DOCSLIB.ORG

Phylogeny of the North Asian Cystopteridaceae (Polypodiopsida) Based on Trng-R Intergenic Spacer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogeny of the North Asian Cystopteridaceae (Polypodiopsida) Based on Trng-R Intergenic Spacer Ukrainian Journal of Ecology Ukrainian Journal of Ecology, 2020, 10 (2), 177-183, doi: 10.15421/2020_82 ORIGINAL ARTICLE UDC 582.394.72 Phylogeny of the North Asian Cystopteridaceae (Polypodiopsida) based on trnG-R intergenic spacer I.I. Gureyeva1,2*, D.О. Ulko1**, R.S. Romanets1, A.A. Kuznetsov1 1Tomsk State University, Lenina ave. 36, 634050, Tomsk, Russia 2Tomsk Oil and Gas Design and Research Institute, Mira ave. 72, 634027, Tomsk, Russia *Corresponding author E-mail: [email protected]*, [email protected]** Received: 10.03.2020. Accepted: 26.04.2020 The molecular phylogenetic analysis of the Cystopteridaceae family based on sequencing of the plastid DNA intergenic spacer trnG-R is carried out. The dataset includes sequences mainly of North Asian samples of both widerspread species and species described from the former USSR and modern Russia. The use of trnG-R intergenic spacer showed more comprehensive results for Gymnocarpium, than for Cystopteris. Gymnocarpium phylogeny includes four well-supported clades: the dryopteris clade, the robertianum clade, the continentale clade, and the jessoense clade. Data from trnG-R support the divergence between species with glabrous fronds (G. dryopteris) and species with glandular-pubescent fronds. Among species having glandular-pubescent fronds, the robertianum clade is a sister to the remaining ones. Gymnocarpium fedtschenkoanum is more related to G. robertianum, than other glandular species. Our data confirmed the recognition of Gymnocarpium continentale and G. jessoense as distinct species. The topology of G. tenuipes has remained uncertain. Among Cystopteris species three highly supported clades are indicated: the montana clade, the sudetica clade and the Cystopteris fragilis complex. C. montana and C. sudetica occupy the clearest position in the phylogenetic tree. The topology of C. montana as sister to the remainder of the genus, and then the placement of C. sudetica as sister to the C. fragilis complex does not allow C. montana to be included together with C. sudetica in the same supraspecific taxon but allows to accept the genus Rhizomatopteris as distinct monotypic genus containing a single species – Rh. montana. Relationships among the taxa of C. fragilis complex including the species described from North Asia remain uncertain. Key words: Cystopteris; Gymnocarpium; Cystopteridaceae; Plastid DNA; trnG-R intergenic spacer; Phylogeny Introduction Cystopteris Bernh. and Gymnocarpium Newman are both the members of the fern family Cystopteridaceae (Payer) Shmakov, which was first treated as a separate family by A. I. Shmakov (2001), who included in it about 60 species. The family status was accepted and circumscription by M. J. M. Christenhusz et al. (2011), and they recognize 30 species in the family. Subsequent molecular phylogenetic studies provided by C. Rothfels et al. (2012, 2013, 2014) have yielded a clear understanding of this family, which led to the recircumscription of the Cystopteridaceae. In the modern sense, Cystopteridaceae includes of four genera and about 38 species: Acystopteris Nakai – 3 species, Cystoathyrium Ching – 1 species, Gymnocarpium (including Currania Copel.) – 7 species, and Cystopteris (including Rhizomatopteris A. P. Khokhr.) – about 27 species (Rothfels et al., 2013). Thus, the genera Cystopteris and Gymnocarpium are the largest genera in this family. Many taxonomists have expressed the complexity of the intrageneric taxonomy of Cystopteris and Gymnocarpium. As noted by V. N. Siplivinsky (1973: 353), “Difficulties in recognizing of Siberian Gymnocarpium are inversely related to their species diversity”. Opinion regarding Cystopteris is that the Cystopteris fragilis complex represents “perhaps the most formidable biosystematics problem in the ferns” (Lovis, 1978: 356). The molecular phylogenetic study of Cystopteridaceae by C. Rothfels et al. (2013) based on a three-locus plastid dataset (matK, rbcL, trnG-R) included multiple accessions of the most species from across their geographic