel A, a sheep with a strong inflammation of the face and bloody rhinorrhea caused by Pythium insidiosum is shown. In Panel B the location of the granulomatous tissue is inside the nostril passages (Courtesy of Drs. F. Riet-Correa and S.M.S. Silva). Gaastra et al. (2010) Pessoa et al. (2012) described a new form of pythiosis involving the alimentary tract of 2 nursing lambs from 2 different farms in the semiarid region of Brazil. The first lamb showed food regurgitation, lethargy, and anorexia, and died 5 days after the presentation of clinical signs. The second lamb had no history of gastrointestinal disease before death. Necropsy findings were similar in both lambs. The mucosa of the esophagus, reticulum, rumen, omasum, and abomasum showed ulcerated areas covered by yellowish caseous granular exudate. The lesions were transmural and extended to the serosal surfaces, and adhesions were observed between the serosa of the forestomachs and abomasum to the liver and diaphragm. Histologic lesions consisted of pyogranulomatous necrotizing transmural esophagitis, rumenitis, reticulitis, omasitis, and abomasitis with vascular thrombosis and intralesional hyphae. Pythium insidiosum was confirmed as the etiology by immunohistochemistry

88 and culture. The presence of sheep in the vicinity of water ponds during the hot, dry season when forage is not available in the pastures seems to be the main predisposing factor for the occurrence of pythiosis in sheep in the Brazilian semiarid region.

A, prestomachs and abomasum of sheep 1. A dark rounded lesion is observed on the serosal surface of the reticulum (arrow), and a similar yellow lesion is present on the serosal surface of the rumen (*) adjacent to the spleen (S). B, abomasum, prestomachs, and liver of sheep 2. A yellow caseous granular exudate is covering the ulcerated mucosa of the omasum (O), reticulum (R), and abomasum (A); Ru = rumen. C, sheep 2. An ulcer (arrow) is observed on the ruminal mucosa. D, sheep 2; liver. A yellow caseous granular exudate is covering the visceral surface of the liver, which is adhered to the abomasum. Pessoa et al. (2012)

Digestive pythiosis; omasum; sheep. A, a central eosinophilic area of necrosis (N) is surrounded by granulomatous inflammation with numerous macrophages, lymphocytes, plasma cells, and Langhans-type multinucleate giant cells (arrows). Hematoxylin and eosin. Bar = 20 µm. B, Pythium insidiosum stained with silver in Grocott methenamine stain. Bar =20 µm. C, immunohistochemistry showing positive reaction to P. insidiosum. Bar = 20 µm. Pessoa et al. (2012)

Ubiali et al. (2013) necropsied 186 sheep over a 6-year period. Thirty (16.1%) cases of rhinitis in sheep that were caused by Conidiobolus lamprauges (n = 15) or Pythium insidiosum (n = 15) were investigated further. The lesions of P. insidiosum infection was associated with rhinofacial (93.3%) lesions that mainly involve the frontal region and hard palate and appear as an irregular, friable, yellow to red mass. Microscopically, pythiosis presents as diffuse necrotizing eosinophilic rhinitis.

Immunohistochemistry using polyclonal antisera raised specifically against the two organisms was used to confirm the identity of the infectious agent in each disease. This study reports the first immunohistochemical diagnosis of conidiobolomycosis and the first description of a rhinopharyngeal lesion caused by P. insidiosum in sheep.

Mid-sagittal section of the head of a sheep with pythiosis. (A) Rhinofacial. Ulcerated mucosa with a friable, dark- brown mass extending from the mucocutaneous region into the nasal vestibule (arrowhead). (B) Rhinopharyngeal. A friable, brown mass extends from the ethmoidal region to the ventral edge of the cribriform plate (arrowheads). (C) Nasal tissue. Caseous necrotic area with negatively-stained hyphae (arrowhead) surrounded by granular Splendore–Hoeppli material and an inflammatory infiltrate composed of eosinophils, neutrophils and fibrin. HE. (D) Skeletal muscle. Polymorphonuclear inflammatory cell infiltration with necrosis of muscle fibres. These cells contain negatively-stained hyphae (arrowheads). HE. (E) Hyphae with thick walls that are almost parallel and sparsely septate. GMS. (F) Pythium insidiosum hyphae within the necrotic area. IHC. Ubiali et al. (2013) Bernardo et al. (2015) reported pythiosis in a sheep from southwestern Paraná, Brazil, confirmed by indirect ELISA and immunohistochemistry. A 4-year-old ewe from a flock of 30 Santa Inês sheep, raised semi-extensively with access to a weir, showed cachexia, bilateral enlargement in nasal region, a serous and bloody secretion with a fetid odor from its nose and swollen submandibular and retropharyngeal lymph

90 nodes. Indirect ELISA resulted positive for pythiosis. Necropsy revealed necrosis of the hard palate with a diameter of 3.5cm and extending up to the nasal cavity, forming a fistula. Submandibular and retropharyngeal lymph nodes were enlarged and edematous on section. Microscopic findings for submandibular and retropharyngeal lymph nodes consisted in moderate infiltration of eosinophils mainly in the subcapsular sinus, characterizing reactive eosinophilic lymphadenitis. The nasal cavity revealed rhinitis and oral cavity stomatitis with necro-eosinophilic and pronounced multifocal granulomatous infiltration and presence of hyphae. Hyphae found in palate and nasal cavity were positive for Pythium insidiosum by Grocott's method and immunohistochemistry, the last one considered to be confirmatory for the pathogen diagnostic.

Volume enlargement of the nasal region and nasal necrosis in sheep. Severe destruction of hard palate of a sheep due to necrosis associated to serous and bloody secretion. Bernardo et al. (2015)

Nasal lesion of a sheep. Reaction similar to Splendore-Hoeppli, surrounded by eosinophil inflammation (arrows). H&E, obj.40x. Lesion in palate of a sheep showing black hyphae (arrows). Grocott method, obj.40x. Bernardo et al. (2015)

Immunohistochemistry technique confirming the presence of Pythium insidiosum (arrows). Nasal region of a sheep. Obj.40x. Bernardo et al. (2015)

do Carmo et al. (2015) reported pythiosis for the first time in a goat. The affected goat had daily access to an aquatic environment and had developed an ulcerative lesion on the skin of the left hindlimb. Microscopically, there were dermal pyogranulomas with „negatively stained‟ hyphae, which were identified immunohistochemically as Pythium insidiosum.

do Carmo et al. (2015)

4.4. Conidiobolomycosis in sheep and goats

Conidiobolomycosis is a zygomycosis caused by fungi of the class Zygomycetes, order Entomophthorales, affecting humans and animals.  The main Conidiobolus species involved are o C. coronatus, o C. incongruus, o C. lamprauges.  Conidiobolus spp. are found mainly in soil, decaying vegetation, and insects of tropical and subtropical regions.  In humans, C. coronatus is the most common agent isolated causing infections of the upper airways.  In animals, conidiobolomycosis caused by C. coronatus, C. lamprauges, and C. incongruus are reported mainly as subcutaneous infections or rhinofacial, nasopharyngeal, or oral infections

Two clinical forms of the disease have been diagnosed. Rhinofacial conidiobolomycosis is characterized by swelling in the nasal vestibule and mucocutaneous union of the skin of the anterior part of the face and upper lip. In addition, nasal discharge and partly clogged nostrils are often observed, while the nasal mucosa and hard palate may be ulcerated. Clinical evolution can last for weeks, but some animals have been successfully treated (Riet-Correa, 2007). Nasopharyngeal conidiobolomycosis affects the ethmoidal region, turbinates, paranasal sinuses, soft palate, orbit, pharynx, nearby muscles and local lymph nodes (Riet-Correa, 2007; Silva et al., 2007; Riet-Correa et al., 2008). In this latter form, severe injury leads to exophthalmos and ocular lesions of the orbit, which are usually unilateral, and the eye is often swollen, opaque and exhibits corneal ulceration (Silva et al., 2007; Riet-Correa et al., 2008; Boabaid et al., 2008). The clinical course usually ranges from 7 to 15 days (Riet-Correa, 2007); however, cases persisting up to 56 days have been reported (Boabaid et al., 2008). Clinical manifestations: mucohemorrhagic nasal discharge, dyspnea, anorexia, enlargement of anterior or posterior nasal cavity, and exophthalmos. Gross lesions: granulomatous necrotic tissue in the ethmoidal region extending through the turbinate bones into the brain and also into soft tissues of the nose with dissemination to the lung and lymph nodes. Histologically: the presence of Splendore-Hoeppli material surrounding fungal hyphae is characteristic of the infection. Diagnosis Direct microscopy is done with blades made by the Gram technique and KOH The direct microscopy displaysg large non-septated hyphae. Culture is done by inoculation on Sabouraud Chloramphenicol agar, Dichloran Rose Bengal Chloramphenicol agar and selective agar for pathogenic fungi. Expanding growth, subhyaline, waxy, without aerial mycelium, with cerebriform center and radial deep

93 fissures in the outer zone in all inoculated media Histopathological examinations showed hyphae in fragments, confirming the diagnosis. Lesions disappeared spontaneously, not being accomplished any treatment.

Distribution. Central America, equatorial Africa, India.

Description of aetiologies: Conidiobolus coronatus (Costantin) A. Batko, Entomophaga, Mémoires hors série 2: 129. 1964 1. Boudierella coronata Costantin, Bulletin de la Société Mycologique de France 13: 40 (1897) 2. Conidiobolus coronatus (Costantin) Batko, Entomophaga 2: 129 (1964) 3. Delacroixia coronata (Costantin) Sacc. & P. Syd., Sylloge Fungorum 14: 457 (1899) 4. Entomophthora coronata (Costantin) Kevorkian, Journal of Agriculture of the University of Puerto Rico 21 (2): 191 (1937)

Colonies 7-16 days old on SMA at 25°C, obverse white (Y00 M00 C00) to yellowish (Y10 M00 C00) and reverse yellowish (Y10-20 M00 C00) at 16th day, 90 mm in diameter, or composed of up to 10 mm colonies occupying almost all the plate surfaces, flat, aerial mycelium absent. Feeding mycelium filamentous, branched, rarely septate, greenish to pale brown containing olive green droplets, 5-20.8 µm in diameter, releasing or not hyphal bodies (segments) of 37-180 µm long. Conidiophores undifferentiated from feeding mycelium. Primary conidia spherical to globose, pale olive green to greenish chestnut, 23.5-65 µm in diameter. Papillae applanate or cone-shaped with blunt or sharp ends, respectively, 4.9-19 x 8.3-20.9 µm. Villose conidia spherical, rarely papillate, similar to primary conidia in size. Replicative conidia rare. Microconidia ovoid, lemon-shaped to rounded 14.5-28 x 14- 24 µm (CCIBt 2335) or absent (CCIBt 2336). Chlamydospores and zygosporangia absent.

'Conidiobolus coronatuscolony on potato dextrose agar. 25℃, 3 days. Image from Chiba University Research Center for Pathogenic Fungi and Microbial Toxicoses Spherical conidia with prominent papillae characteristic of Conidiobolus coronatus. Image from Mycology Online

Conidiobolus incongruus Drechsler, American Journal of Botany 47: 370 (1960) Colonial morphology of Conidiobolus incongruous on inhibitory mold agar, obverse view. Colonies are tan coloured, initially flat and dry with sparse white aerial hyphae developing on center of colonies. On potato dextrose agar, after time, top of culture plate becomes covered with fine powder composed of sporangiospores that are expelled or discharged from colonies. Pbverse view, colonies are cream or tan coloured, developing radial folds with age. Sporangiospores of Conidiobolus coronatus (single-celled round spores) with prominent papillae. Some spores have short hairlike appendages called villi (white arrow). Original magnification, 400Â; lactophenol cotton blue stain.

Colonial morphology of Conidiobolus incongruous on potato dextrose agar, obverse view. and obverse view.

Sporangiospores of Conidiobolus coronatus/ Shaikh et al. (2016), Mycobank

Conidiobolus lamprauges Drechsler, Journal of the Washington Academy of Sciences 43: 35 (1953) Colonies (SGA) expanding, flat, somewhat farinose near the centre, with shallow radial fissures, whitish. Hyphae 3-8 ?m wide, irregular. Conidiophores hypha-like, irregular, not swollen at their apices. Primary conidia forcibly discharged, densely granular when immature, spherical, thin-walled, with one to several flat papilla after liberation, 13-22 ?m diam. Zygospores spherical, 12-18 ?m in diam, thick-walled, with a large oil globule near the centre, formed intercalarily on undifferentiated hyphae, easily liberated, with two protuding lateral appendages (beaks).

Conidiobolus lamprauges strain BLDCL-01 on SDA. (A) A smooth, glabrous, waxy 3-day-old colony of C. lamprauges at 37°C. (Inset) The same colony after 24 h of incubation at 37°C. (B) The same colony after more than 6 days of incubation at 37°C. Older colonies are characterized by the development of powdery structures with short aerial mycelia discharging papillate conidia, with folds radiating from the centers Vilela et al., 2010

Mycobank

Reports: Carrigan et al. (1992) reported the death of about 700 sheep on 52 farms in north- western New South Wales and south-western Queensland over a 3 mo period. Affected animals had a marked asymmetrical swelling of the face, extending from the nostril to just anterior to the eyes. They lost condition rapidly and died within 7 to 10 days. At necropsy there was a unilateral severe necrogranulomatous rhinitis with extension of inflammation into the adjacent subcutaneous tissue, nasal septum and hard palate. Metastatic lesions were present in the draining lymph nodes and in the thorax. Histological changes consisted of a granulomatous reaction with numerous eosinophilic foci of necrosis and a diffuse, heavy, mixed inflammatory cell response. Many vessels had segmental necrosis and thrombosis. Fungal hyphae were numerous, particularly within or associated with necrotic foci. Conidiobolus incongruus was isolated from nasal tissues, parotid and submandibular lymph nodes and pulmonary lesions. Ketterer et al. (1992) described the clinical findings, pathology and mycology of a cluster of 5 ovine cases of rhinocerebral and nasal zygomycosis caused by Conidiobolus incongruus. All cases were in Border Leicester or Merino x Border

Leicester ewes from a flock pastured in a low-lying paddock adjoining a small tidal river in subtropical Queensland (latitude 28d S). These cases of zygomycosis are believed to be the first infections due to C incongruus recorded in animals other than humans.The disease was subacute in 4 animals with a course of up to several weeks. In these, the primary site of infection was the posterior nasal cavity. The lesions extended to the dorsum of the face between the eyes, to the orbital cavity and to the anterior brain and meninges in the cranial cavity. In one animal, where the anterior nasal cavity was affected and lodine treatment used, the course was longer. The fungal granulomas had numerous foreign body giant cells, neutrophils and eosinophils. Fungal hyphae were thin walled, 6 to 8 μm in diameter, with occasional septa and irregular branching. They were cuffed with a wide zone of necrotic cell coagulum, or with homogeneous eosinophilic Splendore-Hoeppli granules.

Silva et al. (2007) reported conidiobolomycosis in the state of Piauí, in the semiarid region of northeastern Brazil. Affected sheep had depression, weight loss, serous or mucohemorrhagic nasal discharge, and cranium-facial asymmetry from exophthalmos of 1 eye, generally with increased volume of the eyeball, keratitis, and corneal ulceration. At necropsy of 60 sheep, friable masses were observed in the posterior region of the nasal cavity, often destroying the ethmoturbinate bones. Frequently, the lesions invaded the nasal sinuses, cribiform plate, orbit, and brain. The masses were irregular, granular with moist surfaces, and soft and friable with white, yellow, or tan coloration. Dissemination of the lesion to lungs was observed in 27 sheep, to the brain in 26, to lymph nodes in 3, to the kidney in 2, and to the gallbladder and heart in 1. The microscopic examination showed granulomatous inflammation composed of central necrosis surrounded by lymphocytes, epithelioid and giant cells, and fibrous tissue. In all lesions, negatively stained structures representing hyphae were surrounded by Splendore-Hoeppli material. Coagulative necrosis, thrombosis, and vasculitis were also observed. Grocott methenamine silver stain showed 8–30-μm- thick hyphae, rarely septate or ramified, irregular in shape, and with black contoured wall, sometimes with bulbous dilatation in the extremities. On electron microscopy, the hyphae had a thick double wall surrounded by cellular remnants and an inflammatory exudate. Conidiobolus coronatus was isolated from the lesions of 6 sheep. Conidiobolomycosis is an important disease of sheep in the state of Piauí, and other regions of northeastern Brazil.

Conidiobolomycosis. Sheep with nasal discharge, cranium-facial asymmetry, and exophthalmos of the right eye. The eyeball is enlarged with keratitis and corneal ulceration. Sheep conidiobolomycosis. Sagittal section of the head. The ethmoid bone and most of the turbinate bones are destroyed and have been replaced by a yellow mass. The pharynges and larynges are full of exudates. The lesion extended to the frontal meninges, which is thickened (arrow). Silva et al. (2007)

Sheep conidiobolomycosis. Lung. Multifocal whitish nodules measuring 0.5–3 cm (arrows). Sheep conidiobolomycosis. Kidneys. Multifocal whitish nodules measuring 0.5–3 cm are observed.Silva et al. (2007)

Sheep conidiobolomycosis. Nasopharyngeal tissues. A granuloma is observed containing hypha-like structures (white arrows) surrounded by eosinophilic Splendori-Hoeppli material and some necrotic eosinophils (black arrows) and neutrophils. The central area is surrounded by epithelioid macrophages. HE. Bar = 60 μm. Sheep conidiobolomycosis. Nasopharyngeal tissues. Walled, occasionally septate or ramified hyphae, irregular in shape, sometimes with bulbous dilatation in the extremities are observed in the center of the granuloma. Gomori methenamine silver. Bar = 100 μm. Silva et al. (2007)

Riet-Correa et al. (2008) reported 2 outbreaks of zygomycosis with rhinofacial and two other with rhinopharyngeal lesions involving fungi with filamentous coaenocytic hyphae characteristic of entomoph-thoramycetous fungi in the state of Paraíba, northeastern Brazil. One outbreak of rhinofacial zygomycosis occurred during the rainy season affecting 5 sheep. Another outbreak of the clinical form affected one out of 40 sheep during the dry season. Common clinical signs of the rhinofacial infection were bilateral serosanguineous nasal discharge with swelling of nostrils, upper lip, and the skin of the face. At necropsy the nasal mucosa showed dark brownish ulcerated areas which extended from the mucocutaneous region to 10cm inside the nasal vestibule. The mucosa of the hard palate was also ulcerated. The cutting surface of nostrils and palate showed a brownish or red spongeous tissue of friable consistency. One outbreak of rhinopharyngitis took place on an irrigated coconut farm; 7 out of 60 adult sheep were affected. Another outbreak affected a sheep in a flock of 80 during the dry season. Clinical signs as noisy respiration and dyspnoea due to mechanical blockage of the nasal cavities, swelling of the nostrils, and serosanguineous nasal discharge were observed. Six out of 8 sheep in this group showed exophthalmia, keratitis and unilateral corneal ulceration of the eye. The sheep either died of their infection or were euthanized after a clinical course of 7-30 days. At necropsy there was a dense yellow exudate in the nasopharyngeal area affecting the ethmoidal region, turbinate bones, paranasal sinuses, hard and soft palates, orbital cavity, pharynges, regional muscles and lymph nodes. Histopathologically both forms

98 of the disease showed multifocal granulomas with an eosinophilic necrotic reaction (Splendore-Hoeppli phenomenon) containing ribbon-type coenocytic hyphae with 7- 30mm in diameter similar to hyphae of zygomycetous fungi, possibly Conidiobolus spp. Outbreaks of both forms of mycotic rhinitis are common in northeastern Brazil and in other regions of the country.

Riet-Correa et al. (2008)

Boabaid et al. (2008) reported the epidemiological, clinical, pathological and mycological findings of an outbreak of conidiobolomycosis in a flock of 40 Santa Ines sheep, in the state of Mato Grosso, Brazil. The illness occurred in the municipality of Nobres during January-June, 2007, resulting in death of about 30% of the affected sheep within 2-5 weeks. The clinical signs were characterized by apathy, weight loss, labored and noisy breathing with dyspnea, and mucous or serohemorrhagic nasal discharge. In three sheep there was unilateral exophthalmia, keratitis and corneal ulceration. A firm whitish, multi-lobulated, friable growth was evident in the ethmoturbinate region at the coronal sections of the head from six affected sheep. In all sheep the choana had similar nodular infiltration which resulted in local obstruction. In three of those there was exophthalmia. There was infiltration in the cribiform plate and brain (2 cases), regional lymph nodes (2), lungs (3), and abomasums (1). Microscopic findings were granulomatous inflammation of the rhinoetimoidal region, with necrosis, lymphocytic infiltration, epithelioid multinucleated giant cells and fibrovascular tissue, surrounding Splendore-Hoeppli material wich contained unstained ghost images of hyphae. The methenamine-silver stain uncover fungi hyphae, rarely ramified with bulbous dilatation in their extremities. Conidiobolus sp. was isolated from nasal tissue lesions of four

Boabaid et al. (2008)

100

Boabaid et al. (2008)

Batista et al. (2009) determined hematologic values, serum levels of albumin, globulins, total proteins, calcium, phosphorus, magnesium, chloride, urea nitrogen, creatinine, total, direct and indirect bilirrubin, and serum activities of aspartate aminotransferase (AST), alkalin phosphatase (AF) and gama-glutamyltransferase (GGT) in 56 hair sheep with conidiobolomycosis and 371 healthy hair sheep from the same flocks. Sheep with conidiobolomycosis had nonregenerative, normocytic and normochromic anemia, leucocytosis with neutrophilia and increased nutrophil:lymphocyte rate, moderate monocytosis, moderate thrombocytosis, hypoproteinemia (hypoglobulinemia), hypomagnesemia, hypocalcemia and increased values of phosphorus. Serum activities of AST and GGT were increased and serum activity of FA decreased. Serum values of urea and creatinine were within normal values. Hypoglycemia and hyperbilirrubinemia were also observed. These results can be used for experimental studies with the disease, for treatments trials, and to detect early cases of the disease without clinical signs. Otherwise the hematologic and blood biochemistry values of healthyy sheep can be used as reference values for hair sheep in the semi-arid region of Brazil de Paula et al. (2010) characterized 5 samples of Conidiobolus isolated from 3 herds with clinical disease in Mato Grosso State, Brazil. The clinical and pathological findings were similar to nasopharyngeal zygomycosis. Based on morphological features, isolates were classified as Conidiobolus spp., and molecular phylogenetic analyses based on 18S ribosomal DNA grouped all isolates in a Conidiobolus lamprauges cluster.

101

Phylogenetic tree of Conidiobolus spp. from ovine nasopharyngeal zygomycosis. The neighbor joining tree of Conidiobolus genera and 3 isolates of Conidiobolus from Mato Grosso State (MT303, 290, 273) is based on partial sequence data from the 18S ribosomal DNA region. Bootstrap values are shown next to the nodes (1,000 replicates). All isolates in the current study fell within 1 cluster of Conidiobolus lamprauges (cluster A). Saccharomyces cerevisiae was the outgroup.

Furlan et al. (2010) reported an outbreak of conidiobolomycosis affecting sheep in the State of Santa Catarina, Southern Brazil. The disease occurred in six Santa Inês breed sheep from a flock of 75 during the rainy season. Common clinical signs were noisy respiration and dyspnea, serous to mucosanguineous nasal discharge and exophthalmus. At necropsy there was a dense yellow mass in the nasopharyngeal area affecting the ethmoidal region, turbinate bones and occasionally limph nodes, central nervous system and pleura. Histopathologycally there was multifocal granulomas whith an eosinophilic necrotic reaction containing ribbon type hyphae similar to zygomycetous fungi. At molecular examination Conidiobolus lamprauges DNA was detected. The clinical, epidemiological, macroscopical, microscopical and molecular aspects characterize conidiobolomycosis caused by Conidiobolus lamprauges in sheep.

