Classification and Phylogeny of the Plant Genus Dianella Lam. Ex Juss

Home , Agrostocrinum, Arnocrinum, Arthropodium, Asphodelaceae, Boryaceae, Caesia

Classification and phylogeny of the plant genus Dianella Lam. ex Juss.

Karen Mary Muscat 2017 A thesis submitted in total fulfilment of the requirements of the degree of Doctor of Philosophy

February 2017 School of BioSciences Faculty of Science The University of Melbourne

The beauty and diversity of Dianella flowers, fruit and habitat. Photos by K.M Muscat, P.Y Ladiges, A.J Perkins and B Gray.

Produced on archival quality paper

ii Abstract

The global distribution of Dianella Lam. ex Juss. (flax lilies, Asphodelaceae, Asparagales) extends from south-eastern Africa, Madagascar and India, to south-east Asia (north to Japan), Australia, Pacific Islands from Micronesia to Tahiti, Pitcairn Islands, New Zealand, New Caledonia, Norfolk Island and Hawaii. It occurs throughout Australia (excluding the central arid region), where there is the greatest diversity of 42 taxa (19 species and 23 varieties) (Australian Plant Census 2016). Of those, three taxa also extend to south-east Asia, and a further 17 species occur outside Australia (Australian Plant Census 2016; Kew World Checklist of Selected Families, compiled by Govaerts et al. 2016). Plants are characterised by two leaf forms: basal strap-like leaves and cauline leaves on aerial stems (+/- extravaginal branching units). The showy flowers have a characteristic struma between the anther and filament, while the fruit is a fleshy berry, typically in shades of purple. The name Dianella is attributed to the Greek goddess Diana, the mythical goddess of the hunt.

A cpDNA phylogeny by Wurdack & Dorr (2009) found Dianella to be monophyletic and sister to the monotypic genus Eccremis from South America. However, there has been no comprehensive phylogenetic analysis of taxa within Dianella, which has the potential to reveal not only taxonomic relationships but biogeographic patterns and the evolutionary history of the group, including the role of polyploidy. Furthermore, species delimitations, including complexes of varieties, have been based only on morphology from field observation and herbarium samples and require further study.

Using three chloroplast markers (trnQUUG–5'rps16, 3'rps16–5'trnK(UUU) and rpl14– rps8–infA–rpl36) and two nuclear markers, (ITS 4, ITS 5, 18SE-ETS and DIAN-ETS) molecular phylogenetic analyses using Bayesian and Maximum Parsimony are presented (Chapters 2, 3, 4 and 5). Accessions include the majority of Australian and extra-Australian Dianella. The related outgroup genera Eccremis, Stypandra, Thelionema and Herpolirion were also included. The cpDNA and nrDNA phylograms were relatively congruent and a combined data set produced the most resolution. The combined results (Chapter 5) differed from those of Wurdack & Dorr (2009) in showing Stypandra with a sister relationship to Herpolirion + Thelionema. Within Dianella, resolved clades largely related to biogeographic regions, such as the

iii Hawaiian Islands and New Caledonia, Norfolk Island related to New Zealand and Australian bioregions, revealing for example an early divergence between eastern and Western Australian lineages, congruent with the pattern for other Australian biota.

Of the four Australian species complexes described by Rodney Henderson in The Flora of Australia, volume 45, the D. caerulea complex was found to be monophyletic except for two varieties that clustered with other far-north Queensland taxa, and two D. caerulea var. caerulea samples that are morphologically distinct when compared to taxa in the complex. Of the other species complexes, D. revoluta, D. pavopennacea and D. longifolia are each polyphyletic. Their relationships indicate biogeographic patterns, such as for D. longifolia accessions, which were resolved in two separate clades, one clade from the Kimberley and Northern Territory, and one clade from eastern and southern Australia. For extra-Australian Dianella, the widespread D. ensifolia was also polyphyletic occurring in multiple clades with distinct taxonomic units able to be recognised. Chromosome counts available from the literature were plotted on the phylogeny for Dianella and indicated that polyploidy has arisen multiple times, particularly in taxa of some of the Australian species complexes and in D. ensifolia sensu lato. These results indicate the need to recognise new species and to resurrect other taxa for Australian and extra-Australian Dianella.

Chapter six is a morphometric, multivariate analysis (using phenetic clustering and ordination methods) of Hawaiian Dianella to determine the number of species on the islands. Field collections were made on Oahu, Maui, Hawaii and Kauai to examine populations in situ, develop species concepts and collect plant material for the dataset. The results indicate that five operational taxonomic units should be recognised including the current taxon D. sandwicensis. Fruit morphology is unique, with distinctive fruit dye colour and fruit surface colour in some taxa. D. lavarum, a narrow endemic that inhabits recent dry lava flows, observed in the Hawaii Volcanoes National Park, is to be resurrected. A review of herbarium specimens confirmed its distributional range extends to Maui, which is in agreement with Otto Degener who originally described the species.

The D. caerulea complex was also analysed further in Chapter 7, based on extensive fieldwork in Queensland, New South Wales, Victoria and Western Australia, using

iv multivariate analysis of a morphological data set. Morphometric clusters were largely in agreement with Henderson's varieties, but it is recommended that some be raised to species level. D. caerulea var. assera and D. caerulea var. producta, which appear to be sister taxa based on the shared character extravaginal branching, were each found to include morphological variation. It is recommended that these taxa be recognised as species with three subgroups recognised in D. caerulea var. assera, and five subgroups in D. caerulea var. producta; however, further field sampling is required for taxonomic revision.

v Declaration and statement of authorship

This is to certify that:

1. This thesis comprises only my original work towards the Ph.D. Due acknowledgements have been made in the text and for the use of photographic images, and to all other material used. 2. This thesis is fewer than 100,000 words in length, exclusive of tables, maps, bibliographies and appendices.

Karen Mary Muscat

vi Acknowledgements

I would firstly like to acknowledge the Dianella taxonomists, past and present who provided the stepping stones for the research in this thesis. My supervisors, Dr Mike Bayly and Prof. Pauline Ladiges for their mentorship, expertise, constructive discussions and the review of chapters. Prof. Gary Nelson for his wealth of knowledge and access to his book collection. The staff in the systematics lab, thank you for your support and assistance: Dr Tanja Schuster, Dr Joannne Birch, Dr Gill Brown, Erin Batty and Kathy Vohs. Fellow lab students, Rachel Fowler, Dr Rose Barrett, David Meagher, Dr Daniel Ohlsen, Dr Steph Conway, Cat Clowes, Alice Crowe, Emma Lewis, Dr Todd McLay and Dr Claire Marks. Steve Effedaris, The University of Melbourne Nursery Manager for his care and management of the living Dianella collection. To my family for your patience and assistance with field work, a big thank you. A special thank you to Monty, my little dog.

To the numerous Australian botanists who attended field trips, provided information about certain localities, and sent living plant material in the mail, your support and interest in Dianella research was fundamental to the results in this project. Thank you to Dr Andrew Perkins, Dr Paul Forster, Dr Ailsa Holland, Val Stajsic, Neville Walsh, Geoff Carr, Peter Heenan, David Fell, David Cameron, Rober Miller, Colin Gibson Bruce Gray, Gary & Nada Sankowsky, Rod Henderson, Dr John Conran, Bill Molyneux, Ian Menkins, John McCabe, Dr Daniel Ohlsen, Fred & Sue Fetherston. Friends who assisted in the field: Dr Melanie Archer, Karen Lester, Wendy Clark, Ruth Jackson, Jenny Porter and David Shoesmith. Thank you to Geoff Carr who initially introduced me to the diversity and taxonomy of Dianella. Robert Miller and Colin Gibson, thank you for sharing your expertise in Dianella and introducing me to populations in the Blue Mountains region. For extra-Australian plant material used in the phylogeny, thank you to Dr Jenny Reid, Dr Liz James, Prof. Goro Kokubugata, Dr Sarder Uddin, Dr Sook Ngoh Phoon, Dr Barry Conn, Dr Shelley James and Oscar Parraga. Thank you to the Park Rangers at Dorrigo National Park, Moreton Island National Park and Townsville region for assistance with field work.

Research on the Hawaiian Islands was supported by numerous colleagues. Thank you to the staff from Bishop Museum and National Tropical Botanical Garden, Kauai for

vii your hospitality and assistance, which was fundamental to the success of this project. Thank you to Dr David Lorence, Tim Flynn and Rae Williams for assistance with loans, my collections and for your hospitality whilst on Kauai. Thank you Natalia Tangalin for attending all of the field trips and your skills in collecting Hawaiian Dianella in some difficult localities, and monitoring Dianella fruit on Kauai. Sierra McDaniel, Botanist from Hawaii Volcanoes National Park for providing Dianella flower images. Joel Lau for his invaluable knowledge about Hawaiian Dianella, access to photographs and providing locality information and attending field trips on Oahu. Kenji Suzuki for attending field trips on Oahu; Forest and Kim Starr, and Anna Palomino for access to plant material on Maui and your expertise. I would also like to thank Dr Warren Wagner for his discussions and expertise about Hawaiian flora and Dr Larry Dorr, Smithsonian Institution (U.S.A).

The translation of botanical documents from French, Latin and German to English. Thank you, Dr Henry Méra (The University of Melbourne), Dr Peter Bostock (Queensland Herbarium) and Michaela Plein (The University of Melbourne).

Thank you to International and Australian herbaria for assistance and access to loans. For Australia: CANB, PERTH, CNS, MEL, MELU, DNA, BRI, NSW and HO. For International herbaria: National Tropical Botanical Garden Kauai (PTBG), Herbarium Pacificum (BISH), National Museum of Nature and Science, Japan (TNS), Bangladesh National Herbarium (DACB), Auckland Museum (AK), Missouri Botanical Garden (MO) and Universidad Central de Venezuela (MYF), IRD Noumea (NOU) and United States National Herbarium (US), Smithsonian Institution, Washington. Thank you to all permit agencies in Australia and Hawaii, US for permission to collect Dianella in the field. This research was funded by a Doctor of Philosophy Research Scholarship, The University of Melbourne; The Australian Biological Resources Study (ABRS), Australian Capacity Building grant, Bush Blitz grant, McBryde grant, (Smithsonian Institution, USA) and Australian Botany Foundation Travel Award, The University of Melbourne.

viii Table of Contents

Abstract ...... iii Declaration ...... vi Acknowledgements ...... vii

Chapter 1: The nomenclatural history of Dianella and higher-level classification ...... 1

1.1 The early classification of petaloid monocots ...... 1 1.2 A time of rapid progress: the rise of molecular plant systematics ...... 3 1.3 Subfamily Hemerocallidoideae and Dianella ...... 5 1.4 Taxonomic history of Dianella ...... 7 1.4.1 Malesia…………………………………………………………...9 1.4.2 Melanesia ...... 9 1.4.3 Polynesia………………………………………………………... 9 1.4.4 Micronesia...... 10 1.4.5 Asia-Indian Ocean ...... 10 1.4.6 Australia ...... 11 1.5 Morphological traits ...... 12 1.5.1 Roots and stems ...... 12 1.5.2 Leaf morphology ...... 13 1.5.3 Inflorescence ...... 17 1.5.4 Flowers ...... 18 1.5.5 Fruit morphology ...... 19 1.5.6 Seed morphology ...... 19 1.6 Cytology in Dianella ...... 19 1.7 Global geographic distribution of Dianella ...... 23 1.8 Diversity and distribution of Dianella in Australia ...... 26 1.8.1 Australian Dianella complexes ...... 26 1.8.2 D. longifolia complex ...... 26 1.8.3 D. revoluta complex...... 27 1.8.4 D. caerulea complex ...... 27 1.8.5 D. pavopennacea complex ...... 27 1.9 The regional biogeography of Australian Dianella ...... 28 1.10 Origin of the genus Dianella ...... 31 1.11 Fossil evidence ...... 32

1.12 Research objectives ...... 33

ix Chapter 2: General methodology ...... 34

2.1 Chapter Aims ...... 34 2.2 Sample Collections ...... 34 2.3 Formal identification of taxa ...... 35 2.4 Selection of cpDNA and nrDNA markers ...... 37 2.5 DNA extraction, amplification and sequencing ...... 37 2.6 Phylogenetic analyses...... 38

Chapter 3: Chloroplast DNA phylogeny ...... 40

3.1 Introduction ...... 40 3.1.1 Chapter aims ...... 41 3.2 Methods ...... 42 3.2.1 Marker selection...... 42 3.2.2 Accessions and analyses ...... 43 3.3 Results ...... 44 3.3.1 Informativeness of cpDNA ...... 44 3.3.2 Composition and distribution of clades ...... 46 3.3.3 Outgroup genera...... 46 3.3.4 Dianella...... 47 3.4 Discussion ...... 56 3.4.1 Overview ...... 56 3.4.2 Biogeographic patterns within Dianella ...... 57 3.4.3 CpDNA phylogeny and species taxonomy ...... 58 3.4.4 CpDNA phylogeny and D. revoluta complex...... 59 3.4.5 CpDNA phylogeny and D. caerulea complex ...... 61 3.4.6 CpDNA phylogeny and D. longifolia complex ...... 63 3.4.7 CpDNA phylogeny and D. pavopennacea complex ...... 65 3.4.8 Australian species not part of taxonomic complexes ...... 65 3.4.9 Phylogenetic relationships of extra-Australian Dianella ...... 66 3.5 Conclusion ...... 68

Chapter 4: Nuclear DNA phylogeny ...... 69

4.1 Introduction ...... 69 4.1.1 Chapter aims ...... 70 4.2 Methods ...... 70 4.2.1 Marker Selection and primer design ...... 70 4.2.2 Accessions and analyses ...... 71

x 4.3 Results ...... 72 4.3.1 Informativeness of nrDNA ...... 72 4.3.2 Composition and distribution of clades ...... 74 4.3.3 Outgroup genera...... 74 4.3.4 Dianella...... 75 4.4 Discussion ...... 81 4.4.1 Overview ...... 81 4.4.2 Outgroup genera...... 81 4.4.3 Biogeographic patterns within Dianella ...... 82 4.4.4 nrDNA phylogeny and species taxonomy ...... 84 4.4.5 nrDNA phylogeny and D. revoluta complex ...... 84 4.4.6 nrDNA phylogeny and D. caerulea complex ...... 86 4.4.7 nrDNA phylogeny and D. longifolia complex ...... 88 4.4.8 nrDNA phylogeny and D. pavopennacea complex ...... 90 4.4.9 Australian species not part of taxonomic complexes ...... 90 4.4.10 Hawaiian Dianella ...... 92 4.5 Conclusions ...... 92

Chapter 5: Combined Phylogeny...... 93

5.1 Introduction ...... 93 5.1.1 Chapter aims ...... 93 5.2 Methods ...... 93 5.3 Results ...... 94 5.3.1 Informativeness of the combined cpDNA and nrDNA dataset . 94 5.3.2 Composition and distribution of clades ...... 95 5.3.3 Outgroup genera...... 97 5.3.4 Dianella...... 98 5.4 Discussion ...... 104 5.4.1 Overview ...... 104 5.4.2 Usefulness of combining data sets ...... 104 5.4.3 Outgroup genera ...... 104 5.4.4 Origin and age of Dianella ...... 109 5.4.5 Fossils and molecular dating ...... 109 5.4.6 Biogeographic hypotheses: vicariance and dispersal ...... 109 5.4.7 Chromosome evolution in Dianella ...... 115 5.4.8 Combined phylogeny and summary of species taxonomy ...... 118 5.4.9 D. revoluta complex...... 119 5.4.10 D. caerulea complex ...... 119 5.4.11 D. longifolia complex ...... 121 5.4.12 D. pavopennacea complex ...... 121

xi 5.4.13 Taxa not part of the taxonomic complexes ...... 122 5.4.14 Phylogenetic and taxonomic relationships of extra-Australian Dianella ...... 123 5.5 Conclusion ...... 125

Chapter 6: A morphometric study of Hawaiian Dianella .. 129

6.1 Introduction ...... 129 6.1.1 Chapter aims ...... 130 6.2 Methods ...... 131 6.2.1 Sampling ...... 131 6.2.2 Character selection ...... 132 6.2.3 Final samples used in the study ...... 132 6.2.4 Scanning Electron Microscopy ...... 136 6.2.5 Phenetic analyses ...... 137 6.3 Results ...... 137 6.3.1 Cluster analysis ...... 137 6.3.2 Ordination analysis ...... 140 6.3.3 Seed morphology ...... 141 6.4 Discussion ...... 148 6.4.1 Overview ...... 148 6.4.2 D. lavarum ...... 149 6.4.3 D. sp. aff. lavarum ...... 151 6.4.4 D. multipedicellata ...... 151 6.4.5 D. sandwicensis and D. sp. aff. sandwicensis ...... 153 6.5 Conclusion ...... 155 6.6 Taxonomic Treatment ...... 156 6.6.1 Dianella sp. aff. lavarum ...... 156 6.6.2 Dianella lavarum ...... 157 6.6.3 Dianella multipedicellata...... 158 6.6.4 Dianella sp. aff. sandwicensis ...... 159 6.6.5 Dianella sandwicensis ...... 160 6.7. Key to the Hawaiian Dianella ...... 162 6.8 Specimens examined from BISH and PTBG ...... 163

Chapter 7: A morphometric study of the D. caerulea complex ...... 165

7.1 Introduction...... 165 7.1.1 Taxonomic history ...... 165

xii 7.1.2 Brief descriptions of Henderson’s taxa in the D. caerulea complex and the related D. congesta ...... 167 7.2 Justification and Chapter aims ...... 172 7.3 Methods...... 173 7.3.1 Sampling...... 173 7.3.2 The living collection ...... 178 7.3.3 Character coding ...... 179 7.3.4 Numerical analyses ...... 179 7.4 Results ...... 184 7.4.1 Cluster analyses of the D. caerulea complex and D. congesta 184 7.4.2 Ordination analysis of D. caerulea complex with D. congesta 187 7.4.3 Cluster analysis and ordination of Group A (var. producta and var. assera) ...... 188 7.4.4 Flower morphology ...... 192 7.5 Discussion ...... 197 7.5.1 Overview ...... 197 7.5.2 Comparison with the molecular phylogeny ...... 198 7.5.3 Investigating the leaf character ‘zone of occlusion’ ...... 199 7.5.4 Inflorescence morphology ...... 200 7.5.5 Rhizome morphology...... 201 7.5.6 Seed morphology ...... 201 7.5.7 Comments on taxa...... 202 7.5.8 D. caerulea var. caerulea ...... 202 7.5.9 D. caerulea var. petasmatodes ...... 203 7.5.10 D. caerulea var. protensa...... 204 7.5.11 D. congesta ...... 204 7.5.12 D. caerulea var. vannata ...... 205 7.5.13 D. caerulea var. cinerascens ...... 206 7.5.14 D. assera complex ...... 206 7.5.15 D. caerulea var. producta ...... 209 7.6 Recommendations ...... 211 List of References ...... 213 Appendix A ...... 235 Appendix B ...... 244 Appendix C ...... 248 Appendix D ...... 249 Appendix E ...... 257 Appendix F ...... 261 Appendix G ...... 263

xiii Appendix H ...... 265 List of Figures

Fig. 1.1. Maximum likelihood consensus tree of four plastid gene regions showing generic relationships in superfamily Xanthorrhoeaceae, from Wurdack & Dorr (2009). (Note Hemerocallidaceae is now treated as subfamily Hemerocallidoideae) ...... 8

Fig. 1.2. Key morphological characters of Dianella. (A) Inflorescence and fruit of D. caerulea var. cinerascens. (B) Extravaginal branching units of D. caerulea var. assera. (C) Tuberous roots of D. fruticans. (D) Typical flower of Dianella with bicoloured tepals, D. caerulea var. assera (Yarriabini NP). (E) A tuft of ciliate hairs at the apex of the tepals of D. caerulea var. assera. (F) Red sheaths and (G) green sheaths of D. tasmanica. (H) Aboveground stem with leaves of D. incollata. (I) In situ D. caerulea variant Theresa Creek...... 22

Fig. 1.3. The global distribution of Dianella; the black regions represent the inhabited continents and islands; A is a close-up view of the Hawaiian Islands...... 23

Fig. 1.4. The Australian distribution of Dianella from the Australia Virtual’s Herbarium (2016), overlaid with a climatic map and distribution data...... 30

Fig. 2.1. A global map illustrating in red the localities of Dianella and outgroup genera used in the molecular phylogeny for Chapters 3, 4 and 5. Figure A is a close-up view of the localities of Dianella samples sourced from the Hawaiian Islands...... 36

Fig. 3.1. The Bayesian majority-rule consensus tree of combined chloroplast data. The high Bayesian posterior probabilities (PP) are shown in blue. All major clades are labelled from A–N, with their detailed structure and support values shown in subsequent figures...... 45

Fig. 3.2. The Bayesian majority-rule consensus tree of combined chloroplast data for outgroups, clades A, B, and C. Bayesian posterior probabilities (PP) are shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey and node 5 leads to Dianella...... 46

Fig. 3.3. The Bayesian majority-rule consensus tree of combined chloroplast data for clades D and E. Bayesian posterior probabilities (PP) are shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey...... 47

Fig. 3.4. The Bayesian majority-rule consensus tree of combined chloroplast data for clade F. Bayesian posterior probabilities (PP) are shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey...... 48

xiv

Fig. 3.5. The Bayesian majority-rule consensus tree of combined chloroplast data for clade G. Bayesian posterior probabilities (PP) are shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey...... 50

Fig. 3.6. The Bayesian majority-rule consensus tree of combined chloroplast data for clade H. Bayesian posterior probabilities (PP) are shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey...... 51

Fig. 3.7. The Bayesian majority-rule consensus tree of combined chloroplast data for clade I. Bayesian posterior probabilities (PP) are shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey...... 52

Fig. 3.8. The Bayesian majority-rule consensus tree of combined chloroplast data for clades J and K. Bayesian posterior probabilities (PP) are shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey...... 53

Fig. 3.9. The Bayesian majority-rule consensus tree of combined chloroplast data for clades L and M. Bayesian posterior probabilities (PP) are shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey...... 54

Fig. 3.10 The Bayesian majority-rule consensus tree of combined chloroplast data for clade N. Bayesian posterior probabilities (PP) are shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey...... 55

Fig. 4.1 The Bayesian majority-rule consensus tree based on analysis of combined nuclear ribosomal data. Branches with high Bayesian posterior probabilities (PP 0.95–1.00) are shown in orange. Main clades are labelled A-N, and their detailed structure and support values shown in subsequent figures...... 73

Fig. 4.2. The Bayesian majority-rule consensus tree of combined nrDNA data showing outgroup clades A, B and C. Bayesian posterior probabilities (PP) shown above branches and bootstrap values (BS) shown below. Node 5 is Dianella. Nodes are numbered in grey ...... 74

Fig. 4.3. The Bayesian majority-rule consensus tree based on combined nrDNA data for clades D, E and F. Bayesian posterior probabilities (PP) shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey...... 76

Fig. 4.4. The Bayesian majority-rule consensus tree of combined nrDNA data for clade G. Bayesian posterior probabilities (PP) shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey...... 77

Fig. 4.5. The Bayesian majority-rule consensus tree of combined nrDNA data for clades H, I and J. Bayesian posterior probabilities (PP) shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey...... 78

Fig. 4.6. The Bayesian majority-rule consensus tree of combined nrDNA data for clades K, L, M. Bayesian posterior probabilities (PP) shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey...... 79

Fig. 4.7. The Bayesian majority-rule consensus tree of combined nrDNA data for clade N. Bayesian posterior probabilities (PP) shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey...... 80

Fig. 5.1. The Bayesian majority-rule consensus tree of combined cpDNA and nrDNA data. The large terminal triangles are major clades shown in detail in later figures. The smaller terminal triangles include more than one accession. Thick lines represent branches with high Posterior Probabilities = 0.95–1.0, shown above branches; bootstrap values are below branches. Chromosome counts (2n) and location of those samples are shown in green;? = count unknown. Chromosome counts were sourced from Hair (1942), Curtis (1952), Skottsberg (1953), Carr (1978), Tanaka (1981), Henderson (1987a) and de Lange & Murray (2003)...... 96

Fig. 5.2. The combined Bayesian majority-rule consensus tree of the outgroup genera, clades A, B, and C. The monophyly of Thelionema within clade B is questionable given differences among BI and MP analyses of the combined data set. Node numbers are in grey, and PP values and BS support are shown as in Fig. 5.1...... 97

Fig. 5.3. The combined Bayesian majority-rule consensus tree showing clades D (from node 16), E (node 22), F (node 25), G (node 26) and H (node 29). Node numbers are in grey, and PP values and BS support are shown as in Fig. 5.1...... 98

Fig. 5.4. The combined Bayesian majority-rule consensus tree showing clades I (from node 47), J (node 51), K (node 58) and L (node 63). Labels as in Fig. 5.1...... 101

Fig. 5.5. The combined Bayesian majority-rule consensus tree showing clade M (node 81); labels as in Fig. 5.1...... 102

Fig. 5.6. The combined Bayesian majority-rule consensus tree showing clade N (node 91). Labels as in Fig. 5.1...... 103

Fig. 5.7. Clade M with the chromosome counts (2n) mapped on the tree...... 117

xvi Fig. 6.1. A map of the collecting localities used in this study. The line connected to a coloured dot corresponds to the taxon collected at that ocality, as indicated in the key. Refer to Appendix B for a list of the actual collecting localities...... 133

Fig. 6.2. Dendrogram of 108 specimens of Dianella truncated at the five subgroup level. The samples in the molecular phylogeny are highlighted in dark black with the arrows pointing to the code of the sample: NT3173 and NT3178 D. sp. aff. lavarum; KMM1023 and KMM1025 D. lavarum, NT3186 and KMM1026 D. multipedicellata; NT3167 D. sp. aff. sandwicensis; NT3190 D. sandwicensis...... 138

Fig. 6.3. The Box and Whisker plots of the three highest measurement and scored characters. Refer to the key to determine the plots for each taxon...... 139

Fig. 6.4. Three-dimensional ordinations of 108 specimens based on 14 characters. Stress 0.0963, a (axes 1x2), b (1x3), c (2x3). The samples in the molecular phylogenies are: NT3173 and NT3178 D. sp. aff. lavarum; KMM1023 and KMM1025 D. lavarum, NT3186 and KMM1026 D. multipedicellata; NT3167 D. sp. aff. sandwicensis; NT3190 D. sandwicensis...... 140

Fig. 6.5. Three-dimensional scatterplot of 108 specimens based on 14 characters. The samples in the molecular phylogenies are: NT3173 and NT3178 D. sp. aff. lavarum; KMM1023 and KMM1025 D. lavarum, NT3186 and KMM1026 D. multipedicellata; NT3167 D. sp. aff. sandwicensis; NT3190 D. sandwicensis...... 141

Fig. 6.6. Scanning electron images of Hawaiian Dianella. A-C and D-F are from D. sandwicensis (NT3190 4/4); G-I D. lavarum (KMM1025 5/5); J-L D. sp. aff. lavarum (NT3173 1/4). Images A, D, J, scale bar=1 mm; image G 500 µm, images B, E, H, K =20 µm and C, F, I, L=10 µl...... 142

Fig. 6.7. Diagnostic images of D. sp. aff. lavarum (subgroup A1). (A) plant in situ, Oahu, (B,C) flower, (D) mature dark violet fruits, (E) nested inflorescence, Maui, (F) two fruit dye smears, Oahu. Photo A and F by Joel Lau...... 143

Fig. 6.8. Diagnostic images of D. lavarum (subgroup A2, Hawaii). (A) immature green fruit and mature pale blue fruit, (B) flower partially open, (C) cross-section of mature fruit, (D) red sheaths, (E) habitat Kau desert, Hawaii Volcanoes National Park, (F) mature inflorescence, (G) plantlets, (H) habitat Kipahoehoe Natural Area Reserve. All images were photographed in Hawaii Volcanoes National Park except for H. Image B is photographed by Sierra McDaniel...... 143

xvii Fig. 6.9. Diagnostic images of D. multipedicellata (subgroup A3). (A) Inflorescence, Oahu, (B) image of the spiralling pedicels on branching units (BISH709414), (C) typical plantlets, Oahu, (D) plant in situ. Kauai, (E) plant in situ Hawaii, (F, G) flowers, Hawaii...... 144

Fig. 6.10. Diagnostic images of D. sp. aff. sandwicensis (subgroup B4 Kauai). (A, E) Populations in situ, Kauai, (B) inflorescence with flowers and immature fruit, (C) brown/maroon immature fruit and mature purple fruit, (D) typical aboveground stem with cauline leaves, (F) flower, (G) lilac mature fruit, (H) lilac fruit cross section with mustard yellow dye smear, (I) mustard brown dye smear of immature fruit, (J) dark brown smear of mature fruit. Photographs B, C, G, H, I, J by Natalia Tangalin...... 144

Fig. 6.11. Diagnostic images of D. sandwicensis (subgroup A5). (A) D. sandwicensis in situ, Oahu, (B) immature fruit (orange) and mature fruit (purple), Oahu, (C) immature fruit, Maui, (D, E) flower, Oahu, (F) fruit, Oahu. Image F Joel Lau...... 145

Fig. 6.12. The distributional ranges of the five taxonomic entities. The black dots represent collecting localities from this study and examined herbarium specimens from BISH and PTGB (Refer to 6.8). (A) D. sp. aff. lavarum, (B) D. lavarum, (C) D. multipedicellata, (D) D. sp. aff. sandwicensis and (E) D. sandwicensis...... 146

Fig. 6.13. Arrangement of mature pedicels. (A). D. sp. aff. lavarum NT3173 1/4, (B) D. lavarum NT1023, (C) D. multipedicellata BISH709414, (D) D. sp. aff. sandwicensis NT3166, (E) D. sandwicensis NT3190 4/4. All scale bars represent 1 cm. Asymmetrical pedicels; A-B, D-E; radially symmetrical pedicels C...... 147

Fig. 6.14. Diagrammatic representation of pedicel morphology in one plane; (A1.1) D. multipedicellata, (B1.1) D. sandwicensis, D. sp. aff. sandwicensis, D. lavarum and D. sp. aff. lavarum. A cross-section of a branching unit with pedicels. (A1.2) D. multipedicellata and (B1.2) represents all other taxa...... 147

Fig. 6.15.The combined Bayesian majority-rule consensus tree of the Hawaiian and New Caledonian Dianella from Chapter 5. Posterior Probabilities are above branches; bootstrap values are below branches...... 150

Fig. 7.1. The Australian distributional range of taxa in this study sourced from Australia’s Virtual Herbarium (2016). (A) D. caerulea var. assera, (B) D. caerulea var. cinerascens (C) D. caerulea var. petasmatodes (D) D. caerulea var. producta (E) D. caerulea var. protensa (F) D. caerulea var. vannata (also in southern New Guinea) (G) D. caerulea var. caerulea, and (H) D. congesta...... 171

Fig. 7.2. Some of the D. caerulea varieties growing in The University of Melbourne glasshouse...... 178

xviii Fig. 7.3. Dendrogram of 263 specimens of Dianella truncated to the eightgroup level, stress 0.1035. The bolded lines are representative of the terminal taxa used in the phylogeny...... 185

Fig. 7.4. Three-dimensional ordination of 263 specimens based on 14 characters. Stress 0.1035, A (axes 1×2), B (1×3), C (2×3). The key colour codes the eight groups from the dendrogram. Molecular accessions included in the analyses are shown in A...... 187

Fig. 7.5. Dendrogram of 67 specimens of Dianella showing nine groups, stress 0.1151 ...... 189

Fig. 7.6. Three-dimensional ordination of 67 specimens based on 18 characters. Clusters are classified based on the nine groups found in the dendrogram (Fig. 5). Stress level 0.1151, A (axes 1×2), B (1×3), C (2×3)...... 190

Fig. 7.7 A photographic image of D. caerulea var. assera s.s. The black arrows highlight the white to transparent margin of the sheath which continues into the zone of occlusion, between the two red lines...... 194

Fig. 7.8 The leaf occlusion zone. The arrow in each image indicates the position of the occlusion zone. Open occlusion zone: (A) D. caerulea var. producta (Putty Rd, NSW) and (B) D. caerulea var. producta (Illawarra, NSW). The adjacent diagrams represent the extent of the fusion zone; 100% is completely open, the 60-70 % diagram, the dark region is completely fused and the 50 % diagram, the dark region is the fused region. Closed fusion zone: (C) D. caerulea var. petasmatodes (D’Aguilar NP, Qld.) and (D) D. caerulea var. vannata (Fraser Island). The adjacent image illustrates the fusion zone 100% completely fused...... 195

Fig 7.9 A diagnostic drawing of a Dianella leaf (adapted from Henderson 1987a). In between the two red lines below the leaf blade is the zone of occlusion...... 196

Fig. 7.10 Photographic images of raised ridges and denticles. (A) The pedicels of D. caerulea var. assera Springbrook NP ‘very narrow leaf’ illustrating raised ridges and denticles (arrows). (B) Raised ridges and denticles on a branching unit of D. caerulea var. assera Springbrook NP ‘very narrow leaf’ ...... 196

Fig. 7.11 The combined Bayesian majority-rule consensus tree of the D. caerulea complex (Chapter 5). Posterior Probabilities are above branches; bootstrap values are below branches. Nodes are numbered in grey ...... 199

xix List of Tables

Table 1.1. A summary of the currently recognised Dianella taxa according to the Australian Plant Census (2016) and the Kew World Checklist of Selected Plant Families (Govaerts et al. 2016)...... 14

Table 1.2. A list of the published chromosome counts of Dianella according to Curtis (1952), Carr (1978), Henderson (1987a), Hair (1942), Kaneko (1985), de Lange & Murray (2003), Skottsberg (1953) and Tanaka (1981). Continued over the page ...... 24

Table 3.1. Chloroplast forward and reverse primers used in this study (from Shaw et al. 2007)...... 42

Table 3.2. Newly designed internal primers for rpl14-rpl36 and trnQUUG- rps16 (Shaw et al. 2007)...... 43

Table 3.3. Statistics from MP analysis of the cpDNA dataset ...... 44

Table 4.1. Nuclear forward and reverse primers used in this study: ITS4 and ITS5 (White et al. 1990), I8S-ETS (Baldwin & Markos1998) and the newly designed primer DIAN-ETS ...... 71

Table 4.2. Statistics of the nrDNA parsimony analysis ...... 72

Table 5.1. Table of statistics for the combined cpDNA and nrDNA phylogenetic tree...... 95

Table 5.2. A list of the major morphological characters that define genera in Hemerocallidoideae...... 107

Table 5.3. Current status of the genus based on the phylogeny...... 126

Table 6.1. Characters used in the morphometric study...... 134

Table 6.2. A description of how the morphological characters were measured. Refer to Appendix G Figure 1 for a diagnostic drawing of the major plant parts of Dianella, and Appendix G Figure 2 for a diagnostic drawing of the major inflorescence parts ...... 135

Table 6.3. Characters with the highest Kruskall-Wallis (KW) values and their range and mean values for the five subgroups in the dendrogram (Figure 6.2)...... 139

Table 7.1. The total number of samples and populations of Henderson’s varieties and other potential taxa included in the morphometric analyses...... 175

Table 7.2. Samples from the molecular analyses (Chapter 5) that were also included in the morphometric analyses...... 177

xx Table 7.3. Characters used in the morphometric study. Characters without an asterisk in the (*) column were used in both analyses. One asterisk (*) indicates characters only used in the first analysis of the D. caerulea complex. Two asterisks (**) indicate characters used in the second analysis of D. caerulea var. assera, D. caerulea var. producta and related entities ...... 180

Table 7.4. The highest Kruskall and Wallis Values (KW) and the important characters with range and mean values for the eight groups...... 186

Table 7.5. The highest Kruskall and Wallis values and the important characters with range and mean values for the nine phenetic groups...... 191

Table 7.6a. Flower characters examined and recorded for five of the varieties of D. caerulea and compared with D. congesta...... 193

Table 7.6b. Flower characters of D. caerulea var. assera and affinities ...... 193

Table 7.6c. Flower characters of D. caerulea var. producta and affinities ...... 194

xxi Chapter 1: The nomenclatural history of Dianella and higher- level classification of petaloid monocots

1.1 The early classification of petaloid monocots The petaloid lilioid monocots are a morphologically diverse group of flowering plants, often distinguished by their showy tepals. Early taxonomists adopted this character to distinguish the large family Liliaceae in Engler and Prantl’s Liliiflorae in 1888 (Rudall et al. 1995). The German systematist Krause (1930) arranged the monocotyledons into 233 genera, divided into 12 subfamilies and numerous tribes. However, Krause chose not to review the family Liliaceae, simply because of its overwhelming complexity (Dahlgren et al. 1985).

Hutchinson (1934, 1959, 1973) applied a different approach to classifying the petaloid monocots. He proposed the superorder Corolliflorae (corolla bearers), which grouped petaloid monocots in 14 orders. The order Liliales consisted of six families of herbs with corms, rhizomes, or bulbs, and with small to large, showy flowers, and Liliaceae was the largest family in the order. The key characters to define Liliaceae were anthers mostly opening by slits (rarely pores) and a superior ovary.

Hutchinson also proposed the order Amaryllidales, superorder Corolliferae, which typically contained herbs with a tunicated bulb, showy flowers and an umbellate inflorescence that was rarely solitary. In an attempt to reduce the size of Liliaceae, inflorescence type was used to transfer genera from the family Liliaceae to Amaryllidaceae. In Liliaceae, Dianelleae (tribe 16) predominantly contained southern hemisphere genera, e.g. Dianella Lam. ex. Juss (Tropical Asia to New Zealand and Pacific Islands), Stypandra R.Br. (Australia) and Eccremis Willd. (South America) (Hutchinson 1934).

Cronquist (1981) applied a different approach to Hutchinson’s superorder Corolliferae. Inflorescence type was not used as a primary character to differentiate between the petaloid monocot groups. Instead, he proposed the class Liliopsida, subclass Liliidae, which consisted of only two orders, Liliales and Orchidales. Subclass Liliidae typically contained showy flowers with petaloid tepals. Order Orchidales was characterised as strongly mycotrophic (a symbiotic relationship that exists with a fungus (Judd et al. 2002), with the nectary position variable and the ovary position inferior. In contrast, 1 the order Liliales was characterised as not mycotrophic, with sepal nectaries present mostly on the base of the tepals and ovary position superior or inferior. Thus, the mycotrophic association was a key character dividing the two orders. Family Liliaceae was the largest family in the order Liliales, containing half of the species, approximately 8000. Key characters to delimit genera in the family were characters and character states including the lilioid six tepals, ovary commonly superior, and cells often present with raphides, needle-like shaped crystals of calcium carbonate or calcium oxalate (Judd et al. 2002). In this classification system, the family Liliaceae included the genus Dianella, which is consistent with Hutchinson (1934). The synthesis by Cronquist was considered a major stepping stone in monocot classification.

The German systematist Huber (1969) was recognised for classifying petaloid monocots based on the seed coat character phytomelan (Kauff et al. 2000; Dahlgren et al. 1985). The presence of phytomelan results in a black seed and the “incrustation of the seed coat” (Clifford et al. 1998). Petaloid monocots with such seeds (typically in fleshy or capsular fruit) were placed into the proposed order Asparagales (Kauff et al. 2000). Since the work by Huber (1969), Dahlgren et al. (1985) proposed the super order Liliiflorae, which consisted of five orders: Dioscoreales, Asparagales, Melanthiales, Burmanniales and Liliales. Order Asparagales was differentiated by non-variegated petaloid tepals, frequently showy, a phytomelaniferous seed coat and nectaries in the septa of the ovary. Order Liliales was characterised by variegated, petaloid tepals, often spotted, with a non-phytomelaniferous seed coat and nectaries mostly located at the base of the tepals. Thorne (1992) also adopted the phytomelan seed coat character from Huber (1969), and higher-order concepts of Dahlgren et al. (1985), particularly the orders Asparagales and Liliales. Takhtajan (1997) continued with the principal findings by Huber and Dahlgren for the classification of the petaloid monocots.

2 1.2 A time of rapid progress: the rise of molecular plant systematics The history of molecular systematics is reviewed, particularly the reorganisation of the petaloid monocots in the order Asparagales, and the subfamily Hemerocallidoideae. The major research papers are reviewed that influenced the classification scheme of the Angiosperm Phylogeny Group (1998, 2003, 2009, 2016).

The rise of phylogenetic studies in higher-level classification provided a new impetus in the classification of petaloid monocots. An early study by Chase et al. (1995a) investigated monocots using two datasets, i.e. a morphological and a DNA dataset of the rbcL gene, which included 95 taxa. The combined dataset found Lilianae sensu Dahlgren et al. (1985) to be monophyletic. Representatives of the order Asparagales formed a clade, including the families Hemerocallidaceae, Xanthorrhoeaceae sensu stricto and Asphodelaceae. A further phylogenetic study by Chase et al. (1995b) increased the sample size to 172 DNA sequences of the rbcL gene, representing all major monocot lineages, to investigate further phylogenetic relationships within the superorder Lilianeae sensu Dahlgren et al. (1985). In contrast to the previous analyses, Lilianeae was paraphyletic, with lineages positioned near the base of the monocots. Another unexpected result was the inclusion of Iridaceae and Orchidaceae within Asparagales, otherwise placed in Liliales in accordance with Dahlgren et al. (1985). The authors concluded that a larger sample size may assist in further clarification of other relationships not resolved within Lilianeae. Chase et al. (1995b) also recognised higher and lower asparagoid clades within the order Asparagales, which could be attributed to simultaneous microsporogenesis in lower asparagoids and successive microsporogenesis in higher asparagoids (Rudall et al. 1997).

Chase et al. (2000) took a multi-gene approach to investigate the evolutionary relationships in monocots. Three gene regions, 18S ribosomal DNA, atpB and rbcL were analysed for 126 monocots and 22 magnoloid outgroups. The phylogenetic tree was generally congruent with clades identified in Chase et al. 1995a and Chase et al. 1995b, but with more resolution and node support. The monocots were confirmed as monophyletic with most orders also strongly supported. Order Acorales was sister to the rest of the monocots with 95% Bootstrap support (BS). The Asparagales had weak support (BS 56%), with the inclusion of additional families, i.e. Asteliaceae,

3 Blandfordiaceae, Boryaceae, Hypoxidaceae and Orchidaceae. Some suprafamilial relationships within Asparagales were moderately supported, i.e. Asphodelaceae and Xanthorrhoeaceae (BS 77%). However, some subfamilies were missing from the dataset including Hemerocallidaceae. The authors noted that more samples of selected genera were required to clarify the unresolved family relationships.

Fay et al. (2000) continued research in the order Asparagales and investigated four plastid regions (trnL-trnF intergenic spacer, rbcL, atpB and the trnL intron) to test suprafamilial relationships. A representative of all families according to Angiosperm Phylogeny Group (1998) was included, and the tree topology was similar to that of Chase et al. (1995b), but with greater support, and the order Asparagales was a strongly supported clade. The higher asparagoids also formed a strongly supported clade sensu Chase et al. (1995b), and the lower asparagoids had moderate to low support and formed a paraphyletic grade. Families Xanthorrhoeaceae sensu stricto, Asphodelaceae and Hemerocallidaceae formed one clade with high bootstrap support. However, the relationship between Asphodelaceae and Xanthorrhoeaceae was only weakly supported. Additionally, Orchidaceae and Iridaceae were included in Asparagales as in Chase et al. 1995b, and Chase et al. 2000. Based on these studies, the Angiosperm Phylogeny Group (APG II) (2003) reorganised the families Hemerocallidaceae, Xanthorrhoeaceae and Asphodelaceae into one super family Xanthorrhoeaceae.

Chase et al. (2006) used a multi-gene data set of nuclear DNA, chloroplast and mitochondrial DNA: nr18S, partial 26S rDNA, plastid atpB, matK, ndhF, rbcL and mtDNA atp1 to further investigate monocots. The results were highly congruent with previous studies by Chase et al. (1995b) and Fay et al. (2000), and resolved a number of major evolutionary relationships within Asparagales. Asparagales were weakly supported (BS 79%) as sister to the commelinids and Orchidaceae sister to Asparagales with high support (BS 90%); Xanthorrhoeaceae s.l. received high support for the new familial arrangement (BS 98%), also in agreement with numerous other studies (Graham et al. 2006; Chase et al. 2006; Givnish et al. 2006; Wurdack & Dorr 2009).

4 Subsequently, the Angiosperm Phylogeny Group (APG III) (2009) revised Asparagales to include 14 families, including the superfamily Xanthorrhoeaceae and Chase et al. (2009) described the superfamily Xanthorrhoeaceae, which included the three subfamilies: Xanthorrhoeoideae M.W. Chase, Reveal & M.F. Fay, Hemerocallidoideae Lindley and Asphodeloideae Burnett. The analysis of Wurdack & Dorr (2009) included a larger number of genera representing Hemerocallidoideae, which provided further support for the superfamily Xanthorrhoeaceae and its constituent subfamilies. To clarify unresolved nodes reported in these earlier studies of Asparagales, Seberg et al. (2012) sequenced three plastid regions (matK, ndhF and rbcL) and two mitochondrial genes (atp1 and cob) for 138 ingroup and 15 outgroup taxa. They found strong support for Orchidaceae as sister to all other families in Asparagales and for the superfamily Xanthorrhoeaceae. Chen et al. (2013) sequenced four plastid regions (atpB, matK, ndhF and rbcL) and found strong support for the superfamily Xanthorrhoeaceae s.l. (sensu APG III). The results were mostly congruent with those of Fay et al. (2000), Graham et al. (2006), Seberg et al. (2012); Steele et al. 2012 and Chen et al. (2013). Angiosperm Phylogeny Group (APG IV) (2016) rearranged the superfamily Xanthorrhoeaceae due to “nomenclatural issues” and Asphodelaceae was the superfamily name.

The recent development of new molecular techniques, in particular, Next Generation Sequencing, may further clarify unresolved relationships at all levels within the order Asparagales.

1.3 Subfamily Hemerocallidoideae and Dianella Of interest to this thesis is the history of the classification of subfamily Hemerocallidoideae, and the position of the genus Dianella. Dahlgren et al. (1985) first referred to Hemerocallidaceae as a monogeneric family to include the genus Hemerocallis L. Henderson & Clifford (1984) considered family Phormiaceae to include five genera: Dianella, Eccremis, Phormium J.R.Forst. & G.Forst., Rhuacophila Blume and Stypandra. A new genus Thelionema R.J.F.Hend. was also included in Phormiaceae by Henderson (1985). However, Chase et al. (1995b) found Hemerocallis to be nested within family Phormiaceae together with genera in the so-called Johnsonioid clade (or PhormioidJohnsonioid clade). At the time, the Johnsonioid clade was formally placed in the family Anthericaceae, which was found to be paraphyletic in Chase et al. (1995b). Chase et al. (1996) thus introduced a new concept for Phormiaceae to include 18 genera

5 that mostly occur in the Southern Hemisphere (largely Australian) together with the genus Hemerocallis L. Rudall et al. (1997) found the synapomorphic character of trichotomosulate pollen in all genera except Hemerocallis, which had sulcate pollen. Clifford et al. (1998) chose to disregard Phormiaceae (1858) because the family name Hemerocallidaceae (1810) has priority. The family Hemerocallidaceae includes the genera Hemerocallis, Phormium, Agrostocrinum F.Muell., Pasithea D. Don, Herpolirion Hook.f, Thelionema, Simethis Kunth, Stypandra, Caesia R.Br., Geitonoplesium A.Cunn. ex R.Br., Rhuacophila, Dianella and Xeronema Brongn. & Gris. Today, Phormiaceae is no longer recognised and all genera are in the subfamily Hemerocallidoideae, superfamily Asphodelaceae (Angiosperm Phylogeny Group 2016).

Wurdack & Dorr (2009) investigated generic relationships within subfamily Hemerocallidoideae (see Figure 1.1). They sequenced plastid gene regions atpB, ndhF, rbcL and trnL-F to determine how closely related the South American genera Eccremis and Pasithea were to other genera in the subfamily. In their analysis, they included six Dianella species, the largest number of taxa sampled in a molecular study to date, and found the genus to be monophyletic. The South American genera Pasithea and Eccremis were not sister to each other, indicating two separate lines of evolution. Interestingly, Eccremis was found to be sister to Dianella for the first time with high support. Additionally, Stypandra, Herpolirion, Rhuacophila and Thelionema formed a clade, although the relationships between these genera were unresolved (with only weak support). This study also provided new insights into other relationships, particularly that of the ‘Johnsonioid clade,’ initially placed in family Anthericaceae, but now in subfamily Hemerocallidoideae (see Figure 1.1) (Wurdack & Dorr 2009; Stevens 2012). More recently, Chamaescilla F.Muell. ex Benth. was added to the family, identified by analysis of DNA sequences by McLay & Bayly 2016. As shown in the phylogram of Wurdack & Dorr (2009), Dianella is in the phormiod clade, sister to a ‘Johnsonioid’ clade (see Fig. 1.1); the latter includes genera that are mostly endemic to Western Australia.

In summary, subfamily Hemerocallidoideae is currently considered to contain 23 genera of which 11 are endemic to Australia (Stevens 2012). Dianella has one of the most extensive distributional ranges in the subfamily, occurring throughout south-east Asia, Australia, New Zealand, the Pacific (east to Hawaii and the Marquesas) and the Indian Ocean to mainland Africa and Madagascar (Govaerts et al. 2016; Stevens 2012). The

6 genus Caesia also has a distribution occurring in southern Africa, New Guinea and Australia (Henderson 1987), and Geitonoplesium occurs in Malesia, Pacific Islands, Australia, Philippines (Furness et al. 2013). Other genera in the subfamily occur in Australia, New Zealand, Asia to the Pacific, South America and Europe. These include Phormium, endemic to New Zealand and Norfolk Island; Rhuacophila in Malesia, New Caledonia and Fiji; Hemerocallis ranges from Central Europe to China and Japan. Eccremis and Pasithea occur in South America, and Simethis inhabits Europe to Morocco. Herpolirion, a monotypic genus, occurs in Australia and New Zealand. The genera endemic to Australia include Stypandra, Thelionema, Agrostrocrinum, Johnsonia R.Br., Hensmania W.Fitzg., Stawellia F.Muell., Arnocrinum Endl. & Lehm., Hodgsoniola F.Muell., Corynotheca F.Muell. ex Benth., Tricoryne R.Br. and Chamaescilla.

1.4 Taxonomic history of Dianella The following summarises the taxonomic history of the genus Dianella, the main contributors to its taxonomy and current legitimate taxa. Some of the following draws from the review of the older literature by Henderson (1977a). The genus Dianella was formally described in 1789 by A.L. de Jussieu in Genera Plantarum. Prior to the publication by Jussieu, Lamarck described two species in 1786. However, these species were not considered valid as a generic description was not provided (Henderson 1977a). Based on this evidence, Henderson designates the formal description of the genus Dianella Lam. ex Juss. (Henderson 1977a).

The type for the genus is D. ensifolia (L.) Redouté (Govaerts et al. 2016). Henderson (1977a) originally thought the sheet in LINN that he designated as lectotype of the name D. ensifolia was not a Dianella, hence he took up the later name D. ensata (Thunberg) R.J.F.Hend. for the type species Dianella. However, Henderson (1987a) later examined the sheet in LINN and found that it was a mixture of a Cordyline and a Dianella and designated the Dianella part of that specimen as the lectotype of the name D. ensifolia. Since the description of the genus, 171 names were published and to date, 63 names are accepted (Refer to Table 1.1) (Govaerts et al. 2016, Australian Plant Census 2016).

Fig. 1.1. Partial maximum likelihood consensus tree of four plastid gene regions showing generic relationships in superfamily Xanthorrhoeaceae, from Wurdack & Dorr (2009). (Note Hemerocallidaceae is now treated as subfamily Hemerocallidoideae).

Jakob Schlittler (1940) wrote the only global monograph for the genus and stated: “The aim was to investigate the inner relationships between species, the genesis of the genus and its relationship to proximate monocots” (Pg. 15). Schlittler relied on herbarium specimens and a living collection of D. caerulea plants to investigate anatomical characters and a suite of morphological characters including floral, leaf, stem, rhizome and inflorescence features. He was the first to investigate the leaf occlusion zone in detail, a character also adopted by Henderson (1987a). Schlittler created a new arrangement for genera closely related to Dianella. He treated Rhuacophila and Eccremis as subgenera in Dianella. Today, this arrangement is no longer accepted. As part of his treatment, Schlittler described numerous new Dianella species. According to Govaerts et al. (2016), six species remain valid and the majority inhabit New Caledonia, except for D. dentata which occurs in south-east China (Table 1.1).

8 1.4.1 Malesia Hallier (1914) described five Dianella species for Papua New Guinea and three remain valid: i.e. D. serrulata Hallier f., D. monophylla Hallier f. and D. bambusifolia Hallier f. (Govaerts et al. 2016). Henderson (1987a) described a population in far-north Queensland as suggesting that it might be conspecific with D. serrulata Hallier f.; now referred to as D. caerulea var. Theresa Creek (W.G.Trapnell 269) R.J.F.Hend. (Australian Plant Census 2016). Further research is required to determine the validity of the taxon because no floral or inflorescence material was available for examination (Henderson 1987a). Dianella odorata Blume occurs in Malesia to northern Australia and was described in 1827 (Henderson 1987a; Govaerts et al. 2016; Blume 1827).

1.4.2 Melanesia Schlittler (1954) investigated Dianella in New Caledonia and confirmed seven species (D. intermedia Endl., D. nigra Colenso, D. acutifolia Schlittler, D. daenikeri Schlittler, D. pendula Schlittler, D. plicata Schlittler and D. stipitata Schlittler). Today the majority are still recognised in New Caledonia, except for D. nigra and D. intermedia (Govaerts et al. 2016). Since Schlittler’s study, Henderson (1988) reviewed Dianella in New Caledonia and did field work on the island. He reinstated the oldest name once applied to Dianella in New Caledonia, i.e. Anthericum adenanthera G. Forster and published a new combination, Dianella adenanthera (G. Forst.) R.J.F.Hend. Henderson (1988) concluded that more research is required to clarify the number of species, including the accuracy of Schlittler’s recognition of D. nigra in New Caledonia. A revisionary study is required to clarify Schlittler’s species and to highlight morphological affinities between neighbouring islands and continents.

1.4.3 Polynesia Dianella sandwicensis Hook. & Arn. is considered a variable species confined to the Hawaiian and Marquesas Islands (Wagner et al. 1990b). For New Zealand three endemic species are recognised, D. nigra, D. latissima Heenan & de Lange and D. haematica Heenan & de Lange. Dianella intermedia occurs in Norfolk Island and Lord Howe Island (Green 1994) and further research is required to clarify if a new species should be described on Lord Howe Island (de Lange et al. 2005). A new historic record was discovered for Dianella on Easter Island. A palaeoecological study by Can˜ellas-Bolta et al. (2014) in a volcanic crater, uncovered numerous Dianella seeds and pollen in

9 sediment cores. Although living Dianella plants were never documented on the island, this finding has extended the geographic range of the genus in the Polynesian region. D. andenanthera is recorded in the south Pacific (Govaerts et al. 2016) and further study is required to clarify the number of taxa in the region.

1.4.4 Micronesia Two Dianella species were described for the region: D. carolinensis Lauterb is endemic to the Caroline Islands and D. saffordiana Fosberg & Sachet is endemic to the Mariana Islands and only recorded on the island of Guam (Refer to Fosberg & Sachet 1987).

1.4.5 Asia-Indian Ocean In south-east Asia, Dianella occurs in a range of environments from grasslands to forests, at sea level to 3000 m altitude (Dahlgren et al. 1985). Jessop (1979) reviewed Dianella for the Malesian region and placed numerous Dianella species in synonymy with D. ensifolia. Due to this reclassification, the taxon has the most expansive distributional range of any Dianella. It occurs throughout south-east Asia, from IndoMalaysia to Madagascar and east Africa (Dahlgren et al. 1985; Jessop 1979).

