pathogens

Article Characterisation of the Major Extracellular Proteases of Stenotrophomonas maltophilia and Their Effects on Pulmonary Antiproteases

Kevin Molloy 1, Stephen G. Smith 2, Gerard Cagney 3, Eugene T. Dillon 3, Catherine M. Greene 4,* and Noel G. McElvaney 1 1 Department of Medicine, Royal College of Surgeons in Ireland, Beaumont Hospital, D02 YN77 Dublin, Ireland 2 Department of Clinical Microbiology, School of Medicine, Trinity College Dublin, D02 PN40 Dublin, Ireland 3 School of Biomolecular and Biomedical Science, University College Dublin, D04 V1W8 Dublin, Ireland 4 Department of Clinical Microbiology, Royal College of Surgeons in Ireland, Beaumont Hospital, D02 YN77 Dublin, Ireland * Correspondence: [email protected]



Received: 31 May 2019; Accepted: 22 June 2019; Published: 28 June 2019


Abstract: Stenotrophomonas maltophilia is an emerging global opportunistic pathogen that has been appearing with increasing prevalence in cystic fibrosis (CF). A secreted protease from S. maltophilia has been reported as its chief potential virulence factor. Here, using the reference clinical strain S. maltophilia K279a, the major secreted proteases were identified. Protein biochemistry and mass spectrometry were carried out on K279a culture supernatant. The effect of K279a culture supernatant on cleavage and anti-neutrophil elastase activity of the three majors pulmonary antiproteases was quantified. A deletion mutant of S. maltophilia lacking expression of a protease was constructed. The serine proteases StmPR1, StmPR2 and StmPR3, in addition to chitinase A and an outer membrane esterase were identified in culture supernatants. Protease activity was incompletely abrogated in a K279a-∆StmPR1: Erm mutant. Wild type K279a culture supernatant degraded alpha-1 antitrypsin (AAT), secretory leucoprotease inhibitor (SLPI) and elafin, important components of the lung’s innate immune defences. Meanwhile SLPI and elafin, but not AAT, retained their ability to inhibit neutrophil elastase. StmPR3 together with StmPR1 and StmPR2, is likely to contribute to protease-mediated innate immune dysfunction in CF.

Keywords: serine protease; cystic fibrosis; alpa-1 antitrypsin; secretory leucoprotease; elafin

1. Introduction Bacterial proteases have important pathological consequences in cystic fibrosis (CF) lung disease. The role of some, in particular proteases produced by P. aeruginosa, an opportunistic CF lung pathogen, have been investigated [1,2]. Less is known regarding the role of proteases in the pathogenesis of Stenotrophomonas maltophilia lung disease in CF. S. maltophilia is commonly present in the CF respiratory tract [3,4]. The pathogenic role of this organism in CF is controversial with recent evidence indicating that colonisation is associated with an almost threefold increased risk of death or lung transplantation [5]. S. maltophilia produces both a major (StmPR1) and a minor (StmPR2) [6–8] extracellular protease. The stmPR1 gene encodes a 63 kDa precursor which is post-translationally modified to a functionally active 47 kDa subtilisin-like serine protease. StmPR1 is an alkaline protease with an optimal pH of 9.0 and its activity can be inhibited in the presence of antipain, chymostatin, and phenylmethylsulfonyl fluoride (PMSF) [6–8]. Significant inter strain differences in StmPR1 expression exist [9]. Two distinct

Pathogens 2019, 8, 92; doi:10.3390/pathogens8030092 www.mdpi.com/journal/pathogens Pathogens 2019, 8, 92 2 of 20 allelic variants of stmPR1 have been identified; the original one first identified by Windhorst et al. [6] and the second in K279a, the reference clinical strain [7]. The genome of S. maltophilia K279a has been fully sequenced [10] and is now the reference clinical strain of choice for studying S. maltophilia virulence related mechanisms, and is used throughout this work. StmPr2 is expressed in K279a [7,8] Using both clinical and an environmental strains of S. maltophilia, further serine proteases from S. maltophilia have been identified, termed StmPR3 and StmPR4 [8,11]. An ATP-dependent metalloproteinase (FtsH) [11] and an esterase have also been described [9]. Extracellular protease production from S. maltophilia may have important pathogenic consequences in persons colonised by the organism, being responsible for degradation of components of the extracellular matrix, immunoglobulin G [6] and for destructive effects on airway epithelial cells [12]. StmPR1 was a more important virulence determinant than StmPR2 in a toxicity model in Galleria mellonella larvae [9]. Indeed, a series of studies has reported genomic and biochemical information on StmPR1, 2 and 3 under various bacterial growth conditions, protease mutant construction and demonstration that the proteases are secreted via a type II secretion system [7,8]. In addition, evidence exists of serine proteolytic and caseinolytic activity by S. maltophilia, that is sensitive to PMSF and chymostatin, and can degrade host extracellular matrix proteins and IL-8, induce human lung epithelial cell rounding, detachment and, death, and activate PAR receptors [7,8]. Production of an extracellular protease has been purported to be responsible for the pathological effects seen in cases of lethal haemorrhage in S. maltophilia pulmonary infection [13] and could also be responsible for virulence in CF lung disease. The CF lung is an intense pro-inflammatory environment, the hallmark of which is neutrophil dominated inflammation and high amounts of the serine protease, neutrophil elastase (NE) [14]. Three important pulmonary serine anti-proteases are alpha-1 antitrypsin (AAT), secretory leucoprotease inhibitor (SLPI) and elafin [15]. These have important beneficial effects within the lung and their dysregulated activity can impact adversely on the inflammatory process [14,15]. Bacterial proteases have the potential to destroy host tissues as well as to destroy proteins that are important components of the innate immune defences [16–19]. For example, Pseudomonas proteases can cleave AAT [20], SLPI [21] and elafin [1]. The direct effect of S. maltophilia proteases on pulmonary anti-proteases has not been investigated. AAT, a 52 kDa glycoprotein is the canonical serine protease inhibitor within the lung and is the most important inhibitor of NE. In the CF lung, the inhibitory activity of AAT is overwhelmed by an excess of harmful proteases, in particular neutrophil elastase (NE) but also cathepsin L [22] and Pseudomonas elastase. SLPI, an 11.7 kDa cationic protein, is a potent inhibitor of NE and can also inhibit cathepsin G [23]. It also has antibacterial, antiviral and anti-inflammatory properties [24–28]. SLPI is susceptible to cleavage by cathepsins B, L and S [29]. Elafin is expressed in the lung and other sites [30,31]. It possesses anti-microbial and anti-inflammatory activities [32–34] and is susceptible to NE-mediated cleavage in the lungs of patients colonised with P. aeruginosa [35]. In the CF lung, the important anti-inflammatory, anti-microbial and anti-protease effects of AAT, SLPI and elafin are lost but the role of S. maltophilia in mediating these effects has not yet been determined. Here we elucidate its major extracellular protease(s) using K279a as the reference clinical strain of S. maltophilia and investigate the ability of K279a culture supernatant to degrade AAT, SLPI and elafin and determine the functional consequences on their ability to inhibit neutrophil elastase. In addition, we generate a mutant of S. maltophilia defective in StmPR1.

2. Results

2.1. Optimal Conditions for K279a Extracellular Protease Production Initially to screen for phenotypic expression of proteolytic activity in K279a, the ability of K279a to form clear zones when grown on indicator LB agar medium containing 2% skimmed milk was assessed, similar to Karaba et al. [12]. Halo formation was caused by hydrolysis of the milk protein casein. K279a Pathogens 2019, 8, 92 3 of 20 Pathogens 2019, 8 FOR PEER REVIEW 3 assessed,formed clear similar halos to atKaraba 24 h (13 et al mm). [12]. and Halo 48 hformation (27 mm), was respectively caused by (Figure hydrolysis1A) corresponding of the milk protein to the casein.early to K279a mid-stationary formed clear phase halos of growthat 24 hours (Figure (13 1mm)B). and 48 hours (27 mm), respectively (Figure 1A) corresponding to the early to mid-stationary phase of growth (Figure 1B).

(left) (right) (A)

(B)

FigureFigure 1. 1. InitialInitial screening screening for for protease protease activity activity using using LB LB agar agar 2% 2% milk milk plates plates an andd K279a K279a growth growth curve. curve. ° (A)(A).. Following Following overnight overnight culture, 100 μµL of K279a (grown in LBB at 37 37◦CC and and 200 200 rpm) rpm) was was inoculated inoculated inin a a centrally centrally cored cored 0.8 0.8 cm cm well well in in a a LB LB agar agar plate plate containing containing 2% 2% skim skim milk. milk. Plates Plates were were photographed photographed atat 24 hhours (left) (left) and 48and h (right)48 hours following (right) incubationfollowing andincubation examined and for examined zones of fo hydrolysisr zones of (indicated hydrolysis by (indicatedcentral clearing by central of halos). clearing (B) A K279aof halos). growth (B) curveA K279a was constructedgrowth curve following was constructed inoculation offollowing 10 µL of inoculationan overnight of culture 10 μL ofof K279aan overnight (grown inculture LBB atof 37 K279a◦C and (grown 200 rpm) in LBB in fresh at 37 LBB.°C and Absorbance 200 rpm) at in 600 fresh nm LBB.(OD600 Absorbance) and a CFU at/ mL600 countnm (OD was600) calculated and a CFU/ml every count 2 h for was the calculated first 16 h and every every 2 hours 24 h thereafterfor the first for 16 a hourstotal duration and every of 9624 h.hours Results thereafter are expressed for a total as OD du600rationnm (rightof 96 hours. y-axis) Results and Log are10 CFU expressed/mL (left as y-axis). OD600 nm (right y-axis) and Log10 CFU/ml (left y-axis). Having determined that K279a is proteolytically active at 24 and 48 h on solid medium protease, productionHaving in determined broth liquid that culture K279a (LBB) is wasproteolytically confirmed using active the at Sensolyte 24 and 48 Red hours Protease on assay.solid medium DuMont protease,et al. previously production demonstrated in broth liquid the enzymatic culture (LBB activity) was StmPR confirmed proteins using in the bu ffSensolyteered yeast Red extract Protease [7,8]. assay.In LBB, DuMont significantly et al. morepreviously protease demonstrated activity was evidentthe enzymatic following activity 48 h of StmPR culture proteins compared in withbuffered 24 h yeastand noextract significant [7,8]. In di ffLBB,erence significantly was observed more between protease the activity 24-h time-point was evident and following uninoculated 48 hours control of culture(Figure 2comparedB). A subsequent with 24 increase hours and in activity no significant was observed difference between was days observed 3–4, 4–5 between and 6–7. the However, 24-hour time-pointthis later increase and uninoculated in protease activitycontrol likely(Figure represented 2B). A subsequent a decline increase phase in in bacterial activity growth was observed and was betweentherefore days not investigated3–4, 4–5 and 6–7. any However, further. For this subsequent later increase experiments in protease all activity culture likely supernatants represented were a declinesampled phase after 48in hbacterial of culture. growth and was therefore not investigated any further. For subsequent experiments all culture supernatants were sampled after 48 hours of culture. In order to determine a suitable nutrient medium for the maximal extracellular protease activity, K279a culture supernatant was prepared using a selection of different culture media including LBB, trypticase soy broth (TSB), M9 minimal medium and the mammalian cell culture medium Dulbecco’s modified essential medium (DMEM) [high (25 mM) and low glucose (5.6 mM) versions] with and 3