Furlan et al. (2010)

102

Furlan et al. (2010)

Vilela et al. (2010) reported for the first time the taxonomic and phylogenetic description of three Conidiobolus lamprauges isolates recovered from sheep with rhinopharyngeal entomophthoramycosis. The distinctive clinical and pathological features of C. lamprauges were compared with those of other Conidiobolus spp. affecting sheep, as well as with those of the stramenopilan ovine agent Pythium insidiosum. The comparative morphological attributes of Conidiobolus spp. were also diagramed; along with the sequence data generated, they should assist laboratories in the identification of these uncommon species.

103

(A) Hyaline, coenocytic hyphae of Conidiobolus lamprauges strain BLDCL-01, with numerous smooth, globose mature zygospores, in lactophenol blue. Bar, 40 μm. (B) Close-up of smooth, mature C. lamprauges zygospores on PDA medium, with some space between the internal globules and the cell wall. Bar, 20 μm. (C to F) Different features of the asexual papillate globose conidia observed on PDA. (C) A single hyphal segment (lower red arrow) with a conidium (upper red arrow) before it was forcibly discharged. Bar, 25 μm. (D) Migration of the cytoplasm from the primary papillate conidia into secondary sporophores (replicative conidia). This type of conidium is commonly found in other Conidiobolus species, but the sizes of the structures might differ. Bar, 15 μm. (E) Primary asexual globose papillate conidia of C. lamprauges. Bar, 20 μm. (F) One of the C. lamprauges asexual conidia developing a germ tube that eventually becomes a hypha, used to colonize new environments. Bar, 20 μm. Vilela et al. (2010)

Neighbor-joining tree of aligned 18S SSU rDNA sequences of the 3 Conidiobolus lamprauges strains from sheep and 15 other Entomophthoramycetes sequences. The percentages of 1,000 bootstrap-resampled data obtained by neighbor-joining analysis are given on the branches. The DNA sequences of C. lamprauges strains BLDCL-01 (from reference 22) (GenBank accession number GQ478279), BLDCL-02 (GQ478280), and BLDCL-03 (GQ478281), recovered from three Brazilian sheep in this study, clustered with those of two environmental C. lamprauges strains available in the database. In this tree, the five C. lamprauges DNA sequences clustered in a monophyletic group connected by a long branch to C. osmodes, C. thromboides, C. pumilus, and C. rhysosporus. This taxon, in turn, formed a sister group to the other Conidiobolus species used in this study. The DNA sequences of three Basidiobolus species were used as the outgroup. The bar represents 0.05 substitution per nucleotide Vilela et al. (2010)

104

Microscopic differences between the three known mammalian pathogenic Conidiobolus species recovered in culture. Vilela et al. (2010)

Câmara et al. (2011) reported the occurrence as well as the clinical, laboratorial, pathological and mycological findings of three outbreaks of rhinocerebral and rhinopharyngeal conidiobolomycosis in sheep from Rio Grande do Norte state, Brazil. A total of six sheep with clinical signs of conidiobolomycosis were evaluated, and information on history was obtained from ranchers. Clinical signs included depression, progressive emaciation, sero-sanguinolent nasal discharge, tachycardia, dyspnea, miosis and unilateral exophthalmia with increased ocular globe volume, corneal ulceration and nervous system signs. The main hematological alteration was neutrophilia. Serum biochemical evaluation revealed increased values for AST, GGT, creatinine, urea, and glucose, and decreased total proteins and albumin levels. Cerebrospinal fluid analysis showed the presence of fibrin reticules and pleocytosis. Upon necropsy, longitudinal sections of the head revealed the presence of a nodular mass with a friable consistency and a white-yellowish coloration. Microscopic findings included meningitis, cortex necrosis and encephalitis with the presence of eosinophilic Splendore-Hoeppli substance. Histopathology of the lungs revealed a Splendore-Hoeppli-like material and hyperplasia of alveolar and bronchiolar epithelium. Renal lesions were suggestive of amyloidosis.

105

Câmara et al. (2011)

Mendonça et al. (2012) reported an outbreak of zygomycosis with rhinopharyngeal lesions involving fungal hyphae with characteristic of entomophthoromycosis due to Conidiobolus spp. in the State of Pernambuco, Northeastern Brazil. The

106 epidemiological, clinical, pathological and mycological findings are decrypted in a flock of Santa Inês sheep. The disease occurred at Nazaré da Mata from April to May 2009, all most cases occurred mainly during the rainy season affecting 5 sheep of 29, resulting in death of about 100% of the affected sheep. Clinical signs as noisy respiration and dyspnoea due to mechanical blockage of the nasal cavities, swelling of the nostrils and mucous or serosanguineous nasal discharge were observed. Two of 5 sheep showed exophthalmia, keratitis and unilateral corneal ulceration of the eye. The sheep either died of their infection or were euthanized after a clinical course of 7-20 days. At necropsy there was a firm whitish, lobulated, friable growth was evident in the ethmoidal region and nasal septum at the sagital sections of the head from four affected sheep. Histopathologically findings were multifocal granulomas with lymphocytic infiltration, epithelioid multinucleated giant cells and fibrovascular tissue, surrounding an eosinophilic necrotic reaction (Splendore-Hoeppli phenomenon). The methenamine-silver stain uncovered fungal hyphae, rarely ramified with bulbous dilatation in their extremities. Conidiobolus sp. was isolated from nasal tissue lesions of two sheep. This is the first report of disease in the State.

Sheep conidiobolomycosis. Nasal serosanguineous discharge and little cranium-facial asymmetry. Sheep conidiobolomycosis. Sagittal section of the head. The ethmoid bone and most of the turbinate bones are destroyed and have been replaced by a yellow mass. The pharynges and larynges were invaded too. The lesion extended to the frontal meninges, which is thickened (arrow). Mendonça et al. (2012)

Sheep conidiobolomycosis. Lung showing numerous multifocal subpleural yellowish or whitish nodules, 0.5-1cm in diameter (arrows). Sheep conidiobolomycosis. Histological aspect of lung with epithelioid cells and multinucleated giant cells (arrows). HE. Obj. 40X. Mendonça et al. (2012)

107

Sheep conidiobolomycosis. Nasopharyngeal tissues. A granuloma is observed containing rarely ramified fungi hyphae with bulbous dilatation in their extremities (arrows). Methenamine-silver stain. Obj. 40X. Mendonça et al. (2012)

Ubiali et al. (2013) necropsied 186 sheep over a 6-year period. Thirty (16.1%) cases of rhinitis in sheep that were caused by Conidiobolus lamprauges (n = 15) or Pythium insidiosum (n = 15) were investigated further. The lesions of C. lamprauges infection were mainly rhinopharyngeal (86.7%), localized to the ethmoidal region and associated with exophthalmos. The lesions appear as a white to yellow, firm mass that microscopically appears as a granulomatous inflammatory reaction with numerous giant cells.

Mid-sagittal section of the head of a sheep with conidiobolomycosis. (A) Rhinopharyngeal region. A smooth, yellow–white mass with firm consistency extends from the ethmoidal region to the cribriform plate and involves the dorsal turbinate (arrowhead). (B) Rhinofacial region. A proliferative, firm white mass with a smooth surface extends from the middle portion of the nasal cavity to the subcutaneous region (arrowhead). Ubiali et al. (2013)

(C) Numerous multinucleated giant cells containing hyphae are surrounded by mononuclear cells. HE. (D) A variable number of negatively-stained hyphae (arrowheads) within the amorphous and eosinophilic Splendore– Hoeppli material, surrounded by multinucleated giant cells arrow and lymphocytes. HE. Ubiali et al. (2013)

108

(E) Thin-walled, non-parallel and sparsely-septate hyphae with ballooning dilations are scattered in the nasal lesion. GMS. (F) Conidiobolus lamprauges hyphae within multinucleate giant cells, showing occasional ballooning dilations. IHC. Bars, 50 μm. Ubiali et al. (2013)

Silva et al. (2015) carried out a study of sheep conidiobolomycosis in its clinical, epidemiological, pathological and molecular aspects. This study aimed to identify immunoreactive proteins that may play an important role in the immune response of sheep naturally infected by C. lamprauges. For protein and immunological characterization, C. lamprauges (strain FIOCRUZ-INCQS 40316) isolated from a sheep with clinical signs of conidiobolomycosis in the MT state and five sera samples of naturally infected sheep were used. The presence of IgG antibody was observed in all patients with reagent titers in dilutions up to 1:1600. In immunoblot technique, the antigenic profile against infected sheep sera showed twelve reactive bands with molecular weights ranging from 35 to 198 kDa. Among them, the 198 kDa protein was reactive against sera from three sheep and the 53 kDa showed increased intensity compared to other bands probably being immunodominant. Healthy animal serum samples showed no reactivity demonstrating the specificity of the technique. The presence of antigenic proteins of C. lamprauges and specific IgG in sheep sera observed in this study may assist in the development of early diagnostic methods and the use of protein as candidate vaccines for the control and prevention of infection in animals and human.

109

4.5. Pneumocystosis in sheep and goats

 Pneumocystis carinii is an opportunistic fungal pathogen that can cause severe and sometimes fatal pneumonia in immunosuppressed hosts.  Pneumocystis carinii affects a variety of mammalian host species including humans, monkeys, rats, mice, ferrets, sloths, dogs, cats, sheeps, marmosets and voles [de Souza and Benchimol, 2005].  Pneumocystis carinii infection in goats is very rare with only a few clinical cases reported thus far [McConnell et al., 1971, King,1983

o The taxonomy of P carinii was a matter of discussion:either a protozoan or a fungus  The life cycle of the agent is in favour of being a protozoan: o The structural forms of P carinii that have been recognized are the cyst, which is thick-walled; o the sporozoite, an intracystic structure; and the thin-walled trophozoite. o The cyst is a spherical to ovoid structure 4 to 6 μm in diameter. It contains up to eight pleomorphic sporozoites. o The trophozoite is a thin-walled extracystic cell representing an excysted sporozoite. o The organism can be briefly propagated in embryonic thick epithelial lung cells, Vero cells, and WI-38 cells. o The organism does not enter the host cell, but instead attaches to its surface during a phase in the replicative cycle. o There is no evidence of toxin production.

.. Pneumocystis carinii life cycle | by Arieviln  Recent studies showed rRNA sequences, thymidylate synthase, dihydrofolate reductase, beta tubulin, mitochondrial DNA and chitin in the cell wall of P carinii more closely resemble fungi than protozoa.  Eriksson's treatise places P carinii in a new family, Pneumocystidaceae, and in a new order, Pneumocystidales (Ascomycota).

 Taxon recognized by NCBI Taxonomy:  Cellular organisms +

110 o Eukaryota + . Opisthokonta + . Fungi + . Dikarya + . Ascomycota + . Taphrinomycotina + . Pneumocystidomycetes + . Pneumocystidales +  Pneumocystidaceae + o Pneumocystis + . Pneumocystis carinii +  Pneumocystis carinii is the cause of diffuse pneumonia in immunocompromised hosts. o Even in fatal cases, the organism and the disease remain localized to the lung. o The pneumonia rarely, if ever, occurs in healthy individuals.  Pneumocystis is a single-celled fungal (Ascomycota) respiratory pathogen of mammals. P. carinii and P. wakefieldiae are the two Pneumocystis species that have been identified in laboratory rats, with P. carinii being most commonly found.

Transmission:  Transmission occurs via direct contact and airborne routes.  Experimental infection studies have shown that Pneumocystis isolates are host species-specific.  Interspecies transmission does not occur even in immunodeficient hosts.

Reports: McConnell et al. (1971) reported a fatal case of an infection by Pneumocystis carinii in a young domestic goat. The disease was manifested as a severe diffuse interstitial pneumonitis accompanied by filling of the alveolar air spaces by large numbers of organisms. Light and electron microscopic studtes revealed the parasite to be identical to previously described cases in man and other animals. This is apparently the first case recognized in an animal in Africa.

Diffuse interstitial pneumonitis. HE X 75. 2. Mononuclear infiltration of the pulmonary interstitium and foamy material (parasites) filling and lining the alveolar spaces. HE X 375 McConnell et al. (1971)

111

Higher magnification of a portion of 2 showing numerous parasites which comprise this material. Note the cyst forms with multiple intracystic bodies (arrows). HE X 750. McConnell et al. (1971)

Silver stain showing a significant proportion of the parasites as being· argentophilic. GMS X 375.. Higher magnification of a portion of 5 showing several cysts, including several crescentshaped forms. GMS x 750. McConnell et al. (1971)

Sakakibara et al. (2013) reported a 3-year-old, female, Tokara-native-goat (Capra hircus domesticus) that died of apparent malnutrition caused by multibacillary paratuberculosis. While inflammatory response was slightly observed in the respiratory organs, P. carinii trophozoites and cysts were immunohistochemically observed in the pulmonary alveoli of the infected animal. P. carinii specific DNA was amplified from the formalin fixed and paraffin embedded lung samples. Molecular phylogenetic analyses of the mitochondrial large subunit ribosomal RNA region of P. carinii revealed genetic divergence from previously described P. carinii isolates from other mammalian host species. This is the first description of concurrent infection with P. carinii and the Mycobacterium avium subspecies paratuberculosis in a domestic goat.

Histology and immunohistochemistry of infected tissue. (A) Ileum. Epithelioid macrophages with many acid-fast bacilli are observed in the muscle layer (top) and thickened submucosa. Ziehl-Neelsen. Bar=100 μm. (B) Lung. Masses of foamy material are present within the alveolar space, and round cysts with spores (arrows) are visible. Giemsa. Bar=10 μm. (C) Lung. An adjacent section shows the same masses as those in Fig. 2, and cyst walls stain positively with antibody to P. carinii. SBC. Bar=10 μm. Sakakibara et al. (2013)

112

Kondo et al. (2014) identified Pneumocystis pneumonia in two female (cases 1 and 2) and a male (case 3) Boer cross goat kids aged 3 months on a farm in Uganda. This was fatal in cases 1 and 2, with symptoms of coughing. Severe infestation with Haemonchus contortus was found in the euthanized case 3. Histology revealed numerous Pneumocystis organisms in cases 1 and 2, but fewer in case 3. Although macrophages reactive to the organisms were observed in all cases, the lung lesions were not infiltrated with lymphocytes in cases 1 and 2. Polymerase chain reaction analysis for Pneumocystis DNA identified five genetic clones in case 1. This diversity may be due to repeated infection from other goats, and may also be associated with selective pressure from the innate immune system activated by mild Haemonchus infestation in young kids.

Case 1 Because of thickening of alveolar septa, the alveolar spaces are narrowed and filled with foamy material. Giemsa. Bar = 5 μm. intra-alveolar foamy material positive for Pneumocystis antigen is visible.SAB. Bar = 5 μm. KONDO et al. (2014)

Case 1: CasPneumocystis antigen-positive organisms are observed on the surface of bronchiolar epithelial cells. SAB. Bar = 5 μm.2 CD3-positive cells are almost absent in alveolar septa. SAB. Bar = 20 μm. KONDO et al. (2014)

0 Case 3: Some CD3-positive cells are present in alveolar septa. SAB. Bar = 20 μm.1 Pneumocystis antigen is visible as dark dots (arrows) in the cytoplasm of CD68-positive macrophages. SAB. Bar = 5 μm. KONDO et al. (2014)

113

4.6. Microsporidiosis in sheep and goats

Microsporidia are an exceptionally diverse group of organisms, comprising more than 1,200 species which parasitize a wide variety of invertebrate and vertebrate hosts. These organisms have long been known to be causative agents of economically important diseases in insects (silk worms and honey bees), fish and mammals (rabbits, fur-bearing animals, and laboratory rodents) and they emerged as important opportunistic pathogens when AIDS became pandemic. Microsporidia, currently considered as emerging opportunistic fungal pathogens, are unicellular, obligate intracellular parasited eukaryotes.  Enterocytozoon bieneusi is the most frequently detected in humans, which primarily invades the epithelial cells of the small intestine and causes the disease characterized by chronic diarrhea and wasting syndrome (Didier and Weiss 2006).  Enterocytozoon bieneusi has been found in fecal samples and intestinal tissue of most mammals and some birds as well as milk (Lee 2008; Santín and Fayer 2011).  The findings of the same genotypes of E. bieneusi in both humans and animals support the presumption of zoonotic potentials (Santín and Fayer 2011).  Microsporidia are difficult to detect by light microscopy due to the small size of their spores and uncharacteristic staining properties. o the spores of E. bieneusi strains are morphologically indistinguishable and since this species cannot be cultured, traditional morphological, biochemical, and immunological methods are unavailable for strain differentiation. Instead, o a genotypic method has been described to differentiate characteristic genotypes of the internal transcribed spacer (ITS) of the rRNA gene (rDNA). o due to a very high degree of genetic diversity in the internal transcribed spacer (ITS) region of the rRNA gene within E. bieneusi, sequencing of the ITS gene is considered to be the standard method for genotyping E. bieneusi isolates (Santín and Fayer 2009). o genotyping data of E. bieneusi have revealed the presence of at least 204 ITS genotypes (Karim et al. 2014). o To date, 28 genotypes isolated in humans have also been detected in animals (Matos et al. 2012; Santín et al. 2012).

Morphology:

Microsporidia are unicellular, obligate intracellular eukaryotes. Their life cycle includes a proliferative merogonic stage, followed by a sporogonic stage resulting in characteristically small (1 to 4 μm), environmentally resistant, infective spores. The spores contain a long, coiled tubular extrusion apparatus (“polar tube”), which distinguishes microsporidia from all other organisms and has a crucial role in host cell invasion: Upon extrusion from the spore, it injects the sporoplasm along with its nucleus into the cytoplasm of a new host cell after piercing the plasmalemma of the host cell or the membrane of the phagosomes containing the endocytosed spores

114

Electron micrograph of the developmental stages of the microsporidian species Encephalitozoon cuniculi in a host cell-derived vacuole in in vitro-cultivated human fibroblast cells. K, nucleus of host cell; M, meront; P, sporont, Mathis et al., 2005

Phylogenic characteristics  Microsporidia. are true eukaryotes (i.e., they possess a typical eukaryotic nucleus, endomembrane system, and cytoskeleton  Microsporidia.display molecular and cytological characteristics reminiscent of prokaryotes, including o features of the translational apparatus, o genome size (which is in the range of that of bacteria), and o lack of recognizable mitochondria, peroxisomes, and typical Golgi membranes (reviewed in reference o Because of their prokaryotic features, microsporidia were initially classified within the Archezoa, together with other amitochondriate organisms (Giardia, trichomonads, and Entamoeba) which were thought to have evolved prior to the acquisition of mitochondria by endosymbiosis and consequently to represent the most primitive eukaryotes  Sophisticated phylogenetic analyses revealed that the microsporidia evolved from within the fungi, being most closely related to the zygomycetes  microsporidia are nowadays considered to be highly derived fungi that underwent substantial genetic and functional losses resulting in one of the smallest eukaryotic genomes described to date.  Microsporidia share additional features with fungi, e.g., o the presence of chitin (although chitin is also found in other phyla, e.g., mollusks) and trehalose, o similarities between the cell cycles, and o the organization of certain genes o microsporidiosis in general can be successfully treated with albendazole and fumagillin

Reports: Pang and Shadduck (1985) infected newborn cats, pigs, and sheep experimentally with a rabbit isolate of the mammalian protozoan parasite Encephalitozoon cuniculi.

115

Infection occurred in all cats and in some sheep, but was questionable in pigs. Lesions were seen in the kidneys of 2 of 4 sheep. These lesions were mild, but were compatible with those in a spontaneously affected goat. Encephalitozoon cuniculi were found morphologically in the kidney of 1 sheep with lesions. All sheep had IFA titers of 1:10 to 1:20 before inoculation, and the titers were 1:20 to 1:320 when they were killed. Cisláková et al. (2001) detected the presence of antibodies against Encephalitozoon cuniculi in Angora goats by the method of indirect immunofluorescence (IFAT). The animals reacting at the titre 1: 64 and more were considered positive. Of the total number of 48 sera examined, 4 were positive at the titre 1: 32 and 2 were positive at the titre 1: 64. The occurrence of antibodies against E. cuniculi indicates that one of the causes of disorders in the reproductive cycle in Angora goats may be microsporidia Encephalitozoon cuniculi, and that these animals may be potential sources of infection for people. Malčeková et al. (2010) examined the presence of antibodies against Encephalitozoon cuniculi (E. cuniculi) and Encephalitozoon intestinalis (E. intestinalis) in 215 samples from humans and in 488 samples from five different species of domestic and companion animals in Slovakia. The 215 human samples and samples from 90 swine, 123 non-infected cattle (cattle), 24 cattle infected with bovine leukosis virus (BLV-positive cattle), 140 sheep and 111 dogs were examined by the enzyme-linked immunosorbent assay (ELISA). Samples with serum titres 1:200 or higher were considered as positive. Specific anti-E. cuniculi antibodies were found in humans (0.9%), swine (52%), cattle (2%), sheep (9%) and dogs (15%) except for the BLV-positive cattle at the titre of 1:200. The titre of 1:400 was detected only in humans (0.5%). The presence of specific anti-E. intestinalis antibodies at the titre of 1:200 was confirmed in humans (6%), swine (51%), cattle (11%), BLV-positive cattle (13%) and dogs (6%) but not in sheep. The anti-E. intestinalis antibodies reached the 1:400 in humans (1%), swine (4%) and BLV-positive cattle (17%). The presence of specific anti-E. intestinalis antibodies at the titre of 1:600 was observed only in one swine (1%). Significant differences were observed in animals at titres 1:200 and 1:400 (chi-squared test: p<0.0001) for both pathogens and in humans only for E. cuniculi at the titre of 1:400 (chi-squared test: p<0.0075).

Zhao et al. (2015) analyzed 193 fecal specimens from 138 sheep and 55 goats from eight farms in Heilongjiang Province, China for the occurrence of Enterocytozoon bieneusi by PCR and sequencing of the single internal transcribed spacer (ITS) of the rRNA gene. The average prevalence of E. bieneusi was 22.3% (43/193), with 22.5% (31/138) for sheep versus 21.8% (12/55) for goats. Altogether 14 genotypes of E. bieneusi were identified, including six known genotypes-BEB6 (n=15), Peru6 (8), D (n=6), O (n=3), EbpC (n=2), and EbpA (n=1)-and eight novel genotypes named COS- I to COS-VII and COG-I (one each). Six of the genotypes were previously detected in humans. In phylogenetic analysis, the five novel genotypes COG-I and CCOS-IV to COS-VII were clustered into group 1 with zoonotic potential. These results indicated that these animals may play a potential role in the transmission of E. bieneusi to humans.

116

4.7. Scopulariopsis in sheep and goats

 The genus Scopulariopsis contains both hyaline and dematiaceous moulds, and their teleomorphs are included in the genus Microascus.  Scopulariopsis species are saprobes commonly isolated from soil, air, plant debris, paper, and moist indoor environments.  Some Scopulariopsis species are known to be opportunistic pathogens, mainly causing superficial tissue infections, and they represent some of the principal causes of nondermatophytic onychomycoses.  Less common clinical manifestations include o keratitis following eye trauma o otomycosis o pneumonia o endophthalmitis o subcutaneous and brain abscesses o invasive sinusitis o peritonitis o endocarditis  The most frequently reported species in all clinical presentations and anatomic locations is Scopulariopsis brevicaulis.  Other less frequent species are Scopulariopsis acremonium, Scopulariopsis brumptii, Scopulariopsis flava, Microascus niger, Microascus cinereus, Microascus cirrosus, Microascus manginii, and Microascus trigonosporus .  Currently, there are close to 40 accepted species of Scopulariopsis and Microascus.  Scopulariopsis species grow well on routine laboratory media.  Histopathology has limited significance in diagnostics since in tissue, the fungi show features similar to those of other more common pathogenic moulds, such as Aspergillus or Fusarium species.  The sequencing of the ribosomal operon has been used for the identification of clinical strains of Scopulariopsis, although the results may not be reliable because of insufficient availability of reference sequences in the public databases.