According to Govaerts et al. (2016), D. ensifolia extends to South tropical Asia: Mozambique, Zimbabwe; Western Indian Ocean: Mauritius, Madagascar Reunion, and Seychelles; China South-Central: Hainan. China South-east; Eastern Asia: Japan, Nansei-shoto, Ogasawara-shoto and Taiwan; India Subcontinent: Assam, Bangladesh, Eastern Himalaya, Nepal, Sri Lanka; Indo-China: Cambodia, Laos, Myanmar, Thailand and Vietnam; Malesia: Borneo, Java, Lesser Sunda Island, Malaya, Maluku Philippines, Sulawesi, Sumatra, New Guinea and Solomon Islands.

A new locality record for D. ensifolia in Bangladesh extends the range of the taxon (Uddin & Hassan 2009). According to Govaerts et al. (2016), D. dentata Schlittler is the only other taxon in south-east China. Schlittler (1948) continued his taxonomic research and focussed his studies on Dianella in the Malesian region.

Early taxonomists recognised D. ensifolia in north-eastern Australia (Bentham 1878; Bailey 1902), however today it has been reclassified as a new taxon, Dianella atraxis

10 R.J.F.Hend. by Henderson (1987a). D. atraxis occurs in the the wet tropics region in Australia and has morphological affinities to D. ensifolia s.l.

1.4.6 Australia The first Dianella species described in Australia was D. caerulea in 1801 (Sims, Bot. Mag. 14: t. 505). Robert Brown (1810) included seven species and six were new species to science. Hooker (1860) agreed with four of Brown’s species for Tasmania and also described a new taxon, D. tasmanica Hook.f. Mueller (1868) found some of Brown and Hooker’s taxa to be conspecific, reducing the number of Australian species to five. Bentham (1878) described Dianella to be “chiefly Australian but extends in a very few species to tropical Asia, Mascarene and Pacific Islands, and New Zealand”. He confirmed five species including the extra-Australian taxon D. ensifolia. D. longifolia var. stenophylla Domin was first described in 1915 by Domin and D. brevicaulis (Ostenf.) G.W.Carr & P.F.Horsfall in 1921 by Ostenfeld.

Rodney Henderson, a Queensland botanist, initiated a new momentum for Dianella research in Australia. He published the first Australian treatment for the genus in Flora of Australia, Volume 45 (Henderson 1987a). His revision largely focussed on north- eastern Australian taxa, which resulted in many new taxa for the region, and four new complexes were described: D. longifolia R.Br. complex (seven infraspecific taxa), D. revoluta R.Br. (six infraspecific taxa), D. pavopennacea R.J.F.Hend. (three infraspecific taxa) and D. caerulea complex (nine infraspecific taxa). The treatment was composed of 36 new taxa; 7 species and 17 varieties. Henderson also listed chromosome counts for the majority of taxa, mostly sourced from his Master's thesis (Henderson 1977b). A list of putative hybrids was also published, highlighting further complexities in identifying Dianella. Henderson also published two papers (1977a, 1988), which clarified some aspects of Dianella nomenclature.

Since Henderson’s publication on Australian Dianella (1987a), for Australia, two infraspecific taxa were elevated to specific rank D. brevicaulis and D. porracea (R.J.F.Hend.) G.W.Carr & P.F.Horsfall, and five new Australian species were described: D. callicarpa G.W. Carr & P.F.Horsfall, D. amoena G.W. Carr & P.F.Horsfall, D. tarda G.W. Carr & P.F.Horsfall, D. tenuissima G.W. Carr, and D. fruticans R.J.F.Hend. According to the Australian Plant Census (Australian Plant Census 2016), numerous

11 entities of D. longifolia and D. revoluta (Victoria) require further morphological research to determine their nomenclatural merit.

An honours project by Muscat (2009) conducted a morphometric study to determine the morphological variation within D. tasmanica. The study examined fresh plant material collected throughout the range of the taxon. Morphologically distinct populations were found and are to be recognised as new species (Muscat, unpublished).

1.5 Morphological traits

1.5.1 Roots and stems Dianella taxa have two kinds of root systems: (1) the underground stem known as the rhizome and (2) the swollen root, known as the tuber, which is fleshy to fibrous (Refer to Fig. 1.2C) (Henderson 1987a). Taxa with a rhizomatous root system develop short to long underground stems, resulting in a densely caespitose to a gregarious plant habit, which can also form large clonal colonies many metres wide (Henderson 1987a).

Multiple tubers are typical on a tuberous producing taxon, which can vary in diameter and length. The plant habit is densely caespitose, up to 0.75 m wide (Henderson 1987a). Tuberous root systems develop leaf buds at the apex of a tuber that grow into a cluster of leaves. Fibrous rootlets can occur on both root types, covered with small white floccose hairs on the surface. Non-photosynthetic scales appear on the rhizome, also known as cataphylls. Rhizome colour is commonly shades of yellow and the tubers are typically shades of white to cream. Vegetative buds develop on the nodes of the rhizome, which can develop into aerial stems or a cluster of basal leaves. Photosynthetic cataphylls or scales (modified leaf sheaths Henderson 1987a) occur alternately on the base of the aerial stem followed by leaves. Aerial stem height, the number of cataphylls and leaves can vary between taxa. Extravaginal branching units occur on the aerial stem of some taxa, Fig. 1.2B (Henderson 1987a).

12 1.5.2 Leaf morphology The leaf is composed of a sheath and blade. In many taxa, the blade is commonly strap- like, up to 2 m in height (Fig. 1.2I). The sheath is the lower portion of the leaf, which is conduplicate and develops further into a flat blade. Some Dianella taxa, particularly those with tall aerial stems, have short cauline leaves (Fig. 1.2B) when compared to plants with only basal leaves that are typically longer (Fig. 1.2I). In many taxa, a cluster of leaves develop into a fan-like equitant arrangement. (Fig. 1.2B, F, G).

The junction of the sheath and blade is termed the ‘zone of occlusion’ by Henderson (1987a). In this zone, the sheath and blade can fuse, and the extent of the fusion differs between taxa. This is a key character to delimit taxa in the D. caerulea complex (Henderson 1987a). In some taxa, papillae occur on the adaxial sheath surface (Henderson 1987a). Inner sheath colour can vary in shades of red, pink, green and white (Fig. 1.2F, G), and the leaf colour varies in shades of green. Prominent parallel veination occurs on the abaxial leaf surface, and visible veination appears on the adaxial surface of the sheath in some taxa. The leaf margins can be smooth or scabrid with short, sharp outgrowths, tooth-like projections described as denticles that are prickle-like.

13 Table 1.1. A summary of the currently recognised Dianella taxa according to the Australian Plant Census (2016) and the Kew World Checklist of Selected Plant Families (Govaerts et al. 2016).

Taxon Authority Distribution D. acutifolia Schlittler New Caledonia

D. adenanthera (G.Forst.) R.J.F.Hend. New Caledonia G.W.Carr & D. amoena Vic, Tas P.F.Horsfall D. atraxis R.J.F.Hend. NE Qld Papua New Guinea to D. bambusifolia Hallier f. NE Qld (Ostenf.) G.W.Carr & SE Australia, SA, WA, D. brevicaulis P.F. Horsfall Tasmania D. brevipedunculata R.J.F.Hend. SE Qld and NE NSW Vic, NSW, Qld, Torres D. caerulea Sims Strait Islands, S. Papua New Guinea D. caerulea var. R.J.F.Hend. NE Qld aquilonia

D. caerulea var. assera R.J.F.Hend. E Qld to E NSW

D. caerulea var. Sims SE Qld, NSW caerulea D. caerulea var. R.J.F.Hend. NSW cinerascens

D. caerulea var. R.J.F.Hend. E Qld to NE NSW petasmatodes D. caerulea var. R.J.F.Hend. SE Qld to E NSW producta D. caerulea var. R.J.F.Hend. E Qld to E NSW protensa D. caerulea variant R.J.F.Hend. NE Qld Theresa Creek D. caerulea var. S. Papua New Guinea to R.J.F.Hend. vannata E Australia

14 Taxon Authority Distribution G.W.Carr & D. callicarpa Vic, SA P.F.Horsfall D. carolinensis Lauterb. Caroline Islands SE Qld to E NSW, D. congesta R.Br. Torres Strait D. crinoides R.J.F.Hend. Eastern Australia D. daenikeri Schlittler New Caledonia D. dentata Schlittler SE China S Tropical Africa, (Chimanimani Mts), D. ensifolia (L.) Redouté Madagascar to Tropical & Subtropical Asia D. fruticans R.J.F.Hend. E Qld

New Zealand, North D. haematica Heenan & de Lange Island D. incollata R.J.F.Hend. NE Qld Norfolk Island, Lord D. intermedia Endl. Howe Island D. javanica (Blume) Kunth Malesia to SW Pacific New Zealand, North D. latissima Heenan & de Lange Island D. longifolia R.Br. Australia, all states D. longifolia var. R.Br. Australia, all states longifolia D. longifolia var. R.J.F.Hend. NE Qld fragrans D. longifolia var. R.J.F.Hend. SE Qld, NSW, Vic, SA grandis D. longifolia var. Domin SE Qld to E NSW stenophylla D. longifolia var. R.J.F.Hend. Qld to NE NSW stupata

15 Taxon Authority Distribution D. longifolia var. R.J.F.Hend. SE Qld to NE NSW surculosa D. monophylla Hallier f. New Guinea D. nervosa R.J.F.Hend. E Qld to NE NSW D. nigra Colenso New Zealand Malesia to Northern D. odorata Blume Australia, New Guinea N Qld, Torres Strait D. pavopennacea R.J.F.Hend. islands D. pavopennacea var. R.J.F.Hend. N Qld pavopennacea D. pavopennacea var. N Qld, Torres Strait R.J.F.Hend. major islands D. pavopennacea var. R.J.F.Hend. N Qld robusta D. pendula Schlittler New Caledonia D. plicata Schlittler New Caledonia (Hend.) G.W.Carr & D. porracea S Qld to NE NSW P.F.Horsfall D. prunina R.J.F.Hend. SE NSW D. rara R.Br. E Qld E & S Australia, D. revoluta R.Br. excluding the Northern Territory D. revoluta var. (R.Br.) R.J.F.Hend. WA, SA, Vic divaricata D. revoluta var. minor R.J.F.Hend. SE Qld E & S Australia, D. revoluta var. (R.Br) R.J.F.Hend. excluding the Northern revoluta Territory D. revoluta var. tenuis R.J.F.Hend. SE Qld D. revoluta var. vinosa R.J.F.Hend. SE Qld to NE NSW

16 Taxon Authority Distribution D. saffordiana Fosberg & Sachet Guam Hawaiian Islands, D. sandwicensis Hook. & Arn. Marquesas D. serrulata Hallier f. New Guinea D. stipitata Schlittler New Caledonia G.W Carr & P.F. D. tarda SE Australia Horsfall D. tasmanica Hook.f. SE NSW to Tasmania D. tenuissima G.W.Carr NSW

Abbreviations: New South Wales (NSW), Victoria (Vic), Queensland (Qld), South (S), East (E), North (N), North-east (NE), South-east (SE), South Australia (SA), Western Australia (WA).

1.5.3 Inflorescence The inflorescence is defined as a raceme in accordance with Weberling (1989). The main axis does not terminate with an individual flower and is thus an indeterminate inflorescence (Weberling 1989). The main branching units of the inflorescence alternate, and in many taxa they contain numerous showy pedicellate flowers. Along the main axis, one prophyll (Henderson 1987a) is at the base of each major branching unit, and the same pattern applies for each pedicel. The inflorescence of most taxa is typically a compound raceme with multiple orders of branching, e.g. double and triple raceme. Interestingly, some taxa contain multiple branching orders, e.g. D. caerulea var. cinerascens (Fig. 1.2A). Inflorescence shape is used by some authors to delimit taxa e.g. narrow conical, oblong to open conical (Henderson 1987a). The number of pedicels on a branching unit can also delimit taxa such as D. crinoides and D. rara from other taxa in the D. longifolia complex (Henderson 1987a). To date, minimal literature is available to describe inflorescence morphology of Dianella, particularly information about branching orders and pedicel patterns.

1.5.4 Flowers The perianth is entirely petaloid, arranged in two series. Tepal colour is quite variable, e.g. blue, purple, green or white, and can vary within a population for some taxa (personal obs. K.M.M). The inner and outer tepals are differently coloured in some taxa. For 17 example, D. bambusifolia, D. caerulea var. assera (Yarriabini NP) and some populations of D. caerulea var. vannata and D. caerulea var. petasmatodes, e.g., the inner whorl is white and the outer whorl is purple (Fig. 1.2D). The tepals have parallel veins along the centre and the number of veins can vary between the inner and outer whorl (Henderson 1987a). At the apex of the tepal, a tuft of ciliate hairs is present, first documented by Degener (1932) in Hawaiian Dianella. My observations confirm all Australian Dianella flowers contain these tufts of hairs (Fig. 1.2E). The ovary is superior, three-locular; ovules biseriate, 2–12 per locule (Henderson, 1987a). The androecium is composed of six stamens; each stamen is composed of three units, the filament, anther and a swollen mid portion called the struma which is papillose (Fig. 1.2D) (Henderson 1987a, Carr 2006; Heenan & de Lange 2007).

The pollen of Dianella is released by terminal pores in the anther, which further develop into slits (Henderson 1987a; Bernhardt 1995; Wurdack & Dorr 2009). Furness et al. (2013) conducted a pollen survey on selected Dianella species and found the most typical pollen-aperature type was trichotomosulcate, with occasional monosulcate pollen. Variation in pollen surface morphology was also evident. Dianella revoluta had a microreticulate surface, and D. intermedia, D. ensifolia and D. montana had a perforate and fossulate patterning.

Little is known about the function of the struma, a cushion-like swelling (Beentje 2016) positioned between the filament and the anther. Studies by Vogel (1978) and Faegri (1986) suggest the struma could be an evolutionary adaptation towards deception and is possibly a visual attractant for pollinators. Bernhardt (1995) examined the flowers of D. caerulea var. assera, D. sp. aff. longifolia and D. ensifolia to investigate if scent glands (osmophores) were present in the struma and concluded they were absent. His study confirmed that Dianella flowers are buzz pollinated by Australian bee species in the families Anthophoridae (Exoneura spp.) and Halictidae (Lasioglossum, Nomia spp.). This was also substantiated by Duncan et al. (2004) who examined the pollinators of two Victorian Dianella (D. longifolia and D. revoluta). Buzz pollination was observed on D. longifolia flowers predominately pollinated by Homalictus bees, and D. revoluta was pollinated by Lipotriches bees.

18 1.5.5 Fruit morphology The fruit is a fleshy berry that typically matures in shades of purple or blue (Fig. 1.2A). Fruit shape is an important character to assist in the identification of some taxa. For example, D. tasmanica has oblong fruit, D. caerulea var. assera R.J.F. Hend. has round fruit and D. sandwicensis s.s of Degener (1932) has round to oblong fruit with a pointed base. Fruit dye in most Dianella taxa is purple. Interestingly, Dianella sp. aff. tasmanica (Snowfields) has a green fruit dye (Muscat 2009), and Hawaiian Dianella has a range of fruit dye colours including yellow, purple-violet and dark brown (Refer to Chapter 6). This may prove to be an important taxonomic character to delimit taxa.

1.5.6 Seed morphology Shape and texture of the testa of Dianella seeds can assist in the delimitation of some taxa (Degener 1932, Henderson 1987a, Carr & Horsfall 1995). Henderson (1987a) described Dianella seed to be obliquely ovate, smooth, shiny and sculptured, and either black or brown in colour. He provided the first scanning electron images of Dianella seeds in his Flora treatment, which provided evidence to support new taxa. Carr & Horsfall (1995) and Degener (1932) included drawings of seeds in their publications when describing new species.

1.6 Cytology in Dianella Schnarf & Wunderlich (1939) were the first researchers to do chromosome counts in Dianella and recorded n=9 for D. tasmanica, although the base number is eight as confirmed by Curtis (1952) and Henderson (1977b). In the Pacific region, Hair (1942) provided an illustration of New Zealand Dianella chromosomes of 2n=16 (at the time, the taxon was recognised as D. intermedia). de Lange and Murray (2002) also recorded 2n=16 for D. latissima and D. haematica, two recently described New Zealand species. For the Hawaiian Islands, Kaneko (1985) and Carr (1978) both recorded D. sandwicensis s.l. as having 2n=32 and Skottsberg (1953) recorded 2n=40,70, indicating polyploidy in Hawaiian Dianella. For D. adenanthera, first described in New Caledonia, de Lange & Murray (2003) noted counts of this taxon from Rarotonga and Tonga were 2n=64. Interestingly, the authors also confirmed D. intermedia on Norfolk Island has 2n=64.

In the south-east Asian region, Nandi (1974) investigated three populations of D. ensifolia and a horticultural variety, D. ensifolia var. variegata from India. The majority

19 had a diploid number of 2n=40 except for the third population, 2n=34. Also in the Indian region, Sharma & Chatterji (1958) investigated D. variegata (currently accepted name is D. ensifolia) and recorded 2n=28; and found an aneuploid series, and different-sized chromosomes with a high frequency of multivalents in meiosis, which may have a role in speciation. Tanaka (1981) recorded 2n=32 for D. ensifolia from Japan.

In Australia, Curtis (1952) investigated four species to test for polyploidy, i.e. D. revoluta R.Br., D. laevis R.Br. (currently treated as a synonym of D. longifolia), D. caerulea and D. tasmanica, sourced from Tasmania, mainland Australia and Papua New Guinea. She also investigated macro-morphological characters, including leaf length, colour and the size of pollen grains, in an attempt to find a correlation between ploidy level and morphological characters. Dianella species were found to have variable chromosome counts. D. revoluta plants were diploids 2n=16, tetraploids 2n=32 or hexaploids 2n=48; D. laevis plants were diploids 2n=16 and tetraploids 2n=32; and D. caerulea were diploids 2n=16, tetraploids 2n=32 or hexaploids 2n=48. The most diverse taxon was D. tasmanica with diploids 2n=16, octoploids 2n=64, decaploids 2n=80 and aneuploids as well as hyper and hypodecaploids 2n=84 and 76. Apomixis was observed in two individuals of D. tasmanica, never before documented in the genus.

Although Curtis (1952) did not find a correlation between morphological characters and ploidy counts to warrant any new taxa, she did recognise a pattern in chromosome counts between certain populations within a species. For example, D. revoluta plants could be placed in two groups based on morphology and ploidy level: group (A) plants with slender leaves and an inflorescence much shorter than leaves, 2n=16, and group (B), plants with erect leaves (observed to be sometimes glaucous), inflorescence equal in length or exceeding the leaves at time of flowering, and 2n=32. The large variation of ploidy in D. tasmanica and observed apomixis suggests a reproductive flexibility and potential for speciation, which is indicated in the morphometric study by Muscat (2009), which identified distinct operational taxonomic units.

Henderson (1977b) sampled Dianella species from north-eastern Australia to investigate both morphology and polyploidy. He measured micro-anatomical characters, including the relative size of stomata and their guard cells, and the size of pollen grains in an attempt to find indicators of polyploidy. His research was aided by a living collection of

20 Dianella plants to assist in the collection of fresh plant material and the observation of morphological characters.

Henderson also identified taxonomic complexes that contained diploid, tetraploid, and hexaploid cytotypes. Henderson also recognised multivalents and univalents in meiosis and suggested many taxa are autopolyploids, which may contribute to reduced pollen fertility, and could explain why fruit did not contain seeds. Henderson concluded that pollen grains and stomatal characters did not correlate reliably with polyploidy. Interestingly, he recognised a unique morphological character in the D. longifolia complex: stomates only present on the leaf abaxial surface. Refer to Table 1.2 for a list of the chromosome counts of Dianella taxa.

Fig. 1.2. Key morphological characters of Dianella. (A) Inflorescence and fruit of D. caerulea var. cinerascens. (B) Extravaginal branching units of D. caerulea var. assera. (C) Tuberous roots of D. fruticans. (D) Typical flower of Dianella with bicoloured tepals, D. caerulea var. assera (Yarriabini NP). (E) A tuft of ciliate hairs at the apex of the tepals of D. caerulea var. assera. (F) Red sheaths and (G) Green sheaths of D. tasmanica. (H) Aboveground stem with leaves of D. incollata. (I) In situ D. caerulea variant Theresa Creek.

22 1.7 Global distribution and life history of Dianella In Australia, Dianella has diversified in a range of environments including grassland, heathland sclerophyll forest, subtropical to tropical rainforest and subalpine environments (Henderson 1987). In other parts of the world, Dianella commonly occurs in tropical to temperate latitudes (Clifford et al. 1998).

Fig. 1.3. The global distribution of Dianella represented in black; A is a close- up view of the Hawaiian Islands.

The proliferation and distribution of the genus is likely aided by the fleshy fruit, which is consumed by a diversity of bird species. Numerous authors have observed Dianella taxa occurring in sympatric association, for example in New Zealand and Australia (Henderson 1987a, Heenan & de Lange 2007, Duncan et al. 2004). Such associations may influence cross-pollination and thus the chance of hybridisation events, potentially triggering the onset of speciation over time. Duncan et al. (2004) recorded the flowering times of two sympatric Dianella in Australia, D. longifolia, and D. revoluta, to investigate reproductive ecology. Dianella longifolia produced flowers much later than D. revoluta with only one day of overlap between the two taxa. Duncan et al. (2004) also observed different native bee species pollinating each taxon, indicating the chance of cross-pollination between the two taxa to be unlikely, and that these sympatric species may be reproductively isolated.

23 Table 1.2. A list of the published chromosome counts of Dianella according to Curtis (1952), Carr (1978), Henderson (1987a), Hair (1942), Kaneko (1985), de Lange & Murray (2002, 2003), Skottsberg (1953) and Tanaka (1981). Continued over the page.

Taxon Chromosome Count (2n)

D. atraxis 16

D. adenanthera 64

D. bambusifolia 16

D. brevicaulis 16

D. brevipedunculata 16

D. caerulea var. assera 16

D. caerulea var. caerulea 32, 48

D. caerulea var. cinerascens 16

D. caerulea var. petasmatodes 32, 48

D. caerulea var. producta 32

D. caerulea var. protensa 48

D. caerulea var. vannata 16, 32, 48

D. congesta 16

D. crinoides 48

D. ensifolia 28, 40, 32, 34

D. intermedia 64

D. incollata 16

D. haematica 16

D. latissima 16

D. longifolia var. longifolia 30, 32, 48,

D. longifolia var. fragrans 48

24 Taxon Chromosome Count (2n)

D. longifolia var. grandis 16, 32

D. longifolia var. stenophylla 16

D. longifolia var. stupata 32, 48

D. longifolia var. surculosa 48

D. nigra 16

D. nervosa 32

D. odorata 16

D. pavopennacea var. pavopennacea 16

D. pavopennacea var. major 32

D. pavopennacea var. robusta 32, 48

D. porracea 16

D. prunina 16

D. rara 16

D. revoluta var. minor 32

D. revoluta var. revoluta 16, 32, 48

D. revoluta var. tenuis 16

D. revoluta var. vinosa 16

D. sandwicensis s.l. 32, 40, 70

D. tasmanica 16, 64, 76, 80, 84

25 1.8 Diversity and distribution of Dianella in Australia Throughout Australia, Dianella inhabits a diverse range of environments and substrates, commonly on sandstone and volcanics. The greatest species diversity occurs along the eastern seaboard of Australia (Henderson 1987). Distinctive morphological forms may represent adaptations to the varied environments available in this latitudinal gradient, many of which are recognised as species, occurring in isolated localities (Fig. 1.4).

1.8.1 Australian Dianella complexes Henderson (1987a) recognised four complexes in Australian Dianella, i.e. the D. longifolia, D. revoluta, D. caerulea and D. pavopennacea complexes. Some taxa not currently recognised in these complexes may also be associated with them. Molecular analysis may provide new insights into the relationships between these taxa and forms.

1.8.2 D. longifolia complex The D. longifolia complex occurs in dry environments, i.e., grasslands, woodlands and open forests in all mainland states and does not extend to Tasmania (Henderson 1987a, de Salas & Baker 2015). Dianella longifolia var. longifolia has the widest distributional range in the complex, occurring in all mainland states. The leaves are basal, quite soft and flexible; the plant habit is solitary. The D. longifolia complex has adapted to an arid environment with the development of fleshy fibrous and tuberous roots (Henderson 1987), which serve the function of water storage.

D. rara, D. tarda, D. porracea and D. amoena also have similar leaf morphology but are currently not in the complex. Carr & Horsfall (1995) suggested D. porracea and D. tarda belong in the D. longifolia complex based on morphology.

26 1.8.3 D. revoluta complex The D. revoluta complex typically occurs in grasslands, woodlands and open forest and less commonly in wet environments in all Australian states excluding the Northern Territory (Henderson 1987a). They can form discrete clumps to clonal colonies many metres wide. D. revoluta var. revoluta is widespread across the range of the complex and is commonly found in sympatric association with many other Dianella taxa.

1.8.4 D. caerulea complex The D. caerulea complex is a widespread group, common throughout the eastern seaboard of Australia. Its southern limit is East Gippsland, Victoria and it extends north to Cape York and New Guinea (Australia’s Virtual Herbarium, 2016). The group is composed of nine varieties that occur in dry to wet sclerophyll environments to subtropical/tropical rainforest. Dianella caerulea var. vannata is the only taxon to extend to New Guinea. According to Henderson (1987a) D. caerulea var. Theresa Creek could be a variety of D. serrulata, which is endemic to New Guinea (Australian Plant Census 2016). Dianella caerulea var. caerulea has the most southern range extending to eastern Victoria. The majority of the complex is commonly recognised by elongated aboveground stems with cauline leaves and some variants have extravaginal branching units; the plants form discrete clumps to clonal colonies many metres wide.

1.8.5 D. pavopennacea complex The D. pavopennacea complex is restricted to far-north Queensland in open eucalypt forest and woodlands, from south of Cooktown to Torres Strait Islands (Henderson 1987a). The complex is composed of three varieties, which have elongated aerial stems, cauline leaves and extravaginal branching units. Further research is required to investigate the morphological variation within the variants to determine their taxonomic status.

27 1.9 The regional biogeography of Australian Dianella The greatest species diversity occurs in Queensland with 32 taxa, that occur in a range of environments, rarely west of the Great Dividing Range (Henderson 1987a). As mentioned above, the D. pavopennacea complex occurs in open eucalypt forest and woodland environments in the Cape York bioregion. Dianella odorata also inhabits dry forest types in far-north Queensland and extends into Indonesia and New Guinea (Henderson 1987a). In the wet tropics region, D. atraxis R.J.F. Hend., D. caerulea var. Theresa Creek, D. caerulea var. assera and D. bambusifolia typically occur along margins of tropical rainforests. D. caerulea var. petasmatodes was observed in cloud forest on Mt Lewis (pers. comm. K.M.M), and in subtropical rainforest in the wet tropics bioregion in far-north Queensland, and dry sclerophyll environments south to the Macleay-McPherson Overlap bioregion. Other taxa in the D. caerulea complex also occur throughout eastern Queensland.

In drier forest types in the wet tropics, D. nervosa is mostly known around the Cairns area and is believed to extend to Blackdown Tableland (Henderson 1987a), whilst D. caerulea var. vannata occurs throughout Queensland and parts of Cape York in dry forest environments. Dianella incollata, a highly unusual species, first collected from Laura in Queensland (Henderson 1987a), occurs on sandstone outcrops and is listed as near threatened wildlife (Queensland Nature Conservation Act 1992) (Department of Environment and Heritage Protection 2016). Dianella congesta, a coastal taxon, commonly occurs on sand dunes and beach front communities south of the Tropic of Capricorn to south of Sydney, New South Wales (Henderson 1987a). According to Australia’s Virtual Herbarium (2016) collections are also recorded in Cape York. Dianella longifolia and D. revoluta varieties occur in sclerophyll forests and grasslands throughout Queensland but they decline north of Cairns (Henderson 1987a).

An interesting taxon is D. fruticans R.J.F.Hend., first collected in Carnarvon Gorge, occurs on sandstone outcrops in open eucalypt forest (Henderson 1991) and its distributional range was recently expanded, occurring near Rockhampton and Eungella. The northern limit of D. caerulea var. caerulea is south of Brisbane and it extends throughout New South Wales to eastern Victoria (Henderson 1987a). Dianella caerulea var. producta first described from the Glasshouse Mountains, occurs from south-eastern

28 Queensland and New South Wales in a variety of environments in drier forest communities Henderson (1987a).

Twenty-four taxa are recognised in New South Wales, and of those three are endemic to the region: D. prunina, in Sydney (NW to S) (Henderson 1987a), D. tenuissima is endemic to sandstone landscapes in the Blue Mountains region (Carr 2006), and D. caerulea var. cinerascens R.J.F.Hend. occurs in the Upper Hunter Valley and west to Wollar and north to near Werris Creek (Henderson 1987a). Taxa within the D. longifolia and D. revoluta complexes occur throughout New South Wales mostly in a range of drier sclerophyll environments. Dianella caerulea var. assera extends throughout the south- eastern seaboard of New South Wales, typically in rainforest communities. Dianella caerulea var. producta is common throughout New South Wales and parts of East Gippsland, Victoria (Currently this taxon is not formally recognised in Victoria (pers. comm. K.M.M). Dianella caerulea var. caerulea occurs in forest communities along the coast of NSW and extends into the Blue Mountains. Dianella tasmanica occurs in a range of environments, typically in wet sclerophyll forest throughout southern New South Wales to the Blue Mountains, and then north in Barrington Tops and in New England National Park (Henderson 1987a). East of Australia, D. intermedia occurs on Norfolk Island and Lord Howe Island. The taxon is said to occur in a range of environments in forest and coastal landscapes and grasslands (Green 1994).

Ten Dianella taxa are recognised in Victoria (Australian Plant Census 2016). These are mostly variants of D. longifolia and D. revoluta which are widespread in a variety of plant communities including grasslands, woodlands, and open forests. Dianella callicarpa is restricted to moist environments in western Victoria and South Australia (Carr & Horsfall 1995; Barker et al. 2005) and D. amoena is confined to dry forest types, mostly grasslands. It is Federally listed as Endangered in Victoria, and in Tasmania it is listed as Threatened and Rare (Australian Government, Department of the Environment 2016). Dianella tasmanica s.l. typically occurs in moist elevated forests (wet sclerophyll and subalpine forests) and is also known in coastal communities in East Gippsland and heathland communities in western Victoria. The southern limit of D. caerulea var. caerulea is in East Gippsland to the outskirts of Melbourne. According to the Australian Plant Census (2016), numerous entities of D. longifolia and D. revoluta require further taxonomic investigation.

29 Four Dianella taxa occur in Tasmania: D. amoena, D. revoluta var. revoluta, D. tasmanica, and D. brevicaulis (de Salas & Baker 2015). Most taxa are restricted to forest landscapes and drier forest types and are absent from subalpine plant communities. Dianella brevicaulis is mostly restricted to coastal landscapes.

Fig. 1.4. The Australian distribution of Dianella from Australia’s Virtual Herbarium (2016), overlaid with a climatic map and distribution data.

In South Australia (SA) seven taxa occur in the region (Barker et al. 2005) in open forests, woodlands, grasslands, mallee and coastal communities. These taxa are D. tarda (listed as Endangered in SA), D. revoluta var. divaricata, D. revoluta var. revoluta, D. brevicaulis, D. longifolia var. grandis R.J.F. Hend. (Rare status in SA), D. porracea (R.J.F. Hend.) P.F. Horsfall & G.W. Carr (Vulnerable in SA) and D. callicarpa (Endangered status in South Australia).

In Western Australia, four taxa are known, three of which occur in the south-west bioregion of Western Australia. Dianella brevicaulis inhabits a broad distributional range, in coastal and forest environments of the south-west. Dianella revoluta var.

30 revoluta is also broadly distributed throughout sclerophyll forest communities and D. revoluta var. divaricata occurs in mallee vegetation and in the sand belt region, extending inland in forest landscapes. Dianella longifolia var. longifolia is the only taxon in the complex to occur in north Western Australia, in the Kimberley bioregion (Australia’s Virtual Herbarium 2016).

In northern Australia, two Dianella taxa are recognised in the Northern Territory. Both are widespread and occur in Queensland and Western Australia (see above). D. longifolia var. longifolia inhabits open eucalypt forests and D. odorata is commonly found in tropical eucalypt woodlands, forests, and open sandstone terrain (Henderson 1987a).

1.10 Origin of the genus Dianella The Gondwanan origin of major monocot groups was investigated by Bremer & Janssen (2006) using dispersal-vicariance analysis. The order Asparagales was strongly linked to South Gondwana, composed of South America, Antarctica, and Australasia. They concluded the flora within the order Asparagales was Australasian in origin due to the many groups occurring in the region. Wurdack & Dorr (2009) also agreed with this concept, however, they were uncertain regarding the route of dispersal of subfamily Hemerocallidoideae into South America for Pasithea and Eccremis. They speculated two scenarios: (1) the dispersal of genera from Australia to South America by island hopping or (2) overland migration via the South Gondwanan connection (South America and Australia connected by Antarctica). In relation to Dianella, they proposed the development of fleshy fruit, which is ingested by birds, likely assisted in the proliferation and colonisation of the genus throughout Australia, the Pacific and other parts of the world. The fruit of most other genera in the subfamily are dispersed by wind, in particular Eccremis, which has capsular fruit, with only a thin fleshy covering that dehisces at the apex. They hypothesise that wind is the likely form of dispersal for Eccremis (Wurdack & Dorr 2009), which may have resulted in the genus being confined to South America. For Dianella, Carr (2007a) hypothesised the genus originated in Australia and radiated from Gondwanan rainforest stock, diversifying into other environments, most likely during the Tertiary (Paleogene and Neogene) and Quaternary periods.

31 1.11 Fossil evidence The use of plant fossils in plant systematics can assist in estimating the age of a genus, its diversification and evolution over time (Crane et al. 2004). Two Dianella fossils were discovered. The first fossil is described as D. ensifolia, excavated from Pagan island, south-south-east of Tokyo, Japan (Fosberg & Corwin 1958). It was found in pyroclastic deposits estimated to be of late Quaternary age. The second fossil was discovered at Nelly Creek near Lake Eyre, Central Australia and was dated from the Eocene period 50-35 Mya (McLoughlin 2001), associated with sclerophyllous vegetation (Conran et al. 2008). The fossil is believed to be a close relative of Dianella based on similarities in the spacing of primary and secondary leaf venation when compared to extant species D. odorata and D. bambusifolia. Based on this evidence, the fossil was described as the new genus Dianellophyllum Conran, Christophel & Cunningham, and a new species Dianellophyllum eocenicum Conran Christophel & Cunningham (Conran et al. 2008).

Can˜ellas-Bolta et al. (2014) undertook a palaeoecological study on Easter Island. Sediment cores were retrieved from the bottom of a volcanic crater known as Rano Raraku, which is today filled with water (2–3m), known as Lake Raraku, estimated to be more than 300,000 years old. Dianella seed and pollen were found from 7 to 1.5 m deep in the sediments and this is the first evidence to confirm that Dianella inhabited Easter Island. The authors speculate its presence is likely in the mid-Holocene, which was a moist and dry period. Today, Easter Island is mostly cleared of native vegetation and this is the first study to document Dianella seed in sediment cores and to suggest the seed can be preserved for such a long period of time. This study has also extended the distributional range of Dianella in the Pacific, the closest locality to South America.

32 1.12 Research objectives

• To create a phylogeny of Dianella and closely related genera using selected cpDNA and nrDNA markers.

• To test the monophyly of the current infrageneric complexes recognised in Australia.

• To test the validity of taxa described with morphology alone, and entities not currently described.

• To research the Australian and extra-Australian biogeographical relationships of the genus.

• To investigate the infraspecific relationships of taxa in the D. caerulea complex, according to the phylogeny, by a morphometric study on selected clades.

• To investigate the interspecific relationships of Hawaiian Dianella utilising morphometric and molecular studies.

33 Chapter 2: General methodology

2.1 Chapter Aims This chapter introduces the methods used to collect, extract, amplify and generate chloroplast (cpDNA) and nuclear ribosomal (nrDNA) sequences of Dianella and closely related genera. The steps used to analyse the datasets and the parameters used in the analyses are presented. Particular methods relevant to each genome are included in chapters 3, 4 and 5.

2.2 Sample Collections Plant samples and associated voucher specimens were predominately made from wild plants (by various collectors - see Appendix A): in Australia, New Guinea, Taiwan, Japan, Brunei, Malaysia, New Caledonia, Hawaii, Mauritius, Caroline Islands and Bangladesh. The remaining DNA samples were sourced from herbarium specimens, including vouchers representative of mainland Australia, Madagascar, New Zealand, Lord Howe Island and Norfolk Island. A total of 125 accessions of Dianella taxa and four outgroup genera, i.e. Stypandra, Thelionema, Herpolirion and Eccremis (10 terminals), were included in the molecular phylogenetic analyses (Fig. 2.1 and Appendices A-E). However, not all accessions were successfully sequenced for both cpDNA and nrDNA (see Chapters 3, 4 and 5 for the final number of accessions in each separate analysis).

All Australian taxa were included in the combined cpDNA-nrDNA phylogeny except for Dianella longifolia var. fragrans. The phylogenies also included eight non- Australian Dianella species and three putative taxa: D. adenanthera (New Caledonia); D. nigra, D. haematica, D. latissima (New Zealand); D. serrulata (New Guinea); D. sandwicensis, D. lavarum, D. multipedicellata and D. sp. aff. lavarum (Hawaiian Islands); D. carolinensis (Caroline Islands) and D. ensifolia (Bangladesh, Brunei, Madagascar, Mauritius, Taiwan and Yonaguni Island (part of the Ryukyu Islands) and Orchid Island (Taiwan). Refer to Figure 2.1 to examine a global map illustrated with the samples used in this study. Six extra-Australian Dianella species were not included in the phylogenetic analyses due to difficulties in obtaining plant material: D. saffordiana from the island of Guam (north

34 of New Guinea) and five species, D. acutifolia, D. daenikeri, D. pendula, D. plicata and D. stipitata from New Caledonia. For a full list of the samples used in this study refer to Appendix A. Multiple samples of some Dianella taxa were sequenced as well as individuals collected in the field with unusual morphological characters. The latter were included to clarify their placement within the genus.

Plant material was used from the following herbaria for destructive sampling or fresh plant material dried in silica: National Herbarium of New South Wales (NSW), Queensland Herbarium (BRI), Australian Tropical Herbarium (CNS), Australian National Herbarium (CANB), State Herbarium of South Australia (AD), Northern Territory Herbarium (DNA), Western Australian Herbarium (PERTH), Tasmanian Herbarium (HO), National Tropical Botanical Garden Kauai (PTBG), National Museum of Nature and Science, Japan (TNS), Bangladesh National Herbarium (DACB), Auckland Museum (AK), Missouri Botanical Garden (MO) and Universidad Central de Venezuela (MYF).

2.3 Identification of taxa As indicated above, the majority of Australian Dianella samples were collected in the field, and in many cases samples were from type localities. A living Dianella collection was housed in a glasshouse at The University of Melbourne, which assisted in obtaining plant material for sequencing and observing morphological differences among plants in various “species complexes”. For the D. caerulea complex, the living collection included plants of D. caerulea var. Theresa Creek (W.G. Trapnell 269) from the type locality (Theresa Creek Rd, Milla Milla, Cairns) and from other locations in the Wet Tropics, Cairns, Queensland. D. caerulea var. Theresa Creek (W.G. Trapnell 269) produced inflorescences and flowers, which provided the first documented observations; prior to this, no records were known of flowers and inflorescences from herbarium specimens.

Fig. 2.1. A global map illustrating in red the localities of Dianella samples and outgroup genera used in the molecular phylogeny for Chapters 3, 4 and 5. Figure A is a close-up view of the Dianella samples sourced from the Hawaiian Islands.

All taxa in this study were identified by the author. The examination of herbarium specimens, photographs of plants in situ and taxonomic literature aided in the delimitation of taxa in this study. Forms of Dianella with distinct morphological characters were given an informal phrase name to differentiate the entity from other taxa in the study. The Hawaiian specimens in this study were identified in accordance with Degener (1932).

2.4 Selection of cpDNA and nrDNA markers The chosen chloroplast markers were trnQUUG–5'rps16, 3'rps16–5'trnK(UUU) and rpl14– rps8–infA–rpl36. These were amplified using the primers described by Shaw et al. (2007). Additional internal primers were designed for rpl14-rps8-infA-rpl36 and trnQUUG-5'rps16 (Refer to Tables 3.1 & 3.2).

Two nrDNA markers were utilised: the Internal Transcribed Spacers (ITS), amplified using the primers ITS 4 and ITS 5 (White et al. 1990); and the External Transcribed Spacer (ETS), amplified using the primers 18SE-ETS (Baldwin and Markos 1998) and a newly designed primer DIAN-ETS (Refer to Table 4.1).

2.5 DNA extraction, amplification and sequencing Total DNA was extracted from silica-dried leaf material sourced from field collections, the glasshouse living collection (The University of Melbourne) and herbarium specimens. Leaf tissue was ground with a pestle and mortar. The DNeasy Plant Mini Kit (QIAGEN) was used to extract DNA from 20–25 mg of leaf material, following the manufacturer’s instructions. The CTAB method (Shepherd & McLay 2011) was also used to extract DNA from some samples, particularly from older herbarium specimens. Approximately 50–100 mg of dried leaf material was used for the CTAB method. A (QIAGEN) QIAamp DNA Stool Mini Kit was used to extract DNA from herbarium specimens that had been doused in alcohol.

Multiple copies of DNA were amplified using the Polymerase Chain Reaction (PCR) performed in a MyCyclerTM Thermocycler (Bio-Rad Laboratories, Gladesville, NSW, Australia). A standard PCR recipe was followed to amplify chloroplast DNA, using a total volume of 25 µl for each sample. The PCR recipe contained 0.125 µl of My Taq DNA Polymerase (Bioline, Australia), 1µl of each primer, 2.0 µl of extracted DNA, 5.0

µl of 5 × Buffer, 2.0 µl of Magnesium Chloride (MgCl2) and 13.875 µl of ultrapure water. The amplification of nrDNA also used a total volume of 25 µl for each sample. The PCR recipe contained 13.5 µl ultrapure water, 2.5 µl 10 × PCR Buffer, 1.0 µl of each primer, dNTPS 2.0 µl, 1.0 µl Ghetto Taq (Pluthero FG 1993), 2.0 µl of extracted DNA and 2.0 µl of Dimethyl sulfoxide (DMSO).

The thermocycling conditions were standard for all chloroplast markers. The cycle began with an initial denaturation step of 95°C for 5 minutes, followed by 30 cycles of 95°C for 1 minute, 50°C for 1 minute, 65°C for 4 minutes and a final extension time of 65°C for 5 minutes. For the amplification of nrDNA, a standard PCR protocol was also used, i.e. 95°C for 5 minutes, followed by 30 cycles of 94°C for 1 minute, 50°C, for 1 minute, 72°C, and a final extension time of 72°C for 10 minutes.

The concentration and length of the DNA fragments produced by PCR were determined using the gel electrophoresis process. The PCR products were placed in 5 µl aliquots and mixed with 1µl loading dye and loaded onto a 1.5% agarose gel (in 0.1 TBE buffer) and stained with ethidium bromide. DNA ladders, Easyladder and Hyperladder (Bioline), were loaded in the gel and the brightness of bands was compared to estimate fragment length and DNA concentrations. The QIAquick PCR Purification Kit (QIAGEN) purified the PCR products and they were quantified on a Nanodrop 2000 UV-Vis Spectrophotometer (Thermo-Scientific). Some PCR products were also purified with ExoSAP-IT (Affymetrix). Prior to the purification of these samples, the brightness of bands was examined on a gel and compared to a DNA ladder to estimate DNA length and quantity. The amount of EXOSAP-IT (Affymetrix) digest was calculated for each sample. Purified DNA was sequenced in both directions by Australian Genome Research Facility (AGRF), Melbourne branch, using an ABI 3730xl 96 capillary automated DNA sequencher.

2.6 Phylogenetic analyses DNA chromatograms were edited using Sequencher V 4.9 (Gene Codes Corporation, Ann Arbor, MI, USA) and Geneious V 7 (Kearse et al. 2012). Sequences generated for each marker were manually aligned in Geneious. Indels were coded for analysis according to Simmons & Ochoterena (2000) using the Simple Indel Coding method. All indels were represented by a single character, and this was implemented in Seqstate 1.4 (Muller 2005). 38

Maximum parsimony (MP) analyses were performed using PAUP* 4.0 B 10 (Swofford 2001) using heuristic tree searches on unweighted characters with tree bisection and reconnection (TBR) branch swapping. The accelerated transformation (ACCTRAN) branch length optimisation was also used in searches. The maximum number of trees (Maxtrees) saved was set to 100,000. The number of rearrangements (per addition- sequence replicate) was limited to 10,000,000. After the completion of the heuristic searches, Strict Consensus trees were constructed from equally parsimonious trees of shortest length. Bootstrap analyses (BS), using "full heuristic" tree searches for 1,000 bootstrap replicates, provided a measure of support for clades. Within each bootstrap replicate, the number of rearrangements was set to 10,000,000. Trees were rooted with ten accessions belonging to the outgroup genera Stypandra, Thelionema, Herpolirion and Eccremis.

Each marker was firstly analysed individually using heuristic tree searches and bootstrap analyses. The resulting phylogenies were found to be congruent for both genomes (cpDNA and nrDNA), so the data matrices were concatenated, using Geneious V7 (Kearse et al. 2012), into one large alignment and further MP analyses were performed. The results of each analysis, i.e. cpDNA, nrDNA phylogeny and combined cpDNA and nrDNA phylogeny, are discussed in Chapter 3, 4 and 5.

Data was also analysed using Bayesian Inference (BI) in MrBayes v.3.1.2 (Ronquist & Huelsenbeck 2003). Mr Model Test (version 2) was used to assess the best substitution model for each marker under the Corrected Akaike Information Criterion (AIC). The models selected for BI analyses were: trnQUUG–rps16 (GTR+I+G), rps16–trnKUUU (GTR+G), rpl14–rpl36 (GTR+G), ITS (GTR+1+G), and ETS (GTR+G). Indels were analysed using the standard binary (restriction) setting in MrBayes. Parameters were unlinked between partitions and each included two runs of four chains with each run for 40,000,000 generations and the burn in fraction set at 0.25. The sample frequency was set to 1,000. The standard deviations of split frequencies for all individual analyses were <0.05 at completion of runs. The Bayesian analyses were compared with the MP analyses and are reported in Chapters 3, 4 and 5.

Chapter 3: Chloroplast DNA phylogeny

3.1 Introduction The discovery of protein-coding DNA within the chloroplast organelle (cpDNA), and its application in plant systematics, created a new impetus in elucidating evolutionary relationships between plants at all taxonomic levels. Prior to such advancements, researchers relied on ‘morphologic, cytologic, biochemical, and ecologic traits’ (Hamby & Zimmer 1992) to delimit species and other plant groups.

An endosymbiotic event occurred about 600 Mya that resulted in the evolution of the green chloroplast organelle. This resulted in the fusion of two lineages: one cyanobacterium and one eukaryote (McFadden & Dooren 2004). CpDNA in plants is uniparentally inherited, haploid, and nonrecombining (Mort et al. 2007). It is a circular molecule with multiple genomes and composed of noncoding regions, intergenic spacers and coding gene regions (Small et al. 2004). In plants, the genome size can range from 120-170kb (Shaw et al. 2007) with approximately 120 genes (Sugiura 1992). A common feature in cpDNA is the inverted repeat, which can vary in land plants from 6- 76 kb (Palmer 1985) and is absent in some plant groups. It is hypothesised the inverted repeat was present in a common ancestor of all land plants, but was lost during evolution in some groups (Palmer 1985).

The comparison of homologous sequences is the direct method to detect evolutionary relationships used in molecular phylogenetics. Mutations in cpDNA, particularly in the intergeneric spacer, are point mutations, rearrangements and indels. These changes may indicate patterns of diversification and evolution (Clegg & Zurawski 1992). Inversions, loop mutations and pseudogenes may also occur and require careful analysis (Downie & Palmer 1992) for phylogenetic inference.

Functional regions such as genes are commonly more conserved when compared to non- functional regions, which are more diverse (Zurawski et al. 1987). According to Clegg & Zurawski (1992), chloroplast protein-coding genes evolved at a lower rate of nucleotide substitution (Wolfe et al. 1987, 1988) than nuclear DNA. Therefore, a conservative rate of evolution may be evident in some chloroplast regions and may result in a deeper level of phylogenetic resolution. An example of this is the rbcL gene, which

has been used extensively to test higher-level and intrafamilial relationships (Chase et al. 1995a, 1995b). The intergeneric spacer regions of cpDNA show a higher rate of nucleotide substitution compared to the functioning gene regions and are targeted in evolutionary studies at many taxonomic levels including intraspecific relationships (Shaw et al. 2014). Some plant groups diversified rapidly or are recently derived, and in some cases cpDNA alone can be insufficient to detect suitable variation due to a lack of variability between samples, making phylogenetic resolution difficult (Mort et al. 2007).

The structural stability of the chloroplast genome has enabled various universal primers to be developed. Shaw et al. (2005, 2007) designed PCR primers to amplify non-coding cpDNA used by researchers worldwide. A recent review of the literature by Shaw et al. (2014) investigated the most variable cpDNA regions across angiosperm lineages. These authors report that the region trnQUUG-rps16 is one of eight sets of highly used regions. They did not detect any pattern for which markers resulted in the most informative (variable) sequences. Therefore, the screening of chloroplast markers is required for all phylogenetic studies (Shaw et al. 2014).

In relation to the petaloid monocots, particularly the family Asphodelaceae, multiple chloroplast regions were used to investigate phylogenetic relationships at the family to genus level (APG 2016, Wurdack & Dorr 2009, Devey et al. 2006). However, of the twenty genera in the subfamily Hemerocallidoideae, very few infrageneric phylogenetic studies have been reported. There is no published comprehensive analysis of Dianella, which has the widest distributional range of any genus in the subfamily. A phylogenetic study of Dianella may provide the first insight into the evolution and radiation of the genus across its global range.

3.1.1 Chapter aims This chapter aims to resolve the phylogeny of Dianella using three cpDNA noncoding regions. The primary objective is to identify clades within the genus across its entire geographic range, but with an Australian focus. The infrageneric and intraspecific relationships are examined, highlighting biogeographic patterns and evidence of species radiation. The current taxonomy is compared to the topology of the phylogenetic tree and the implications are discussed.

3.2 Methods

3.2.1 Marker selection Scientific papers were reviewed to identify markers and PCR primers used in closely related genera, at the subfamilial and order level, e.g. Hemerocallis, Bulbine, Lomandra and Thysanothus (Noguchi & De-yuan 2004, Noguchi, Hong & Grant 2004, Sirisena 2010 & Donnon 2009). This resulted in a number of chloroplast markers being screened for sufficient polymorphic variation; additional markers were also trialled from Shaw et al. (2007). The chloroplast markers screened were: rpoB-trnCGCA, trnH-psbA (Shaw et al. 2005), rpl32trnL(UAG), ndhF-rpl32, psbD-trnT(GGU), petL-psbE, psaI-accD, trnS-trnG-trnG, trnV-ndhC, psbJ-petA, psba-trnH (Shaw et al. 2007), trnL-F (Taberlet et al. 1991) and rbcL-atpB (Terachi 1993). As discussed in Chapter 2, the chosen chloroplast markers for this study were trnQUUG-rps16 (1400 bp), rps16-trnK(UUU) (1400 bp) and rpl14-rps8-infA-rpl36 (700bp) (Shaw et al. 2007) (Table 3.1).

Table 3.1. Chloroplast forward and reverse primers used in this study (from Shaw et al. 2007).

Primer Sequence 5'–3'

trnQUUG GCGTGGCCAAGYGGTAAGGC

rpS16 x1 GTTGCTTTYTACCACATCGTTT

rpl14 AAGGAAATCCAAAAGGAACTCG

rpl36 GGRTTGGAACAAATTACTATAATTCG

rps16 x 2F2 AAAGTGGGTTTTTATGATCC

trnK(UUU) x 1 TTAAAAGCCGAGTACTCTACC

Additional internal primers were designed for the markers rpl14-rps8-infA-rpl36 and trnQUUG-rps16 (Shaw et al. 2007). This enabled smaller DNA fragments to be amplified, sequenced and aligned, and in most cases allowed the development of an entire sequence for each marker (Table 3.2).

Table 3.2. Newly designed internal primers for rpl14-rpl36 and trnQUUG-rps16.

Primer Sequence 5'–3'

trnQ-950F FTTAACTATCCRCGATTCYCC

trnQ-1450F FGACCTTTTCGAKTCATCAGCTT

trnQ-950-R GGRGAATCGYGGATAGTTAA

trnQ-1450R RAAGCTGATGAMTCGAAAAGGTC

trnQ-950F GGCTTCTCACAAACGTAATGG

trnQ-950R ATTTTGCTCCGGAATTGGA

trnQ-950R2 TCCCAATTCCACATTTTATTTG

rpl14-36 INT740F CTAGTCCTTCTATGTCGTAAG

rpl14-36 INTR590F TAGTCTAGCTTCTCGATCTGTC

rpl14-36 INTR740R CTTACGACATAGAAGGACTAG

3.2.2 Accessions and analyses A total of 124 accessions were successfully sequenced for the phylogenetic analyses. Dianella longifolia var. grandis (Mt Marlay, Queensland), voucher held at The University of Melbourne Herbarium was excluded due to difficulties with amplification and producing clean sequences. Data for D. longifolia var. longifolia (Northern Territory D0147042) is absent for the marker rpl14-rps8-infA-rpl36 also due to amplification and sequencing difficulties. Some Dianella samples were difficult to

amplify for trnQUUG-rps16 and this resulted in partial sequences for D. ensifolia (Malaysia NSW425409) and D. ensifolia (Bangladesh DACB 36699). The combined cpDNA alignment, including the outgroup genera, was analysed using Maximum Parsimony and Bayesian analyses (refer to section 2.6).

3.3 Results

3.3.1 Informativeness of cpDNA A combined cpDNA analysis was conducted using three cpDNA regions plus the coded indels. The resultant data matrix contained a total of 4100 characters (3791 aligned DNA characters and 309 coded indels). This combined cpDNA dataset contained 518 parsimony informative characters. The PM analysis produced 79,960 most parsimonious trees each with a tree length of 1083 steps (Table 3.3). At the end of BI analyses, the average standard deviation split frequencies was 0.003. The Bayesian Inference analysis (BI) produced a phylogram with a negative log likelihood of -13305.83 (Fig. 3.1). These data provided a high-level of resolution and structure to the tree topology.

The topology of the strict consensus tree from the Maximum Parsimony (MP) analysis and the topology of the tree from the BI analysis were the same (Fig. 3.1). Sixty-four nodes had low bootstrap support (BS values ≥ 50%), 31 nodes had moderate to high bootstrap support (BS values ≥ 80%) and 57 nodes had high posterior probability (PP) values (PP ≥ 0.95). However, some nodes that had PP support lacked BS support, particularly the ‘backbone’ nodes within Dianella. There were no major conflicts between the nodes when the BS and PP were compared to each other. Statistics of the MP analyses are shown in Table 3.3.

Table 3.3. Statistics from MP analysis of the concatinated cpDNA dataset for Dianella.