Pathogens 2019, 8 FOR PEER REVIEW 4 without 10% foetal calf serum (Figure 2A). Growth in DMEM resulted in the highest fold (3.933 ± 0.092) increase in protease activity compared with LBB (p < 0.0001). The concentration of glucose had no effect on protease, being similar in DMEM with a high glucose concentration (25 mM) and a low glucose concentration (5.6 mM). The presence of foetal calf serum (FCS) reduced K279a protease activity in DMEM L/G (1.294 ± 0.1684) and H/G (1.227 ± 0.08744) likely due to the potential presence of protease inhibitors such as AAT and alpha-2 macroglobulin in FCS. As no significant difference between low glucose and high glucose versions of DMEM was identified, DMEM with the lower glucose concentration (5.6 mM) was used for all subsequent experiments and will be referred to as DMEM from this point forward. Indeed, this concentration is of the order observed in the CF lung [36,37].Pathogens 2019, 8, 92 4 of 20 Fold Rise in Protease Activity Protease in Rise Fold

A

####

B

FigureFigure 2. EffectEffect of culture mediummedium andand timetime on on K279a K279a protease protease activity. activity. (A K279a) K279a culture culture supernatant supernatant was obtained following following inoculation inoculation of of 10 10 μµLL of of an an overnight overnight culture culture of of K279a K279a (grown (grown in in LBB LBB at at 37 37 °C◦C andand 200 200 rpm) rpm) in in the the following following test test media: media: LBB, LBB, TS TSB,B, M9 M9 minimal minimal media, media, DMEM-L/G DMEM-L/G ± 10%10% v/v v/ vFCS, FCS, ± DMEM-H/GDMEM-H/G ± v/vv/v 10%FCS. 10%FCS. Each Each culture culture was was incubated incubated for for48 hours 48 h at at 3737 °CC and 200 rpm. Protease Protease ± ◦ activityactivity in in culture culture supern supernatantsatants was was measured measured using using the the Sensolyte Sensolyte Red Red Protease Protease assay assay kit kit (Anaspec). (Anaspec). K279aK279a culture supernatant obtainedobtained fromfrom LBBLBB atat 48 48 h hours and trypsin and trypsin (12.5 mU(12.5/µ L)mU/ wereμL) used were as used positive as positivecontrols. controls. Results Results are expressed are expressed as fold as risefold inrise protease in protease activity activity relative relative to brothto broth control control and and are arerepresentative representative of three of three independent independent experiments. experiment Alls. measurementsAll measurements are representedare represented as means as meansSEM ± ± from biological replicates. One-way-ANOVA followed by Tukey post hoc test for multiple comparisons; ns (non significant) LBB vs day 1, ****(p 0.0001)4 protease activity in test media vs LBB K279a culture ≤ supernatant, #### (p 0.0001) protease activity in DMEM L/G or H/G 10% v/v FCS. (B) K279a culture ≤ ± supernatant from LBB cultures following inoculation of 10 µL of an overnight culture and prepared on days 1-7 by centrifuging at 1000 rcf for 5 min to pellet the cells followed by filter sterilisation through a 0.22 µm Millex syringe filter. Protease activity was measured using the Sensolyte Red Protease assay kit (Anaspec). LBB and trypsin (12.5 mU/µL) were used as negative and positive controls. Results are representative of three independent experiments and are represented as means SEM from biological ± replicates. One-way-ANOVA followed by Tukey post hoc test for multiple comparisons; ns (non significant) LBB vs day 1; ****(p 0.0001) protease activity of K279a culture supernatant per days of ≤ culture 1-2, 3-4, 4-5 and 6-7; #### (p 0.0001), LBB vs trypsin control. ≤ Pathogens 2019, 8, 92 5 of 20

In order to determine a suitable nutrient medium for the maximal extracellular protease activity, K279a culture supernatant was prepared using a selection of different culture media including LBB, trypticase soy broth (TSB), M9 minimal medium and the mammalian cell culture medium Dulbecco’s modified essential medium (DMEM) [high (25 mM) and low glucose (5.6 mM) versions] with and without 10% foetal calf serum (Figure2A). Growth in DMEM resulted in the highest fold ( 3.933 0.092) ± increase in protease activity compared with LBB (p < 0.0001). The concentration of glucose had no effect on protease, being similar in DMEM with a high glucose concentration (25 mM) and a low glucose concentration (5.6 mM). The presence of foetal calf serum (FCS) reduced K279a protease activity in DMEM L/G (1.294 0.1684) and H/G (1.227 0.08744) likely due to the potential presence of ± ± protease inhibitors such as AAT and alpha-2 macroglobulin in FCS. As no significant difference between low glucose and high glucose versions of DMEM was identified, DMEM with the lower glucose concentration (5.6 mM) was used for all subsequent experiments and will be referred to as DMEM from this point forward. Indeed, this concentration is of the order observed in the CF lung [36,37]. Concurrent with this experiment bacterial growth characteristics were assessed by calculating log CFU/mL of K279a in each of the respective growth media. On close examination of Figure2A no significant difference in K279a protease activity was identified between rich culture media (LBB and TSB) and the minimal M9 growth medium following correction for multiple comparisons using a Tukey post-hoc test. The fold rise in protease activity relative to broth control between LBB, TSB and M9 growth medium was 0.124, 0.3444 and 0.6642, respectively. ANOVA analysis of these three media alone demonstrated a statistically significant difference between LBB and M9 (p = 0.002) and TSB and M9 (p = 0.03) after correction for multiple comparisons. Examination of growth characteristics of K279a in these respective media showed that K279a grew robustly in LBB, TSB and DMEM (low/high glucose) with or without 10% foetal calf serum (data not shown). In contrast, growth of K279a in M9 minimal medium is 75% less efficient than LBB and TSB and 66% less efficient to the DMEM variants (data not shown). Thus, even in suboptimal growth conditions (as with M9 medium) K279a proteases are more readily produced than in the nutrient rich media such as LBB and TSB but not quite as avidly as with DMEM, which we deemed to have the optimal in vitro conditions for protease induction.

2.2. The Major Secreted Extracellular Protease of K279a Exhibits Serine Protease Activity Having optimised growth conditions for maximal production of protease activity, we next confirmed the classes of proteases secreted by K279a. To this end the inhibitory capacity of a variety of protease inhibitors was assessed including PMSF (phenylmethylsulfonyl fluoride), an irreversible inhibitor of serine proteases and chymostatin, a bioactive peptide with selectivity for chymotryptase-like serine proteases identified previously as a potent inhibitor of StmPR1, the major secreted extracellular protease by S. maltophilia [6–8]. Other protease inhibitors assessed included E64, an irreversible inhibitor of cysteine peptidases and GM6001, a broad-spectrum metalloproteinase inhibitor. Figure3 shows that PMSF and chymostatin, at all concentrations tested, significantly inhibited K279a extracellular protease activity (p 0.0001) relative to their vehicle controls propanol and DMSO, respectively. No ≤ inhibition by GM6001 and E64 was evident. Therefore, our studies (though performed in different media) support other published works reporting that the major secreted extracellular proteases belong to the serine protease class of enzymes [6–8]. Pathogens 2019, 8 FOR PEER REVIEW 6

PathogensPathogens2019 2019, 8, ,8 92FOR PEER REVIEW 6 of 206

Figure Figure 3. K279a 3. K279a extracellular extracellular proteases proteases are inhibite are inhibitedd by PMSF by PMSF and andchymostatin. chymostatin. K279a K279a culture culture supernatantsupernatant was treated was treated with withPMSF PMSF (0.1 mM, (0.1 mM,0.5 mM 0.5 and mM 1 and mM), 1 mM), chymostatin chymostatin (10 μ (10M, 50µM, μM 50 andµM and 100 μ100M),Figureµ E64M), (13. E64 μK279aM, (1 5µ μM, Mextracellular 5 andµM 10 and μM) 10 proteasesorµM) GM6001 or GM6001 are (10 inhibiteμMa (10 µ50Mad μ M)by 50 andµPMSFM) protease and and protease chymostatin.activity activity was measured wasK279a measured culture usingusing supernatantthe theSensolyte Sensolyte was Red treated Red Protease Protease with PMSF assayassay relative(0.1relative mM, to 0.5 theirto mMtheir vehicle and vehicle controls1 mM), controls chymostatin (PMSF (PMSF= propanol, (10 = μpropanol,M, Chymostatin, 50 μM and Chymostatin,E64,100 GM6001μM), E64, E64= GM6001(1DMSO). μM, 5 μ= Relative MDMSO). and 10 % Re μ inhibitionM)lative or GM6001 % inhibition was calculated (10 μ wasMa 50calculated using μM) the and reaction using protease the velocity reactionactivity of was thevelocity untreatedmeasured vehicleusing (V0)the controlSensolyte and Red that ofProtease the tested assay protease relative inhibitors to their (V1) vehicle using thecontrols equation (PMSF 100 =(1 propanol, – V1/V0). of the untreated vehicle (V0) control and that of the tested protease inhibitors (V1) using the equation× 100 ×Velocity Chymostatin,(1 – V1/V0). wascalculated Velocity E64, GM6001 was based calculated = onDMSO). the slope based Relative of on the %the line inhibition slope using of the wasthe linear linecalculated using regression theusing linear equation: the reactionregression y = velocitymx + c equation:(mof denotingthe y =untreated mx + the c (m slope) vehicle denoting on (V0) the the steepest control slope) portionand on thethat ofsteepest of the the kinetic tested portion curve. protease of the All kineticinhibitors results curve. are (V1) representative All using results the areequation of three independent100 × (1 – V1/V0). experiments Velocity and was are calculated represented based as means on the slopeSEM of from the biologicalline using replicates.the linear regression One-way representative of three independent experiments and are represented± as means ± SEM from biological ANOVAequation: followed y = mx + by c (m Tukey denoting post hocthe slope) test; **** onp the0.0001: steepest Inhibitor portion of vs the vehicle kinetic control. curve. Student All resultst-test; are replicates. One-way ANOVA followed by Tukey post≤ hoc test; ****p ≤ 0.0001: Inhibitor vs vehicle #representativep 0.05: PMSF of 0.1three mM independent vs 0.5 mM. experiments Abbreviations: and DMSO,are represented Dimethyl as sulfoxide;means ± SEM Prop, from 2-propanol; biological control. Student≤ t-test; #p ≤ 0.05: PMSF 0.1 mM vs 0.5 mM. Abbreviations: DMSO, Dimethyl sulfoxide; Prop,PMSF, replicates.2-propanol; phenylmethylsulfonyl One-way PMSF, ANOVAphenylmethylsulfonyl fluoride. followed by Tukeyfluoride. post2.3. hoc Screening test; **** pK279a ≤ 0.0001: for InhibitorExtracellular vs vehicle control. Student t-test; #p ≤ 0.05: PMSF 0.1 mM vs 0.5 mM. Abbreviations: DMSO, Dimethyl sulfoxide; 2.3.Serine Screening Proteases K279a for Extracellular Serine Proteases Prop, 2-propanol; PMSF, phenylmethylsulfonyl fluoride.2.3. Screening K279a for Extracellular The TheS.Serine maltophiliaS. maltophiliaProteases K279a K279a genome genome has hasbeen been sequenced sequenced (GenBank: (GenBank: AM743169.1). AM743169.1). It encodes It encodes two two metalloproteinasemetalloproteinase genes, genes, one esterase one esterase gene geneand four and fourserine serine protease protease genes, genes, namely, namely, FtsH, FtsH, ZnMMP, ZnMMP, The S. maltophilia K279a genome has been sequenced (GenBank: AM743169.1). It encodes two esterase,esterase, StmPR1, StmPR1, StmPR2, StmPR2, StmPR3 StmPR3 and andExSP ExSP [7–11] [7.– 11The]. presence The presence of these of these protease protease genes genes on the on the metalloproteinase genes, one esterase gene and four serine protease genes, namely, FtsH, ZnMMP, genomegenome of K279a of K279a was wasvalidated validated by PCR by PCRusing using specific specific primers primers to each to eachprotease protease gene gene of interest of interest on on esterase, StmPR1, StmPR2, StmPR3 and ExSP [7–11]. The presence of these protease genes on the K279aK279a genomic genomic DNA. DNA. A 1.5% A 1.5% agarose agarose gel gelverified verified single single products products of ofthe the predicted predicted size, size, indicating indicating the genome of K279a was validated by PCR using specific primers to each protease gene of interest on the carriagecarriage of of all all of of protease protease genes genes of of interest interest in in the the genome genome of of K279a K279a (Figure (Figure 44).). K279a genomic DNA. A 1.5% agarose gel verified single products of the predicted size, indicating the carriage of all of protease genes of interest in the genome of K279a (Figure 4).