Reports:

Ali-Shtayeh et al. (1989) reported Scopulariopsis brevicaulis among the fungi they isolated from the wool in 285 sheep from the West Bank of Jordan

Abdel- Gawad (1998) recoded that scopulariopsis was obtained in 36% of goats hair. Montagna et al. (2004) isolated Scopulariopsis brevicaulis from medium ripened sheep cheeses Ozturk et al. (2009) described a case of hair loss and skin changes due to Scopulariopsis brevicaulis infection of a dead goat and a sick kid, and determined effective treatments. At the macroscopic examination, both goat hair loss and skin lesions of varying size were seen along the body of the animals. Microscopically,

117 arthrospores were seen in the hair and skin samples. In parasitological examination, no parasites were observed in the skin and hair. Pure cultures of Scopulariopsis brevicaulis were isolated from skin and hair samples in Sabouraud dextrose agar with penicillin and streptomycin. The infection in the kid was successfully treated by itraconazole (100 mg/kg, daily, for 6 weeks) and D-biotin (twice 0.1 mg/kg i.m., at 1- week interval).

Hair loss and matted skin of the goat before death. Ozturk et al. (2009)

Morphology of Scopulariopsis brevicaulis colony, which is initially white, with powdery surface, and at the later stages of culture became buff-coloured. Chains of Scopulariopsis brevicaulis – brunched chains, strong rough-walled, lemon-shaped conidia, cotton-blue lactophenol staining. Ozturk et al. (2009)

Sallam and ALKolaibe (2010) examined the mycoflora of 80 samples of goats hair and sheep wool (40 each) from Taiz city at Yemen and calculated the frequency of occurrence and the relative importance value for different fungal species found. 38 species related to 21 genera from goats hair and sheep wool were identified. The highest count of fungal colonies (303 and 220 colonies /360 segments) was recorded on goats hair, while low counts (185 and 140/360 segments) were noticed on sheep wool. the most prevalent genera on the two substrates were Aspergillus, Chrysosporium and Scopulariopsis. Scopulariopsis (represented by 2 species)

118 occupied the third place in the number of cases of isolation. The genus was isolated from 23% and 20% of the samples comprising 10.6% and 8.2% of total fungi by the two isolation methods, respectively. Of the two species identified S. brevicaulis was the most dominant. It was recovered each from 20% of the samples sharing with 96.9% and 100% of total Scopulariopsis and 10.2% and 8.2% of total fungi. S. candida was recovered in rare occurrence.

Ilhan et al. (2016) isolated Scopulariopsis brevicaulis from a case of subclinical mastitis in a hair goat.

Scopulariopsis brevicaulis. Sabouraud dextrose agar, 25°C, 7 days Ilhan et al. (2016)

Awad (2017) evaluated the occurrence of mycoflora in 30 samples of healthy goat‟s hair and sheep wool collected from different localities in Taif, Saudi Arabia, and the ability of some fungal isolates for keratinase activities. Sixty four species belonging to 28 genera were identified. The genus Scopulariopsis was represented by S. brevicaulis from sheep and goats,S brumptii from goats and S. candida from sheep.

119

5. Diseases caused by multiple agents 5.1. Mycotic mastitis in sheep and goats

Mycotic mastitis in sheep and goats is usually caused by yeasts, particularly Candida albicans, and by moulds mostly Aspergillus fumigatus. It occurs as sporadic cases or sometimes as outbreaks. The following fungi have been reported in the available literature: Sheep Aspergillus fumigatus El-Naggar et al. (1997), Pérez et al. (1998), Pérez et al. (1999), Las Heras et al. (2000), Garcia et al. (2004) Candida albicans Abd El-Ghany et al. (1978), El-Naggar et al. (1997), Hassan et al. (2012), Hassan et al. (2014) Candida krusei Abd El-Ghany et al. (1978) Candida guilliermondii Abd El-Ghany et al. (1978) Candida famata Hassan et al. (2014) Cryptococcus neoformans Abd El-Ghany et al. (1978), Hassan et al. (2012) Rhodotorula rubra Hassan et al. (2014) Saccharomyces species Abd El-Ghany et al. (1978) Aspergillus niger Hassan et al. (2014) Aspergillus flavus Hassan et al. (2014) Aspergillus terreus Hassan et al. (2014) Penicillium spp Hassan et al. (2014) Fusarium spp. Hassan et al. (2014)

Goats Aspergillus fumigatus Mandal and Gupta (1993), Mandal and Gupta (1993), Jensen et al. (1996), MISHRA (1996), El-Naggar et al. (1997), Mizher (2014) Candida albicans Abd El-Ghany et al. (1978), MISHRA (1996), El-Naggar et al. (1997), Singh et al. (1998), Hassan et al. (2012), Ilhan et al. (2016), Mizher (2014) Candida krusei Abd El-Ghany et al. (1978), Mizher (2014) Candida lusitaniae Ilhan et al. (2016) Candida parapsilosis Ilhan et al. (2016) Candida glabrata Ilhan et al. (2016) Cryptococcus neoformans Abd El-Ghany et al. (1978), Singh et al. (1994), Ilhan et al. (2016), Mizher (2014) Saccharomyces species Abd El-Ghany et al. (1978) Curvularia spp. Chhabra et al. 2004, Mizher (2014) Aspergillus niger Mizher (2014) Penicillium sp. Mizher (2014) Alternaria sp Mizher (2014) Scopulariopsis brevicaulis Ilhan et al. (2016)

120

Reports:

Mandal and Gupta (1993) inoculated Aspergillus fumigatus spores in 31 (including ten lactating) healthy goats divided into 3 groups viz. intravenous (I/V), intratracheal (I/T) and intramammary (I/M). Two animals were kept as control for each group. Acute mastitis developed in the right infected udder halves only with a brief and transitory illness in all goats of I/M group and marked discrepancy in size between right inoculated and left uninfected udder halves was observed. Mycological isolation in pure culture, demonstration of fungus in the impression smears by lactophenol cotton blue staining and in histological sections by PAS and GSM methods were achieved in the right infected udder halves and their milk/secretions in I/M group. Mandal and Gupta (1994) performed an intramammary inoculation of goats with Aspergillus fumigatus spores which resulted in the development of mastitis with characteristic gross and microscopic lesions. The mastitis and the lesions were restricted to the infected udder halves only and there was no dissemination of infection to other tissues of the body. The experiment was continued for 45 days. Gross changes in the infected udder were observed up to the 45th day post-infection. The lesions, in general, included variable sized abscesses in the first 15 days followed by development of varying sized greyish-white nodules in the infected udders. Microscopic changes consisted of granulomatous reaction with well developed granulomas in the infected udders. Hyphae and spores of Aspergillus fumigatus could be demonstrated in sections of the infected udders up to 45 days after infection. Reisolation of the fungus consistently was achieved up to 45 days. It is concluded that intramammary inoculation of Aspergillus fumigatus spores in goats leads to chronic granulomatous mastitis. Singh et al. (1994) mentioned that unilateral intramammary inoculation of 10 goats with Cryptococcus neoformans (2 x 10(6) yeast cells) resulted in the development of mastitis, with gross and microscopic lesions being restricted to the infected udder halves only and there was no dissemination of infection to the opposite uninfected udder halves as well as to other organs of the body. The experiment was continued for 40 days, with 2 animals each from the infected and control groups being killed on 5th, 10th, 20th, 30th and 40th day post-inoculation (DPI). Initial enlargement of the infected udder halves was followed by marked decrease in size leading to very small, firm and nodular udder halves. After infection, there was also sharp fall in the milk yield. Cryptococcal organisms were demonstrated in the mastitic milk and udder impression smears with special stains. C. neoformans was reisolated from the milk of the only infected udder halves up to 25th DPI. Microscopically, there was initially acute diffuse purulent mastitis which later on became chronic, characterised by marked infiltration of lymphocytes, macrophages, extensive fibrosis and development of multiple granulomas. The cryptococcal organisms could be demonstrated in the udder sections only up to 30th DPI. Jensen et al. (1996) reported mycotic mastitis in 27 out of 73 goats on a dairy farm, in the post-partum period. Purulent mammary secretion, progressive induration of the affected glands, slight fever and weight loss were observed. As treatment produced no improvement within 2-3 weeks, all diseased animals were slaughtered. At postmortem examination, widespread acute and chronic mycotic lesions were seen throughout the affected glands. Infection was thought to have spread through the milk ducts as an ascending infection resulting from prophylactic intramammary treatment with antibiotic before parturition. In all lesions, Aspergillus hyphae were identified by

121 indirect immunofluorescent labelling, which gave a strong and uniform reaction with polyclonal and monoclonal antibodies to Aspergillus fumigatus. In a single granulomatous lesion, zygomycotic hyphae were also identified immunohistochemically. At terminal swellings of Aspergillus hyphae, "yeast-like bodies" were produced, a phenomenon which seems to be associated with special, but unknown, circumstances. Mishra et al. (1996) studied 44 samples of goat milk which were positive using the California Mastitis Test. fungal isolates were identified as Aspergillus niger (4.54%); and Candida albicans (2.27%).

El-Naggar et al. (1997a) isolated the following yeasts and moulds from milk samples collected from mastitic and apparently healthy sheep and gosts.

El-Naggar et al. (1997b) performed 2 experiments of mycotic mastitis in 2 groups of ewes and goats. The first group was inoculated intramammary with spore suspension of Aspergillus fumigatus and the second group with spore suspension of Candida albicans. Development of mycotic mastitis in both groups was detected, but the lesions were restricted to the infected udder halves only and not extending to the body organs. The animals were sacrificed 25 days after infection, gross lesions were described. Microscopical examination of the first group revealed mycotic granulomatous mastitis. Aspergillus fumigatus hyphae were seen in the center of the lesions which was heavily infiltrated with neutrophils, lymphocytes, macrophages and surrounded by fibrous connective tissues. Diffuse necrosis and cavitation of the udder tissues were detected and reproductive vesicles of Aspergillus fumigatus were also seen. Pathological examination of the second group revealed extensive suppurative mycotic mastitis characterized by diffuse enlargement of milk acini which were highly infiltrated with neutrophils, macrophages, lymphocytes and giant cells. Also few aggregation of giant cells phagocyizing some fungal elements were detected. Candida albicans pseudohyphae were seen in the affected lesions.

122

123

Pérez et al. (1998) diagnosed mammary aspergillosis in four flocks of dairy sheep, comprising a total of 1,750 ewes. These animals had been treated prophylactically by intramammary infusion with cloxacillin 5 months prior to lambing. Mammary aspergillosis with concomitant spread to the regional lymph nodes was present in these flocks in a percentage ranging from 2% to 36.4% of treated sheep. Pathologic, bacteriologic, and mycologic studies were performed in seven of the affected ewes. Some of them also had lung, kidney, and liver involvement. The pathologic reaction within lesions ranged from the acute to subacute type, dominated by necrosis and vasculitis with thrombosis, to the chronic granulomatous type, with macrophages and giant cells. The distribution of lesions and the presence of a remarkable vasculitis with fungal thrombi in the mammary gland suggested a hematogenous dissemination of the infection from this organ. Immunologic staining with monoclonal antibody MAb-WF- AF-1, which reacts specifically with Aspergillus hyphae, identified the causative agent in histologic sections of the different affected tissues. The etiologic diagnosis was further supported by the isolation of Aspergillus fumigatus in pure culture from affected tissues and from eight samples of mammary secretions. Singh et al. (1998) conducted a study with the objectives to understand hitherto little known aspects of candidal mastitis, like its sequential pathology, pathogenesis and clinico-biochemical changes. Unilateral intramammary inoculation of 10 goats with Candida albicans (1.2 x 10(7) yeast cells) resulted in the development of mastitis, with gross and microscopic lesions being restricted to the infected udder halves only and without dissemination of infection to the opposite uninfected udder halves as well as other organs of the body. The experiment was continued for 40 days and after infection, there was sharp fall in milk yield and Candida albicans was directly demonstrated in the milk and re-isolated from the milk and udder tissues up to 30th day after inoculation. An increase in total immunoglobulins in the milk and plasma along with increase in total plasma proteins were also observed. Haematology revealed leukocytosis and neutrophilia. Microscopically, there was acute purulent mastitis, which later became chronic, nonpurulent and interstitial with formation of granulomas. It was concluded that Candida albicans was highly pathogenic to the lactating goat mammary gland even without immunosuppression or antibiotic treatment, resulting in severe irreversible tissue damage and nearly complete agalactia. Pérez et al. (1999) described two cases of systemic aspergillosis in dairy sheep from a flock in which fungal mastitis appeared subsequent to the antibiotic treatment of animals before parturition. Lesions characterized by necrosis and a pyogranulomatous exudate were observed in the mammary glands, supramammary and mediastinal

124 lymph nodes, kidneys, lung, liver, heart, forestomachs and brain. The intense vasculitis with thrombosis observed in various organs, but especially in the mammary glands, suggested a haematogenous dissemination of the infection from this organ. The aetiological diagnosis was accomplished by the immunohistochemical staining of the fungal structures seen in the histological sections by the specific Aspergillus monoclonal antibody Mab-WF-AF-1 together with the isolation of Aspergillus fumigatus in pure culture from affected tissues. Las Heras et al. (2000) carried out an intramammary Aspergillus fumigatus infection in dairy ewes associated with antibiotic dry therapy

Chhabra et al. (2004) isolated Curvularia species from a case of subclinical mastitis in a goat. Garcia et al. (2004) compared three techniques for the diagnosis of mammary aspergillosis in ewes: indirect ELISA to detect the level of anti-Aspergillus IgG in serum, determination of galactomannan (Platelia procedure), and detection of DNA of Aspergillus in serum by a nested PCR. Twenty sera from proven cases of aspergillosis in ewes were positive using ELISA (100%), 80% were positive using PCR, but only 55% were positive using Platelia. All 20 control sera were negative using ELISA and PCR, whereas using Platelia methodology one was positive and the other doubtful. The detection of antibody by ELISA in sera is therefore a reliable criterion for the diagnosis of mammary aspergillosis in ewes. Platelia showed the same deficiencies reported in humans, with the appearance of false positives and negatives. The use of PCR was promising and might have valuable application in human medicine. Hassan et al. (2012) isolated C. albicans from 32% and 24% of milk samples collected from mastitis cases of sheep and goats, respectively. Cr.neoformans was detected in 4% of milk samples of mastitic sheep

Hassan et al. (2014) investigated the mycotic mastitis in sheep during the period from October 2011 to May 2012 in different areas of Al-Diwaniya province. 253 ewes were examined, from which 500 milk samples were collected (495 samples from apparently healthy ewes that examined by California Mastitis Test (CMT ) in addition to five samples from sheep infected with clinical mastitis). Results indicated that the incidence of mastitis in ewes was 17.8%. Yeasts isolates were Candida famata and Rhodotorula rubra from the clinical cases of mastitis only. Moulds were identified as Asperigllus niger, 28.84%, Asperigllus flavus, 23%, Asperigllus fumigauts, 17.30%, Pencillium spp, 13.33%, Asperigllus terreus, 5.76%, and the least percentage of isolation 3.84% was of the Fusarium spp. Mizher (2014) collected 172 milk samples from subclinical and clinical mastitis udders of 86 does in many parts of Al-Diwaniya province, Iraq,. The results showed that 6 samples (3.48 %) were diagnosed as clinical mastitis and 57 samples (33.13%) as subclinical mastitis. Mycotic mastitis in does was recorded in 25 milk samples (14.53%), 3 samples (1.74%) from clinical form and 22 (12.79%) from subclinical cases. Different species of fungi were isolated from milk samples, 37.93% of these were yeasts and 62.06% were moulds. The yeasts isolated were: Candida albicans (24.13%), Cryptococcus neoformans (10.34%) and Candida krusei (3.44%). The mould isolates were identified as: Aspergillus niger (31%), Aspergillus fumigatus (13.79%), Penicillium (10.34%), Alternaria and Curvularia (3.44%) for each one.

125

Panelli et al. (2014) applied culture-independent methods for the characterization of fungal populations (yeasts and moulds) naturally occurring in Sardinian ewe's milk sampled in the Italian areas with the largest dairy production (Sardinia and Lazio regions). Sequences of the D1/D2 variable domains at the 5' end of the 26S rRNA gene were obtained by amplification of DNA directly isolated from milk, and this allowed identification of a total of 6 genera and 15 species of fungi. Among the 6 identified genera Geotrichum spp., Candida spp., Phaeosphaeriopsis spp., Pestalotiopsis spp. and Cladosporium spp. belong to the phylum of Ascomycota, while Cryptococcus spp. is part of the phylum of Basidiomycota. In particular, two genera (Pestalotiopsis and Phaeosphaeriopsis) and two species (Plectosphaerella cucumerina and Pryceomyces carsonii) have never been reported in dairy ecosystems before. Results provided evidence that several moulds and yeasts, previously described only in ovine cheeses, are transferred directly from raw milk. Ilhan et al. (2016) identified the fungal agents in milk samples of hair goats. A total of 170 milk samples were collected from the goats with clinical and subclinical mastitis and clinically healthy animals. The samples were collected from the beginning stages of lactation in goats located in Van region, in Turkey. The samples (approximately 10 ml) were obtained in sterilised sample bottles and transferred immediately to the laboratory and California mastitis test was carried out. Milk samples were centrifuged at 4000 rpm for 10 min and sediments were cultivated on sabouraud dextrose agar (SDA) by sterile cotton swabs. Petri dishes were incubated at both 25°C and 37°C for 5 weeks. Fungal agents were isolated from 19 (11.1%) of 170 goat milk samples. In culture, 3 (1.7%) milk samples were positive for Candida (C.) albicans, 2 (1.1%) for C. lusitaniae, 1 (0.5%) for C. parapsilosis, 1 (0.5%) for C. glabrata, 2 (1.1%) for Cryptococcus neoformans, 1 (%0.6%) for Nocardia spp., 4 (2.3%) for Penicillium spp., 3 (1.7%) for Scopulariopsis brevicaulis, 2 for (1.1%) Aspergillus fumigatus. All clinical mastitis samples were found to be negative for fungi. In conclusion, bacteria are believed to be the major cause of mastitis, but present study indicated that fungi are responsible as primarily aetiological agents of mastitis in goats.

A hair goat with clinical mastitis Ilhan et al. (2016)

126

Cryptococcus neoformans. Sabouraud dextrose agar, 25°C, 5 days Ilhan et al. (2016)

Scopulariopsis brevicaulis. Sabouraud dextrose agar, 25°C, 7 days Ilhan et al. (2016)

127

5.2. Mycotic abortion in sheep and goats

 Mycotic placentitis has been induced experimentallv in sheep, a species not naturally prone to the disease, by inoculation with A. fumigatus spores (Cysewski and Pier. 1968: Pier, Cvsewski and Richard, 1972, El-Naggar et al. (1997).  The ovine infection has been used as an experimental model to examine the pathological and immunological changes which occur during the course of placental infection (Cysewski and Pier, 1968: Corbel. 1972, Thurston et al., 1972: Corbel et al. 1973).  The main fungi reported in mycotic abortion were: o Aspergillus fumigatus Cysewski and Pier (1968), Pier et al. (1972), Day and Corbel (1974), El-Naggar et al. (1997), Atwa and Rady (2007) Dehkordi et al. (2012), Faris et al. (2013) o Candida albicans Atwa and Rady (2007), Maneenil et al. (2015), Ophelders et al. (2016)

Reports: Gardner (1967) mentioned that several different species of fungi have been incriminated as agents capable of causing abortion in cattle In sheep, however, no recorded instance of abortion due to fungal invasion of the allantochorion could be found in the literature. He described an outbreak of suspected mycotic abortion in ewes. Cysewski and Pier (1968) described pathologic changes in mycotic abortion in ewes produced by Aspergillus fumigatus Pier et al. (1972) reported mycotic abortion in ewes produced by Aspergillus fumigatus experimentally by intravascular and intrauterine inoculation. Day and Corbel (1974) observed no significant changes in relation to infection in the haemoglobin concentration, erythrocyte sedimentation rate, packed cell volume, mean corpuscular haemoglobin concentration or erythrocyte morphology of sheep inoculated with Aspergillus fumigatus spores. There was little evidence of changes in total leucocyte count in most sheep in the first few weeks following inoculation, although those animals receiving larger inocula showed signs of an increasing leucocytosis at the terminal phase of gestation. This increase was even more pronounced at the time of lambing or abortion. Compared with uninoculated pregnant controls, the mean relative neutrophil counts of the inoculated sheep tended to increase during the later stages of gestation and showed highly significant increases at the time of lambing or abortion. Both total leucocyte and relative neutrophil counts were significantly higher in those sheep showing signs of placental infection than in those inoculated animals with no evidence of placentitis. There was some evidence of a relationship between the dose of A. fumigatus conidia inoculated and the severity of infection as indicated by the number of animals aborting, extent of placental involvement and reduction in mean gestation period. Irrespective of inoculum size, only a proportion of inoculated animals developed detectable placentitis.

128

El-Naggar et al. (1977a) isolated the following yeasts and moulds from the cervical swab samples of pregnant and aborted sheep and goats.

El-Naggar et al. (1997c) induced mycotic abortion experimentally in pregnant ewes and goats. Twelve animals were inoculated i.v. with 10 ml of Aspergillus fumigatus spore suspension containining 2x107 viable spores and 4 pregnant animals were kept as control. All experimental animals aborted between 20-30 and 19-29 days postinfection in ewes and goats, respectively. Uteri, maternal and foetal placenta and foetal tissues showed thrombosis, extensive necrosis, infarctions and invasion with Aspergillus fumigatus hyaphae. Skin lesions of aborted foeti were detected. Mycotic granulomatous inflammation was recorded in the lungs, brains, spleens and kidnyes.

129

130

Atwa and Rady (2007) collected 120 aborted foeti, vaginal discharges and placentas from 70 aborted ewes and 50 aborted goats from Menoufiea Governorate, Egypt, for bacteriological and mycological examinations. Swabs from the stomach and intestinal contents of aborted fetuses as well as liver, spleen and lungs were collected. Mycological examination of aborted foeti, vaginal discharage and Placenta of aborted sheep revealed the isolation of Aspergillus fumigatus, Aspergillus niger, Aspergillus flavus, Candida albicans , Candida krusei, Mucor spp. Abisidia spp. and Rhodotrula spp. with incidence of (12.9%,5.7%, 2.9%, 8.6%, 2.9%, 4.3%, 2.9% and 1.4%, respectively). While the fungi isolated from aborted she goats were Aspergillus fumigatus, Aspergillus niger, Aspergillus flavus, Candida tropicalis, Candida albicans, Mucor spp., Rhizopus spp., Penicillium pp. and Fusarium spp. with incidence of (14%, 6%, 2%, 10%, 8%, 6%, 4%, 2% and 2%, respectively).

Dehkordi et al. (2012) performed a study for detection of Aspergillus species (A. fumigatus, A. flavus, A. niger and A. terreus) in aborted bovine, ovine, caprine and camel foetuses by real-time PCR in Iran. After modification of real-time PCR on abomasal contents, from the total number of 970 samples, 141 (14.53%) gave positive results for Aspergillus species. Of them, 62 (17.71%), 33 (14.04%), 27 (12.05%) and 19 (11.8%) positive specimens were detected in bovine, ovine, caprine and camel foetuses respectively. Statistical analysis showed significant differences between bovine and camel and bovine and caprine aborted foetuses. Aspergillus abortion was the most prevalent in cattle whereas camels tended to be the most resistant. This study was the first report of direct identification of Aspergillus species by real-time PCR in aborted bovine, ovine, caprine foetuses in Iran and camel foetuses in the world.