Parameter cpDNA

Total characters in the dataset 4,100

Total variable characters 857

Parsimony informative characters 518

Number of informative Indels 174

Number of equally most parsimonious trees 79,960

Tree length 1083

Consistency Index (CI) 0.50

Retention Index (RI) 0.81

Homoplasy Index (HI) 0.50 44

Fig. 3.1. The Bayesian majority-rule consensus tree of combined chloroplast data. The high Bayesian posterior probabilities (PP 0.95 – 1.0) are shown in blue. All major clades are labelled from A–N, with their detailed structure and support values shown in subsequent figures.

3.3.2 Composition and distribution of clades 3.3.3 Outgroup genera Clade A (Fig. 3.2) is composed of Herpolirion and Thelionema, which are sister to the clade of Stypandra in clade B. H. novae-zelandiae is represented by two accessions from Victoria (Mt Baw Baw and Falls Creek) that clustered together with high support (node 9, PP 0.99, BS 91%). Of the three Thelionema species sampled, T. caespitosum (KMM189) from Cape Conran Victoria and T. umbellatum (KMM669) from Illawarra NSW form a clade with high support (node 10, PP 0.97, BS 72%). The position of T. grande from Girraween NP (KMM1060) QLD is unresolved as part of the polytomy in clade A.

Clade B (Fig. 3.2) contains three samples of the Australian genus Stypandra strongly supported as monophyletic (node 3, PP 1.00, BS 100%). The Western Australian species S. jamesii (from Wave Rock WA) is sister to two samples of S. glauca from New South Wales and Victoria (Durran Durra and Grampians) that clustered together with high support (node 11, PP 1.00, BS 100%).

Clade C (Fig. 3.2) is composed of two samples of Eccremis coarcata from Venezuela, South America with high support (node 4, PP 1.00, BS 100%).

3.3.4 Dianella The cpDNA phylogenetic tree (Fig. 3.1, 3.3) strongly supports the monophyly of Dianella (node 5, PP 1.00, BS 97%, Fig. 3.3). At node 12 (PP 1.00, BS 100%), all south-west Western Australian Dianella taxa and two samples from South Australia form clade D that is sister to the rest of Dianella (Fig. 3.3). Clade D includes samples attributed to D. revoluta var. divaricata and var. revoluta, D. brevicaulis and D. sp. aff. brevicaulis. None of these taxa are monophyletic based on the cpDNA results.

Clade E (Fig. 3.3, node 18) is composed of extra-Australian Dianella from New Guinea (D. serrulata and D. sp. aff. serrulata), Taiwan, Malaysia, Madagascar, Mauritius (D. ensifolia) and Caroline Islands (D. carolinensis) with high PP support (PP 1.00), but no BS support.

In clade E, two samples of D. sp. aff. serrulata (NSW841071 New Guinea) and D. serrulata (NSW870233 New Guinea) cluster with high support (node 19, PP 1.00, BS 99%) (Fig. 3.3). Node 20 includes two D. ensifolia samples from Sabah, Malaysia 47

(NSW425409) and Orchid Island, Taiwan (TNS9529075) (PP1.00, BS 97%). Node 22 includes D. carolinensis (PTBG054738) from Caroline Islands and D. serrulata (DGF Y8/Y34) from New Guinea, with PP support of 0.98 but with no BS support. Node 23 is a clade of two samples of D. ensifolia from Madagascar (MO6185727) and Mauritius (NTBG910308), which are affiliated biogeographically and morphologically with strong support (PP 1.00, BS 100%).

Clade F (node 24, PP 1.00, BS 100%) includes eight taxa of Dianella from far-north Queensland and the Northern Territory, Australia, and one sample of D. ensifolia from Brunei (CNS138344.1) (Fig. 3.4). Subclades within clade F were resolved with low to moderateto high support. Subclade at node 25 was weakly supported (PP 0.53) and subclade at node 30 was strongly supported (PP 1.00, BS 72%). The subclade at node 25 includes D. bambusifolia, D. atraxis, D. caerulea var. aquilona, D. incollata and D. pavopennacea var. major, all from Queensland. The subclade at node 30 contains all three samples of D. odorata from Queensland and the Northern Territory together with D. pavopennacea var. robusta and the one sample of D. ensifolia. Node 7 is a polytomy, including a number of clades (F-N) with varying levels of support (see Fig. 3.1).

Clade G (node 35, PP 1.00, BS 87%) is composed of seven species of Australian Dianella ranging geographically from South Australia, Tasmania, Victoria, New South Wales and Queensland to the Northern Territory (Fig. 3.5). There are three subclades (nodes 36, 38, 40) each with weak, moderate to high support, forming a polytomy. The subclade at node 36 (PP 0.77, BS 74%) supports the monophyly of D. fruticans from Queensland. The subclade at node 38 (PP 0.52, BS 66%) relates D. longifolia var. longifolia (DO147042) Northern Territory and two accessions of D. nervosa Queensland (node 39, PP 1.00, BS 94%). The other D. longifolia var. longifolia accessions from Northern Territory and Western Australia are in clade I. The third subclade at node 40 (PP 1.00, BS 80%) includes seven varieties of D. longifolia from South Australia and eastern Australia together with additional species that have morphological affinities to that complex, including D. crinoides (KMM75 Queensland), D. tarda (SA, Victoria), D. amoena (Tasmania and Victoria), and D. porracea (NSW484949 NSW). The complex of varieties of D. longifolia is not resolved as monophyletic, although three varieties from Queensland (varieties stenophylla, stupata and surculosa) form a well-supported lineage at node 48 (PP 1.00, BS 96%).

Clade H (Fig. 3.6, node 49) has a PP support value of 1 but lacks bootstrap support. It consists mostly of samples of D. caerulea var. caerulea, D. tasmanica (and spp. aff. tasmanica), D. revoluta, D. brevicaulis and D. callicarpa, from south-eastern Australia (South Australia, Tasmania, Victoria and New South Wales). Included also is D. intermedia from Lord Howe Island (NSW519675) on a relatively long branch, and oddly, and also with a longer branch length, a sample of D. ensifolia from Bangladesh (DACB36699). Except for nodes 51, 56, 59 and 63, most internal nodes are poorly supported.

Figure 3.7 shows node 8 which relates clades I to N with only very weak PP support of 0.83 (see Fig. 3.1). Node 8 is a polytomy and includes one accession of D. caerulea var. Theresa Creek from Queensland. Clade I (Fig. 3.7, node 66) and node 65 (Fig. 3.8) that leads to one sample of D. tenuissima and clades J, K, and L+M+N.

Figure 3.7 shows clade I (node 66, PP 1.00, BS 98%) as including D. longifolia var. longifolia from the Northern Territory and Kimberley, Western Australia, as a clade that is sister to a clade comprising D. sp. aff. nervosa and D. rara (PP 0.94). These northern Australia samples attributed to D. longifolia are clearly not related to those from South Australia (in clade G) and one sample of D. longifolia also in clade G.

Clade J (Fig. 3.8, node 70, PP 1.00, BS 73%) includes samples of three varieties of D. revoluta from Queensland and the only sample in this study of D. prunina from New South Wales. D. prunina (NSW759138) is nested within the samples of D. revoluta and is most closely related to D. revoluta var. vinosa (KMM1060 Queensland) at node 72, which has high support (PP 1.00, BS 96%). D. revoluta var. minor (Queensland) is sister to this clade (PP 0.97, BS 57%) with D. revoluta var. tenuis (KMM899 Queensland) in the basal position.

Clade K (Fig. 3.8, node 73) is composed of extra-Australian Dianella from New Caledonia, Norfolk Island, Hawaii, Taiwan and Japan. Although resolved in the consensus tree, the clade has weak support (PP 0.62). Four samples of D. ensifolia from Taiwan and Ryukyu Islands group together at node 75. Node 77 is composed of two D. ensifolia samples from Yonaguni Island (part of Ryukyu Islands) with significant support (PP 1.00, BS 80%). There is strong support at node 78 (PP 1.00, BS 69%) for a sister relationship between a clade (node 79, PP 0.99, BS 60%) of D. adenanthera and D. intermedia from New Caledonia and Norfolk Island respectively and a clade (node 81, PP 0.97, BS 69%) of D. sp. aff. lavarum (Oahu and Maui) and D. multipedicellata (Oahu) from Hawaii. The accession of D. sandwicensis also from Oahu is outside this group but part of clade K.

Clade L (node 83, Fig. 3.9) includes the only Queensland accession of D. brevipedunculata (KMM46 Queensland) with three further accessions of Hawaiian Dianella. However, this node 83 has insignificant support (PP 0.68) and the relationship is equivocal. In contrast, the next node (node 84, PP 1.00, BS 96%) that groups the samples from the Big Island of Hawaii is well supported, showing D. multipedicellata (KMM1026 Hawaii) as sister to the two samples of D. lavarum (KMM1023 Hawaii and KMM1025 Hawaii).

Clade M (Fig. 3.9, node 86, PP 1.00, BS 90%) relates a sample of D. sandwicensis Kauai, Hawaii to a strongly supported clade (node 87, PP 1.00, BS 99%) of all New Zealand Dianella species (D. haematica, D. latissima and D. nigra).

Clade N (Fig. 3.10, node 89) includes the majority of samples from the D. caerulea complex. Clade N is highly supported (PP 1.00, BS 88%) including 18 samples of D. caerulea ranging from Victoria to Queensland together with, and nested among them, the two samples of D. congesta.

Three other samples from the D. caerulea complex did not fall into clade N. D. caerulea var. aquilonia Somerset Cape York (Queensland) clustered with samples of other north Queensland taxa in clade F (node 28); D. sp. aff. caerulea var. Theresa Creek. (KMM545 Mt Lewis) was unresolved at the polytomy, node 7, Fig. 3.4; and D. caerulea var. Theresa Creek (KMM478, Mt Bartle Frere) was in an unresolved position at the polytomy of node 8 (Fig. 3.7). Internal nodes for clade N are not well supported, except for terminal nodes 94, 97 and 100, and thus the analysis does not reveal any distinct pattern within the D. caerulea complex.

Fig. 3.10. The Bayesian majority-rule consensus tree of combined chloroplast data for clade N. Bayesian posterior probabilities (PP) are shown above branches and bootstrap (BS) shown below. Nodes are numbered in grey.

3.4 Discussion

3.4.1 Overview Of the outgroups included, the cpDNA data set provided strong evidence for a relationship between the Australian genera Thelionema and Herpolirion. Herpolirion is a monotypic genus confined to alpine environments in New South Wales, Victoria, Tasmania and New Zealand. It is a small plant, reaching up to five centimetres in height (Hewson 1987). Thelionema is endemic to Australia and includes three species, plants of which are much taller and more erect, reaching heights of up to 125 cm (Thelionema grande, Henderson 1987c). Taxa in this genus occur throughout south-eastern Australia, with the northern limit in south-east Queensland (Australia’s Virtual Herbarium 2016); and occurs in a range of environments and altitudes, mostly forest communities (Henderson 1987c), extending to the fringes of subalpine woodland (pers. obs. MJ Bayly). Based on the cpDNA phylogeny Thelionema may or may not be monophyletic and one possibility, if Thelionema is not monophyletic, is that Thelionema could be merged into an expanded Herpolirion (the older of the two generic names). Thelionema and Herpolirion (from Australia) were examined from living plant material and herbarium specimens and this author observed no major morphological differences other than size. Herpolirion has a reduced inflorescence and the flowers of Herpolirion are quite large in comparison to the size of the plant, and this could be an adaptation to attract pollinators. More samples of Herpolirion from New South Wales, Tasmania and New Zealand, as well as additional molecular markers in a phylogenetic study may provide additional resolution and clarification of the relationships between these two genera.

Evidence was also strong for the monophyly of each of the genera Stypandra (Australia) and Eccremis (South America). Stypandra jamesii is restricted to a few localities in Western Australia (Hopper 1999) and is sister to S. glauca (Queensland, Western Australia, New South Wales, South Australia, Victoria), which is widespread. The monotypic Rhuacophila from south-east Asia and the Pacific was not included in this study; however, Devey et al. (2006) found it to be related to Stypandra with high bootstrap support. Examination of herbarium specimens and comparison of Stypandra in the field clearly shows morphological similarities between the two genera, as also recognised by Henderson (1991). Including sample

of Rhuacophila in a future phylogenetic study could provide further insight into the genus and its relationship to Stypandra.

Dianella is monophyletic, including a number of clades that reflect geographic distributions and or currently described taxa. On the other hand, the cpDNA data set provided limited resolution of the monophyly and relationships among some Dianella species and varieties, including species complexes.

3.4.2 Biogeographic patterns within Dianella Within Dianella, based on cpDNA, a clade (D) of Western Australia and South Australia taxa is the sister group to all other accessions. Deep divergences between south-west Western Australian clades are evident in other plant groups. The south- west botanical province is a region of high plant diversity and endemism in Australia (Burbidge 1960, Crisp et al. 1999, Hopper & Gioia 2014). Early studies by Burbidge (1960) found several genera with high levels of endemism in this region, patterns later confirmed in phylogenetic studies, e.g. east-west divergence in Eucalyptus (Ladiges et al. 2012) and Banksia (Mast & Givnish 2002). The south-west has been isolated at various times from the early Cenozoic, with marine introgression and also subsequent widespread drying in Central Australia c. 28-11 million years ago (Ma) (Truswell 1993). Given that the sister group to clade D includes not only Australian Dianella but taxa ranging from the Ryukyu Archipelago to the south-west Pacific and Indian Ocean, this basal divergence is likely to be a considerably old event in the early Cenozoic with subsequent range expansion of Dianella. This and other patterns are discussed further in Chapter 5.

Clade E includes Dianella samples from New Guinea, Malaysia, Taiwan, Mauritius, Madagascar and the Caroline Islands. In that clade, accessions of D. ensifolia fell into two subclades, each with strong support, the other relating accessions from Malaysia and Taiwan, another relating accessions from Madagascar and Mauritius (Fig. 3.3). Clade F is composed of far-north Queensland Dianella and one accession of D. ensifolia from Brunei. Clade G is composed of D. longifolia varieties and related taxa - ‘the longifolia complex’ - from eastern Australia, South Australia and one sample from the Northern Territory. Clade G also includes two species of

Dianella from far-north Queensland, D. nervosa and D. fruticans, both shown here to be monophyletic, but rather weak support for D. fruticans.

Clade H can be described as the D. revoluta – D. tasmanica group, from South Australia, Tasmania, Victoria and New South Wales, with two samples of D. caerulea var. caerulea as sister group. Clade H also includes the sample of D. intermedia from Lord Howe Island, which has geographic connections to eastern Australia as documented for other taxa (see chapter 5). Clade I is composed of Dianella from the D. longifolia complex from the Northern Territory and Kimberley of Western Australia, and two taxa from Queensland. Clade J represents D. revoluta taxa from Queensland but suggests that D. prunina from the Blue Mountains, New South Wales, is nested within it.

Although clades K and L lack significant support, some internal nodes show relationships of biogeographic interest that require further data and analysis. For example, samples from Taiwan are related to those from the Ryukyu Island group. The taxa from Hawaii show a number of relationships: within clade K, samples from Maui and Oahu are related to those from New Caledonia and Norfolk Island; the second group of samples from the big island of Hawaii are related to one another within Clade L; while the sample of D. sandwicensis from Kauai is related to a clade of all taxa sampled from New Zealand in clade L. Kauai is the oldest island (which emerged 5 Ma; Grigg 2012), which may indicate an estimated dispersal period between New Zealand and Kauai. These south-west Pacific biogeographic connections are discussed further in Chapter 5.

3.4.3 CpDNA phylogeny and species taxonomy Implications for taxonomy are discussed in Chapter 5 following the analysis of nrDNA (Chapter 4) in addition to combined analyses. It is possible that some of the phylogenetic patterns evident in the cpDNA data relate to hybridisation or chloroplast capture (Rieseberg & Soltis 1991; Arnold 1992; Gurushidze et al. 2010) reflecting geographic location rather than species phylogeny. Thus, the cpDNA results need to be compared with the nrDNA data analysis.

Suffice to say that in some cases, Dianella taxa represented by two or more samples form a clade in agreement with the current taxonomy, although with low to high 58

support. These are: D. atraxis, D. fruticans, D. nervosa, D. brevicaulis (Tasmania, SA, Victoria) and one putative taxon, D. lavarum (KMM1023 Hawaii, KMM1025 Hawaii).

Some taxa were resolved as either paraphyletic or polyphyletic and in conflict with current taxonomy. Samples of D. ensifolia fell into a number of different clades, suggesting this taxon includes different lineages and is in need of taxonomic revision (see section 3.15 below and Chapter 5 for a detailed discussion). The positions of some accessions of interest were also unresolved at polytomous nodes or were at nodes with no significant support and which collapsed in the MP analysis: for example, three accessions of D. serrulata or D. sp. aff. serrulata from New Guinea (Fig. 3.3, clade E); D. sp. aff. caerulea var. Theresa Creek Mt Lewis (KMM545) (Fig. 3.4, node 7) and D. caerulea var. Theresa Creek (KMM478) from Mt Bartle Frere, both far-north Queensland (Fig. 3.7, node 8); D. intermedia (NSW519675) from Lord Howe Island (Fig. 3.6, node 54); D. sandwicensis NT3190 from Oahu, Hawaii (Fig. 3.8, node 74); and D. brevipedunculata from Queensland is not supported as related to Hawaiian taxa although resolved in clade L (Fig. 3.9).

3.4.4 CpDNA phylogeny and D. revoluta complex The cpDNA phylogenetic tree clustered representatives of the D. revoluta complex in three clades (D, H, J). Clade D (PP 1.00, BS 100%) is sister to all Dianella in the phylogeny and includes samples identified as D. revoluta var. revoluta and var. divaricata from both the south-west Province of Western Australia and South Australia, and D. brevicaulis and D. sp. aff. brevicaulis restricted to Western Australia. None of these taxa (species or varieties) is monophyletic, and, furthermore, the branch lengths with clade D are not insignificant. Chromosome counts (Henderson 1987a, are analysed further in Chapter 5) for taxa in this clade include D. revoluta var. revoluta 2n=16 (diploid), 32 (tetraploid), 48 (hexaploid), and D. brevicaulis 2n=16 (diploid). Unfortunately, no counts are available for D. revoluta var. divaricata. Analysis of nuclear DNA data (Chapter 4) is essential to compare with the chloroplast DNA results but there is strong indication here for the need of taxonomic reassessment of Western Australian taxa in the D. revoluta complex. There may be a number of restricted endemics in Western Australia, with two examples in clade D (represented by D. sp. aff. brevicaulis (KMM1037) Stirling

Ranges and (KMM1038 Wave Rock). KMM1037 (Fig. 3.3, node 13) is sister to other Western Australia and two from South Australia Dianella (PP 0.98, BS 54%) and KMM1038 formed a clade with D. brevicaulis (KMM1036) from the Stirling Ranges (Fig. 3.3, node 16, PP 0.67, BS 73%). Further field work will be required to examine plants in situ and clarify the taxonomy of Western Australia Dianella.

In clade H (Fig. 3.6), node 55 includes accessions from southern and south-eastern Australia (South Australia, Tasmania, Victoria and New South Wales). Node 60 clusters three accessions of D. brevicaulis (from Tasmania, South Australia and Victoria) with low support (PP 0.88, BS 65%), nested within D. revoluta. Henderson (1987a) classified D. brevicaulis as D. revoluta var. brevicaulis, which Carr & Horsfall (1995) later reinstated as a species. Further analyses of morphological and nuclear DNA data are required to determine which taxa warrant recognition.

D. callicarpa (one sample) is nested within D. revoluta in clade H; it occurs in Victoria (Carr & Horsfall 1995) and South Australia (Australian Plant Census 2016) and has not previously been associated with the D. revoluta complex. Carr & Horsfall (1995) speculated that D. callicarpa may be part of the D. caerulea complex; however, the cpDNA phylogeny indicates it is more closely related to taxa in the D. revoluta complex. Other samples of D. revoluta that are geographically separated from those in the south and south-east are those from Queensland placed in clade J (Fig. 3.8). This clade also includes one sample of D. prunina, which is endemic to New South Wales (the W to SW parts of the Sydney region and the Upper Hunter) growing in eucalypt forest in sandy soil from c. 60 m to 1000 m altitude (Henderson 1987a). That taxon shares many morphological characters with the D. revoluta complex in the broad sense, including root, leaf and inflorescence characters. D. prunina is distinguished by the distinctive glaucous/purple colour of the leaves and seed morphology (Henderson 1987a). Anthers are lilac coloured, which is quite unusual for the genus and not typical of taxa in the D. revoluta complex. Seed morphology is unique, with an angular shape and testa minutely colliculate (Henderson 1987a). An examination of D. prunina specimens and living plants has provided sufficient evidence to accept the taxon as having morphological affinities with the D. revoluta complex, in particular inflorescence and flower morphology. The whole complex needs further taxonomic assessment and revision.

3.4.5 CpDNA phylogeny and D. caerulea complex Clade N (Fig. 3.10, node 89 with high support) supports the monophyly and recognition of the D. caerulea complex (Henderson 1987a) from eastern Australia (Victoria, New South Wales and Queensland). Two accessions of D. caerulea var. caerulea formed a subclade in clade H outside of clade N and show distinct morphological differences when compared to the rest of the D. caerulea complex. Dianella sp. aff. caerulea var. Theresa Creek (KMM545) Mt Lewis (Fig. 3.4) and D. caerulea var. Theresa Creek (KMM478) Mt Bartle Frere (Fig. 3.7) are also outside clade N, and D. caerulea var. aquilonia Somerset, Cape York (node 28) clustered in a far-north Queensland clade F (Fig. 3.4). These three accessions show morphological differences when compared to the rest of the D. caerulea complex.

Dianella congesta is part of the D. caerulea complex which clustered in clade N with D. caerulea var. cinerascens and var. assera (Fig. 3.10). Henderson (1987a) also agreed that D. congesta is most closely related to variants in the D. caerulea complex. Dianella caerulea var. assera and D. congesta both occur in coastal plant communities in New South Wales and Queensland and were observed in sympatric association at different localities (pers. obs. K.M.M). D. congesta is commonly found on the edges of beaches and in sand communities (Henderson 1987a). The morphology of D. congesta is most similar to D. caerulea varieties that lack extravaginal branching, i.e. D. caerulea var. petasmatodes, D. caerulea var. vannata, D. caerulea var. protensa and D. caerulea var. aquilonia. Some of the key characters that define D. congesta are the absence of extravaginal branching units, the nearly complete absence of denticles along the leaf margins, midrib, and a unique raceme which has reduced branching units and is decurved at the apex. Caution is required in the interpretation of results because a number of these nodes within clade N are not well supported and may be spurious. However, ‘absences’ may well prove to be plesiomorphic.

Hybridisation between taxa from similar environments and geographic localities may have resulted in some of the incongruent patterns in the cpDNA phylogeny. For example, D. caerulea var. assera (KMM48) Bunya Mountains, Queensland and D. caerulea var. petasmatodes (KMM858) Bulburin NP, Queensland were related at node 97 (clade N, Fig. 3.10). The taxa are morphologically distinct from each other

but can occur in sympatric association in subtropical to tropical rainforests throughout northern New South Wales and Queensland (pers. obs. K.M.M). Although the specimens used in the phylogenetic analysis were collected approximately 265 km apart, prior to land clearance a continuous vegetated landscape existed between the two localities and gene exchange may have occurred between populations. Likewise, D. caerulea var. assera from Illawarra, New South Wales, and D. caerulea var. cinerascens from Kurri Kurri, New South Wales, are sister taxa (node 98) although with low support (PP 0.83, BS 57%). Both taxa occur in forest environments at the southern and northern ends respectively of the Sydney region and are morphologically quite different from each other.

Dianella caerulea var. aquilonia (clade F, Fig. 3.4) clustered with far-north Queensland taxa. Examination of a living plant and herbarium specimens indicates similarities in leaf and pedicel morphology to D. caerulea var. vannata and D. caerulea var. petasmatodes. The habit of D. caerulea var. aquilonia and var. vannata is typically a discrete clump whilst var. petasmatodes forms clonal colonies, up to many metres wide. The raceme of var. aquilonia is quite narrow in diameter; the number of branching orders and pedicels per branching unit may provide additional characters to delimit the taxon. The seed shape is angular with a raised ridge in the centre, similar to D. sandwicensis (see Chapt. 6 Fig. 6.6A), which is quite distinctive when compared to taxa in the D. caerulea complex (clade N).

Recorded chromosome counts for taxa in the D. caerulea complex indicate a range of polyploids, e.g. diploids D. caerulea var. assera 2n=16, D. caerulea var. cinerascens 2n=16; tetraploids and hexaploids D. caerulea var. caerulea 2n=32, 48, D. caerulea var. producta 2n=32, D. caerulea var. petasmatodes 2n=32, 48, D. caerulea var. protensa 2n=48 and D. caerulea var. vannata (2n=16, 2n=32, 2n=48) (Henderson 1987a). Interestingly in clade N, node 99 (although only PP 0.64) clusters presumed polyploids and node 100 strongly supports (PP 1 BS 90%) the two polyploids var. producta and protensa as sister taxa (Fig. 3.10). Chromosome numbers are assessed further in Chapter 5 based on the combined nrDNA and cpDNA phylogeny.

3.4.6 CpDNA phylogeny and D. longifolia complex The majority of accessions representing the D. longifolia complex are in clade G (Fig. 3.5 node 40, PP 1.00, BS 80%) from eastern Australia, South Australia and Northern Territory). Also in clade G are Dianella species with morphological affinities to the complex, based on leaf, flower and inflorescence morphology. These species are D. crinoides, D. tarda, D. porracea, D. amoena, D. fruticans and D. nervosa.

Within the clade at node 40, four subclades received some PP and BS support, i.e. nodes 42, 44, 46 and 48. Node 42 (PP 1.00, BS 70%) related D. amoena (Tasmania) and D. porracea (New South Wales). Three varieties of D. longifolia from Queensland have virtually identical sequences and clustered at node 48 (PP1.00, BS 96%); sister to these varieties is D. crinoides, the only other taxon from Queensland in the D. longifolia complex (node 47, PP 0.89, BS 70%).

Samples grouped in clade G to the longifolia complex are D. fruticans (monophyletic, node 36) and D. nervosa (monophyletic, node 39) both from Queensland. D. nervosa inhabits open eucalypt forest in northern Queensland and is distinguished by a closed leaf sheath, prominent nerves along the leaf surface and a reduced inflorescence (Henderson 1987a). When compared to other taxa in the D. longifolia complex, it does share similarities in flower morphology, particularly a kinked filament and quite a long anther. The leaves of taxa in clade G have a smooth surface and are soft and flexible, while the leaves of D. nervosa are thick and rigid. Observing the micromorphology of taxa in clade G by leaf cross-sections may provide additional morphological differences. Henderson (1977b) observed stomates only on the undersurface of D. longifolia taxa, which is unusual for the genus, as he reported other taxa have stomates on both surfaces.

Dianella fruticans was first described from Carnarvon Gorge, Queensland, on rocky sandstone outcrops in open eucalypt forest (Henderson 1991). It is a morphologically distinct taxon with a unique combination of characters, i.e. above-ground stems with cauline leaves and tuberous roots (Chapter 1, Fig. 1.2C) and an open leaf occlusion. The taxon resembles Stypandra in leaf and stem morphology (Henderson 1991). In recent years, two disjunct populations were discovered near Rockhampton and Eungella, Queensland and are included in this phylogeny. Further taxonomic

research is required to determine if the Rockhampton population (sample KMM1019 QLD), resolved here as sister to the other accessions (but with low support), could be recognised as a subspecies sister to Carnarvon Gorge and Eungella (node 37 samples AQ611721 and AQ679815 QLD) (Fig. 3.5).

The other samples of D. longifolia var. longifolia clustered in clade I and were all from the Northern Territory, Kimberley, Western Australia (nodes 67, 68) and Queensland (node 69). These northern and western Australian populations of D. longifolia var. longifolia are thousands of kilometres from southern and eastern Australian samples of the complex that clustered in clade G, but all have a similar habit, leaf, inflorescence and flower morphology. One Northern Territory sample, D. longifolia var. longifolia (DO147042 NT) (node 38), with a relatively long branch length, clustered in clade G sister to D. nervosa but with poor support (PP 0.52, BS 66 %). This sample was unable to be sequenced for one region in the cpDNA dataset (rpl14-rpl36) and this likely influenced its placement in clade G. Based on the cpDNA phylogeny, it is apparent that D. longifolia var. longifolia from the Northern Territory and northern Western Australia requires further population sampling to assess whether it should be recognised as a new species.

The Kimberley and Northern Territory samples of D. longifolia var. longifolia grouped with D. rara from the Glasshouse Mountains Queensland and D. sp. aff. nervosa from Blackdown Tableland Queensland (node 69). Populations of Dianella on the Blackdown Tableland were described by Henderson (1987a) as a potential subspecies of D. nervosa but the sample here did not cluster with D. nervosa (Cairns), indicating non-monophyly. A morphological review of D. sp. aff. nervosa Blackdown Tableland indicates leaf morphology to be considerably different from D. nervosa s.s. and it is likely to be recognised as a distinct taxon as part of this project (Refer to the results and discussions in Chapter 4 and 5). Dianella rara is restricted to Queensland and is not recognised as being in the D. longifolia complex by Henderson (1987a).

Henderson (1987a) included chromosome counts for taxa in the D. longifolia complex, which indicate polyploidy particularly for D. longifolia var. longifolia (2n=30, 32, 48), D. longifolia var. grandis (2n=16, 32), D. longifolia var. fragrans

(2n=48), D. longifolia var. stupata 2n=32 and D. longifolia var. surculosa 2n=48. Other varieties in the complex include the diploid D. longifolia var. stenophylla 2n=16, and the associated species D. porracea 2n=16. There are no recorded chromosome counts for D. tarda and D. amoena.

3.4.7 CpDNA phylogeny and D. pavopennacea complex A sample of each of the three varieties was included to provide insight into their relationships and to test the monophyly of the complex. All three taxa clustered in clade F with other far-north Queensland Dianella taxa and one sample of D. ensifolia from Brunei (Fig. 3.4). However, the samples of D. pavopennacea did not cluster together but rather with other species. D. pavopennacea var. major Cape York, QLD (node 29) grouped with D. incollata collected west of Cook Town (PP 0.95, BS 61%), samples from hundreds of kilometres apart. D. pavopennacea var. pavopennacea clustered with D. odorata KMM608 (node 34, PP 0.82, BS 79%), which were collected within 100 km of each other. D. odorata and D. incollata share morphological affinities with D. pavopenancea var. pavopennacea and D. pavopennacea var. major respectively. Henderson (1987a) indicated morphological affinities between D. odorata and taxa in the D. pavopennacea complex and also reported some chromosome counts. D. pavopennacea var. pavopennacea is reported by Henderson (1987a) to be 2n=16, D. pavopennacea var. major 2n=32 and D. pavopennacea var. robusta 2n=48, which indicates polyploidy within the complex. Examination of all taxa in the complex growing in glasshouse conditions indicates that the hexaploid D. pavopennacea var. robusta is quite distinctive when compared to the other two varieties in the complex. Comparison with nrDNA is presented in chapter 4, and further field work will be required to make a thorough taxonomic appraisal of each taxon and to examine populations of each throughout their range.

3.4.8 Australian species not part of taxonomic complexes The majority of far-north Queensland Dianella taxa clustered in clade F (Fig. 3.4), i.e. D. atraxis, D. bambusifolia, D. caerulea var. aquilonia, D. incollata, D. pavopennacea var. major, D. pavopennacea var. robusta, D. odorata, D. pavopennacea var. pavopennacea and also D. ensifolia (Brunei). D. atraxis is endemic to far-north Queensland in tropical rainforest (Henderson 1987a) and is monophyletic but with low PP support (PP 0.88) and no BS support. Prior to the

formal recognition of D. atraxis by Henderson (1987a), the morphologically similar D. ensifolia was considered to extend into Australia. D. bambusifolia (node 25) occurs in tropical rainforest in far- north Queensland, New Guinea and Indonesia and is sister to D. atraxis, however with poor support (PP 0.53). The remainder of Australian taxa in this clade are mostly confined to dry environments from the Wet Tropics region and north throughout Cape York (Henderson 1987a).

Dianella caerulea var. caerulea (Bunyip SF KM1046 Victoria) and D. caerulea var. caerulea (Blue Mountains KMM666 New South Wales) are resolved as sister taxa in clade H but with insignificant support (node 50, PP 0.56). These samples are morphologically similar to D. laevis var. aspera which is currently considered synonymous with D. caerulea var. caerulea (Australian Plant Census 2016), and the cpDNA results indicate there is no relationship with any taxa in the D. caerulea complex. Analysis of the nrDNA phylogeny may provide further evidence to support these results. A review of plants in situ and herbarium specimens indicates that the samples labelled as D. caerulea var. caerulea in clade H are most similar in morphology to D. tasmanica s.s., which is represented also in clade H.

Clade H indicates that D. tasmanica sampled from Mt Dandenong Victoria and D. sp. aff. tasmanica sampled from Mt Buffalo Victoria (node 52, PP 0.97, BS 72 %) are closely related. The position of the third sample of D. sp. aff. tasmanica (Deua NP, New South Wales) in clade H is equivocal with very low PP and no BS support. According to the chromosome counts for D. tasmanica in Curtis (1952) a range of polyploids exist (2n=16, 64, 76, 80, 84), indicating octoploids, decaploids and aneuploids in the taxon.

3.4.9 Phylogenetic relationships of extra-Australian Dianella Two Dianella accessions from New Guinea, D. serrulata (NSW870233 New Guinea) and D. sp. aff. serrulata (NSW841071 New Guinea), clustered in clade E with high support (node 19, PP 1.00, BS 99%). A morphological review of these specimens indicated that they are dissimilar to each other, particularly in inflorescence morphology, yet they share similarities in leaf morphology. They occur in the same mountain range in high altitude forest. A third New Guinea specimen, D. serrulata (DGF Y8/Y34 New Guinea) clustered with D. carolinensis (PTBG054738) from the

Caroline Islands with high BI support (node 22, PP 0.98) but was unresolved in the MP analysis. These two specimens are morphologically dissimilar although they occur in the same broad geographic region: the Caroline Islands being north of New Guinea.

The inclusion of multiple accessions of D. ensifolia (south-east Asia, the Pacific and the Indian Ocean) provided insight into the variation in this ‘species’ and its biogeographic pattern. D. ensifolia samples were placed in various clades with low to high support (nodes 20, 23, 33, 54, 76, 77). Clade E grouped two samples from Malaysia and Taiwan (node 20, PP 1.00 BS 97%), and also two samples from Madagascar and Mauritius (node 23, PP 1.00, BS 100%), reflecting in each case geographic proximity. The samples in these two clades are morphologically similar to each other and quite distinct from other D. ensifolia samples in this study. The Malaysia and Taiwan samples match the description of D. ensifolia (L.) Redouté s.s. Based on this study alone, D. ensifolia requires further investigation. The following chapters will provide further evidence to support this.

In clade K, two samples of D. ensifolia from the Ryukyu Islands were related to a clade of Pacific Dianella (New Caledonia, Norfolk Island to Hawaii). The two samples of D. ensifolia from Yonaguni Island (part of Ryukyu Islands) clustered together (node 77, PP 1.00, BS 80%) and were morphologically similar to each other and quite different from D. ensifolia from Malaysia, Taiwan, Madagascar and Mauritius in clade E (nodes 20, 23). The samples from New Caledonia and Norfolk Island grouped together (node 79, PP 0.99, BS 60%) and were sister to Hawaiian D. sp. aff. lavarum (Oahu and East Maui) and D. multipedicellata (Oahu) (node 80, PP 1.00, BS 75%). Although the backbone nodes of clade K have low support, the phylogeny does provide some insight into Pacific and Hawaii connections, discussed in detail in chapter 5.

Other Hawaiian Dianella samples clustered in Clade L and M rather than clade K, possibly indicating a divergence between the islands and/or different origins. Caution is stressed, however, because some of the lower nodes that resolve the Hawaiian taxa in separate clades have insignificant support values and may collapse with further data (e.g. nuclear DNA, Chapter 4). Nonetheless, Dianella in clade L only occurs on

the island of Hawaii. D. lavarum Hawaii is monophyletic (node 85, PP 1.00, BS 100%) and sister to D. multipedicellata Hawaii (PP 1, BS 96%). All samples were collected in the same National Park within 100 km of each other, and similarity may reflect chloroplast sharing.

In clade M, the Hawaiian D. sandwicensis from Kauai was resolved with high support (PP 1.00, BS 90%) as sister to a clade of three species of New Zealand Dianella. As mentioned earlier, the Island of Kauai is estimated to have emerged 5 Ma (Grigg 2012) and is the oldest emergent island. The phylogeny provides insight into a possible New Zealand-Hawaii connection and the diversification of Dianella in the Pacific.

3.5 Conclusion The cpDNA phylogeny provided insight into the infrageneric and intraspecific relationships of Dianella and related genera (outgroups) within Australia and other parts of the world. The maternally inherited cpDNA reflects variation occurring in only one part of the genealogy, and therefore only half of the parentage is examined (Small et al. 2004). Examination of another genome, e.g. nuclear DNA, may provide a comparative DNA dataset to test the cpDNA tree topology, and to expand current knowledge of the phylogenetic history of the genus.

Chapter 4: Nuclear DNA phylogeny

4.1 Introduction Nuclear ribosomal DNA (nrDNA) has proved useful in clarifying evolutionary relationships among plant taxa. It is a source of information independent from cpDNA (Small et al. 2004) and can exhibit a broad range of phylogenetic signal, from deep divergent histories to species-level resolution (Hershkovitz et al. 1999). The development of universal primers (White et al. 1990, Baldwin & Markos 1998) resulted in the extensive use of three nuclear regions in early molecular phylogenetic studies. These were the 18S-26S internal transcribed spacers (ITS4 and ITS5) and the 18S-26S external transcribed spacer (ETS) (Hershkovitz et al. 1999). The ETS spacer was shown to be of benefit in augmenting ITS data by providing a similar level of evolutionary resolution (Hershkovitz et al. 1999). It is suggested that ETS and ITS are under the same evolutionary rate, although independent of each other, and, therefore, a reliable tool for inferring relationships (Musters et al. 1990, Baldwin & Markos 1998, Hershkovitz et al. 1999).

The main function of nrDNA is to code for the RNA components of ribosomes, which are the sites of protein synthesis (Dahlberg 1989). Ribosomal DNA can constitute up to two-thirds of plant DNA (Appels & Honeycutt 1986) and is composed of two sets of tandem arrays of one or two chromosomal loci (Hamby & Zimmer 1992, Small 2004). The first set is 5S RNA, and the second set is 18S-5.8S-26S arrays, which are commonly used in plant phylogenetic studies (Small 2004). In eukaryotes, this second rDNA cistron encodes 18S, 5.8S and 26S rRNAs, which are separated by two internal transcribed spacers (ITS1 and ITS2) and flanked by the 5' and 3' external transcribed spacers (5' ETS and 3' ETS) (Hershkovitz et al. 1999) on either side of the intergenic spacer (IGS). In angiosperms, ETS is typically longer than ITS1 and ITS2 combined (Volkov et al. 1996, Baldwin & Markos 1998). Early researchers discovered the length of the IGS to vary from 1 to 8 kb in plants, and it can be variable within species and individuals of the same population (Jorgensen & Cluster 1988, Schaal & Learn 1988).

The advantage of using nrDNA in phylogenetic analyses is the potential for more informative characters because of the faster rate of evolution when compared to 69

cpDNA (Wolf et al. 1987). This is the result of increased polymorphic variation, which may infer evolutionary relationships. However, the repetitive nature of multiple copies in some nuclear DNA regions (particularly ITS and ETS) may pose problems of paralogy for analysis and interpretation of relationships (Sanderson & Doyle 1992, Bayly et al. 2008, Razafimandimbison et al. 2004). Furthermore, incongruence between nuclear and chloroplast datasets could be the result of introgression, hybridisation and incomplete lineage sorting (Wendel & Doyle 1998).

4.1.1 Chapter aims This chapter will present the first nrDNA phylogenetic study of the genus Dianella. The evolutionary relationships will be discussed in detail, applying the same research aims as in Chapter 3. The topology of the nrDNA tree will be compared with the cpDNA tree, followed by implications for current taxonomy. Relationships of the outgroup genera will also be reviewed and compared with the cpDNA results.

4.2 Methods

4.2.1 Marker Selection and primer design The regions ITS1 and ITS2 were amplified for Dianella and closely related genera using the primers ITS4 and ITS5 by White et al. 1990 (Table 4.1). ETS was amplified using the primer 18SE-ETS (Baldwin & Markos 1998), anchored in the 18S gene, paired with a newly designed primer ‘DIAN-ETS’ (Table 4.1), anchored in the ETS region. This new primer was needed because variation in the non-coding ETS region limits the transferability of primers designed for other plant groups. To design this primer, the long PCR method described by Baldwin & Markos (1998) and Oh & Potter (2005) was first used to amplify the intergenic spacer (IGS). Sequences from the 18S end of this amplicon were then used to identify a suitable position in the ETS to locate the new primer.

Mixtures used for the long PCR to amplify the IGS included a total volume of 25 µl: 2.5 µl 10× Buffer, AccuTaqTM LA (Sigma), 1.25 µl of dNTPs, 2.5 µl of DNA template, 0.5 µl of each primer, 17 µl of ultrapure water and 0.25 µl of Accu Taq LA DNA Polymerase mix and 0.5 µl of Dimethyl sulfoxide (DMSO). The thermocycling conditions for the long PCR began with an initial denaturation at 98°C for 30 seconds, followed by 30 cycles of 94°C for 15 seconds, 65°C for 20 seconds, 68°C for 20 70

minutes and a final extension time of 68°C for 10 minutes. PCR products were purified and sequenced (Refer to Chapter 2 for the other PCR protocols in section 2.5 DNA extraction, amplification and sequencing).

Once the primer was designed and sequences were successfully produced, they were compared and aligned with sequences of closely related genera sourced from Genbank.

Table 4.1. Nuclear forward and reverse primers used in this study: ITS4 and ITS5 (White et al. 1990), I8S-ETS (Baldwin & Markos 1998) and the newly designed primer DIAN-ETS.

Primer Sequence 5’-3’

ITS4 TCCTCCGCTTATTGATATGC

ITS5 GGAAGTAAAAGTCGTAACAAGG

18SE-ETS ACTTACACATGCATGCTTAATCT

DIAN-ETS WTTGGRACKCGTTTGCCC

4.2.2 Accessions and analyses The nuclear alignment is composed of 121 terminals, four outgroup genera (10 terminals) and Dianella taxa: 26 species, 20 varieties (111 terminals). Taxa missing from the nrDNA dataset were D. caerulea var. petasmatodes (Queensland), D. caerulea var. protensa (Queensland), D. incollata (Queensland) and D. revoluta var. revoluta (NSW, Royal NP) due to difficulties in obtaining clean sequences for the available accessions. D. revoluta var. revoluta (Barbers Creek, New South Wales), D. revoluta var. revoluta (Cape Conran, Victoria) and the outgroup taxon Stypandra jamesii were absent only from the ETS dataset. The combined nrDNA alignment, including the outgroup genera, was analysed using Maximum Parsimony and Bayesian analyses. For the complete methodology refer to Chapter 2.

4.3 Results

4.3.1 Informativeness of nrDNA The combined nrDNA alignment of two regions (ITS and ETS) produced 1483 characters with 372 parsimony-informative. These provided a high level of resolution and structure to the phylogenetic tree. The topology of the strict consensus tree from the Maximum Parsimony (MP) analysis and the topology of the 50% majority rule consensus tree from the Bayesian inference (BI) analysis were the same (Fig. 4.1). Sixty-four nodes had bootstrap support (BS values ≥ 50%), thirty six had moderate to high (BS values ≥ 80%) and 58 nodes had high support from posterior probability values (PP ≥ 0.95). However, some nodes had PP support but lacked BS support, particularly lower nodes in the tree, which had limited resolution. There were no major conflicts between the nodes when the BS and PP were compared to each other. Statistics of the MP analyses are shown in Table 4.2.

At the end of BI analyses the average standard deviation of split frequencies was 0.03. The harmonic mean of the negative log likelihood was -8306.44

Table 4.2. Statistics of the nrDNA parsimony analysis.

Parameter nrDNA

Total characters in the dataset 1483

Total variable characters 529

Parsimony informative characters 372

Number of phylogenetic informative characters ETS 176

Number of phylogenetic informative characters ITS 146

Number of informative Indels (ETS & ITS) 50

Number of most equally parsimony trees (=maxtrees setting) 100,000

Tree length 826

Consistency Index (CI) 0.54

Retention Index (RI) 0.87

Homoplasy Index (HI) 0.46

Fig. 4.1 The Bayesian majority-rule consensus tree based on analysis of combined nuclear ribosomal data. Branches with high Bayesian posterior probabilities (PP 0.95– 1.00) are shown in orange. Main clades are labelled A-N, and their detailed structure and support values shown in subsequent figures.

4.3.2 Composition and distribution of clades 4.3.3 Outgroup genera The outgroup genera (Fig. 4.2) formed three clades each with strong support (PP 1.00, BS 100%): clade (A) Stypandra, (B) Thelionema and Herpolirion, and (C) Eccremis. Clades A and B are related at node 1 (PP 1.00, BS 100%) but are separated by long branch lengths. Dianella is monophyletic (node 5, PP 1.00, BS 94%).

In clade A, the two samples of S. glauca from New South Wales and Victoria were very similar (node 8, PP 1.00, BS 100%) with S. jamesii from Western Australia their sister (node 2, PP 1.00, BS 100%) but differentiated by long branch lengths. Clade B includes three species of Thelionema from eastern Australia, with T. caespitosum and T. grande related (node 11, PP 1.00, BS 100%) and T. umbellatum their sister species with high support (node 10, PP 0.98, BS 82%). Herpolirion novae-zelandiae is related to Thelionema in clade B with strong support (node 3, PP 1.00, BS 100%). The two samples of Eccremis coarcata (clade C, node 4, PP 1.00, BS 100%) were monophyletic.

4.3.4 Dianella The nrDNA phylogenetic tree supports Dianella as monophyletic at node 5, Fig. 4.2, (PP 1.00, BS 94%) represented by 11 major clades D-N (Fig. 4.1). However, the basal node of Dianella is a polytomy of five lineages whose relationships to one another are unresolved (Fig. 4.1). The four species complexes D. longifolia, D. caerulea, D. pavopennacea and D. revoluta recognised by Henderson (1987a) are represented in taxonomic and biogeographic clades.

Clade D (Fig. 4.3, node 12, PP 0.84) is weakly supported and is composed of D. tenuissima (Blue Mountains, New South Wales) sister to D. caerulea var. caerulea (Bunyip State Forest, Victoria) and D. caerulea var. caerulea (Blue Mountains, New South Wales) (node 13, PP 0.96, BS 81%).

Clade E includes three accessions of D. tasmanica and D. sp. aff. tasmanica (Fig. 4.3), but the clade is also only weakly supported (node 14, PP 0.82). D. tasmanica (KMM1055 Mt Dandenong, Victoria) and D. sp. aff. tasmanica (KMM1054 Mt Buffalo, Victoria) are sister taxa (node 15, PP 0.84, BS 50%) and sister to them is D. sp. aff. tasmanica (KMM1053 Deua National Park, New South Wales).

Clade F relates New Zealand and Norfolk Island Dianella with high support (Fig. 4.3, node 16, PP 1.00, BS 100%). D. haematica (AK293920 New Zealand) and D. latissima (AK300546 New Zealand) are sister taxa (node 17, PP 0.99, BS 84%) as are D. intermedia (CBG8903427 Norfolk Island) and D. nigra (AK295538 New Zealand) (node 18, PP 0.97, BS 66%).

Clade G (Fig. 4.4, node 19, PP 0.93, BS 75%) includes all D. revoluta accessions together with accessions of D. brevicaulis, D. prunina, D. brevipedunculata and D. ensifolia. It has two subclades, although each has only weak to moderate support. One subclade at node 20 (PP 0.53, BS 70%) is mostly a large polytomy containing D. revoluta varieties from Victoria, New South Wales, South Australia and Western Australia as well as D. brevicaulis from Western Australia and South Australia.

D. brevicaulis is not monophyletic, with a Western Australian accession at node 20, and a South Australian accession at node 23 (PP 1.00, BS 70%) related to further accessions from Victoria and Tasmania together with D. revoluta var. revoluta KMM187. The other subclade of G, at node 25 (PP 0.77, BS 69%), contains a highly- supported group of other Western Australia Dianella including two samples of D. sp. aff. brevicaulis (Wave Rock and Stirling Ranges National Park) and one of D. revoluta var. divaricata (node 26, PP 1.00, BS 100%). These accessions are sister (with significant branch lengths) to a group of accessions (node 28, PP 1.00, BS 99%) of D. revoluta varieties tenuis, revoluta, minor and vinosa, D. prunina and D. brevipedunculata, all from New South Wales and Queensland, and four accessions of D. ensifolia from Taiwan and Yonaguni Island, the latter forming a highly- supported clade (node 34, PP 1.00, BS 100%).

Clade H relates three accessions of New Guinean D. serrulata (Fig. 4.5, node 37, PP 1.00, BS 99%). This clade was resolved as sister (node 7) to more than half of the Dianella samples in the analysis (node 7, PP 1.00) including the majority of extra- Australian Dianella and samples in the D. caerulea and D. longifolia complexes. 76

However, node 6 (see Fig. 4.1, 4.5) has poor support and only from the Bayesian analysis (PP 0.77).

Clade I (Fig. 4.5) includes a number of subclades, which reflect in part both current taxonomy and biogeographic regions. The D. caerulea complex is not monophyletic although the subclade at node 40 (PP 1.00, BS 92%) exclusively contains samples of D. caerulea (vars. caerulea, assera, cinerascens) from Victoria and New South Wales. The subclade at node 45 (PP 1.00, BS 90%) includes D. caerulea (vars. assera and producta, and D. sp. aff. caerulea) from New South Wales and Queensland. Other varieties of D. caerulea are positioned in clades K (var. vannata), M (var. Theresa Creek), N (var. aquilonia) and D (var. caerulea).

Clade J (node 50, PP 1.00, BS 74%) is largely the D. longifolia complex, but not resolved as monophyletic, together with samples of five other species that have morphological affinities to the complex, i.e. D. crinoides, D. tarda, D. amoena, D. porracea and D. callicarpa all from eastern and southern Australia. Sister to the 77

majority of taxa is a clade at node 51 (PP 0.97, BS 60%) of D. amoena (Victoria) and D. longifolia var. stenophylla (AQ724202 Queensland). The relationships of the taxa from node 52 (PP 1.00, BS 99%) are largely unresolved although D. amoena (HO547092 Tasmania), D. porracea (NSW), D. callicarpa (Victoria) and D. longifolia var. longifolia (KMM1048 Victoria) are supported as a subclade (node 54, PP 0.98, BS 54%).

Clade K and L are sister groups at node 57 (PP 0.92, BS 66%). Clade K (Fig. 4.6, node 58, PP 1.00, BS 96%) is composed of two samples of D. caerulea var. vannata (Queensland) that are related to a highly-supported subclade of sister species

D. intermedia Lord Howe Island and D. congesta New South Wales. Clade L (Fig. 4.6, node 61, PP 1.00, BS 91%) includes D. sp. aff. nervosa Blackdown Tableland and four accessions of D. longifolia var. longifolia from the Northern Territory and Kimberley, Western Australia. These northern accessions of D. longifolia var. longifolia are clearly unrelated to other accessions assigned to this taxon, which are in clade J.

Clade M (Fig. 4.6, node 66, PP 0.82) is poorly supported but includes Queensland samples of Dianella, mostly from far-north Queensland. D. rara Glasshouse Mountains, Queensland has a long branch and is sister to the other accessions, which are more strongly supported as a group (node 67, PP 1.00, BS 82%). In this group are three taxa, each of which is monophyletic: D. fruticans (three accessions at node 68, PP 1.00, BS 100%), D. caerulea var. Theresa Creek and D. sp. aff. caerulea var. Theresa Creek (node 71, PP 1.00, BS 91%) and D. nervosa (two accessions, node 72, PP 1.00, BS 100%).

Clade N relates the majority of extra-Australian Dianella and taxa from far-north Queensland Wet Tropics and Cape York regions but with relatively weak support (Fig. 4.7, node 73, PP 0.88, BS 70%). Although some of the internal nodes of this clade lack significant support, i.e. nodes 76–79 with PP values of only 0.53–0.68,

there are some resolved relationships of interest. Firstly, D. atraxis Queensland is monophyletic (node 75, PP 1.00, BS 100%). D. ensifolia is polyphyletic with the Brunei sample of D. ensifolia sister to all the other taxa in clade N (node 74, PP 1.00, BS 54%) and separated from two other accessions of D. ensifolia from Madagascar and Mauritius (node 81, PP 1.00, BS 100%), three from Taiwan, Bangladesh and Malaysia (node 82, PP 0.80), and one other far removed in clade G. The D. ensifolia accessions from Madagascar and Mauritius are strongly supported as related to D. carolinensis (node 81, PP 1.00, BS 100%) from the Caroline Islands.

D. odorata (node 84) and the D. pavopennacea complex (nodes 77, 78, 87) are also not monophyletic but most accessions cluster with D. bambusifolia, forming a Queensland–Northern Territory group (node 84, PP 1.00, BS 62%).

A significant finding is the strong support for the clade of Hawaiian and New Caledonian Dianella (node 88, PP 1.00, BS 99%). This clade includes two subclades, although neither has strong support. Node 89 (PP 0.81) relates D. sandwicensis from the Hawaiian Islands of Kauai and Oahu and D. lavarum (monophyletic) from the ‘big island’, Hawaii. Node 91 (PP 0.71) relates the New Caledonian D. adenanthera to D. multipedicellata from Hawaii and Oahu and D. sp. aff. lavarum (monophyletic) from East Maui and Oahu.

4.4 Discussion

4.4.1 Overview The relationships of the outgroup genera are nearly identical to the cpDNA phylogeny with many nodes highly supported. The deeper branches in the nrDNA phylogeny are congruent with the cpDNA phylogeny as are most of the major clades within Dianella. Parsimony and Bayesian analyses again have a similar topology. The nrDNA dataset had fewer informative characters (372) than the cpDNA dataset (518). However, the nrDNA phylogeny provided greater resolution within some clades, particularly for extra-Australian Dianella in clade N. In this case the nrDNA phylogeny has provided greater phylogenetic signal than the chloroplast DNA phylogeny despite the fewer parsimony informative characters.

4.4.2 Outgroup genera Stypandra jamesii is sister to S. glauca, congruent with the cpDNA phylogeny (Fig. 4.2). Additional resolution is provided for Herpolirion, which is sister to Thelionema with high support. The phylogenetic distance (branch length) between these two genera is relatively short. These close relationships are also reflected in their diploid chromosome number, which is 2n=16 for both genera (Henderson 1987c, Moore & Edgar 1970). Furthermore, their relationship is supported by morphological characters (see Chapter 5).

Thelionema caespitosum (Cape Conran, Victoria) and T. grande (Giraween NP, Queensland) formed a clade with high support, sister to T. umbellatum (Illawarra, New South Wales). In the cpDNA phylogeny, a different relationship was evident, with T. caespitosum and umbellatum resolved as sister species, also with high

support. Additional samples of each taxon and markers may provide further clarification of these relationships.

The nrDNA analyses show the two samples of Eccremis are monophyletic, as in the cpDNA phylogeny. With broader sampling and extending outgroups beyond the taxa studied here, Wurdack & Dorr (2009) show Eccremis as the sister to Dianella, which is consistent with morphological characters (see Chapter 5).

4.4.3 Biogeographic patterns within Dianella Overall, the nrDNA phylogeny provided additional resolution within some clades and contributed to understanding of biogeographic patterns in Dianella. However, as with the cpDNA, some of the deeper nodes and major nodes are unresolved or have weak PP and BS support. Differences between the nrDNA and cpDNA analyses reflect this lack of resolution, rather than being in major conflict, and a combined analysis of both data sets may provide greater resolution of the biogeographic relationships (see Chapter 5).