Figure 4. Candidate protease genes identified from the genome of K279a by PCR. Genomic DNA was extracted from overnight cultures of K279a (grown in LBB at 37 C with agitation at 200 rpm) using the Figure 4. Candidate protease genes identified from the genome of K279a◦ by PCR. Genomic DNA was Fast DNA spin kit (MP Bio). DNA concentration was quantified using the NanoDrop 8000 (Thermo extracted from overnight cultures of K279a (grown in LBB at 37 °C with agitation at 200 rpm) using Scientific) and a final concentration of 100 ng was used for PCR with SYBR Green I Master on the the FastFigure DNA 4. Candidatespin kit (MP protease Bio). genesDNA identifiedconcentration from wasthe genome quantified of K279a using by the PCR. NanoDrop Genomic 8000DNA was Roche LC480 lightcycler. PCR products were electrophoresed on 1.5%° agarose gel electrophoretograms (Thermoextracted Scientific) from and overnight a final concentrationcultures of K279a of 100 (grown ng was in usedLBB atfor 37 PCR C with agitationSYBR Green at 200 I Master rpm) using using a 100 bp (New England Biolabs) DNA ladder. Abbreviations: 16s rRNA = 16s ribosomal on thethe Roche Fast DNALC480 spin lightcycler. kit (MP Bio).PCR DNA products concentr wereation electrophoresed was quantified on using 1.5% the agarose NanoDrop gel 8000 RNA; FtsH = ATP dependent metalloproteinase; StmPR1, 2 and 3 = Subtilisin like serine proteases; electrophoretograms(Thermo Scientific) using and a 100 a final bp (New concentration England ofBi olabs)100 ng DNA was usedladder. for Abbreviations: PCR with SYBR 16s Green rRNA I =Master ZnMMP = Zinc metalloproteinase; ExSP = Extracellular serine protease. 16s ribosomalon the RNA;Roche FtsH LC480 = ATP lightcycler. dependent PCRmetalloproteinase; products were StmPR1, electrophoresed 2 and 3 = Subtilisin on 1.5% like agaroseserine gel electrophoretograms using a 100 bp (New England Biolabs) DNA ladder. Abbreviations: 16s rRNA = proteases;Given ZnMMP that a serine= Zinc metalloproteinase; protease(s) was responsibleExSP = Extracellular for almost serine all protease. extracellular proteolytic activity, 16s ribosomal RNA; FtsH = ATP dependent metalloproteinase; StmPR1, 2 and 3 = Subtilisin like serine we focused on candidate proteases with serine-type endopeptidase activity, namely StmPR1, StmPR2, proteases; ZnMMP = Zinc metalloproteinase; ExSP = Extracellular serine protease. StmPR3 and ExSP. These belong to the peptidase6 S8 or subtilase family of serine proteases as classified

6

Pathogens 2019, 8 FOR PEER REVIEW 7

PathogensGiven2019, 8 ,that 92 a serine protease(s) was responsible for almost all extracellular proteolytic activity,7 of 20 we focused on candidate proteases with serine-type endopeptidase activity, namely StmPR1, StmPR2, StmPR3 and ExSP. These belong to the peptidase S8 or subtilase family of serine proteases byas the classified MEROPS by peptidase the MEROPS database peptidase (www.merops.sanger.ac.uk database (www. merops.sanger.ac.uk)) with an Asp, His with and an Ser Asp, catalytic His and triad.Ser Tablecatalytic1 summarises triad. Table the 1 features summarises of each the of thefeatures candidate of each extracellular of the candidate serine proteases extracellular including serine UniProtproteases ID, geneincluding name, UniProt sequence ID, length gene name, and predicted sequence molecular length and weights. predicted The molecular predicted weights. isoelectric The pointspredicted (PI) were isoelectric obtained points from (PI) ExPASy were obtained (http://web.expasy.org from ExPASy/compute_pi (http://web.expasy.org/compute_pi/)./).

TableTable 1. Characteristics1. Characteristics of of candidate candidate K279a K279a extracellular extracellular serine serine proteases. proteases.

StmPR1StmPR1 StmPR2StmPR2 StmPR3StmPR3 ExSPExSP UniProtUniProt ID ID B2FNH2B2FNH2 B2FQ06B2FQ06 B2FLH5B2FLH5 B2FI22B2FI22 GeneGene Smlt0686Smlt0686 expRexpR Smlt4395Smlt4395 Smlt4145Smlt4145 Length (AA) 630 580 588 1,118 Length (AA) 630 580 588 1,118 Predicted MW 63,605 Da 58,291 Da 61,297 Da 116,012 Da PredictedPredicted PI MW 6.4763,605 Da 6.2258,291 Da 9.1461,297 Da 116,012 6.15 Da MEROPSPredicted family PI S8 (subtilisin)6.47 S8 (subtilisin)6.22 S8 (subtilisin)9.14 S8 (subtilisin)6.15 MEROPS familyAbbreviations: S8 (subtilisin) AA, amino acid; MW,S8 molecular (subtilisin) weight; PI =S8isoelectric (subtilisin) point. S8 (subtilisin) Abbreviations: AA, amino acid; MW, molecular weight; PI = isoelectric point. ToTo visualise visualise the proteolyticthe proteolytic activity activity of K279a of secretedK279a secreted proteases, proteases, gelatin zymography gelatin zymography was utilised towas identifyutilised bands to identify with gelatinolytic bands with activity gelatinolytic and approximate activity and their approximate molecular their weight. molecular Gelatin weight. zymography Gelatin ofzymography K279a culture of supernatant K279a culture (diluted supernatant 1:10 in (diluted DMEM) 1:10 confirmed in DMEM) that confirmed the major secreted that the extracellularmajor secreted proteasesextracellular from proteases K279a were from serine K279a proteases, were serine being pr inhibitedoteases, bybeing the serineinhibited protease by the inhibitor serine protease PMSF. Fourinhibitor major PMSF. bands (FigureFour major5A) and bands five (Figure minor bands5A) and (Figure five minor5B) were bands identified. (Figure The5B) were activity identified. of all the The majoractivity bands of (dataall the not major shown) bands and three(data ofnot the shown) minor bandsand three (Figure of5 B)the was minor abolished bands in(Figure the presence 5B) was ofabolished PMSF indicating in the presence the presence of PMSF of indicating high molecular the pr (approximatelyesence of high molecular 250 kDa) (approximately and lower molecular 250 kDa) weightand lower (approximate molecular MW weight range (approximate 55–80 kDa) MW secreted range serine 55 – proteases.80 kDa) secreted PMSF serine had no proteases. effect on PMSF the activitieshad no ofeffect two ofon thethe minor activities bands of withtwo of intermediate the minor molecularbands with weight intermediate (~100 kDa) molecular and indicated weight they (~100 belongedkDa) and to indicated a different they class belonged of proteases. to a different class of proteases.

FigureFigure 5. 5.Gelatin Gelatin zymography zymography of of K279a K279a culture culture supernatant. supernatant. A A 1:10 1:10 dilution dilution of of K279a K279a culture culture supernatantsupernatant was was either either untreated untreated or pre-incubated or pre-incubated with with 1 mM 1 ofmM PMSF of PMSF before before being mixedbeing inmixed a 1:1 in ratio a 1:1 µ withratio non-reducing with non-reducing sample bu sampleffer. 10 buffer.L of sample 10 μL was of loadedsample per was well loaded and subjected per well to and electrophoresis subjected to for (A) 4 h or (B) 1.5 h on a 12.5% gelatin zymogram. Zones of gelatinolytic activity are indicated by the electrophoresis for (A) 4 hours or (B) 1.5 hours on a 12.5% gelatin zymogram. Zones of gelatinolytic black arrows. activity are indicated by the black arrows. 2.4. Identification of the Major Secreted Proteases by Mass Spectrometry 2.4. Identification of the Major Secreted Proteases by Mass Spectrometry As a means of identifying the proteases secreted by K279a, culture supernatant concentrates from broth culturesAs a means of K279a of identifying were examined the proteases by SDS-PAGE secret anded Coomassieby K279a, culture blue silver supernatant staining (Figure concentrates6A). Thisfrom revealed broth clusteringcultures of of K279a four bandswere examined adjacent to by the SDS-PAGE 55.4 kDa molecularand Coomassie weight blue standard silver (bandsstaining 3–6). The most intensely staining band had an approximate7 molecular weight of 47 kDa which may

Pathogens 2019, 8 FOR PEER REVIEW 8

(Figure 6A). This revealed clustering of four bands adjacent to the 55.4 kDa molecular weight standard (bands 3–6). The most intensely staining band had an approximate molecular weight of 47 kDa which may correspond to mature StmPR1 (band 5) as described by Windhorst et al. [6]. Three additional bands, (bands 3, 4, 6) may contain the additional serine proteases of interest while the two high molecular weight bands (bands 1, 2) may contain proteases representative of the high molecular weight areas of protease activity that were observed by gelatin zymography (Figure 5A). Given that the most intense area of protease activity on zymography was located adjacent to the 64 kDa molecular weight standard, we hypothesised that the most intensely staining bands on SDS- PAGE and Coomassie staining adjacent to the 55.4 kDa molecular weight standard contained the proteases of interest. These included StmPR1, StmPR2 and StmPR3 but not ExSP with unprocessed molecular weights of 63 kDa, 58 kDa and 61 kDa respectively. Four fractions of gel bands were excised (bands 3–6) and in-gel digestion was performed on each fraction. After in-gel digestion of proteins, LC-MS/MS was used to analyse the extracted peptides for protein identification. All three proteases of interest were identified in addition to chitinase A (UniProt ID: B2FMT1) and an outer membrane esterase (UniProt ID: B2FSC8) (Table 2).