Faris et al. (2013) performed a study to isolate the fungal species associated with ewe abortion and to examine the histopathological changes in the placenta associated with fungal isolates and to study the genetic information of TNF alpha gene, intensity and score of TNFalpha protein in aborted and normal placenta by PCR and IHC respectivly. Frozen placental tissue and paraffin embedded tissue belong to aborted and normal groups were used for assessment of TNF alpha gene by studying the genetic information of TNFalpha gene in aborted and normal placental sample by PCR. Immmunohistochemical study was carried out to determine TNF protein in the placental sample. The same frozen placenta tissue samples were also used for DNA extraction to detect TNF alpha gene in the two groups. A fragment of (238 bp ) of the TNF alpha gene was amplified by PCR using primers ,the sequence of sense and antisense primer for TNF alpha gene was: GAA TAC CTG GAC TAT GCC GA, CC TCA CTT CCC TAC ATC CCT (bp 238) Gene Bank: X56756. The study showed

131 that 10 fungal species were isolated from aborted placenta. The fungal isolates were variable according to region of sample collecting, high percentage in the ALManathera(36%),followed by Al-Kuzweenia (34%) and Al-Shabaka(30%). The fungal isolates include Coccidioides immitis (16%). Aspergillus.fumigatus (14%), Rhodotorula rubra, and Aspergillus.ochraceus , (10%) for each one . Candida krusei, (8%). Aspergillus.flavus and Geotrichum , 6%) for each one. Prototheca zopfi, Saccharomyces.cerevisiae, Cryptococcus uniguttultus and Candida zeylanoides, (4%) for each one. The histopathological examination showed acute suppurative placentitis, necrosis of chorion villi, congestion of blood vessels with fibrin deposition in the villus stroma and inter villus space, in addition to calcification in the villus stroma and sloughing and desquamation of cytotrophoblast .numerous yeast and spheriols were detected in the placental tissue by periodic acid Schiff reaction(PAS).

Amplified DNA of TNF –alpha gene in ewes Lane-1:Ladder universal ladder kit 100-10000 bp size Lane-2:TNF- alpha gene amplified from normally delivered ewe at 238 bp Lane 3.controlLane4&5:Amplifid TNF-alpha gene in aborted ewes at the level 238 bpLane 6:Amplification of TNF-gene 2 bands 238 &300 bpLane 7: Amplification of TNF-gene 3 band 238,400 &600 bp. Faris et al., 2013

Placenta from normal delivery ewes showing TNF-alpha expression (cytoplasmic staining) of macrophage .Score 1, Moderate Intensity.(IHC).Stained by DAB-chromogen (Brown) and counter by Hematoxyline.400X. Placenta from aborted sheep showing TNF-alpha expression (cytoplasmic staining) of Macrophage .Score 3,high Intensity.(IHC).Stained by DAB-chromogen (Brown) and counter by Hematoxyline.400X. Faris et al., 2013

Histopathological section in the placenta of aborted sheep shows severe necrosis of cotyledon ,congestion of blood vessels with neutrophils infiltration in the necrotic area (H&Estain 40X) Histopathological section in the placenta

132 of aborted sheep shows edema. congestion of blood vessels with neutrophils in their lumen and vacuolation of trophoblasts (H&E stain 40X) Faris et al., 2013

Histopathological section in the placenta of aborted sheep shows congestion of blood vessels with neutrophils in their lumen yeast in the necrotic debris (PAS stain 40X). Histopathological section in the placenta of aborted sheep shows yeast in the necrotic debris (PAS stain 40X) Faris et al., 2013

Maneenil et al. (2015) injected 107 colony-forming units of C. albicans intra- amniotically in sheep. After 2 d, animals were then randomized to: (i) intra-amniotic and fetal intraperitoneal saline with delivery after 24 h (3 d C. albicans group); (ii) intra-amniotic and fetal intraperitoneal injections of fluconazole with delivery after either 24 h (3 d C. albicans plus 1 d fluconazole group) or 72 h (5 d C. albicans plus 3 d fluconazole group). Controls received intra-amniotic injections of saline followed by intra-amniotic and fetal intraperitoneal fluconazole injections. Intra-amniotic C. albicans caused severe fetal inflammatory responses characterized by decreases in lymphocytes and platelets, an increase in posterior mediastinal lymph node weight and proinflammatory mRNA responses in the fetal lung, liver, and spleen. Fluconazole treatment temporarily decreased the pulmonary and chorioamnion inflammatory responses. Ophelders et al. (2016) studied immunological responses and structural changes of the fetal brain in a well-established translational ovine model of intra-amniotic C. albicans infection and tested whether these potential adverse outcomes of the fetal brain were improved in utero by antifungal treatment with fluconazole. Pregnant ewes received an intra-amniotic injection of 10(7) colony-forming units C. albicans or saline (controls) at 3 or 5 days before preterm delivery at 0.8 of gestation (term ~ 150 days). Fetal intra-amniotic/intra-peritoneal injections of fluconazole or saline (controls) were administered 2 days after C. albicans exposure. Post mortem analyses for fungal burden, peripheral immune activation, neuroinflammation, and white matter/neuronal injury were performed to determine the effects of intra-amniotic C. albicans and fluconazole treatment. Intra-amniotic exposure to C. albicans caused a severe systemic inflammatory response, illustrated by a robust increase of plasma interleukin-6 concentrations. Cerebrospinal fluid cultures were positive for C. albicans in the majority of the 3-day C. albicans-exposed animals whereas no positive cultures were present in the 5-day C. albicans-exposed and fluconazole-treated animals.

133

5.3. Mycotic pneumonia in sheep and goats

Fungi recorded in mycotic pneumonia in sheep and goats

Aspergillu sp. Fragner et al. (1970), Young (1970), Rehbinder (1977), El-Naggar et al. (1997) Emmonsia crescens Ohbayashi and Ishimoto (1971) , Koller and Helfer (1978) Mortierella wolfii Cordes et a:l. (1972) Pneumocystis carinii Chauhan and Dwivedi (1974) Cryptococcus neoformans Lemos et al. (2007), Hassan et al. (2012) Candida albicans El-Naggar et al. (1997), Hassan et al. (2012) Rhodotorula rubra Monga and Garg (1980)

Reports: Fragner et al. (1970) reported bronchopulmonary aspergillosis in lambs. Young (1970) reported pulmonary aspergillosis in lambs. Ohbayashi and Ishimoto (1971) reported two cases of adiaspiromycosis in small mammals. Cordes et al. (1972) described mycotic pneumonia and placentitis caused by Mortierella wolfii in experimentally infected sheep. Chauhan and Dwivedi (1974) described pneumomycosis in sheep and goats. Rehbinder (1977) described a case of mycotic granulomatous pneumonia due to Aspergillus sp. The route of infection was discussed. Koller and Helfer (1978) diagnosed adiaspiromycosis in the lungs of a goat. Monga and Garg (1980) reported a case of pulmonary infection due to Rhodotorula rubra in a sheep based upon isolation and histopathological demonstration of the fungus is described. A local, non-descript, 4 years ewe died suddenly after showing signs of respiratory distress on a Government Sheep Breeding Farm. The post mortem examination revealed the presence of some casmus suppurative nodules in lungs and liver, other organs appeared normal. These lesions were collected for cultural and histopathological examinations. Lung and Lver pieces showing lesions were cultured aerobically on 10 % sheep blood agar plates and Sabouraud dextrose agar slants. Haemotoxilin-Eosin (HE) and Gomori-Methenamine Silver (GMS) stained lung and liver sections were examined for histopathological lesions and fungal cells, respectively. Purified colonies were examined for their morphological, cultural and biochemical characters. The assimilation tests of various carbon compounds were performed as per technique of Beijerinck (Hunter and Cooper 1974). Identification of the isolate was done according to “Key to the species of the genus Rhodotorwla” suggested by Phaff and Ahearn (Lodder, 1970).

134

Mandal and Gupta (1993) inoculated Aspergillus fumigatus spores in 31 (including ten lactating) healthy goats intravenously (I/V), intratracheally (I/T). Two animals were kept as control for each group. Clinical aspergillosis developed and was more severe and fatal in consequence in I/V group than those of other groups. Respiratory symptoms appeared and persisted in both I/V and I/T groups. Haematological examination revealed significant decrease of haemoglobin concentration and significant increase in both TLC and DLC (neutrophilia) in I/V group but no marked haematological change was observed in I/T and I/M groups. Mycological isolation in pure culture, demonstration of fungus in the impression smears by lactophenol cotton blue staining and in histological sections by PAS and GSM methods were achieved in the lungs, kidneys, heart, liver, spleen and abomasum in I/V group, in the lungs and occasionally in the mediastinal lymph node and liver in I/T group. El-Naggar et al. (1977c) inoculated 12 pregnant ewes and goatsinoculated i.v. with 10 ml of Aspergillus fumigatus spore suspension containining 2x107 viable spores. All animals aborted between 20-30 and 19-29 days postinfection in ewes and goats, respectively. Mycotic granulomatous inflammation was recorded in the lungs. Lemos et al. (2007) reported the anatomopathology of respiratory cryptococcosis in ovine and the recuperation and identification of Cryptococcus neoformans var. neoformans from 1-year frozen lung tissue sample. The findings from haematoxylin/eosin staining microscopy and special staining showed the destruction of the columnar respiratory epithelium architecture associated to suppuration, and the growth of spherical yeast buddings sometimes involved by clear halo produced by unstained capsular substance. The agent was identified by miniApi ID32C, while variety neoformans was further identified by culture in CGB agar. The diagnosis in stock animal suggests the involvement of an exogenous source of the agent as an alert to public health and contributes for epidemiological investigations. Hassan et al. (2012) isolated C. albicans from from nasal swabs of sheep and goats that suffered from respiratory disorders (20% and 16 %), respectively. The lower infection with C. albicans was reported in nasal swabs of apparently healthy cases (12% of sheep and 4% of goats). It was interesting to report that Cr.neoformans was detected in 4% of of nasal discharge of sheep suffered from respiratory disorders.

135

6. Diseases caused by algae 6.1. Protothecosis in sheep and goats

Prototheca sp. are microscopic, ovoid to globose, unicellular, achlorophilous algae with hyaline refractile cellulose wall surrounding granular cytoplasm.  The genus Prototheca encompasses six generally accepted species (Cremonesi et al., 2012) o P. stagnora, o P. ulmea, o P. blaschkeae, o P. wickerhamii, o P. zopfii, and o P. cutis sp. nov.  The species P. blaschkeae, P. wickerhamii, P. zopfii, and P. cutis are considered causal agents of local human and/or animal infections (Milanov et al., 2006, Roesler et al., 2006, Marques et al., 2008, Satoh et al., 2010, Wawron et al., 2013).  P. zopfii has been isolated worldwide from milk of cows with clinical and subclinical mastitis (Anderson and Walkerm 1988, Costa et al., 1996, Aalbaek et al., 1998 Malinowski et al., 2002).  P. zopfii (variant II) and P. wickerhamii have been reported to be the causative agent of bovine protothecal mastitis [Dion , 1982, Schuster et al., 1983, Gonzalez, 1996].  In goats, the disease was reported in an animal with noisy, difficult respiration in the semiarid rangeland of the State of Paraíba, Northeastern Brazil. Ulcerated pyogranulomatous necrotising multifocal nodules were observed in the nasal vestibule, mucocutaneous region and nasal and lip skin and in the border of the right ear. Myriads of walled sporangium, characteristic of P. wickerhamii, were observed histologically (Macedo. 2008).

Sources of Infection and transmission  Members of the genus Prototheca are saprophytes, originally recovered from slime or trees and subsequently isolated from a variety of sources, including potato skin, soil, mud, acidic stream, lake waters, marine waters, sludge in water stabilization ponds and faeces of various animals including bovine and pig faeces [Gonzalez, 1996].  Algae belonging to the genus Prototheca occur all over the world, primarily in humid habitats rich in organic material.  The organism even survived routine disinfection procedures with a chlorine solution (Costa et al., 1967, Anderson and Walker, 1988 ).  They were isolated from o milk of lactating animals o milking machines, o feeding and watering troughs, o soil, o faeces, o dung channels

136

o communal sewages where they can survive for weeks to months. Diagnosis

Direct detection

 Diagnosis of protothecal mastitis depends on the demonstration of cells of a Prototheca sp. from tissues and in secretions from infected animals  The organisms can be demonstrated in unstained wet mounts from specimens or in fixed smears stained with a Romanowsky-type or fungal stain [Hirsh and Zee, 1999].

Isolation and identification  Prototheca sp. can be grown on routine mycological media, including Sabouraud‟s Dextrose agar, which is free of the antifungal agent cycloheximide, but chloramphenicol can be used to inhibit bacterial contaminants.  Media containing glucose (e.g. Sabouraud's dextrose agar) are the most suitable for culturing P. zopfii (Pore et al., 1983, Costa et al., 1996).  Use of 8% sheep blood agar as culture media appears better in an incubation period of only 48 h at 37_C for isolation [Varqas et al., 1996].  Contaminating bacteria and fungi might overgrow Prototheca. To suppress bacterial contaminants, 100 mg/L chloramphenicol can be added to the medium.  On Sabouraud's agar at 37°C for 48 h, P. zopfii forms flat, colourless or whitish colonies about 2 mm in diameter with irregular margins, granular surface, and a compact central protrusion. Yellowish-white colonies of wax- like consistency 5-7 mm in diameter are seen after longer incubation times. The organism forms small, grey, dull colonies with irregular surface on blood or blood-esculine agar [Sudman, 1974].  A selective medium with the following ingredients (g/l distilled water): potassium hydrogen phthalate, 10; NaOH, 0.8; MgSO4, 0.1; KH2PO4, 0.2; NH4Cl, 0.3; glucose, 10; thiamine hydrochloride, 0.001; agar, 20; and S- fluorocytosine, 0.25, all at pH 5–5.2, was formulated and found useful for isolation of Prototheca sp. from highly contaminated sources [Pore, 1986].  Prototheca Isolation Medium (PIM) and Prototheca Enrichment Medium (PEM) containing inhibitory substances (5-fluorocytosine) can be used for the selective isolation of Prototheca and Chlorella algae. (Pore, 1973 and Pore et al., 1987  Selective culturing of Prototheca zopfii is also possible on media of pH 5.1 and containing acetate as the only carbon source.  Stereomicroscopic observation may help to identify alga colonies after 24 h of incubation (Pore et al., 1987).  By light microscopy, o the hyaline, globose to oval cells ranging in size from 1.3–13.4 to 1.3– 16.1m can be demonstrated [Sudman, 1974].

137

o the mulberry-like sporangia containing endospores can be visualized in smears made from cultures (or from the sediment of milk samples) with simple staining procedures and 400-fold magnification. o the sporangia of P. zopfii are usually ovally elongated or spherical and 15-30 p.m in diameter. o released endospores with a starch-granulated cytoplasm are oval and 8- 15 p.m in diameter.  Species can be identified by o cell walls and endospores can be readily demonstrated by direct microscopic examination and Lactophenol cotton-blue slide preparations (Sporangia, either empty or filled with endospores). o carbohydrate and alcohol assimilation test [Arnold and Ahearn, 1972, Borkhoff et al., 1982] and by o the fluorescent antibody technique [Sudman and Kaplan, 1973]. o rapid differentiation of Prototheca from Candida species can be achieved by the so-called aggregation test, which makes use of the hydrophobic character of P. zopfii. o a susceptibility test for ribostamycin (60 g/disc) is suitable for differentiating between Candida and Prototheca species. o unlike resistant budding yeasts, Prototheca isolates show an inhibition zone 25-28 mm in diameter after incubation. o electron microscopy helps in classifying P. zopfii into different variants on the basis of difference in cell size and shape, difference in mitotic activity and difference in intensity and rate of galactose and glycerol assimilation [Blaschke et al., 1985].  Simple, quick and reliable tests for diagnosis of protothecal mastitis: o Fine needle aspiration associated with scanning electron microscopy has been used in the diagnosis of bovine clinical mastitis caused by P. zopfii [Rebeiro et al., 1999]. o Counter-flow electrophoresis for detection of antibodies in serum against P. zopfii in cattle was tried successfully for diagnosis of clinical and subclinical protothecal mastitis [Blaschke et al., 1985]. o Fluorescence microscopy using Fungiqual was also reported to be a simple and sensitive method for detection of fungi and algae including Prototheca in milk samples [Deutz and Kuttin, 1990]. o Gel immunodiffusion test using the serum of the affected animal and cultured supernatant antigen of Prototheca was tried successfully for diagnosis of protothecal mastitis [Sato et al., 1998]. o Indirect enzyme-linked immunosorbent assay (ELISA) using IgG in serum and IgA and IgG1 in whey as antibody isotypes was found highly sensitive and suitable for discrimination between infected and non-infected animals [Roesler et al., 2001]. o Antigen and hyperimmun serum can be used as diagnostic tool for Prototheca strain isolation or antibodies identification through agar gel immunodiffusion [Rapuntean et al., 2001].

 The differentiation of Prototheca species is facilitated by carbohydrate assimilation tests as well as antimicrobial sensitivity tests with neomycin (P. zopfii is sensitive) and clotrimazole (P. zopfii is resistant).

138

o All cell stages of P. wickerhamii are spherical and the average cell size is about half that reported for P. zopfii. o Capsule production, detectable by Indian ink staining (the capsule does not stain), occurs in P. stagnora and P. moriformis (identified by Pore as a distinct species) .

Reports: Kaplan et al. (1983) identified unicellular green algae in two adult Nellore brown rams in India. At necropsy multiple green lesions were observed in the lungs, liver and kidneys of both sheep. Histological examination revealed necrotizing granulomas that contained numerous spheroidal to elliptical organisms ranging from 5-20 micrometers in diameter. These organisms occurred in several reproductive stages: small (5-9 micrometers) single, undifferentiated cells; intermediate (9-15 micrometers) cells undergoing nuclear and cytoplasmic cleavage; and large, mature, endosporulating cells containing two to six or more endospores. In addition, occasional large (20-35 micrometers), round thick-walled forms were among the typical cells. The cytoplasm of the algal cells contained numerous, large, irregularly- shaped and densely packed granules of varying sizes, which were strongly stained by the Gridley fungus, periodic acid-Schiff, and Gomori methenamine silver procedures. Electron microscopic studies revealed chloroplasts in the cytoplasm of these organisms. The chloroplasts consisted of smoothly contoured electron-lucent or electron-dense granules, 0.5 to 3.0 micrometers in diameter, that were either surrounded by or contiguous to two or more tightly appressed membranes or multidisc bands. Some of the alternating membranes appeared to be spirally twisted or associated with several cytoplasmic granules in one plane of section. This is the first record of algal infections in India. Zakia et al. (1989) reported cases of ovine chlorellosis in the Sudan

Bueno et al. (2006) described the occurrence of bovine mastitis caused by Prototheca zopfii in Goiás State, Brazil. Samples of milk, environment and udder were taken from a herd of 120 Holstein cows. Sabourauds dextrose agar plates were incubated under aerobic conditions at 37° C/96 h, for microbiological analysis. Somatic cell count and milk composition were also determined. Histological sections from two udders Macedo et al. (2008) reported a case of protothecosis in an adult goat with inspiratory dyspnea and stertor. Dermatitis with prominent ulcerated nodules up to 3 cm in diameter was observed in the muzzle at the mucocutaneous junctions of nasal and lip skin, and in the border of the pinna. Histologic lesions were necrotizing pyogranulomatous dermatitis and rhinitis with myriads of walled sporangia, characteristic of Prototheca wickerhamii. This seems to be the first report of protothecosis in a goat. Ramírez-Romero et al. (2010) examined formalin-fixed tissues from a dead ewe submitted to the Veterinary Diagnostic Laboratory of the Universidad Autónoma de Nuevo León for histopathological examination. These tissues were from a 48- month-old ewe with accompanying medical history of progressive emaciation. This ewe belonged to a 200 heads flock in Piedras Negras, Coahuila, Mexico. According to the owner, eight other animals ranging in age from young to adults had died or

139 were killed in extremis because of progressive emaciation during September and October, 2008. Some animals (about 20) had diarrhea and had been unsuccessfully treated with antibiotics (Oxytetracycline, 2 ml/10 kg; Engemycin® Intervet México, S.A. de C·V.) and vitamins (ADE, 2 ml; Vigantol ADE Fuerte, Bayer de México, S.A. de C·V.). Interestingly, the farmer reported that his entire flock had been drinking and grazing in a new improved area irrigated with non-treated sewage water. Gross examination of the fixed tissues revealed that the mesenteric lymph nodes were enlarged and showed coalescing areas of caseous necrosis on cut surface. The liver showed a zonal pattern and had focal to coalescing foci of pale discoloration. The fixed lung appeared mottled and firm. A striking finding observed while trimming the samples was a conspicuous green discoloration of all fixed specimens. Microscopically, the liver had focal aggregates of large macrophages admixed with few lymphocytes and neutrophils. Most macrophages contained yeast-like structures and the whole lesion was often surrounded by variable amounts of fibrous connective tissue. The intracellular organisms were round to oval, 8–14 μm in diameter and had a thick refractile cell wall that was more evident when the cysts were empty. Occasional binucleation was observed. Sporulated organisms were larger contained 2–8 spores, ranging from 2 to 6 μm in diameter. Microscopic lesions in the lymph nodes were similar, but necrosis was more extensive with abundant empty and refractile shells. In the lung, the lesions and the organisms were less numerous but still easy to find. The organisms had a strongly PAS-positive cell wall and abundant positive dense granules in the cytoplasm. The cell walls and granules also stained strongly positive with the Grocott‟s stain. Ultrastructural identification of the alga was done by transmission electron microscopy. The cell wall appeared as a thick electron-lucent structure, but the most streaking feature was the presence of small and large chloroplasts with thylakoid-stacks (grana) and electron-dense (osmiophilic) starch granules. Chloroplasts and starch granules were larger in the sporulated cells. Other ultrastructural findings include translucent cytoplasmic lipid droplets and organisms with 2 or rarely 3 nuclei.

Formalin-fixed tissues: A lung, B lymph node, and C liver. Note green discoloration in all tissues. Bar = 2.5 cm Ramírez-Romero et al. (2010)

140

Liver. Granuloma formed by large macrophages containing organisms in different stages of development. Sporangium (arrows) and endospores (arrowheads). Fibrous connective tissue admixed with cellular infiltrates, mostly macrophages and few lymphocytes. H&E stain. Bar = 20 μm Lung. Large number of organisms showing dense positive granules in the cytoplasm. Grocott stain. Bar = 20 μm Ramírez-Romero et al. (2010)

Liver. Single algal organism showing a thick cell wall (CW), large chloroplasts with thylakoid- stacks (grana) (arrows) of different size, and electron-dense (osmiophilic) starch granules (S). There are also multiple lipid droplets (arrowheads). TEM; uranyl acetate and lead citrate. Bar = 2 μm Ramírez-Romero et al. (2010) Camboim et al. (2011) reported a new case of protothecosis by Prototheca wickerhamii in goats. The animal presented severe respiratory difficulty and nodules, sometimes ulcerated, in the nasal vestibule, mucocutaneous junction of the nostrils and skin of the face. Prototheca wickerhamii was isolated from the lesions. The animal had no clinical or haematologiccl evidence of immunodepression. The agent was highly resistant to antimicrobial drugs. The goat was treated unsuccessfully with fluconazole and euthanised 10 months after the diagnosis of the disease. Histological lesions were necrotising pyogranulomatous dermatitis, rhinitis and osteomyelitis with myriads of walled sporangia characteristic of P. wickerhamii. It is suggested that in goats, protothecosis is characterised by a chronic, slowly progressive infection, which affects immunologically competent goats, causing multifocal, ulcerative, pyogranulomatous and necrotising lesions of the mucosa of the nasal vestibule, mucocutaneous junctions of the nostrils and skin of the face.