In the nrDNA analysis, Dianella species from New Zealand and Norfolk Island are in clade F positioned at the basal, unresolved polytomy, suggesting an early divergence. The cpDNA placed these south-west Pacific samples with some from Hawaii (see below).

The cpDNA analysis resolved a divergence of taxa from south-west Western Australia and South Australia from eastern and extra-Australian taxa at the base of Dianella in clade G. In the nrDNA analysis it is not clear whether divergence between southwest and eastern clades is the earliest within Dianella because clade G is part of a basal polytomous node. In the nrDNA analysis all south-west Western Australian taxa clustered in clade G with the D. revoluta complex (Western Australia, South Australia, New South Wales, Victoria, Queensland and Tasmania) and related species. D. revoluta taxa occur in temperate Australian environments particularly drier forest types (Henderson 1987a).

Interestingly a clade of D. ensifolia (Taiwan and Yonaguni Island) also clustered in clade G, suggesting an Australian-Taiwan-Ryukyu Islands connection. Taiwan and the Ryukyu Islands are part of an archipelago of 140 islands on the western rim of 82

the Pacific with high levels of endemism. The flora also has connections to Australasia, mainland Asia and Malesia (Chiang & Schaal 2006). Yonaguni Island is tropical, approximately 110 km west of Taiwan, and 1000s of km from Australia. The Ryukyu Islands arose simultaneously and not sequentially, with emergence estimated 9 Ma in the late Miocene, which is relatively recent (Sibuet & Hsu 2004) considering the evolution of the Australian flora (Frakes 1999, Hill & Broadribb et al. 1999, Hill 2004). The biogeographic pattern in Dianella may reflect seed dispersal from Australia northwards. Research into avian migratory routes from Australia to Asia and anthropogenic dispersal patterns could provide some additional clues.

New Guinean D. serrulata (clade H) is also near the base of the genus, possibly sister to the majority of Australian, Indian and Pacific Ocean taxa. In the cpDNA analysis, D. serrulata was also near the base of the genus but possibly related (low node support) to D. carolinensis of the Caroline Islands and D. ensifolia (clearly not monophyletic) from Madagascar and Mauritius.

The D. caerulea complex (in clade I, fig. 4.5) revealed two subclades, one from Victoria and New South Wales, and another from Queensland, suggesting a biogeographic break.

The D. longifolia complex (Eastern Australia) is sister to a clade of D. caerulea var. assera accessions from Queensland, New South Wales and Victoria, however, this node has low support.

The majority of taxa in the D. longifolia complex (including related narrow endemic species) are also in an eastern Australian clade (J, ranging from Queensland to New South Wales, Victoria, South Australia, and Tasmania) while the disjunct D. longifolia var. longifolia from northern Australia (Northern Territory and Kimberley) clustered in clade L (Fig. 4.6) with one Queensland taxon D. sp. aff. nervosa Blackdown Tableland.

In the major clades M+N (Figs 4. 6-7) Queensland taxa, including D. rara, D. fruticans, some samples of D. caerulea, D. nervosa, D. atraxis, and D. pavopennacea are related to extra-Australian Dianella from south-east Asia (Malaysia, Bangladesh, 83

Brunei), Indian Ocean region (Madagascar, Mauritius), Micronesia (D. carolinensis Caroline Islands) and the Pacific (Hawaii and New Caledonia). Clade N, in particular, indicates a far-north Queensland-south-east Asia-Indian Ocean- Micronesia-Pacific connection. A strongly supported subclade (PP 1.00, BS 99%) within N is the grouping of all Hawaiian taxa and accessions, together with D. adenanthera from New Caledonia. In the cpDNA phylogeny, similar subclades were evident but their relationships to one another were not clear. D. adenanthera was sister to the D. intermedia Norfolk Island accession, both of which grouped with three samples from Hawaii (representing D. lavarum and D. multipedicellata); four other Hawaiian samples clustered together and one clustered with New Zealand Dianella. The implications or both species-level taxonomy and the biogeographic patterns of the Hawaiian taxa are discussed further in Chapters 5 and 6.

4.4.4 nrDNA phylogeny and species taxonomy The nrDNA phylogeny supported the same species-level taxa identified in the cpDNA phylogeny: these are D. atraxis, D. fruticans, D. nervosa and D. lavarum (Hawaii). Additional clades congruent with the current taxonomy were also supported by the nrDNA phylogeny: these are D. caerulea var. cinerascens (New South Wales), D. congesta (New South Wales, Queensland) and D. sp. aff. lavarum (Oahu, Maui). Accessions with morphological affinities to specific taxa were also confirmed as closely related taxa: these are D. caerulea var. Theresa Creek (Mt Bartle Frere, Queensland) and D. sp. aff. caerulea var. Theresa Creek (Mt Lewis, Queensland); D. sp. aff. tasmanica (Mt Buffalo, Victoria), D. tasmanica (Mt Dandenong, Victoria) and D. sp. aff. tasmanica (Deua National Park, New South Wales). In Western Australia, accessions of D. sp. aff. brevicaulis (Stirling Ranges and Wave Rock, Western Australia) were monophyletic. Dianella ensifolia clustered in a number of clades in agreement with the cpDNA phylogeny and the taxonomy of those clades will be discussed in detail in Chapter 5.

4.4.5 nrDNA phylogeny and D. revoluta complex Although all samples of the D. revoluta complex were in one clade (G, PP 0.93, BS 75%). This clade also included eastern Australian species with morphological affinities to the complex, i.e. D. prunina, D. brevipedunculata and D. brevicaulis, as well as samples of D. ensifolia from Taiwan and Yonaguni Island (part of Ryukyu

Island group). D. brevicaulis from Western Australia is outside of this clade but may be related to D. brevicaulis from South Australia, Victoria and Tasmania, including D. revoluta var. revoluta KMM187 from Victoria. The two accessions of D. sp. aff. brevicaulis from Western Australia did not cluster with D. brevicaulis but grouped with a sample of D. revoluta var. divaricata KMM1050 also from Western Australia. The cpDNA phylogeny also supported this pattern, indicating a need for taxonomic revision but also for further sampling in the field.

Dianella prunina (NSW759138, New South Wales) and D. sp. aff. revoluta (KMM667, New South Wales) were highly supported as sister taxa. Both taxa were collected in the Blue Mountains New South Wales and are morphologically distinct from each other. In the cpDNA phylogeny, D. prunina clustered with samples of D. revoluta from Queensland with high support, while D. sp. aff. revoluta (KMM667, New South Wales) was sister to a large clade of the D. revoluta complex from Victoria and South Australia. Only one sample of each taxon was included in this study and thus further samples and markers are required to determine whether D. prunina and D. sp. aff. revoluta should be treated as the one taxon or separate sister taxa.

Dianella brevipedunculata was resolved as sister to D. revoluta var. vinosa. Accessions of both taxa were from Queensland (clade G, node 33, PP 1.00, BS 100%). D. brevipedunculata is restricted to south-east Queensland in forest environments (Henderson 1987a) and extends west to the Mount Moffatt section of Carnarvon National Park and north to Rockhampton (Henderson 1991). It shares morphological characters with the D. revoluta complex in the broad sense, e.g. absence of denticles along the leaf margins. Henderson (1987a) described D. brevipedunculata as characteristically having an ovary with two ovules per locule and the inflorescence nested in the foliage, noting similarity of the position of the inflorescence of D. brevicaulis. However, the nrDNA phylogeny found D. brevipedunculuta is not closely related to accessions attributed to D. brevicaulis and that the latter is not monophyletic. Furthermore, the north-eastern limit of “D. brevicaulis” is southern New South Wales (Australia’s Virtual Herbarium 2016) and there is no overlap between the geographic ranges of it and D. brevipedunculata.

As mentioned above, and as in the cpDNA phylogeny, the nrDNA phylogeny showed that D. ensifolia is not monophyletic. One accession from Taiwan and two from Yonaguni Island (part of Ryukyu Islands) are related but these are not closely related to accessions from Madagascar, Mauritius, Brunei, Bangladesh and Malaysia, and a further sample from Taiwan. The nrDNA phylogeny nested the Yonaguni Island and Taiwan clade in the D. revoluta complex. A review of the specimens of D. ensifolia (Ryukyu Islands and Taiwan) indicates there are no clear morphological similarities with D. revoluta taxa. Examination of populations in situ for habit and morphological characters would likely provide further evidence of whether they are indeed part of D. revoluta. D. ensifolia (Ryukyu Islands/Taiwan) occurs in tropical latitudes and D. revoluta taxa are confined to Australia mostly in temperate environments particularly drier forest types (Henderson 1987a). Further research into anthropogenic dispersal patterns and avian migratory routes from Asia to Australia could provide further evidence to eludicate the relationships identified in this phylogeny.

4.4.6 nrDNA phylogeny and D. caerulea complex The majority of the D. caerulea complex samples clustered in clade I (Fig. 4.5), within two well supported subclades that are paraphyletic (PP 0.66) but with low support. As in the cpDNA phylogeny, some taxa were positioned outside the complex, i.e. D. caerulea var. Theresa Creek, D. caerulea var. aquilonia and the two samples of D. caerulea var. caerulea in clade D (New South Wales and Victoria) formed a clade like in Chapter 3 (clade H). Additionally, in the nrDNA phylogeny two samples of D. caerulea var. vannata clustered with D. congesta from New South Wales and Queensland and with D. intermedia from Lord Howe Island (clade K, fig. 4.6).

Multiple samples of D. caerulea var. assera were grouped together in a clade that also included one sample of D. caerulea var. producta and one sample identified as D. sp. aff. caerulea (Fraser Island, Queensland). D. caerulea var. assera Illawarra NP and Nortons Basin, New South Wales (Fig. 4.5, node 42) occur in the same area in New South Wales but are morphologically dissimilar to each other, and considerably different from D. caerulea var. assera s.s from Queensland. Samples in node 47 from Dorrigo National Park and Yarriabini National Park, New South Wales also showed differences in morphology. Both samples were collected in

subtropical rainforest in northern New South Wales. D. caerulea var. assera Bunya Mountains (KMM48) and D. caerulea var. assera Springbrook Plateau Queensland (KMM1040) are morphologically similar to the holotype in accordance with Henderson (1987a). However, both samples were not monophyletic. D. caerulea var. assera Bunya Mountains was collected without an inflorescence, and the identification of this sample was based on only aerial stem, leaf and rhizome morphology. D. caerulea var. assera (Bunya Mountains) clustered with a sample from Byron Bay, northern New South Wales (node 49). These two samples are morphologically dissimilar; D. caerulea var. assera Bunya Mountains has wider leaves and inhabits Bunya forest, whilst D. caerulea var. assera Byron Bay has narrow leaves and was collected in coastal forest, and the populations occur approximately 300 km apart. The taxonomy of D. caerulea var. assera s.l. will be discussed in detail as part of a morphometric study in Chapter 7.

D. caerulea var. cinerascens is restricted to New South Wales in forest environments north-west of Sydney (Henderson 1987a). It was resolved as monophyletic (Fig. 4.5, node 43), but with low support, and clustered with four accessions of var. assera and one of var. caerulea. In contrast, in the cpDNA phylogeny, D. caerulea var. cinerascens was polyphyletic among the D. caerulea taxa (chapter 4 clade N). Although D. caerulea var. cinerascens shares stem and leaf characters with D. caerulea var. vannata (as well with var. protensa and var. petasmatodes, not included in the nrDNA data set) they were not related in the nrDNA phylogeny. D. caerulea var. vannata occurs in New South Wales, Queensland and New Guinea. The Queensland accession (from Ravensbourne National Park and WooCoo National Park) was positioned in clade K (Fig. 4.6) with D. congesta and D. intermedia Lord Howe Island.

D. congesta is monophyletic with high support (node 60), but the accessions were paraphyletic in the cpDNA phylogeny. The sister relationship of D. congesta and D. intermedia Lord Howe Island has high support. Both species share unique morphological characters, particularly inflorescence, leaf and stem characters. Lord Howe Island is approximately 560 km east of Australia, and the isolation and evolution of the island, estimated over a 7 Ma period (Buckley et al. 2009), has resulted in numerous endemics found on the island (Heads 2011). The nrDNA results

indicate that D. intermedia Lord Howe Island is not the same taxon as D. intermedia Norfolk Island, which was placed in clade F (Fig. 4.3) with New Zealand Dianella.

D. caerulea var. Theresa Creek, Mt Bartle Frere, Queensland and D. sp. aff. caerulea var. Theresa Creek Mt Lewis Queensland formed a clade with high support (Fig. 4.6, node 71) that clustered with other far-north Queensland Dianella in clade M. The phylogenetic positions of these two accessions were equivocal in the cpDNA phylogeny but they share unique anther morphology. Observing plants in the living collection confirmed the anthers split along the entire length, on both sides, which is not typical of the genus. This provided additional support for their sister relationship observed in the nrDNA analysis. Additionally, D. sp. aff. caerulea var. Theresa Creek (Mt Lewis) lacks a struma, which is highly unusual.

D. caerulea var. aquilonia clustered with far-north Queensland taxa (clade N) congruent with the cpDNA phylogeny, providing further evidence for it to be excluded from the D. caerulea complex.

4.4.7 nrDNA phylogeny and D. longifolia complex

The D. longifolia complex clustered in two clades, with samples from eastern Australia and South Australia in clade J (Fig. 4.5) and samples from the Northern Territory and Kimberley, Western Australia, in clade L (Fig. 4.6). Clade J also includes D. amoena, D. tarda, D. porracea and D. callicarpa, which have morphological affinities to the complex. These taxa were also shown as related in the cpDNA phylogeny, except for D. callicarpa. Clade J is mostly a large polytomy with short branch lengths and the nodes have high PP support but low BS, with limited biogeographic and taxonomic patterns.

Accessions of D. longifolia var. longifolia (Kimberley and Northern Territory) (Fig. 4.6, clade L, node 61) clustered together, which is mostly congruent with the cpDNA phylogeny, indicating that these northern populations are not related to eastern Australian populations. Herbarium specimens were examined to determine morphological differences; however, it was difficult to undertake a thorough examination due to missing characters and some specimens contained plants with different stages of growth. Observing populations in situ and obtaining all required

plant parts is needed to determine morphological differences from var. longifolia (eastern Australia) and other varieties to determine if a new species should be described. Seed morphology may also provide informative characters. The nrDNA phylogeny has provided sufficient evidence that var. longifolia (Western Australia and Northern Territory) is likely a new species pending a morphological review.

D. sp. aff. nervosa (Blackdown Tableland) was sister to D. longifolia var. longifolia (Northern Territory, Kimberley) accessions (clade L). Henderson (1987a) proposed that populations of D. nervosa on the Blackdown Tableland could be a distinct subspecies of D. nervosa. In the nrDNA phylogeny here, two accessions of D. nervosa clustered in clade M, providing sufficient evidence that D. sp. aff. nervosa Blackdown Tableland is not part of that species. This conclusion is supported by morphology. D. nervosa has a fused occlusion zone, whilst D. sp. aff. nervosa (Blackdown Tableland) has an open occlusion zone, which is a major difference. Additional field work is required to examine populations in situ, particularly in the Blackdown Tableland region.

In the cpDNA phylogeny, D. callicarpa is supported as part of the D. revoluta complex, however in the nrDNA analysis, D. callicarpa is in the D. longifolia clade J (Fig. 4.5). A morphological review of D. callicarpa is required to understand the taxonomy and relationships observed in these phylogenies. The inclusion of additional samples in a molecular study would assist in resolving the placement with either D. revoluta or D. longifolia taxa. It is highly probable that D. callicarpa occurs in close proximity in the field with D. revoluta and D. longifolia varieties, and this could result in hybridisation and chloroplast capture, resulting in the contrasting results in the cpDNA and nrDNA phylogenies.

D. fruticans and D. nervosa are each monophyletic (Fig. 4.6, clade M) in the nrDNA analysis, in agreement with the cpDNA phylogeny. However, in the cpDNA phylogeny both species were nested with D. longifolia taxa (eastern Australia) whereas in the nrDNA analysis they were related to accessions of D. caerulea var. Theresa Creek, D. fruticans and D. nervosa share inflorescence characters with taxa in the D. longifolia complex, e.g. perianth characters, struma and anther morphology, and D. fruticans has an open leaf occlusion, which is a key character to define D.

longifolia s.l. D. nervosa occurs in eucalypt forest from northern New South Wales to Cooktown, Queensland and D. fruticans inhabits open eucalypt forest environments in south central Queensland (Henderson 1991).

Sister to these taxa is a single sample of D. rara Glasshouse Mountains, Queensland, which had a long branch length (clade M), indicating its divergence and isolation. It shares a number of morphological characters with the D. longifolia complex and in the cpDNA phylogeny, it clustered with D. longifolia var. longifolia from Western Australian, Northern Territory and one Queensland taxon, D. sp. aff. nervosa Blackdown Tableland. D. rara is diploid 2n=16, whereas other varieties of D. longifolia include a range of polyploids (see Chapter 5), which may result in reproductive incompatibilities and isolation.

The topologies of the cpDNA and nrDNA phylogenies provide sufficient evidence that the D. longifolia complex is not monophyletic but that there are two separate clades (discussed in Chapter 5).

4.4.8 nrDNA phylogeny and D. pavopennacea complex The samples representing the D. pavopennacea complex clustered in clade N with far- north Queensland and extra-Australian Dianella. The complex is polyphyletic, based on analyses of both nrDNA and cpDNA. Additional samples in future studies may provide further resolution of the complex.

4.4.9 Australian species not part of taxonomic complexes D. odorata, D. atraxis and D. bambusifolia clustered with the majority of extra- Australian Dianella samples in clade N (Fig. 4.7), and sister to clade N (node 73) is D. ensifolia (CNS138344.1 Brunei). D. atraxis is monophyletic in nrDNA analyses (node 75), which is congruent with the cpDNA phylogeny. The samples of D. odorata (Queensland) form a clade, and the other sample from Northern Territory clusters with the Queensland taxon, D. pavopennacea var. pavopennacea. The samples of D. odorata (Queensland) share some morphological characters, particularly leaf and stem morphology, with D. pavopennacea var. major. D. bambusifolia (Queensland) is sister to D. odorata and D. pavopennacea var. pavopennacea in the nrDNA analyses, also from Queensland. Both D. odorata and D. bambusifolia extend to New Guinea and Indonesia, although they occur in 90

different environments, i.e. D. bambusifolia is confined to tropical rainforest and D. odorata occurs in dry tropical open forests (Henderson, 1987a). Additional samples of these taxa from New Guinea and Indonesia would likely provide further resolution of Australian connections with extra-Australian taxa.

In eastern Australia, two clades provide further clarification of undescribed species. In clade D, D. caerulea var. caerulea (Bunyip SF, Victoria) and D. caerulea var. caerulea (Blue Mountains, New South Wales) form a clade with high support (node 13), in agreement with the cpDNA phylogeny. The name D. laevis var. aspera was first described by Bentham (1878) and was later synonymised by Willis (1962) into D. caerulea var. caerulea. The plants of D. caerulea var. caerulea KMM666 (New South Wales) and KMM1046 (Victoria) have mauve anthers and unique leaf margin denticle morphology and appear to be D. laevis var. aspera (sensu Bentham 1878). Dianella prunina also has mauve anthers, and occurs in the same region as the specimen KMM666 which was also collected in the Blue Mountains, New South Wales, but, D. prunina clustered in the D. revoluta complex, indicating no evolutionary relationship with clade D. Dianella tenuissima, an endemic restricted to the Blue Mountains, New South Wales, is sister, but with only low PP support. In the cpDNA phylogeny, the position of this taxon was unresolved.

All three samples of D. tasmanica, including specimens attributed to potentially undescribed taxa D. sp. aff. tasmanica (Deua NP) New South Wales and D. sp. aff. tasmanica (Mt Buffalo) from Victoria, clustered together, (although node 14, fig. 4.3, has only weak PP support), consistent with them all being related. D. sp. aff. tasmanica (Deua NP) and D. sp. aff. tasmanica (Mt Buffalo) should be described as two new species based on significant morphological differences (Muscat 2009). D. sp. aff. tasmanica (Deua NP) has glaucous blue leaves and white flowers and is only known from one locality in Deua National Park, New South Wales on rhyolite outcrops. D. sp. aff. tasmanica (Mt Buffalo) was found to be distinctive when compared to D. tasmanica populations in a morphometric study by (Muscat 2009). It has green fruit at maturity and green fruit dye, compared with D. tasmanica s.s which has purple mature fruit and typically a purple dye.

4.4.10 Hawaiian Dianella The results of the nrDNA analyses indicate that the taxonomy of Hawaiian Dianella requires revision. D. sp. aff. lavarum (east Maui and Oahu) is monophyletic (Fig. 4.7) and shown as most closely related to a possibly paraphyletic D. multipedicellata (Hawaii and Oahu), rather than to D. lavarum (Hawaii). D. multipedicellata and D. sp. aff. lavarum have similar leaf, flower and inflorescence morphology, but, there are inflorescence characters that delimit the two taxa. Both taxa were also observed in sympatric association at numerous localities, particularly on Oahu (pers. obs. K.M.M). The two accessions of D. sandwicensis (Oahu and Kauai) form part of a trichotomy (PP=0.81) that also includes a monophyletic D. lavarum; whereas in the cpDNA phylogeny D. sandwicensis (Kauai) is sister to New Zealand Dianella. The unique morphological characters of the potentially new taxon D. sp. aff. lavarum will be discussed in Chapter 5 and Chapter 6.

New Guinean Dianella, D. serrulata and D. sp. aff. serrulata, were sourced from the Mandang province in high altitude wet forest and all samples were collected from the same mountain range. Although D. sp. aff. serrulata (NSW841071 New Guinea) formed a highly supported clade with D. serrulata, it did have unique inflorescence morphology. The morphological examination of additional populations in situ, may provide further clarification about the taxonomic differences observed in D. sp. aff. serrulata.

4.5 Conclusions The nrDNA phylogeny produced a similar topology to the cpDNA phylogeny and additional resolution clarified some taxonomic groups and entities currently not recognised in the genus. The evolutionary relationships, particularly for extra- Australian Dianella were more resolved. The clades identified for the taxonomic complexes D. longifolia, D. caerulea, D. revoluta and D. pavopennacea are supported and also similar to those found in the cpDNA phylogeny. The infrageneric relationships of the outgroup genera were similar to the cpDNA phylogeny and provided additional resolution of Herpolirion and Thelionema. Given the level of concordance, the cpDNA and nrDNA data sets were combined for analysis in the following chapter.

Chapter 5: Combined Phylogeny

5.1 Introduction If datasets from separate DNA regions do not show significant conflict in phylogenetic signal they are often combined to provide a larger set of characters than those based on individual DNA regions (Johnson & Soltis 1998); for example Gibbs et al. 2009, Weston et al. 2014, Bayly et al. 2013. A phylogenetic tree inferred from a combined dataset may provide additional resolution and statistical support of the deeper branches in Dianella than recovered in the individual analyses of Chapters 3 and 4. Greater phylogenetic resolution could also clarify the biogeographic relationships within the genus.

5.1.1 Chapter aims The aim of this chapter is to present a combined cpDNA and nrDNA phylogeny for Dianella and closely related genera. The same research questions as in Chapter 3 and Chapter 4 will be discussed, including a review of the chromosome counts of the genus and how these relate to the infrageneric and infraspecific relationships in the phylogenetic tree. The biogeographic distribution of the genus will be examined in light of the tree topology. Nomenclatural changes that are required based on the principle of monophyly of taxa will be outlined at the end of the chapter. The synapomorphic characters observed in outgroup genera and Dianella will be examined and discussed.

5.2 Methods The phylogenetic trees based on the individual analyses of cpDNA (Chapter 3) and nrDNA (Chapter 4) showed no major conflict, with only ‘soft’ incongruence in some clades (Seelanen et al. 1997). Based on this evidence, tests for homogeneity were not performed and the datasets were combined and analysed, in accordance with the flow chart by Johnson & Soltis (1998). The combined dataset included the same number of accessions as in Chapters 3 and 4, with 39 of the 40 Australian taxa and 9 of the 17 extra-Australian species. Ten accessions represented four outgroup genera.

Field work and examination of specimens throughout the global range of Dianella provided further observations for taxonomic assessment and interpretation of the phylogenetic tree topology (see Johnson & Soltis 1998). Refer to Chapter 2 for the methods used to collect, extract and amplify DNA sequences used in the combined phylogenetic analysis.

5.3 Results

5.3.1 Informativeness of the combined cpDNA and nrDNA dataset The combined markers provided an alignment of 5583 included characters, with 890 parsimony-informative, and the data set resolved some of the lower nodes in Dianella, with variable levels of support compared to the results from the individual data sets (Chapters 3 and 4). The posterior probability (PP) values of the Bayesian analysis gave support to more nodes, 85 (PP ≥ 0.95), when compared to the bootstrap scores (BS) in the MP analyses, 67 (≥ 50%) and 41 nodes had moderate to high support (≥ 80%).

The number of the shortest, most parsimonious (MP) trees in the combined analysis was 480, which is considerably fewer when compared to the cpDNA (79,960 MP trees) and nrDNA (>100,000 MP trees) results. Therefore, the combined analysis produced fewer trees indicating a stronger and more resolved phylogenetic signal in the combined dataset. Statistics of the MP analyses are shown in Table 5.1.

The Retention Index for the combined analysis was 0.79, cpDNA (0.81) and nrDNA (0.87). This indicates only a small increase in character conflict (homoplasy) when data were combined. This is reflected also in the other indices (Table 5.1) including the Consistency Index (CI), which for the combined analysis was slightly lower (0.45) than for the individual data sets (cpDNA CI=0.50, nrDNA CI=0.54).

For the Bayesian analysis, the average standard deviation split frequencies were 0.025 at the end of the runs. The harmonic mean of the negative log likelihood was 23276.94.

Table 5.1. Table of statistics for the combined cpDNA and nrDNA phylogenetic tree.

Parameter Combined nrDNA and cpDNA

Included characters 5583

Total variable characters 1386

Parsimony Informative 890 Characters

Number of informative Indels 224

No. of shortest trees 480

Tree length 2203

Consistency Index (CI) 0.45

Retention Index (RI) 0.79

Homoplasy Index (HI) 0.55

5.3.2 Composition and distribution of clades The tree topology from the BI analysis was very similar to that of the strict consensus tree from the MP analysis (not shown). The overall topology of the Bayesian tree, with major clades labelled A-N, is shown in Fig. 5.1. Details of clades and node support values (PP and BS) are shown in Figs 2–8, with the level of divergences indicated by branch lengths.

Fig. 5.1. The Bayesian majority-rule consensus tree of combined cpDNA and nrDNA data. The large terminal triangles are major clades shown in detail in later figures. The smaller terminal triangles include more than one accession. Thick lines represent branches with high Posterior Probabilities = 0.95–1.0, shown above branches; bootstrap values are below branches. Chromosome counts (2n) and location of those samples are shown in green; ? = count unknown. Chromosome counts were sourced from Hair (1942), Curtis (1952), Skottsberg (1953), Carr (1978), Tanaka (1981), Henderson (1987a) and de Lange & Murray (2003).

5.3.3 Outgroup genera As in the analyses of the individual data sets, the outgroup genera form three clades; clade A Stypandra is sister to clade B Thelionema + Herpolirion and clade C includes two accessions of Eccremis (Fig. 5.2). Each of nodes 1–4 has strong support (PP 1.0, BS 100%). The one difference between analyses is the relationship of the accessions within clade B. For the Bayesian analysis, the combined data set gives the same result as the nrDNA data set (Chapter 4) with Thelionema monophyletic, although node 14 (Fig. 5.2 below), showing T. umbellatum as sister to the other two species (T. caespitosum and T. grande), has only very weak support (PP 0.67). The MP analysis of the combined dataset shows T. umbellatum at the basal node of clade B and Herpolirion nested within Thelionema, making the latter paraphyletic. In the cpDNA Bayesian analysis (Chapter 3), the monophyly of Thelionema was also equivocal but with the position of T. grande unresolved.

5.3.4 Dianella The genus Dianella is monophyletic with strong support (node 5, PP 1.00, BS 100%). Within Dianella, there are 11 major clades evident (D-N): nine with a PP support value of 0.99–1.00, and seven of which have BS support (65–100%). Although the deeper nodes relating these clades to one another are resolved in both the Bayesian Inference majority-rule consensus tree and the MP strict consensus tree (not shown), they generally lacked PP or BS support.

Clade D (node 16, PP 1.00, BS 100%) is well supported as the sister group to the rest of Dianella (node 5, Fig. 5.3). Clade D includes exclusively accessions from southwest Western Australia and two from South Australia. As concluded from the results of the individual data sets (Chapter 3 and 4) none of the taxa D. brevicaulis, 98

D. sp. aff. brevicaulis and D. revoluta is monophyletic. There is strong support for D. brevicaulis accession KMM1036WA as sister to the South Australian samples of D. revoluta AD213697 & AD167789 SA.

Clade E (Fig. 5.3) is composed of three accessions of New Guinean D. serrulata and D. sp. aff. serrulata with high support (node 22, PP 1.00, BS 89%). This clade is sister to all other clades F–N at node 7 (PP 1.00, see Fig. 5.1).

Node 24 groups three clades (F, G, H; Fig. 5.3) ranging from eastern Australia (South Australia, Tasmania, Victoria, New South Wales and Queensland) to Taiwan and Yonaguni Island (Ryukyu Islands group). However, node 24 is only weakly supported with PP 0.84 and was unresolved in the MP strict consensus tree. Clade F (node 25, PP 1.00, BS 67%) consists of D. caerulea var. caerulea (Victoria) and D. caerulea var. caerulea (Blue Mountains). Clade G (node 26, PP 0.88, BS 62%) includes three accessions of D. tasmanica (KMM 1055) Victoria and D. sp. aff. tasmanica (Mt Buffalo Victoria and Deua NP New South Wales) and is sister to clade H (node 29, PP 1.00) but no BS support. Clade H contains all D. revoluta varieties and is polyphyletic. The clade splits into two subclades at nodes 30 and 38. The subclade at node 30 (PP 1.00, BS 86%) is well supported and includes all accessions of D. revoluta var. revoluta from Victoria and New South Wales (clustered at node 31, PP 1.00, BS 66%) and a sister group of accessions at node 33 (PP 1.00, BS 67%). This group includes three samples of D. brevicaulis from Tasmania, South Australia, and Victoria (node 34, PP 1.00, BS 94%) and D. revoluta var. revoluta and var. divaricata from Victoria and South Australia (node 36, PP 0.95).

Clearly, D. brevicaulis is not monophyletic given that the Western Australian accessions clustered in clade D with another Western Australian Dianella. The other subclade within H, at node 38 (PP 1.00, BS 80%), contains D. sp. aff. revoluta Blue Mountains, D. revoluta vars. tenuis, minor and vinosa, D. prunina, D. brevipedunculata, and a cluster of D. ensifolia samples from Taiwan and Yonaguni Island (node 44, PP 1.00, BS 100%). Node 8 groups the remainder of the Dianella clades (I-N, see Fig. 5.1) but the support for this node is weak (PP 0.69).

It suggests that clade I (node 47, PP 1.00, Fig. 5.4) is sister to clades J-N. Clade I is composed of D. tenuissima from New South Wales and D. intermedia from Norfolk 99

Island as successive sister groups to a clade (node 49, PP 1.00, BS 100%) of single accessions of three New Zealand species, D. haematica, D. latissima and D. nigra.

Clade J (node 51, PP 1.00, BS 83%) is composed of far-north Queensland taxa. Node 52 (PP 0.99, BS 85%) groups D. sp. aff. caerulea var. Theresa Creek Mt Lewis (KMM 545) and D. caerulea var. Theresa Creek (KMM478) Bartle Frere, both from the Queensland Wet Tropics. At node 53 (PP 1.00, BS 95%) D. nervosa and D. fruticans are sister species, each of which is also monophyletic. Clade J is sister to clades K-N at node 10, but only with weak support (PP 0.68; see Fig. 5.4, 5.1).

Node 57 relates clades K and L but has only very weak support (PP 0.79). Clade K (node 58, PP 1.00, BS 87%) contains four accessions of D. longifolia var. longifolia, three from the Northern Territory and one from the Kimberley, northern Western Australia, together with two Queensland taxa (node 62, PP 0.94), D. sp. aff. nervosa (Blackdown Tableland) and its sister D. rara (Mt Beerburrum), the latter having a relatively long branch length. The basal node of clade L has only weak support (Fig. 5.4, node 63, PP 0.78), but suggests that D. intermedia from Lord Howe Island is related to a well-supported clade (node 64, PP 1.00, BS 70%) composed of D. congesta (New South Wales and Queensland) and the majority of taxa in the D. caerulea complex of Henderson (1987a) (from Victoria, New South Wales and Queensland). Seven of the nine varieties of D. caerulea occur in this clade, with six together supported as a monophyletic group at node 68 (PP 1.00, BS 50%). Only D. caerulea var. Theresa Creek (clade J), D. caerulea var. aquilonia (clade N) and the two samples of D. caerulea var. caerulea (clade F) are placed outside clade L and are not in the D. caerulea species complex (clade L).

Clades M and N are sister clades (Fig. 5.1), but only with support in the Bayesian analysis with PP (0.99) and not in the bootstrap analysis. Clade M (Fig. 5.5, node 81, PP 1.00, BS 82%) includes all eastern Australian D. longifolia taxa from South Australia, Tasmania, Victoria, New South Wales and Queensland. The complex is not monophyletic and the majority of all nodes are poorly supported. The clade also includes species not otherwise recognised as part of the complex or related to D. longifolia, i.e. D. porracea (NSW), D. tarda (SA), D. crinoides (Qld) and D. callicarpa (Victoria).

100

Fig. 5.4. The combined Bayesian majority-rule consensus tree showing clades I (from node 47), J (node 51), K (node 58) and L (node 63). Labels as in Fig. 5.1.

Node 84 (PP 1.00, BS 90%) resolves D. amoena and D. porracea as sister taxa and node 90 (PP 0.86, BS 70%) supports the sister relationship of D. longifolia var. stupata and D. longifolia var. surculosa both from Queensland.

Clade N (Fig. 5.6, node 91, PP 1.00, BS 65%) has a broad geographic distribution from the Indian Ocean to Australia, Taiwan and the Pacific. It includes three subclades (nodes 92, 97, 105) each with good support but as part of a polytomy.

101

Fig. 5.5. The combined Bayesian majority-rule consensus tree showing clade M (node 81); labels as in Fig. 5.1.

The subclade at node 92 (PP 1.00, BS 57%) includes accessions of D. ensifolia from Bangladesh, Malaysia, Taiwan, Madagascar and Mauritius but, the taxon is paraphyletic with D. carolinensis from the Caroline Islands nested within and related most closely to D. ensifolia from the biogeographic region of Madagascar and Mauritius than the four accessions (from Taiwan and Ryukus) of D. ensifolia in clade H.

The second subclade at node 97 (PP 1.00, BS 97%) includes all accessions from the Hawaiian Islands and New Caledonia. Within this subclade, most nodes receive high support. For example, node 98 (PP 1.00, BS 88%) shows the south-west Pacific D. adenanthera (sampled from New Caledonia) as sister to D. multipedicella (Hawaii) and D. sp. aff. lavarum (Maui and Oahu). Another accession of D. multipedicellata (Hawaii) is, however, related to two accessions identified as D. lavarum from the same Island (node 103, PP 1.00, BS 91%). Possibly related to these three is D. sandwicensis from the older island of Kauai, although nodes 101 and 102 are poorly supported (PP 0.50, 0.58 respectively).

The third subclade at node 105 (PP 1.00, BS 88%) includes six species of Dianella from far-north Queensland and the Northern Territory, with one extra-Australian

102

sample of D. ensifolia (CNS138344.1 Brunei) nested within it. D. odorata is resolved as paraphyletic and D. pavopennacea is polyphyletic with the samples of three varieties of the latter species being well separated. Two samples of D. atraxis cluster together supporting the monophyly of that species (node 109, PP 1.00, BS 99%).

Fig. 5.6. The combined Bayesian majority-rule consensus tree showing clade N (node 91). Labels as in Fig. 5.1.

103

5.4 Discussion

5.4.1 Overview 5.4.2 Usefulness of combining data sets The benefits of combining two congruent datasets from different genomes, and the increase in the number of parsimony-informative characters, provide a potential for improvement of the overall phylogenetic signal, particularly for nodes with low to medium support. This may also “increase the support of true clades” (Johnson & Soltis 1998) and produce a gene tree not largely influenced by introgression, incomplete lineage sorting and polyploidy (Pamilo & Nei 1988). In the case of Dianella, the phylogeny based on the combined data set reveals taxonomic and biogeographic patterns, reflecting the putative evolutionary history of the genus.

5.4.3 Outgroup genera The Maximum Likelihood analysis of Wurdack & Dorr (2009) of the super-family Xanthorrhoeaceae resolved a clade of Thelionema, Rhuacophila, Stypandra + Herpolirion (sister taxa), Eccremis + Dianella (sister taxa). Except for Rhuacophila, these taxa were used as the outgroups in the molecular analyses of Dianella reported here.

The results of the combined data set here differ from Wurdack & Dorr (2009) in showing Stypandra (clade A) with a sister relationship to Herpolirion + Thelionema (clade B). Devey et al. (2006) reported a similar result to the phylogeny in this study, with Herpolirion + Thelionema monophyletic. Clade B is strongly supported but relationships within it are not fully resolved. The Bayesian analyses of the combined data set and nrDNA data sets both show Thelionema as monophyletic but with only weak support; in contrast, the MP strict consensus tree shows Herpolirion nested within Thelionema while the results from the cpDNA data set were equivocal. The three species of Thelionema differ in leaf length and overall plant size, and Henderson (1987a) recorded significant differences in seed surface morphology. Thelionema caespitosum and T. grande are the largest (c. 125 cm) and T. umbellatum is distinctly small, c. 40 cm high (Henderson 1987c). T. umbellatum cpDNA and nrDNA sequences are also distinct, the accession sequenced having the longest branch among these species. All species were previously classified in Stypandra and transferred to the new genus of Thelionema (Henderson 1985). Thus, if Herpolirion is nested 104

among Thelionema, and the entire group is treated as a single genus, the older name, Herpolirion Hook.f., would have to be used. Herpolirion novae–zelandiae (Sky lily) is the sole species currently recognised in Herpolirion, but is widespread, occurring in New Zealand and south-eastern Australia. Greater sampling across the geographic range of all of these species, including the sister genus Stypandra and Rhuacophila, is required to confirm the molecular relationships noted here.

To compare with the molecular results, morphological characters were reviewed for Dianella and the outgroup genera by examining Australian specimens and populations in situ, images and specimens (Table 5.2). The fruit of Thelionema, Herpolirion, Stypandra and Eccremis is a loculicidal capsule that is slightly fleshy and dehisces at the apex to release seeds (Moore & Edgar 1970; Henderson 1987b, c; Hewson 1987; Wurdack & Dorr 2009). The inner and outer structures remain intact after drying and some authors suggest the fruit is black at maturity (Edgar 1970; Henderson 1987b, c; Moore & Hewson 1987). My observations indicate the capsule is slightly fleshy and pale green in colour for Thelionema, Stypandra and Herpolirion prior to the release of seeds. For Eccremis, the type illustration indicates the capsule is also light green.

For Dianella and the monotypic Rhuacophila, the fruit is a fleshy berry, which would be a homoplasious character given the phylogeny in Wurdack & Dorr (2009) and Devey et al. (2006) confirmed Rhuacophila and Stypandra to form a monophyletic group. Jessop (1979) described the fruit of Rhuacophila javanica to be pale green/yellow and black at maturity, and it is likely bird dispersed. For Dianella, the commonly blue to purple fruit are dispersed by birds, which may explain the broad distribution and species-richness of the genus in Australia, the Pacific, south-east Asia and the Indian Ocean. Wind could be the dispersal agent for the seeds of Thelionema, Herpolirion and Stypandra, first proposed for Eccremis by Wurdack & Dorr (2009).

Other potentially informative morphological characters among the outgroup genera include leaf and androecium morphology. Equitant (overlapping, distichous) leaves occur in Thelionema, Herpolirion, Rhuacophila, Stypandra and Eccremis (Moore & Edgar 1970; Jessop 1979; Henderson 1987 a, b, c; Wilson 1993; Wurdack & Dorr

105

2009) and in other genera within Hemerocallidoideae, e.g. Phormium. The leaf occlusion zone occurs at the junction of the sheath and blade (Henderson 1987a) and the extent of fusion is important in distinguishing taxa in Dianella (Henderson 1987a). The occlusion zone of Stypandra and Rhuacophila is not fused whereas all other outgroup genera have a degree of fusion (Table 5.2). In Dianella, the occlusion zone is mostly or completely fused for many taxa except for taxa in the D. longifolia complex and species morphologically allied to that group. Additionally, some taxa in the D. caerulea complex (see Chapter 7) and far-north Queensland taxa, i.e. D. incollata, D. odorata, D. fruticans and taxa in the D. pavopennacea complex.

The coiling of the anther after anthesis is well documented for Thelionema, Herpolirion, Stypandra and Rhuacophila (Moore & Edgar 1970, Henderson 1987, Wilson 1993, Wurdack & Dorr 2009), whilst anthers of Dianella and Eccremis remain straight after anthesis (Henderson 1987a, Wurdack & Dorr 2009), which could be interpreted as a synapomorphic character based on the molecular phylogeny of Wurdack & Dorr (2009). Dianella, Stypandra, Eccremis and Rhuacophila contain a swelling between the filament and the anther known as the struma (Moore & Edgar 1970, Henderson 1987a; Wilson 1993; Carr & Horsfall l995). Thelionema and Herpolirion lack a struma, which suggests a synapomorphic character (albeit an absence character) confirming the relationship of these two genera in clade B (Table 5.2).

Degener (1932) noted a tuft of ciliate hairs at the apex of the tepals in Hawaiian Dianella. My observations confirm this character is also evident in Australian and extra-Australian Dianella. Carr (2006) likewise confirmed the presence of this character in the formal description of D. tenuissima. It is also present in Thelionema, Herpolirion, Stypandra, Rhuacophila and Eccremis and other genera within Hemerocalloideae. However, my preliminary investigations indicate the density of the tuft varies between the outer and inner whorl tepals in Dianella and the mentioned genera. Within Australian Dianella, variation in density of the tufts in the inner and outer whorl is evident and the area is also quite papillose, which could relate to the presence of glands or nectaries that have not been documented before in the genus. These could also be potential characters for species identification within Dianella.

106

Table 5.2. A list of the major morphological characters that define genera in Hemerocallidoideae.

Character Dianella Eccremis Rhuacophila Stypandra Thelionema Herpolirion

Equitant leaf Present Present Present Present Present Present sheath

Leaf Open to Fused Open Open Fused Fused occlusion fused Anthers after Straight Straight Twisted Twisted Twisted Twisted pollination Struma Present Present Present Present Absent Absent

Fruit type Fleshy Semi- Fleshy Semi- Semi-fleshy Semi-fleshy fleshy fleshy loculicidal loculicidal loculicidal loculicidal capsule capsule capsule capsule Fruit colour Purple/violet, Light green Light green Light green Light green Light green green, blue Tuft of hair Present in Present in Present in Present in Present in Present in on tepals inner and inner and inner and inner and inner and inner and outer whorl outer whorl outer whorl outer whorl outer whorl outer whorl

5.4.4 Origin and age of Dianella Bremer & Janssen (2006) proposed that the order Asparagales likely originated in Australasia due to the high number of genera in the region. The distribution of Dianella extends from south-eastern Africa, Madagascar and India, to south-east Asia (north to Japan), Australia, Micronesia, New Zealand, New Caledonia, Norfolk Island and Hawaii in the mid-Pacific. Of the other related genera, Thelionema and Stypandra are endemic to Australia, Herpolirion occurs in south-eastern Australia and New Zealand, Eccremis occurs in South America, and the tropical Rhuacophila javanica occurs in the Pacific and Malesia. Other genera in Asparagales with a similar geographic pattern to Dianella include: Caesia (subfam. Hemerocallidoideae), which occurs in South Africa, Madagascar, Australia (east and

107

west) and New Guinea; and Arthropodium (subfam. Asphodeloideae) in Madagascar, New Guinea, Australia, New Caledonia, Australia and New Zealand.

The current distribution of Dianella includes continental landmasses and emergent volcanic islands that likely reflect ancient vicariant and more recent dispersal events. The historical distribution of Dianella and its relatives, however, is arguably the Australian region of Gondwana, where species diversity is highest. The Australian flora is hypothesised to have its origins in the Weddellian Biogeographic Province of Gondwana (ca. 98-65 Myr.), in the Late Cretaceous when south-east Australia, New Zealand, Western Antarctica and the southern region of South America were connected (Hill 2004) and rainforest was widespread. Some of the sclerophyll flora is estimated to be Late Cretaceous-early Palaeogene, such as groups within Proteaceae (Hill 2004, Hill et al. 1998) and the eucalypt group (Ladiges et al. 2003). The rainforests of north-east Queensland contain some of the oldest relictual Gondwanan flora and are considered a window into early plant lineages of the Australian flora (Groves 1999). Dianella is the only genus in the subfamily Hemerocallidoeae to inhabit relictual rainforest in the Wet Tropics region of North Queensland, indicating the genus is likely an old lineage. Dianella species inhabiting these relictual rainforest include D. atraxis, D. bambusifolia, D. caerulea var. Theresa Creek, D. sp. aff. caerulea var. Theresa Creek (Mt Lewis), D. caerulea var. assera and D. caerulea var. petasmatodes (based on field collections as part of this PhD).

As Australia, drifted northwards from Antarctica, latitudinal change altered climate, light and rainfall regimes. This influenced the composition and structure of plant communities c. 35-24 Ma (Frakes 1999), evident today in diverse environments throughout Australia. Sclerophyll genera became more diversified and dominant with the onset of drier climates during the later Paleogene, and a decline in soil quality, resulting in low phosphorus and nitrogen (Hill 1998). Sclerophylly is recorded in the south-west Western Australia in the late Eocene (ca. 41-36 Ma). Carpenter et al. (2015) report evidence of ancient sclerophyllous Proteaceae in central Australia from the late Cretaceous. Today many Dianella taxa occur in the understorey of eucalypt forests, including wet and drier forest environments, with a

108

proliferation of species throughout eastern Australia, east of the Great Dividing Range (Henderson 1987a).

5.4.5 Fossils and molecular dating The paucity of pollen and macro fossils limits our understanding of the age of divergence of monocot genera (Herendeen & Crane 1995). For the Asparagales Birch & Keeley (2013) estimate Astelia s.l. (Asteliaceae) to be 34.2 My old, Late Eocene - Early Oligocene, based on fossils and molecular divergence dating (presumably thus a minimal age). Those authors consider Australia to be the centre of diversity of Astelia, although it is widespread, occurring in New Guinea, New Zealand, New Caledonia, South America, Pacific Islands and the Mascarene Islands. With regard to Dianella, Conran et al. (2008) described a new genus Dianellophyllum (based on a leaf fossil) from Lake Eyre, believed to be most closely related to Dianella and dated in the Eocene (35-50 Mya; see also McLoughlin 2001). Another leaf fossil identified as Dianella is much more recent, from Pagan Island, near Japan, and is estimated as late Quaternary (Fosberg & Corwin 1958). Lee et al. (2012) discussed the recovery of Dianella/Phormium leaves in New Zealand by Maciunas et al. (2009), currently not formally published. Can˜ellas-Bolta et al. (2014) discovered Dianella pollen and seeds in sediment cores at the bottom of a volcanic crater known as Rano Raraku in Easter Island, estimated at 300,000 years old. Based on this evidence, these authors suggested that Dianella was extant in the mid-Holocene on Easter Island.

5.4.6 Biogeographic hypotheses: vicariance and dispersal Wurdack & Dorr (2009) resolved the South American Eccremis as the sister genus to Dianella. One possibility is that Eccremis + Dianella clade was ancestrally distributed across some part of the South American-Antarctica-Australian region of Gondwana. Or the more inclusive clade of these genera together with Stypandra etc. may have been ancestrally in the Australian region with subsequent range expansion and vicariance, isolating Eccremis in South America, with the eventual separation of that continent from Antarctica and Australia. A narrow land connection was maintained between South America and Antarctica, and between Antarctica and Australia until the Late Oligocene (McLoughlin 2001, Hill 2004).

109

Clade D: South-West Western Australia Within Dianella, the molecular phylogeny strongly supports the position of clade D (Fig. 5.3) consisting of taxa from the south-west Western Australia as sister to all other taxa in eastern Australia and outside Australia. This relationship of western and eastern clades is documented for many other plant groups (Burbidge 1960, Crisp et al. 1999, Ladiges et al. 2012). This common pattern is explained by vicariance with the isolation of the south-west during periods of marine incursions into southern Australia, more or less continuous since the late Eocene (Barlow 1981), and eventual uplift of the Nullabor Plain, together with climate change. The inclusion of a taxon in South Australia in clade D (at a terminal branch) suggests a later range expansion from the south-west.

The nodes relating the other Dianella clades E to N to one another, with the possible exception of two (nodes 7 and 11 with PP 1 and 0.99 respectively, Figs 5.3 and 5.5), have either weak or no support and their phylogenetic sequence in the tree (Fig. 5.1) should not be over-interpreted. Thus, the discussion of the biogeographic patterns is presented for the individual clades that have strong support.

Clade E: New Guinea connections The phylogenetic position of the New Guinea species D. serrulata (clade E) as sister to all other clades of Dianella (except those from western Australia) has some support (node 7, PP 1 but no BS support) in the combined analysis (Fig. 5.3). The cpDNA data (Chapter 3) relates D. serrulata and D. sp. aff. serrulata to the samples of D. ensifolia from Malaysia, Taiwan and the Indian Ocean in a relatively basal clade. Although the relationships of D. serrulata are somewhat equivocal, it is clear from the individual and combined data analyses that D. ensifolia is polyphyletic (Figs. 5.3 & 5.6). Given the positions of the various D. ensifolia accessions in the molecular tree, it is likely a number of dispersal events have occurred. The sample of D. ensifolia in clade H suggests dispersal to Taiwan-Yonaguni Island. During the mid- Miocene (c. 15 Ma) the leading edge of Australia (including what is now southern New Guinea) came into contact with the Sunda Arc, forming the present New Guinea land mass and possibly land connections with South-east Asia (e.g. see Barlow 1981), providing opportunity for range expansion of various taxa (Turner et al. 2001) such as Dianella. Further investigation into molecular variation in D. ensifolia could

110

provide insight into geographic connections as well as resolve the taxonomy of this widespread taxon.

Additionally, glacial and interglacial cycles in the Quaternary also saw changes in sea-level and shifts of the Australian coastline leading to patterns of genetic interchange, range expansions, isolation and speciation in flora and fauna (Fox, 1999). Some north Queensland Dianella species extend to New Guinea and Indonesia, which is likely the result of these closer land connections during periods of low sea-level, e.g. D. odorata (North Queensland, Northern Territory, Indonesia, New Guinea), D. bambusifolia (North Queensland, New Guinea and Indonesia) and D. caerulea var. vannata (Queensland, New Guinea).

Clades F, G and H: Eastern Australia to Taiwan and the Ryukyu Archipelago Clades F, G and H (Fig. 5.3) show geographic paralogy: they have overlapping taxon distributions. Clades F and G consist of multiple accessions that simply support the monophyly of two taxa, D. caerulea var. caerulea (KMM666 NSW, KMM1046 Vic) (clade F) and D. tasmanica/D. sp. aff.- tasmanica (clade G) both occurring in Victoria and New South Wales. Clade H (related to F and G but with low support) is more informative of geographic patterns in eastern Australia. The subclades at node 31 and 33 (accessions of D. revoluta and D. brevicaulis) is exclusively temperate south- eastern Australia: Tasmania, South Australia, Victoria and New South Wales. The subclade at node 38 (Fig. 5.3) relates, in phyletic sequence, New South Wales, Queensland, Taiwan and the Yonaguni Island/Ryukyu Archipelago summarised in the notation: New South Wales, Queensland, Taiwan, Ryukyu). The taxa include varieties of D. revoluta/D. sp. aff. revoluta, D. prunina, D. brevipedunculata and accessions of D. ensifolia. The subclade is related to a warm temperate-tropical subclade, possibly associated with climate-driven vicariance.

Other elements of the Australian flora are evident in the Ryukyu Archipelago. Recent phylogenetic studies of Lobelia (Campanulaceae) by Kokubugata et al. (2012) found L. loochooensis (Ryukyu Island endemic) related to L. fluviatilis (Australian endemic), with that clade sister to New Zealand taxa. Solenogyne (Asteraceae) (Nakamura et al. 2012) occurs in eastern Australia and the Ryukyu Archipelago. Long distance dispersal is a likely hypothesis for these biogeographic connections. In the case of Dianella, avian dispersal of fleshy-fruited taxa, with numerous 111

migratory bird routes between these regions is probable (Kokubugata et al. 2012). The pattern here for Dianella clade H suggests a dispersal from Queensland north to Taiwan and the Ryukyu Archipelago, areas of similar subtropical climatic zone, which likely enabled the successful adaptation and evolution of D. ensifolia (Taiwan and Yonaguni Island accessions).

The Ryukyu Islands were once connected to Taiwan and China mainland by a land bridge in the Quaternary c. 2.6 Ma, evident today in the flora and fauna (Chiang & Schaal 2006, Kokubugata et al. 2010). Dianella also occurs in China and is recognised as D. ensifolia s.l, but no mainland samples were available for inclusion in the present study. Further research is required to investigate its taxonomy and further eludicate the biogeographic connections in the region.

Clade I: New Zealand and Norfolk Island Clade I provides strong support for the area relationship of New Zealand (three endemic species included) and Norfolk Island (D. intermedia), which together are related to eastern Australia (represented by the New South Wales endemic D. tenuissima). Without being able to estimate the age of this clade, the origin of the New Zealand taxa is unknown. Hypotheses may include relatively long distance overwater dispersal from eastern Australia, or older dispersal via Zealandia post- Eocene (see Pole 1994, Ladiges & Cantrill 2007, Lee et al. 2001, Lee et al. 2012). Dispersal to the relatively young volcanic Norfolk Island (3.05 2.3 Ma; Pole, 1994) is interpreted from the phylogeny as from a New Zealand source. The Norfolk Island D. intermedia is genetically distinct and not the same taxon as D. intermedia from Lord Howe Island, which is in clade L (see below).

Clades J, K and L: Northern Australia to Lord Howe Island These three clades include taxa from northern Australia (Kimberley, Top End), north Queensland (e.g. Wet Tropics), south-eastern Queensland, New South Wales and Lord Howe Island to Victoria. Clade J indicates that ‘D. sp. aff. caerulea var. Theresa Creek’ from Mt Lewis and Mt Bartle Frere in the Wet Tropics is sister to a clade of other Queensland taxa, suggesting that the former is a relatively old lineage. Clade K relates the Kimberley and Northern Territory ‘D. longifolia’ to Queensland taxa. Clade L shows the relationship of the Lord Howe Island ‘D. intermedia’ as sister to the D. congesta + D. caerulea complex largely in New South Wales and Queensland. 112

Lord Howe Island is the most southern volcanic island on the Lord Howe Rise, having emerged at 6.9 Ma (McDougall et al. 1981). Older drowned sea mounts are to the north. The origin of Dianella on Lord Howe Island may have been by dispersal from eastern Australia directly or via the older island chain.

Clades M and N: Into the Indian Ocean and the Pacific Clade M is another example of a clade distributed from South Australia to Tasmania, Victoria, New South Wales and Queensland, including various accession of D. longifolia (not monophyletic) and five other related species. Greater sampling may reveal area relationships across this region for comparison also with other clades with a similar geographic range (discussed above).