Table 2. Proteases identified from in gel-digestion of bands 3-6 from K279a culture supernatant. Spectral Count % coverage MW (Da) StmPR1 15 37.3 63,605 StmPR2 2 8 58,291 StmPR3 16 38.1 61,297 Chitinase 1 1.7 72,939 Esterase 11 27 64,199

PathogensRelative2019, 8, 92protein quantitative levels were determined by spectral counting. StmPR1 and StmPR38 of 20 were the most abundant subtilisins (serine protease) identified and were detected in all four digested bands. StmPR2, the so-called minor extracellular protease and chitinase A, a glycoside hydrolase with correspondanti-fungal to properties mature StmPR1 were present (band 5)in asbands described 4 and band by Windhorst 5 but were et less al. [ 6abundant]. Three additional than StmPR1 bands, and (bandsStmPR3 3, 4,[38]. 6) mayThe containouter membrane the additional esterase serine was proteases more readily of interest represented while the in twoband high 5 but molecular was also weightdetected bands in bands (bands 4 and 1, 2) 6 may (Figure contain 6B-E). proteases These results representative indicate that of the StmPR1 high molecular is not the sole weight major areas serine of proteaseprotease activity secreted that by wereS. maltophilia observed but by that gelatin StmP3 zymography may also be (Figure a major5A). extracellular protease of K279a.

Figure 6. Identification of the major extracellular8 serine proteases by in-gel digestion and mass spectrometry analysis. (A) K279a culture supernatant proteins were filtered and concentrated and loaded onto a 12.5% polyacrylamide gel, subjected to SDS-PAGE, and stained with colloidal Coomassie blue silver stain. The relative migrations of molecular mass protein standards (lane 1; in kDa) are indicated on the left and K279a culture supernatant proteins to the right. Respective bands are indicated by the arrows. (B–E) Spectral counts of peptides identified by LC-MS/MS from in gel-digestion of proteases in bands 3-6. Each protease is represented by a unique colour. The spectral count is indicated by a whole number and denoted below is the percentage spectral count of each protease per band.

Given that the most intense area of protease activity on zymography was located adjacent to the 64 kDa molecular weight standard, we hypothesised that the most intensely staining bands on SDS-PAGE and Coomassie staining adjacent to the 55.4 kDa molecular weight standard contained the proteases of interest. These included StmPR1, StmPR2 and StmPR3 but not ExSP with unprocessed molecular weights of 63 kDa, 58 kDa and 61 kDa respectively. Four fractions of gel bands were excised (bands 3–6) and in-gel digestion was performed on each fraction. After in-gel digestion of proteins, LC-MS/MS was used to analyse the extracted peptides for protein identification. All three proteases of interest were identified in addition to chitinase A (UniProt ID: B2FMT1) and an outer membrane esterase (UniProt ID: B2FSC8) (Table2).

Table 2. Proteases identified from in gel-digestion of bands 3-6 from K279a culture supernatant.

Spectral Count % Coverage MW (Da) StmPR1 15 37.3 63,605 StmPR2 2 8 58,291 StmPR3 16 38.1 61,297 Chitinase 1 1.7 72,939 Esterase 11 27 64,199 Pathogens 2019, 8 FOR PEER REVIEW 9

Pathogens 2019, 8, 92 9 of 20 Figure 6. Identification of the major extracellular serine proteases by in-gel digestion and mass spectrometry analysis. K279a culture supernatant proteins were filtered and concentrated and loaded ontoRelative a 12.5% protein polyacrylamide quantitative gel, levelssubjected were to SDS-PAGE, determined and by stained spectral with counting. colloidal StmPR1 Coomassie and blue StmPR3 weresilver the moststain. abundantThe relative subtilisins migrations (serine of molecular protease) mass identifiedprotein standards and were (lane detected 1; in kDa) in are all indicated four digested bands.on the StmPR2, left and the K279a so-called culture minor supernatant extracellular proteins protease to the right. and Respective chitinase bands A, a glycoside are indicated hydrolase by the with anti-fungalarrows. (B-E) properties Spectral were counts present of peptides in bands identified 4 and by band LC-MS/MS 5 but were from less in gel-digestion abundant than of proteases StmPR1 and StmPR3in bands [38]. 3-6. The Each outer protease membrane is represented esterase by was a un moreique colour. readily The represented spectral count in bandis indicated 5 but by was a also detectedwhole in number bands 4and and denoted 6 (Figure below6B–E). is the These percentage results spectral indicate count that of StmPR1 each protease is not theper soleband. major serine protease secreted by S. maltophilia but that StmP3 may also be a major extracellular protease of K279a. 2.5. Incomplete Attenuation of Protease Activity in a K279a StmPR1 Mutant 2.5. Incomplete Attenuation of Protease Activity in a K279a StmPR1 Mutant To elucidate the contribution of StmPR1 to total extracellular proteolytic activity of K279a, mutantsTo elucidatewere constructed the contribution in-house of as StmPR1 described to total in Materials extracellular and proteolytic Methods and activity similarly of K279a, to reference mutants [7].were To constructedassay the activity in-house of the as K279a- describedΔStr1: in Erm Materials mutants, and 10 Methods colonies andwere similarly selected toat random reference and [7]. proteaseTo assay activity the activity measured of the by K279a- the Sensolyte∆Str1: ErmRed Prot mutants,ease assay. 10 colonies All colonies were selected selected had at random diminished and proteaseprotease activity activity (70.29 measured ± 0.94%) by the relative Sensolyte to the Red K27 Protease9a wild assay.(WT) type All colonies control. selectedInterestingly, had diminished mutation ofprotease the StmPr1 activity gene (70.29 incompletely0.94%) relativeabolished to theextracellu K279a wildlar protease (WT) type activity control. indicating Interestingly, a role mutationof other ± proteasesof the StmPr1 such geneas StmPR2 incompletely as previously abolished described, extracellular or StmPR3 protease as described activity indicating in this work a role (Figure of other 7) [7,8].proteases such as StmPR2 as previously described, or StmPR3 as described in this work (Figure7)[ 7,8].

Figure 7. Extracellular protease activity is incompletely attenuated in selected K279a-∆Str1: Erm Figuremutants. 7. CultureExtracellular supernatants protease were acti obtainedvity is incompletely following inoculation attenuated of ain single selected colony K279a- of WTΔStr1: K279a Erm and

mutants.10 selected Culture K279a- supernatants∆Str1: Erm. Eachwere cultureobtained was followi incubatedng inoculation for 48 h at of 37 a◦ Csingle and 200colony rpm of and WT bacterial K279a andculture 10 selected supernatant K279a- wasΔStr1: obtained Erm. Each as previously culture was described. incubated Protease for 48 hours activity at was37 °C measured and 200 rpm using and the bacterialSensolyte culture Red Protease supernatant assay was kit obtained (Anaspec). as WTprev K279aiously culturedescribed. supernatant Protease activity was used was as measured a positive usingcontrol the while Sensolyte DMEM Red culture Protease medium assay was kit used(Anasp asec). a negative WT K279a control culture (Cont.). supe Allrnatant results was are used expressed as a positiverelative control to WT K279awhile DMEM and are culture representative medium ofwas three used independent as a negative experiments. control (Cont.). All measurementsAll results are expressedare means relativeSEM fromto WT biological K279a replicates.and are represen One-way-ANOVAtative of three followed independent by Tukey experiments. post hoc test All for ± measurementsmultiple comparisons; are means **** ± (p SEM0.0001), from ***biological (p 0.001), replicates. ** (p 0.01), One-way-ANOVA * (p 0.05), protease followed activity by relativeTukey ≤ ≤ ≤ ≤ postto WT hoc K279a. test for multiple comparisons; ****(p ≤ 0.0001), ***(p ≤ 0.001), **(p ≤ 0.01), *(p ≤ 0.05), protease activity relative to WT K279a. 2.6. AAT, SLPI and Elafin Are Degraded in the Presence of K279a Culture Supernatant 2.6. AAT,Next, SLPI wild and type Elafin K279a are Degraded culture supernatant in the Presence was of used K279a to Culture evaluate Supernatant the effect of proteases secreted by K279aNext, onwild AAT, type SLPI K279a and culture elafin. supernatant As shown in was Figure used8, to AAT, evaluate SLPI andthe effect elafin of were proteases cleaved secreted and /or bydegraded K279a on by AAT, K279a SLPI proteases and elafin. after As 15 min.shown Both in Figu AATre and 8, AAT, elafin SLPI were and completely elafin were degraded cleaved after and/or 1 h. degradedThe serine by protease K279a proteases inhibitor after PMSF 15 prevented minutes. Both cleavage, AAT indicatingand elafin were that onecompletely or several degradedS. maltophilia after 1serine hour. proteasesThe serine were protease involved inhi inbitor this PMSF process. prevented The ability cleavage, of S. maltophilia indicatingproteases that one to or cleave several these S.

9

PathogensPathogens 20192019, 8, 8FOR, 92 PEER REVIEW 10 of10 20 maltophilia serine proteases were involved in this process. The ability of S. maltophilia proteases to cleaveproteins these may proteins render may them render incapable them ofincapable inhibiting of inhibiting neutrophil neutrophil elastase, the elastase, most abundantthe most abundant elastolytic elastolyticenzyme in enzyme the CF in lung. the CF lung.

Figure 8. Effect of K279a culture supernatant on the integrity of the innate immune proteins: AAT, SLPI Figure 8. Effect of K279a culture supernatant on the integrity of the innate immune proteins: AAT, and Elafin. (A) AAT (0.83 µM), SLPI (0.83 µM) and elafin (0.42 µM) were incubated with K279a culture SLPI and Elafin. (A) AAT (0.83μM), SLPI (0.83μM) and elafin (0.42 μM) were incubated with K279a supernatant (CS) (5 103 RFU/min) in the presence and absence of the protease inhibitor PMSF (1 mM) culture supernatant (CS)× (5 × 103 RFU/min) in the presence and absence of the protease inhibitor PMSF at 37 C for various time points indicated above. Incubation products were analysed by Western under (1 mM)◦ at 37 °C for various time points indicated above. Incubation products were analysed by reducing conditions. Cleavage products of (A) AAT, (B) SLPI and (C) elafin are indicated by the arrows. Western under reducing conditions. Cleavage products of (A) AAT, (B) SLPI and (C) elafin are Results are representative of three independent experiments. indicated by the arrows. Results are representative of three independent experiments. 2.7. The Anti-NE Capacity of AAT, But Not SLPI or Elafin, Is Lost Due to K279a Proteases 2.7. The Anti-NE Capacity of AAT, But not SLPI or Elafin, is Lost Due to K279a Proteases Given that K279a proteases were capable of degrading AAT, SLPI and elafin, we investigated theGiven consequences that K279a on proteases their ability were to inhibitcapable neutrophilof degrading elastase AAT, (NE)SLPI usingand elafin, a specific we investigated fluorescence theresonance consequencesenergy transferon their (FRET; ability Abz-Ala-Pro-Glu-Glu-IL-Met-Arg-Arg-GLn-EDDnp) to inhibit neutrophil elastase (NE) using a specific substrate. fluorescence Figure9 resonancedemonstrates energyinhibition transfer of NE(FRET; activity Abz-Ala-Pro- by intact AAT,Glu-Glu-IL-Met-Arg-Arg-GLn-EDDnp) SLPI and elafin. AAT inhibits NE insubstrate. a 1:1 ratio Figurebut a tenfold9 demonstrates molar excess inhibition of SLPI of andNE activity elafin was by intact required AAT, to achieveSLPI and significant elafin. AAT levels inhibits of inhibition. NE in a 1:1 ratio but a tenfold molar excess of SLPI and elafin was required to achieve significant levels of inhibition.