141

Goat with protothecosis, (a) at time of its arrival at the VH, and (b) 10 months later showing better body condition and severe respiratory distress Camboim et al. (2011)

. Lesions observed when the goat arrived to the VH, with nodules in the mucocutaneous junction and upper lip, Camboim et al. (2011)

Lesions 10 months later showing various ulcerated nodules in the nasal vestibulum, mucocutaneous junctions and upper lip, and a large ulcerated nodule in the dorsal skin of the nostril Camboim et al. (2011)

(a) Yellowish colonies of P. wickerhamii in Sabourand dextrose agar after 48 h incubation, measuring 2–5 mm in diameter, and showing undulate edges and umbonate elevations. (b) Sporangios of P. wickerhamiimeasuring 2.5– 13 μm in diameter. One sporangium has a morula-like structure (arrow) characteristic of P. wickerhamii. Lactophenol cotton blue. Camboim et al. (2011)

Mid-sagital cut of the goat's head. Protothecosis. Yellowish soft masses are observed on the nasal mucosa, extending from the nostrils to the rostral portion of the turbinate bones. Subcutis. Goat protothecosis. Sporangios, some of them with a morula-like structure, within inflammatory exudates of mainly macrophages. H-E. Inset: Sporangium with a morula-like appearance stained PAS. Camboim et al. (2011)

142

Everton Ferreira et al (2014) reported a case of disseminated infection by Chlorella sp. in a sheep in semiarid region of Paraíba, northeastern Brazil. The animal showed weight loss and abdominal distension. At necropsy greenish nodules were observed in liver, lung, intestine and lymph nodes. Histologically the nodules corresponded to pyogranulomas with myriad of intralesional algae. Probably the infection occurred as a result of the consumption of stagnant water or grass which had been cut in an irrigated area, conditions that are common in the dry season in the semiarid region.

Ovino com chlorelose disseminada. A. Fígado. Superfície de corte com nódulos esverdeados multifocais a coalescentes. B. Jejuno. Mucosa espessada com área ulcerada e vasos linfáticos evidentes, distendidos e esverdeados. Linfonodo mesentérico e aumentado de volume e esverdeado. Everton Ferreira et al (2014)

Superfície de corte difusamente esverdeada e friável, sem distinção da região cortical e medular e com áreas esbranquiçadas, opacas e deprimidas. D. Fígado. Observam-se múltiplos esporângios contendo grânulos basofílicos intracitoplasmáticos. Bar= 100µm. Ferreira et al (2014)

Espaço periportal distendido por miríades de algas. PAS. Bar= 100µm. F. Linfonodo. Observam-se múltiplos esporângios com grânulos e parede celular impregnados pelo Grocott. Bar= 100µm Ferreira et al (2014)

143

7. Keratinophilic fungi

 Keratinophilic fungi are natural colonizers of keratinous substrates. Some are keratolytic and play an important ecological role in decomposing α-keratins, insoluble fibrous proteins (Filipello Marchisio, 2000).  Keratinophilic fungi include a variety of filamentous fungi mainly comprising of hyphomycetes and several other taxonomic groups. Hyphomycetes include dermatophytes and a great variety of non dermatophyte filamentous fungi.  Keratinophilic fungi occur on cornfield debris in the soil and degrade hard keratin and keratinous material.  Keratinophilic fungi play an important ecological role in decomposing such residue (Filipello Marchisio, 2000; Sharma and Rajak, 2003).  Keratinophilic fungi, specially dermatophytes on animal hairs may act as a source of human and animal infections by direct contact or by contaminating working areas and dwelling places (Ripon, 1982).  Keratinophilic fungi along with dermatophytes are responsible for various cutaneous mycoses.  The presence of keratinophilic fungi on hairs of various animals has been briefly reviewed by numerous researchers in many parts of the world o Ali-Shtayeh et al., 2000; o Dobrowolska et al., 2006; o Al-Duboon and Farhan, 2007; o Nichita and Marcu, 2010; o Sallam and ALKolaibe, 2010; o Jain and Sharma, 2012; o Emenuga and Oyeka, 2013; o Enany et al., 2013). Reports:

Ali-Shtayeh et al. (1988) analysed the mycoflora of the hair in 178 goats from the West Bank of Jordan and the frequency of occurrence and the relative importance value for the different keratinophilic fungi found was calculated. One hundred and seven species which belonged to 38 genera were isolated. Thirty six of these species were either well recognised agents of mycoses (Trichophyton mentagrophytes, T. verrucosum, and M. nanum), or have been frequently isolated from human and animal lesions (Arthroderma spp., Acremonium kiliense, Alternaria alternata, Aspergillus flavus, Cladosporium carionii, and several other species). These potentially pathogenic fungal species comprised 66.9% of all keratinophilic fungi found on the hair of goats. The role of this animal as a reservoir for dermatophytes and other potentially pathogenic fungi is discussed.

Ali-Shtayeh et al. (1989) analysed the mycoflora of the hair in 285 sheep from the West Bank of Jordan. Ninety six species which belonged to 36 genera were isolated. Forty one of these species were either well-known agents of animal and human mycoses (Trichophyton verrucosum, T. mentagrophytes, Microsporum nanum, M. canis, and others), or have been isolated from human and animal lesions (Arthroderma cuniculi, A. curreyi, Chrysosporium tropicum, Acremonium kiliense, Aphanoascus fulvuscens, Aspergillus versicolor, Paecilomyces lilacinus, Scopulariopsis brevicaulis,

144 and others). These pathogenic fungi comprised 75.4% of all fungi recovered from the hair of sheep. This animal seems to represent an adequate reservoir for several dermatophytes and several potentially pathogenic fungi. Abdel-Hafez et al. (1990) collected 76 species belonging to 29 genera from 320 samples of cloven-hooves and horns of goats and sheep. Chrysosporium was the most common genus on the various substrates and comprehended the following species: C. asperatum, Chrysosporium anamorph of Arthroderma cuniculi, Chrysosporium anamorph of Arthroderma curreyi, C. georgii, C. indicum, C. keratinophilum, C. lobatum, C. lucknowense, C. pannicola, C. pseudomerdarium, C. queenslandicum, Chrysosporium state of Thielavia sepedonium and C. tropicum. Some interesting fungi were isolated: Myceliophthora anamorph of Arthroderma tuberculatum, Myceliophthora anamorph of Corynoascus novoguineensis, Myceliophthora anamorph of Ctenomyces serratus, Trichosporon cutaneum, Trichophyton terrestre and T. verrucosum. Also, several saprobic filamentous fungi tolerating high levels of cycloheximide were isolated of which numerous members of Acremonium, Aspergillus, Chaetomium, Fusarium, Penicillium, Scopulariopsis and several others. Bagy and Abdel-Mallek (1991) examined hair samples from different animals from different sites in Riyadh, Saudi Arabia for the presence of saprophytic and keratinolytic fungi. Fifty-one specimens were examined of which 19 were from rabbits, 13 from sheeps, 12 from camels and 7 from horses. Forty-eight species and one variety which belonged to 24 genera were collected during this investigation. The most common genera were Aspergillus and Chrysosporium. In low frequency, members of the genera Thermoascus, Scopulariopsis, Alternaria, Penicillium, Rhizopus, Botryotrichum, Fusarium, Ulocladium and keratinophilic fungi of the genera Microsporum, Trichophyton and Arthroderma were also recovered. El-Said and Abdel-Sater (1995) analysed the mycoflora on the hair in 25 samples of each of goats and sheep collected from El - Bahrain using two isolation methods at 25 !C. Seventy species and 3 varieties belonging to 31 genera were collected from the two substrates. The hairs of sheep were more polluted with fungi than the goat ones, containing higher total counts and number of genera and species. Two species of true dermatophytes were isolated namely: Trichophyton rubrum and T. terrestre. Several keratinophilic species were isolated, but with different frequency, of which Chrysosporium indicum, C. keratinophilum and C. tropicum were the most prevalent. El-Said et al. (2009) analyzed the mycoflora on the hair in 25 samples of each of goats and sheep collected from Libya using two isolation methods at 25℃. Seventy species and 3 varieties belonging to 31 genera were collected from the two substrates. The hairs of sheep were polluted with fungi than goat, contained high total counts and number of genera and species. Two species of true dermatophytes were isolated namely Trichophyton rubrum and T. terrestre. Several keratiophilic species were isolated of which Chrysosporium indicum, C. keratinophilum and C. tropicum were the most prevalent. The commonest saprophytes in order of frequency were members of the genera Aspergillus, Penicillium, Emericella, Alternaria and Cochliobolus.

145

Sallam and ALKolaibe (2010) examined the mycoflora of 80 samples of goats hair and sheep wool (40 each) from Taiz city at Yemen. Using two methods of isolation at 28°C. Thirty eight species belonging to 21 genera were isolated during this investigation. The results revealed that goats hair were highly contaminated than sheep wool. The most common genera from the two substrates were: Chrysosporium, Aspergillus and Scopulariopsis. The dermatophytes represented by Microsporum canis, M. gypseum and Trichophyton verrucosum were rarely recorded . Goats hair and sheep wool seem to represent an adequate reservoir for several pathogenic fungi. Emenuga and Oyeka (2013) screened 4860 animals 2570(52.88%) were goats and 2290(47.12%) were sheep. The fungi associated with the infections were identified. Of the 2570 and 2290 of goats and sheep, 80(3.11%) and 144(6.29%) had fungal lesions respectively. Fifty soil samples from the environment were collected for fungal analysis and 31 nomads were checked for fungal lesions. Antifungal biogram and animal pathogenicity studies were also done. Prevalence of fungal infections was higher on the animals from farms than those at the markets. Infection was more prevalent in animals between 13-24 months of age. The glaborous skin was mostly affected (37.5%) in the goats, while in the sheep, the face was affected most (62.5%). Fungi recovered from the animals included Trichophyton verrucosum (19.64%), T. mentagropytes,(20.54%), Microsporum gypsum (5.80%), Sporothrix schenckii (20.98%), Candida albicans (7.59%), Fusarium solanii (5.36%), Geotricum candidum (3.13%) and Aspergillus species (16.96%). Almost the same types of fungi were isolated from the nomads and the soil. These parameters when compared statistically using ANOVA was not significant, P > 0.05. Pathogenecity studies of the isolates on laboratory mice revealed that T. mentagrophytes and T.verrucosum were highly virulent. The antifungal biogram test showed the fungal isolates to be more sensitive to Fluconazole than Ketoconazole, Miconazole and Grisofulvin. Fungal skin infections are communicable diseases and poor sanitary conditions promotes there spread but if proper sanitary measures are taken, the infections may be eradicated.

Awad (2017) conducted a study to evaluate the occurrence of mycoflora in 30 samples of healthy goat‟s hair and sheep wool collected from different localities in Taif, Saudi Arabia, and the ability of some fungal isolates for keratinase activities. Sixty four species belonging to 28 genera were collected from the two substrates. The wool of sheep was polluted with fungi than goat hairs, and contained high total counts and number of fungal genera and species.

146

Nine species of true dermatophytes isolated belonged to Microsporum (3 species) and Trichophyton (6 species). Several keratinophilic species were isolated of which, Chrysosporium indicum, Chrysosporium keratinophilum and Chrysosporium tropicum were the most prevalent. The commonest saprophytes in order of frequency were members of the genera, Aspergillus, Penicillium, Alternaria and Cochliobolus. In addition, the other genera found included Acremonium, Chaetomum, Cladosporium, Cochliobolus, Fusarium, Mucor, Paecilomyces, Phoma, Rhizopus, Scopulariopsis, Stachybotrys, Trichoderma and others. Five species from 20 tested isolates (Aspergillus niger, C. keratinophilum, C. tropicum, Microsporum gypseum and Trichoderma viride) had high keratinase activity. The results of this study indicate that both goat hair and sheep wool provide a suitable habitat for dermatophytes and other keratinophilic fungi. Most of these fungi play an important role in the degradation of keratin substrates, so that they can help preserve the environment and reduce pollution.

147

8. Mycotoxins in feeds and milk of sheep and goats

The following mycotoxins were reported in sheep and goats

Aflatoxins, mainly aflatoxin B1 (AFB1) and M1 (AFM1)  in sheep Lewis et al. (1967), Höhler et al. (1999), Fernández et al. (2000), Battacone et al. (2003), Finoli & Vecchio (2003), Battacone et al. (2005), Bognanno et al. (2006), Hassan et al. (2008), Rahimi and Ameri (2012), Malissiova et al. (2013), Virdis et al. (2014)  in goats Smith et al. (1994), Hassan et al. (2004), Oliveira et al. (2005), Özdemir (2007), de Freitas et al. (2009), Mazzette et al. (2009), Motawee et al. (2009), Upadhaya et al. (2009), Urbán et al. (2010), Nudda et al. (2012), Rahimi and Ameri (2012), Malissiova et al. (2013), Virdis et al. (2014), Mugerwa et al. (2015), Silva et al. (2015 Ochratoxin A

 in Sheep Hassan et al. (2008)  in goats Wei et al. (1979)

Cyclopiazonic acid  in goats de Freitas et al. (2009)

Zearalenone  in sheep Smith et al. (1991), Reed (2001), Smith and Morris (2006), DeWolf et al. (2008), Hassan et al. (2008), Hassan et al. (2010)  in goats Dong et al. (2010a), Dong et al. (2010b) T-2 toxin  in sheep Friend et al. (1983), Hassan et al. (2008), Hassan et al. (2010) Fuminosin B1  in sheep Hassan et al. (2008), Hassan et al. (2010)

Reports: Lewis et al. (1967) studied the effect of feeding toxic groundnut meal to sheep over a period of five years.

Wei et al. (1979) studied the fate of OA) in goats given a single oral dose of 3H‐OA (0.5 mg/kg). More than 90% of the radioactivity was found to be excreted in 7 days and the majority (53%) was found in feces. Thirty‐eight percent, 6% and 2.26% of the activity was found in urine, milk and serum, respectively. The radioactivity in the liver and kidney 6 hours after feeding amounted to 1.5 and 0.5% of the total dose administered, respectively. Subsequent fractionation of liver and kidney homogenates revealed that microsomes, ribosomes and post‐ribosomal supernatant fractions contained most radioactivity. Thin layer chromatographic analyses revealed two

148 additional radioactive spots with Upvalues and fluorescent characteristics different from OA, Oα and 4‐OH‐OA. Whereas OA was found as the unaltered molecule in feces, the metabolites were primarily found in urine and milk. Less than 0.03% of free OA was found in milk during the 7‐day period.

Friend et al. (1983) gave lambs T-2 toxin at a rate of 0.6 or 0.3 mg/kg body weight per day in a protein reduced diet for 21 days to study the immunological and pathological effects of T-2 toxin in sheep. Blood was collected before T-2 treatment and on days 7, 14 and 21 of the trial for hematological and biochemical examination and for the separation of peripheral blood lymphocytes for the mitogen assay. Myeloid:erythroid ratios were determined from sternal bone marrow samples taken a day before T-2 treatment began, on day 12 and at death (day 22). Lambs treated with 0.6 mg/kg body weight of T-2 toxin daily were leukopenic on day 7 and lymphopenic on days 7 and 14. Also, on day 7, the mitogenic responses of these lambs to the B-cell mitogen, lipopolysaccharide, were significantly depressed and prothrombin times were prolonged. At necropsy, lymphoid atrophy of mesenteric lymph nodes and spleens was most marked in lambs treated with 0.6 mg/kg body weight of T-2 toxin per day. To the authors' knowledge, this is the first report of leukopenia, lymphopenia and lymphoid depletion in ruminants fed T-2 toxin. Shlosberg et al. (1991) incriminated sprouted barley grains, the waste product of malt extract production, as the cause of a lethal (96% mortality) neurotoxic syndrome in sheep fed the grains. Clinical manifestations, comprising tremors, lameness, abnormal gait, paralysis and death indicated a tremorgenic mycotoxicosis. Whilst 50% of the flock died within 17 days, mortality continued over more than 5 months. Pathological findings were limited to neuronal degeneration and necrosis in the midbrain. Germinating grains were shown to be contaminated with growth of Aspergillus clavatus. Smith et al. (1994) exposed lactating dairy goats to aflatoxin (100 and 200 ppb) and hydrated sodium calcium aluminosilicate at 1, 2, and 4% in two separate experiments. Naturally occurring low levels of aflatoxin M1 (.009 ppb) were found in the milk of the control diet, whereas there were no detectable levels of aflatoxin M1 in the milk of diets containing hydrated sodium calcium aluminosilicate in both experiments. In Exp. 1, no treatment-related differences in clinical behavior or significant difference in the feed intake, milk production, or milk component analyses were observed with 200 ppb of aflatoxin and 4% hydrated sodium calcium aluminosilicate. However, 4% hydrated sodium calcium aluminosilicate was responsible for an 86.9% reduction of aflatoxin M1 residue in the milk of diary goats. In Exp. 2, the combination of 1% hydrated sodium calcium aluminosilicate and aflatoxin at 100 ppb resulted in an overall reduction of aflatoxin M1 residue by 51.9%, which represented a mean change of aflatoxin M1 from .553 to .266 ppb of aflatoxin M1 in the milk. The diet that contained 2% hydrated sodium calcium aluminosilicate and 100 ppb of aflatoxin further reduced aflatoxin residue by a mean change from .553 to .098 of ppb aflatoxin M1, which represents an 82.2% reduction of aflatoxin M1 residue in the milk. Analysis of the data by time indicated that there were no statistical differences between days of sampling.

Tüller et al. (1998) analysed 111 silage samples from Bavaria for roquefortine by HPLC-UV- (High performance liquid chromatography in connection with an UV- detector) and ' H-NMR-spectroscopy ('H-nuclear magnetic resonance). Roquefortine

149 was detected in 24 of the samples in concentrations ranging from 48 to 28150 &kg silage with an average of 4250 pg/kg (AKMBKUST1I9.K94 ). These results indicated that silages are frequently contaminated with roquefortine and that the concentrations are relatively high in comparison with other mycotoxins in feed. Eighteen female sheep of 80.8 f 8.2 kg average bodyweight were acclimated to the animal facility for 13 days. The animals were provided with water and hay ad libitum and fed twice daily with corn silage (2 kg/day) and a mineral supplement (0.01 kg/day). A general anaesthetic was administered to each sheep and a catheter was surgically inserted into the vcna jugularis. The cycle was synchronized by intramuscular injection of cloprestinol. The control period started with the beginning of the oestrus and lasted for the whole first cycle. Roquefortinc was administered during the second cycle. The roquefortine was placed into stomach-soluble gelatinc capsules and administered to the sheep by means of a stomach tube. The amounts of roquefortine given were equivalent to zero, 5 and 25 mg/kg silage. The clinical, clinico-chemical (alaninc amenotransferase (ALT), aspartate aminotransferase (AST), glutamate dehydrogenase (GLDH), bilirubin, blood glucose) and haematological data (number of erythrocytes, leucocytes and thrombocytes; haemoglobin, packed cell volume) as well as profiles of progesterone, luteinizing hormone (LH) and follicle stimulating hormone (FSH) were recorded for 34-36 days (two cycles). The elimination of roquefortine was studied by analysing urine and faeces samples. After the animals were killed, gross pathological and histopathological examinations were performed and selected tissues and the rumen fluid as well as blood serum were analysed for the residues of roquefortine. During the experimental period no clinical signs of an intoxication were observed. No abnormities regarding food intake nor behaviour of the sheep were detectable and neither the clinico-chemical (ALT, AST, GLDH, bilirubin, blood glucose) nor the haematological parameters (number of erythrocytes, leucocytes and thrombocytes; haemoglobin, packed cell volume) were changed by roquefortine. The profiles of LH, FSH and progesterone during the experimental period were similar to those of the control period. The duration of the ovarian cycle remained within the normal range in spite of the roquefortinc burden. The post-mortem pathology, including histopathology, revealed no lesions which could be attributed to the administeration of roquefortine.

Höhler et al. (1999) fed three groups of four sheep diets consisting of 70% concentrates and 30% hay (dry matter basis, energy to supply 1.1 times the requirement for maintenance) for 4 wk with three dietary concentrations of OA (0, 2, or 5 mg/kg of concentrate feed). The OA content did not affect feed intake or nutrient digestibility. In a preliminary experiment, an OA dose of 20 mg/kg of concentrate feed greatly reduced feed intake. After 1, 2, 3, and 4 wk of the trial, significant concentrations of OA were detected in the serum of the animals fed 2 or 5 mg of OA/kg feed. This suggested that even at a dosage of 2 mg of OA/kg of concentrate feed, considerable amounts of OA were not degraded by ruminal and intestinal microorganisms. The analysis of the feces and urine samples reflected these findings; OA and Oalpha were found in significant concentrations, escaping fermentation in the rumen and in the hindgut. The current experiment demonstrates that OA hydrolysis in the gastrointestinal tract of sheep is substantially less than previously described, especially if OA is ingested in combination with concentrate-rich diets.

Fernández et al. (2000) intoxicated 24 female lambs with a diet contaminated with 2 ppm aflatoxin for a period of 37 d. Twelve lambs were maintained as the control

150 group. After this period, the lambs were left for 35 d without aflatoxin in their feed. Performance, hematology and clinical immunology were examined in the intoxicated lambs. A non-significant decrease in body weight was observed in the intoxicated lambs during the intoxication period, whereas a significant decrease (P<0.001) in average daily gain was noted on the last day of intoxication and during the clearance period. No significant differences were observed in erythrocyte count, white blood cell count or differential leukocyte count between the groups. Bacteriostatic activity of the serum was lower in the intoxicated lambs, however, there was no effect on serum opsonic activity. Phagocytosis by the neutrophils was higher during the intoxication period and the levels of IgG were elevated in the intoxicated lambs. In vivo cellular immunity was assessed by intradermal injection of phytohemagglutinin; the response was lower during intoxication period. These results indicate that a lowering in the average daily gain was the most sensitive indicator of aflatoxicosis in lambs, and that the immune response was altered, which could render the animals more susceptible to infectious diseases.Battacone et al. (2003) conducted 2 experiments to study the amount of aflatoxin M1 (AFM1) in milk in response to feeding aflatoxin B1 (AFB1). In experiment 1, four dairy ewes in early lactation received a single dose of pure AFB1 (2 mg). Individual milk samples were collected during the following 5 d to measure AFM1 concentration. The average excretion of AFM1 in milk followed an exponential decreasing pattern, with two intermediate peaks at 24 and 48 h. No AFM1 was detected in milk at 96 h after dosing. The mean rate of transfer of AFB1 into AFM1 in milk was 0.032%, with a high individual variability (SD = 0.017%). In experiment 2, 16 dairy ewes in midlactation were divided into four groups that received different daily doses of AFB1 (0, 32, 64, and 128 μg for control and groups T1, T2, and T3, respectively) for 14 d. Pure AFB1 was administered to each animal divided in two daily doses. Individual milk samples were collected at 12, 24, 36, 48, 72, 96, 144, 216, and 312 h after the first AFB1 administration, during the intoxication period, and every 24 h for 7 d after the withdrawal of AFB1. AFM1 was detected in the milk of all animals of the treated groups at 12 h after the administration of AFB1. In all treated groups, milk AFM1 concentration increased from 12 to 144 h after the beginning of administration. It then decreased, reaching a stable concentration at 216 and 312 h after the first administration. No AFM1 was detected in milk 3 d after the last administration of AFB1. Milk AFM1 concentration measured at steady-state condition was significantly affected by the AFB1 dose (0.031, 0.095, and 0.166 in T1, T2, and T3 groups, respectively), with a linear relationship between AFB1 dose and milk AFM1 concentration (R2 = 77.2%). The carryover (AFM1/AFB1 ratio) was not significantly affected by treatment, and its mean value was 0.112% (SE = 0.011). The carryover was lower than that reported for dairy cattle and goats, suggesting a better ability of sheep to degrade AFB1. Finoli & Vecchio (2003) analyzed samples of feedstuffs (15), milk (40), and cheese (30) coming from sheep and dairy farms (23) or market in Western Sicily for their respective content of aflatoxin B1 (AFB1) and M1 (AFM1) to evidence any possible indirect mycotoxin contamination risk to the consumer. Analyses using HPLC and fluorescence detection were performed after immunoaffinity column sample extraction and cleanup; AFM1 was detected in 30% of the milk samples at levels ranging from 4 to 23 ng/l and in 13% of the cheeses from 21 to 101 ng/kg; in the feed the AFB1 ranged from

151

152

Hassan et al. (2004) detected aflatoxins in 40 out of 80 serum samples of diseased goats. Aflatoxins could be detected in the feed consumed by these goats. Experimental induction of aflatoxicosis in goats revealed the same symptoms observed in the field. Biochemical and haematological examination of blood from experimental goats showed significant alterations in liver and kidney functions. Histopathological examination of the organs showed pathological changes in all organs, particularly the liver and kidneys.