Clade N (Fig. 5.6) is weakly supported as sister to clade M. Clade N includes three subclades that extend the range of Dianella from Australia west into the Indian Ocean east into the central Pacific. One subclade is representative of tropical Queensland, including D. odorata, D. bambusifolia, which extends to New Guinea, and one sample of D. ensifolia from Brunei. D. saffordiana, a species described from the Island Guam (north of New Guinea) is absent from the phylogeny is morphologically allied to D. odorata, based on stem, leaf and inflorescence morphology. The inclusion of this taxon in further phylogenetic studies would likely assist in eludicating the radiation of Dianella in this region.

The second subclade includes samples of D. ensifolia from India, Malaysia + Taiwan, and Madagascar + Mauritius. D. carolinensis is nested within this subclade as sister to the D. ensifolia accessions from Madagascar and Mauritius.

D. carolinensis is a Micronesian taxon from the Island of Babeldaob (part of the Caroline Islands archipelago), which is 900 km north of Indonesia and 1000s of km from Madagascar and Mauritius. The distribution is possibly interpreted as a result of dispersal from northern Australia and separate from that described for clade H (towards Taiwan). The dispersal route is unclear given the low support for node 93 (clade N, Fig. 5.6) and the number of accessions able to be included in the analysis. However, it is likely Dianella is a relatively recent arrival to Mauritius from Madagascar, Mauritius being c. 8 My old, part of an archipelago of volcanic islands, the Mascarene islands (Mc Dougal & Chauman 1969, Debjatyoti et al. 2005). Little 113

is known about Dianella in south-eastern Africa (the Chimanimani mountains, Zimbabwe), which is recognised as D. ensifolia (Wild 1953) and further sampling is required for more detailed molecular analysis.

The third subclade relates all of the Hawaiian Island accessions but with D. adenanthera (sampled from New Caledonia) nested within it, related to a cluster of Hawaiian samples from Oahu-Maui-Hawaii (node 97, Fig. 5.6). D. adenanthera occurs not only in New Caledonia (Henderson 1988) but also Rarotonga and Tonga (de Lange & Murray 2003). The volcanic Hawaiian Islands have a high level of endemicity in the flora (Wagner et al. 1990a), although the current emergent islands of Hawaii are relatively young, having formed sequentially: Kauai 5.1 Ma, Oahu 3.7 Ma, Lanai 1.3 Ma, Maui 1.75 Ma and Hawaii 0.5 Ma (Grigg 2012). Older islands in the chain have eroded and have been submerged. Various authors suggest that plant dispersals throughout the Pacific, are the result of bird transport of seeds and fruits and island hopping, which may be the case for Dianella (Carlquist 1967). New Caledonia is one possible source from which Hawaiian Dianella has evolved, but there may have been more than one colonisation event.

New Caledonia (Ladiges & Cantrill 2007) is approximately c. 6,000 km to the south- west of the Hawaiian Islands and c. 3,000 km east of Australia. The island has a high level of endemism, with many taxa having phylogenetic links to Australia. There is argument over the role of vicariance between the two regions (for old lineages with limited dispersal abilities, Ladiges & Cantrill (2007) and more recent dispersal to New Caledonia by frugivorous birds (Carlquist 1967; Bayly et al. 2013). The geological history of present-day New Caledonia is complex, dating from the Oligocene but with the possibility of emergent land persisting in the greater New Caledonian area from the Eocene (Ladiges & Cantrill 2007), and the biogeography is probably a result of both vicariance and dispersal. It is not possible to determine the origin and age of the New Caledonian Dianella from this study other than to note that D. adenanthera is in clade N that includes a subclade of Queensland taxa. Furthermore, five species described by Schlittler (1940) as endemic to New Caledonia were not included in the phylogeny, due to difficulties in obtaining plant material and these need to be sequenced to understand the taxonomy, biogeographic

114

connection to Australia and radiation in the Pacific (Schlittler 1940, Henderson 1988, Green 1994).

5.4.7 Chromosome evolution in Dianella Barlow (1981, and references cited within) highlighted the role of polyploidy as a mechanism of speciation in the Australian flora, particularly the arid flora. One south-eastern Australian mesic example is the polyploid series in Triglochin (2n=16, 32, 48) that correlated well with morphology and species delineation (Rob & Ladiges 1981).

For Dianella, the plesiomorphic chromosome number is 2n=16 (see Chapter 1), based on outgroup comparison with Herpolirion 2n=16, Thelionema 2n=16, Stypandra 2n=16 for Queensland and 2n=16, 32 for Western Australia (Moore & Edgar 1970; Henderson 1987a, b; Russell 1998), and patterns within Dianella clades. Other chromosome counts indicate that polyploidy (2n=32, 48, 64, 76, 80, 84) has arisen independently in a number of clades, G, H, I, J, L, M and N, although counts are unavailable in various taxa and some counts and identifications require further investigation.

Clade G indicates polyploidy within the complex of D. tasmanica with numerous Tasmanian samples having a count of 2n=80 and also counts of 2n=76, 84 (Curtis 1952). For mainland Australia, Curtis (1952) recorded samples with 2n=16 and 2n=64 for Victoria, New South Wales and Australian Capital Territory. Samples from Mt Hotham (Victoria) and Mt Ginini (Australian Capital Territory) are both 2n=16, and could be D. sp. aff. tasmanica (Snowfields) based on their locality (Muscat 2009).

In Clade H the subclade at node 30 (PP 1, BS 86%) indicates that D. brevicaulis (Tasmania) has the plesiomorphic count 2n=16 (Henderson 1987a) and is sister to a subclade of two D. revoluta var. divaricata accessions (no known counts). D. revoluta var. revoluta from Victoria and New South Wales (node 31) appears to include polyploids with counts recorded for this variety of 2n=16, 32, and 48 (Curtis 1952). The subclade at node 38 (PP 1, BS 80%) indicates that D. revoluta var. tenuis and D. prunina with 2n=16 are related to D. revoluta var. minor, which is tetraploid 2n=32 (Henderson 1987a). Other taxa in this subclade are also 2n=16 (D. 115

brevipedunculata and D. revoluta var. vinosa) (Henderson 1987a). However, there are no counts available for D. ensifolia from Taiwan and Japan, although D. ensifolia from India (clade N) is reported to be 2n=28, 34, 40 (Nandi 1974; Sharma & Chatterjii 1958).

In clade I, D. intermedia from Norfolk Island is octoploid 2n=64, while all three New Zealand species are 2n=16 (de Lange & Murray 2003). Thus, speciation on Norfolk Island is likely to be associated with polyploidy. There is no count for the related New South Wales taxon D. tenuissima. Similarly, in clade J (node 54, PP1.00, BS 100%) D. nervosa is polyploid with 2n=32; it is sister to D. fruticans, whose chromosome number is unknown; both species are from north Queensland.

D. caerulea is polyphyletic (clade J, L and N). However, D. caerulea var. caerulea (clade L) is reported to have 2n=32 and 48 while D. caerulea var. producta is 2n=32, and D. caerulea var. cinerascens and var. assera are 2n=16 (Henderson 1987a). D. caerulea var. vannata requires further study but it appears to be paraphyletic although only two accessions were included (clade L); it is reported to have chromosome counts of 2n=16, 32 and 48 (Henderson 1987a). D. congesta, which is the sister to D. caerulea has 2n=16 (Henderson 1987a).

As an example, chromosome counts are mapped onto the phylogeny for taxa represented in clade M (Fig. 5.7). Again, missing counts restrict conclusions but it is suggested that the polytomy of Queensland and one Victorian taxon (refer to arrow in Fig. 5.7) (PP 0.81, BS 69%) may resolve on chromosome number, relating Queensland taxa D. crinoides (2n=48) with D. longifolia var. surculosa (2n=48) and D. longifolia var. stupata (2n=32, 48) (Henderson 1987a). D. longifolia var. stenophylla has the plesiomorphic count of 2n=16; it may be sister to D. amoena (Victoria) but there are no recorded counts for the latter. It would be interesting to compare these samples from Queensland and other ‘D. longifolia' from South Australia (also in clade M).

116

Fig. 5.7. Clade M with the chromosome counts (2n) mapped on the tree.

In Clade N, the subclade at node 97 is highly supported (PP 1, BS 97%). Although more counts are needed and for specific localities, it may be that this New Caledonian-Hawaiian subclade has evolved through polyploidy. D. adenanthera sampled from Rarotonga and Tonga (de Lange & Murray 2003) is recorded to be an octoploid 2n=64 and D. sandwicensis s.l. is recorded as 2n=32, 40, 70. Polyploidy is evident on the Hawaiians islands with 80% of genera documented as polyploids (Wagner et al. 1990a; Carr 1978).

In the subclade at node 105 in clade N (PP 1, BS 88%), D. pavopennacea from Queensland is polyphyletic. At node 106 it includes polyploids D. pavopennacea var. robusta with counts of 2n=32 and 48, and node 110 D. pavopennacea var. major with 2n=32 (Henderson 1987a). D. pavopennacea var. pavopennacea is 2n=16 and in a different subclade (node 111) together with D. bambusifolia and D. odorata also 2n=16 (Henderson 1987a).

For ‘D. ensifolia’ s.l., only two chromosomal studies are known. Nandi (1974) recorded D. ensifolia (Shillong, Eastern Himalayas 4,500 ft.) and D. ensifolia var. variegata (Nursery variety, Calcutta) to have 2n=40, and D. ensifolia (Khasia Hills, India) as 2n=34. Sharma & Chatterji (1958) investigated D. variegata (likely to be D. ensifolia s.l.) and recorded 2n=28, however, they did not provide a locality for the specimen. Based on this evidence, all of these are considered to represent the taxon 117

in India. Counts are needed for D. ensifolia from Madagascar, India, Caroline Islands, Malaysia and Taiwan and other parts of its range, Reunion, the Seychelles, SE Asia and the Phillipines throughout the Pacific to test whether any of these populations are polyploids.

Apomixis is documented for D. tasmanica by Curtis (1952), and for D. tenuissima by Carr (2006) who reported cleistogamy, indicating non-opening, self-pollinating flowers. Bicknell & Koltunow (2004) state that polyploids and diploids are commonly apomitic perennials that can grow asexually by rhizomes and develop large clonal stands. They can be morphological forms not true to species, leading to difficulties in identification purposes (Otto & Whitton 2000, Bicknell & Koltunow 2004). Apomicts can occur in environments where individuals or populations are widely dispersed, for example in rainforest environments, which reduces reliance on pollination events (Asker & Jerling 1992). Observations of Dianella taxa in a living collection in a glasshouse indicate that rainforest species regularly produce fruit, e.g. D. atraxis and D. bambusifolia, while many other taxa do not, suggesting that the former are potentially apomictic or self-incompatible. Further research is required to investigate pollination syndromes.

Dianella tasmanica s.l. occurs in a range of environments, including wet sclerophyll forests and subalpine communities (Henderson 1987a, Muscat 2009) to the foreshore of beaches in a sand substrate (pers. comm. K.M.M). Being apomictic and a polyploid may have contributed to its ability to inhabitat such a range of environments. Hybrids are noted for Dianella (Henderson 1987, Heenan & de Lange 2007), which may also lead to allopolyploid apomictic progeny (Bicknell & Koltunow 2004), which is another pathway to the development of morphological variation.

5.4.8 Combined phylogeny and summary of species taxonomy The combined phylogeny resolved a number of clades that agree with the current species taxonomy. These are D. atraxis, D. congesta, D. nervosa and D. fruticans. It is also assumed that all New Zealand species, D. latissima, D. nigra and D. haematica, and the Australian D. tenuissima, D. incollata are accepted even though this current study was only able to include single accessions. Nomenclatural changes

118

are recommended for the remaining taxa included in this study. For a summary of these changes, refer to Table 5.3.

5.4.9 D. revoluta complex The D. revoluta complex as recognised by Henderson (1987a) includes D. revoluta var. revoluta, var. divaricata, var. tenuis, var. minor, var. vinosa and D. brevicaulis. The group was polyphyletic, with accessions placed in clade D (south-west Western Australia, Nullarbor, Eyre Peninsula and Murray Region of South Australia) and clade H (Victoria, New South Wales, Tasmania, South Australia, Queensland). The narrow endemics D. prunina (NSW759138) and D. brevipedunculata (KMM46) are also placed here in clade H, not previously included in this complex.

Carr & Horsfall (1995) raised D. revoluta var. brevicaulis Ostenf. to species level (Henderson 1987a). The type locality of D. brevicaulis is Yallingup Cave, Western Australia (Henderson 1987a). All of clade D could be assigned to the name D. brevicaulis with D. revoluta restricted to eastern Australian populations. However, a detailed population study is recommended for Western Australia and South Australia before taxonomic changes are published.

In clade H, the lineages from node 30 represent three varieties. These are var. revoluta (node 31, NSW, Victoria) with the type locality occurring in Port Jackson NSW, var. divaricata (node 36) represented by the three samples from SA and Victoria (but no samples were from the type locality, King George Sound, WA) and var. nov., representing the three samples of ‘D. brevicaulis’ (node 34) from south- eastern South Australia, Victoria, Tasmania. D. sp. nov. Blue Mountains KMM667NSW (node 39) would have to be considered a new species, sister to Queensland, New South Wales, Taiwan and Yonaguni Island taxa (currently D. ensifolia). It is known from a few localities in the Blue Mountains region and can be distinguished by flower, inflorescence and leaf morphology. D. revoluta var. tenuis and var. minor (Henderson 1987a) would also each need to be raised to species, the same rank as D. prunina. Dianella brevipedunculata would be retained as a species and consequently D. revoluta var. vinosa would be raised to species. These taxa all show morphological differences.

119

5.4.10 D. caerulea complex Dianella caerulea var. Theresa Creek (Mt Bartle Frere) and D. sp. aff. caerulea var. Theresa Creek (Mt Lewis) clustered together in clade J and not in the D. caerulea complex. They should be treated together as a new species with two subspecies. Observation of a living collection has identified that the flowers of D. sp. aff. caerulea var. Theresa Creek (Mt Lewis) lack a struma, which is a key character that defines the genus and presumably is a secondary loss in this form. D. caerulea var. Theresa Creek (Mt Bartle Frere) does have a struma.

Dianella caerulea var. aquilonia clustered in clade N with far-north Queensland Dianella and should be investigated further since it is likely not part of the D. caerulea complex based on the phylogeny. The key characters to distinguish this taxon are a narrow inflorescence and distinctive seed morphology. It is very similar in leaf and inflorescence morphology to D. caerulea var. vannata, which also extends throughout the Cape York region and to New Guinea, but is genetically distinct from var. aquilonia, being placed in clade L. Further research is required to assess populations from New Guinea identified in herbaria as var. vannata because they could, alternatively, belong to the lineage identified here as var. aquilonia.

With the exclusion of the above, the D. caerulea complex is monophyletic. Clade L (node 63) is composed entirely of D. caerulea with seven varieties and possibly undescribed forms (analysed further in Chapter 7). Var. assera and var. producta are the only taxa to have extravaginal branching in the complex and thus may be related.

Some other far-north Queensland Dianella species (e.g. D. atraxis, D. bambusifolia, D. odorata and D. pavopennacea complex) also have extravaginal branching, but, they are in a different clade, not sister taxa.

The two accessions of D. congesta form a monophyletic group that is strongly supported as related to the D. caerulea complex (possibly as sister to other members, but with weak support). D. congesta rarely has denticles along the leaf margin and midrib (Henderson 1987) (occasionally on the leaf apex). In contrast, the leaf margins of taxa in the D. caerulea complex have many denticles. The cyme and cymules of D. congesta are quite contracted, and have some similarities to those of D. caerulea var. cinerascens and the more distantly related var. aquilonia (clade N). 120

A review of SEM images of Dianella seeds in Henderson (1987a) and seed collections as part of this thesis indicates the seed morphology of D. congesta is identical to that of taxa in the D. caerulea complex, which is further evidence of their sister relationship.

5.4.11 D. longifolia complex Dianella longifolia is polyphyletic occurring in clade K (Northern Territory, Kimberley, Western Australia and Queensland) and clade M (Victoria, New South Wales, Tasmania, South Australia and Queensland).

In clade K node 58, D. longifolia var. longifolia (North Territory and Western Australia) is clearly not related to samples given the same name in clade M from eastern Australia and should be recognised as a new species. Although it appears to be paraphyletic in clade K, nodes 59 and 60 lack bootstrap support and could collapse, allowing the possibility of monophyly. Further field work is required to determine morphological characters to distinguish this taxon. Also in clade K, D. sp. aff. nervosa (node 62) should be raised to specific rank. It is different from D. nervosa s.s. having distinctive sheath morphology.

Clade M includes taxa currently not recognised in the D. longifolia complex of Henderson (1987a), i.e. D. amoena, D. tarda, D. porracea, and D. crinoides. The inclusion of D. amoena would extend the distributional range of the complex to Tasmania (de Salas & Baker 2015). Further research is required to resolve the relationships between taxa in this group due to the poorly supported nodes in this study, and therefore no nomenclatural changes are suggested at this time.

5.4.12 D. pavopennacea complex The D. pavopennacea complex was described by Henderson (1987a) and is composed of three varieties. The phylogeny found the group to be polyphyletic and all two varieties clustered with far-north Queensland taxa in clade N. Based on this evidence, the complex should not be recognised. The review of specimens and plants growing in a glasshouse has provided additional evidence to support the need for nomenclatural change. D. pavopennacea var. major was related in the molecular phylogeny, with high PP and BS support, to D. incollata, with which it shares some similarities in leaf and stem morphology, although they have differences. 121

Specimen GS2087 identified as D. pavopennacea var. robusta is resolved in a basal position in a subclade with D. caerulea var. aquilona, D. incollata and D. pavopennacea var. major. GS2087 was grown in a glasshouse and had an above ground stem up to 2 metres long, extravaginal branching units, and a completely fused leaf occlusion zone. Henderson described this character for the complex to be “slightly occluded”, and therefore further taxonomic study is required to examine populations of var. robusta in situ. This subclade of clade N requires further taxonomic study.

5.4.13 Taxa not part of the taxonomic complexes The majority of far-north Queensland taxa clustered together with high support in clade N (node 111). This “far-north Queensland Group” included, D. bambusifolia, D. odorata, D. ensifolia Brunei and D. pavopennacea var. pavopennacea discussed above. The three samples of D. odorata (two from Queensland and one from the Northern Territory) were not monophyletic. Review of these specimens indicates there are no clear morphological differences to distinguish the individuals, and I suggest they should all remain under D. odorata in the absence of stronger evidence regarding morphological and genetic variation in the species. D. ensifolia Brunei should be recognised as a distinct taxon, although more samples need to be investigated for confirmation. The examination of the one specimen included indicated that it differed in leaf and inflorescence differences from other D. ensifolia samples (clades H and N).

The two samples of D. caerulea var. caerulea, one from New South Wales and one from Victoria, grouped together (in clade F) and should be assigned to D. laevis var. aspera.

In clade G, one sample of D. tasmanica clustered with two samples assigned to D. sp. aff. tasmanica Deua (New South Wales) and D. sp. aff. tasmanica Mt Buffalo (Victoria). Three varieties of D. tasmanica thus could be recognised. Morphological differences between them were noted in Chapter 4.

122

5.4.14 Phylogenetic and taxonomic relationships of extra-Australian Dianella

D. ensifolia Dianella ensifolia occurred in multiple clades, and distinct taxonomic units are recognised. Accessions of D. ensifolia (Taiwan, Yonaguni Island, Ryukyu Island group) were in clade H (node 44). According to the descriptions on the herbarium specimens sampled, they were from evergreen broad leaf forest. They are quite different from the protologue drawing of D. ensifolia, particularly in leaf morphology. The detailed line drawing and description of the species (in English) is similar to the four specimens at nodes 44, 45, particularly with regard to aboveground stem, leaf, inflorescence and pedicel morphology. Ryokichi Yatabe (1803) described D. straminea for the Ryukyu Islands but that name is currently treated as synonymous with D. ensifolia. Yatabe (1803) noted denticles along the leaf margins as a key character to distinguish D. straminea from D. ensifolia. However, the specimens I examined from herbarium loans mostly lacked denticles on the leaf margins and mid rib. This could be the result of ageing specimens. The examination of in situ populations is needed to determine the presence or absence of denticles and to examine other morphological characters not available in herbarium specimens, particularly flowers, fruit and seeds. In summary, specimens of D. ensifolia (Taiwan, Yonaguni Island, Ryukyu Island group) should be reinstated as D. straminea but require further field work for an accurate species description.

Specimens of D. ensifolia from Bangladesh, Malaysia and Orchid Island (Taiwan) (clade N, nodes 93, 94) are morphologically similar to the type drawing and description of D. ensifolia Redouté. D. ensifolia Orchid Island (TNS9529075) occurs approximately 72 km south-west of Taiwan and in close proximity to Yonaguni Island; it is sister to a subclade containing D. ensifolia Malaysia and D. ensifolia Bangladesh. Photographs of D. ensifolia from Bangladesh show that denticles and raised ridges occur along the branching units of the inflorescence, characters that are not shown in the type drawing of D. ensifolia nor found on other D. ensifolia specimens included in this phylogeny. Raised ridges on the raceme are also evident in Queensland taxa, particularly those in the D. caerulea complex (see Chapter 7). Further research is required to examine populations in situ and to determine if D. ensifolia from Bangladesh should be recognised as a distinct taxon. 123

A review of the morphology of the specimens of D. ensifolia from Madagascar and Mauritius indicates that they are similar to each other and distinctive when compared to other D. ensifolia samples included in this phylogeny. They share tall, aboveground stems with alternate cauline leaves and denticles along the leaf margins, and a fused occlusion zone. The translation of the type description of D. mauritiana, a taxon currently merged in D. ensifolia, indicates this taxon has similar morphology to Madagascan Dianella and the name should be reinstated. Although D. carolinensis does not occur in the same geographic region, in the phylogeny it is sister to Madagascar and Mauritius Dianella. D. carolinensis shows similarities to plants from Madagascar in above ground stem morphology, the presence of cauline leaves and inflorescence morphology but it is distinguished by an open leaf occlusion zone and the absence of denticles along the leaf margins and mid rib.

Pacific region: New Zealand This research shows New Zealand Dianella to be monophyletic, with D. haematica sister to D. nigra and D. latissima with high support. D. intermedia Norfolk Island is sister to all New Zealand Dianella. D. tenuissima is sister to D. intermedia Norfolk Island (with high PP support, but with no BS support) and is a narrow endemic in the Blue Mountains of New South Wales.

The sample of D. intermedia from Lord Howe Island clustered with D. caerulea taxa (Fig. 5.4) and other authors have suggested that D. intermedia Lord Howe Island is a taxon separate from that on Norfolk Island (Green 1994; de Lange et al. 2005). Morphological differences between them can be confirmed, particularly inflorescence characters, and they are here treated as different species. Additional field research is required to undertake a morphological assessment and to observe multiple populations to develop a species description.

Hawaii The phylogeny suggests six taxa endemic to the islands (Table 5.3). The morphology of these is analysed and discussed in detail in Chapter 6.

New Guinea Two accessions of D. serrulata and one of D. sp. aff. serrulata formed clade E. D. serrulata (NSW870233 New Guinea) and D. serrulata (DGF Y8/Y34 New Guinea) 124

are morphologically similar to the holotype of D. serrulata (Hallier 1914) but were paraphyletic, with D. sp. aff. serrulata (NSW841071 New Guinea) nested between them. Either all three should be treated as the same species or some splitting will be required, following further sampling and analysis. According to the locality information on the specimens, all taxa occur in montane to lowland closed forest environments in the Western Highlands, Mandang Province region, from 750 m to 2300 m in altitude.

5.5 Conclusion The combined phylogeny provided additional resolution of relationships and biogeographic connections of Australian and extra-Australian Dianella. A north Queensland-south-east Asia-Indian Ocean-Pacific relationship is inferred and a New Zealand-Norfolk Island-Australia clade provides evidence of radiation in the Pacific region. Lineages in the phylogeny can be correlated with morphology, providing further evidence for the recognition of new taxa and rearrangement of some of the complexes of Henderson (1987a). Further research is required to investigate polyploidy within Dianella taxa, which may provide additional insights into speciation and radiation of the genus.

125

Table 5.3. Current status of the genus based on the phylogeny.

Clade Taxa Distribution Comment Clade D D. brevicaulis sensu stricto South-western D. brevicaulis WA node 16, Australia and SA requires a population study to further clarify the number of taxa (Type is from Western Australia).

Further research is D. revoluta var. revoluta required to examine D. revoluta var. divaricata populations in situ and D. sp. aff. brevicaulis perform molecular research Clade E D. serrulata New Guinea Further research is node 22 D. sp. aff. serrulata required to examine populations in situ

Clade F D. caerulea var. caerulea Victoria, New Requires formal node 25 South Wales recognition. Specimens include (KMM666 NSW, KMM1046 Vic)

Clade G D. tasmanica Victoria, New Three subspecies to be node 26, South Wales described: 27 var. tasmanica s.l var. ‘Mt Buffalo’ var. ‘Deua NP’ Clade H D. revoluta (nodes 31, 34, Victoria, New Three varieties: node 29 36) South Wales, SA, D. revoluta var. revoluta nodes 31, Tasmania D. revoluta “was 34, 36 brevicaulis” (node 34) nodes 43, D. revoluta “divaricata”

44 D. sp. aff. revoluta New SouthWales Further investigation and possible recognition (KMM667, NSW)

D. revoluta var. tenuis Qld Examine pops. in situ D. prunina Qld To remain unchanged D. revoluta var. minor Qld Examine pops. in situ D. brevipedunculata Qld To remain unchanged D. revoluta var. vinosa Qld Examine pops. in situ

D. ensifolia (node 44, 45, 46) Taiwan, Likely to be D. Yonaguni Island straminea, (currently synonymous with D. ensifolia). Additional field work is required to confirm morphology

126

Clade Taxa Distribution Comment Clade I D. tenuissima New South Wales To remain unchanged node 47 D. intermedia Norfolk Island To remain unchanged D. haematica New Zealand To remain unchanged D. nigra New Zealand To remain unchanged D. latissima New Zealand To remain unchanged Clade J D. caerulea var. Theresa Nth Qld Each sample to be node 51 Creek & D. sp. aff. caerulea described as a subspecies nodes 54, var. Theresa Creek (node 52) based on molecular and 55 morphological evidence

D. fruticans Nth Qld Examination of populations in situ

D. nervosa Nth Qld To remain unchanged Clade K D. longifolia var. longifolia North Australia, Monophyly not clear but node 58 Kimberley and some nodes (60, 62) not Top End strongly supported. Qld Further research is required to examine morphology of populations in situ

D. sp. aff. nervosa Blackdown A new species, requiring Tableland examination of populations in situ

D. rara To remain unchanged Clade L D. intermedia Lord NSW See Chapter 5, appears node 63 Howe Island paraphyletic but nodes 63 nodes 64, collapses 66, 67-68 D. caerulea complex Qld, NSW, to 80 Victoria

D. caerulea sensu. strict. To remain unchanged, D. congesta based on this analysis. See D. caerulea var. assera Chapter 7 D. caerulea var. vannata D. caerulea var. producta D. caerulea var. protensa D. caerulea var. petasmatodes Further research to examine the taxonomy of D. sp. aff. caerulea KMM807 populations in situ

127

Clade M D. longifolia clade Eastern Australia Internal nodes, clade M Vic largely unsupported and node 81 D. callicarpa Tasmania should be collapsed D. longifolia var. longifolia NSW D. longifolia var. grandis SA All taxa in clade M to D. longifolia var. stupata, Qld remain unchanged. D. longifolia var. surculosa Additional molecular D. amoena and morphological D. porracea research is required D. tarda D. crinoides Clade N D. ensifolia Malaysia, Bangladesh, These specimens are Taiwan node 91 likely D. ensifolia (L.) Redouté. Further field nodes, work is required to 93,94 examine populations node 95 in situ node 96 D. carolinensis Caroline Islands To remain unchanged node 98 D. ensifolia Madagascar, Mauritius Nodes 99 Likely to be Dianella mauritiana, further field to 104 work is required

D. adenanthera (node 98) New Caledonia To remain unchanged

Hawaiian Dianella D. multipedicellata (nodes Oahu, Hawaii Refer to Chapter 6 for a 99-104) morphometric review of D. sp. aff. lavarum Maui, Oahu Hawaiian Dianella D. lavarum Big Island Hawaii D. sandwicensis Oahu D. sandwicensis Kauai Clade N D. atraxis Nth Qld To remain unchanged D. caerulea var. aquilonia Nth Qld Raised to species, more node 105 field work is required for species descriptions

D. incollata Nth Qld To remain unchanged

D. pavopennacea var. Nth Qld pavopennacea var. major and robusta to D. pavopennacea var. Nth Qld be raised to species; major further field work is required for plant D. pavopennacea var. Nth Qld descriptions and robusta to clarify the taxonomy of var. robusta

D. odorata Nth Qld, NT To remain unchanged

D. ensifolia Brunei Raised to species

128

Chapter 6: A morphometric study of Hawaiian Dianella

6.1 Introduction Dianella occurs throughout the Pacific and extends northeast to the Hawaiian and Marquesas Islands (Wagner et al. 1990b). The indigenous people of the Hawaiian Islands used Dianella for multiple purposes. The leaves were braided for cordage and were a component of housing construction (Abbott 1992). The fruit was a source of dye; purple and true blue was obtained with the additional use of lime (Krauss 1993). Six species are recorded for New Caledonia, one species (D. intermedia) for Norfolk Island and Lord Howe Island (although accessions analysed in Chapter 5 show these are distinct) and three species in New Zealand (Govaerts et al. 2016). Based on the review of herbarium specimens, the genus also occurs in the Cook Islands, Fiji, Society Islands and throughout eastern Polynesia, currently identified as D. adenanthera.

The location of the Hawaiian Islands remote from major continents, coupled with a tropical environment and rich volcanic soils, has resulted in high plant species diversity and endemism (Wagner et al.1990a; Campbell 1928). In the past, up to four species of Dianella were recognised on the islands (Degener 1932). However, currently, only one species is recognised: D. sandwicensis (uki’uki’), which is known to inhabit all major islands excluding Niihau and Kahoolawe (Hooker & Arnott 1832, Wagner et al.1990b, Skottsberg (1937). The species occurs in a range of environments including mesic forest, dry shrubland, wet forest, grassland and dry lava fields at altitudes of 120–2140 m (Wagner et al.1990b).

Analysis of the combined molecular data set (Chapter 5) revealed one highly- supported clade of all accessions from Hawaii together with one accession of the south-west Pacific taxon D. adenanthera sampled from New Caledonia. The molecular analysis also revealed genetic variation among accessions sampled from Hawaii, bringing into question the current recognition of only one species.

129

Dianella sandwicensis was described by Hooker & Arnott (1832) from the Sandwich Islands, the earlier name of the Hawaiian Islands given by James Cook in 1778. Baker (1875) chose to merge D. sandwicensis with D. ensifolia.

For Hawaii, Hillebrand (1888) only recognised D. odorata, which is currently understood to occur from Malesia to northern Australia (Govaerts et al. 2016). Brown (1930) reinstated D. sandwicensis and indicated the taxon occurs in the Marquesas as well as the Hawaiian Islands. Degener (1932) provided the first detailed illustrations of Hawaiian Dianella and recognised D. sandwicensis and two new species, D. lavarum and D. multipedicellata. Skottsberg (1937) agreed that D. sandwicensis likely occurs on Oahu and the Marquesas, but was doubtful whether D. multipedicellata was sufficiently distinct from D. sandwicensis. He provided no taxonomic comments about D. lavarum and considered Degener’s treatment of three Hawaiian taxa to “say practically nothing” to delimit the taxa. He reduced the number of Hawaiian Dianella to one taxon, D. sandwicensis. Fosberg (1969) followed the opinion of Skottsberg (1937) and was dubious about D. lavarum and D. multipedicellata being given specific rank and so he treated them as varieties, D. sandwicensis var. lavarum and D. sandwicensis var. multipedicellata . According to Fosberg, characters distinguishing var. lavarum are pale blue flowers, smaller racemes and pale blue fruits. The variety D. multipedicellata was characterised by numerous flowers on a branchlet, a character also recognised by Degener (1932). Furthermore, Fosberg (1969) questioned whether D. multipedicellata required any formal classification, even at varietal rank. More recently, Wagner et al. (1990b) followed Skottsberg (1937), recognising only the one species, D. sandwicensis. To date, no study has collected and statistically analysed morphological or genetic variation in populations of Dianella across the Hawaiian Islands. A comprehensive morphological analysis, combined with the limited molecular sampling (Chapter 5), may provide evidence for recognition of multiple taxa from what is currently accepted as within - species variation of D. sandwicensis.

6.1.1 Chapter aims This study had two major aims: (1) to examine the morphological variation of Hawaiian Dianella using fresh material and statistical analyses, with comparison to

130

the more limited molecular study of Chapter 5 and (2) to provide descriptions and a dichotomous identification key for taxa recognised.

6.2 Methods

6.2.1 Sampling Prior to the commencement of field work, as a preliminary review of morphological variation, herbarium specimens of Dianella from throughout the Pacific region were examined, with an emphasis on the Hawaiian Islands. Specimens were examined from the National Tropical Botanical Garden (PTBG), Herbarium Pacificum (BISH), IRD Noumea (NOU) and Auckland Museum (AK). Flower and fruiting times were documented so that a collecting itinerary could be developed.

Field work was conducted on the islands of Oahu, Hawaii, Kauai and Maui with Natalia Tangalin (National Tropical Botanical Garden) between March and April 2012. Joe Lau, a local Dianella expert assisted with finding localities on Oahu and took part in the field trips. The type localities of D. lavarum, D. multipedicellata and D. sandwicensis (Degener 1932) were visited, including the Wainane Mountains (Oahu) and Kau Desert (Hawaii Volcanoes National Park, Hawaii). Collecting permits were sourced from the Department of Land and Natural Resources (Honolulu) to collect in Natural Area Reserves (NARS). The US National Park Service provided a permit to collect Dianella in Hawaii Volcanoes National Park. Collections were also made under the collecting permit of Natalia Tanglain of the National Tropical Botanical Garden.

At each locality, five mature plants were collected across an area with a 20–50 metre diameter to ensure separate individuals were sampled. This was particularly important for populations that developed large clones. Aboveground stems with leaves, inflorescence, and where possible flowers and fruits were collected and pressed, and plant habit was recorded. It was important to choose specimens at the same stage of development, in particular those with a mature inflorescence. Photographs were taken to capture the morphological diversity. This was particularly important for fruit colour and inflorescence morphology. The photographs in this study are mostly by the author, and other contributors are acknowledged throughout the chapter. 131

6.2.2 Character selection The character set was developed after the review of herbarium specimens and observing and collecting plant material in the field. A range of characters unique to some populations were included (Table 6.1). Fruit and flowers showed informative characters, but due to an inadequate sample size, these were excluded from the quantitative dataset. They were used in the description of taxa. In all, 14 characters were analysed, including three binary, ten measurements and one count (Table 6.1). Table 6.2 summarises how characters were scored. Flowers were rehydrated so they could be accurately measured for the descriptions. A Kincromic Digital Vernier Calliper and drafting rulers were used to measure plants. All measurements are in millimetres (mm) and centimetres (cm) recorded from fresh plant material, and plant habit was measured in metres.

6.2.3 Final samples used in the study The dataset included 108 samples collected from 41 populations (1–5) samples per population) from the islands of Oahu, Maui, Hawaii and Kauai (Fig. 6.1, Appendix B). It was expected that additional herbarium specimens would be included in the dataset, but due to missing morphological characters, they were excluded. The specimens collected for this study are lodged at MELU and PTBG. Refer to Fig. 6.8 for a list of the herbarium specimens reviewed from BISH and PTBG.

The morphological analysis included the eight Hawaiian samples used in the molecular phylogenies in Chapters 4 and 5. These samples were: D. multipedicellata NT3186 1/1 Oahu, D. multipedicellata KMM1026 4/4 Hawaii, D. sp. aff. lavarum NT3173 1/4 Maui, D. sp. aff. lavarum NT3178 1/5 Oahu, D. sp. aff. sandwicensis NT3167 1/4 Kauai, D. sandwicensis NT3190 2/4 Oahu, D. lavarum KMM1023 5/5 Hawaii and D. lavarum KMM1025 5/5 Hawaii.

132

Fig. 6.1. Collecting localities of specimens used in this study. Refer to Appendix B for a list of the collecting localities.

133

Table 6.1. Characters used in the morphometric study.

CHARACTER NUMBER CODE CHARACTER STATES

Habit characters

1 DC Discrete clump c. 50–75 cm in diameter Discrete clump (1) (1) or clonal colony >1m (0) clonal colony (0)

Leaf characters

2 SRORGR Inner sheath red or green on the adaxial Green (0) red (1) surface.

3 NOLEST Number of leaves along stem Count

4 SL Sheath length (mm) Measurement

5 BL Blade length (mm) Measurement

6 BW Blade width (mm) Measurement

Inflorescence characters

7 PH Inflorescence rachis height (mm) Measurement

8 NOPED Pedicels spirally arranged in two ranks Present (1) absent (Fig. 6.14, A1.1) along the branching (0) units, > 50 pedicels on second major raceme branch

9 SPBTP Average space between pedicels Measurement

10 SH Stem height (mm) Measurement

11 TIH Total inflorescence height (mm) Measurement

12 PW Inflorescence diameter (mm) Measurement

13 PDLEN Pedicel length (mm) Measurement

14 LENSBR Length of second major branch (mm) Measurement

134

Table 6.2. How the morphological characters were measured. Refer to Appendix H (fig. 1 & 2) for diagnostic drawings of the major plant and inflorescence parts.

CHARACTER METHOD

1. Discrete clump c. 50–75 cm (1) or Observed and measured in the field. colony >1 m (0)

2. Inner sheath red or green Observed from fresh plant material.

Leaves were counted from the base of the stem and scales 3. Number of leaves along stem were excluded.

Measured from the base of the sheath and included the zone 4. Sheath length of occlusion (see fig. 7.8), with a drafting ruler.

Measured from above the zone of occlusion to the apex of 5. Blade length the blade, with a drafting ruler.

6. Blade width Measured with a drafting ruler at the widest midpoint.

From the first node of the lowest major branching unit to 7. Inflorescence rachis length (mm) the tip of the tallest branching unit, measured with drafting ruler (Appendix H, fig. 1).

8. Pedicels spirally arranged in two The pedicels on an inflorescence were observed to confirm ranks (Fig. 6.14, A1.1) along the if pedicels were spirally arranged in two ranks. All pedicels branching units, on the second major on the second major infloresence branch were counted (see branch; > 50 pedicels on second major fig. 6.13). The second branching unit was chosen because it raceme branch had reached maturity in most cases.

The space between five mature pedicels on one inflorescence were measured and the average was 9. Average space between pedicels calculated. A Kincromic Digital Vernier Calliper was used to measure the space between each pedicel.

From the node of the first aboveground scale to the highest 10. Stem height (mm) leaf node, measured with a drafting ruler.

From the last leaf node to the top of the tallest branching 11. Total inflorescence height (mm) unit, measured with a drafting ruler (Appendix H, fig. 1).

12. Inflorescence rachis diameter The widest section of the compound raceme was measured (mm) with a drafting ruler (Refer to Appendix H, figure 1).

135

CHARACTER METHOD

Five mature pedicels were unsystematically chosen from an individual. The length of each pedicel was measured with a 13. Pedicel length (mm) drafting ruler. The average length was calculated of the five pedicels.

Length of the second major branch from its node to the top 14. Length of second major branch of its uppermost branching unit. Refer to Appendix H, figures 1 and 2 for illustrations.

6.2.4 Scanning Electron Microscopy Seed morphology was examined from selected field collections and herbarium specimens using a dissecting microscope. Morphological differences were apparent and thus Scanning Electron Microscopy (SEM) was also used to examine some seeds in more detail. For some collections of D. sp. aff. sandwicensis and D. sandwicensis, the seeds were soaked in a drop of detergent and water to assist in the separation of the dried seed from the fruit pulp.

The seeds from the following accessions were initially examined:

D. sp. aff. lavarum: BISH559936, Maui, NT3173 1/4 Maui, NT3170 Kauai, NT3178 1/5 Oahu

D. lavarum: BISH752596 Maui, BISH704994 Hawaii, KMM1025 5/5 Hawaii and KMM1024 5/5 Hawaii.

D. sandwicensis: NT3190 4/4 Oahu, and NT3188 Oahu

D. sp. aff. sandwicensis: BISH19588 and NT3166 2/5, 1/5 Kauai,

For SEM, two to three seeds of a taxon were secured on a SEM stub. The seeds were gold coated with a Dynavac Xenospot. An FEI XL30 FEG SEM was used to photograph the seeds at different magnifications to highlight the important features.

136

6.2.5 Phenetic analyses The data set was subjected to multivariate analysis using the PATN program version 3.11 (Belbin 1987). Characters were range-standardized and the Gower metric was used to assess similarity between samples (Gower 1971). A dendrogram was generated using the flexible un-weighted pair group method of arithmetic averages (UPGMA). The data set was also analysed by ordination using Semi-Strong Hybrid multidimensional scaling (SSH), with 60 random starts (Belbin 1987). Ordination coordinates were imported into Minitab 17 to create three-dimensional ordinations. Kruskal-Wallis (KW) values were calculated by PATN for groups defined in the dendrogram. The characters with the largest KW values were considered to be significant.

6.3 Results

6.3.1 Cluster analysis The dendrogram revealed two main morphological groups, A and B (Fig. 6.2). Group (A) is composed of three subgroups: D. sp. aff. lavarum (A1), D. lavarum (A2) and D. multipedicellata (A3). Group (B) is composed of two subgroups: D. sp. aff. sandwicensis (B4) and D. sandwicensis (B5). Each of these subgroups can be recognised as a distinct operational taxonomic unit, with three of the five subgroups consistent with the species concepts of Degener (1932), i.e. D. lavarum, D. sandwicensis and D. multipedicellata. The other two subgroups are new entities for the islands, i.e. D. sp. aff. sandwicensis and D. sp. aff. lavarum. Of the 14 macromorphological characters scored, five had the highest KW values (Table 6.3). These are stem height, plant habit (i.e., clumped versus spreading clone), inflorescence height and the number of leaves along the stem. A visual representation for: stem height, inflorescence height and number of leaves along aerial stem are presented in box plots (Fig. 6.3). The KW values of the remaining characters were considerably lower in value (Appendix C).

137

Fig. 6.2. Dendrogram of 108 specimens of Dianella truncated at the five-subgroup level. The samples in the molecular phylogeny are highlighted in black with the arrows pointing to the code of the sample: NT3173 and NT3178 D. sp. aff. lavarum; KMM1023 and KMM1025 D. lavarum, NT3186 and KMM1026 D. multipedicellata; NT3167 D. sp. aff. sandwicensis; NT3190 D. sandwicensis.

138

Table 6.3. Characters with the highest Kruskall-Wallis (KW) values and their range and mean values for the five subgroups in the dendrogram (Figure 6.2).

Character & Kruskall- D. sp. aff. D. D. D. sp. aff. D. Wallis (KW) lavarum lavarum multipedicellata sandwicensis sandwicensis value

Stem height 2–21 3–13 4–42 45–120 30–77 (cm) x = 6 x = 8 x = 17 x = 73 x = 48 KW 86.64 ̅ ̅ ̅ ̅ ̅

Plant habit Discrete Clonal Clonal Clonal Discrete clump KW 80.14 clump Total inflorescence 9–58 24–47 35–86 75–157 49–112 height (cm) x̅ = 30 x̅ = 34 x̅ = 62 x̅ = 116 x̅ = 86 KW 76.84 Number of leaves along 4–9 4–8 4–10 16–33 7–29 stem x̅ = 6 x̅ = 5 x̅ = 6 x̅ = 21 x̅ = 18 KW 72.27

Fig. 6.3. The Box and Whisker plots of the three highest measurements and scored

characters. The key lists the five OTUs.

139

6.3.2 Ordination analysis The three-dimensional ordination stress value was 0.0963, which is considered acceptable (Belbin 1987). The ordination in three dimensions (Figs. 6.4A, B, C) and three-dimensional scatterplot (Fig. 6.5) support the dendrogram in showing five rather homogenous groups which are clearly defined. The distances between the samples reflect their taxonomic similarity: the shorter the distance between them, the more similar are the plants. Dianella sp. aff. lavarum is clearly defined in Fig. 6.4A and B while D. lavarum is a discrete group in Fig. 6.4B and C, and is especially distinct in Fig. 6.5. Dianella multipedicellata is defined in Fig. 6.4C, D. sp. aff. sandwicensis (Kauai) in Fig. 6.4A and B and D. sandwicensis (Oahu, Maui) in Fig. 6.4A and C.

Fig. 6.4. Three-dimensional ordinations of 108 specimens based on 14 characters. Stress 0.0963, A (axes 1x2), B (1x3), C (2x3). The samples in the molecular phylogenies are: NT3173 and NT3178 D. sp. aff. lavarum; KMM1023 and KMM1025 D. lavarum, NT3186 and KMM1026 D. multipedicellata; NT3167 D. sp. aff. sandwicensis; NT3190 D. sandwicensis.

140

6.3.3 Seed morphology SEM images of seeds revealed differences in seed shape for the majority of subgroups identified in the clustering and ordination analyses (Fig. 6.6).

Further examination with a dissecting microscope of seeds of various populations of D. sp. aff. sandwicensis (subgroup B4) and D. sandwicensis (subgroup B5) indicates they have similar morphology, particularly the seed type shown in Fig. 6.6A which has a central raised elevated ridge and a pointed end.

However, variability was observed in seed shape of individual samples with irregularity in outline and more of a prominent pointed end, similar to the drawing of a D. sandwicensis seed by Skottsberg (1937) and Degener (1932). The seed shape of Fig. 6.6D is elliptic in outline and was observed only in D. sandwicensis. For D. sp. aff. sandwicensis only the seeds from two localities were examined and the seeds were quite variable in shape with many lacking the central raised ridge evident in Fig. 6.6A. Images of these seeds were not photographed and the 141

examination of additional populations is needed to confirm the seed shape. The seeds of D. lavarum (Fig. 6.6G-I) and D. sp. aff. lavarum (Fig. 6.6J-L) are different in shape from the above taxa, being oblong to round in shape, and lacking an elevated central ridge observed in Fig. 6.6A.

The seed surface is relatively similar among the subgroups, with a cell-like pattern that appears to be more prominent in some taxa than others. The surface of D. lavarum (Fig. 6.6H, I) seems to have the most defined pattern, which could be influenced by the age of the seed or state of desiccation.

Fig. 6.6. Scanning electron images of seeds of Hawaiian Dianella. A-C and D-F are from D. sandwicensis (NT3190 4/4); G-I D. lavarum (KMM1025 5/5); J-L D. sp. aff. lavarum (NT3173 1/4). Images A, D, J, scale bar=1 mm; image G, scale bar =500 µm, images B, E, H, K scale bar=20 µm and C, F, I, L scale bar =10 µl.

142

Fig. 6.7. Diagnostic images of D. sp. aff. lavarum (subgroup A1). (A) plant in situ, Oahu, (B, C) flower, (D) mature dark violet fruits, (E) nested inflorescence, Maui, (F) two fruit dye smears, Oahu. Photo A and F by Joel Lau.

Fig. 6.8. Diagnostic images of D. lavarum (subgroup A2, Hawaii). (A) immature green fruit and mature pale blue fruit, (B) flower partially open, (C) cross-section of mature fruit, (D) red sheaths, (E) habitat Kau Desert, Hawaii Volcanoes National Park, (F) mature inflorescence, (G) plantlets, (H) habitat Kipahoehoe Natural Area Reserve. All images were photographed in Hawaii Volcanoes National Park except for H. Image B is photographed by Sierra McDaniel.

143

Fig. 6.9. Diagnostic images of D. multipedicellata (subgroup A3). (A) Inflorescence, Oahu, (B) image of the spiralling pedicels on branching units (BISH709414), (C) typical plantlets, Oahu, (D) plant in situ, Kauai, (E) plant in situ Hawaii, (F, G) flowers, Hawaii.

144

145

Fig. 6.12. The distributional ranges of the five taxonomic entities. The black dots represent collecting localities from this study and herbarium specimens examined from BISH and PTGB (Refer to 6.8). (A) D. sp. aff. lavarum, (B) D. lavarum, (C) D. multipedicellata, (D) D. sp. aff. sandwicensis and (E) D. sandwicensis.

146

Fig. 6.13. Arrangement of mature pedicels. Asymmetrical pedicels; A-B, D-E; radially symmetrical pedicels or also defined as spirally arranged in two ranks C. (A). D. sp. aff. lavarum NT3173 1/4, (B) D. lavarum NT1023, (C) D. multipedicellata BISH709414 (D) D. sp. aff. sandwicensis NT3166 (E) D. sandwicensis NT3190 4/4. All scale bars represent 1 cm.

147 6.4 Discussion

6.4.1 Overview Five distinct groups were evident in both the clustering and ordination analyses indicating that D. sandwicensis s.l. should be revised (Fig. 6.2-6.5). Three of the five groups are consistent with the species recognised by Degener (1932); and these are D. lavarum (subgroup A2), D. multipedicellata (subgroup A3) and D. sandwicensis (subgroup B5). Two additional subgroups are recognised as new entities, referred to as D. sp. aff. lavarum (subgroup A1) and D. sp. aff. sandwicensis (subgroup B4).

The majority of the subgroups identified in this study were observed growing in sympatric association. On the island of Oahu, D. sp. aff. lavarum, D. sandwicensis and D. multipedicellata occurred together in multiple localities. On the island of Hawaii, D. multipedicellata and D. sp. aff. lavarum occurred together in Manuka NAR and D. lavarum was collected within a kilometre of those populations. On the island of Kauai, D. sp. aff. sandwicensis was observed growing near D. multipedicellata. Of the numerous localities examined, it became apparent that species boundaries existed between the subgroups and no hybrids were recognisable. The colonisation and evolution of Dianella on recent lava flows could be the result of frugivorous birds. Carlquist (1967) emphasised bird dispersal in the Hawaiian flora in general.

The morphological results are supported by the results of the combined molecular data (Chapter 5, see clade N, Fig. 5.6), although the molecular data set included only eight Hawaiian accessions. These accessions clustered in the morphometric subgroups matching the taxonomic identifications of the author. This provides confidence in the taxonomic conclusions.

The molecular phylogeny (Fig. 6.15) revealed a subclade (PP 1.00, BS 88%) with an accession of D. adenanthera (New Caledonia sample) as sister to a supported group (PP 1.00, BS 93%) of three Hawaiian samples: one attributed to D. multipedicellata and two attributed to D. lavarum. Another sample of D. multipedicellata was, however, related in a separate subclade to two other samples identified as D. lavarum from the same island. Possibly related to these three were two samples of D. sandwicensis (one considered here to be D. sp. aff. sandwicensis from the older island of Kauai). The node linking the two DNA samples of D. sandwicensis and D. sp. aff. sandwicenisis was poorly supported, and 148

separated by relatively long branches, indicating that they are distinctly different and not necessarily closest relatives (Fig. 6.15). Additional samples need to be sequenced to test whether they are sister taxa or not. The morphometric study found they clustered in the same major phenetic group (group B) but formed discrete groups (B5 and B4), clearly evident in the three-dimensional ordination. Based on this evidence the recommendation is that D. sandwicensis and D. sp. aff. sandwicensis be considered separate taxa.

As indicated above, D. lavarum and D. sp. aff. lavarum are each monophyletic in the molecular analysis but were not each other’s closest relative. Dianella lavarum (from the island of Hawaii) was related to D. multipedicellata from the same island, while D. sp. aff. lavarum (from Oahu and east Maui) clustered with D. multipedicellata (from Oahu). In the morphological cluster and ordination analyses D. lavarum and D. sp. aff. lavarum formed distinct entities but clustered together in the same major group (A, as A1 and A2) indicating their phenetic similarity. The two data sets support the recommendation that they be recognised as separate species. The incongruence between the morphology and molecular phylogeny relates to D. multipedicellata (phenetic morphology group A3) and the question of its monophyly requires further sampling in a genetic study, but it is here treated as a putative taxon.

6.4.2 D. lavarum Dianella lavarum (subgroup A2, Fig. 6.8) is most similar morphologically to D. sp. aff. lavarum and D. multipedicellata having a stem height of 3–13 cm ( x̅ = 8), inflorescence height 24–47 cm ( x̅ = 34) and the number of leaves along the stem 4–8 (x̅ = 5) (Table 6.3). It is also characterised by red leaf sheaths, and green leaf blades with a slightly glaucous appearance. The plant spreads clonally for many metres on solidified lava, in Hawaii Volcanoes National Park, particularly in the areas with Metrosideros communities in Kau Desert (Fig. 6.8E). In other localities, a rocky substrate, e.g. in Kipahoehoe NAR, may influence the plant’s spreading habit (Fig. 6.8H).

149

Fig. 6.15. The combined Bayesian majority-rule consensus tree of the Hawaiian and New Caledonian Dianella from Chapter 5. Posterior Probabilities are above branches; bootstrap values are below branches.

Although not scored in this study, the fruit surface was light green when immature and light blue at maturity with a yellow fruit flesh (Fig. 6.8C) and mustard-yellow dye. The tepals are cream to white in colour, which is similar to D. sp. aff. sandwicensis and D. sandwicensis tepals (see Figs. 6.10, 6.11). Sierra McDaniel, a botanist from Hawaii Volcanoes National Park, photographed the flower of D. lavarum (Fig. 6.8B) and also observed a lilac undersurface on the tepals.

Examination of herbarium specimens, including those of Degener, indicates D. lavarum also occurs on the island of Maui, at Kaupo Gap, Haleakala crater in a similar environment on dry lava as indicated by Degener (1932). Additionally, his specimens provided important taxonomic notes, particularly describing the fruit colour as “pale blue” (BISH146916). He described D. lavarum, from the type locality Kau Desert (Hawaii Volcanoes National Park) with pale blue fruits, but didn’t include any additional information about fruit dye in his treatment. However, he did describe the fruit dye as leaving a brownish-yellow in his earlier publication ‘Plants of Hawaii National Park Illustrated’ (Degener 1930). Further examination is required to examine the flowers and inner sheath colour of the Maui populations because these characters were difficult to examine on herbarium specimens.

150

6.4.3 D. sp. aff. lavarum D. sp. aff. lavarum (subgroup A1, Fig. 6.7) grows in discrete clumps, with a short stem height of 2–21 cm ( x̅ = 6) and an inflorescence height of 9–58 cm ( x̅ = 30), which is most similar to D. lavarum. The fruit shape is round to oblong, green when immature and dark blue/violet in colour when mature (Fig. 6.7D, E).

Observing the plants in situ and examining mature fruit and fruit dye indicated the fruit dye is most often a purple/violet colour. However, Joel Lau observed fruit dye colour variation on the island of Oahu, including a brown fruit dye (Fig. 6.7F). The seeds of D. sp. aff. lavarum are round in shape and lack a raised ridge in the centre of the seed, when compared with D. sandwicensis (Fig. 6.6A).

In this study, D. sp. aff. lavarum was collected on the islands of Kauai (including the north- east area), Oahu, Maui, and Hawaii, and examination of herbarium specimens indicates it also occurs on Molokai and Lanai.

Since the field work was conducted for this project, J. Lau identified populations of D. sp. aff. lavarum on the north-west side of Oahu that have spread into large clonal forms, and further research is required to investigate these populations in situ.

6.4.4 D. multipedicellata Dianella multipedicellata (Fig. 6.9) is defined by stem height of 4–42 cm ( x̅ = 17) inflorescence height of 35–86 cm ( x̅ = 62) and the number of leaves along the stem, 4–10 ( x̅ = 6) although measurements overlapped those recorded for D. lavarum and D. sp. aff. lavarum (see Fig. 6.3, Table 6.3). Dianella multipedicellata forms large spreading clones (Fig. 6.9D, E).