ranges. Authors of that study have established, that all represented genera are supported as monophyletic, the Gymnocarpium is deeply divided into three major clades labeled the disjunctum clade, the robertianum clade, and core Gymnocarpium. Cystopteris features four deeply diverged clades: C. montana, the sudetica clade, the bulbifera clade, and the C. fragilis complex. Only two accessions in the dataset by C. Rothfels et al. (2013) originate from Russia. These accessions represent two species – Cystopteris sudetica A. Braun et Milde and Gymnocarpium jessoense (Koidz.) Koidz. subsp. parvulum Sarvela. C. Rothfels et al. (2013) did not involve several species of Cystopteridaceae described from the territory of the former USSR as well as accessions of widespread species from Russia in their study. Six species of Cystopteridaceae were described from the territory of the former USSR; these are Gymnocarpium continentale (Petrov) Pojark., G. fedtschenkoanum Pojark., G. tenuipes Pojark. ex Shmakov, Cystopteris almaatensis Kotukh., C. altajensis Gureeva, and C. gureevae Stepanov. V. A. Petrov (1930) described Gymnocarpium continentale from Yakutia (Russia) as Dryopteris pulchella (Salisb.) Hayek var. continentalis Petrov, and later A. V. Pojarkova (1950) included it in the genus Gymnocarpium. A. V. Pojarkova (1950) described Gymnocarpium fedtschenkoanum and G. tenuipes from different parts of Central Asia. Protolog of G. fedtschenkoanum was published by A. V. Pojarkova (1950) in Latin in compliance with the rules of the botanical nomenclature, the description of G. tenuipes was represented in the same publication only in Russian. A. I. Shmakov validated it in 1995 (Shmakov, 1995). Gymnocarpium fedtschenkoanum was described from the Hissar Ridge, Tajikistan and considered as endemic for Central Asia (Pamir-Alay, Tianshan, northwest Himalayas). Gymnocarpium tenuipes mentioned by A. V. Pojarkova (1950) as an endemic of the Kazakh Uplands, Central Kazakhstan. Afterwards, A. I. Shmakov (1995) indicated it for the Russian Altai. Cystopteris almaatensis was described from Zailiisky Alatau, Kazakhstan (Kotukhov, 1966). Latter, this species were found in the Russian Altai (Gureyeva et al., 2015), furthermore, as the authors know on the herbarium collections from LE, MW, and TK, it Ukrainian Journal of Ecology occurs also in the mountains of Northern Kyrgyzstan and Tajik Pamir. Cystopteris altajensis was described from the Russian Altai (Gureyeva, 1985); its geographic range covers the Altai-Sayan mountain system. And finally, Cystopteris gureevae is described recently from Western Sayan (South Siberia, Russia) and is still known only from locations indicated in protolog (Stepanov, 2015). The aim of this study is the molecular phylogenetic analysis of plastid DNA locus trnG-R of the most species of the Cystopteridaceae occurred in North Asia, including species, described from the territory of the former USSR. Materials and Methods Phylogenetic analysis was provided on the base of the sequencing of the intergenic spacer of plastid DNA trnG-R, which was used in the study by С. Rothfels et al. (2013). The most of the fern samples were collected in natural populations mainly in South Siberia on the Western Sayan (2015, I. I. Gureyeva, A. A. Kuznetsov, N. V. Stepanov) and Kuznetsk Alatau (2016, I. I. Gureyeva, D. O. Ulko, R. S. Romanets), samples outside Russia were collected by I. I. Gureyeva (Fig. 1). Vouchers are stored in the Herbarium of Tomsk State University (TK). Plastid DNA was extracted from silica-dried material or herbarium specimens using the protocol of the manufacturer of DNA isolation kits or by the standard CTAB method (Rogers & Bendich, 1989). The quality and quantity of DNA were checked on the Implen P330 spectrophotometer. To obtain comparable results, the amplification of chloroplast DNA locus trnG-R was carried out with the same primers used by C. Rothfels et al. (2013) (Table 1 and Figure 1). Figure 1. Some species of the family Cystopteridaceae. A – Cystopteris altajensis (Russia, Kuznetsk Alatau, near Tunguzhul village); B – Cystopteris gureevae (Russia, Western Sayan, Malyi Kebezh River); C – Cystopteris alpina (Austria, Arlberg, Formarinsee); D – Gymnocarpium continentale (Russia, basin of Podkamennaya Tunguska