Battacone et al. (2005) carried out an experiment using dairy ewes to study the transfer of aflatoxin B1 (AFB1) from feed to milk and from milk to cheese. The effects of AFB1 on liver function and hematological parameters were also investigated. Fifteen ewes were assigned to treatments in replicated 3 x 3 Latin squares. The experimental groups received 32, 64, or 128 microg/d of pure AFB1 for 7 d followed by 5 d of clearance. On the sixth day of the first period, the total daily milk produced by each ewe was collected separately and processed into cheese. The results indicate that the level of AFB1 used did not adversely affect animal health and milk production traits. The aflatoxin M1 (AFM1) concentrations in milk approached a steady-state condition in all treated groups between 2 and 7 d after the start of treatment. The mean AFM1 concentrations of treated groups in steady-state condition (184.4, 324.7, and 596.9 ng/kg in ewes fed 32, 64, or 128 microg of AFB1, respectively) were significantly affected by the AFB1 doses. The AFM1 concentration was linearly related to the AFB1 intake/kg of BW. The carry-over values of AFB1 from feed into AFM1 in milk (0.26 to 0.33%) were not influenced by the AFB1 doses. The AFM1 concentrations in curd and whey were linearly related to the AFM1 concentrations in the unprocessed milk. Oliveira et al. (2005) analysed 36 samples of pasteurised, ultra-high-temperature (UHT) treated and goat milk powder traded in the city of Campinas, Brazil, for aflatoxin M1 (AFM1), from October to December 2004 and March to May 2005. Results showed 25 (69.4%) positive samples for AFM1 at levels of 0.011– 0.161 μg L−1 of milk, which were below the tolerance limit of 0.500 μg L−1 as adopted for AFM1 in milk by Brazilian regulations. Mean levels of AFM1 in pasteurised, UHT and goat milk powder were 0.072 ± 0.048, 0.058 ± 0.044 and 0.056 ± 0.031 μg L−1, respectively. It was concluded that the incidence of AFM1 in goat milk traded in Campinas is high, but at levels that probably leads to a non-significant human exposure to AFM1 by consumption of goat milks.

153

Bognanno et al. (2006) examined, during the period of October–July 2000, 240 samples of dairy ewes milk, obtained from farms of Enna (Sicily, Italy), for Aflatoxin M1 (AFM1) by HPLC using a fluorimetric detector. The limit of detection and the limit of quantification were 250 ng/L for AFM1. All the positive milk samples for AFM1 were confirmed by LC-MS. AFM1 was detected in 81% of milk samples, ranging from 2 to 108 ng/L. Three samples were over the legal limits (50 ng/L). Mean contamination of samples obtained from stabulated ewes was higher than that from grazing ewes (35.27 vs. 12.47 ng/L). Furthermore, samples collected in the period September–October showed higher contamination than samples collected during the other months (42.68 vs. 10.55 ng/L). Both differences are related to the administration of compound feed. Based on current toxicological knowledge we concluded that the AFM1 contamination levels recorded in ewe milk did not present a serious human health hazard. However, as ewe milk is exclusively used to produce cheese due to its higher protein content, and also considering the preferential binding of AFM1 to casein during coagulation of milk, a potentially high concentration effect could occur, thus the surveillance of contamination levels should be more continuous and widespread.

Smith and Morris (2006) mentioned that zearalenone is a naturally occurring mycotoxin from the Fusarium fungus which grows on pastures in New Zealand in autumn, and it has been found on farms in some years from Northland to Southland. The toxin may interfere with oestrogen-related functions in sheep during reproduction, reducing ovulation rates and fertility and thus lambing percentages, because its chemical structure is similar to that of reproductive steroids. Forty four per cent of over 6000 New Zealand pasture samples, collected in autumn and tested for zearalenone, were found to have high enough levels for ewe fertility to be either depressed (9% of samples), or `at risk` (35%). Control of zearalenone toxin production or of Fusarium growth on pasture on a large scale is currently not feasible. Attempts to mitigate its effects by immunisation have failed or even exacerbated the problem. Provision of alternative zearalenone-free feed crops is costly and generally uneconomic. Selection of sheep for genetic resistance would seem to be the most beneficial approach. Resistance to zearalenone is inherited in sheep (heritability estimate = 0.32 ± 0.10), and a test could be set up in ram-breeding flocks to select for resistance. Özdemir (2007) determined the levels of AFM1 in goat milk commonly consumed in the city of Kilis. One hundred and ten samples of milk were collected randomly from individual farms in Kilis from March 2006 to April 2006, Turkey, samples were analysed for AFM1 by ELISA. AFM1 was not determined in 17 samples (15.46%), whereas 93 samples (84.54%) were found to contain AFM1 at various levels. In 70 of the 110 samples, the presence of AFM1 was detected in a concentration ranging between 5.16 and 116.78 ng/l. AFM1 levels in 7 (6.36%) of 110 goat milk samples were found to be higher than the maximum tolerable limit (50 ng/l) accepted by the Turkish Food Codex. We concluded that AFM1 was determined in 84.54% of the goat milk samples consumed by the people in the Kilis province. Moreover 6.36% of samples contained AFM1 at hazardous levels for human health.

Hassan et al. (2008) collected samples of ration used for feeding cattle and sheep and 200 serum samples from the animals from farms at Minufiya, El-

154

Behira and Assiute governorates, in which cattle and sheep suffered from loss of weight gain, low productivity and disturbance in fertility. These samples were evaluated for mycotoxins contamination. Aflatoxins were detected in 30% of feed samples with a mean value of 3.4 ± 0.1 ppm and ochratoxins in 20% with a mean value of 2.2 ± 0.2 ppm. Whereas, T-2 toxins and zearalenone were detected in 20% and 16% of samples with a mean level of 36.0 ± 0.1 and 22 ± 0.3 ppm, respectively. Fuminosin B1 (FB1) toxin was found in only 2% of samples at mean level of 70 ± 0.01 ppm. The detection of mycotoxins in sera of diseased cattle and sheep showed that the most prevalent mycotoxins in cattle sera was aflatoxin B1, which was detected in 40% of cases with a mean level of (5.4 ± 0.1), followed by ochratoxin A in 33% of cases with a mean level of (8.2 ± 0.1), T2 in 17% with the mean level of (26 ±0.2) and zearalenone in (10%) with a mean level of (19 ± 0.2). The lowest incidence was detected in cases of FB1, which was measured in 2% of cattle cases with a mean levels of (55 ± 0.6). Also, the pattern of incidence of mycotoxins in sheep sera was nearly similar to those in cattle with the exception that the FB1 not detected at all in sheep. The mycotoxins, aflatoxin, ochratoxin and zearalenone was given to male albino rats in the doses of 0.5, 1.0 and 2.5 ppm in feeds (respectively), for up to 6 months of age to investigate their effects on the growth rates and hormones regulating fertility (FSH, LH, Testosterone, T3 and T4). The results indicated the obvious adverse effects of mycotoxins on the secretion of these hormones and productivity of animals. The environmental pollutions particularly feed contamination was suggested to be the main source of the problem.

155

Karki et al. (2008) reported an outbreak of syndrome of unknown etiology associated with the feeding of mouldy dry forage and green fodder to goats in Dhakeri village of Banke District. Goats suddenly became ill with symptoms of knuckling of the fetlocks of the pelvic limbs, with no apparent ataxia or flexor weakness. Weight bearing was possible while the digits were extended, but with knuckling, weight was supported on the dorsal surface of the foot .The more severely affected goats were paraplegic and recumbent. Anorexia, apathy, diarrhea and ruminal stasis, flaccid posterior paralysis,hindlegs stretched forward both side of abdomin,paralysis of all four legs, head bented to sides, aimlessly head and rear shaking .On clinical examination based on history these goats were provisionally diagnosed as Dhakeri-Bange as being called locally and Endemic Mycotic polyneuropathy syndrome as seen first time in Nepal due to moldy forage/fodder poisoning in natural pasture were treated with Antidegnala liquor(sr). On mycological and microbiological examination of tissue samples from post-mortem of dead goat and forage/fodder samples from pasture and goats feeding stalls on respective medium revealed the growth of fungal pathogens like Aspergillus and Penicillium spp with E.coli.These results provide circumstantial evidence that feeding of moldy forages and green fodder leaves infected by Penicillium and Aspergillus spp may cause outbreaks of a systemic Mycosis in these goats. de Freitas et al. (2009) evaluated the presence of aflatoxins and cyclopiazonic acid in diets intended for dairy goats and their residues in milk in 10 familiar properties of Southwestern São Paulo region, totalizing 128 samples of feed and 120 samples of milk. Aflatoxins have been extracted and purified in an immunoaffinity column specific for aflatoxins B1 (AFB1), B2 (AFB2), G1 (AFG1) and G2 (AFG2) and aflatoxin M1 (AFM1). The analyses for detection and quantification of toxins were performed by high-performance liquid chromatography. From the analyses of the feeds, 2.34% of these were contaminated with aflatoxin at levels ranging from: 3.65 to 36.93 μg/kg for AFB1; 0.35 to 2.46 μg/kg for AFB2; trace to 46.06 μg/ kg for AFG1 and 0.61 to 1.65 μg/ kg for AFG2. One sample showed a concentration of 87.1 μg/kg, above that allowed by Brazilian law. Concerning CPA, 3.12% of the feed samples were positive for it at concentrations ranging from trace to 1.90 μg/kg. AFM1 and CPA were not detected in the milk samples. The results demonstrate that low contamination by mycotoxins in feeds and the absence of AFM1 and CPA in milk indicate best practices in the management and storage of these feeds.

156

Mazzette et al. (2009) carried out an experiment to study the excretion of aflatoxin M1(AFM1) in milk of three goats fed a single dose (0.8mg/head) of pure aflatoxin B1 (AFB1). The values of AFM1 concentration excreted in milk was highly variable among goats, even if the pattern of excretion over time was very similar among the three animals. AFM1 was first detected at the milking performed 1h after the AFB1 administration. The highest values of AFM1 concentration in milk were reached 3 and 6h after the AFB1 intake. The trend of clearance of AFM1 in milk over time was expressed by a decreasing exponential equation. AFM1 concentration was below the EU maximum allowed level (50 ng/L) in milk collected 36 h after the AFB1 administration. Motawee et al. (2009) collected milk from goat in Ismailia in Egypt. Aflatoxin (AFM(1)) levels were lower than previous surveys, and were influenced by feeding practices. Goats are fed a combination of prepared ration as a supplement to pasture grazing. Most milks (74%) of goat were below the European Union maximum of AFM(1) <50 ng/L and all milk samples were <500 ng/L. Upadhaya et al. (2009) compared the aflatoxin B1 degrading abilities of two different ruminants. One set of experiments evaluated the aflatoxin B1 degradation ability of different rumen fluid donors (steers vs. goats) as well as the rumen fluid filtration method (cheese cloth filtered vs. 0.45 µm Millipore) in a 2 × 2 factorial arrangement. Additional studies examined aflatoxin B1 degradation by collecting rumen fluid at different times (0, 3, 6, 9 and 12 h) after feeding. Cannulated Holstein steers (740 ± 10 kg bw) and Korean native goats (26 ± 3 kg bw) were fed a 60% timothy and 40% commercial diet with free access to water. Rumen fluid from Korean native goats demonstrated higher (p < 0.01) aflatoxin B1 degradability than Holstein steers. However, filtration method had no significant influence on degradability. In addition, aflatoxin degradation did not depend upon rumen fluid collection time after feeding, as no significant differences were observed. Finally, a comparison of two types of diet high in roughage found aflatoxin degradability in goats was higher with timothy hay opposed to rice straw, although individual variation existed. Thus, our findings showed the aflatoxin degradability is comparatively higher in goats compared to steers.

157

Dong et al. (2010a) studied histopathological changes and toxicokinetic profiles in goats administered with a single intravenous (iv) injection of ZEA at doses of 2.4 mg/kg bw and 1.2 mg/kg bw, respectively. The expression of the mRNA of estrogen receptor (ER) alpha and beta in tissues was also investigated. The histopathological study revealed that ZEA caused hepatocellular swelling and lymphocytic infiltration in the liver, kidney, and uterus. The expression of ERalpha mRNA was enhanced by ZEA in association with the histopathological changes, indicating the possible involvement of ERalpha in the toxic effects of ZEA. For toxicokinetic profiles, blood plasma, urine, and feces were collected consecutively after iv injection of ZEA and analyzed for ZEA and its metabolites with high performance liquid chromatography (HPLC). alpha-Zearalenol (ZOL) and beta-ZOL were detected with ZEA, but alpha- zearalanol (ZAL), beta-ZAL, and zearalanone were below the detection limits. The distribution half-life (t(1/2alpha)) and elimination half-life (t(1/2beta)) of ZEA were 3.15 and 28.58h, respectively. ZEA, alpha-ZOL, and beta-ZOL were excreted in urine and feces, with beta-ZOL being the predominant metabolite. The ZEA and ZOL in urine were largely in their glucuronide and/or sulphate conjugated forms, while those in feces were largely in their free forms. This study showed the toxic effect of zearalenone and its metabolites, and their pharmacokinetic characteristics in goats. Dong et al. (2010b) investigated the in vitro metabolic conversion of ZEA by various tissues of adult male and female goats. The results indicate that in the liver, α-ZOL was a major metabolite in cytosolic fractions, whereas β-ZOL was a predominant metabolite in microsome fractions. Such a feature of ZEA metabolism was confirmed by the Km and Vmaxvalues from an enzyme kinetics experiment. Post-mitochondrial fractions of the liver converted ZEA predominantly to α-ZOL, indicating that the goat liver may function as an activation organ rather than as an inactivation organ, for ZEA metabolism in goats. In most other tissues including rumen tissue, the activity converting ZEA to α-ZOL was higher than that to β-ZOL. The amount of α-ZOL formed by gastrointestinal tissues was 1/8-1/3 of that by the liver tissue in terms of the amount per mg protein, but the contribution of all gastrointestinal tissues to production of α-ZOL was estimated to be comparable to that of the liver because of the large mass of gastrointestinal tissues in ruminants. Overall the results show the importance of not only the liver tissue, but also other tissues, especially gastrointestinal ones, in the formation of a potent estrogenic metabolite, α-ZOL.

Hassan et al. ( 2010) investigated 100 cases of diseased sheep at desert districts in governorates of (Giza; 6th October and El-Wadi-El-Gadid). Sixty percent of sheep sera had mean levels of T-2, zearalenone and fumonisins of 2.5±0.2, 4.3±0.5 and 25.0±2.0, respectively. Seven genera and 15 species of fungi were recovered from feeds and water. The most predominant isolates belonged to members of genus Aspergillus with a range of (5-100%), followed by Fusarium spp. (40-90%), Penicillium spp. (10-55%) and Mucor spp. (10-50%). The Fusarium toxins were detected in the same feed samples, the largest amount was estimated in crushed yellow corn (60%) namely FB1, T2 and zearalenone with the mean levels of (48.4±1.0; 3.0±0.1 and 0.84±0.03), respectively. The significant high levels of FB1 in the present feed samples and serum of diseased sheep gave a large possibility that FB1 was responsible for this disease outbreak in sheep. The internal organs of dead cases during this disease had various significant pathological changes in vital organs including hemorrhagic, alveolar pneumonia and calcification in lung. The liver showed hemorrhage, oedema, vacuolar degeneration and necrosis of hepatocytes with evidence of preneoplastic stage in liver cells. Whereas, the kidney showed vacuolar

158 degenerating changes and necrosis of the tubular epithelium, in addition to glomurular oedema and calcium deposition.

159

Lung of sheep fed on mycotoxin (FB1, T2, ZNE) showing proliferation of the epitheliial cells lining bronchiols was severe, uncontrolled and form nest of epithelial cells giving the feature of preneoplastic stage (H & E X 100). Lung of sheep fed on mycotoxin (FB1, T2, ZNE) showing destruction of the wall of some alveoli with infiltration of inflammatory cells (lymphocytes, macrophages and neutrophils) accompanied with hemorrhage and calcification (H & E X a) 200, b) 400). Hassan et al., 2010

Liver of sheep fed on mycotoxin (FB1, T2, ZNE) showing disorganization of hepatic cord (a) with tendency to formation of irregular aceni (preneoplastic stage) (b) (H & E X 400). Kideny of sheep feeding on mycotoxin (FB1, T2, ZNE) showing necrosis of renal tubular epithelium, gromerular oedema and calcium deposition. (H & E X 400). Hassan et al., 2010

Urbán et al. (2010) conducted a study to assess the level of aflatoxin M1 (AFM1) in goat milk and cheese. Milk samples (n=60) were taken during the period July 2008 to June 2009 from 5 goats production units. Cheese samples (n=20) were taken in July 2009. Samples were analyzed by high performance liquid chromatography (HPLC) using the methods proposed by the AOAC. The results show 30% of milk samples with some level of AFM1, 18% were above the maximum permissible level (0.05 µg Kg-1) by the European Community, with a peak of 1.61 µg Kg-1. Cheese samples showed a 15% incidence of AFM1, with a maximum level of 0.23 µg Kg-1.

160

Nudda et al. (2012) determined the excretion patterns of aflatoxin M1 (AFM1) in the milk of dairy goats fed a single dose of pure aflatoxin B1 (AFB1), which can occasionally occur if feeds are infected by hot-spot growth of molds that produce aflatoxins. Five dairy goats in midlactation were administered 0.8 mg of AFB1 orally. Individual milk samples were collected for 84 h after AFB1 dosage. Aflatoxin M1 was found in milk in the highest concentration. In all goats, AFM1 was not detected in milk before AFB1 administration, but was detected in the first milking following AFB1 administration. The excretion pattern of AFM1 concentration in milk was very similar in all goats even if the values of the concentration differed between animals. The peak values for AFM1 concentration in milk was observed in milk collected during the milking at 3 and 6 h. After the peak, the AFM1 in milk disappeared with a trend that fitted well a monoexponential decreasing function, and the toxin was not detected after 84 h. Only about 0.17% of the amount of AFB1 administered was detected as AFM1 in milk, and about 50% of this was excreted in the first liter of milk yielded after AFB1 intake. Correct procedures to prevent growth of molds, and consequent AFB1 contamination, on the feedstuffs for lactating goats represent the key to providing consumers a guarantee that milk is not contaminated by AFM1.

Rahimi and Ameri (2012) analyzed a total of 150 bovine (60), ovine (42), and caprine (48) bulk milk samples using a commercially available competitive ELISA kit. Overall, AFM1 was found in 46.7 % of the analyzed samples by an average concentration of 40.3 ± 22.2 ng/L. The incidence rates of AFM1 contamination in bovine, ovine, and caprine bulk milk samples were 66.7, 31.0, and 35.4 %, respectively. The concentration of AFM1 in 37.5 % of AFM1-positive bovine milk samples and 5.9 % of AFM1-positive caprine milk samples were higher than 50 ng/L. Malissiova et al. (2013) assessed the level of AFM1 contamination in ewes and goats raw milk in Greece, identify possible risk factors and compare organic and conventional milk.Thirty-nine organic and 39 conventional farms participated in this study and 243 samples were collected, during a lactation period (December–July). A standardized questionnaire and a sampling protocol were completed for all farms and samples, including information for the farming system. Samples were screened for AFM1 with ELISA and confirmed with HPLC. Analytical results were statistically analysed as to explore any associations with the questionnaire data for possible risk factors. Out of 234 samples analysed, in 191 (81.6%) samples AFM1 was not detected, while 4 (1.7%) were found above the EU maximum tolerable limit of 50 ng kg−1. There was no conventional samples found over the maximum limit for AFM1 (0/117), while 4/117 (3.4%) organic samples exceeded 50 ng kg−1 [no statistically significant difference (p-value = 0.122)]. It was found more possible for organic farms to present AFM1 contamination in comparison to conventional [no statistically significant difference (RR 1.2, 95%CI 0.71–2.02, p-value = 0.492)]. Among several potential risk factors investigated for AFM1 milk contamination, the use of warehouse for feed storage (OR 2.69, 95%CI 1.25–5.79), winter season (OR 2.58, 95%CI 1.07–6.24) and feeding field pea (OR 4.17, 95%CI 1.41–12.32) were identified as statistically significant. Virdis et al. (2014) reported the results of a survey conducted in Sardinia Region on Aflatoxin M1 (AFM1) contamination in milk of small ruminants from 2005 to 2013. A total of 517 sheep and 88 goat milk samples from bulk tank, tank trucks and silo tank milk were collected. Analyses were performed by the Regional Farmers Association

161 laboratory using high-performance liquid chromatography following the ISO 14501:1998 standard. None of the sheep milk samples analysed during 2005-2012 showed AFM1contamination. In sheep milk samples collected in 2013, 8 out of 172 (4.6%) were contaminated by AFM1with a concentration (mean±SD) of 12.59±14.05 ng/L. In one bulk tank milk sample 58.82 ng/L AFM1 was detected, exceeding the EU limit. In none of goat milk samples analysed from 2010 to 2012 AFM1 was detected. In 2013, 9 out of 66 goat milk samples (13.6%) showed an AFM1 concentration of 47.21±19.58 ng/L. Two of these samples exceeded the EU limit, with concentrations of 62.09 and 138.6 ng/L. Higher contamination frequency and concentration rates were detected in bulk tank milk samples collected at farm than in bulk milk truck or silo samples, showing a dilution effect on AFM1 milk content along small ruminants supply chain. The rate and levels of AFM1 contamination in sheep and goat milk samples were lower than other countries. However, the small number of milk samples analysed for AFM1 in Sardinia Region in 2005-2013 give evidence that food business operators check programmes should be improved to ensure an adequate monitoring of AFM1 contamination in small ruminant dairy chain.

Zhang et al. (2014) used current RNA-seq based approaches to investigate the effects of mycotoxin exposure in a ruminant model. Having first assembled a de novo reference transcriptome, they used RNA-Seq technology to define in vivo hepatic gene expression changes resulting from mycotoxin exposure in relationship to pathological effect. As expected, characteristic oxidative stress related gene expression is markedly different in animals exhibiting poorer outcomes. However, expression of multiple genes critical for detoxification, particularly members of the cytochrome P450 gene family, was significantly higher in animals exhibiting mycotoxin tolerance („resistance‟). Further, they presented novel evidence for the amplification of Wnt signalling pathway activity in „resistant‟ animals, resulting from the marked suppression of multiple key Wnt inhibitor genes. Notably, „resistance‟ may be determined primarily by the ability of an individual to detoxify secondary metabolites generated by the metabolism of mycotoxins and the potentiation of Wnt signalling may be pivotal to achieving a favourable outcome upon challenge. Mugerwa et al. (2015) conducted an experiment to investigate the concentration, total excretion and carry-over of Aflatoxin B1 (AFB1) into milk as Aflatoxin M1. Nine crossbred lactating goats were divided into three groups of three each, based on the level of milk production. Commercial Aflatoxin B1 (AFB1) was administered to all groups at a rate of 100 ppb in the diet. Group I served as control (T1). In group II (T2), calcium bentonite (CaB) and in group III (T3), activated charcoal (AC), were added at the rate of 1% of Dry Matter Intake (DMI). Dry matter intake was not significantly different (P>0.05) among T1 (1.22), T2 (1.14) and T3 (1.13). Daily milk yield was also not significantly different (P>0.05) among treatments T1 (0.91), T2 (0.86) and T3 (1.03) during the experimental period of 14 days. The AFM1 concentration, excretion and carry-over of AFB1 in T1 continued to increase with time, whereas, the same was seen to decline in the adsorbent fed groups T2 and T3. The results suggest that supplementation of CaB or AC at 1% of DMI for lactating goats result in a reduction in AFM1 content in milk and carryover of aflatoxin from feed to milk without causing any change in composition of milk.