As part of this study, the number of pedicels was counted on the entire second inflorescence branch for all specimens in the data set. D. multipedicellata had the highest number of pedicels on a major branching unit (average >80) when compared to the other subgroups, and in many cases, there were many hundreds. Two samples of D. multipedicellata had fewer than 50 pedicels, which were likely immature inflorescences. All the other subgroups had fewer than 80 pedicels on the second major inflorescence branch: D. lavarum 3–29 pedicels, D. sp. aff. lavarum 9–48, D. sp. aff. sandwicensis 4–69 and D. sandwicensis 4–

151

65. For D. sandwicensis and D. sp. aff. sandwicensis some of the inflorescences with low counts appeared to be immature.

Another character to delimit D. multipedicellata from the other identified taxa is radially symmetrical pedicels that are relatively densely arranged along the axis (Table 6.1, character 8; Fig. 6.9B; Fig. 6.13). The pedicel arrangement for all the other groups is non- spirally arranged or assymetrical (Fig. 6.14). Degener (1932) and Fosberg (1969) noted this feature as distinctive for D. multipedicellata (hence the name). Although this character did not score in the top four highest KW values, it is a distinct feature of this taxon (Fig. 6.9A, B). The observation of numerous populations in situ and the examination of numerous inflorescences at different stages of growth indicates a mature inflorescence is the best character to delimit D. multipedicellata. Without inflorescence material, identification could be difficult because the species has a similar stem, sheath and blade morphology to D. sp. aff. lavarum (Fig. 6.7A), and the two taxa can occur in sympatric association, particularly on the island of Oahu. If current season inflorescences are not mature, old inflorescences of D. multipedicellata retained on a plant can assist with identification in the field.

Based on my observation of growing north-east Australian Dianella in a glasshouse for a number of years, some taxa in the D. caerulea complex also have a similar arrangement of spirally arranged pedicels, in particular D. caerulea var. petasmatodes and D. caerulea var. vannata. These inflorescences take many months to mature, and therefore it is likely the inflorescence of D. multipedicellata may also require a considerable amount of time to mature, which is a consideration when attempting to identify the species in situ.

The flower morphology of D. multipedicellata is most similar to D. sp. aff. lavarum with pale to medium purple tepals (Fig. 6.7B, C and Fig. 6.9F, G), all of similar shape and size. Fruits are rarely seen (see below), but one mature fruit was observed purple in colour with a purple dye and with no seeds.

The observation of plants at multiple localities on the islands of Oahu, Maui, Kauai and Hawaii indicated that D. multipedicellata lacked fruit when all other subgroups were profusely fruiting. Joel Lau, a local botanist on the island of Oahu confirmed that D. multipedicellata is very rarely in fruit. Furthermore, herbarium specimens from BISH and PTBG all lacked fruit. Degener (1932) does not include any information about fruit or a 152

seed drawing, which he did include for the other described taxa (i.e. D. sandwicensis and D. lavarum), suggesting lack of fruit availability. Further research is required to investigate the reproductive biology and mode of dispersal of D. multipedicellata given the rarity of fruit set, and the possibility of self-incompatibility in this species.

Although Degener (1932) thought D. multipedicellata to be rare and endemic to Oahu in the Waianae Range and Koolau Range, numerous later collections lodged at BISH and PTBG confirm that it occurs on other Hawaiian Islands, including Lanai and Molokai. Furthermore, this study confirmed it also occurs on Kauai.

6.4.5 D. sandwicensis and D. sp. aff. sandwicensis The characters that separate D. sandwicensis (subgroup B5) from D. sp. aff. sandwicensis (subgroup B4) (Table 6.3) were stem height of 30–77 cm ( x̅ = 48) compared to 45–120 cm ( x̅ = 73), inflorescence height 49–112 cm ( x̅ = 86) compared to 75–157 cm ( x̅ = 116) and the number of leaves along the stem 7–29 ( x̅ = 18), compared to 16–33 ( x̅ = 21) (Table 6.3). D. sp. aff. sandwicensis (Fig. 6.10) is a larger plant at maturity forming clonal colonies, whereas D. sandwicensis (Fig. 6.11) forms discrete clumps (Fig. 6.10, 11A). In the field, the occasional plant of D. sp. aff. sandwicensis was also observed as a discrete clump, but this was presumed to be a juvenile plant growing amongst other mature plants that formed large clones (Fig. 6.10A, E). Plant size and growth habit may be influenced by environment, such as substrate, but the molecular data (Chapter 5) indicated some genetic differences between the two taxa.

Both D. sandwicensis and D. sp. aff. sandwicensis have similar flower morphology, but some colour differences were observed. For D. sandwicensis, the inner tepals were white to cream with inner yellow veins, and the outer tepals were mostly light to medium brown with white to cream margins (Fig. 6.11D and E). For D. sp. aff. sandwicensis, the inner and outer tepals were cream to white with inner yellow veins (Fig. 6.10F). Some herbarium specimens included descriptions of a purplish tinge to the tepals, which was not observed in this study.

Both D. sandwicensis and D. sp. aff. sandwicensis can have large multi-branching racemes compared with the other taxa. However, the size of the inflorescence can vary, which is likely the result of age or environmental factors, and this could also influence the number

153

of pedicels on a branching unit (see Fig. 6.10B and C). The fruit shape of both taxa is oblong to round, and the base of the fruit can be pointed to round (Fig. 6.11B).

The immature fruit surface colour of both D. sandwicensis and D. sp. aff. sandwicensis is not the typical green colour of the genus. For D. sandwicensis, immature fruit surface colour is shades of orange or yellow to brown with similar shades in fruit dye, with the colour deepening to purple with the ageing of the fruit (Fig. 6.11B, C, F). At maturity, the mustard brown dye remains. Degener (1932) described the fruit colour of D. sandwicensis to be very dark blue, but I did not observe this fruit colour.

For D. sp. aff. sandwicensis Natalia Tangalin from National Tropical Botanical Garden researched the fruit from two populations, from Kokee, Kauai. The population were approximately 100 ft apart. She conducted a smear test to examine the fruit dye colour at different stages of maturity and, as above for D. sandwicensis, suggested that the age of the fruit influences the dye colour, resulting in colour variability (pers. comm. N. Tangalin). At the first stage (1), the fruit surface colour is maroon/red with light brown/red fruit dye (Fig. 6.10C, I). At stage 2 the fruit changes to a purple/dark purple colour, which is typical of the genus, and the fruit dye colour is purple to shades of brown. At stage 3, the fruit surface matures to lilac to light grey with a watery light brown/ maroon dye. The fruit in stage 3 was also photographed with a yellow pulp (Fig. 6.10H), which could be the result of fruit losing pigment as it starts to break down. It is currently unknown if D. sandwicensis has this final stage of fruit maturity. During field work, some populations of D. sp. aff. sandwicensis observed along Waimea Canyon Rd had immature fruit with a mustard- yellow colour surface, which is similar to the immature fruit of D. sandwicensis from Maui (Fig. 6.11C), indicating variability in fruit colour.

Different fruit surface colour and flesh fruit colour could be associated with attracting particular birds that aid dispersal and colonisation. Additionally, a nutritional reward could be offered in the fruit and skin pulp (Willson & Whelan 1990).

Dianella sandwicensis occurs on Maui and Oahu on fertile volcanic soils, commonly in shaded environments. Plants were not observed in situ on Maui but were observed and sourced from Olinda Rare Plant Facility, and the private residence of Forest and Kim

154

Starr. These were grown in cultivation and appeared to be growing in discrete clumps. Degener (1932) did not recognise D. sandwicensis to occur on the island of Hawaii and based on the review of herbarium specimens and field work, there are no collections of the species on that island.

Dianella sp. aff. sandwicensis appears to be restricted to Kauai. Herbarium specimens indicate D. sandwicensis and/or D. sp. aff. sandwicensis occur on Lanai and Molokai, but it is difficult to nominate which taxon is represented by the specimens because they lack rhizomes and no information is included about plant habit.

6.5 Conclusion This study has confirmed that D. sandwicensis requires taxonomic revision and that Degener’s (1932) concept of three species is supported, i.e. D. lavarum. D. multipedicellata and D. sandwicensis. Two new taxa are recognised for the islands, referred to here as D. sp. aff. lavarum and D. sp. aff. sandwicensis Kauai although the former is not necessarily related to D. lavarum but to D. multipedicellata, based on the molecular analysis. Dianella multipedicellata appears to rarely set fruit, and requires further study. The molecular phylogenetic study also suggested that D. multipedicellata from the island of Hawaii may represent a new taxon requiring further investigation.

155

6.6 Taxonomic Descriptions

6.6.1 Dianella sp. aff. lavarum

Holotype: The entity requires the designation of a holotype.

Habit: Commonly in discrete clumps, 50–75 cm wide.

Root system: Short to long, creeping, yellow, branched rhizomes, c. 1 cm wide.

Stems: Above-ground stems 2.5–21 cm long, light green. Cataphylls 4 at the base of the stem, followed by 4–9 alternate leaves.

Leaves: Leaf composed of a sheath and blade, medium to dark green, smooth without denticles. The sheath is completely folded and fused towards the junction of the sheath and blade. Sheath length 8.5–27.5 cm, blade length 32–77 cm, and blade width 2–2.8 cm. Margins of sheath and blade smooth without denticles.

Inflorescence: Composed of 6–7 alternate major branches, 9–48 pedicels on the second major branching unit. Total inflorescence height c. 9.5–58.5 cm, rachis height 8–28 cm, raceme width 8–28 cm; the length of the second major branch 8–5.5 cm. Pedicels distributed asymmetrically along the rachides. Inflorescence shape ovoid to oblong. The average space between pedicels is 1–2 mm, pedicel length 3.6–10.4 mm.

Flowers: Tepals light to medium purple, 6 mm long × 2.5 mm wide, outer tepals 6.5 mm long x 2.5 mm wide; inner tepals with 4–5 veins, outer tepals width 5–7 veins. Tuft of ciliate hairs on the apex in both inner and outer tepals. Anthers yellow, 2.0 mm long × 0.80 mm wide; struma yellow to orange, 1.8 mm long × 2 mm wide; filaments white, 1.25 mm long × 0.35 mm wide. Ovary green, 3 locules (chambers) with 2–3 ovules per locule, 1.75 mm long × 1.75 mm wide; style white, 2.5 mm long × 0.4 mm wide. No floral scent detected.

Fruit: Fruit oblong; immature fruit surface light to medium green. Mature fruit surface dark purple, dark violet, or dark blue. Mature fruit dye in various shades of purple.

Flowering phenology: Spring to summer.

Seeds: Oblong to round in shape and lacking central elevated ridges. Testa black, smooth and shiny.

Distribution: Occurs in plant communities on exposed ridges and slopes on Oahu, Maui, Hawaii and Kauai (Fig. 6.12A).

156

6.6.2 Dianella lavarum Holotype: Degener (1932) designated specimen no. 4208 as the type. The locality of the specimen is unknown. The examination of additional BISH specimens of D. lavarum collected and annotated by Otto Degener are in agreement with the description of D. lavarum in this study.

Habit: Commonly in large clonal colonies

Root system: Short to long, creeping, yellow, rhizomes branched, 0.6-1.0 cm in diameter.

Stems: Above ground stems 3.2–13.4 cm in length, light green. Cataphylls 4–6, alternate at the base of the stem, followed by 4–8 alternate leaves.

Leaves: Leaf composed of a sheath and blade, inner red to mid to dark green sheath colour, medium to dark green blade. The sheath and blade can also have a glaucous appearance. Margins of sheath and blade smooth without denticles. The sheath is completely folded and mostly fused towards the junction of sheath and blade. Sheath length 12.3–21.2 cm, blade length 32.3–62 cm, and blade width of 13–23 mm.

Inflorescence: Composed of 9 alternate branches, 3–29 pedicels on the second major branching unit. Total inflorescence height 24–47 cm, raceme height 7–22 cm, raceme width 3–15 cm; length of second major branch 2–13 cm. Pedicel length 7.2–10 mm and average space between pedicels 0.4–2 mm. Pedicels distributed asymmetrically along the rachides. Inflorescence shape ovoid to oblong.

Flowers: Tepals cream to white, 7 mm long × 2mm wide, outer tepal 7 mm long × 2 mm wide; inner tepal 4–5 veins, outer tepals 5–6 veins. Tuft of ciliate hairs present on the apex in both inner and outer tepals. Anther yellow, 1.5 mm long × 0.8 mm wide, struma orange 0.5 mm long × 0.5 mm wide. Filament white 1.5 mm long × 1 mm wide. Ovary green, 3 locules (chambers) and each having 2–3 ovules; 1.5–2.5 mm long, 1.5–2 mm wide; style white 2.5 mm long × 0.8 mm wide. No floral scent detected. The flowers were seen only partially open, therefore a minor variation in size could be possible.

Fruit: Fruit shape round; immature fruit colour light to medium green; mature fruit colour light blue; mature fruit dye yellow to mustard colour.

Flowering phenology: Spring to Summer.

Seeds: Testa black, smooth and shiny, oblong to round in shape, lacking central elevated ridges.

157

Distribution: Restricted to dry lava flow environments on the islands of Hawaii and Maui (Fig. 6.12 B). Hawaii: Kipahoehoe Natural Area Reserve, Hawaii Volcanoes National Park. Maui: Kaupo Gap, Haleakala crater.

6.6.3 Dianella multipedicellata Holotype. The holotype of D. multipedicellata (Degener, Park & Kruse, No. 4197) was examined and matched the taxonomic concept of D. multipedicellata identified in this study.

Habit: Commonly found in large colonies many metres wide.

Root system: Short to long, creeping, yellow, branched rhizomes, 1 cm diameter.

Stems: Above ground stems between 4–42 cm in height, light green. Cataphylls c. 4 alternate at the base of the stem, followed by alternate 4–10 leaves.

Leaves: Leaf composed of a sheath and blade, medium to dark green, smooth without denticles. The sheath is completely folded and mostly fused towards the junction of the sheath and blade. Sheath 11–30 cm long, blade 38–80 cm long, and blade width of 23–39 mm.

Inflorescence: Composed of 5–11 alternate branches, of c. >50 pedicels for the second major branching unit. Total inflorescence height 35–86 cm, raceme height 20–44 cm, and raceme width 4–13 cm; length of second major branch 3–17.5 cm. Raceme shape, narrow to wide oblong. Pedicel length 4.8–8.6 mm, and the average space between pedicels 1–1.8 mm. Pedicels distributed spirally arranged in two ranks along the rachides.

Flowers: Tepals light to medium violet, 5 mm long × 2.5 mm wide; outer tepal 6.5 mm long x 2.5 mm wide. Inner tepal 4–5 veins, outer tepal 5–6 veins. Tuft of ciliate hairs on the apex of both inner and outer tepals. Anther yellow, 2.5 mm long × 1 mm wide; struma 1.5 mm long × 1.2 mm wide; filament white, 1.3 mm long × 0.5 mm wide. Ovary green, 3 locules (chambers) and each having 2–3 ovules; 2 mm long × 1.5 mm wide; style white 2.5 mm long × 0.5 mm wide. No floral scent detected.

Flowering phenology: Spring to Summer.

Fruit: Rarely seen in fruit.

Seed: Rarely collected.

Distribution: Occurs on exposed ridges and slopes on Oahu, Maui, Hawaii and Kauai (Fig. 6.12C). 158

6.6.4 Dianella sp. aff. sandwicensis Holotype: The entity requires the designation of a holotype.

Plant habit: Mature plants form large clonal colonies for many metres.

Root system: Short to long, creeping, yellow branched rhizomes, 1cm wide.

Stems: Above ground stem 45–120 cm in height, light green. Alternate cataphylls c. 4–6 along the base of the stem, followed by 16–33 alternate cauline leaves.

Leaves: Leaf composed of a sheath and blade, medium to pale green, smooth without denticles. The sheath is completely folded, and is mostly fused towards the junction of the sheath and blade. Sheath length 9–18 cm, blade length 29–46.8 cm and blade width of 12– 30 mm. Margins of sheath and blade smooth without denticles.

Inflorescence: Composed of 8–11 alternate major branching units; 4–69 pedicels on a second major branching unit. Total inflorescence height 75–157 cm, raceme height 18– 41.5 cm and width 8–19 cm; length of the second major branch 5.7–15 cm. Inflorescence shape, narrow to wide oblong to triangular. Pedicel length 7.4–10.6 mm, average space between pedicels 1.6–3.6 mm. Pedicels distributed asymmetrically along the rachides.

Flowers: Tepals cream to white; inner veins yellow. Inner tepal 6–7 mm long × 2 mm wide, outer tepal 6–7 mm long × 2.5 mm wide. Inner tepal 3–5 veins, outer tepal 5–6 veins. Tuft of ciliate hairs on the apex in both inner and outer tepals. Anther yellow to orange, 2.5 mm long × 1 mm wide; struma yellow to orange, 2 mm long × 1.5 mm wide; filament white, 2.5 mm long × 0.5 mm wide. Ovary green, 3 locules (chambers) and each having 2–3 ovules; 3 mm long × 2.5 mm wide, style white 2.5 mm long × 0.4 mm wide. No floral scent detected.

Fruit: Oblong and occasionally with a pointed base. Immature fruit colour is a maroon/red colour with a light brown/red to maroon fruit dye. (Fig. 6.10C, I). Fruit matures to a purple/dark purple colour and the fruit dye colour is purple to shades of brown. The fruit surface continues to mature a lilac to light grey with a watery light brown/ maroon colour dye. The fruit at this stage was also observed with a yellow pulp. Some populations had immature fruit with a mustard-yellow colour surface, which is similar to the immature fruit of D. sandwicensis from Maui, indicating variability in fruit colour.

Flowering Phenology: Spring to summer.

159

Seeds: Testa smooth and shiny; a preliminary review of seeds indicates they are angular with a pointed side without raised central ridges.

Distribution: Occurs on exposed ridges, slopes and margins of swamps on the island of Kauai in a range of vegetation types (Fig. 6.12D).

6.6.5 Dianella sandwicensis Holotype: Two specimens of D. sandwicensis collected by Hook. & Arn. are the likely candidates for the type, lodged at The Royal Botanic Garden Edinburgh (E). They also match the morphology of D. sandwicensis in this study.

Plant habit: Densely caespitose isolated clumps, c. 75 cm wide.

Root system: Short to long, creeping, pale yellow branched rhizomes, c. 1cm wide

Stems: Above ground stems c. 30.5–77 cm long, light green. Cataphylls alternate c. 4–6 at the base of the stem, followed by c. 7–29 alternate cauline leaves.

Leaves: Leaf composed of a sheath and blade; medium to pale green; smooth without denticles. The sheath is completely folded and mostly fused towards the junction of the sheath and blade. Sheath length 9–18 cm, blade length c. 26.5–46.5 cm, blade width c. 20– 27 mm. Margins of sheath and blade smooth without denticles.

Inflorescence: Composed of 7–11 alternate branching units; 4–65 pedicels for second major branching unit. Inflorescence c. 49–112 cm in height; raceme 12–39.5 cm in height, 4–19 cm wide; length of second major branch 3.3–16 cm. Raceme shape, narrow to wide oblong to triangular. Pedicel length 7.2–12.2 mm and average space between pedicels 1.6– 4 mm. Pedicels distributed asymmetrically along the rachides.

Flowers: Tepals colour; inner tepals white to cream with inner yellow veins; outer tepals light to medium brown with white to cream margins. Inner tepal l6 mm long × 2.5 mm wide; outer tepal long 6 mm × 2.5 mm wide. Inner tepal 3 veins, outer tepal 5 veins. Tuft of hairs on the apex in both inner and outer tepals. Anther yellow to orange 2 mm long × 0.5 mm wide, struma yellow to orange, 1 mm long × 0.75 mm wide; filament white 1.3 mm long × 0.5 mm wide. Ovary green, 3 locules (chambers) and each having 2–3 ovules; 1.5 mm long × 1.5 mm wide; style 2.5 mm long × 0.13 mm wide. No floral scent detected.

Flowering Phenology: Spring to Summer.

Fruit: Berry ovoid with a pointed to round base; c. 1cm long × 7 mm wide. Immature fruit surface colour varies in shades of orange, yellow to brown with similar shades in fruit dye.

160

Mature fruit colour deepens in purple as the fruit matures. Similarily, the fruit dye colour can be quite variable, deepening to dark brown with the age of the fruit.

Seeds: Testa smooth, shiny, angular, pointed with raised central ridges. Another seed type observed was elliptic in shape without raised central ridges.

Distribution: Occurs on exposed ridges and slopes on Oahu and Maui (Fig. 6.12E), at altitudes from 2000 to 6000 feet (Degener 1932).

161

6.7. Key to the Hawaiian taxa of Dianella

1a. Pedicels distributed radially along the rachides in two ranks; flowers self-incompatible, a fruiting inflorescence rarely seen…………………………………………D. multipedicellata

1b. Pedicels distributed asymmetrically along the rachides in one rank; flowers self- compatible, inflorescences typically with high fruit set………………..…………………….2

2a. Immature fruit surface green; mature fruit pale blue, purple, indigo or violet in colour; mature fruit dye light yellow to mustard yellow or shades of purple to violet………3

2b. Immature fruit surface either yellow, orange, brown or maroon; mature fruit colour varies from purple/dark purple to lilac to light grey, never pale blue; mature fruit dye mustard yellow brown or maroon……...………………………...... 4

3a. Tepal colour white to cream; inner leaf sheath red; mature fruit surface pale blue, mustard yellow dye; aerial stem height 3–13 cm, pedicels on the second major branching unit 3–29; spreading clonally for many metres, occurring in dry lava environments on Hawaii and Maui…………………………………………………………………..D. lavarum

3b. Tepal colour light to medium purple; inner leaf sheaths green; mature fruit surface indigo to violet purple with a purple to violet dye; aerial stem height 2–21 cm; pedicels on the second major branching unit 9–48; occurring in discrete clumps to 75 cm; occurring in plant communities on exposed ridges and slopes on Oahu, Kauai, Maui, Hawaii, Molokai, Lanai………………………………………………………………………D. sp. aff. lavarum

4a. Plants in discrete clumps; aerial stem height 30–77 cm, with 7–29 leaves; tepals white to cream; occurring on exposed ridges and slopes on Oahu & Maui altitudes from 2000 to 6000 feet ...... D. sandwicensis

4b. Plants spreading clonally for many metres; aerial stem height 45–120 cm, with 16–33 leaves, tepals white to cream; currently only known on Kauai in a range of environments………………………………………………………...D. sp. aff. sandwicensis

162

6.8 Specimens examined from BISH and PTBG

D. sandwicensis BISH Waahila Ridge Trail, Oahu, W. Takeuchi, BISH504141; Koolau Range, Oahu, Th. Nilimoto BISH06803; Manawainui, West Maui, O Degener, BISH146930; Mt Kahala, Oahu, M. Kerr BISH405946; Ridge between Puu Hapapa and Puu Kanekoa Waianae Mts, Oahu, K. Nagata, BISH76543; West Maui: Trail up NW Slopes of Puu Kukui, M.R Crosby, W.R Anderson, BISH147000; East Makaleha Valley, Oahu, O. Degener, A. Greenwell, W. Hatheway BISH146979; Pauoa Pacific Height ridge Oahub (no collector) BISH146933; Forest National Wildlife Refuge, Kipapa Trail, Oahu, L.S. Reynolds, M. Zoll & J Devrell BISH739197.

D. sp. aff. sandwicensis BISH Kauai, Alakai Swamp, along swamp trail, B.C Stone BISH19588; Kauai, Kokee, Waimea, Na Pali-Kona Forest Reserve, H. St John, E.Y. Hosaka, E. Hume, R. Inafuku, J.C. Lindsay, R. Masuhara, D.D. Mitchell and W. Wong, BISH146989; Kauai, Wahiawa Bog, Mt Kahili, B. C. Stone, BISH19589, Kauai, Kawaiiki Valley off Kaluahaulu ridge, N. Tangalin, W. Kishida, M. O'Sullivan BISH748257; Kauai, Na Pali-kona Forest Reserve, Makaha Valley, D.H Lorence, T. Flynn, R. De Lappe BISH513609; Kauai, Nualolo Trail Na-Pali-Kona Forest Reserve, H. St John, E.Y. Hosaka, E Hume, R Inafuku, J.C. Lindsay, R Masuhara, D.D Mitchell, W. Wong, BISH405000.

D. sp. aff. lavarum BISH Oahu: south-east slope of Makua, valley near its head, O. Degener, K.K Park BISH146927; Oahu, Upper Manoa Valley, J.A Harris, BISH146925, Maui, East Maui Keopuka Rock, off the north coast of East Maui, R. Hobdy, BISH460003; Oahu, Koolau Range, Maakua- Papali Ridge, R.S Cowan, BISH146926; Lanai: Waiakeakua Gulch, in forest, O. Degener & T. Murashige, BISH146921; Lanai: north-east ridge of Kaiholena Valley, O. Degener, I. Degener, R. Hobdy, BISH146920; Maui: Hana Bay, along north side along and above trail to lighthouse, T. Flynn, BISH559936; Molokai: West ridge of Honomuni, H. St. John, BISH413384.

163

D. lavarum BISH Maui: Haleakala National Park, G.E Olson, BISH752596; Hawaii: Between north Kona and Kau Desert, O. Degener, BISH693736; Maui: Near Kaupo Gap, Haleakala, O. Degener, BISH146912; Maui: Mauka of Paliku, Haleakala, O. Degener, I. Degener, BISH146916; Hawaii: Hamakua District Hawaii, B. Close, C. Popolizio,BISH704994; Maui: Near Kaupo Gap, Haleakala, O. Degener, BISH694078; Maui: Haleakala Crater, H. St. John, A.L Mitchell, BISH413898; Maui: Kaupo Gap Haleakala, O. Degener, BISH146904.

D. multipedicellata BISH Lanai: Kapano Gulch, Kalunha 2190 ft., H. St. John, A.J James, BISH412188; Oahu: East ridge of Kaipapau Valley, O. Degener, K.K Park, BISH493583; Lanai: North-east ridge of Kaiholena valley, O. Degener, I. Degener, Robert Hobdy, BISH193585; Oahu, south-east slope of Makua, K.K Park, BISH493577; Oahu, Near Mauna Kapu, O. Degenner, O, Park, Shigeura, and Jakauulto?, BISH493582; Oahu, Pohakea Pass, at base of cliffs, O. Degenner, Muvashige, BISH493559; Maui: Paupau Ridge Mauka of Lahaina, O. Degenner, T. Musashige?, BISH499109; West Maui: Honolua, valley on west side, H.L, Oppenheimer, BISH709414.

D. sp. aff. sandwicensis PTBG Kauai, Waimea district, Waimea canyon Drive, T. Flynn, R. Koske, J. Gemma, PTBG002090.

D. multipedicellata PTBG Kauai Waimea Canyon State Park, Puu Hinahina Lookout, T. Flynn, R. Koske, J. Gemma PTBG002254; Kauai: Mahanaloa valley, K. Wood, PTBG040381.

164 Chapter 7: A morphometric study of the D. caerulea complex

7.1 Introduction Henderson described nine varieties in the ‘D. caerulea complex’ in the Flora of Australia (1987a) based on morphology. The combined molecular phylogeny of chloroplast and nuclear DNA (Chapter 5) supports the monophyly of the complex (clade L), except for D. caerulea var. aquilonia and D. caerulea var. Theresa Creek (named as 'serrulata variant' by Henderson 1987a) which were well outside the clade and related to far-north Queensland samples of other species of Dianella (clade J). Additionally, the two samples of D. caerulea var. caerulea (clade H) were also well outside the D. caerulea complex clade, and are distinctively different in morphology when compared to varieties in the complex in clade L. Dianella intermedia from Lord Howe Island and D. congesta were found to be the closest relatives (in that phyletic order) of all accessions.

Molecular analyses revealed genetic variation within varieties: for example, D. caerulea var. assera, which was represented by multiple samples and was not supported as monophyletic. One sample identified as D. sp. aff. caerulea KMM807 from Lake McKenzie on Fraser Island clustered within the D. caerulea clade L, in a subclade of largely Queensland representatives, but it was not related to D. caerulea var. caerulea as initially expected. The molecular analyses bring into question the current number of species and infraspecific taxa recognised in the complex.

7.1.1 Taxonomic history Dianella caerulea (Paroo Lily, Blueberry Lily, Blue Flax-lily) was first described from Port Jackson, New South Wales (Sims 1801; Henderson 1987a). Other early taxonomists revised taxa with morphological affinities to D. caerulea. For example, Mueller (1868) changed the rank of D. bambusifolia H.Hallier to D. caerulea var. bambusacea; Bailey (1891) applied a similar approach to D. congesta R. Br and described D. caerulea var. congesta, but neither of these changes is accepted today. In his global treatment, Schlittler (1940) erected subsection Caerulea to include three extra infraspecific taxa, i.e. D. caerulea var. elegans (Kunth & C.D. Bouché) Schlittler, D. caerulea var. laevigata Schlittler and D. caerulea f. nutans Schlittler. Today, these names are not accepted and 165

are considered to be taxonomic synonyms of D. caerulea var. caerulea (Govaerts et al. 2016; Australian Plant Census 2016).

Henderson (1987a) described the varieties in D. caerulea complex to account for observed variation among populations including chromosome counts. In his concept of this complex, he also recognised D. congesta as a separate but related species. The complex is found on a range of geological substrates, particularly sandstone and volcanic substrates, in a diverse range of environments. Taxa occur in eastern Australia (Fig. 7.1) from Victoria north to Somerset on Cape York, rarely west of the Great Dividing Range (Henderson, 1987a). Records of D. caerulea var. caerulea in Tasmania are incorrect (see Discussion). Dianella caerulea var. vannata extends beyond Queensland to New Guinea and the Torres Strait Islands. In the combined molecular analysis, two accessions of this northern variety were sister to the well-supported main clade of D. caerulea. A single specimen (PERTH 07703546) collected by D.G Bright and purported to be in the D. caerulea complex, is recorded for south-west Western Australia, but this needs further assessment. Examination of the specimen suggests it has morphological affinities with the complex, which is odd given the phylogenetic relationships of all other Western Australian taxa (see Chapter 5). The plant could be an introduction, because D. caerulea plants are available for sale in the nursery industry. However, the locality of this specimen was visited as part of field work, and no Dianella plants similar to the specimen were found. It could also be possible that the label data was wrong.

Henderson (1987a) based his taxonomic treatment on examining specimens, observing Dianella in the field, a living collection of plants and on chromosome counts. Some of the key morphological characters he used to delimit varieties were the fusion (occlusion) at the junction of the sheath and blade, presence or absence of extravaginal branching, leaf lamina measurements, flower morphology and plant habit.

166

7.1.2 Brief descriptions of Henderson’s taxa in the D. caerulea complex and the related D. congesta

The following brief descriptions are summarised from the floristic descriptions of Henderson (1987a).

The D. caerulea complex Plants solitary to mat-forming; stems to 2 m long, up to 0.5 m apart. Sheath conduplicate, moderately to completely occluded distally. Cymules open to contracted, 3–25 flowered, perianth 5–7 nerved; ovules 6–12 per locule.

D. caerulea Sims var. caerulea

Distribution and habitat Occurs in a variety of environments from heathland to open eucalypt forests, from eastern Victoria to south-east Queensland.

Habit Upright plant with a solitary habit, up to 0.5 m tall.

Stem and leaf Stems short with leaves along the stem. Leaf internodes touching or up to 60 cm apart. Leaf occlusion zone moderately fused, extravaginal branching absent.

Flower, inflorescence and chromosome counts Inflorescence conical in outline, cymules less than 10 flowered. Perianth colour mid to dark blue, 2n=32, 48.

D. caerulea var. producta R.J.F. Hend.

Distribution and habitat From south-eastern Queensland to west of Sydney, on rocky hillsides and mountains in forest communities.

Habit Upright plant, caespitose with a solitary habit, up to 1.3 m tall.

167

Stem and leaf Aboveground stems arching or ascending, commonly with cataphylls along the stem, touching or up to 10 cm apart. Extravaginal branching units developing with age, leaf sheaths moderately occluded.

Flower, inflorescence and chromosome count Inflorescence mostly ovoid in outline, cymules approximately 3–6 flowered. Perianth colour green-white to blue. 2n=32.

D. caerulea var. assera R.J.F. Hend.

Distribution and habitat Occurs in eastern Australia from Cairns, Queensland, to New South Wales, at high altitudes in rainforest communities.

Habit Upright plant with a solitary habit, up to 1.8 m tall.

Leaf and stem Stems tall, arching or descending with cataphylls along the stem, up to 30 cm apart and extravaginal branching present. Leaf sheaths completely occluded distally.

Flower, inflorescence and chromosome count Inflorescence narrowly conical to narrowly cylindrical in outline. Few-flowered cymules, flowers pale blue to mid-blue with green streaking externally, 2n=16.

D. caerulea var. cinerascens R.J.F. Hend.

Distribution and habitat Restricted to north-west New South Wales on sandstone outcrops, in dry sclerophyll forest.

Habit Upright plant, solitary to gregarious habit, up to 0.8 m tall.

Stem and leaf Short stem, leaves along the stem touching and leaf nodes up to 30 cm apart. Leaf occlusion zone mostly fused and extravaginal branching units absent.

168

Flower, inflorescence and chromosome count Inflorescence mostly narrowly cylindrical in outline, cymules few-flowered and contracted. Perianth cream-green to pale blue, 2n=16

D. caerulea var. petasmatodes R.J.F. Hend.

Distribution and habitat From north-eastern New South Wales to eastern subtropical Queensland. Open eucalypt forest on sandy soil and clay loams and along the margins of rainforest.

Habit Upright plant forming dense mats from 2 metres wide and up to 1.3 metres tall.

Stem and leaf Aerial stems with a few scales at the base, followed by leaves evenly spaced. Leaves completely occluded with extravaginal branching units absent.

Flower, inflorescence and chromosome counts Inflorescence irregular in outline with separated narrowly conical sub-units with many flowered cymules. Perianth dark bronze-green to blue-green in colour, 2n=32, 48.

D. caerulea var. protensa R.J.F. Hend. Distribution and habitat

Occurs from west of Sydney, New South Wales, to north-eastern Queensland, on sandy

soils from sea level to 1000 m in altitude.

Habit Plant solitary to 0.5 metres tall.

Stem and leaf Aerial stem with scales at the base and leaves progressively increasing in size upwards, leaf sheath completely occluded and extravaginal branching units absent.

Flower, inflorescence and chromosome count Inflorescence mostly narrowly conical in outline, cymules 3–5 flowered. Perianth pale blue. 2n=48.

169

D. caerulea var. vannata R.J.F. Hend.

Distribution and habitat Occurs in open forest from sea level to high altitude mountainous regions, from west of

Sydney, New South Wales, throughout Queensland to the Torres Strait islands and

southern New Guinea.

Habit Upright plant with a solitary habit, up to 1.3 m tall.

Stem and leaf Aboveground stems with scales at the base followed by leaves increasing in size along the stem. Leaf occlusion zone mostly fused and extravaginal branching units absent.

Flower, inflorescence and chromosome counts Inflorescence narrowly conical to narrowly cylindrical in outline, with cylindrical sub units, many flowered. Perianth pale blue to mid-blue. 2n=16, 32, 48.

D. congesta R.Br.

Distribution and habitat Commonly in sand-dune coastal plant communities from south of Sydney to Townsville, Queensland.

Habit Aerial stems to 1 m in height, forming large mats to 20 m wide.

Stem and leaf Stems to 5–60 cm long, leaves 10–45 cm long, leaf lamina 1–1.5 cm wide, sheaths conduplicate and completely occluded; extravaginal branching units absent.

Flower, inflorescence and chromosome counts Inflorescence within foliage, raceme cylindrical in outline, cymules condensed, 2–8 flowered; pedicels less than 1cm long, sharply ridged to winged, mid to dark blue. Ovules 4–8 per locule; berry 6–12 mm long, 2n=16.

170

Fig. 7.1. A record of the localities where D. caerulea varieties and D. congesta have been collected (Australia’s Virtual Herbarium 2016). (A) D. caerulea var. assera, (B) D. caerulea var. cinerascens, (C) D. caerulea var. petasmatodes, (D) D. caerulea var. producta, (E) D. caerulea var. protensa, (F) D. caerulea var. vannata (also in southern New Guinea) (G) D. caerulea var. caerulea, and (H) D. congesta.

171

7.2 Justification and chapter aims The purpose of this chapter is to conduct a morphometric analysis on the D. caerulea complex for comparison with the combined molecular phylogenetic analysis that included, by necessity, fewer accessions (Chapter 5). Henderson (1987a) himself recommended further taxonomic research of most of his varieties, in particular, D. caerulea var. assera and D. caerulea var. producta.

Far-north Queensland taxa, D. odorata, D. bambusifolia, D. atraxis and varieties in the D. pavopennacea complex, share some morphological similarities with taxa in the complex, e.g. aerial stems with numerous cataphylls, cauline leaves and extravaginal branching units. The molecular phylogeny found they were not related, and for this reason, they were excluded from this study. Due to insufficient plant material, D. intermedia Lord Howe Island (sister to D. congesta and D. caerulea sensu lato) and D. sp. aff. caerulea KMM807 Lake McKenzie Fraser Island were not included.

The author has identified seven additional entities that require further analysis and these are included in the study. These are D. caerulea aff. var. assera Springbrook ‘very narrow leaf’ Qld and NSW, D. caerulea aff. var. assera Yarriabini ‘broad leaf’ NSW, D. caerulea aff. var. assera Norton Basin NSW, D. caerulea aff. var. assera Wentworth Falls NSW, D. caerulea aff. var. assera Dorrigo NSW, D. caerulea aff. var. producta Putty Rd NSW, D. caerulea aff. var. producta East Gippsland Victoria, and D. caerulea aff. var. producta Illawarra NSW.

The specific aims of this chapter are:

(1) To determine the pattern of morphological variation within the D. caerulea complex to test the named varieties using multivariate analyses.

(2) To investigate whether the selected macromorphological characters reliably distinguish taxa, to contribute to further taxonomic work and ultimately descriptions and an identification key.

(3) To refine the geographic limits and distribution of taxa in eastern Australia.

172 7.3 Methods

7.3.1 Sampling At the commencement of this project, Australian herbaria with the largest Dianella collections were examined to determine the morphological similarities and dissimilarities between related species and the varieties in the D. caerulea complex. Selected specimens were borrowed from the major Australian herbaria: Queensland Herbarium (BRI), Australian Tropical Herbarium (CNS), National

Herbarium of New South Wales (NSW), Tasmanian Herbarium (HO), Western Australian Herbarium (PERTH), Northern Territory Herbarium (DNA), State Herbarium of South Australia (SA) and Australian National Herbarium (CANB).

Many herbarium specimens were missing important plant parts or stages for species- level identification. Thus, the objectives of the field work were: (1) to collect all necessary plant parts for identification (i.e. root system, aboveground stems, inflorescence, flowers, fruit and seeds); (2) to collect strategically the D. caerulea complex across its geographic range, but excluding the Cape York region because of logistics; and (3) to create a living collection of Dianella for post examination of morphological characters.

The distributional range of each taxon was analysed using Australia’s Virtual Herbarium and observing herbarium specimens. Dianella literature was reviewed to investigate the morphological characters used to delimit taxa (Henderson 1987a, Heenan & de Lange 2007, Carr 2007b). Recommendations from naturalists and colleagues about specific localities were also included in the collecting regime. A key consideration when planning fieldwork was to ensure Dianella populations were in flower and if possible with fruit. This was determined by examining the collection dates and the flowering stage of herbarium specimens to determine the most suitable collecting period. Once a list of collecting localities was determined, logistics and accessibility to sites were investigated to finalise the trip itinerary.

The trips (between 2010 and 2014) were strategically planned so that at lower altitudes Dianella populations were collected from mid-September to early November, but later at higher altitudes, where the flowering period was from late November until late 173

December. For Dianella in the wet tropics, collections began in early August. Specimens were pressed in the field and living plants were housed in a glasshouse and shade house at The University of Melbourne.

All varieties in the D. caerulea complex were collected from type localities and were included in the dataset. Collecting permits were sourced from the relevant agencies for Queensland, Western Australia and New South Wales. The University of Melbourne, School of Botany Permit was used to collect Dianella in Victoria.

Living plants from northern Queensland were sourced from numerous botanists: Paul Forster, Queensland Herbarium, and local botanists Bruce Gray and Gary and Nada Sankowski. Plants were obtained from New South Wales in the Hunter Valley region by local botanist Fred Fetherston and in the Blue Mountains area by Robert Miller and Colin Gibson. Geoff Carr provided information about the D. caerulea complex in Victoria and New South Wales. At each locality, five mature plants were collected within a 50-metre radius or greater to avoid collecting clones that have a spreading habit. On average, three individuals represented a population, because it wasn't always possible to collect five individuals and therefore the number was less for some taxa.

If available, five flowers with an open perianth from an individual were chosen and stored in 70% ethanol in a plastic screw lid container. In some instances, flowers were pressed in a paper towel. All parts of a flower were scored for colour using a Royal Horticultural Society Colour Chart (5th Edition). Collections were also made in areas where no specimens had previously been collected. All specimens in this study were identified by the author.

A total of 266 specimens, from 95 populations plus 7 herbarium specimens representing all varieties, was included in analysis 1 (Table 7.1, Appendix D). In analysis 2, 67 of 99 available specimens of var. assera and var. producta were studied. These 67 specimens included inflorescences and thus represented a more complete data set for a more detailed comparison of these two varieties.

Dianella flowers were examined with a dissecting microscope to determine if significant morphological differences could be identified (Refer to Appendix E) for a list of the examined flowers). Characters examined were tepal colour and shape, the 174

number of nerves on the inner and outer tepals, struma shape, height, width; filament shape (if straight or kinked), anther length, width and shape; the attachment of the filament to the anther; struma and anther ratio. These characters were not included in the phenetic analysis because there were insufficient samples.

Table 7.1. The total number of samples and populations of Henderson’s varieties and other potential taxa included in the morphometric analyses.

Taxon No. samples No. populations

D. caerulea var. producta

D. caerulea aff. var. producta Mallacoota 37 14

D. caerulea aff. var. producta Putty Rd NSW

D. caerulea var. assera s.s

D. caerulea aff. var. assera Yarriabini

D. caerulea aff. var. assera Springbrook 63 24 D. caerulea aff. var. assera Wentworth Falls

D. caerulea aff. var. assera Nortons Basin

D. caerulea aff. var. assera Dorrigo NSW

D. caerulea var. caerulea 43 13 (+7 herbarium specimens) D. congesta 6 3

D. caerulea var. petasmatodes 46 18

D. caerulea var. protensa 6 2

175

Taxon No. samples No. populations

D. caerulea var. vannata 43 15

D. caerulea var. cinerascens 19 6

Total 263 102

*Also included were those plants that were sampled for the molecular phylogenetic analyses in Chapters 5. These are listed in Table 7.2.

176

Table 7.2. Samples from the molecular analyses (Chapter 5) that were also included in the morphometric analyses.

Taxon Number and location

D. congesta KMM45 Noosa NP Qld; KMM141 Iluka NP NSW

D. caerulea var. caerulea KMM191Cann River Victoria

D. caerulea var. vannata and KMM76 Ravensbourne NP Qld; KMM787 var. vannata? Woocoo NP Qld

D. caerulea var. cinerascens KMM349 Kurri Kurri NSW; KMM339 Putty Rd NSW

D. caerulea var. assera and KMM1041 Tenterfield NSW; KMM48 Bunya aff. var. assera Mountains Qld; KMM1040 Springbrook Plateau Qld; KMM148 Byron Bay NSW; KMM1039 Dorrigo NP Qld; KMM163 Yarriabini NP NSW; KMM665 Nortons Basin NSW.

D. caerulea var. producta and KMM1042 Springbrook NP Qld, KMM664 aff. var. producta Illawarra NP NSW, KMM976 East Gippsland Victoria

D. caerulea var. protensa KMM80 Moreton Island Qld

D. caerulea var. petasmatodes KMM858 Bulburin NP Qld

177

7.3.2 The living collection The living collection (Fig. 7.2) was grown in black plastic pots with a general potting mix that consisted of medium and coarse bark, sand and trace elements. The glasshouse temperature was kept at an average of 25 °C. A spread dripper system watered the plants daily for 20 minutes (8 litres/hour). The occasional treatment for aphids and mealy bugs was spraying with white oil. A slow release native mix fertiliser was applied quarterly.

Fig. 7.2. Some of the D. caerulea varieties growing in The University of Melbourne glasshouse.

178

7.3.3 Character coding Sixteen habit and morphological characters were used to analyse first the whole D. caerulea complex together with the sister species D. congesta; characters comprised seven observational characters, seven measurements and two counts (Analysis 7.1, Table 7.3).

A second analysis was performed on a reduced set of samples for D. caerulea var. producta and D. caerulea var. assera and associated entities. Due to missing plant parts, particularly absence of inflorescence, the number of specimens were reduced for D. caerulea var. producta, D. caerulea aff. var. producta Putty Rd, D. caerulea aff. var. producta East Gippsland, D. caerulea aff. var. producta Illawarra, D. caerulea var. assera s.s ‘narrow leaf’, D. caerulea aff. var. assera ‘very narrow leaf’, D. caerulea aff. var. assera ‘broad leaf’, D. caerulea aff. var. assera Nortons Basin, D. caerulea aff. var. assera Wentworth Falls and D. caerulea aff. var. assera Dorrigo.

Eighteen characters were scored for the second analysis, including more inflorescence characters. These were six observational characters, ten measurements and two counts (analysis 2, Table 7.3). Characters were measured with a Kincromic Digital Vernier Caliper and drafting rulers. A dissecting microscope was also used to examine selected plant parts. The Leica M205A dissecting microscope and an attached camera was used to create images of the morphological variation in Figures 7.7 and 7.8.

The flower morphology of each cluster (entity) found in the numerical analyses was examined to see if there were further discriminating characters (Appendix E lists flowers examined). The characters examined were: number of veins in the inner and outer whorl, struma and anther ratio, if the filament had a kink or was straight and tepal colour.

7.3.4 Numerical analyses Data were analysed using agglomerative hierarchical classification and multidimensional ordination methods (see Chapter 6 for methods). The ordinations were produced in two and three dimensions, however, the stress values for the two- dimensional analyses were greater than 0.2, which is not ideal. The ordinations in three dimensions provided a better fit for both datasets (analyses 1 and 2) with reduced stress values just above 0.1. 179

Table 7.3. Characters used in the morphometric study. Characters without an asterisk in the (*) column were used in both analyses. One asterisk (*) indicates characters only used in the first analysis of the D. caerulea complex. Two asterisks (**) indicate characters used in the second analysis of D. caerulea var. assera, D. caerulea var. producta and related entities.

NUMBER * CODE CHARACTER CHARACTER STATES

Habit characters

1 DC Discrete clump Binary: observation in situ (1) or colony (0)

Stem characters

2 SH Aerial stem Measurement: from the node of height (mm) the first above-ground scale to the highest node, which could be from a scale or a leaf.

3 ASI Average stem Measurement: stem nodes with internode (mm) leaves were unsystematically chosen. The stem length in between each node was measured and the average of three nodes was calculated.

4 SW Aerial stem Measurement: the diameter of diameter (mm) the aerial stem was measured from the mid-length of the stem with a digital calliper.

Leaf characters

5 SL Sheath length Measurement: from the base of (mm) the sheath to the junction of the sheath and blade (including the occlusion zone).

180

NUMBER * CODE CHARACTER CHARACTER STATES

6 BL Blade length Measurement: from the junction (mm) of sheath and blade to the tip of the blade. The occlusion zone was not included.

7 BW Blade width (mm) Measurement: at the widest midpoint of the leaf.

8 FZ Fusion Binary: observed just below the (occlusion) zone junction of the sheath and blade. open (1), closed Refer to Fig. 7.9. (0)

9 NT Number of Measurement: The denticles denticles along were counted along the margin sheath margin of the sheath (midpoint region) using a dissecting microscope (x2 mag.). A graticule (of 10 bars) was also used to count the denticles. The number of denticles within the 10 bars was recorded.

Continued overleaf

181

NUMBER * CODE CHARACTER CHARACTER STATES

10 NOLEST Number of leaves Count: from the base to the along stem top of the aerial stem.

11 * GG Leaves green (1), Binary: glaucous (0) Observation

12 * LU Mature aerial stems Multistate: with cauline leaves in Observation in situ and also the upper 25% region pressed plants (1), Mature aerial stems with cauline leaves along the entire length of the stem (2), Mature aerial stems with two stem systems: upper 25% and 50% (3)

13 * BU Blade undersurface Binary: green (1), glaucous Observation (0) *

14 * EB Extravaginal Binary: observed along branching units aerial stem present (1), absent (0) 15 NC Number of scales Count: scales were counted along aerial stem from the base of the stem and to the top of the stem

16 * TM Denticles commonly Binary: observed along the present along sheath entire margins of the leaf and blade margins (1) or rarely along sheath and blade margins (0)

182

NUMBER * CODE CHARACTER CHARACTER STATES

17 * DS Denticles common on Binary: observed along the sheath and blade (1) entire margins of the leaf or sporadic (0) *

Inflorescence characters

18 * INF Inflorescence Binary: decurved (1), upright observation (0)

19 * RT Ridges and denticles Binary: a dissecting commonly present on microscope (x 2 mag.) was raceme branchlets used to examine all parts of * and pedicels (1), (0) the raceme uncommon to rare

20 * APL Average pedicel Measurement: five pedicels length were unsystematically chosen and the lengths were * measured with a ruler, and the average was calculated. 21 * SH Peduncle height (cm) Measurement: from the last node of the highest leaf to the first node of a branching * unit. (Refer to Appendix H, fig. 1).

22 * RH Rachis height Measurement: from the node of the first major branching unit to the end of the tallest * branching unit (Appendix H, fig. 1)

23 * AS Mature aerial stems Binary: with cauline leaves in Observation the upper 25% region * (1) Mature aerial stems with two stem systems: upper 25% and 50%

183

7.4 Results

7.4.1 Cluster analyses of the D. caerulea complex and D. congesta The UPGMA dendrogram (Fig. 7.3) revealed two major groups, A and B, which split further into subgroups that largely matched Henderson’s taxa. Group A represented varieties assera and producta and revealed three subgroups (A1, A2, A3). Group B revealed five subgroups (B4, B5, B6, B7, B8) including the species D. congesta as one distinct cluster, three that correspond to three of Henderson’s varieties and one cluster that is a mix. The characters with the highest Kruskall-Wallis values that supported the groupings were: (1) extravaginal branching units (present/absent), (2) fusion zone (open/closed), (3) number of cataphylls or scales, and (4) average stem internodes (Table 7.4). In subgroup A1, a cluster of samples attributed to D. caerulea var. assera ‘broad leaf’ Yarriabini NP, New South Wales (A1.1) grouped with samples of D. caerulea var. producta from New South Wales and Queensland (A1.2). Subgroup A2 consists of three other clusters of aff. var. producta: A2.1 aff. var. producta Illawarra, New South Wales, A2.2 aff. var. producta East Gippsland, Victoria, and aff. var. producta and A2.3 Putty Rd, New South Wales. Subgroup A3 clusters together all plants attributed to D. caerulea var. assera and aff. var. assera. A3.1 includes all samples of D. caerulea aff. var. assera Wentworth Falls and Nortons Basin, New South Wales, while A3.2 includes all samples of D. caerulea var. assera sensu stricto from Queensland and New South Wales. A3.3 includes var. aff. assera (‘narrow leaf’), aff. var. assera (‘very narrow leaf’, Dorrigo) and three samples of var. assera collected from Mt Lewis. In group B, subgroup B4 contains all samples of D. caerulea var. caerulea from Victoria, New South Wales and Queensland, except for one specimen from Rockvale, New England Tableland, New South Wales (which fell into subgroup B5). Subgroup B5 is a mix of varieties and is composed of all samples identified as D. caerulea var. petasmatodes, D. caerulea var. protensa (B5.1) from New South Wales and Queensland, and the sample of D. caerulea var. caerulea from Rockvale, New South Wales. All samples of D. congesta clustered together in subgroup B6 from Queensland and New South Wales. All samples of D. caerulea var. cinerascens from New South Wales clustered together in subgroup B7 and all samples of D. caerulea var. vannata from Queensland clustered together in subgroup B8.

184

Fig. 7.3. Dendrogram of 263 specimens of Dianella truncated to the eight-group level, stress 0.1035. The bolded lines are representative of the terminal taxa used in the phylogeny.

185

Table 7.4. The highest Kruskall-Wallis values (KW) and the important characters with range and mean values for the eight groups.

Taxon/ A1 A2 A3 B4 B5 B6 B7 B8 Character var. var. producta var. assera s.s. ‘narrow var. var. D. var. var. Kruskall-Wallis producta + Illawarra, East leaf’+ aff. var. assera ‘very caerulea petasmato congesta cinerascens vannata value aff. var. Gippsland, narrow leaf’ des + var. assera Putty Rd. Wentworth Falls, Nortons protensa ‘broad leaf’ Basin & Dorrigo EB Extravaginal Branching Present Present Present Absent Absent Absent Absent Absent 185.2 FZ Fusion Zone Open, Open to 170.8 variable Open Closed to open Closed Closed Closed Closed closed degree 186 ASI Stem Internode 3–30 5–42 2–51 3–15 5–47 15–38 3–11 23–68 (mm) x = 11 x =16 x = 13 x = 14 x = 27 x = 23 x = 5 x = 44 163.4 ̅ ̅ ̅ ̅ ̅ ̅ ̅ ̅ NC Number of 6–21 6–18 6–33 2–10 2–12 4–7 5–12 2–11 cataphylls x̅ = 13 x = 13 x = 16 x = 5 x = 6 x = 5 x = 8 x = 6 161.7 ̅ ̅ ̅ ̅ ̅ ̅ ̅ LU Aerial Stem Leaves Leaves Leaves on Leaves on Leaves Leaves Morphology Leaves on upper 25% of along along Leaves along upper 25 % upper 25 % and along along entire 152 stems entire entire entire stem of stems 50 % of stems entire stem stem stem stem DC Discrete Clump, Discrete Discrete Discrete clonal colony Colony Discrete clump or colony Colony Colony Colony clump clump clump 145.6 SH Stem Height 27–121 19–77 11–125 1–35 1–99 13–34 4–11 17–103 (cm) x = 61 x = 54 x = 67 x = 8 x = 33 x = 22 x = 9 x = 45 141.11 ̅ ̅ ̅ ̅ ̅ ̅ ̅ ̅

7.4.2 Ordination analysis of D. caerulea complex with D. congesta The groups identified in the dendrogram are evident in the three-dimensional ordination (Fig. 7.4). There are nine discrete clusters of samples. Four of these correspond to Group A in the dendrogram and are: D. caerulea var. producta (including samples initially identified as aff. var. assera Yarriabini ‘broad leaf’); aff. var. producta from East Gippsland, Illawarra, and Putty Rd NSW; D. caerulea var. assera sensu stricto called ‘narrow leaf’, including three samples from Mt Lewis Queensland, clustering with aff. var. assera Wentworth Falls and Nortons Basin; and a separate cluster of D. caerulea aff. var. assera ‘very narrow leaf’ and aff. var. assera Dorrigo. The other five clusters are D. caerulea var. caerulea; D. caerulea var. petasmatodes combined with all samples of D. caerulea var. protensa; D. congesta; D. caerulea var. cinerascens; and D. caerulea var. vannata. One sample of D. caerulea var. cinerascens clustered with D. caerulea var. vannata.