10

Pathogens 2019, 8 FOR PEER REVIEW 11 Pathogens 2019, 8, 92 11 of 20

Figure 9. Inhibitory capacity of AAT, SLPI and elafin on neutrophil elastase activity. NE (5 nM) was used Figurea positive 9. Inhibitory control or capacity incubated of withAAT, an SLPI equimolar and elaf amountin on neutrophil of intact AAT elastase or increasing activity. concentrations (A) NE (5 nM) of wasSLPI used (12.5, a 25positive and 50 control nM) and or elafinincubated (12.5, with 25 and an 50 equimolar nM). NE activityamount wasof intact measured AATusing or increasing a specific concentrationsFRET substrate of (Abz-Ala-Pro-Glu-Glu-IL-Met-Arg-Arg-Gln-EDDnp)SLPI (12.5, 25 and 50 nM) and elafin (12.5, 25 and 50 nM). in NE activity reaction was buff measureder ((0.5 M usingNaCl, a 0.1%specific (v/v) FRET Brij-35 substrate and 0.1 M(Abz-Ala-Pro-Glu HEPES, pH 7.5).-Glu-IL-Met-Arg-Arg-Gln-E Fluorescence intensity was measuredDDnp) in atNE an reaction emission bufferwavelength ((0.5 M of 420NaCl, nm 0.1% after 120(v/v) s. Brij-35 All results and are 0.1 representative M HEPES, pH of three7.5). independentFluorescence experiments. intensity was All measuredmeasurements at an areemission means wavelengthSEM from of biological 420 nm replicates.after 120 seconds. One-way All ANOVA results followed are representative by Tukey post of ± threehoc test.independent *** p 0.001, experiments. **** p 0.0001, All measurements AAT, SLPI and are elafin means versus ± SEM NE from control. biological replicates. One- way ANOVA followed≤ by Tukey≤ post hoc test. ***p ≤ 0.001, ****p ≤ 0.0001, AAT, SLPI and elafin versus NENext, control. AAT (5 nM), SLPI (50 nM) and elafin (50 nM) were left untreated or treated with K279a culture supernatant in the presence or absence of chymostatin. Chymostatin was used to inhibit K279a proteaseNext, activity AAT (5 rather nM), thanSLPI PMSF(50 nM) in orderand elafin to prevent (50 nM) any were inhibitory left untreated effect of or an treated exogenous with protease K279a cultureinhibitor supernatant on NE activity, in the other presence than theor absence three anti-proteases of chymostatin. under Chymostatin investigation. was Figure used 10toA inhibit shows K279athat AAT protease lost its activity anti-NE rather capacity than following PMSF in treatment order to prevent with K279a any culture inhibitory supernatant. effect of an This exogenous effect was proteaseabrogated inhibitor in the presenceon NE activity, of chymostatin other than indicating the three anti-proteases that a secreted under protease(s) investigation. was responsible Figure 10A for showsthis eff thatect. AAT Chymostatin lost its anti-NE had no inhibitorycapacity following effect on NE,treatment confirming with K279a its weak culture anti-NE supernatant. activity and This did effectnot interfere was abrogated with the NEin the inhibitory presence eff ectof ofchymos AAT. Conversely,tatin indicating SLPI that and elafina secreted retained protease(s) their ability was to responsibleinhibit NE (Figurefor this 10effect.B,C) Chymostatin following treatment had no withinhibitory K279a effect culture on supernatant.NE, confirming its weak anti-NE activity and did not interfere with the NE inhibitory effect of AAT. Conversely, SLPI and elafin retained their ability to inhibit NE (Figure 10B and C) following treatment with K279a culture supernatant.

11

PathogensPathogens2019 2019, 8, ,8 92FOR PEER REVIEW 12 of 2012

Figure 10. Effect of K279a proteases on the anti-NE capacity of AAT, SLPI and elafin. (A) Proteases on theFigure anti-NE 10. Effect capacity of K279a of AAT. proteases (B)Effect on of the K279a anti-NE proteases capacity on of the AAT, anti-NE SLPI capacity and elafin. of SLPI. NE (5 (C nM))Eff wasect ofused K279a as a proteases positive control on the anti-NEor incubated capacity with of an elafin. equimolar NE (5 amount nM) was of intact used asAAT a positive or a 10 controlfold molar or incubatedexcess of withSLPI an(50 equimolar nM) or elafin amount (50 ofnM) intact as a AAT positive or a 10treatment fold molar control. excess AAT, of SLPI SLPI (50 or nM) elafin or elafin were (50either nM) untreated as a positive or treated treatment with control.K279a culture AAT, supern SLPI oratant elafin in the were presence either untreatedor absence or of treatedchymostatin. with K279aNE (5 culturenM) and supernatant chymostatin in (50 the μ presenceM) represented or absence the chymostatin of chymostatin. control. NE NE (5 nM)activity and was chymostatin measured (50usingµM) a representedspecific FRET the substrate chymostatin (Abz-Ala-Pro-Glu control. NE activity-Glu-IL-Met-Arg-Arg-Gln-E was measured using a specificDDnp) FRET in NE substrate reaction (Abz-Ala-Pro-Glu-Glu-IL-Met-Arg-Arg-Gln-EDDnp)buffer ((0.5 M NaCl, 0.1% (v/v) Brij-35 and 0.1 M inHEPES, NE reaction pH 7.5). buff erFluorescence ((0.5 M NaCl, intensity 0.1% (v was/v) Brij-35measured and 0.1at an M HEPES,emission pH wavelength 7.5). Fluorescence of 420 nm intensity after 120 was seconds. measured All at results an emission are representative wavelength ofof 420three nm independent after 120 s. All experiments. results are representativeAll measurements of three are independentmeans ± SEM experiments. from biological All replicates. measurements One- areway means ANOVASEM followed from by biological Tukey post replicates. hoc test. One-way ****p ≤ 0.0001, ANOVA treatment followed versus by NE Tukey positive post control. hoc test. ± **** p 0.0001, treatment versus NE positive control. 3. Discussion≤ 3. Discussion Here we characterise the major extracellular proteases of S. maltophilia K279a. Previous studies haveHere examined we characterise virulence determinants the major extracellular of S. maltophilia proteases and although of S. maltophilia those didK279a. not directly Previous determine studies havewhich examined proteases virulence were responsible determinants for proteolytic of S. maltophilia activity,and althoughthe data strongly those did indicated not directly that determine StmPr1 is whichthe major proteases virulence were factor responsible of S. maltophilia for proteolytic [6–9]. activity,Thus, while the dataStmPR1 strongly is the indicated major reported that StmPr1 contributor is the majorto extracellular virulence factorprotease of S.activity, maltophilia here[ 6screenin–9]. Thus,g and while analysis StmPR1 of isthe the K279a major genome reported identified contributor the topreviously extracellular described protease minor activity, StmPR2 here protease screening but and also analysis a relatively of the uncharacterised K279a genome StmPR3 identified protease the previouslyand a higher described molecular minor weight StmPR2 extracellular protease butserine also protease a relatively (ExSP uncharacterised or Smlt4145) StmPR3[8]. Using protease gelatin andzymography, a higher molecular we identified weight four extracellular major bands serine and proteasefive minor (ExSP bands or Smlt4145)of gelatinolytic [8]. Using activity. gelatin The zymography,activities of all we major identified and three four of majorthe minor bands bands and were five minorinhibited bands in the of presence gelatinolytic of PMSF activity. indicating The activitiesthey belong of all to majorthe serine and threeprotease of the family minor of bandsendopeptidases. were inhibited Whether in the the presence four major of PMSF bands indicating represent theyfour belongdifferent to theproteases serine proteaseis difficult family to ascertain of endopeptidases. directly from Whether zymography. the four majorIt is possible bands represent that one fourenzyme different may proteases be responsible is diffi cultfor the to ascertain presence directly of more from than zymography. one band, being It is possible present that in the one form enzyme of a pro-enzyme (zymogen), being able to form dimers or undergoing degradation to truncated versions 12

Pathogens 2019, 8, 92 13 of 20 may be responsible for the presence of more than one band, being present in the form of a pro-enzyme (zymogen), being able to form dimers or undergoing degradation to truncated versions that are still active. While we can make inferences about the molecular weight (MW) of unknown proteases from zymography it must be borne in mind that accurate molecular weight determination can be hampered, given that some proteases exhibit slower migration through a gel that contains a substrate protein, meaning that an apparent protease may appear to have a greater MW than if run through a gel in the absence of substrate protein. In this work we undertook LC-MS/MS analysis of in-gel trypsin digests of bands excised from SDS-PAGE gels of K279a culture supernatant concentrate which approximated the major region of protease activity observed by zymography. Using this approach, we identified StmPR1, StmPR2, StmPR3, chitinase A and the outer membrane esterase. Spectral counting indicated that StmPR1 may not be the only major extracellular protease, but that StmPR3 may also be an important pathogenic protease in S. maltophilia infection. Concomitant with spectral counting from in-gel digests of identified proteases, StmPR3 was intermediate in LFQ intensity between StmPR1 and StmPR2, indicating that it may play an intermediary role between the major and minor extracellular proteases. We further examined the importance of StmPR1 as the major extracellular protease by creating a K279a mutant lacking stmPr1. The observed loss of protease activity in culture supernatants of StmPR1 mutants was estimated as 70% of the wild-type control, which highlighted the relative importance of other secreted proteases using a K279a model of S. maltophilia virulence. Studies to examine loss of the virulence by this mutant, or indeed double or triple StmPR mutants could prove interesting, but were beyond the scope of the current study. Neutrophil elastase is by far the most abundant (approximately 90%) serine protease in the lungs of persons with cystic fibrosis. High levels of proteinase-3 (PR3) [39] and cathepsins G [40], B, L and S [29] are also present in CF bronchoalveolar lavage fluid, as well as macrophage- and neutrophil-derived metalloelastases (MMP-8, MMP-9) [41] and elastolytic proteases expressed by P. aeruginosa [15]. Even though bacterial protease concentrations are small, their ability to cleave key anti-proteases that also exhibit anti-inflammatory, anti-microbial and immunomodulatory functions, underscores their potential role in the pathogenesis of the acquired mucosal immunodeficiency state that typifies CF lung disease. In the presence of Pseudomonas co-infection, although Pseudomonas proteases may be more abundant, rather than out-competing the effects of S. maltophilia proteases, the proteases from both species may collectively contribute to pathological effects. Furthermore, it is important to keep in mind that we characterised the expression pattern of S. maltophilia proteases at the peak of the growth phase in order to be able to study their biochemistry, whereas at suboptimal growth conditions such as may exist in the CF lung, some of these individual proteases might be more readily produced than others. AAT is degraded by S. maltophilia, an effect which is reversed in the presence of the serine protease inhibitor PMSF. We have demonstrated that StmPR1 is the most abundant protease secreted by S. maltophilia K279a, indicating a potentially novel extracellular serine protease may be responsible for this effect. However, the other secreted serine proteases including StmPR3 and to a lesser degree StmPR2 may also be responsible. The cleavage and inactivation of AAT has important pathogenic consequence for cystic fibrosis. We have shown that AAT loses its anti-NE capacity following degradation by extracellular K279a proteases, an effect which is reversed by chymostatin. Depletion of AAT and an overabundance of NE can cause significant damage to the CF bronchial epithelium and act as a pro-inflammatory stimulus via activation of TLR4 through an EGFR pathway, amongst other effects [42]. SLPI was also cleaved in the presence of K279a proteases but that it was not completely degraded after six hours. While SLPI retained its ability to inhibit NE, SLPI levels are significantly decreased in the lungs of patients with cystic fibrosis secondary to degradation by NE and bacterial protease [1,35]. However, the ability of SLPI to retain its anti-NE capacity may have novel beneficial effects in the treatment of S. maltophilia lung disease if it can be shown that it can inhibit protease activity at higher concentrations (>0.83 µM) than the concentrations used in this study. Pathogens 2019, 8, 92 14 of 20