River, mouth of Lakura River). Photos by I. I. Gureyeva (A–C) and Yu. G. Raiskaya (D). Table 1. Primers used for trnG-R amplifications of the Cystopteridaceae members. Locus Direction Sequence (5'–3') References trnG-R F GCGGGTATAGTTTAGTGGTAA Nagalingum et al. (2007) trnG-R F GCTAYACGACCAARACGTAAGC Rothfels et al. (2013) trnG-R R GTGGCATCCATAAAATCYATGTCAG Rothfels et al. (2013) trnG-R R CTATCCATTAGACGATGGACG Nagalingum et al. (2007) Loci were amplified in 15 µl reactions consisting of 2 µl of DNA, 1 µl of each primer (10 µM), 1.5 PCR buffer, 1.6 µl of MgCl2, 0.12 µl of dNTP, 0.2 µl of taq polymerase and 7.58 µl of DI water. The PCR reaction was carried out using S1000 Thermal CyclerTM (BIO-RAD) and the thermal cycling program consisted of an initial denaturation step (94ºC for 3 min), 35 denaturation, annealing, and elongation cycles (94ºC for 45 sec, 50ºC for 30 sec, 72ºC for 1.5 min), and a final elongation step (72ºC for 10 min). The obtained amplification was checked for the presence of the target fragment by electrophoresis in 1.5% agarose gel stained with ethidium bromide. After confirming the target fragment for all samples, the purification procedure was carried out: PCR product was treated with a mixture of exonuclease I (to remove dNTP)
Load more

Recommended publications
  • Rare Plant Survey Triple A-CR 510-Red Road-Sleepy Hollow
    Rare Plant Survey Triple A-CR 510-Red Road-Sleepy Hollow Marquette County, Michigan Prepared for: Kennecott Eagle Minerals Company Marquette County, Michigan Prepared by: King & MacGregor Environmental, Inc. 2520 Woodmeadow SE Grand Rapids, Michigan 49546 www.king-macgregor.com DRAFT DATE: April 2011 TABLE OF CONTENTS INTRODUCTION & BACKGROUND ........................................................................................... 1 METHODS .................................................................................................................................... 1 RESULTS ..................................................................................................................................... 2 DISCUSSION ................................................................................................................................ 2 REFERENCES FIGURES Figure 1. Overall Project Location-Land Cover Map Figure 2. Rare Plant Location Map TABLES Table 1. MNFI Element Occurrence List for Marquette County Table 2. Rare Plant Species by Habitat Type for Marquette County APPENDIX: Photographs INTRODUCTION & BACKGROUND King & MacGregor Environmental, Inc. (KME) was retained by Kennecott Eagle Minerals Company to conduct botanical assessments along various potential roadway alignments within Marquette County. Initial surveys of potential road routes were completed in 2008 and data was included within a report that was issued to Kennecott Eagle Minerals Company (KME, 2009). This report is an addendum to that original report
    [Show full text]
  • Notes on Rust Fungi in China 4. Hosts and Distribution of <I> Hyalopsora
    MYCOTAXON ISSN (print) 0093-4666 (online) 2154-8889 Mycotaxon, Ltd. ©2018 January–March 2018—Volume 133, pp. 23–29 https://doi.org/10.5248/133.23 Notes on rust fungi in China 4. Hosts and distribution of Hyalopsora aspidiotus and H. hakodatensis Jing-Xin Ji1, Zhuang Li2, Yu Li1, Jian-Yun Zhuang3, Makoto Kakishima1, 4* 1 Engineering Research Center of Chinese Ministry of Education for Edible and Medicinal Fungi, Jilin Agricultural University, Changchun, Jilin 130118, China 2 College of Plant Pathology, Shandong Agricultural University, Tai’an 271000, China 3 Institute of Microbiology, Chinese Academy of Sciences, Beijing 10001, China 4 University of Tsukuba, Tsukuba, Ibaraki 305-8572, Japan * Correspondence to: [email protected] Abstract—Hosts and distribution in China of two fern rust fungi, Hyalopsora aspidiotus and H. hakodatensis, are clarified based on new collections and examination of herbarium specimens. The ferns Athyrium iseanum, Deparia orientalis, and Phegopteris connectilis are newly identified hosts for H. hakodatensis, while Gymnocarpium jessoense represents a new host for H. aspidiotus in China. The rusts are also reported as new for several Chinese provinces. Key words—Pucciniomycetes, taxonomy, Uredinales Introduction Rust fungi on ferns—species of Hyalopsora, Milesina, and Uredinopsis (together with anamorphic taxa designated as Milesia)—are distributed mainly in temperate to cold areas, especially where their alternate hosts (Abies species) are found (Cummins & Hiratsuka 2003). Many fern rust species are believed to occur in China because of the wide range of areas suitable for their growth. However, these rust fungi have been insufficiently investigated on the mainland. Tai (1979), who listed two Hyalopsora, six Milesina, and eight Uredinopsis species, recorded most of the sixteen species from Taiwan.