187

7.4.3 Cluster analysis and ordination of Group A (var. producta and var. assera) The dendrogram (Fig. 7.5) shows an initial division into two groups A and B. Subgroups other than A3 and B9 correspond to population/locality. Group A is composed of three subgroups: A1 D. caerulea aff. var. assera ‘broad leaf’, A2 D. caerulea var. assera s.s ‘narrow leaf’ and A3 D. caerulea aff. var. assera ‘very narrow leaf’. Group B includes six subgroups: B4 D. caerulea aff. var. producta Illawarra, B5 D. caerulea aff. var. producta East Gippsland, B6 D. caerulea aff. var. producta Putty Rd NSW, B7 D. caerulea aff. var. assera Wentworth- Falls, B8 D. caerulea aff. var. assera Nortons Basin, and B9 D. caerulea var. producta. In the dendrogram, D. caerulea aff. var. assera Wentworth Falls and D. caerulea aff. var. assera Nortons Basin are separated from group A1 suggesting a similarity with D. caerulea var. producta rather than D. caerulea var. assera. However, they cluster in Group B at a high level in the hierarchy and their affinity is equivocal (see ordination below). The characters with the highest Kruskall- Wallis values (Table 7.5) correlating with these groups are blade width (e.g. discriminating groups A1 and B7 from the others), plant habit discrete clump or clonal colony, fusion zone open or closed, average pedicel length, number of denticles along the sheath and scape height. However, these KW values are not high and characters are not clear cut; for example, assera entities ‘narrow leaf form’ and ‘broad leaf form’ generally form discrete clumps, whereas, variation was observed in ‘very narrow leaf’: although mostly scored as a clonal colony, samples from a population in Byron Bay were in discrete clumps.

The three-dimensional ordination (Fig. 7.6) confirms that D. caerulea var. producta sensu stricto (B9) and var. assera sensu stricto ‘narrow leaf’ (A2) are distinctly different. The ordination also confirms morphological variation within each of these varieties. Within D. caerulea var. assera there is a broad leaf form from Yarriabini NP (A1), and two clusters (A2 and A3) are evident in the ‘narrow leaf’ form (one var. assera sensu stricto ‘narrow leaf’ from New South Wales and Queensland, and the other var. assera ‘very narrow leaf from New South Wales and Queensland. As mentioned above, the affinities of clusters B7 and B8 in the dendrogram are less clear. In Fig. 7.6A and C, samples of D. caerulea aff. var. assera Wentworth Falls are located nearest to other samples of var. assera, but in Fig. 7.6B one sample is closest to D. caerulea var.

188

producta sensu stricto. The three samples of D. caerulea aff. var. assera Nortons Basin either cluster amongst D. caerulea var. producta (Fig. 7.6A, axes 1 and 2) or as a separate group (Fig. 7.6B, axes 1 and 3, Fig. 7.6C axes 2 and 3).

Fig. 7.5. Dendrogram of 67 specimens of Dianella showing nine groups, stress 0.1151.

189

190

Table 7.5. The highest Kruskall-Wallis values and the important characters with range and mean values for the nine phenetic groups.

Character & A1 A2 A3 B4 B5 B6 B7 B8 B9 Kruskall-Wallis aff. var. var. assera aff. var. var. var. var. producta var. assera var. assera var. values assera s.s ‘narrow assera ‘very producta producta Putty Rd, Wentworth Nortons producta ‘broad leaf’ NSW, narrow leaf’ Illawarra, East NSW Falls, NSW Basin, NSW s.s NSW, leaf’, NSW QLD NSW, QLD Vic., NSW Gippsland QLD

Blade width (mm) 19–25 12–24 7–12 9–14 7–9 10–15 18–27 12–17 12–25 49.648 x̅ = 22 x̅ = 17 x̅ = 10 x̅ = 11 x̅ = 7 x̅ = 12 x̅ = 23 x̅ = 14 x̅ = 18 Plant habit Colony to Discrete Discrete Discrete Discrete 49.235 discrete Colony Colony Colony Colony

191 clump clump clump clump clump

Fusion zone Closed to Open Closed Open Open Open Closed Closed Open 48.971 open Average pedicel length (mm) 6–9 3–5 6–10 6–10 10–12 4–6 8–9 7–9 5–11 46.747 x̅ = 7 x̅ = 3 x̅ = 8 x̅ = 9 x̅ = 11 x̅ = 5 x̅ = 8 x̅ = 8 x̅ = 7

No. denticles along 2–5 6–20 7–10 3–5 3–8 3–8 3–5 7–10 5–13 sheath x = 3 x = 12 x = 8 x = 4 x = 6 x = 5 x = 4 x = 9 x = 8 43.779 ̅ ̅ ̅ ̅ ̅ ̅ ̅ ̅ ̅ Peduncle height 8–12 8–24 85–42 30–48 37–50 12–28 24–52 23–45 29–64 (cm) x = 104 x = 14 x = 20 x = 40 x = 41 x = 21 x = 37 x = 36 x = 40 43.488 ̅ ̅ ̅ ̅ ̅ ̅ ̅ ̅ ̅

7.4.4 Flower morphology The samples investigated for floral morphology indicate that there is some variation among entities in the D. caerulea complex. Taxa have either 3 or 5 veins on the inner tepals and 5–7 veins on the outer tepals (Table 7.6a, b & c). The struma to anther ratio was measured as approximately 1:3 for all taxa. The filament has a kink for all taxa, except in D. caerulea var. assera s.s., in which it is straight, and in D. caerulea aff. var. assera ‘broad leaf’ where it varies from straight to kinked.

Tepal colour was typically consistent within a population, classified as light purple, medium purple to dark purple. In some cases, tepal colour was pale blue or white in separate populations of D. caerulea var. producta. Multi-coloured tepals were observed in some taxa, i.e. aff. var. assera ‘broad leaf’, aff. var. assera ‘very narrow leaf’, and D. caerulea var. vannata, with white outer tepals and pale to medium purple inner tepals. Anthers were typically yellow, the struma orange, filament white, ovary green and style white. The anthers split at the apex, approximately for 1/4 to 1/3 the length of the entire anther. No floral scent was detected in the populations examined, expect for one population of aff. var. assera ‘very narrow leaf’ collected in Myall Lakes National Park, New South Wales. The flowers of D. caerulea aff. var. assera Dorrigo were not examined due to limited flower material. The size of each flower part was also examined; there was some variation but this was considered to be natural variation. A preliminary examination of the ovaries indicates that 3 locules (chambers) occur in all taxa. Further research is required as Henderson (1987a) found 6–12 ovules per chamber in D. caerulea s.l.

192

Table 7.6a. Flower characters examined and recorded for five of the varieties of D. caerulea and compared with D. congesta.

Taxa/ var. var. var. var. var. D. Character caerulea petasmatodes protensa cinerascens vannata congesta

Filament Kinked Kinked Kinked Kinked Kinked Kinked

Number of inner tepal 3–5 3 3 5 3 3–5 nerves

Number of outer tepal 5 5 5 7 5 5–7 nerves

Struma/anther length 1:3 1:3 1:3 1:3 1:3 1:3 ratio

Table 7.6b. Flower characters of D. caerulea var. assera and putative variants.

Taxa/Character var. aff. var. aff. var. aff. var. aff. var. assera assera assera assera assera s.s ‘broad ‘very Wentworth Norton ‘narrow leaf’ narrow Falls Basin leaf’ leaf’ Filament Straight Straight to Kinked Kinked Kinked kinked

Inner tepal 3 3 3 5 3 nerves

Outer tepal 3–5 5 5 7 5 nerves

Struma anther 1:3 1:3 1:3 1:3 1:3 ratio

193

Table 7.6c. Flower characters of D. caerulea var. producta and affinities.

Taxa/Character var. var. producta East var. producta Gippsland producta s.s Putty Rd

Filament Kinked Kinked Kinked

Inner tepal 3–5 3–5 5 nerves

Outer tepal 3–5 3–5 5 nerves

Struma anther 1:3 1:3 1:3 ratio

194

Fig. 7.8 The leaf occlusion zone. The arrow in each photographic image indicates the position of the occlusion zone. Open occlusion zone: (A) D. caerulea var. producta (Putty Rd, NSW) and (B) D. caerulea var. producta (Illawarra, NSW). The adjacent diagrams represent the extent of the fusion zone; 100% is completely open, the 60-70 % diagram, the dark region is completely fused and the 50 % diagram, the dark region is the fused region. Closed fusion zone: (C) D. caerulea var. petasmatodes (D’Aguilar NP, Qld) and (D) D. caerulea var. vannata (Fraser Island). The adjacent image illustrates the fusion zone 100% completely fused.

195

Fig. 7.9 A diagnostic drawing of a Dianella leaf (adapted from Henderson 1987a). In between the two red lines below the leaf blade is the zone of occlusion.

Fig. 7.10 Pedicels and branching units with raised ridges and denticles. (A) The pedicels of D. caerulea var. assera Springbrook NP ‘very narrow leaf’ illustrating raised ridges and denticles (black arrows). (B) Raised ridges (black arrows) on a branching unit of D. caerulea var. assera Springbrook NP ‘very narrow leaf’.

196

7.5 Discussion

7.5.1 Overview The morphometric analyses confirmed that the D. caerulea complex includes a number of morphological groups, which largely correspond to the varieties of Henderson (1987a), but also revealed more complex variation within two of those varieties. The molecular phylogeny, in addition to morphology, indicated that D. congesta is the sister taxon to the D. caerulea complex and that the complex is monophyletic. Within the complex, D. caerulea var. vannata, which ranges from eastern Australia to New Guinea, is sister to the other varieties in the combined molecular analysis, but it may include a number of lineages (as hinted at in the molecular phylogeny, and with recorded chromosome counts of 2n=16, 32 and 48). It requires more detailed sampling and analysis to increase understanding of its variation to reveal its evolutionary history, but it is recommended that it be raised taxonomically to species level.

Dianella caerulea var. caerulea, var. cinerascens, var. petasmatodes and var. protensa were each identifiable morphological clusters with the accessions used in the molecular phylogeny clustering as expected within their morphological groups. The analyses also revealed that both D. caerulea var. producta and var. assera include morphological variation that could be recognised taxonomically. ‘Producta’ includes two groups: the typical form from New South Wales and Queensland (B9, Fig. 7.5), characterised by plant habit in a discrete clump, open occlusion zone; and a group of three subgroups (B4, B5 and B6, Fig. 7.5) that clustered together from Illawarra NSW, Putty Rd NSW and East Gippsland, all of which require further study. ‘Assera’ includes a ‘broad leaf’ form, only known from Yarriabini NP New South Wales, the typical ‘narrow leaf’ form from subtropical to tropical rainforest in New South Wales and Queensland, and a ‘very narrow leaf’ form, also from New South Wales and Queensland (which inhabits a diverse range of communities, e.g. coastal forest to subtropical rainforest). Distinctive populations from Wentworth Falls and Nortons Basin, from south-east New South Wales, require further sampling and analysis. Varieties producta and assera are likely sister taxa characterised by the presence of extravaginal branching units, arguably an apomorphic character given D. congesta is the outgroup.

197

If ‘producta’ and ‘assera’ were each to be raised to the rank of species and variation within then considered at variety level, then the other current varieties in the complex would need to be revised to recognise monophyletic groups. In addition to the possibility of raising var. vannata to species level, var. caerulea sensu stricto and var. cinerasens also may be raised. However, the positions of varieties petasmatodes and protensa are unclear in the preliminary molecular phylogeny, as indicated below (Fig. 7.11).

7.5.2 Comparison with the molecular phylogeny Six accessions identified as D. caerulea var. assera or aff. assera (‘broad leaf’, ‘narrow leaf’ and ‘very narrow leaf’) were included in the molecular phylogeny (Fig. 7.11). They clustered in the one clade (node 75) but also with one accession identified as var. petasmatodes (with a long branch length). A sample of var. assera Nortons Basin was outside the clade and was related to var. producta from Mallacoota. This link with var. producta reflects the findings of the morphological analysis with this population being equivocal. The tree in Figure 7.11 suggests some biogeographic links such as node 71 relating accessions from south-east New South Wales and Mallacoota East Gippsland, Victoria, node 76 relating Queensland accessions, and node 78 relating North-East New South Wales to south-east Queensland.

As mentioned earlier, D. caerulea var. vannata is in a basal position (nodes 66, 67) and the rest of the complex is supported as a clade (node 68, PP 1.00, BS 50%). Dianella caerulea var. caerulea (node 69, PP 1.00) is sister to taxa in the same broad biogeographic region including D. caerulea var. cinerascens. These molecular results indicate that a greater level of sampling for DNA analysis, together with studies of ploidy levels across the geographic range of taxa, have the potential to reveal the evolutionary history of the clade and provide further evidence for taxonomic revision.

198

7.5.3 Investigating the leaf character ‘zone of occlusion’ In his treatment for Dianella, Henderson (1987a) described the leaf occlusion zone, as follows. “There is a zone on the leaf, at or towards the apex of the sheath, where the adaxial surfaces of opposing sides are variously connate about the midrib. This is referred to as the zone of occlusion of the leaf sheath.” He used this character to delimit taxa in the complex, evident in his dichotomous key (see Henderson 1987a, p. 209). For each variety, he described the character to be either moderately, considerably or ± completely occluded distally, and provided a diagnostic drawing to illustrate this character (Henderson 1987a, Fig. 65D, pg. 210).

The leaf occlusion zone (Fig. 7.9) was thoroughly examined by observing fresh material and herbarium specimens. In some instances, along the sheath margin, a transparent to white region occurs, which is approximately 2–4 mm in height, and can

199

be open and not fused (Fig. 7.7). In these instances, the fusion zone (the transparent to white region) was still scored as closed because the transparent margin was considered not technically part of the sheath.

The extent of fusion in the zone of occlusion can vary within a variety, also indicated by Henderson (1987a) in his dichotomous key. The fusion zone of D. caerulea var. producta varies from completely open to 30%, 50% or even 75% fused (Fig. 7.8A, B); similarly, D. caerulea var. caerulea ranges from open to completely fused and this was also identified for taxa in this study. Other taxa were scored as having a completely closed fusion zone: D. congesta (outgroup) and D. caerulea vars. vannata, var. cinerascens, var. protensa, var. petasmatodes and some var. assera s.s and the majority of aff. var. assera ‘very narrow leaf’ (Fig. 7.8C, D). Thus, a closed fusion zone is arguably plesiomorphic and an open zone the more derived condition, evolving in both var. caerulea and var. producta. The open condition may prove useful for delimiting taxa identified with this character.

7.5.4 Inflorescence morphology In the first analysis, inflorescence characters were not included because many racemes were at different stages of maturity. Observing numerous specimens in the living collection indicated that approximately 2–3 months is required for a raceme to reach maturity. Additionally, observing the arrangement of pedicels on a branching unit provided useful information to delimit taxa. For example, the pedicels of D. caerulea var. petasmatodes, D. caerulea var. vannata and D. caerulea var. cinerascens were radially symmetrical (pedicels arranged spirally around the stem axis; Fig. 6.14) whilst the pedicels of all other taxa were not radially symmetrical. The branching units of D. caerulea var. cinerascens are quite reduced and identifying this pedicel arrangement was quite difficult. D. congesta also has reduced branching units, and the pedicels appeared to be not radially symmetrical.

Some specimens included in the dataset were not grown in the glasshouse, and therefore further research is required to observe mature inflorescences of those populations. The inflorescences in the holotypes of var. vannata and var. petasmatodes are immature, which made identifying the pedicel arrangement quite difficult.

200

Raised ridges and denticles (Figure 7.10) on the branching units and pedicels are additional distinguishing characters for D. caerulea var. vannata, var. cinerascens, var. assera and D. congesta. However, there were some exceptions for D. caerulea var. assera, with some plants were lacking raised ridges and denticles identified as D. caerulea aff. var. assera Dorrigo, and populations from Wentworth Falls and Nortons Basin in south-east New South Wales. Taxa lacking these characters (possibly an apomorphic loss) are D. caerulea var. caerulea, var. producta, var. petasmatodes and var. protensa. But there were exceptions in var. petasmatodes, with populations observed with raised ridges and denticles (see section 7.5.9). Observing raceme development for multiple taxa in the glasshouse indicated that the development of denticles and ridges (discussed in more detail below) is influenced by the age of the raceme, which varied between specimens scored. This could make the identification of these characters difficult in herbarium specimens.

7.5.5 Rhizome morphology Henderson (1987a) used plant habit to assist in delimiting taxa, which was also done by other authors (Carr & Horsfall 1995; Heenan & de Lange 2007). The study here found D. caerulea var. petasmatodes and D. caerulea var. protensa to spread clonally for many metres, but, Henderson (1987a) described var. protensa as occurring in discrete clumps. Henderson (1987a) described var. petasmatodes to be ‘matt-forming’ and spreading for many metres, which agrees with the scoring here of that variety clonal. Field observations indicated the ‘matt-forming’ rhizome morphology described by Henderson (1987a) for var. petasmatodes is quite variable and is likely influenced by the substrate, which can result in a mixture of short to long rhizomes observed in a plant that forms large clonal colonies. Using habit to diagnose Dianella taxa is an important character, coupled with other characters. However, it is best applied when observing plants in situ. Unfortunately, the majority of herbarium specimens lack this information. Additionally, when observing this character in the field, it is important to observe a large group of plants in an area, to be certain of observing mature plants.

7.5.6 Seed morphology A preliminary review of seed morphology was made for all taxa. All seeds were observed have a smooth surface and two different seeds shapes were observed, (1)

201

oblong to round in outline, and, (2) oblong with a pointed end. Further research is required to examine a larger sample size to confirm the observations recognised in this study.

7.5.7 Comments on taxa The following clarifies the distribution of taxa in the D. caerulea complex. The varietal names of Henderson (1987a) are used below, although taxonomic revision and raising some to species rank is foreshadowed.

7.5.8 D. caerulea var. caerulea According to Henderson (1987a Appendix, pg. 477) Sims' (1801) coloured plate and description were based on plants grown from seeds sourced from Sydney, and raised in a glasshouse in London. Henderson (1987a) used the coloured plate as the main guide for the application of the name caerulea, and this was taken into consideration when researching this variety. Henderson (1987a) did not allocate a type locality for the variety, although this is a taxonomic requirement.

This study includes collections from the northern limit of var. caerulea in south-east Queensland, e.g. Lamington National Park and Karawartha Park in Brisbane. Some of these plants were grown in a glasshouse to confirm their identification. A review of specimens lodged at BRI indicates the variety commonly occurs in this region. Based on the distribution of var. caerulea in Australia's Virtual Herbarium (2016), the distribution includes the New England Tableland and further south-east to Port Macquarie. However, these specimens were not examined to confirm their identification. One herbarium specimen was observed from Rockvale, (New England Tableland) CBG331625 but only limited information could be obtained from the specimen. It was the only specimen of D. caerulea var. caerulea with a closed fusion zone and clustered with D. caerulea var. petasmatodes in the dendrogram. In the ordination in three dimensions (Fig. 7.7A) the specimen clustered with other herbarium specimens of D. caerulea var. caerulea. Further research is required to examine populations part of the western range.

Specimens lodged at the Australian Tropical Herbarium, annotated as D. caerulea var. caerulea, are from the Cairns region (i.e. CNS108508, CNS504937, CNS504938, CNS107278, CNS107279, CNS504945, CNS108090, CNS108416, CNS115687). 202

These specimens were examined and are not D. caerulea var. caerulea. They are mostly var. vannata and var. petasmatodes which both occur in the region. This confirms the most northern limit of D. caerulea var. caerulea is south-east Queensland.

Specimens from the Cape York region, (CANB00326093, CBG8802536 and BRI756026) show morphological affinities to D. caerulea var. caerulea, particularly short aerial stems, open leaf occlusion zone and similarities in inflorescence morphology. Further field work is required to visit the localities of these accessions to make an accurate morphological assessment.

The southern range of D. caerulea var. caerulea extends into the eastern fringes of Melbourne in sclerophyll forest environments. Collections in this study were included from East Gippsland and populations were observed east of Melbourne to confirm it is var. caerulea. Henderson (1987a) also described the variety as occurring in Tasmania (de Salas & Baker 2015). However, the Tasmanian Census of 2015 no longer recognises its occurrence, which is also confirmed by the review of herbarium specimens lent by HO as part of this study. D. amoena is now recognised for Tasmania.

7.5.9 D. caerulea var. petasmatodes Dianella caerulea var. petasmatodes occurs in a range of environments, including rainforest and dry sclerophyll environments. Variation in aerial stem height and leaf width was evident and all populations were observed spreading clonally for many metres in width, with the occasional small clump plant within the population, which was identified as a juvenile. As discussed above (section 7.5.4), there were exceptions with the presence of raised ridges and denticles on the branching units of var. petasmatodes. These populations were from Noosa National Park and Kurrimine Beach (both occurring in foreshore environments).

A collection of Dianella from Yamba in New South Wales initially appeared to be D. caerulea var. caerulea. Observation of a living plant over numerous seasons found the plant developed tall aerial stems with cataphylls and leaves in the upper 25% to 50% without extravaginal branching units, which is not typical of taxa in group B. Further research is required to assess the morphology of populations throughout 203

central to north coast New South Wales. The southern limit of var. petasmatodes is Lismore, New South Wales, typically in subtropical rainforest environments, and northern limit is Mt Lewis in far-north Queensland.

7.5.10 D. caerulea var. protensa Henderson (1987a) described D. caerulea var. protensa as occurring in parts of Queensland and New South Wales (Fig. 7.1). Including sandstone localities on the Blackdown Tableland and Cania Gorge in Queensland, visited as part of the field work. Populations were observed spreading in large clonal colonies many metres wide, and were identified as D. caerulea var. petasmatodes, and not var. protensa, largely based on plant habit. Unfortunately, the majority of collections had immature inflorescences, and this was also the case for Henderson’s annotated specimens that he assigned to var. protensa (NSW599247 Blackdown Tableland and Cania Gorge NSW599252). Henderson (1987a) noted that D. caerulea var. protensa extends to Mt Tomah, in the Blue Mountains in New South Wales. Based on numerous field trips in the area, I did not observe var. protensa in the region nor var. petasmatodes and var. vannata.

Inflorescence morphology assists in delimiting D. caerulea var. protensa from var. petasmatodes. The pedicels of D. caerulea var. protensa are arranged asymmetrically, whilst those of D. caerulea var. petasmatodes are radially symmetrical (Chapter 6, Fig. 6.14 and 6.13). This was confirmed by examining the holotype of D. caerulea var. protensa which contained a mature inflorescence that matched the specimens collected on Moreton Island. Without the examination of mature inflorescences, it would be difficult to delimit these two taxa.

7.5.11 D. congesta Dianella congesta is morphologically unique compared to other taxa in the complex. The raceme is quite contracted and decurved at the apex with relatively short branching units. It rarely has denticles on the leaf margins, whilst all taxa in the D. caerulea complex commonly have denticles.

The type locality is purported to be the Prince of Wales Island in Torres Strait, based on a specimen collected by Robert Brown in 1802. Henderson (1987a) placed a question mark next to the type locality, in accordance with Brown who placed a 204

question mark on the specimen label. Henderson (1987a; Appendix, p. 479) states the taxon does not occur as far-north as Torres Strait Island, and the type specimen was likely collected further south than Good Island. The holotype contains an immature inflorescence and it was difficult to determine if denticles were present or absent on the leaves. Australia's Virtual Herbarium (2016) includes specimens identified as D. congesta north of the Tropic of Capricorn in Queensland. Further research is required to examine these specimens and to clarify whether the taxon does extend to the Prince of Wales Island in Torres Strait.

7.5.12 D. caerulea var. vannata As with var. petasmatodes and var. protensa, field collections of var. vannata mostly had immature inflorescences. The majority of borrowed specimens were also immature, and in many cases, the inflorescence was folded, which made the use of the specimens for phenetic analyses quite difficult. Multiple plants were grown in the glasshouse from different localities. There are potential differences in the length of the major branching units of the raceme, the number of pedicels and branching orders between populations. Further research is required to examine mature inflorescences across the range.

A thorough taxonomic examination is required to compare D. caerulea var. aquilonia and D. caerulea var. vannata. Although the combined molecular phylogeny indicated that they are not related (and each should be considered to be species), based on the current circumscriptions by Henderson (1987a), very limited information is provided to delimit the two taxa morphologically. Plants of D. caerulea var. aquilonia were grown in the glasshouse from numerous localities, including the type locality (Somerset, Cape York) and from the Cairns region. My observations indicate differences in inflorescence and seed morphology (Chapter 3, section 3.45). Further research is required to examine populations throughout the Cape York region. This study includes specimens from south-east Queensland to far-north Queensland. Field work was not conducted in the western part of the range in south-east Australia and the Cape York region, nor were collections from the Torres Strait islands to southern New Guinea included so that region requires further research. According to Henderson (1987a), the southern limit of D. caerulea. var. vannata is Mt Nardi, north of Lismore, New South Wales and this area also requires further study.

205

7.5.13 D. caerulea var. cinerascens Plants grown in a glasshouse and shade house for several years confirm that the distinctive glaucous appearance of D. caerulea var. cinerascens is a reliable character. The taxon has short aerial stems compared to the majority of taxa in group B (Table 7.5). Although not scored in this study, in some specimens, depending on the age of the raceme, the pedicels appear to be radially symmetrical like var. vannata and var. petasmatodes. However, many specimens had very reduced branching units, and it was difficult to make an accurate assessment. The molecular phylogeny placed D. caerulea var. cinerascens in a separate clade to D. caerulea var. vannata, which provides supporting evidence they are not closely related.

Morphological variation was observed in two localities: plants in a population along Putty Road, in New South Wales were green and not glaucous. In Denman, New South Wales plants formed large clonal colonies (many metres) and rhizomes were quite widely spread apart. All other populations in this study were observed in discrete clumps with short rhizomes. Samples from Denman were not included in the dataset because of poor quality material. Additionally, a specimen from Denman NSW365235 had scales mostly along the entire length of the aerial stem, which is not typical. Further research is required to examine populations in these localities in New South Wales. Dianella caerulea var. cinerascens occurs in the Upper Hunter Valley, New South Wales in sandstone outcrops and dry sclerophyll forests (Henderson 1987).

7.5.14 D. assera complex Five groups are apparent in D. caerulea var. assera and these are discussed in detail below.

D. caerulea var. assera s.s ‘narrow leaf’ D. caerulea var. assera s.s ‘narrow leaf’ forms a discrete clump to 0.5 m wide with short rhizomes. It has the shortest pedicels 3 (3–5) mm, including raceme and major branching units. A review of the flower morphology indicates the filament is straight, whilst D. caerulea var. assera ‘very narrow leaf’ is always kinked, as well as Nortons Basin and Wentworth Falls populations in south-east New South Wales. The filament of D. caerulea var. assera ‘broad leaf’ was straight with the occasional kinked filament. Additionally, Henderson (1987a) described the tepals of D. caerulea var.

206

assera to have green streaking, however, I did not observe this colour, which could be an environmental or pathogenic condition

Observations of a living plant in the glasshouse, showed that the raised ridges and denticles on the raceme develop prior to the commencement of flowering. A population occurring in rainforest at Springbrook Plateau, Springbrook National Park and had white flowers, which is not typical. Examination of these two flower forms indicated there were no major differences other than perianth colour. A plant occurring on Mt Lewis, in far-north Queensland spread clonally to approximately 1.5 metres, which is not typical. Further research is required to examine populations on Mt Lewis. Two other diagnostic characters not scored were inner sheaths always medium green in colour and a transparent to white sheath margin (2–4 mm) common along the sheath.

Based on the collections in this study and the review of herbarium specimens, the northern limit of var. assera ‘narrow leaf’ is the wet tropics region in far-north Queensland. The most southern locality observed was west of Port Macquarie in rainforest.

D. caerulea var. assera ‘broad leaf’ Dianella caerulea var. assera ‘broad leaf’ had the widest leaf blades and is the only entity to consistently have an open occlusion zone. The plant habit is also 0.5 m wide at the base with short rhizomes. The perianth is multicoloured with inner white tepals and pale to mid-violet outer tepals (see Figure 1.2, Chapter 1). The denticles along the leaf are quite sparse compared to the other groups identified in var. assera. Raised ridges and denticles were observed appearing after the raceme had commenced flowering (based on observing a living plant in a glasshouse), which is different to var. assera s.s ‘narrow leaf’. A plant in a private collection had aerial stems to c. 1.5 metres, which indicates large forms do exist. Only one specimen is lodged at the New South Wales Herbarium NSW249540. Two diagnostic characters not scored were inner sheaths pale to medium green and the presence of a transparent to white sheath margin.

The entity is a narrow endemic, only known to occur on Yarrahappinnii Mountain, Yarriabini National Park in north-east New South Wales. It occurs in sympatric association with D. caerulea var. assera ‘very narrow leaf’. Adventitious roots were 207

observed on the extravaginal branching units by Robert Miller (pers. comm.), which is not documented for Australian Dianella. This root type was also observed at the base of extravaginal units of D. caerulea var. assera ‘very narrow leaf’ collected in Springbrook National Park as part of this study (pers. obs. KMM).

D. caerulea var. assera ‘very narrow leaf’ Dianella caerulea var. assera ‘very narrow leaf’ occurs in clonal colonies (1–3 metres wide), with short to long rhizomes. It inhabits a range of environments, e.g., in sclerophyll forest, Springbrook National Park, Queensland and Tenterfield New South Wales; rainforest in Dorrigo National Park New South Wales, coastal rainforest in Myall Lakes National Park and sandstone forest near Wisemans Ferry, New South Wales. Plants were observed in discrete clumps in a population at Byron Bay, New South Wales, which indicates variability in rhizome morphology. Collections from Tenterfield, were quite variable, with short aerial stems spreading many metres wide.

In some populations, the aerial stems of the the extravaginal branching units were long and multi-branched, which is not typical. They were not multibranched for var. assera ‘narrow leaf’, and var. assera ‘broad leaf’. Unfortunately, inadequate plant material was available to further evaluate these characters. Some mature inflorescences of plants from Tenterfield, Myall Lakes lacked raised denticles and raised ridges. Sheath colour was quite variable, ranging from light green, to red and maroon. A clear transparent white sheath margin was also visible in plants of some populations; however, it could be difficult to detect when the sheath margin is red or maroon.

Further research is required to assess morphological forms in the Taree region and further north-east in New South Wales because the area was not adequately sampled. Dianella occurring in rainforest on Mt Cambewarra, in south-east New South Wales, is likely to be D. caerulea var. assera ‘very narrow leaf’, which would be the most southern locality. Collections were made along a steep road embankment in rainforest vegetation and only one plant was observed. Some of the sheaths had an open occlusion zone which is unusual. No collections are currently lodged in Australian herbaria for this locality and more field work is required to examine populations in situ.

208

Dianella caerulea aff. var. assera Dorrigo collected from Yarriabini NP and Dorrigo National Park, New South Wales and occurred in grassy woodland. The plants had a spreading habit c. 1–1.5 metres wide, with short to long rhizomes. A plant was grown for multiple years in a glasshouse and produced large multibranched inflorescences without denticles or ridges, which is unusual for var. assera entities. Additionally, extravaginal branching units appeared distally with age. The majority of specimens in this study lacked inflorescences, and further research is required to investigate additional populations in the region.

D. caerulea var. assera Wentworth Falls This group in the phenetic analysis was composed of three individuals from one locality in Wentworth Falls, Blue Mountains, New South Wales. Other morphological distinctions not scored include inner red sheaths and prominent raised venation on the sheath, however, this latter character was variable. The blade has a glaucous undersurface, short aerial stems and a clonal habit, with plants spreading for many metres. The raceme branching units and pedicels were smooth and lacked raised ridges and denticles. Additional samples are required to determine if this population is significantly different from the other groups and if it warrants taxonomic recognition or it represents some level of hybridisation.

D. caerulea var. assera Nortons Basin This phenetic group included samples from Nortons Basin and Silverdale in south- east New South Wales. Plants sampled in the field occurred in dry forest environments and the leaves were quite glaucous. Plants grown in a glasshouse did not remain very glaucous and the upper surface of the leaf was more a dark green colour. However, the leaf undersurface remained glaucous and this was scored in the analysis. The extravaginal branching units appear distally with age and had similarities in morphology to D. caerulea aff. var. assera Dorrigo, which occurs in grassy sclerophyll forest environments. Based on the examination of plants from two localities, denticles and ridges were absent on the branching units and pedicels of the raceme.

7.5.15 D. caerulea var. producta Subgroups were evident in both analyses for D. caerulea var. producta, indicating morphologic variation and biogeographic patterns. The examination of flower morphology of the investigated populations found no major differences. However, 209

there were apparent differences in raceme size, and the number of branching orders in mature racemes that require further study. Perianth colour varied from pale blue, to white to light to mid-purple. Inner white to pale green sheaths is another character to define the group. Plant habit varied throughout the range with populations that formed discrete clumps to clonal colonies.

Dianella caerulea var. producta has some morphological similarities with D. caerulea var. caerulea. They both have a multi-branching raceme, absent of pedicels and raised ridges, asymmetrically arranged pedicels, an open leaf occlusion zone with pale white to green inner sheaths. They also occur in the same geographic region in similar environments. Henderson (1987a) also noted morphological similarities between D. odorata and D. caerulea var. producta and recommended further study of the taxa. I observed substantial morphological differences between the two taxa. D. odorata has a contracted raceme, whilst D. caerulea var. producta has a multi-branched raceme. The leaves of D. odorata are without denticles (in some instances denticles can be observed at the apex of the blade), whilst D. caerulea var. producta commonly has denticles along the leaves (but sporadic denticles on leaves in some populations were observed, as discussed below). Seed and fruit morphology may provide additional characters to delimit the two taxa.

D. caerulea var. producta s.s Occurs in dry sclerophyll forest in south-east Queensland, north-east New South Wales and the study here included samples collected from the type locality, Mt Coonowrin, Glasshouse Mountains, Queensland (Henderson, 1987a). Plants occurred in discrete clumps to c. 0.5 m wide, which is in accordance with the description by Henderson (1987a). Denticles commonly occur along the margins of the leaves. Leaves and extravaginal branching units occur in the upper 25% of the aerial stems.

Central and North-East New South Wales Populations have unique aerial stem morphology with two different leaf systems on individual aerial stems, occurring in the upper 25% or upper 50%. Collections from Putty Road and Colo Heights (NSW) in the same group had extravaginal branching units along the entire length of the aerial stem, which is not typical. This character was not scored because inadequate plant material was available. The leaves were a light to medium green which is the typical colour of D. caerulea var. producta s.s. 210

Specimens from Sea Acres National Park, NSW had sporadic denticles along the leaves and were the only population in the group to have this arrangement, whilst all other populations commonly had denticles. The populations occurred in clonal colonies for many metres.

Illawarra and Woodford, south-east New South Wales Populations spread clonally from c. 1 metre to many metres. The leaves were dark green with a glaucous undersurface, and the denticles along the sheath, blade and midrib were sporadic, similar to plants from Sea Acres National Park and Port Macquarie, New South Wales. Populations were quite prolific throughout the Blue Mountains region, and there was a range of forms. This made identifying the taxon difficult, due to the variation in leaf height, width and plant habit, which can vary depending on the age of the plant. Leaves and extravaginal branching units occur in the upper 25% of the aerial stems. Dianella caerulea var. producta East Gippsland, Victoria includes collections from Mitchell River National Park and Mallacoota. The leaves were light green, and denticles along the leaves were common along the sheath, blade and midrib. The plants were observed in large clonal colonies many metres wide. This is a range extension for D. caerulea var. producta.

7.6 Recommendations This study is a basis for the elevation of some taxa in the D. caerulea complex to species, and the recognition of subspecies or varieties within some of those species. The evidence for taxonomic change is based on the documented morphological variation, the preliminary molecular phylogeny informing monophyly of taxa, and consideration of ploidy levels. The plesiomorphic chromosome number is 2n=16, with evidence of polyploidy among lineages (see Chapter 5), but this requires further study. Although the molecular phylogeny requires greater sampling, genetic variation between taxa was evident.

Dianella caerulea var. vannata should be raised to species rank but further study is required across the geographic range, from Queensland to New Guinea. One molecular sample identified as D. caerulea var. vannata? suggested paraphyly of the taxon. This plant was observed spreading clonally for many metres and clustered with D. caerulea var. petasmatodes in the morphological phenetic analysis. A greater

211

geographic range of samples is required to assess ‘vannata’, including investigation of polyploidy.

D. caerulea var. cinerascens (2n=16) should be raised to species rank, it formed distinct clusters in the phenetic analysis and informative morphological characters were identified.

Dianella caerulea var. assera (2n=16) and D. caerulea var. producta (2n=32) both have extravaginal branching units and are likely sister taxa based on morphology. On the basis of the molecular phylogeny, more sampling is required for these two taxa. The study indicates that both taxa should be raised to specific rank but within each taxon, there is morphological variation. Dianella assera should be recognised as having three subspecies; subsp. assera Bulburin NP ‘narrow leaf’, subsp. assera Yarriabini NP ‘broad leaf’, and subsp. assera Springbrook NP ‘very narrow leaf’. The groups identified in D. producta (Table 7.5) require more assessment using molecular analyses and chromosome counts.

Although overlapping in the morphological phenetic analyses, var. petasmatodes and var. protensa should be retained as varieties of D. caerulea. The phenetic analysis did not include scoring of inflorescence characters but they do differ from one another in pedicel and raceme morphology. Neither taxon was well represented in the molecular phylogenetic tree and require further genetic study. Only one sample of D. caerulea var. protensa Moreton Island was included in the molecular analysis and had a long branch length, indicating genetic distinctiveness. The molecular analysis included only one sample of var. petasmatodes from Bulburin (from type locality), and it also had a relatively long branch length.

212

List of References

Abbott IA (1992) La’au Hawaii: Traditional Hawaiian uses of plants. Pg. 63 (Bishop Museum Press: Hawaii)

Angiosperm Phylogeny Group (1998) An ordinal classification for the families of flowering plants. Annals of the Missouri Botanical Garden 85, 531–553.

Angiosperm Phylogeny Group (2003) An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG II. Botanical Journal of the Linnean Society 141, 399–436.

Anigosperm Phylogeny Group (2009) An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG III. Botanical Journal of the Linnean Society 161, 105–121.

Anigosperm Phylogeny Group (2016) An update of the Anigosperm Phylogeny Group classification for the orders and families of flowering plants: APG IV. Botanical Journal of the Linnean Society 181, 1–20.

Appels R, Honeycutt RL (1986) rDNA: evolution over a billion years. In ‘DNA systematics, Vol. II, plants.' (Ed SK Dutta) pp. 81–35. (CRC Press: Boca Raton FL)

Arnold ML (1992) Natural hybridisation as an evolutionary process. Annual Review of Ecology and Systematics 23, 237–261.

Asker SE, Jerling L (1992) Apomixis in plants. (CRC Press: United States of America)

Bailey FM (1891) Contributions to the Queensland flora. Bulletin no. 9, pg. 19. Department of Agriculture, Brisbane, Queensland.

Bailey FM (1902) Liliaceae In ‘Queensland Flora.’ 5, pp. 1633–1635 (Government Printer: Brisbane)

213

Baker JG (1875) Revision of the genera and species of Asparagaceae. Linn. Soc. Journ. Bot. 14.

Baldwin BG, Markos S (1998) Phylogenetic utility of the external transcribed spacer (ETS) of 18S–26S rDNA: congruence of ETS and ITS trees of Calycadenia (Compositae). Molecular Phylogenetics and Evolution 10, 3 449–463.

Barker WR, Barker RM, Jessop JP, Vonow HP (Eds.) (2005). Census of South Australian Vascular Plants. Journal of Adelaide Botanic Garden, (Botanic Gardens of Adelaide & State Herbarium: Adelaide)

Barlow BA (1981) The Australian flora: its origin and evolution. In ‘Flora of Australia, Introduction.’ (Ed AS George). vol. 1. pp. 25–75. (Australian Government Publishing Service: Canberra)

Bayly MJ, Holmes GD, Forster PI, Cantrill DJ, Ladiges PY (2013) Major clades of Australasian Rutoideae (Rutaceae) based on rbcL and atpB sequences. PLoS ONE 8, e72493.

Bayly MJ, Udovicic F, Gibbs AK, Parra-O C, Ladiges PY (2008) Ribosomal DNA pseudogenes are widespread in the eucalypt group (Myrtaceae): implications for phylogenetic analysis. Cladistics 24, 131–146.

Beentje H (2016) The Kew plant glossary. 2nd Edition (Kew Publishing; Royal Botanic Gardens Kew)

Belbin L (1987) ‘PATN Pattern Analysis Package. Reference manual and users guide.’ (Division of Wildlife and Rangelands Research, CSIRO: Canberra)

Bentham G (1878) Liliaceae. In ‘Flora Australiensis.’ 7, pp. 3–16. (Reeve & Co: London)

Bernhardt P (1995) The floral ecology of Dianella caerulea var. assera (Phormiaceae). Cunninghamia 4, 9–20.

214

Bicknell RA, Koltunow AM (2004) Understanding apomixis: recent advances and remaining conundrums. The Plant Cell 16, S228–S245.

Birch JL, Keeley SC (2013) Dispersal pathways across the Pacific: the historical biogeography of Astelia s.l. (Asteliaceae, Asparagales). Journal of Biogeography 40, 1914–1927.

Blume CL (1827) Enumeratio Plantarum Javae. 1, 13.

Bremer K, Janssen T (2006) Gondwanan origin of major monocot groups inferred from dispersal-vicariance analysis. Aliso 22, 22–27.

Brown FBH (1930) New Polynesian Plants. Bernice P Bishop Museum Occasional Papers 9, 4 1–22.

Brown R (1810) Prodromus Florae Novae Hollandiae et Insulae Van Diemen.

Buckley TR, Attanayake D, Bradler S (2009) Extreme convergence in stick insect evolution: phylogenetic placement of the Lord Howe Island tree lobster. Proc. R. Soc. Bot. 276, 1055–1062.

Burbidge N (1960) The phytogeography of the Australian Region. The Australian Journal of Botany 8, 75–211.

Campbell DH (1928) The Australasian element in the Hawaiian flora. American Journal of Botany 15, 215–221.

Cañellas-Boltà N, Rull V, Sáez A, Prebble M, Margalef O (2014) First records and potential paleoecological significance of Dianella (Xanthorrhoeaceae), an extinct representative of the native flora of Rapa Nui (Easter Island). Vegetation History and Archaeobotany 23, 331–338.

Carlquist S (1967) The biota of long-distance dispersal versus plant dispersal to Pacific Islands. Bulletin of the Torrey Botanical Club. 94, 3 129–162.

215

Carpenter RJ, Macphail MK, Jordan GJ, Hill RS (2015) Fossil evidence for open, Proteaceae-dominated heathlands and fire in the late cretaceous of Australia. American Journal of Botany. 102, 12 2092–2107.

Carr GD (1978) Chromosome numbers of Hawaiian flowering plants and the significance of cytology in selected taxa. American Journal of Botany 65, 236–242.

Carr GW (2006) Dianella tenuissima (Hemerocallidaceae), a remarkable new species from the Blue Mountains, New South Wales, Australia. Telopea 11, 300–306.

Carr GW (June-Aug 2007a) Taxonomy of Dianella and implications for conservation. Australasian Plant Conservation: Journal of the Australian Network for Plant Conservation. 16, 1 11–13.

Carr GW (2007b) Collection and curation of material of Dianella Lam. ex Juss. and Rhuacophila Blume (Hemerocallidaceae) for herbarium and living collections. Australian Systematic Botany Society Newsletter 133

Carr GW, Horsfall PF (1995) Studies in Phormiaceae (Liliaceae) 1: new species and combintations in Dianella Lam. ex Juss. Muelleria 8, 365–378.

Chase MW, Rudall PJ, Conran JG (1996) New circumscriptions and a new family of asparagoid lilies: genera formerly included in Anthericaceae. Kew Bulletin 51, 667– 680.

Chase MW, Stevenson DW, Wilkin P, Rudall PJ (1995a) Monocot systematics: a combined analysis. In ‘Monocotyledons: systematics and evolution.’ (Eds PJ Rudall, PJ Cribb, DF Cutler, CJ Humphries). vol. 2 pp. 685–730. (Royal Botanical Gardens; Kew)

Chase MW, Duvall MR, Hills HG, Conran JG, Cox AV, Eguiarte LE, Hartwell J, Fay MF, Caddick LR, Cameron KM, Hoot S (1995b) Molecular phylogenetics of Lilianae. In ‘Monocotyledons: systematics and evolution.’ (Eds PJ Rudall, PJ Cribb, DF Cutler, CJ Humphries. vol. 1 pp. 109–138 (Royal Botanic Gardens: Kew)

216

Chase MW, Soltis DE, Soltis PS, Rudall, PJ, Fay MF, Hahn WH, Sullivan S, Joseph J, Moluray M, Kores PJ, Givnish TJ, Sytsma KJ, Pires JC (2000) Higher-level systematics of the monocotyledons: an assessment of current knowledge and new classification. In ‘Monocots: systematics and evolution.’ (Eds Wilson KL, Morrison DA) pp. 3–16. (CSIRO: Melbourne)

Chase MW, Fay FF, Devey DS, Maurin O, Ronsted N, Davies TJ, Pillon Y, Petersen G, Seberg, O, Tamura MN, Asmussen CB, Hilu K, Borsch T, Davis JI, Stevenson DW, Pires JC, Givnish TJ, Sytsma KJ, Mc Pherson MA, Graham SW, Rai HS (2006) Mulitgene analyses of monocot relationships: A summary. Aliso 22, 63–75.

Chase MW, Reveal JL, Fay MF (2009) A subfamilial classification for the expanded asparagalean families Amaryllidaceae, Asparagaceae and Xanthorrhoeaceae. Botanical Journal of the Linnean Society 161, 132–136.

Chen S, Kim D-K, Chase MW, Kim J-H (2013) Networks in large-scale phylogenetic analysis: reconstructing evolutionary history of Asparagales (Lilianae) based on four plastid genes. PloS One, 8 3, e59472.

Chiang T, Schaal BA (2006) Phylogeography of plants in Taiwan and Ryukyu Archipelago. Taxon 55, 1 31–41.

Clegg MT, Zurawski G (1992) Chloroplast DNA and the study of plant phylogeny: present status and future prospects. In ‘Molecular systematics of plants.’ (Eds PS Soltis, DE Soltis, JJ Doyle) pp. 1–13 (Springer-Science + Business Media: New York)

Clifford HT, Henderson RJF, Conran JG (1998) The families and genera of vascular plants III. Flowering Plants: Monocotyledons Lilianae (except Orchidaceae). (Eds. K Kubitzki, H Huber, PJ Rudall, PS Stevens, T Stutzel). (Springer-Verlag Berlin) Conran JG, Christophel DC, Cunningham L (2008) An Eocene monocotyledon from Nelly Creek, Central Australia, with affinities to Hemerocallidaceae (Lilianae: Asparagales). Alcheringa 27, 107–115.

Crane PR, Herendeen P, Friis EM (2004) Fossils and plant phylogeny American Journal of Botany 91, 1683–1699.

217

Crisp MD, West JG, Linder HP (1999) Biogeography of the terrestrial flora. In ‘Flora of Australia.’ vol. 1, 2nd edn. pp. 321–67. (Aust. Biol. Res. Study: Canberra).

Cronquist A (1981) An Integrated System of Classification of Flowering Plants. (Columbia University Press: New York).

Curtis WM (1952) Variation in certain Tasmanian plants. New Phytologist 51, 3 398– 414.

Curtis W (1801) Dianella caerulea, Blue Dianella. Sims Bot. Mag. 14: t. 505. (London)

Dahlberg A (1989) The functional role of ribosomal RNA in protein synthesis. Cell 57, 525–529.

Dahlgren RMT, Clifford HT, Yeo PF (1985) The families of the monocotyledons: structure, evolution, and taxonomy.’ (Springer-Verlag: Berlin) de Lange PJ, Gardner RO, Sykes WR, Crowcroft GM, Cameron EK, Stalker F, Christian ML, Braggins JE (2005) Vascular flora of Norfolk Island: some additions and taxonomic notes. New Zealand Journal of Botany 43, 563–596. de Lange PJ, Murray BG (2002) Contributions to a chromosome atlas of the New Zealand flora – 37. Miscellaneous families. New Zealand Journal of Botany 40, 1– 23. de Lange PJ, Murray BG (2003) Chromosome numbers of Norfolk Island endemic plants. Australian Journal of Botany 51, 211–215.

Debjatyoti P, White WM, Blichert-Toft J (2005) Geochemistry of Mauritius and the origin of rejuvenescent volcanism on oceanic island volcanoes. Geochemistry Geophysics Geosystems 6, 6 1525–2027.

Degener O (1930) Plants of Hawaii National Park Illustrated. pp. 93–95. (Honolulu StarBulletin Ltd.: Honolulu, Hawaii)

218

Degener O (1932) Dianella sandwicensis, Dianella lavarum, Dianella multipedicellata. In ‘Flora Hawaiiensis.’ Hawaii

Devey D, Leitch I, Rudall PJ, Pires C, Pillon Y, Chase M (2006) Systematics of Xanthorrhoeaceae sensu lato, with an emphasis on Bulbine. Aliso 22, 345–351.

Diels L (1930) Iridaceae. In ‘Die natürlichen Pflanzenfamilien’ (Eds A Engler, K Prantl) edn 2, 15a 463–505 (Leipzig)

Domin K (1915) Beitrage zur Flora und Pflanzengeographie Australiens. Bibliotheca Botanica 20, 85 520.

Donnon MJ (2009) Molecular systematics of the Lomandra Labill. complex (Asparagales: Laxmanniaceae). Unpublished PhD thesis. The University of Adelaide, Australia

Downie S, Palmer J (1992) Use of chloroplast DNA rearrangements in reconstructing plant phylogeny. In ‘Molecular Systematics of Plants.’ (Eds PS Soltis, DE Soltis, JJ Doyle) pp. 14–35 (Springer-Science + Business Media)

Doyle JJ (1992) Gene trees and species trees: molecular systematics as one-character Taxonomy. Systematic Botany 17, 144–163.

Duncan H, Nicotra AB, Cunningham SA (2004) High self-pollen transfer and low fruit set in buzz-pollinated Dianella revoluta (Phormiaceae). Australian Journal of Botany 52, 185–193.

Faegri K (1986) The solanoid flower. Botanical society of Edinburgh Transactions 150th Anniversary Supplement 51–59.

Fay MF, Rudall PJ, Sullivan S, Stobart KL, de Bruijn AY, Reeves G, QamaruzZaman F, Hong W-P, Joseph J, Hahn WH, Conran JG, Chase MW (2000) Phylogenetic studies on Asparagales based on four plastid DNA regions. In ‘Monocots systematics and evolution.’ (Eds KL Wilson, DA Morrison) pp. 360– 371. (CSIRO Publishing: Australia)

219

Fosberg FR (1969) Miscellaneous notes on Hawaiian plants. Bernice P Bishop Museum Occasional Papers 24, 2 9–24.

Fosberg FR, Corwin G (1958) A fossil flora from Pagan, Mariana Islands. Pacific Science 12, 3–16.

Fosberg FR, Sachet MH (1987) Noteworthy Micronesian Plants. Micronesica. Journal of the University of Guam 20, 131–133.

Fox MD (1999) Present environmental influences on the Australian flora. In 'Flora of Australia, vol. 1, 2nd edn. pp. 205–241. (CSIRO: Canberra)

Frakes LA (1999) Evolution of Australian environments. In ‘Flora of Australia.’ edition 2, vol.1 pp. 163–203. (Australian Government Publishing Service: Canberra)

Furness CA, Conran JG, Gregory T, Rudall PJ (2013) The trichotomosulcate asparagoids: pollen morphology of Hemerocallidaceae in relation to systematics and pollination biology. Australian Systematic Botany 26, 393–407.

Gibbs AK, Udovicic FB, Drinnan AN, Ladiges P (2009) Phylogeny and classification of Eucalyptus subgenus Eudesmia (Myrtaceae) based on nuclear ribosomal DNA, chloroplast DNA and morphology. Australian Systematic Botany 22, 158–179.

Givnish TJ, Pires CJ, Graham SW, Mc Pherson MA, Prince LM, Patterson TB, Rai SH, Roalson EH, Evans TM, Hahn WJ, Millam KC, Meerow AW, Molvray M, Kores PJ, O'Brien HE, Hall JC, Kress JW, Sytsma KJ (2006) Phylogenetic relationships of Monocot based on the highly informative plastid gene region ndhF: evidence widespread concerted convergence. Aliso 22, 28–51.

Gower JC (1971) A general coefficient of similarity and some of its properties. Biometrics 27, 857–874.

Graham SW, Zgurski JM, Mc Pherson MA, Cherniawsky DM, Saarela JM, Horne EFC, Smith SY, Wong WA, O'Brien HE, Biron VL, Pires JC, Olmstead RG, Chase MW, Rai HS (2006) Robust inference of monocot deep phylogeny using an expanded

220

multigene plastid data set. In 'Monocots: comparative biology and evolution (excluding Poales).’ (Eds JT Columbus, EA Friar, JM Porter, LM Prince, MG Simpson) pp. 3–21. (Santa Ana Botanic Garden: California, USA)

Green PS (1994) Liliaceae. In ‘Flora of Australia.’ Oceanic Islands. Vol. 49. pp. 505–

506 (Australian Government Publishing: Canberra)

Grigg R (2012) In the beginning: Archipelago, The origin and discovery of the Hawaiian Islands. (Island Heritage Publishing: Hawaii).

Groves RH (1999) Present Vegetation Types. In ‘Flora of Australia.’ Vol. 1, 2nd edn (ed. A.E. Orchard), pp. 369–401, (CSIRO Publishing: Melbourne, Australia)

Gurushidze M, Fritsch Reinhard M, Blattner Frank R (2010) Species-level phylogeny of Allium subgenus Melanocrommyum: Incomplete lineage sorting, hybridization and trnF gene duplication. Taxon. 59 3 pp. 829–840.

Hair JB (1942) The chromosome complements of some New Zealand plants –1. Transcations and Proceedings of the Royal Society of New Zealand 71, 271–276.

Hallier H (Ed Brill EJ) (1914) Liliaceae, Dianella in Nova Guinea: Resultats De L'expedition Scientifique Neerlandaise A La Nouvelle-Guinee En 1907–1909. (Boekhandel En Drukkeri: Leiden)

Hamby KR, Zimmer EA (1992) Ribosomal RNA as a phylogenetic tool in plant systematics. In ‘Molecular systematics of plants.’ (Eds PS Soltis, DE Soltis, JJ Doyle) pp. 49–91. (Springer- Science + Business Media)

Heads M (2011) Old taxa on young islands: A critique of the use of island age to date island-endemic clades and calibrate phylogenies. Systematic Biology. 60, 2 pp. 204– 218.

Heenan PB, de Lange PJ (2007) Two new species of Dianella (Hemerocallidaceae) from New Zealand. New Zealand Journal of Botany 45, 269–285.

221

Henderson RJF (1977a) Typification of Dianella-lam-ex-Juss (Lillaceae). Taxon 26, 131–137.

Henderson RJF (1977b) Cyto-taxonomic studies in Dianella Lam. ex Juss. (Liliaceae) in North-Eastern Australia. Masters of Science Thesis. The University of Queensland.

Henderson RJF (1985) Thelionema, a new genus of the Phormiaceae from Australia. Austrobaileya 2, 109–111.

Henderson RJF (1987a) Dianella. In ‘Flora of Australia.’ Vol. 45. (Australian Government Publishing Service: Canberra)

Henderson RJF (1987b) Stypandra. In ‘Flora of Australia.’ Vol. 45. (Australian Government Publishing Service: Canberra)

Henderson RJF (1987c) Thelionema. In ‘Flora of Australia.’ Vol. 45. (Australian Government Publishing Service: Canberra)

Henderson RJF (1988) Nomenclatural studies in Dianella Lam. ex Juss. (Phormiaceae) 1. Austrobaileya 2, 5 419–426.

Henderson RJF, Clifford HT (1984) A recircumscription of the Phormiaceae Agardh. Taxon 33, 423–427.