The role of the S. maltophilia extracellular serine proteases in the degradation of elafin was underlined in this study by the capacity of PMSF, a specific inhibitor of K279a serine protease(s) to prevent proteolytic degradation by K279a culture supernatant. Both P. aeruginosa PAO1-conditioned medium and two purified Pseudomonas metalloproteases, elastase and alkaline protease, have been shown to cleave recombinant elafin, but while elastase was shown to inactivate the anti-NE activity of elafin by cleaving its protease-binding loop, the antibacterial properties of elafin against PAO1 were found to be unaffected after elastase treatment [1]. In contrast to elastase, alkaline protease failed to inactivate the inhibitory properties of elafin against NE but cleaved elafin at the amino-terminal Lys6-Gly7 peptide bond, resulting in a decreased ability to covalently bind purified fibronectin following transglutaminase activity. Here, elafin retained its ability to inhibit NE following cleavage by S. maltophilia extracellular serine proteases, indicating that it can still function as a serine antiprotease in the S. maltophilia colonised lung. This is quite different from Pseudomonas proteases such as pseudolysin and aeruginolysin, which have diverse effects on the anti-NE and fibronectin binding qualities of elafin.

4. Conclusions The major secreted protease from K279a is a serine protease and its expression are culture condition dependent. Three serine proteases StmPR1, StmPR2 and StmPR3 were identified as the major, minor and intermediate proteases secreted by K279a in a DMEM in vitro model of S. maltophilia virulence, respectively. AAT is cleaved and inactivated by S. maltophilia proteases. SLPI and elafin are also cleaved by S. maltophilia but they retain their ability to inhibit neutrophil elastase.

5. Materials and Methods

5.1. Bacterial Growth and Reparation of K279a Culture Supernatant Fresh LBB was inoculated with 10 µL of S. maltophilia K279a (BIOMERIT Research Centre, Cork, Ireland) from an overnight culture that was grown overnight at 37 ◦C. To optimise the growth, medium required to induce protease production, 10 µL of overnight culture was incubated in 5 mL of LB broth (LBB), trypticase soy broth (TSB), M9 minimal medium or Dulbecco’s modified essential medium (DMEM, Invitrogen) low glucose (5.6 mM) or high glucose (25 mM) +/ 10% foetal calf serum − (Invitrogen). To obtain K279a culture supernatant (CS) from cultures, they were centrifuged for five minutes at 1000 g and the supernatant was decanted and filtered through a 0.22-µm-pore-size (Millex) × filter to remove residual bacterial cells.

5.2. Protease Activity Studies Overnight cultures (100 µL) were transferred to agar wells created by means of a cork-borer (0.8 cm) in LB agar 2% (w/v) skimmed milk agar plates and incubated for 48 h at 37 ◦C. Plates were photographed after 24 and 48 h of incubation at 37 ◦C. Protease activity was indicated by a zone of clearing around the well. Protease activity in liquid culture supernatants was measured using the SensoLyte Red Protease Fluorometric Assay Kit (AnaSpec). In brief, 50 µL of a 1:200 dilution of protease substrate solution was mixed with 50 µL of test bacterial culture supernatant and the reaction incubated in the dark at 37 ◦C for 90 min. Culture medium or DPBS served as negative controls while 12.5 mU/µL of trypsin diluent (in H2O) was used as a positive control. Relative fluorescence intensity (RFU) was measured at Excitation/Emission (Ex/Em) = 544 nm/590 nm (Victor™ X3 Multilabel Plate Reader, PerkinElmer, Massachusetts, USA) and background fluorescence was removed by subtracting the readings from the substrate control (culture medium or H2O).

5.3. PCR Bacterial DNA was isolated using the FastDNA Spin Kit (MP Bio) according to the manufacturer’s instructions. The extracted DNA was quantified on a NanoDrop 8000 (Thermo Scientific) and amplified Pathogens 2019, 8, 92 15 of 20 by PCR using SYBR Green Master Mix (Roche, 04707516001) on a Light Cycler 480 (Roche). Primers used are listed in Table3. PCR product samples were appropriately diluted in 6 DNA loading dye buffer × (New England Biolabs) and loaded into separate wells of a 1.5% agarose gel in TAE buffer containing 1 SYBR Safe gel stain (Invitrogen). A 100 bp DNA ladder (New England Biolabs) was used as a × marker for PCR product size. DNA was visualised under UV on a transilluminator and photographed using the Syngene G: BOX Chemi XL gel documentation system (Syngene, Cambridge, UK).

Table 3. Primers used in this study.

Length GC Tm Product Primer Description Sequence (5’–3’) (bp) (%) (◦C) (bp) 16s rRNA-F CAGCTCGTGTCGTGAGATGT 20 55 54 16s ribosomal RNA 193 16s rRNA-R AGCCCTCTGTCCCTACCATT 20 55 54 FtsH-F ATP dependent GTGGCAACGAGAAGGAAGTC 20 55 54 179 FtsH-Rmetalloproteinase CTTGTAGACCGGGTCATGCT 20 55 54 StmPR1-F CAACGACTCGATGAATGTGG 20 50 52 StmPR1 protease 174 StmPR1-R CAGACATAGCCGTTCGGATT 20 50 52 StmPR2-F CAGGTCGAGAGCATCATCAA 20 50 52 StmPR2 protease 168 StmPR2-R GGTCACCGGTACGTTGTTCT 20 55 54 StmPR3-F AGCGAAAACACGATTCGTTC 20 45 50 StmPR3 protease 189 StmPR3-R ACGGTGATGACGTTGAACAG 20 50 52 ZnMMP-F Zinc CGGTCGGTGTAGAAGTTGGT 20 55 54 175 ZnMMP-Rmetalloproteinase ACTACGCCGCTTACATGGAC 20 55 54 Esterase-F TTAGAAGGTGCCGCTGAAGT 20 50 52 Esterase 152 Esterase-R GCCTGAAGTTCGACAAGGAC 20 55 54 ExSP-For Extracellular serine TGGTGAAACCGACTACGTGA 20 50 52 181 ExSP-Revprotease GTACGTGGGATTCTGGCTGT 20 55 54 Str1-For GTCGAGCTCGTGATCAAGAAGCAGAAC 27 52 62 StmPR1 gene cloning Str1-Rev CAGTCTAGATTACTGCGTGGCGAGAATG 28 52 58 Str1Inv-5’ StmPR1 gene deletion CTAGGATCCGTACGGATCGTTGGGCAC 27 59 57 Str1Inv-3’(inverse PCR) ATAGGATCCGCGCCACATGTGGCTGCC 27 63 63 PErm5 GACGGATCCGAAACGTAAAAGAAGTTATG 29 41 59 0 Erythromycin cassette PErm30 GTCGGATCCTACAAATTCCCCGTAGGC 27 56 64

5.4. Gelatin Zymography A 12.5% SDS-polyacrylamide gel was prepared with the addition of gelatin (2 mg/mL) as the substrate. For estimation of protein size, 3 µL of pre-stained SeeBlue protein marker (Invitrogen) was loaded on each gel with a range spanning 4–250 kDa. After complete electrophoresis, the gel was placed in renaturing buffer [Triton X-100 2.5% v/v in developing buffer (50 mM Tris pH 7.6, 200 mM NaCl, 5 mM CaCl2 and 1 µM ZnCL2)] for 30 min at room temperature, followed by developing buffer overnight at 37 ◦C. The gel was stained with Coomassie Blue R250 (0.2% w/v) dissolved in 10% (v/v) acetic acid and 45% (v/v) methanol and then destained with 10% (v/v) acetic acid and 25% (v/v) methanol.

5.5. Polyacrylamide Gel Electrophoresis and Western Immunoblotting Culture supernatant and recombinant proteins (AAT (Athens Research), SLPI (R&D Systems), elafin (Proteo Biotech)) were quantified by bicinchoninic acid assay and electrophoresed on 12.5% SDS-polyacrylamide gels. For band size determination the protein marker SeeBlue®(Thermo Fisher Scientific: Waltham, MA, USA) Pre-stained Protein Standard (Invitrogen, LC5625) (Thermo Fisher Scientific: Waltham, MA, USA) or Mark12TM Unstained Standard (Invitrogen, Bio Sciences Ltd, Ireland) was used. For Coomassie blue silver staining, gels were fixed in ethanol (50% v/v) and phosphoric acid (2%) for one hour and washed 3 in dH2O prior to staining with Coomassie blue silver overnight. For × western blotting, following SDS-PAGE, proteins were transferred to PVDF and signals were detected using goat anti-AAT (Abcam) (https://www.biocompare.com/), goat anti-SLPI (R&D Systems) or mouse anti-elafin (Abcam) with appropriate secondary antibodies and Immobilon Western chemiluminescent Pathogens 2019, 8, 92 16 of 20

HRP substrate (Millipore) using the Syngene G:Box Chemi XL gel documentation system (Syngene International Limited, New Delhi, India).