    [Show full text]
  • Conservation Assessment for Laurentian Brittle Fern (Cystopteris Laurentiana) (Weatherby) Blasdell
    Conservation Assessment for Laurentian brittle fern (Cystopteris laurentiana) (Weatherby) Blasdell USDA Forest Service, Eastern Region September 2002 This document is undergoing peer review, comments welcome This Conservation Assessment was prepared to compile the published and unpublished information on the subject taxon or community; or this document was prepared by another organization and provides information to serve as a Conservation Assessment for the Eastern Region of the Forest Service. It does not represent a management decision by the U.S. Forest Service. Though the best scientific information available was used and subject experts were consulted in preparation of this document, it is expected that new information will arise. In the spirit of continuous learning and adaptive management, if you have information that will assist in conserving the subject taxon, please contact the Eastern Region of the Forest Service - Threatened and Endangered Species Program at 310 Wisconsin Avenue, Suite 580 Milwaukee, Wisconsin 53203. Conservation Assessment for Laurentian brittle fern (Cystopteris laurentiana) 2 Table of Contents Acknowledgements............................................................................................................. 4 Executive Summary............................................................................................................ 4 Introduction/Objectives....................................................................................................... 5 Habitat and Ecology...........................................................................................................
    [Show full text]
  • A Molecular Phylogeny with Morphological Implications and Infrageneric Taxonomy
    TAXON 62 (3) • June 2013: 441–457 Wei & al. • Phylogeny and classification of Diplazium SYSTEMATICS AND PHYLOGENY Toward a new circumscription of the twinsorus-fern genus Diplazium (Athyriaceae): A molecular phylogeny with morphological implications and infrageneric taxonomy Ran Wei,1,2 Harald Schneider1,3 & Xian-Chun Zhang1 1 State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, The Chinese Academy of Sciences, Beijing 100093, P.R. China 2 University of the Chinese Academy of Sciences, Beijing 100049, P.R. China 3 Department of Botany, The Natural History Museum, London SW7 5BD, U.K. Author for correspondence: Xian-Chun Zhang, [email protected] Abstract Diplazium and allied segregates (Allantodia, Callipteris, Monomelangium) represent highly diverse genera belong- ing to the lady-fern family Athyriaceae. Because of the morphological diversity and lack of molecular phylogenetic analyses of this group of ferns, generic circumscription and infrageneric relationships within it are poorly understood. In the present study, the phylogenetic relationships of these genera were investigated using a comprehensive taxonomic sampling including 89 species representing all formerly accepted segregates. For each species, we sampled over 6000 DNA nucleotides of up to seven plastid genomic regions: atpA, atpB, matK, rbcL, rps4, rps4-trnS IGS, and trnL intron plus trnL-trnF IGS. Phylogenetic analyses including maximum parsimony, maximum likelihood and Bayesian methods congruently resolved Allantodia, Cal- lipteris and Monomelangium nested within Diplazium; therefore a large genus concept of Diplazium is accepted to keep this group of ferns monophyletic and to avoid paraphyletic or polyphyletic taxa. Four well-supported clades and eight robust sub- clades were found in the phylogenetic topology.