Henderson RJF (1991) Studies in Dianella Lam. Ex Juss. (Phormiaceae) 2. Austrobaileya 3, 473–480.

Herendeen PS, Crane PR (1995) The fossil history of the monocotyledons. In ‘Monocotyledons: systematics and evolution.’ (Eds PJ Rudall, PJ Cribb, DF Cutler, CJ Humphries) pp. 1–21. (Royal Botanic Gardens: Kew)

Hershkovitz MA, Zimmer EA, Hahn WJ (1999) Ribosomal DNA sequences and angiosperm systematics. In ‘Molecular Systematics and Plant Evolution.’ (Eds PM Hollingsworth, RM Bateman, RJ Gornall) pp. 268–326 (Taylor and Francis: USA)

222

Hewson HJ (1987) Herpolirion. In ‘Flora of Australia' vol. 45. (Australian Government Publishing Service Canberra)

Hill RS (1998) Fossil evidence for the onset of xeromorphy and scleromorphy in Australian Proteaceae. Australian Systematic Botany 11, 391–400.

Hill RS (2004) ‘Origins of the south-eastern Australian Vegetation’. Philosophical Transactions. Biological Sciences of the Royal Society of London 359, 1537–1549.

Hill RS, Brodribb TJ (1999) Southern Conifers in time and space. Australian Journal of Botany 47, 639–696.

Hillebrand WF (1888) Flora of the Hawaiian Islands. A description of their phanerograms and vascular cryptogams. pp. 445–445. (Westermann & Co.; New York)

Hooker JD (1860) Botany of The Antarctic Voyage of H.M Discovery ships Erebus and Terror in the years. 1839–1843. Monocotyledons and Acotyledons. (Lovell Reeve: London)

Hooker WJ, Arnott GAW (Ed. Bohn HG) (1832) The botany of Captain Beechey's Voyage; comprising an account of plants collected by Messrs. Lay and Collie, and other officers of the expedition, during the voyage to the Pacific and Bering's Strait, performed in His Majesty's Ship Blossom, under command of Captain F. W.

Beechey, R.N., F.R.S. & A.S., in the years 1825, 26, 27 and 28. Parts 2–3. (London) Hopper SD (1999) A new species WA species endemic to granite Nutysia 13, 247– 249.

Hopper SD, Gioia P (2004) The southwest Australian floristic region: Evolution and conservation of a global hot spot of biodiversity. Annu. Rev. Ecol. Syst. 35, 623– 650.

Hsieh C (2002) Composition, endemism and phytogeographical affinities of the Taiwan flora. Taiwania 47, 4 298–310.

223

Huber H (1969) Die Sammenmerkmale und Verwandtschaftsverhältnisse der

Liliiflorae. Mitt. Bot. Staat. München 8, 219–538.

Hutchinson J (1934) The families of flowering plants. (Macmillan: London)

Hutchinson J (1959) The families of flowering plants. Vol. 2. Monocotyledons, 2nd Edn. (Oxford: Clarendon)

Hutchinson J (1973) The families of flowering plants. 3rd Edn, (Oxford University Press: London)

Jessop JP (1979) Dianella. In ‘Flora Malesiana.' (General editor CGGJ Van Steenis) ser. 1, 9 pp. 206–209. (The Hague; Boston, London)

Johnson LA, Soltis DE (1998) Assessing congruence: empirical examples from molecular Data. In ‘Molecular systematics of plants II DNA sequencing.’ (Eds. DE Soltis, PS Soltis, JJ Doyle) pp. 297– 348 (Springer Science: New York)

Jorgensen R, Cluster P (1988) Modes and tempos in the evolution of nuclear ribosomal DNA: new characters for evolutionary studies and new markers for genetic and population studies. Ann. Missouri Bot. Gard. 75, 1238–1247.

Judd WS, Campbell SC, Kellogg EA, Stevens PF, Donoghue MJ (2002) Plant Systematics A phylogenetic approach. (Sanauer Associates; USA)

Kaneko K (1985) Karyomorphological studies of Hawaiian Dracaena and Dianella. Kromosomo 37, 1135–1139.

Kauff F, Rudall PJ, Conran JG (2000) Systematic root anatomy of Asparagales and other monocotyledons. Plant Systematics and Evolution 223, 139–154.

Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Mentjies P, Drummond A (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28, 1647–1649. 224

Kokubugata G, Nakamura K, Forster PI, Hirayama Y, Yokota M (2012) Antitropical distribution of Lobelia species (Campanulaceae) between Ryukyu Archipelago of Japan and Oceania as indicated by molecular data. Australian Journal of Botany 60, 417–428

Krause K (1930) Liliaceae. In ‘Die naturlichen Pflanzenfamilien.’ (Eds A Engler, K Prantl) pp. 227–386. 2nd edn. Vol. 15a. (Leipzig: W Engelmann)

Krauss BH (1993) Plants in Hawaiian culture. Pg. 67. (University of Hawaii Press: Honolulu)

Lee DE, Conran JG, Lindqvist JK, Bannister JM, Mildenhall DC (2012) New Zealand Eocene, Oligocene and Miocene macrofossil and pollen records and modern plant distributions in southern hemisphere. Bot. Rev. 78 235–260.

Ladiges PY and Cantrill D (2007) New Caledonia-Australian connections: biogeographic patterns and geology. Australian Systematic Botany 20, 383–389.

Ladiges PY, Udovicic F, Nelson G (2003) Australian biogeographical connections and the phylogeny of large genera in the plant family Myrtaceae. Journal of Biogeography 30, 989–998.

Ladiges PY, Bayly MJ, Nelson G (2012) Searching for ancestral areas and artifactual centres of origin in biogeography: with comment on east-west patterns across southern Australia. Systematic Biology 61, 703–708.

Lee DE, Lee WG, Mortimer N (2001) Where and why have all the flowers gone? Depletion and turnover in the New Zealand Cenozoic angiosperm flora in relation to palaeogeography and climate. Australian Journal of Botany 49, 341–56.

Lee DE, Conran JG, Lindqvist JK, Bannister JM, Mildenhall DC (2012) New Zealand Eocene and Miocene macrofossil and pollen records and modern plant distributions in southern hemisphere. Bot. Rev. 78, 235–260.

225

Maciunas E, Conran JG, Paull R, Lee DE, Bannister JM (2009) Phormium and Asteliaceae macrofossils from New Zealand: using leaf cuticular details to determine phylogenetic affinities. P. 129. In: D. Barrell & A. Tulloch (eds). Joint Geological and Geophysical Societies Conference, Oamaru, 2009: programme and abstracts. Geological Society of New Zealand Miscellaneous Publication 128A.

Mast AR, Givinish TJ (2002) Historical biogeography and the origin of stomatal distributions in Banksia and Dryandra (Proteaceae) based on their cpDNA phylogeny. American Journal of Botany 89, 1311–1323.

McDougall I, Chamalaun FH (1969), Isotopic dating and geomagnetic polarity studies on volcanic rocks from Mauritius, Indian Ocean. Geol. Soc. Am. Bull. 80, 1419–1442.

McDougall I, Embleton BJJ, Stone DB (1981) Origin and evolution of Lord Howe Island, Southwest Pacific Ocean. Journal of the Geological Society of Australia 28, 1–2, 155–176.

McFadden GI, van Doreen GG (2004) Evolution: red algal genome affirms a common origin of all plastids. Current Biology 14, R514–R516.

McLay TGB, Bayly MJ (2016) A new family placement for Australian blue squill, Chamaescilla: Xanthorrhoeaceae (Hemerocallidoideae), not Asparagaceae. Phytotaxa 275, 2097–111.

McLoughlin S (2001) The breakup history of Gondwana and its impact on preCenozoic floristic provincialism. Australian Journal of Botany 49, 271–300.

Moore LB, Edgar E (1970) Herpolirion. In 'Flora of New Zealand Vol. II.’(Government Printer: Wellington New Zealand)

Mort ME, Archibald JK, Randle CP, Levsen ND, O’Leary TR, Topalov K, Wiegand CM, Crawford DJ (2007) Inferring phylogeny at low taxonomic levels: utility of rapidly evolving cpDNA and nuclear its loci. American Journal of Botany 94, 173– 183.

226

Mueller F von (1868) Fragmenta phytographiae Australiae 6: 121–123. (Government Printer: Melbourne)

Müller K (2005) SeqState – primer design and sequence statistics for phylogenetic DNA data sets. Applied Bioinformatics 4, 65–69.

Muscat KMM (2009) A morphometric study of Dianella tasmanica Hook.f. Honours thesis. La Trobe University, Australia.

Musters W, Boon K, van der Sande C, van Heerikhuizen H, Planta RJ (1990) Functional analysis of transcribed spacers of yeast ribosomal. DNA. EMBOJ. 9, 3989– 3996.

Nakamura K, Denda T, Kokubugata G, Forster PI, Wilson G, Peng C (2012) Molecular phylogeography reveals an antitropical distribution and local diversification of Solenogyne (Asteraceae) in the Ryukyu Archipelago of Japan and Australia. Biological Journal of the Linnean Society. Linnean Society of London 105, 197–217. doi:10.1111/j.1095–8312.2011.01769.x

Nandi S (1974) Chromosome characteristics and their correlation with phenotypic and ecological variants in Chlorophytum, Ophiopogon and Dianella. Bull. Bot. Soc. Beng. 28, 117–122.

Noguchi J, De-yuan H (2004) Multiple origins of the Japanese nocturnal Hemerocallis citrina var. vespertina (Asparagales: Hemerocallidaceae): evidence from noncoding chloroplast DNA sequences and morphology. International Journal of Plant Science 165, 219–230.

Noguchi J, Hong DY, Grant WF (2004) The historical evolutionary development of Hemerocallis middendorfii (Hemerocallidaceae) revealed by non-coding regions in chloroplast DNA. Plant Systematics Evolution 247, 1–22.

Oh S, Potter D (2005) Molecular phylogenetic systematics and biogeography of tribe Neillieae (Rosaceae) using DNA sequences of CPDNA, RDNA, and LEAFY. American Journal of Botany 92, 179–192.

227

Otto SP, Whitton P (2000) Polyploid incidence and evolution. Annual Review of Genetics 34, 401–437.

Ostenf (1921) Biol. Meddel. Kongel. Danske Vidensk. Selsk. 3(2): 24.

Palmer J (1985) Comparative organization of chloroplast genomes. Annual Review Genetics 19, 325–354.

Pamilo P, Nei M (1988) Relationships between gene trees and species trees. Molecular Biology and Evolution 5, 568–583.

Pluthero FG (1993) Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Research 21, 20, 4850–4851.

Pole M (1994) The New Zealand flora - entirely long-distance dispersal? Journal of Biogeography 21, 625–635.

Razafimandimbison SG, Kellogg EA, Bremer B (2004) Recent origin and phylogenetic utility of divergent ITS putative pseudogenes: A case study from Naucleeae (Rubiaceae) Syst. Biol. 53, 2 177–192.

Redouté PJ (1802) Les Liliacées. Paris: Volume 1, part 1.

Rieseberg LH, Soltis DE (1991) Phylogenetic consequences of cytoplasmic gene flow in plants. Evolutionary Trends in Plants 5, 65–84.

Robb L, Ladiges PY (1981) Morphological forms and polyploidy in Triglochin procera agg. in Victoria. Aust. J. Bot. 29, 639–51.

Ronquist F, Huelsenbeck JP (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574.

Rudall PJ, Cutler DF (1995) Asparagales: a reappraisal. In ‘Monocotyledons systematics and evolution. (Eds PJ Rudall, PJ Cribb, DF Cutler, CJ Humphries) pp. 157–168. (Whitstable Litho Printers: Great Britian)

228

Rudall PJ, Furness CA, Chase MW, Fay MF (1997) Microsporogenesis and pollen sulcus type in Asparagales (Lilianae). Canadian Journal of Botany 75, 408–430.

Russell J (1998) A biosystematics analysis of Stypandra glauca in Western Australia. B.SC. (Hons) thesis, The University of Western Australia.

Sanderson MJ, Doyle JJ (1992) Reconstruction of organismal and gene phylogenies from data on multigene families: concerted evolution, homoplasy, and confidence. Systematic Biology 41, 1 4–17.

Schaal BA, Learn Jr GH (1988) Ribosomal DNA variation within and among plant populations. Ann. Missouri Bot. Gard. 75, 1207–1216.

Schlittler J (1940) Monographie der Lilaceengattung Dianella Lam. Mitt. Bot. Mus. Univ. Zürich

Schlittler J (1948) Die Liliaceengattung Dianella in Malesia. Blumea 6, 200–228.

Schlittler J (1954) Die Liliaceengattung Dianella Lam. in Neukaledonien und auf den benachbarten Inseln. 185–198.

Schnarf K, Wunderlich R (1939) Zur vergleichenden Embryologiel der Liliaceae - Asphodeloideae. Flora Jena 133, 297–327.

Seberg O, Petersen G, Davis JI, Pires CJ, Stevenson DW, Chase MW, Fay MF, Devey DS, Jorgensen T, Sytsma KJ, Pillon Y (2012) Phylogeny of the Asparagales based on three plastid and two mitochondrial genes. American Journal of Botany 99, 875–889.

Seelanan T, Schnabel H, Wendel JF (1997) Congruence and consensus in the cotton tribe. Systematic Botany 22, 259–290.

Sharma AK, Chatterj AK (1958) Chromosome studies as a means of detecting the method of speciation in some members of Liliaceae. Genet. Iber. 3, 63–70.

Shaw J, Lickey EB, Beck JT, Farmer SB, Liu W, Miller J, Siripun KC, Winder CT, Schilling EE, Small (2005) The Tortoise and the Hare II: Relative utility of 21 229

noncoding chloroplast DNA sequences for phylogenetic analysis. American Journal of Botany 92, 142–166.

Shaw J, Lickey EB, Schilling EE, Small RL (2007) Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. American Journal of Botany, 94, 3 275– 288.

Shaw J, Shafer HL, Leonard OR, Kovach MJ, Schorr M, Morris AB (2014) Chloroplast DNA sequence utility for the lowest phylogenetic and phylogeographic inferences in angiosperms: The tortoise and the hare IV. American Journal of Botany 101 1987–2004.

Shepherd DL, McLay TGB (2011) Two micro-scale protocols for the isolation of DNA from polysaccharide-rich plant tissue. Journal of Plant Research 124, 311– 314.

Sibuet J, Hsu H (2004) How was Taiwan created? Technophysics. 379, 1–4 159–18.

Simmons MP, Ochoterena H (2000) Gaps as characters as sequenced-based phylogenetic analyses. Systematic Biology 49, 369–381.

Sirisena UM (2010) Systematic studies on Thysanothus R.Br (Asparagales:Laxmanniaceae). Ph.D. dissertation, Unpublished PhD thesis. The University of Adelaide, Australia.

Skottsberg C (1937). Liliaceae of south-eastern Polynesia. Occasional Papers Bernice P. Bishop Museum 13, 18 233–244.

Skottsberg C (1953) Chromosome numbers in Hawaiian flowering plants. Arkiv Bot. 3, 4 63–70.

Small R, Cronn R, Wendel J (2004) Use of nuclear genes for phylogeny reconstruction in plants. Australian Systematic Botany 17 145–170.

230

Steele PR, Hertweck KL, Mayfield D., McKain MR, Leebens-Mack J, Pires JC (2012) Quality and quantity of data recovered from massively parallel sequencing: Examples in Asparagales and Poaceae. American Journal of Botany. 99, 330–348.

Sugiura M (1992) The chloroplast genome. Plant Molecular Biology 19, 149–168.

Swofford D (2001) ‘PAUP*. Phylogenetic Analysis Using Parsimony, version 4.0b10’. (Illinois Natural History Survey, Smithsonian Institution: Champaign).

Taberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17, 1105– 1109.

Takhtajan A (1997) 'Diversity and classification of flowering plants'. (Columbia University Press, New York)

Tanaka NY (1981) Studies on chromosome arrangement in some higher plants 1. Interphase chromosomes in three liliaceous plants. Cytologia 46, 343–357.

Terachi T (1993) Structural alterations of chloroplast genome and their significance to the higher plant evolution. Bulletin-Institute for National Land 14, 138–148.

Thorne RF (1992) Classification and geography of the flowering plants. The Botanical Review 58, 225–348.

Truswell EM (1993) Vegetation changes in the Australian Tertiary in response to climatic and phytogeographic forcing factors. Australian Systematic Botany 6, 533– 557.

Turner H, Hovenkamp P, van Welzen PC (2001) Biogeography of south-east Asia and the west Pacific. Journal of Biogeography 28, 217–230.

Uddin SN, Hassan MA (2009) Dianella ensifolia (L.) DC. (Liliaceae) - a new angiospermic record for Bangladesh. Bangladesh Journal of Plant Taxonomy 16, 181– 184.

231

Vogel S (1978) Evolutionary shifts from reward to deception in pollen flowers. In ‘The pollination of flowers by insects.’ Linnean Society Symposium Series Number 6 (Ed. AJ Richards) pp. 89–96 (The Linnean Society of London, Academic Press: London)

Volkov R, Kostishin S, Ehrendorfer F, Schweizer D (1996) Molecular organization and evolution of the external transcribed rDNA spacer region in two diploid relatives of Nicotiana tabacum (Solanaceae). Plant Syst. Evol. 201, 117–129.

Wagner WL, Herbst DR, Sohmer SH (1990a) 'Manual of the Flowering Plants of Hawai'i.' Vol. 1. (University of Hawaii Press: Bishop Museum Press, United States)

Wagner WL, Herbst DR, Sohmer SH (1990b) Manual of the Flowering Plants of Hawai’i’. Vol. 2. (University of Hawaii Press: Bishop Museum Press, United States)

Weberling F (1989) Morphology of flowers and inflorescences. (Cambridge University Press: Great Britian)

Wendel JF, Doyle JJ (1998) Phylogenetic incongruence: window into genome history and molecular evolution. In ‘Molecular systematics of plants II: DNA sequencing. (Eds DE Soltis, PS Soltis, JJ Doyle) (Springer Science+Business Media: New York)

Weston PH, Perkins AJ, Indsto JO, Clements MA (2014) Phylogeny of Orchidaceae Tribe Diurideae and its implications for the evolution of pollinations systems. In ‘Darwin’s Orchids then and now.’ (Eds Edens-Meier R, Bernhardt P) pp. 91–154 (The University of Chicago Press: Chicago and London)

White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In ‘PCR protocols: a guide to methods and applications.’ (Eds. MA Innis, DH Gelfand, JJ Sninsky, TJ White) pp 315–322. (Academic Press: San Diego, California, USA)

Wild H (1953) Dianella ensifolia: A new generic record for continental Africa. Kew Bulletin 8, 251–252.

232

Willis JH (1962) A handbook to plants in Victoria. Ferns, conifers and monocotyledons. Vol. 1. (Parkville, Victoria: Melbourne University Press)

Willson MF, Whelan CJ (1990) The evolution of fruit colour in fleshy-fruited plants. The American Naturalist. 136, 6 790–809.

Wilson KL (1993) Phormiaceae. In ‘Flora of New South Wales.’ Vol. 4. (Ed GW Harden) (New South Wales University Press: Australia)

Wolfe KH, Li H, Sharp P (1987) Rates of nucleotide substitution vary greatly among plant mitochondrial, chloroplast and nuclear DNAs. Proceedings of the National Academy of Sciences 84, 9054–9058.

Wolfe KH, Sharp PM (1988) Identification of functional open reading frames in chloroplast genomes. Gene 66, 215–222.

Wurdack KJ, Dorr LJ (2009) The South American genera of Hemerocallidaceae (Eccremis and Pasithea): two introductions to the New World. Taxon 58, 1122– 1132.

Yatabe R (1803) New or little known plants of Japan. The Botanical Magazine 7, 435– 437.

Zomlefer WB (1999) Advances in angiosperm systematics: examples from the Liliales and Asparagales. Journal of the Torrey Botanical Society 126, 58–62.

Zurawski G, Clegg M (1987) Evolution of higher plant chloroplast DNA-encoded genes: implications for structure-function and phylogenetic studies. Annual Review of Plant Physiology 38, 391–418.

Online references Australian Plant Census (2016) Centre for Australian National Biodiversity Research. Council of Heads of Australasian Herbaria. http://www.chah.gov.au/apc/index.html [Accessed 15.12.16].

233

Australian Government Department of the Environment; Dianella amoena, Matted Flax Lily. http://www.environment.gov.au/cgibin/sprat/public/publicspecies.pl?taxon_id=648 86 [Accessed 03.04.16].

Department of Environment and Heritage Protection: Threatened Species, Queensland. https://www.ehp.qld.gov.au/wildlife/threatened-species [Accessed 20.08. 2016].

Australia’s Virtual Herbarium (2016), Council of Heads of Australasian Herbaria. http://avh.chah.org.au [Accessed 21.6.16].

de Salas MF, Baker ML (2015) A census of the vascular plants of Tasmania including Macquarie Island. http://www.tmag.tas.gov.au/collectionsand_research/tasmanian_herbarium/tasmania n_herbarium_publications [Accessed 8.10.16].

Govaerts R, Newton L (2016) World Checklist of Dianella. http://apps.kew.org/wcsp/. Facilitated by the Royal Botanic Gardens, Kew. [Accessed 15 10 2016].

Stevens PF (2012) Angiosperm Phylogeny Website. Version 12, July 2012 (and more or less continuously updated since). http://www.mobot.org/MOBOT/research/APweb/. [Accessed 15. 05. 2016]

234

Appendix A

Table 1. The collecting localities of specimens used in Chapters 2–5. Abbreviations are: NP, National Park; FR, Forest Reserve; SF, State Forest; SR, Scientific Reserve; SA, South Australia; Vic, Victoria; Tas, Tasmania; NT, Northern Territory; Qld, Queensland; WA, Western Australia; RBG, Royal Botanic Garden; and SCA State Conservation Area; KMM, Karen Mary Muscat; NT, Natalia Tangalin, PIF, Paul I Forster, GK, Goro Kokubugata; DGF, David Gregory Fell.

Taxon Collection ID Location Voucher

D. adenanthera Read J New Caledonia, Port (G.Forst.) MELU TH081A Bouquet Bay R.J.F.Hend. D. amoena Tasmania, Jordan G.W.Carr & Visoiu M 453 HO547092 River P.F.Horsfall D. amoena Carr G sn. Vic, Bundoora MELU

D. atraxis Qld, Bobbin Bobbin KMM485 MELU R.J.F.Hend. Falls, Bartle Frere Qld, Daintree Molyneux B National Park. Lower MELU D. atraxis MQ4 reaches of the Mossman River Qld, Daintree D. bambusifolia MELU KMM575 National Park, Noah Hallier f. Creek Bridge D. brevicaulis (Ostenf.) SA, Region 13, north Duval DJ 109 AD179356 G.W.Carr & of Kingston P.F.Horsfall D. brevicaulis KMM04 Vic, Sandringham MELU

Visoiu M, 119 D. brevicaulis Tas, Calverts Lagoon HO537949 Wood J

D. brevicaulis KMM1036 WA, Yallingup MELU D. Qld, Benarkin State brevipedunculata KMM46 MELU Forest R.J.F.Hend. D. sp. aff. WA, Stirling Ranges KMM1037 MELU brevicaulis NP 235

Taxon Collection ID Location Voucher

D. sp. aff. KMM1038 WA, Wave Rock MELU brevicaulis D. sp. aff. Qld, Lake McKenzie, caerulea Fraser KMM807 MELU Fraser Island Island D. caerulea var. Qld, Somerset, Cape aquilonia Gray B sn. MELU York R.J.F.Hend. D. caerulea var. Qld, Bunya assera KMM48 MELU Mountains NP R.J.F.Hend. D. caerulea var. KMM148 NSW, Byron Bay MELU assera D. caerulea var. KMM1039 NSW, Dorrigo NP MELU assera D. caerulea var. Vic, East Gippsland, KMM976 MELU assera Mallacoota D. caerulea var. KMM664 NSW, Illawarra NP MELU assera D. caerulea var. KMM665 NSW, Nortons Basin MELU assera Qld, Springbrook D. caerulea var. KMM1040 Plateau, Springbrook MELU assera NP D. caerulea var. KMM1041 NSW, Tenterfield MELU assera D. caerulea var. KMM163 NSW, Yarriabini NP MELU assera D. caerulea var. KMM191 Vic, Cann River MELU caerulea D. caerulea var. cinerascens KMM349 NSW, Kurri Kurri MELU R.J.F.Hend. D. caerulea var. NSW, Putty Rd, KMM339 MELU cinerascens Howes Valley D. caerulea var. petasmatodes KMM858 Qld, Bulburin NP MELU R.J.F.Hend. D. caerulea var. producta KMM1042 Qld, Springbrook NP MELU R.J.F.Hend. D. caerulea var. protensa KMM80 Qld, Moreton Island MELU R.J.F.Hend.

236

Taxon Collection ID Location Voucher

D. caerulea var. Qld, Ravensbourne vannata KMM767 MELU NP R.J.F.Hend. D. caerulea var. KMM787 Qld, Woocoo NP MELU vannata D. sp. aff. caerulea var. Theresa Creek Mt KMM545 Qld, Mt Lewis MELU Lewis (W.G. Trapnell 269) R.J.F.Hend. D. caerulea var. Theresa Creek Qld, Bobbin Bobbin KMM478 MELU (W.G. Falls, Bartle Frere Trapnell 269) D.callicarpa Vic, Maam Reserve, G.W.Carr & Carr sn. MELU Warnambool P.F.Horsfall Caroline Islands: D. carolinensis Perlman S Belau: Babeldaob PTBG054738 Lauterb. 20735 Island D. congesta R.Br. KMM141 NSW, Iluka NP MELU

D. congesta KMM45 Qld, Noosa NP MELU D. crinoides KMM75 Qld, Moreton Island MELU R.J.F.Hend.

D. ensifolia (L.) Lorence DH Mauritius, Le Petrin PTBG 910308 Redouté 6925 Nature Reserve Bangladesh, Sarder Nasir Lawachara National D. ensifolia Uddin N- DACB 36699 Park, Moulvibazar 4820 district Malaysia, Sabah. Cult. In RBG NSW from accession LCR D. ensifolia Wilson KL 960464: Wild NSW425409 collection from Gunung Rara Forest Reserve, Sabah Borneo, Malaysia. (Associated: NSW868045)

237

Taxon Collection ID Location Voucher

Lowry PP II et. Madagascar, D. ensifolia MO6185727 al 6706 Bemangidy Forest Taiwan, Nantou, Mt D. ensifolia GK8091 Baimaoshan, Hoping TNS 9543514 Hsiang, Taiwan Taiwan, Taitung, trail to from near Zhongai- D. ensifolia GK7968 chao Bridge to TNS 9529075 Tienchich Lake, Hsiang Taiwan, Nantou, D. ensifolia GK8028 Lushan, Chitou, Jenai TNS 9529244, Hsiang Japan, Ryukyus Okinawa Yaeyama Group, D. ensifolia GK14077 TNS01148192 Yonaguni Island. Yonaguni-cho Higawa Japan, Ryukyus Okinawa D. ensifolia GK14136 Yaeyama Group, TNS01148246 Yonaguni Island. Yonaguni-cho Kada Brunei, Road to Government fishery D. ensifolia Phoon SN 231 CNS138344.1 pond, Pasir Putih Bkt. Udal, Tutong. Qld, Leichardt District: D. fruticans Eddie C Carnarvon Station AQ611721 R.J.F.Hend. Reserve, NE Augathella Bostock PD 1398, Qld, Hazelwood D. fruticans AQ679815 Chinnock Gorge, Eungella RJ D. fruticans KMM1019 Qld, Table Mountain, MELU Kabra, Rockhampton

238

Taxon Collection ID Location Voucher

D. haematica de Lange PJ New Zealand, North Heenan & de 6573, Island, Moanatuatua SR AK293920 Lange Heenan PB D. incollata KMM588 Qld, Laura, Guguyalangi MELU R.J.F.Hend. Gallery CBG890342 D. intermedia Gilmour P Norfolk Island, south end Endl. 7039 of Anson Bay. 7 Lord Howe Island, Mt D. intermedia Cussen JM NSW519675 Eliza track D. caerulea Sims KMM666 NSW, Blue Mountains NP MELU var. caerulea D. caerulea var. KMM1046 Vic, Bunyip SF, Four MELU caerulea Brother Rocks D. latissima de Lange PJ, New Zealand, North Heenan & de 7023, Island, Auckland, AK300546 Lange Gardner RO Rangitoto Island D. sp. aff. NT3173 East Maui, Hoolawa Bay MELU lavarum D. sp. aff. NT3178 Oahu, Pupukea FR, Pupkea MELU lavarum trail Hawaii, Hawaii Volcanoes D. lavarum KMM1023 MELU NP, Kau desert Hawaii, Hawaii Volcanoes D. lavarum KMM1025 MELU NP, Hiliniapali Rd D. longifolia var. Murfet DE, grandis R.J.F. 4048, Taplin SA, Region 9; Murray AD126097 Hend. RL D. longifolia var. Qld, Mt Marlay Lookout, Ohlsen DJ sn. MELU grandis Stanthorpe D. longifolia R.Br. var. KMM1048 Vic, Pakenham MELU longifolia D. longifolia var. Bates, R SA, Region 9; Murray AD178455 longifolia 64519 Michell CR & D. longifolia var. Boyce S NT, Nit2000. Site 690 DO147042 longifolia 3398 Cowie ID D. longifolia var. 10397 & NT DO172382 longifolia Brennan KG

239

Taxon Collection ID Location Voucher Risler JA D. longifolia var. NT, biodiversity site & Cowie DO183425 longifolia GE119, Herb Plot 9319 ID 2823 Barrett RL D. longifolia var. & Barrett WA, Monophylla Flat NE DO194440 longifolia MD RLB of Mount Agnes 4054 D. longifolia var. Qld, Moreton District: stenophylla Mangan J AQ724202 Ambrose Tucker Park Domin D. longifolia var. Qld, Gowrie Creek, stupata PIF37880 Tilgonda, 14km ESE of BRI R.J.F.Hend Oakey D. longifolia var. surculosa KMM371 Qld, Bribie Island MELU R.J.F.Hend. D. Hawaii Volcanoes MELU KMM1026 multipedicellata National Park D. Oahu, Palikea Trail, Oahu, NT3186 MELU multipedicellata Mokuleia Forest Reserve D. sp. aff. nervosa KMM900 Qld, Blackdown Tableland MELU R.J.F.Hend. D. nervosa KMM472 Qld, Cairns, Davies Creek MELU R.J.F.Hend NP Baba Y 377, Qld, Cook District, Mt D. nervosa Kilgour CD Windsor National Park CNS133018 New Zealand, North Island, Western Volcanic Plateau de Lange PJ Ecological Region, D. nigra Colenso 6612, Hobbs AK295538 Tokoroa JFF Ecological District, Mamaku Plateau, Lake Rotohoka MELU D. odorata Blume KMM621 Qld, Archer Point MELU D. odorata KMM608 Qld, Mt Cook NP

NT, Territory Wildlife DO205742 D. odorata SH141 Park D. pavopennacea Qld, Cape York. c. 10 km var. Sankowsky, NW of the Lockhart MELU major G sn. Township R.J.F.Hend.

240

Taxon Collection ID Location Voucher

D. pavopennacea var. KMM614 Qld, Archer Point MELU pavopennacea R.J.F.Hend. D. pavopennacea Qld, Cape York, Claudie var. Sankowsky River camp site, Iron AQ764210 robusta GS2087 Range R.J.F.Hend. NP D. porracea (R.J.F. NSW, Roto, south of Hend.) G.W.Carr Jobson PC NSW484949 railway & P.F.Horsfall Johnstone R, NSW, corner of Cattai D. prunina 2241, Orme Road and Wheeny Creek NSW759138 R.J.F.Hend. AE & Seed Road, South Maroota. LU Qld, Glasshouse MELU D. rara R.Br. KMM19 Mountains, Mt Beerburrum

D. revoluta var. divaricata (R.Br.) KMM1049 Vic, St Arnaud Reserve MELU R.J.F.Hend. D. revoluta var. Badman FJ SA, Region 3 Nullarbor, divaricata 11580 Yellabinna Reserve AD192475 SA, Region 7. Eyre Peninsula, D. revoluta var. Thorpe MJ Eyre Peninsula Eyre AD213697 divaricata 146, TS Te Highway, 3 km W of Wudinna Silos. D. revoluta var. divaricata KMM1050 WA, Kokerbin Rock MELU D. revoluta var. minor PIF37874 Qld, Murgon MELU R.J.F.Hend. Lang PJ & D. revoluta R.Br. PD Canty SA, Region 7; Eyre var. AD167789 BS 128- Peninsula revoluta 1906 SA, Region 9: Murray. Ainsley PJ D. revoluta var. Brown's road, 2km NE of 110, Thorpe AD192620 revoluta intersection with Princes MJ Highway. E side of road.

241

Collection Taxon Location Voucher ID D. revoluta var. NSW, Gulge Lookout, KMM691 MELU revoluta Tallong. Barbers Creek D. revoluta var. KMM671 NSW, Royal NP MELU revoluta D. revoluta var. KMM187 Vic, Cape Conran NP MELU revoluta D. revoluta var. KMM1052 Vic, Grampians NP MELU revoluta NSW, Blue Mountains NP, D. sp. aff. Bells Line of Road, revoluta (Blue KMM667 MELU Kurrajong Mountains) Heights D. revoluta var. WA, Stirling Ranges KMM1051 MELU revoluta National Park D. revoluta var. Qld, Blackdown Tableland tenuis KMM899 MELU NP R.J.F.Hend. D. revoluta var. vinosa KMM1060 Qld, Stanthorpe MELU R.J.F.Hend. D. sandwicensis Kauai, Waimea Canyon NT3167 MELU Hook. & Arn. Rd D. sandwicensis NT3190 Oahu, Molukeia FR PTBG65429

D. serrulata DGF Papua New Guinea: MELU Hallier f. Y8/Y34 Madang Province Conn BJ 5512, New Guinea, Buwitdom, D. sp. aff. Fazang KM, W of Teptep of NSW841071 serrulata James SA & Buwitdomtrack to Madang Lovave M New Guinea, Baudu, c. Conn BJ 220 m 5610, D. serrulata W of Cliffside Research NSW870233 Damas KO Station Kamiali Wildlife & Sule BG Management Area SA, Region 13: south- Duval DJ, eastern. D. tarda 1033 & TS 300 m SW of highway G.W.Carr & AD214908 Te & PJ along Lockhart Road P.F.Horsfall Winter towards Dunalan Homestead. Carr, 1008- Vic, East of Bridgewater D. tarda MELU 250 on Loddon 242

Taxon Collection ID Location Voucher

D. tasmanica Vic, Mt Dandenong, One KMM1055 MELU Hook.f Tree Hill D. sp. aff. KMM1053 NSW, Deua NP MELU tasmanica D. sp. aff. KMM1054 Vic, Mt Buffalo NP MELU tasmanica D. tenuissima NSW, Wentworth Falls, KMM668 MELU G.W.Carr Blue Mountains NP Sth America, Venezuela, Eccremis Lagunazo camp site, coarcata (Ruiz & MYF28907 Guaraira Pav.) Baker Repano NP (Pop 1) Sth America, Venezuela, Eccremis Lagunazo camp site., MYF28907 coarcata Guaraira Repano NP (Pop 2) Herpolirion novae-zelandiae Bayly, MJ sn. Vic, Mt Baw Baw NP MELU Hook.f. Herpolirion Brown, G 302 Vic, Falls Creek MELU novae-zelandiae S. jamesii Hopper KMM1059 WA, Wave Rock MELU

S. glauca R.Br. KMMCol 204 NSW, Durran Durra MELU

S. glauca KMM1057 Vic, Grampians NP MELU T. caespitosum KMM189 Vic, Cape Conran NP. MELU R.J.F.Hend. T. grande KMM1085 Qld, Giraween NP MELU R.J.F.Hend. T. umbellatum NSW, Illawarra KMM669 MELU R.J.F.Hend. Escarpment SCA

243

Appendix B

Table 1. The collection ID, taxon name, location and voucher details of the specimens used in Chapter 6. Herbarium abbreviations are: NAR, Natural Area Reserve; FR, Forest Reserve; NP, National Park; Rd, road; KMM, Karen Mary Muscat; NT, Natalia Tangalin; MELU, The University of Melbourne Herbarium, PTBG, National Tropical Botanical Garden. Vouchers without an accession number are currently housed at PTBG and MELU

Collection ID Taxon Location Voucher NT3170 D. sp. aff. lavarum Kauai, along Napali PTBG65422 Coastal Trail, 10 ft up on steep slope above trail, before Hanakapiai beach Kauai, Napali Coast NT3172 D. sp. aff. lavarum trail, after PTBG65419 Hanakapiai beach, just before Space Rock.

Oahu, NT3181 D. sp. aff. lavarum PTBG65415 Hawaii Loa Ridge

Oahu, Hawaii Loa Ridge NT3180 D. sp. aff. lavarum Forest Reserve, PTBG65437 Hawaii Loa Ridge Trail

KMM1031 D. sp. aff. lavarum Hawaii, Manuka PTBG & NAR MELU

KMM1032 D. sp. aff. lavarum Hawaii, Manuka PTBG & NAR MELU

Oahu, NT3193 D. sp. aff. lavarum Waianae Mtns., PTBG65428 Mokuleia FR

244

Collection ID Taxon Location Voucher

KMM1034 D. sp. aff. lavarum Hawaii, Manuka PTBG & NAR MELU

Maui, NT3173 D. sp. aff. lavarum property of Forest PTBG65420 and Kim Starr, Makawao West Maui, Iao Valley, above Battle NT3176 D. sp. aff. lavarum of Kepaniwai PTBG65418 Historical marker, steep stream walls above Ae Stream. Oahu, Pupukea Forest NT3178 D. sp. aff. lavarum Reserve, Pupukea PTBG65412 Forest trail.

KMM1025 D. lavarum Hawaii, Hawaii PTBG & Volcanoes NP MELU

KMM1023 D. lavarum Hawaii, Hawaii PTBG & Volcanoes NP MELU

KMM1021 D. lavarum Hawaii, PTBG & Kipaphoehoe MELU NAR

KMM1024 D. lavarum Hawaii, Hawaii PTBG & Volcanoes NP MELU

KMM1022 D. lavarum Hawaii, PTBG & Kipaphoehoe NAR MELU

KMM1033 D. multipedicellata Hawaii, Manuka PTBG & NAR MELU

NT3183 D. multipedicellata Oahu, Hawaii Loa PTBG65438 Ridge Trail

NT3191 D. multipedicellata Oahu, Waianae PTBG65432 Mountains, Mokuleia, FR 245

Collection ID Taxon Location Voucher NT3192 D. multipedicellata Oahu, Waianane PTBG65436 Mountains, Mokuleia FR KMM1028 D. multipedicellata Hawaii, Manuka PTBG & NAR MELU

KMM1029 D. multipedicellata Hawaii, Manuka PTBG & NAR MELU

KMM1026 D. multipedicellata Hawaii, Hawaii PTBG & Volcanoes NP MELU

KMM1026b D. multipedicellata Hawaii, Hawaii PTBG & Volcanoes NP MELU

NT3174 D. multipedicellata Maui, Hoolawa PTBG65435 Farms, Haiku

NT3177 D. multipedicellata Oahu, Pupukea PTBG65413 Forest Reserve

NT3168 D. multipedicellata Kauai, Kokee, PTBG65423 Waimea Canyon Rd NT3169 D. multipedicellata Kauai, Waimea PTBG65421 Canyon Rd, Highway 550. NT3185 D. multipedicellata Oahu, Palikea PTBG65439 Trail, Waianae Mountains NT3186 D. multipedicellata Oahu, Palikea PTBG65440 Trail, Waianae Mountains NT3166 D. sp. aff. Kauai, Waimea PTBG65426 sandwicensis Canyon Drive Rd, Highway 550

NT3167 D. sp. aff. Kauai, Kokee, PTBG65424 sandwicensis Waimea Canyon Rd Kauia, NT3165 D. sp. aff. Waimea Canyon PTBG65425 sandwicensis Lookout, Puu Ka Pele, Waimea Canyon Rd

246

Collection ID Taxon Location Voucher Kauai, PTBG & KMM1035 D. sp. aff. sandwicensis Honoonapali MELU Natural Area Reserve Maui, Olinda Rare NT3175 D. sandwicensis Plant Facility, PTBG65417 Olinda Road, Makawao Oahu, Pupukea NT3179 D. sandwicensis Forest Reserve, PTBG65414 Pupukea Forest Trail Oahu, NT3182 D. sandwicensis Hawaii Loa Ridge PTBG65416 Trail, above Kuliouou-Kalaniiki

Oahu, Waianae Mountains, Palikea Trail, above Makakilo NT3187 D. sandwicensis City, through PTBG65433 locked gates and on the boarder of Nanakuli Forest Reserve.

NT3188 D. sandwicensis Oahu, Waianane PTBG65431 Mtns, Mokuleia FR NT3189 D. sandwicensis Oahu, Waianane PTBG65430 Mtns, Mokuleia FR

NT3190 D. sandwicensis Oahu, Waianane PTBG65429 Mtns, Mokuleia FR

247

Appendix C

Fig. 1. Kruskall-Wallis values and box plots of all characters analysed in Chapter 6.

248

Appendix D

Table 1. The taxon name, location and voucher details of the specimens used in Chapter 7. Herbarium abbreviations are: NP, National Park; FR, Forest Reserve; SF, State Forest; Vic, Victoria; Qld, Queensland; WA, Western Australia; NP, National Park; SCA, State Conservation Area; Mt, mountain; Rd, road; MELU The University of Melbourne Herbarium; KMM, Karen Mary Muscat.

Taxon Locality Collector Voucher D. caerulea var. producta s.s NSW, Burleigh Heads KMM87 MELU NP

D. caerulea var. producta s.s Qld, Mt Coonowrin, KMM752 MELU Glasshouse Mountains

D. caerulea var. producta s.s Qld, Springbrook NP KMM1042 MELU

D. caerulea var. producta s.s NSW, Mt Tamborine NP KMM640 MELU

D. caerulea var. producta s.s NSW, Gloucester KMM667 MELU

D. caerulea var. producta s.s NSW, Botany Bay NP KMM662 MELU

D. caerulea aff. var. NSW, Illawarra KMM664 MELU producta ‘Illawarra NSW’ Escarpment SCA

D. caerulea aff. var. NSW, Woodford KMM668 MELU producta ‘Illawarra NSW’

D. caerulea aff. var. producta ‘East Gippsland, Vic, Mitchell River NP KMM961 MELU Vic’

D. caerulea aff. var. Vic, Mallacoota KMM976 MELU producta ‘East Gippsland, Vic’

249

Taxon Locality Collector Voucher

D. caerulea aff. var. NSW, Sea Acres NP, KMM178 MELU producta ‘Putty Rd, NSW’ Port Macquarie

D. caerulea aff. var. producta NSW Miller, R MELU ‘Putty Rd, NSW’ s.n

D. caerulea aff. var. NSW, Old Pacific Hwy, Miller, R MELU producta ‘Putty Rd, NSW’ North of Jolls Bridge s.n

D. caerulea aff. var. Miller, R NSW, Colo Heights MELU producta ‘Putty Rd, NSW’ s.n

D. caerulea aff. var. assera NSW, Wentworth Falls, KMM302 MELU ‘Wentworth Falls, NSW’ Blue Mountains NP

D. caerulea aff. var. assera NSW, Nortons Basin KMM665 MELU ‘Nortons Basin, NSW’

D. caerulea aff. var. assera NSW, Silverdale KMM673 MELU ‘Nortons Basin, NSW’

D. caerulea aff. var. assera NSW, Yarriabini NP KMM163 MELU ‘broad leaf’

D. caerulea var. assera NSW, Myall Lakes NP KMM676 MELU ‘very narrow leaf’

D. caerulea var. assera NSW, Nightcap NP KMM119 MELU ‘very narrow leaf’

D. caerulea var. assera NSW, Tenterfield KMM1041 MELU ‘very narrow leaf’

D. caerulea var. assera NSW, Dorrigo NP KMM1039 MELU ‘very narrow leaf’

D. caerulea var. assera Qld, Woodenbong KMM62 MELU ‘very narrow leaf’

250

Taxon Locality Collector Voucher

D. caerulea var. assera NSW, Brunswick Heads KMM108 MELU ‘very narrow leaf’

D. caerulea var. assera NSW, Byron Bay KMM148 MELU ‘very narrow leaf’

D. caerulea var. assera s.s Qld, Bunya Mountains KMM48 MELU ‘narrow leaf’ NP

D. caerulea var. assera s.s Qld, Cunninghams Gap KMM641 MELU ‘narrow leaf’

D. caerulea var. assera s.s Qld, Mt Tamborine KMM1050 MELU ‘narrow leaf’

Qld, Springbrook D. caerulea var. assera s.s Plateau, Springbrook KMM1040 MELU ‘narrow leaf’ NP

D. caerulea var. assera s.s Qld, Mt Lewis KMM532 MELU ‘narrow leaf’

D. caerulea var. assera s.s Qld, Eungella NP KMM987 MELU ‘narrow leaf’

D. caerulea var. assera s.s Qld, Davies Creek NP KMM468 MELU ‘narrow leaf’

D. caerulea var. assera s.s Qld, Bulburin NP KMM845 MELU ‘narrow leaf’

D. caerulea var. assera Qld, Cania Gorge NP KMM822 MELU s.s‘narrow leaf’

D. caerulea var. assera s.s Qld, Ravensbourne NP KMM772 MELU ‘narrow leaf’

D. caerulea var. assera s.s Qld, Benarkin SF KMM756 MELU ‘narrow leaf’

251

Taxon Locality Collector Voucher

D. caerulea aff. var. assera NSW, Yarriabini NP KMM163 MELU Dorrigo

D. caerulea aff. var. assera NSW, Dorrigo NP KMM1059 MELU Dorrigo

D. caerulea Sims var. Vic, Buchan KMM956 MELU caerulea

D. caerulea var. caerulea NSW, Yurrammie SF KMM199 MELU

D. caerulea var. caerulea Vic, Mitchell River NP KMM941 MELU

D. caerulea var. caerulea Vic, Cann River KMM191 MELU

D. caerulea var. caerulea Vic, Murrungowar Picnic KMM180 MELU Ground

D. caerulea var. caerulea NSW, Nowra KMM225 MELU

D. caerulea var. caerulea NSW, Morton NP KMM230 MELU

D. caerulea var. caerulea NSW, Rockton KMM669 MELU

D. caerulea var. caerulea Qld, Karawartha Park KMM709 MELU

D. caerulea var. caerulea Qld, Lamington NP KMM1058 MELU

D. caerulea var. caerulea NSW, Nightcap NP KMM114 MELU

D. caerulea var. caerulea NSW, Lawson KMM674 MELU

252

Taxon Locality Collector Voucher

D. caerulea var. caerulea NSW, Kempsey KMM664 MELU

D. caerulea var. caerulea NSW, Hat Head CBG8504784

D. caerulea var. caerulea NSW, Swansea CBG8202102

D. caerulea var. caerulea NSW, Budlahdelah CBG048791

D. caerulea var. caerulea ACT, Clyde Mtn, CBG51030 Braidwood,

D. caerulea var. caerulea NSW, Batemans Bay CBG087477

D. caerulea var. caerulea Qld, Woodburn CBG0021091

D. caerulea var. caerulea NSW, Rockvale CBG331625

D. caerulea var. Qld, Mt Archer KMM863 MELU petasmatodes

D. caerulea var. Qld, Blackdown Tableland petasmatodes KMM888 MELU NP

D. caerulea var. Qld, Bunya Mountains NP KMM58 MELU petasmatodes

D. caerulea var. NSW, Lismore KMM126 MELU petasmatodes

D. caerulea var. NSW, Wollumbin-Mt KMM1055 MELU petasmatodes Warning NP

D. caerulea var. Qld, Kingsthorpe KMM840 MELU petasmatodes

253

Taxon Locality Collector Voucher

D. caerulea var. Qld, Woocoo NP KMM888 MELU petasmatodes

D. caerulea var. Qld, Cania Gorge NP KMM827 MELU petasmatodes

D. caerulea var. Qld, Pomona SF KMM776 MELU petasmatodes

D. caerulea var. Qld, Kurrimine Beach KMM440 MELU petasmatodes

D. caerulea var. Qld, Noosa NP KMM35 MELU petasmatodes

D. caerulea var. Qld, Eungella NP KMM985 MELU petasmatodes

D. caerulea var. Qld, Airlie Beach KMM980 MELU petasmatodes

D. caerulea var. Qld, Bulburin NP KMM858 MELU petasmatodes

D. caerulea var. Qld, Bulburin NP KMM853 MELU petasmatodes

D. caerulea var. Qld, D'Aguilar SF KMM727 MELU petasmatodes

D. caerulea var. Qld, Mt Lewis KMM517 MELU petasmatodes

D. caerulea var. Qld, Springbrook NP KMM1045 MELU petasmatodes

D. caerulea var. protensa Qld, Moreton Island, NP KMM80 MELU

D. caerulea var. protensa Qld, Moreton Island, NP KMM70 MELU

254

Taxon Locality Collector Voucher

D. congesta Qld, Fraser Island NP KMM796 MELU

D. congesta NSW, Iluka NP KMM141 MELU

D. congesta Qld, Noosa NP KMM45 MELU

D. caerulea var. NSW, Wollemi NP KMM317 MELU cinerascens

D. caerulea var. NSW, Cournell Mountain KMM327 MELU cinerascens

D. caerulea var. NSW, Muswellbrook KMM332 MELU cinerascens

D. caerulea var. NSW, Kurri Kurri KMM349 MELU cinerascens

D. caerulea var. NSW, Laguna KMM355 MELU cinerascens

D. caerulea var. NSW, Putty Rd, Howes KMM339 MELU cinerascens Valley

D. caerulea var. vannata Qld, Halloways Nature KMM628 MELU Walk, Cairns

D. caerulea var. vannata Qld, Blackdown KMM875 MELU Tableland NP

D. caerulea var. vannata Qld, Fraser Island, Central KMM812 MELU Station

Qld, Rainbow Mountain KMM870 MELU D. caerulea var. vannata NR

D. caerulea var. vannata Qld, Tully Falls KMM458 MELU

255

Taxon Locality Collector Voucher

Qld, Bowling Green Bay KMM401 MELU D. caerulea var. vannata NP

D. caerulea var. vannata Qld, Paluma NP KMM425 MELU

D. caerulea var. vannata Qld, Danbulla NP KMM473 MELU

D. caerulea var. vannata Qld, Murray Falls NP KMM430 MELU

D. caerulea var. vannata Qld, Girrungun NP KMM406 MELU

D. caerulea var. vannata Qld, Woocoo NP KMM781 MELU

D. caerulea var. vannata Qld, D'Aguilar SF KMM737 MELU

D. caerulea var. vannata Qld, Mt Coolum KMM774 MELU

D. caerulea var. vannata Qld, Ravensbourne NP KMM767 MELU

D. caerulea var. vannata Qld, Conway NP KMM1001 MELU

256

Appendix E

Table 1. A table of the flower localities examined in Chapter 7; the taxon name, location and voucher details of the specimens. Herbarium abbreviations are: NP, National Park; FR, Forest Reserve; SF, State Forest; Vic, Victoria; Qld, Queensland; WA, Western Australia; NP, National Park; Mt, mountain; Rd, road; KMM, Karen Mary Muscat.

Taxon Locality Collecting Number Voucher

D. caerulea var. Qld, KMM1042 MELU producta s.s Springbrook

D. caerulea var. Qld, Burleigh KMM87 MELU producta s.s Heads

D. caerulea aff. var. Vic, Mallacoota KMM976 MELU producta ‘East Gippsland, Victoria’

D. caerulea aff. var. NSW, Illawarra KMM664 MELU producta ‘Illawarra Escarpment NP NSW’

D. caerulea aff. var. NSW, Sea KMM178 MELU producta ‘Putty Rd, Acres NP, Port NSW’ Macquarie

D. caerulea aff. var. NSW, Colo Miller, R sn. MELU producta ‘Putty Rd, Heights NSW’ D. caerulea aff. var. NSW, KMM302 MELU assera ‘Wentworth Wentworth Falls, NSW’ Falls Lookout

D. caerulea aff. var. KMM665 MELU NSW, Nortons assera ‘Nortons Basin, Basin NSW’

257

Taxon Locality Collecting Number Voucher

D. caerulea aff. var. NSW, KMM163 MELU assera ‘broad leaf’ Yarriabini NP

D. caerulea var. assera Qld, KMM62 MELU ‘very narrow leaf’ Woodenbong

D. caerulea var. assera NSW, Byron KMM148 MELU ‘very narrow leaf’ Bay

D. caerulea var. assera Qld, Mt KMM1050 MELU ‘very narrow leaf’ Tamborine

D. caerulea var. assera NSW, Myall KMM676 MELU ‘very narrow leaf’ Lakes

D. caerulea var. assera NSW, KMM1041 MELU ‘very narrow leaf’ Tenterfield

Qld, MELU D. caerulea var. assera Ravensbourne KMM772 s.s ‘narrow leaf’ NP

D. caerulea var. assera Qld, Benarkin KMM756 MELU s.s ‘narrow leaf’ SF

D. caerulea var. assera Qld, Davies KMM468 MELU s.s ‘narrow leaf’ Creek NP

Qld, MELU D. caerulea var. assera KMM1040 s.s ‘narrow leaf’ Springbrook Plateau, Springbrook NP D. caerulea var. Vic, MELU KMM180 caerulea Murrungowar Picnic Area D. caerulea var. MELU Vic, Cann River KMM191 caerulea

D. caerulea var. NSW, MELU KMM199 caerulea Yurrammie SF

258

259

Taxon Locality Collecting Number Voucher

D. caerulea var. Qld, Airlie KMM980 MELU Beach petasmatodes

D. caerulea var. Qld, KMM727 MELU D’Aguilar NP petasmatodes

D. caerulea var. NSW, KMM126 MELU Lismore petasmatodes

D. caerulea var. Qld, Woocoo KMM888 MELU NP petasmatodes

D. caerulea var. protensa Qld, Moreton KMM80 MELU Island

D. caerulea var. protensa Qld, Moreton KMM70 MELU Island

D. congesta NSW, Byron KMM104 MELU Bay

D. caerulea var. NSW, KMM317 MELU cinerascens Wollemi NP

D. caerulea var. NSW, Putty KMM339 MELU cinerascens Rd, Laguna

D. caerulea var. NSW, KMM323 MELU cinerascens Denman

D. caerulea var. vannata Qld, KMM406 MELU Girrungun NP

D. caerulea var. vannata Qld, KMM628 MELU Halloways Nature walk, Cairns

260

Taxon Locality Collecting Number Voucher

D. caerulea var. vannata Qld, Danbulla KMM473 MELU NP

D. caerulea var. vannata Qld, Bowling KMM401 MELU Green Bay NP

D. caerulea var. vannata Qld, Murray KMM430 MELU Falls NP

D. caerulea var. vannata Qld, D'Aguilar KMM737 MELU NP

D. caerulea var. vannata Qld, KMM767 MELU Ravensbourne NP

261

Appendix F

Fig. 1. The Kruskall-Wallis values and box plots of the characters analysed for the D. caerulea complex (Chapter 7); continued overleaf.

262

263

Appendix G

Fig. 1. The Kruskall-Wallis values and boxplots of the D. caerulea var. assera and D. caerulea var. producta analyses (Chapter 7); continued overleaf.

264

265

Appendix H

Fig. 1. A diagnostic drawing of the major plant parts of Dianella.

266

Fig. 2. A drawing of a major inflorescence branch, cyme, cymule and pedicel.

267

Minerva Access is the Institutional Repository of The University of Melbourne

Author/s: Muscat, Mary Karen

Title: Classification and phylogeny of the plant genus Dianella Lam. ex Juss.

Date: 2017

Persistent Link: http://hdl.handle.net/11343/191284

Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.