5.6. In-gel Digestion Excised bands were destained with 100 mM ammonium bicarbonate/acetonitrile (1:1, vol/vol) for 30 min. Acetonitrile (500 µL) was added then removed, the gel pieces were dried and subjected to trypsin digestion overnight. Trypsin 20 µg/mL was prepared from proteomics grade Trypsin Singles (Sigma, T7575) (Sigma-Aldrich Chemicals company, St. Louis, MI, USA). Peptides were extracted into 100 µL 1:2 (vol/vol) 5% Formic acid/acetonitrile, vacuum dried and resuspended in 20 µL of sample preparation solution (0.5% trifluoracetic acid) for ZipTip Sample Preparation after which sample tubes were vacuum centrifuged and solvent was evaporated. Samples were resuspended in 20 µL of washing solution and frozen at 20 C prior to injection on LC/MS/MS. − ◦ 5.7. LC-MS/MS Analysis The samples were run on a Thermo Scientific Q Exactive mass spectrometer connected to a Dionex Ultimate 3000 (RSLCnano) chromatography system. Tryptic peptides were resuspended in 0.1% formic acid. Each sample was loaded onto a fused silica emitter (75 µm ID, pulled using a laser puller (Sutter Instruments P2000)), packed with Reprocil Pur C18 (1.9 µm) reverse phase media and was separated by an increasing acetonitrile gradient over 47 min at a flow rate of 250 nL/min. The mass spectrometer was operated in positive ion mode with a capillary temperature of 320 ◦C, and with a potential of 2300V applied to the frit. All data was acquired with the mass spectrometer operating in automatic data dependent switching mode. A high resolution (70,000) MS scan (300–1600 m/z) was performed using the Q ExactiveTM (Thermo Fisher Scientific: Waltham, MA, USA) to select the 12 most intense ions prior to MS/MS analysis using HCD (high-energy-C-trap dissociation).

5.8. Protein Identification and Peptidomic Data Analysis Raw data from the Orbitrap Q-Exactive was processed using MaxQuant version 1.5.0.30 [43,44] incorporating the Andromeda search engine [45]. To identify peptides and proteins, MS/MS spectra were matched to the Uniprot database of S. maltophilia (release 2014_01 containing 49,886 entries). All searches were performed in specific trypsin digestion mode. The database searches were performed with cysteine carbamidomethylation as fixed modification and acetylation (protein N terminus) and oxidation (M) as variable modifications. Mass spectra were searched using the default setting of MaxQuant namely a false discovery rate of 1% on the peptide and protein level. For the generation of label free quantitative (LFQ) ion intensities for protein profiles, signals of corresponding peptides in different nano-HPLC MS/MS runs were matched by MaxQuant in a maximum time window of 0.7 min [46]. The Perseus statistical software (version 1.5.3.2) (https://maxquant.net/perseus/)[47] was used to analyse the protein LFQ intensities.

5.9. Construction of K279a StmPR1 Knock-Out Site directed inactivation of the gene (smlt0686) in K279a was done by sacB counter selection with the suicide vector pEX18Tc [48]. To generate a plasmid construct containing StmPR1, the ORF of the smlt0686 (StmPR1) was amplified using K279a genomic DNA as a template using the primer pair Str1-For and Str1-Rev (Table1). The amplified fragment was double digested with SacI and XbaI and cloned into their respective restriction sites in pEX18Tc, creating pEX18Tc-Str1. This was verified by sequencing. This vector was heat-shock transformed into competent NEB 5-α E. coli cells and was plated onto LB plates supplemented with 10 µg/mL tetracycline (Tc). Using the purified pEX18Tc-Str1 plasmid as a template, a vector containing an 846 bp deletion in StmPR1 (pEX18Tc-∆Str1) was constructed by inverse PCR using the primers Str1Inv-5’ and Str1Inv-3’ (Table1). This also introduced a unique BamH1 site. Next, an erythromycin (Erm) cassette was amplified from the pGEM-Erm plasmid [49] Pathogens 2019, 8, 92 17 of 20

with primers PErm50 and PErm30 (Table1). Subsequently, the BamH1 digested PCR product was ligated into the BamH1 site of pEX18Tc-∆Str1 to yield pEX18Tc-∆Str1:: Erm which carries smlt0686 interrupted by with Erm resistance gene. Plasmid pEX18Tc-∆Str1::Erm was verified by sequencing. Electrocompetent K279a cells were transformed with pEX18Tc-∆Str1::Erm. Mero-diploid colonies were obtained by selection on LB agar containing Tc (17 µg/mL) and Erm (64 µg/mL). Finally, potential double-cross over mutants with an Ermr-Sucr phenotype were selected on LB agar + 5% w/v Sucrose (without NaCl) and Erm 500 µg/mL. Mutants were verified by PCR.

5.10. Neutrophil Elastase Inhibition Studies NE inhibition studies were performed using 5 nM of NE (reconstituted in 0.05 M sodium acetate, 0.1 M NaCl, pH 5.0) with an equimolar amount of untreated (control) AAT or a 10-fold molar excess of SLPI (50 nM) or elafin (50 nM). To study the effect of K279a culture supernatant on AAT, SLPI and elafin, each protein was incubated in DPBS for 1 h at 37 ◦C and were either treated with K279a culture supernatant (400 RFU/µg) or treated with K279a culture supernatant which had been inhibited by chymostatin (50 µM) for 15 min. Activity of NE was measured using a specific fluorescence resonance energy transfer (FRET; Abz-Ala-Pro-Glu-Glu-IL-Met-Arg-Arg-Gln-EDDnp) substrate [50] in NE reaction buffer (0.5 M NaCl, 0.1% (v/v) Brij-35 and 0.1 M HEPES, pH 7.5). Fluorescence intensity was measured in a 96 well black polystyrene flat bottomed microplate at an emission wavelength of 420 nm on Victor™ X3 Multilabel Plate Reader (PerkinElmer, MA, USA) for 120 s. Reactions involving the FRET substrate were carried out in the dark. Background fluorescence was removed by subtracting the readings from the substrate control.

5.11. Statistical Analysis All statistical analyses were performed using GraphPad Prism 5.0 software package (San Diego, CA). All experiments were performed in triplicate and results are expressed as the mean SEM ± and were compared by One-way-ANOVA followed by Tukey post hoc test for multiple comparisons. Differences were considered significant at p 0.05. ≤ Author Contributions: Conceptualization—K.M., S.G.S., C.M.G., N.G.M.; Methodology & Investigation—K.M., E.T.D.; Resources, G.C., N.G.M.; Writing, Reviewing & Editing: All authors. Funding: This research was funded by the Health Research Board, grant number HPF/2012/37. Acknowledgments: Isidre Gibert and Herbert Schweizer are thanked for the gifts of pGem-Erm and pExt18Tc, respectively. Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

1. Guyot, N.; Bergsson, G.; Butler, M.W.; Greene, C.M.; Weldon, S.; Kessler, E.; Levine, R.L.; O’Neill, S.J.; Taggart, C.C.; McElvaney, N.G. Functional study of elafin cleaved by Pseudomonas aeruginosa metalloproteinases. Boil. Chem. 2010, 391, 705–716. [CrossRef][PubMed] 2. Kida, Y. Roles of Pseudomonas aeruginosa-derived proteases as a virulence factor. Nihon Saikingaku Zasshi 2013, 68, 313–323. [CrossRef][PubMed] 3. Wettlaufer, J.; Klingel, M.; Yau, Y.; Stanojevic, S.; Tullis, E.; Ratjen, F.; Waters, V. Longitudinal study of Stenotrophomonas maltophilia antibody levels and outcomes in cystic fibrosis patients. J. Cyst. Fibros. 2017, 16, 58–63. [CrossRef][PubMed] 4. Waters, V.; Yau, Y.; Prasad, S.; Lu, A.; Atenafu, E.; Crandall, I.; Tom, S.; Tullis, E.; Ratjen, F. Stenotrophomonas maltophilia in cystic fibrosis: Serologic response and effect on lung disease. Am. J. Respir. Crit. Care Med. 2011, 183, 635–640. [CrossRef] 5. Waters, V.; Atenafu, E.G.; Lu, A.; Yau, Y.; Tullis, E.; Ratjen, F. Chronic Stenotrophomonas maltophilia infection and mortality or lung transplantation in cystic fibrosis patients. J. Cyst. Fibros. 2013, 12, 482–486. [CrossRef] Pathogens 2019, 8, 92 18 of 20

6. Windhorst, S. The Major Extracellular Protease of the Nosocomial Pathogen Stenotrophomonas maltophilia CHARACTERIZATION OF THE PROTEIN AND MOLECULAR CLONING OF THE GENE. J. Boil. Chem. 2002, 277, 11042–11049. [CrossRef] 7. Dumont, A.L.; Karaba, S.M.; Cianciotto, N.P. Type II Secretion-Dependent Degradative and Cytotoxic Activities Mediated by Stenotrophomonas maltophilia Serine Proteases StmPr1 and StmPr2. Infect. Immun. 2015, 83, 3825–3837. [CrossRef] 8. Dumont, A.L.; Cianciotto, N.P. Stenotrophomonas maltophilia Serine Protease StmPr1 Induces Matrilysis, Anoikis, and Protease-Activated Receptor 2 Activation in Human Lung Epithelial Cells. Infect. Immun. 2017, 85, e00544-17. [CrossRef][PubMed] 9. Nicoletti, M.; Iacobino, A.; Prosseda, G.; Fiscarelli, E.V.; Zarrilli, R.; De Carolis, E.; Petrucca, A.; Nencioni, L.; Colonna, B.; Casalino, M. Stenotrophomonas maltophilia strains from cystic fibrosis patients: Genomic variability and molecular characterization of some virulence determinants. Int. J. Med Microbiol. 2011, 301, 34–43. [CrossRef] 10. Crossman, L.C.; Gould, V.C.; Dow, J.M.; Vernikos, G.S.; Okazaki, A.; Sebaihia, M.; Saunders, D.; Arrowsmith, C.; Carver, T.; Peters, N.; et al. The complete genome, comparative and functional analysis of Stenotrophomonas maltophilia reveals an organism heavily shielded by drug resistance determinants. Genome Boil. 2008, 9, R74. [CrossRef] 11. Ribitsch, D.; Heumann, S.; Karl, W.; Gerlach, J.; Leber, R.; Birner-Gruenberger, R.; Gruber, K.; Eiteljoerg, I.; Remler, P.; Siegert, P.; et al. Extracellular serine proteases from Stenotrophomonas maltophilia: Screening, isolation and heterologous expression in E. coli. J. Biotechnol. 2012, 157, 140–147. [CrossRef][PubMed] 12. Karaba, S.M.; White, R.C.; Cianciotto, N.P. Stenotrophomonas maltophilia Encodes a Type II Protein Secretion System That Promotes Detrimental Effects on Lung Epithelial Cells. Infect. Immun. 2013, 81, 3210–3219. [CrossRef][PubMed] 13. Mori, M.; Kitagawa, T.; Sasaki, Y.; Yamamoto, K.; Onaka, T.; Yonezawa, A.; Imada, K. Lethal Pulmonary Hemorrhage Caused by Stenotrophomonas maltophilia Pneumonia in a Patient with Acute Myeloid Leukemia. Kansenshogaku Zasshi 2012, 86, 300–305. [CrossRef][PubMed] 14. Kelly, E.; Greene, C.M.; McElvaney, N.G. Targeting neutrophil elastase in cystic fibrosis. Expert Opin. Ther. Targets 2008, 12, 145–157. [CrossRef][PubMed] 15. Greene, C.M.; McElvaney, N.G. Proteases and antiproteases in chronic neutrophilic lung disease-relevance to drug discovery. Br. J. Pharmacol. 2009, 158, 1048–1058. [CrossRef][PubMed] 16. Lantz, M.S. Are bacterial proteases important virulence factors? J. Periodontal Res. 1997, 32, 126–132. [CrossRef] 17. Schmidtchen, A.; Frick, I.-M.; Andersson, E.; Tapper, H.; Björck, L. Proteinases of common pathogenic bacteria degrade and inactivate the antibacterial peptide LL-37. Mol. Microbiol. 2002, 46, 157–168. [CrossRef] 18. Kuang, Z.; Hao, Y.; Walling, B.E.; Jeffries, J.L.; Ohman, D.E.; Lau, G.W. Pseudomonas aeruginosa Elastase Provides an Escape from Phagocytosis by Degrading the Pulmonary Surfactant Protein-A. PLoS ONE 2011, 6, e27091. [CrossRef][PubMed] 19. Jacquot, J.; Tournier, J.M.; Puchelle, E. In vitro evidence that human airway lysozyme is cleaved and inactivated by Pseudomonas aeruginosa elastase and not by human leukocyte elastase. Infect. Immun. 1985, 47, 555–560. 20. Morihara, K.; Tsuzuki, H.; Harada, M.; Iwata, T. Purification of human plasma alpha 1-proteinase inhibitor and its inactivation by Pseudomonas aeruginosa elastase. J. Biochem. 1984, 95, 795–804. [CrossRef] 21. Johnson, D.A.; Carter-Hamm, B.; Dralle, W.M. Inactivation of human bronchial mucosal proteinase inhibitor by Pseudomonas aeruginosa elastase. Am. Rev. Respir. Dis. 1982, 126, 1070–1073. [PubMed] 22. Johnson, D.A.; Barrett, A.J.; Mason, R.W. Cathepsin L inactivates alpha 1-proteinase inhibitor by cleavage in the reactive site region. J. Biol. Chem. 1986, 261, 14748–14751. [PubMed] 23. Thompson, R.C.; Ohlsson, K. Isolation, properties, and complete amino acid sequence of human secretory leukocyte protease inhibitor, a potent inhibitor of leukocyte elastase. Proc. Natl. Acad. Sci. USA 1986, 83, 6692–6696. [CrossRef][PubMed] 24. Hiemstra, P.S.; Maassen, R.J.; Stolk, J.; Heinzel-Wieland, R.; Steffens, G.J.; Dijkman, J.H. Antibacterial activity of antileukoprotease. Infect. Immun. 1996, 64, 4520–4524. [PubMed] Pathogens 2019, 8, 92 19 of 20