Silva et al. (2015) identified the mycoflora present in the feed and forage for dairy goat and to isolate and characterize the Aspergillus flavus and A. parasiticus strains

162 based on a morphological and molecular characterization and mycotoxigenic ability. The goat dairy diets were collected monthly from 11 goat milk farms, totaling 129 and 106 samples of concentrate and forage, respectively. For the isolation of the mycobiota the surface plating method was used. Aspergillus, Penicillium, and Fusarium were the main fungi producing mycotoxins isolated. The morphological and molecular characterization and mycotoxigenic ability were used for A. flavus and A. parasiticus identification. The Aspergillus spp. from feed 39% produced aflatoxins B1 and B2, 17% produced cyclopiazonic acid (CPA), 18% produced both toxins, and 42% had no toxigenic ability. Only 2.0% of the strains produced aflatoxins B1, B2, G1, and G2, but no CPA. The strains from forage were producers of aflatoxins B1 and B2 (37%), CPA (14%), 14% of both mycotoxins, whereas 49% have shown no toxigenic ability. The aflD and aflR genes were used by PCR and PCR-RFLP, respectively. The presence of toxigenic species in samples of feed for lactating goats indicates a potential risk of contamination of dairy products, if they are exposed to environmental conditions favorable to fungal growth and mycotoxin production

9. References

1. Abd El-Ghany, M,. M. T. El-Sherif and S. Abd El-Hamid (1978). Prevalence of mycotic mastitis among sheep and goats in Egypt. J. Egypt. Vet. Med. Ass. 38, 2, 85- 90. 2. Abdel-Hafez AII, Moharram AM, Abdel-Gawad K M (1990). Survey of keratinophilic and saprobic fungi in the cloven-hooves, and horns of goats and sheep from Egypt. J. Basic Microbiol. 30:13-20. 3. Abou-Eisha A. M.; M. A. Sobih; Hanaa, M. Fadel and Heba, S. El-Mahallawy. Dermatophytes in animals and their zoonotic importance in suez canal area. SCVMJ, XIII (2), 625- 2008 4. Abou-Gabal, M., G. A. El-Galil, E. A. El-Nor & D. A. El-Rehim (1976): Animal ringworm in upper Egypt, Sabouraudia 14: 33-36. 5. Abou-Elmagd , S.: Some mycological and molecular biological studies on mixed yeast infection M.S., 2011 6. Abou-Elmagd, S., Hosam Kotb, Khalid Sabry and Mohamed Refai (2011): Prevalence of Candida albicans and Cryptococcus neoformans in animals and chickens in Quena Governorate, with special reference to RAPD-PCR patterns of the isolates. J. American Sci 7, 20-31, 2011 7. Abu-Samra MT, Hago BE. Experimental infection of goats and guinea pigs with Microsporum canis and trials on treatment with canesten cream and neguvon solution. Mycopathologia. 1980 Oct 31;72(2):79-84. 8. Ainsworth, G. C. & l? K. C. Austwick (1955): A survey of animal mycoses in Britain: Genera1 aspects. Vet. Rec. 67: 88. 9. Al-Duboon A, Farhan JF (2007). Dermatophytosis in Sheep of Al-Safat show in Basrah, Iraq. Basrah J. Vet. Res. 6(1):54-62. 10. Aller-Gancedo, J. M. and Fernandez D. M. (1981): About an Ooutbreak of Ringworm in Goats caused by Trichophyton verrucosum in Spain. Anales de la Facultad de Veterinaria de Leon, 27: 137-142. 11. Ali-Shtayeh MS, Arda HM, Hassouna M, Shaheen SF. Keratinophilic fungi on the hair of goats from the West Bank of Jordan. Mycopathologia. 1988;104:103–108 12. El-Said AHM, Sohair TH, El-Hadi AG. Fungi Associated with the Hairs of Goat and Sheep in Libya. Mycobiology. 2009;37(2):82-88. doi:10.4489/MYCO.2009.37.2.082.

163

13. Alvarado-Ramírez, E. , Josep M. Torres-Rodríguez , Maite Sellart1 and Valerio Vidotto Laccase activity in Cryptococcus gattii strains isolated from goats. Rev Iberoam Micol 2008; 25: 150-153 14. ATWA, E. I.; RADY, F. M., 2007: Bacteria and fungi associated with abortion in sheep and goat in Menoufiea Governorate. Assiut Veterinary Medical Journal 53(113): 326- 349 15. Bagy MM, Abdel-Mallek AY. Saprophytic and keratinolytic fungi associated with animals hair from Riyadh, Saudi Arabia. Zentralbl Mikrobiol. 1991;146(4):305-10. 16. Baro T, Torres-Rodríguez JM, De Mendoza M, Morera Y, Alía C: First identification of autochthonous Cryptococcus neoformans var. gattii isolated from goats with predominantly severe pulmonary disease in Spain. J Clin Microbiol 1998, 36:458– 461. 17. Batista M.C.S, Castro R.S., Rego E.W., Carvalho A.A., Silva S.M.S., Carvalho C.D.D. & Riet-Correa F. 2009. [Hematology and blood biochemistry in sheep with conidiobolomycosis in northeastern Brazil.] Hemograma, proteinograma, ionograma e dosagens bioquímicas e enzimáticas de ovinos acometidos de conidiobolomicose no Nordeste do Brasil. Pesquisa Veterinária Brasileira 29(1):17-24 18. Battacone, G., Nudda, A., Cannas, A. et al, Excretion of aflatoxin M1 in milk of dairy ewes treated with different doses of aflatoxin B1. J Dairy Sci. 2003;86:2667–2675 19. Battacone G, Nudda A, Palomba M, Pascale M, Nicolussi P, Pulina G. Transfer of aflatoxin B1 from feed to milk and from milk to curd and whey in dairy sheep fed artificially contaminated concentrates. J Dairy Sci. 2005 Sep;88(9):3063-9. 20. Bernardo, Fábio D., Conhizak, Cleverson, Ambrosini, Francielli, Jesus, Francielli P.K. de, Santurio, Janio M., Kommers, Glaucia D., Elias, Fabiana, & Franciscato, Carina. (2015). Pythiosis in sheep from Paraná, southern Brazil. Pesquisa Veterinária Brasileira, 35(6), 513-517. https://dx.doi.org/10.1590/S0100-736X2015000600004 21. Biswas, M. K., C. Debnath, T. Mitra, S. Baidya and S. Pradhan. Studies on dermatophytoses in sheep and goat in West Bengal, India. Indian J. Anim. Hlth. (2015), 54(2): 109 – 114 22. Bliss EL Tinea versicolor dermatomycosis in the goat. J Am Vet Med Assoc. 1984 Jun 15;184(12):1512-3. 23. Boabaid, Fabiana M., Ferreira, Eduardo V., Arruda, Laura P. de, Gasparetto, Naiani D., Souza, Roberto L. de, Silva, Maria C. da, Dutra, Valéria, Nakazato, Luciano, & Câmara, Antônio Carlos Lopes, Soto-Blanco, Benito, Batista, Jael Soares, Vale, André Menezes do, Feijó, Francisco Marlon Carneiro, & Olinda, Robério Gomes. (2011). Rhinocerebral and rhinopharyngeal conidiobolomycosis in sheep. Ciência Rural, 41(5), 862-868. Epub May 10, 2011.https://dx.doi.org/10.1590/S0103- 84782011005000058 24. Bognanno, M., Luca La Fauci, Alberto Ritieni, Alessio Tafuri, Antonino De Lorenzo, Pietro Micari, Laura Di Renzo, Salvatore Ciappellano, Virginia Sarullo, Fabio Galvano. Survey of the occurrence of Aflatoxin M1 in ovine milk by HPLC and its confirmation by MS. Molecular Nutr, Food Res. Volume 50, Issue 3 March 2006, 300–305 25. Brilhante RS , Silva ST, Castelo-Branco DS, Teixeira CE, Borges LC, Bittencourt PV, de Oliveira JS, Monteiro AJ, Bandeira TJ, Cordeiro RA, Moreira JL, Sidrim JJ, Rocha MF. Emergence of azole-resistant Candida albicans in small ruminants. Mycopathologia. 2015 Oct;180(3-4):277-80. 26. Bueno VFF, Mesquita AJ, Neves RBS, Souza MA, Ribeiro AR, Nicolau ES, Oliveira NA: Epidemiological and clinical aspects of the first outbreak of bovine mastitis caused by Prototheca zopfii in Goiás state, Brazil. Mycopathologia 161: 141– 145, 2006 27. Carrigan MJ, Small AC, Perry GH. Ovine nasal zygomycosis caused by Conidiobolus incongruus. Aust Vet J. 1992 Oct;69(10):237-40. 28. Chhabra D, Arora S. and Bagherwal RK: 2004. Isolation of Curvularia spp. from caprine mastitis. Indian Vet. J. 81 (10): 1084- 1085.

164

29. Chapman HM, Robinson WF, Bolton JR, Robertson JP: Cryptococcus neoformans infection in goats. Aust Vet J 1990, 67:263–265.\ 30. Chauhan HV, Dwivedi P Pneumomycosis in sheep and goats. Vet Rec. 1974 Jul 20;95(3):58-9. 31. Chihaya Y, Matsukawa K, Takahashi K, Matsui Y, Koosaka Y, Niioka K, Mizushima S. An ovine case of generalized aspergillosis with alimentary lesions. Nihon Juigaku Zasshi. 1980 Dec;42(6):703-7. 32. Chineme CN, Adekeye JO, Bida SA. Ringworm caused by Trichophyton verrucosum in young goats: a case report. Bull Anim Health Prod Afr. 1981 Mar;29(1):75-8. 33. Cisláková L, Literák I, Bálent P, Hipíková V, Levkutová M, Trávnicek M, Novotná A. Prevalence of antibodies to Encephalitozoon cuniculi (microsporidia) in angora goats--a potential risk of infection for breeders. Ann Agric Environ Med. 2001;8(2):289-91. 34. Colodel, Edson M.. (2008). Conidiobolomicose em ovinos no Estado de Mato Grosso. Pesquisa Veterinária Brasileira, 28(1), 77-81. 35. Corbel MJ, Day CA, Cole DJ. Examination of the relationship between pathological changes, immunological response and serum protein concentrations in pregnant sheep inoculated with Aspergillus fumigatus. Mycopathologia. 1980 May 1;71(1):53-64. 36. Cordes DO, Di Menna ME, Carter ME Mycotic pneumonia and placentitis caused by Mortierella wolfii. I. Experimental infections in cattle and sheep. Vet Pathol. 1972;9(2):131-41. 37. Cremonesi P., Pozzi F., Ricchi M., Castiglioni B., Luini B., Chessa S.: Identification of Prototheca species from bovine milk samples by PCR-single strand conformation polymorphism. J. Dairy Sci 2012, 95, 6963–6968. 38. Cysewski SJ, Pier AC. Mycotic abortion in ewes produced by Aspergillus fumigatus: pathologic changes. Am J Vet Res. 1968 Jun;29(6):1135-51. 39. da Silva EC, Guerra JM, Torres LN, Lacerda AM, Gomes RG, Rodrigues DM, Réssio RA, Melville PA, Martin CC, Benesi FJ, de Sá LR, Cogliati B. Cryptococcus gattii molecular type VGII infection associated with lung disease in a goat. BMC Vet Res. 2017 Feb 7;13(1):41. 40. Dawson CO, Lepper AW. Peyronellaea glomerata infection of the ear pinna in goats. Sabouraudia. 1970 Aug;8(2):145-8. 41. Day CA, Corbel M. Haematological changes associated with Aspergillus fumigatus infection in experimental mycotic abortion of sheep. Br J Exp Pathol. 1974 Aug;55(4):352-62. 42. de Freitas, T. E., Joana D‟arc Felicio, Daniela Pontes Chiebao, Roberto Carlos Felicio & Edlayne Gonçalez. Monitoring of Mycotoxins in Feed for Goats and Their Residues in Milk. Journal of Agricultural Science; Vol. 7, No. 12; 2015 43. Dehkordi, F. Safarpoor, H. Momtaz & A. Doosti, 2012. Application of real-time PCR for detection of Aspergillus species in aborted ruminant foetuses. Bulg. J. Vet. Med., 15, No 1, 30−36. 44. Didier, E. S. & Weiss, L. M. 2006. Microsporidiosis: current status. Curr. Opin. Infect Dis., 19:485–492. 45. De Paula , D.A.J., J.X.O. Filho, M.C. Silva, E.M. Colodel, L. Broetto, et al. Molecular characterization of ovine zygomycosis in central western Brazil. Journal of Veterinary Diagnostic Investigation, 22 (2010), pp. 274–277 46. de Souza, W. and Benchimol, M. 2005. Basic biology of Pneumocystis carinii. Mem. Inst. Oswaldo Cruz Rio de Janeiro 100: 903–908. 47. Di Menna M. E., B. L. Smith & C. O. Miles (2009) A history of facial eczema (pithomycotoxicosis) research, New Zealand Journal of Agricultural Research, 52:4, 345-376, DOI: 10.1080/00288230909510519 48. Ditrich O, Otcenásek M. [Dermatomycosis in sheep caused by a rare strain of Trichophyton verrucosum]. Vet Med (Praha). 1982 Jul;27(7):425-30.

165

49. do Carmo, P.M.S. , R.A. Portela, T.R. Silva, J.C. Oliveira-Filho, F. Riet- Correa, Cutaneous Pythiosis in a Goat. Journal of Comparative Pathology, 152, 2-3, 2015, 103-104 50. Dong M, He XJ, Tulayakul P, Li JY, Dong KS, Manabe N, Nakayama H, Kumagai S. The toxic effects and fate of intravenously administered zearalenone in goats. Toxicon. 2010a Feb-Mar;55(2-3):523-30. 51. Dong, M, Phitsanu TULAYAKUL, Jun-You LI, Ke-Su DONG, Noboru MANABE, Susumu KUMAGAI. Metabolic Conversion of Zearalenone to α- Zearalenol by Goat Tissues. Journal of Veterinary Medical Science Vol. 72 (2010b) No. 3 March P 307-312 52. Edwards JR, RIchards RB, Gwynn RV, Love RA. A facial eczema outbreak in sheep. Aust Vet J. 1981 Aug;57(8):392-4. 53. Eguchi-Coe, Y,, Beth A. Valentine, Elena Gorman, Aurora Villarroel. Putative Malassezia dermatitis in six goats. Vet./ Derm. View issue TOC Volume 22, Issue 6 December 2011 Pages 497–501 54. Eissa NB, Ezzat M, El-Sawah A, El-Hamoly M. Survey on common causative agents of dermatophytosis in different animals in El-Beida-Libya. Benha Vet Med J 2013; 24: 108–15. 55. Eljack H., Abdo Elgabbar M.A, Shuaib Y.A., Elham A.S. CASE STUDY Tricophyton verrucosum infection in a saanen goat (Capra aegagrus hircus). U of K. J. Vet. Med. & Anim. prod. Vol. 2, No. 2, 2011 (131-141) 131 56. El-Naggar, A., Ibrahim, F., Refai, M., Balata, M. and Hassan, A. : The fungal flora of genitalia and udder of sheep and goats under desert condition. Zag. Vet. J. 25, 51-57 (1997)

57. El-Naggar, A., Ahmed, Y., Ibrahim, F. and Refai, M:Mycotic abortion in small ruminants induced by Aspergillus fumigatus. J. Comp. Pathol. & Clinc. Pathol. 10, 59-76 (1997) 58. El-Said AHM, Sohair TH, El-Hadi AG. Fungi associated with the hairs of goats and sheep in Libya. Mycobiology 2009; 37: 82–88. 59. El-Said AHM, Abdel -Sater MA (1995). Fungi associated with the hair of goat and sheep from El-Bahrain. Qatar Univ. Sci. J. 15(1):57-64. 60. Emenuga VN, Oyeka CA (2013). Epidemiology, Health Effects and Treatment of Cutaneous Mycoses of Goat and Sheep from Some Eastern States of Nigeria. Am. J. Infect. Dis. Microbiol. 1(6):106-110. 61. Even-Paz Z, Raubitschek F. Epidemics of tinea capitis due to Trichophyton verrucosum contracted from cattle or sheep. Dermatologica. 1960 Feb;120:74-82. 62. Everton Ferreira Lima, , Maia, Lisanka Ângelo, Nascimento, Eduardo Melo de, Dantas, Antônio Flávio Medeiros, & Riet-Correa, Franklin. (2014). Infecção disseminada por Chlorella sp. em um ovino. Ciência Rural, 44(7), 1253- 1256. https://dx.doi.org/10.1590/0103-8478cr20131270 63. Expedito K. A. Camboim, Felício Júnior Garino, Antônio F. M. Dantas, Sara V. D. Simões, Marcia A. Melo, Edísio O. Azevedo, Rinaldo A. Mota,Franklin Riet-Correa. Protothecosis by Prototheca wickerhamii in goats. Mycoses. Volume 54, Issue 4 July 2011 Pages e196–e200 64. Fábio Souza Mendonça , Raquel Feitosa Albuquerque1 , Joaquim Evêncio-Neto1 , Renata Gebara Sampaio Dória2 , Lázaro Manoel de Camargo3 and Silvio Henrique de Freitas3+ ABSTRACT. Mendonça F.S., Albuquerque R.F., Evêncio-Neto J., Dória R.G.S., Camargo L.M. & Freitas S.H. Conidiobolomycosis in sheep in the State of Pernambuco. Revista Brasileira de Medicina Veterinária, 34(3):241-246, 2012. 65. Fadda ME, Viale S, Deplano M, Pisano MB, Cosentino S. Characterization of yeast population and molecular fingerprinting of Candida zeylanoides isolated from goat's milk collected in Sardinia. Int J Food Microbiol. 2010 Jan 1;136(3):376-80.

166

66. Faris, B. H., Mohammed J. Alwan, Ban Abbass Abdulmajeed. Pathological and molecular study of mycotic abortion in ewes. Kufa J. Vet. Med. Sci. Vol. (4) No 1, 2013, 41-56 67. Fayer, R., Santín, M. & Macarisin, D. 2012. Detection of concurrent infection of dairy cattle with Blastocystis, Cryptosporidium, Giardia, and Enterocytozoon by molecular and microscopic methods. Parasitol. Res., 111:1349–1355. 68. Fernández, A., Hernández, H., Verde, M.T. et al, Effect of aflatoxin on performance, hematology, and clinical immunology in lambs. Can J Vet Res. 2000;64:53–58. 69. Fernández A, Hernández M, Verde MT, Sanz M. Effect of aflatoxin on performance, hematology, and clinical immunology in lambs. Can J Vet Res. 2000 Jan;64(1):53-8. 70. Ferreira JB, Navarro IT, Freire RL, Oliveira GG, Omori AM, Belitardo DR, Itano EN, Camargo ZP, Ono MA. Evaluation of Paracoccidioides brasiliensis Infection in dairy goats. Mycopathologia. 2013 Aug;176(1-2):95-9. 71. Finoli, C. & Angela Vecchio (2003) Occurrence of aflatoxins in feedstuff, sheep milk and dairy products in Western Sicily, Italian Journal of Animal Science, 2:3, 191-196 72. Finoli, C., & Vecchio, A. (1997). Aflatoxin M1 in goat dairy products. Microbiologie-Aliments-Nutrition, 15, 47-52. 73. Fouad, M. S., J. El-Asai & M. Refai (1977): Ringworm in sheep and goat in Egypt with special reference to experimental infection and immunization in sheep. Castellania 5: 165- 167 74. Fragner P, Vítovec J, Vladík P, Tesarík Bronchopulmonary aspergillosis in lamb. Mycopathol Mycol Appl. 1970 Aug 31;40(3):337-40. 75. Friend SC, Hancock DS, Schiefer HB, Babiuk LA. Experimental T-2 toxicosis in sheep. Canadian Journal of Comparative Medicine. 1983;47(3):291-297. 76. Furlan, Fernando Henrique, Lucioli, Joelma, Veronezi, Luciane Orben, Fonteque, Joandes Henrique, Traverso, Sandra Davi, Nakazato, Luciano, & Gava, Aldo. (2010). Conidiobolomicose causada por Conidiobolus lamprauges em ovinos no Estado de Santa Catarina. Pesquisa Veterinária Brasileira, 30(7), 529- 532. https://dx.doi.org/10.1590/S0100-736X2010000700003 77. Gaastra, W., Len J.A. Lipman , Arthur W.A.M. De Cock , Tim K. Exel ,Raymond B.G. Pegge b, Josje Scheurwater b, Raquel Vilela d, Leonel Mendoza. Pythium insidiosum: An overview. Veterinary Microbiology 146 (2010) 1–16 78. Garcia ME, Duran C, Cruzado M, Andrino M, Blanco JL. Evaluation of molecular and immunological techniques for the diagnosis of mammary aspergillosis in ewes. Vet Microbiol. 2004 Jan 14;98(1):17-21. 79. Gardner, D.E. Abortion associated with mycotic infection in sheep. New Zealand Veterinary Journal Vol. 15 , Iss. 5,1967 80. Greenwood PE, Williamson GN. An outbreak of facial eczema in sheep. Aust Vet J. 1985 Feb;62(2):65-6 81. Gugnani HC, Wattal BL, Sandhu RS. Dermatophytes and other Keratinophilic fungi recovered from small mammals in India. Mykosen. 1975;18:529–538 82. Gumaa SA, Abu-Samra MT. Experimental mycetoma infection in the goat. J Comp Pathol. 1981 Jul;91(3):341-6. 83. Gutiérrez M, García Marin JF: Cryptococcus neoformans and Mycobacterium bovis causing granulomatous pneumonia in a goat. Vet Pathol 1999, 36:445–448. 84. Hassan, M. A., H. H. Kamel and A. A. Hassan. Clinicopathological studies on caprine aflatoxicosis. Vet. Med. J. Giza, 52,, 4, 2004, 435-450 85. Hassan, A.A., M.A. Rashid and Kh. M. Koratum. Measurement of mycotoxins in feeds and sera of cattle and sheep and evaluation of its effect on some fertility related hormones in a male rats. Egypt. J. Comp. Path. & Clinic. Path. Vol. 21 No. 2 (April) 2008; 340-358 86. Hassan, A.A. ; Mogda, K. Mansour, Samira, A.M. Snousi and Randa, A. Hassan. Mycological, biochemical and histopathological studies on acute fusariotoxicosis in sheep. Life Science Journal 2010;7(3):49-57].