25. Wiedow, O.; Harder, J.; Bartels, J.; Streit, V.; Christophers, E. Antileukoprotease in Human Skin: An Antibiotic Peptide Constitutively Produced by Keratinocytes. Biochem. Biophys. Res. Commun. 1998, 248, 904–909. [CrossRef][PubMed] 26. Kazmi, S.H.; Naglik, J.R.; Sweet, S.P.; Evans, R.W.; O’Shea, S.; Banatvala, J.E.; Challacombe, S.J. Comparison of Human Immunodeficiency Virus Type 1-Specific Inhibitory Activities in Saliva and Other Human Mucosal Fluids. Clin. Vaccine Immunol. 2006, 13, 1111–1118. [CrossRef][PubMed] 27. Jin, F.-Y.; Nathan, C.; Radzioch, D.; Ding, A. Secretory Leukocyte Protease Inhibitor: A Macrophage Product Induced by and Antagonistic to Bacterial Lipopolysaccharide. Cell 1997, 88, 417–426. [CrossRef] 28. Lentsch, A.B.; Jordan, J.A.; Czermak, B.J.; Diehl, K.M.; Younkin, E.M.; Sarma, V.; Ward, P.A. Inhibition of NF-kappaB activation and augmentation of IkappaBbeta by secretory leukocyte protease inhibitor during lung inflammation. Am. J. Pathol. 1999, 154, 239–247. [CrossRef] 29. Taggart, C.C.; Lowe, G.J.; Greene, C.M.; Mulgrew, A.T.; O’Neill, S.J.; Levine, R.L.; McElvaney, N.G. Cathepsin B, L, and S Cleave and Inactivate Secretory Leucoprotease Inhibitor. J. Boil. Chem. 2001, 276, 33345–33352. [CrossRef][PubMed] 30. McMichael, J.W.; Roghanian, A.; Jiang, L.; Ramage, R.; Sallenave, J.-M. The Antimicrobial Antiproteinase Elafin Binds to Lipopolysaccharide and Modulates Macrophage Responses. Am. J. Respir. Cell Mol. Boil. 2005, 32, 443–452. [CrossRef] 31. Shaw, L.; Wiedow, O. Therapeutic potential of human elafin. Biochem. Soc. Trans. 2011, 39, 1450–1454. [CrossRef][PubMed] 32. Vachon, E.; Bourbonnais, Y.; Bingle, C.; Rowe, S.J.; Janelle, M.F.; Tremblay, G.M.; Bingle, C. Anti-Inflammatory Effect of Pre-Elafin in Lipopolysaccharide-Induced Acute Lung Inflammation. Boil. Chem. 2002, 383, 1249–1256. [CrossRef][PubMed] 33. Baranger, K.; Zani, M.-L.; Chandenier, J.; Moreau, T.; Dallet-Choisy, S.; Dallet-Choisy, S.; Dallet-Choisy, S. The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function. FEBS J. 2008, 275, 2008–2020. [CrossRef][PubMed] 34. Tang, W.; Lu, Y.; Tian, Q.-Y.; Zhang, Y.; Guo, F.-J.; Liu, G.-Y.; Syed, N.M.; Lai, Y.; Lin, E.A.; Kong, L.; et al. The Growth Factor Progranulin Binds to TNF Receptors and Is Therapeutic Against Inflammatory Arthritis in Mice. Science 2011, 332, 478–484. [CrossRef][PubMed] 35. Guyot, N.; Butler, M.W.; McNally, P.; Weldon, S.; Greene, C.M.; Levine, R.L.; O’Neill, S.J.; Taggart, C.C.; McElvaney, N.G. Elafin, an Elastase-specific Inhibitor, Is Cleaved by Its Cognate Enzyme Neutrophil Elastase in Sputum from Individuals with Cystic Fibrosis. J. Boil. Chem. 2008, 283, 32377–32385. [CrossRef][PubMed] 36. Van Sambeek, L.; Cowley, E.S.; Newman, D.K.; Kato, R. Sputum glucose and glycemic control in cystic fibrosis-related diabetes: A cross-sectional study. PLoS ONE 2015, 10, e0119938-37. [CrossRef][PubMed] 37. Baker, E.H.; Clark, N.; Brennan, A.L.; Fisher, D.A.; Gyi, K.M.; Hodson, M.E.; Philips, B.J.; Baines, D.L.; Wood, D.M. Hyperglycemia and cystic fibrosis alter respiratory fluid glucose concentrations estimated by breath condensate analysis. J. Appl. Physiol. 2007, 102, 1969–1975. [CrossRef] 38. Minkwitz, A.; Berg, G. Comparison of Antifungal Activities and 16S Ribosomal DNA Sequences of Clinical and Environmental Isolates of Stenotrophomonas maltophilia. J. Clin. Microbiol. 2001, 39, 139–145. [CrossRef] 39. Witko-Sarsat, V.; Halbwachs-Mecarelli, L.; Schuster, A.; Nusbaum, P.; Ueki, I.; Canteloup, S.; Lenoir, G.; Descamps-Latscha, B.; Nadel, J.A. Proteinase 3, a Potent Secretagogue in Airways, Is Present in Cystic Fibrosis Sputum. Am. J. Respir. Cell Mol. Boil. 1999, 20, 729–736. [CrossRef] 40. Goldstein, W.; Döring, G. Lysosomal enzymes from polymorphonuclear leukocytes and proteinase inhibitors in patients with cystic fibrosis. Am. Rev. Respir. Dis. 1986, 134, 49–56. 41. Ratjen, F.; Hartog, C.-M.; Paul, K.; Wermelt, J.; Braun, J. Matrix metalloproteases in BAL fluid of patients with cystic fibrosis and their modulation by treatment with dornase alpha. Thorax 2002, 57, 930–934. [CrossRef] [PubMed] 42. Bergin, D.A.; Greene, C.M.; Sterchi, E.E.; Kenna, C.; Geraghty, P.; Belaaouaj, A.; Taggart, C.C.; O’Neill, S.J.; McElvaney, N.G. Activation of the Epidermal Growth Factor Receptor (EGFR) by a Novel Metalloprotease Pathway. J. Boil. Chem. 2008, 283, 31736–31744. [CrossRef][PubMed] 43. Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008, 26, 1367–1372. [CrossRef] [PubMed] Pathogens 2019, 8, 92 20 of 20

44. Tyanova, S.; Temu, T.; Cox, J. The MaxQuant computational platform for mass spectrometry-based shotgun proteomics. Nat. Protoc. 2016, 11, 2301–2319. [CrossRef][PubMed] 45. Cox, J.; Neuhauser, N.; Michalski, A.; Scheltema, R.A.; Olsen, J.; Mann, M. Andromeda: A Peptide Search Engine Integrated into the MaxQuant Environment. J. Proteome Res. 2011, 10, 1794–1805. [CrossRef] 46. Cox, J.; Hein, M.Y.; Luber, C.A.; Paron, I.; Nagaraj, N.; Mann, M. Accurate Proteome-wide Label-free Quantification by Delayed Normalization and Maximal Peptide Ratio Extraction, Termed MaxLFQ. Mol. Cell. Proteom. 2014, 13, 2513–2526. [CrossRef] 47. Tyanova, S.; Temu, T.; Sinitcyn, P.; Carlson, A.; Hein, M.Y.; Geiger, T.; Mann, M.; Cox, J. The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat. Methods 2016, 13, 731–740. [CrossRef] 48. Hoang, T.T.; Karkhoff-Schweizer, R.R.; Kutchma, A.J.; Schweizer, H.P. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: Application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 1998, 212, 77–86. [CrossRef] 49. Martíne, P.; Huedo, P.; Martinez-Servat, S.; Planell, R.; Ferrer-Navarro, M.; Daura, X.; Yero, D.; Gibert, I. Stenotrophomonas maltophilia responds to exogenous AHL signals through the LuxR solo SmoR (Smlt1839). Front. Cell. Infect. Microbiol. 2015, 5, 41. 50. Korkmaz, B.; Attucci, S.; Juliano, M.A.; Kalupov, T.; Jourdan, M.-L.; Juliano, L.; Gauthier, F. Measuring elastase, proteinase 3 and cathepsin G activities at the surface of human neutrophils with fluorescence resonance energy transfer substrates. Nat. Protoc. 2008, 3, 991–1000. [CrossRef]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).