167

87. Hassan, A.A. ; Manal A. Hassan ; Rasha M.H. Sayed El Ahl and A.S. Darwish. Prevalence of yeast infections in small in ruminants with particular references to their treatment by some natural herbal extracts. Bulletin of Environment, Pharmacology & Life Sciences, Volume 1, Issue 3, February 2012: 12-22 88. Hassan, B.H., Qassim Haleem Kshash SadiyhaYasir Offi. Mycotic mastitis in sheep. AL-Qadisiya Journal of Vet. Med. Sci. Vol. 13 No. 2 2014 89. Höhler D, Südekum KH, Wolffram S, Frohlich AA, Marquardt RR. Metabolism and excretion of ochratoxin A fed to sheep. J Anim Sci. 1999 May;77(5):1217-23. 90. Hum S. Putative sporidesmin toxicity in an Eastern Grey kangaroo (Macropus giganteus). Aust Vet J. 2005;83(11):678-9. 91. Ilgaz, A. (1975): Studies on the etiology of fungal dermatitis in cattle, sheep and goat in Ehazig province. First Universitesi Veteriner Fekultesi Dergisi 2: 350-351. Cited by Pandey et al. (1979). 92. Ilhan, Z. Ismail Hakkı Ekin, Samet Koltas , Ozgul Gulaydın , Cihat Ozturk , Ayse Ebru Borum. Occurrence of fungal agents in mastitis in dairy goats. Journal of Animal &Plant Sciences, 2016. Vol.29, Issue 3: 4691-4700 93. Jensen HE, Espinosa de los Monteros A, Carrasco L. Caprine mastitis due to aspergillosis and zygomycosis: a pathological and immunohistochemical study. J Comp Pathol. 1996 Feb;114(2):183-91. J Comp Pathol. 1996 Feb;114(2):183-91. 94. Kalaiselvi, G., N. Daniel Joy Chandran and M. Vidhya .Ringworm infection in a goat - a clinical case report . Ind. J. Vet. & Anim. Sci. Res., 43 (5) 386 - 387, September - October 2014 95. Kaplan W, Chandler FW, Choudary C, Ramachandran PK. Disseminated unicellular green algal infection in two sheep in India. Am J Trop Med Hyg. 1983 Mar;32(2):405-11. 96. Karim, S. A. and Abdalla, A. E. D (1988): Ringworm in Sudanese Goat caused by Trichophyton verrucosum. Sudan J .Vet. Res., 8: 57 - 58. 97. Karim, M. R., Dong, H., Yu, F., Jian, F., Zhang, L., Wang, R., Zhang, S., Rume, F. I., Ning, C. & Xiao, L. 2014. Genetic diversity in Enterocytozoon bieneusi from dogs and cats in China: host specificity and public health implications. J. Clin. Microbiol., 52:3297–3302. 98. Ketterer, Pj, Ma Kelly, Md Connole, L. Ajello ,Rhinocerebral and nasal zygomycosis in sheep caused by Conidiobolus incongruus. Aust. Vet J. Volume 69, Issue 4April 1992 Pages 85–87 99. Khosravi A. R. and M. Mahmoudi. Dermatophytes isolated from domestic animals in Iran. Mycoses, 46, 222–225, 2003 100. Kielstein P, Weller W. [Trichophyton verrucosum infections in sheep]. Monatsh Veterinarmed. 1965 Aug 15;20(16):671-5. 101. King, J. M. 1983. Sudden death in sheep and goat. Vet. Clin. North Am. Large Anim. Pract. 5: 701–710 102. Koller L. D., Helfer D. H. 1978. Adiaspiromycosis in the lungs of a goat. J. Am. Vet. Med. Assoc. 173: 80–81. 103. Kondo, H., Godfrey Musoke2), Herman Ssekiwunga2), Shinichi Hatama3), Yoshiharu Ishikawa3), Koichi Kadota. Pneumocystis Infection in Goat Kids in Uganda. Japan Agricultural Research Quarterly: 48 (2014), 3, 349-353 104. Las Heras A, Domínguez L, López I, Payá MJ, Peña L, Mazzucchelli F, García LA, Fernández-Garayzábal JF. Intramammary Aspergillus fumigatus infection in dairy ewes associated with antibiotic dry therapy. Vet Rec. 2000 Nov 11;147(20):578-80 105. Lee, J. H. 2008. Molecular detection of Enterocytozoon bieneusi and identification of a potentially human-pathogenic genotype in milk. Appl. Environ. Microbiol., 74:1664–1666

168

106. Lemos LS, Siqueira de O dos Santos A, Vieira-da-Motta O, Texeira GN, Queiroz de Carvalho EC. Vet Microbiol. 2007 Dec 15;125(3-4):350-4. 107. Lewis, F., Markson, L.M., Allcroft, R. The effect of feeding toxic groundnut meal to sheep over a period of five years. Vet Rec. 1967;80:312–314 108. Luffau, G. (1976): Teignes du mouton. Bull. SCOC. Vet. Prat. France, 60: 1- 7. 109. Luvizotto MCR, Carreira VS, Ferrari HF, Ribeiro D, Vallim MA, Azevedo V et al . Brain and lung cryptococcoma and concurrent corynebacterium pseudotuberculosis infection in a goat: a case report. J. Venom. Anim. Toxins incl. Trop. Dis [Internet]. 2009 ; 15( 3 ): 553-561. 110. Maestrale C, Masia M, Pintus D, Lollai S, Kozel TR, Gates-Hollingsworth MA, Cancedda MG, Cabras P, Pirino S, D'Ascenzo V, Ligios C. Genetic and pathological characteristics of Cryptococcus gattii and Cryptococcus neoformans var. neoformans from meningoencephalitis in autochthonous goats and mouflons, Sardinia, Italy. Vet Microbiol. 2015 Jun 12;177(3-4):409-13. 111. Macedo JT, Riet-Correa F, Dantas AF, Simões SV. Cutaneous and nasal protothecosis in a goat. Vet Pathol. 2008 May;45(3):352-4. 112. Malčeková B, Halánová M, Sulínová Z, Molnár L, Ravaszová P, Adam J, Halán M, Valocký I, Baranovič M. Seroprevalence of antibodies to Encephalitozoon cuniculi and Encephalitozoon intestinalis in humans and animals. Res Vet Sci. 2010 Dec;89(3):358-61 113. Malissiova, E., A. Tsakalof, I.S. Arvanitoyannis, A. Katsafliaka, A. Katsioulis, P. Tserkezou, M. Koureas, A. Govaris, C. Hadjichristodoulou , Monitoring Aflatoxin M1 levels in ewe's and goat's milk in Thessaly, Greece; potential risk factors under organic and conventional production schemes. Food Control, Volume 34, Issue 1, November 2013, Pages 241–248 114. Mandal PC, Gupta PP. Sequential pathological studies in goats infected intratracheally with Aspergillus fumigatus. Mycopathologia. 1993a Feb;121(2):77-81. 115. Mandal PC, Gupta PP. Experimental aspergillosis in goats: clinical, haematological and mycological studies. Zentralbl Veterinarmed B. 1993b Jun;40(4):283-6. 116. Mandal PC, Gupta PP. Sequential pathological studies in the udder of goats intramammarily infected with Aspergillus fumigatus. Mycopathologia. 1994 Apr;126(1):9-14. 117. Maneenil G, Payne MS, Senthamarai Kannan P, Kallapur SG, Kramer BW, Newnham JP, Miura Y, Jobe AH, Kemp MW. Fluconazole treatment of intrauterine Candida albicans infection in fetal sheep. Pediatr Res. 2015 Jun;77(6):740-8. 118. Marasas WF, Adelaar TF, Kellerman TS, Minné JA, Van Rensburg IB, Burroughs GW. First report of facial eczema in sheep in South Africa. Onderstepoort J Vet Res. 1972 Jun;39(2):107-12. 119. Mazzette, A., Decandia, M., Acciaro, M. et al, Excretion of aflatoxin M1 in milk of goats fed diets contaminated by aflatoxin B1. Ital J Anim Sci. 2009;8:631– 633 120. McConnell EE, Basson PA, Pienaar JG. Pneumocystosis in a domestic goat. Onderstepoort J Vet Res. 1971 Jun;38(2):117-24. 121. MISHRA, P. R.; SIDHARTHA HAZARI; PAL, A., 1996: Subclinical Mastitis In Goat With Special Reference To Fungus. Indian Journal Of Dairy Science 49(3): 209-210 122. McKellar Q, Fishwick G, Rycroft A. Ringworm in housed sheep. Vet Rec. 1987 Aug 22;121(8):168-9. 123. Mizher, B. M., 2014. Study of the mycotic mastitis in dairy goats in Al-Diwaniya province. https://www.researchgate.net/publication/ 316273286_

169

124. Mohamed Fadl Awad. Mycoflora associated with the goat‟s hair and sheep wool in Taif, Saudi Arabia. Afr. J. Microbiol Res Vol.11(11), pp. 458-465 , March 2017 125. Monga, D. P., D. N. Garg. Ovine Pulmonary Infection Caused by Rhodotorula rubra Pulmonale Infektion bei einem Schaf durch Rhodotorula rubra. Mycoses 23, 4,1980, 208–211 126. Mortimer PH, Stanbridge TA. The excretion of sporidesmin given by mouth to sheep. J Comp Pathol. 1968 Oct;78(4):505-12. 127. Motawee, M. M., Bauer, J., & McMahon, D. J. (2009). Survey of Aflatoxin M1 in Cow, Goat, Buffalo and Camel Milks in Ismailia-Egypt. Bull Environ Contam Toxicol. 2009 Nov;83(5):766-9. 128. Mugnaini L, Nardoni S, Pistelli L, Leonardi M, Giuliotti L, Benvenuti MN, Pisseri F, Mancianti F. A herbal antifungal formulation of Thymus serpillum, Origanum vulgare and Rosmarinus officinalis for treating ovine dermatophytosis due to Trichophyton mentagrophytes. Mycoses. 2013 May;56(3):333-7. 129. Nayar PR, Sethna SB, Thirumalachar MJ. Trichophytosis in sheep. Hindustan Antibiot Bull. 1974 May;16(4):190-2. 130. Ohbayashi M., Ishimoto Y. 1971. Two cases of adiaspiromycosis in small mammals. Jpn. J. Vet. Res. 19: 103–105. 131. Ophelders DR, Gussenhoven R, Lammens M, Küsters B, Kemp MW7, Newnham JP, Payne MS, Kallapur SG, Jobe AH, Zimmermann LJ, Kramer BW, Wolfs TG. Neuroinflammation and structural injury of the fetal ovine brain following intra-amniotic Candida albicans exposure. J Neuroinflammation. 2016 Feb 2;13:29. 132. Özdemir, M. Determination of aflatoxin M1 levels in goat milk consumed in Kilis province. Ankara Üniv Vet Fak Derg, 54, 99-103, 2007 133. Ozmen O, Sahinduran S, Haligur M, Albay MK. Clinicopathological studies on facial eczema outbreak in sheep in Southwest Turkey. Trop Anim Health Prod. 2008 Oct;40(7):545-51. 134. Ozturk, D., Ramazan Adanir1 , and Hulya Turutoglu. Superficial skin infection with scopulariopsis brevicaulis in two goats. a case report. Bull Vet Inst Pulawy 53, 361-363, 2009 135. Pal M, Randhawa HS: Caprine mastitis due to Cryptococcus neoformans. Sabouraudia 1976, 14:261–163. 136. Pal M. Diagnosis and Management of Trichophyton verrucosum in Ruminants A Report of 4 Animals. NTAS POLIVET, 2015, 16, 2, 464- 466 137. Pandey VS, Mahin L, Vanbreuseghem R Prevalence and distribution of ringworm by Trichophyton verrucosum in sheep in the high atlas of Morocco. Ann Soc Belg Med Trop. 1979;59(4):385-9. 138. Pandey VS, Mahin L. Observations on ringworm in goats caused by Trichophyton verrucosum. Br Vet J. 1980 Mar-Apr;136(2):198-9. 139. Panelli S, Brambati E, Bonacina C, Feligini M. Updating on the fungal composition in Sardinian sheep's milk by culture-independent methods. J Dairy Res. 2014 May;81(2):233-7 140. Pang VF, Shadduck JA. Susceptibility of cats, sheep, and swine to a rabbit isolate of Encephalitozoon cuniculi. Am J Vet Res. 1985 May;46(5):1071-7. 141. Pepin, G. A. & F? K. C. Austwick (1968): Skin diseases of domestic animals. Skin diseases of mycological origin. Vet. Rec. 82: 208-214. 142. Pérez V, Corpa JM, Garćia Marín JF, Adúriz JJ, Jensen HE. Generalized aspergillosis in dairy sheep. Zentralbl Veterinarmed B. 1999 Nov;46(9):613-21. 143. Pérez V, Corpa JM, García Marín JF, Adúriz JJ, Jensen HE. Mammary and systemic aspergillosis in dairy sheep. Vet Pathol. 1998 Jul;35(4):235-40.

170

144. Pessoa CR, Riet-Correa F, Pimentel LA, Garino F Jr, Dantas AF, Kommers GD, Tabosa IM, Reis-Júnior JL. Pythiosis of the digestive tract in sheep. J Vet Diagn Invest. 2012 Nov;24(6):1133-6. 145. Philpot CM, Arbuckle JB. Trichophyton verrucosum infection of goats. Vet Rec. 1983 Jun 4;112(23):550. 146. Pier AC, Cysewski SJ, Richard JL. Mycotic abortion in ewes produced by Aspergillus fumigatus: intravascular and intrauterine inoculation. Am J Vet Res. 1972 Feb;33(2):349-56. 147. Pier AC, Smith JMB, Alexiou H, Ellis DH, Lund A, Pritchard R. Animal ringworm – its aetiology, public health significance and control. J Med Vet Mycol 1994; 32: 133–50. Chermette R, Ferreiro L, Guillot J. Dermatophytes in animals. Mycopathologia 2008; 166: 385–405. 148. Pin D. Seborrhoeic dermatitis in a goat due to Malassezia pachydermatis. Vet Dermatol. 2004 Feb;15(1):53-6. 149. Pinto C, Santos VM, Dinis J, Peleteiro MC, Fitzgerald JM, Hawkes AD, Smith BL. Pithomycotoxicosis (facial eczema) in ruminants in the Azores, Portugal. Vet Rec. 2005 D 17;157(25):805-10. 150. Power SB, Malone A. An outbreak of ringworm in sheep in Ireland caused by Trichophyton verrucosum. Vet Rec. 1987 Sep 5;121(10):218-20. 151. Priji P, Unni KN, Sajith S, Benjamin S. Candida tropicalis BPU1, a novel isolate from the rumen of the Malabari goat, is a dual producer of biosurfactant and polyhydroxybutyrate. Yeast. 2013 Mar;30(3):103-10. 152. Rahimi E, Ameri M. A survey of aflatoxin M1 contamination in bulk milk samples from dairy bovine, ovine, and caprine herds in Iran. Bull Environ Contam Toxicol. 2012 Jul;89(1):158-60. 153. Ramírez-Romero, R., Rodríguez-Tovar, L.E., Nevárez-Garza, A.M. et al. Chlorella Infection in a Sheep in Mexico and Minireview of Published Reports from Humans and Domestic Animals Mycopathologia (2010) 169: 461. doi:10.1007/s11046-010-9287-4 154. Refai, M., Ibrahim, M. and El-Saifi, A. : Uebr das Vorkommen von Trichophyton-verrucosum-Infektion in Aegypten mit Hinweis auf die Behandlung mit Griseofulvin. Dtsch. Tieraerztl. Wschr. 83, 62-64 (1976) 155. Rehbinder C. Mycotic granulomatous pneumonia in a lamb [case report]. Nord Vet Med. 1977 Jul-Aug;29(7-8):343-6. 156. Rhoda Leask, Johan Steyl. Mycotic rhinitis in a Mutton Merino ewe. JSAVA. 88, 2017 157. Riet-Correa, Franklin, Dantas, Antônio F.M., Azevedo, Edísio O., Simões, Sara D.V., Silva, Silvana M.S., Vilela, Raquel, & Mendoza, Leonel. (2008). Outbreaks of rhinofacial and rhinopharyngeal zygomycosis in sheep in Paraíba, northeastern Brazil. Pesquisa Veterinária Brasileira, 28(1), 29- 35. https://dx.doi.org/10.1590/S0100-736X2008000100005 158. Sakakibara M, Shimizu C, Kadota K, Hatama S. Pneumocystis carinii Infection in a domestic goat (Capra hircus domesticus) with multibacillary paratuberculosis. J Vet Med Sci. 2013;75(5):671-4. 159. Saleh, H. A. Mycological studies on Cr.neoformans isolated from clinical cases and environment. M.S., Faculty of Veterinary Medicine, Cairo University, 2005 160. Saleh, H. A. Amgad A. Moawad, Mahmoud El-Hariri, Mohamed K. Refai (2011): Prevalence of Yeasts in Human, Animals and soil sample in El- Fayoum Governorate in Egypt. Int, J. Microbiol. Res.2 (3): 233-239, 2011 161. Sallam AMH, ALKolaibe AM (2010). Distribution pattern of dermatophytes and other keratinophilic fungi on Goats hair and Sheep wool, Taiz city, Yemen. J. Environ. Sci. 39(3):345-356.

171

162. Santín, M. & Fayer, R. 2009. Enterocytozoon bieneusi genotype nomenclature based on the internal transcribed spacer sequence. A consensus. J. Eukaryot. Microbiol., 56:34–38. 163. Sargison ND, Thomson JR, Scott PR, Hopkins G. Ringworm caused by Trichophyton verrucosum--an emerging problem in sheep flocks. Vet Rec. 2002 Jun 15;150(24):755-6. 164. Shlosberg A, Zadikov I, Perl S, Yakobson B, Varod Y, Elad D, Rapoport E, Handji V. Aspergillus clavatus as the probable cause of a lethal mass neurotoxicosis in sheep. Mycopathologia. 1991 Apr;114(1):35-9. 165. Scott DB. An outbreak of ringworm in karakul sheep caused by a physiological variant of Trichophyton verrucosum Bodin. Onderstepoort J Vet Res. 1975 Mar;42(1):49-52. 166. Sharapov, V: M. (1962): Lechenie Profilaktike trikhofitii Karakul Shikh Ovots. Veterinariya MOSCOW39 : 31-34. 167. Shreeve, B. J. (1976): Fungal infections in sheep.Veterinary Annual, 16: 78- 80. MOSCOW39 : 31-34. 168. Silva, Janaina Lara da, Aparecido, Christiane Ceriani, Hansen, Daiane, Pereira, Tacila Alves Muniz, Felicio, Joana D'arc, & Gonçalez, Edlayne. (2015). Identification of toxigenic Aspergillus species from diet dairy goat using a polyphasic approach. Ciência Rural, 45(8), 1466-1471. 169. Silva M.C., Godoy I., Ubiali D.G., Silveira M.M., Pitchenin L.C., Brandão L.N.S., Dutra V. & Nakazato L. 2015. [Immunoreactive proteins of Conidiobolus lamprauges isolated from naturally infected sheep.] Pesquisa Veterinária Brasileira 35(4):344-348. 170. SILVA, S.M.. et al. Conidiobolomycosis in sheep in Brazil. Veterinary Pathology,.44, 314-319, 2007. 171. Singh M, Gupta PP, Rana JS, Jand SK. Clinico-pathological studies on experimental cryptococcal mastitis in goats. Mycopathologia. 1994 Jun;126(3):147- 55. 172. Singh P, Sood N, Gupta PP, Jand SK, Banga HS. Experimental candidal mastitis in goats: clinical, haematological, biochemical and sequential pathological studies. Mycopathologia. 1997-1998;140(2):89-97. 173. Smith BL, Embling PP. Facial eczema in goats: the toxicity of sporidesmin in goats and its pathology. N Z Vet J. 1991 Mar;39(1):18-22 174. Smith BL. Effects of low dose rates of sporidesmin given orally to sheep. N Z Vet J. 2000 Dec;48(6):176-81. 175. Smith MC. Caprine dermatologic problems: a review. J Am Vet Med Assoc. 1981 Apr 1;178(7):724-9. 176. Smith JF, Morris CA. Review of zearalenone studies with sheep in New Zealand. Proceedings of the New Zealand Society of Animal Production, Volume 66, pp 306-310, Jan 2006 177. Smith, E.E., Phillips, T.D., Ellis, J.A. et al, Dietary hydrated sodium calcium aluminosilicate reduction of aflatoxin M1 residue in dairy goat milk and effects on milk production and components. J Anim Sci. 1994;72:677–682 178. Tabosa IM, Riet-Correa F, Nobre VM, Azevedo EO, Reis-Júnior JL, Medeiros RM. Outbreaks of pythiosis in two flocks of sheep in northeastern Brazil. Vet Pathol. 2004 Jul;41(4):412-5. 179. Thakur, D. K.; Misra, S. K. and Choudhuri, P. C. (1982): Dermatomycosis in Goats in India. Mycoses, 25 (8): 442 – 448. 180. Thakur, D. K., S. K. Misra and P C. Choudhuri. Prevalence of Dermatomycosis in Sheep in Northern India. Mykosen 26 (5) 268-272, 1983 181. Tontis A. [Oral aspergillosis in a goat--a stomatologic problem. Case report]. Tierarztl Prax. 1993 Jun;21(3):193-5. 182. Torres-Rodriguez, J M, BaroT, MoreraY, Alia C, Lopez O, Hermosod M. Molecular characterization of Cryptococcus neoformans var. gattii causing epidemic

172

outbreaks of cryptococcosis in goats. Revista IberoamericanaMicologia1999;16:164– 165. 183. Torres-Rodríguez,J. M., Miguel Hermoso de Mendoza, Eidi Alvarado-Ramírez& Gemma Segura-Roca. Cryptococcosis by Cryptococcus gattii in immunocompetent goats in Spain and review of the literature. Acta Scientiae Veterinariae. 34(3): 245-253, 2006. 184. Tüller, G., Armbruster, G., Widenmann, S. et al, Occurrence of roquefortine in silage – toxicological relevance to sheep. J Anim Physiol Anim Nutr. 1998;80:246–249 185. Ubiali D.G. , R.A.S. Cruz, D.A.J. De Paula et al. (2013). Pathology of Nasal Infection caused by Conidiobolus lamprauges and Pythium insidiosum in Sheep. J. Comp. Pathol. 149,2-3, 137-145 186. Upadhaya SD, Sung HG, Lee CH, et al. Comparative study on the aflatoxin B1 degradation ability of rumen fluid from Holstein steers and Korean native goats. Journal of Veterinary Science. 2009;10(1):29-34. 187. Uzal FA, Paulson D, Eigenheer AL, Walker RL. Malassezia slooffiae- associated dermatitis in a goat. Vet Dermatol. 2007 Oct;18(5):348-52.

188. Vanbreuseghem, R (1967): Teigne par Trichophyton verrucosum Bodin 1982 chez des chkvres el chez un mouton en Republique de Somalie, Ann. SOCb. elge. Med. trop. 47: 243-248. 189. van Wuijckhuise L, Snoep J, Cremers G, Duvivier A, Groeneveld A, Ottens W, van der Sar S. [First case of pithomycotoxicosis (facial eczema) in the Netherlands]. Tijdschr Diergeneeskd. 2006 Dec 1;131(23):858-61.

190. Vilela R, Silva SMS, Riet-Correa F, Dominguez E, Mendoza L. Morphologic and Phylogenetic Characterization of Conidiobolus lamprauges Recovered from Infected Sheep . Journal of Clinical Microbiology. 2010;48(2):427-432. 191. Villarroe A, Maggiulli TR: Rare Cryptococus gattii infection in an immunocompetent dairy goat following a cesarean section. Med Mycol 2012, 1:91– 94. 192. Virdis S, Scarano C, Spanu V, et al. A Survey on Aflatoxin M1 Content in Sheep and Goat Milk Produced in Sardinia Region, Italy (2005-2013). Italian Journal of Food Safety. 2014;3(4):4517. doi:10.4081/ijfs.2014.4517. 193. Wei K. Nip & Fun S. Chu. Fate of ochratoxin a in goats. Journal of Environmental Science and Health, Part B, 14, 1979, 3, 319-333 194. White DG, Putt SC. Dermatomycosis in a pig and a ram. Vet Rec. 1984 Feb 25;114(8):203-4. 195. Young NE. Pulmonary aspergillosis in the lamb. Vet Rec. 1970 Jun 27;86(26):790. 196. Zakia AM, Osheik AA, Halima MO. Ovine chlorellosis in the Sudan. Vet Rec. 1989 Dec 16;125(25):625-6. 197. Zhang J, Pan Z, Moloney S, Sheppard A. RNA-Seq Analysis Implicates Detoxification Pathways in Ovine Mycotoxin Resistance. Virolle M-J, ed. PLoS ONE. 2014;9(6):e99975. doi:10.1371/journal.pone.0099975. 198. Zhao W, Zhang W, Yang D, Zhang L, Wang R, Liu A. Prevalence of Enterocytozoon bieneusi and genetic diversity of ITS genotypes in sheep and goats in China. Infect Genet Evol. 2015 Jun;32:265-70. 199. Zia M, Mirhendi H, Toghyani M. Detection and identification of Malassezia species in domestic animals and aquatic birds by PCR-RFLP. Iranian Journal of Veterinary Research. 2015;16(1):36-41.

173

174