    [Show full text]
  • Open Carboniferous Limestone Pavement Grike Microclimates in Great Britain and Ireland: Understanding the Present to Inform the Future
    Open Carboniferous Limestone pavement grike microclimates in Great Britain and Ireland: understanding the present to inform the future Item Type Thesis or dissertation Authors York, Peter, J. Citation York, P, J. (2020). Open Carboniferous Limestone pavement grike microclimates in Great Britain and Ireland: understanding the present to inform the future (Doctoral dissertation). University of Chester, UK. Publisher University of Chester Rights Attribution-NonCommercial-NoDerivatives 4.0 International Download date 10/10/2021 01:26:52 Item License http://creativecommons.org/licenses/by-nc-nd/4.0/ Link to Item http://hdl.handle.net/10034/623502 Open Carboniferous Limestone pavement grike microclimates in Great Britain and Ireland: understanding the present to inform the future Thesis submitted in accordance with the requirements of the University of Chester for the degree of Doctor of Philosophy By Peter James York April 2020 I II Abstract Limestone pavements are a distinctive and irreplaceable geodiversity feature, in which are found crevices known as grikes. These grikes provide a distinct microclimate conferring a more stable temperature, higher relative humidity, lower light intensity and lower air speed than can be found in the regional climate. This stability of microclimate has resulted in an equally distinctive community of flora and fauna, adapted to a forest floor but found in an often otherwise barren landscape. This thesis documents the long-term study of the properties of the limestone pavement grike in order to identify the extent to which the microclimate may sustain its distinctive biodiversity, to provide recommendations for future research which may lead to more effective management. Over a five-year study, recordings of temperature, relative humidity, light intensity and samples of invertebrate biodiversity were collected from five limestone pavements situated in the Yorkshire Dales and Cumbria in Great Britain, and The Burren in the Republic of Ireland.
    [Show full text]
  • Summer 2011 - 49 President’S Message July 2011
    ; THE HARDY FERN FOUNDATION P.O. Box 3797 Federal Way, WA 98063-3797 Web site: www.hardyfernfoundation.org The Hardy Fern Foundation was founded in 1989 to establish a comprehen¬ sive collection of the world’s hardy ferns for display, testing, evaluation, public education and introduction to the gardening and horticultural community. Many rare and unusual species, hybrids and varieties are being propagated from spores and tested in selected environments for their different degrees of hardiness and ornamental garden value. The primary fern display and test garden is located at, and in conjunction with, The Rhododendron Species Botanical Garden at the Weyerhaeuser Corporate Headquarters, in Federal Way, Washington. Satellite fern gardens are at the Birmingham Botanical Gardens, Birmingham, Alabama, California State University at Sacramento, California, Coastal Maine Botanical Garden, Boothbay , Maine. Dallas Arboretum, Dallas, Texas, Denver Botanic Gardens, Denver, Colorado, Georgeson Botanical Garden, University of Alaska, Fairbanks, Alaska, Harry R Leu Garden, Orlando, Florida, Inniswood Metro Gardens, Columbus, Ohio, New York Botanical Garden, Bronx, New York, and Strybing Arboretum, San Francisco, California. The fern display gardens are at Bainbridge Island Library. Bainbridge Island, WA, Bellevue Botanical Garden, Bellevue, WA, Lakewold, Tacoma, Washington, Lotusland, Santa Barbara, California, Les Jardins de Metis, Quebec, Canada, Rotary Gardens, Janesville, Wl, and Whitehall Historic Home and Garden, Louisville, KY. Hardy Fern Foundation
    [Show full text]
  • Pakistan) and Their Some Adjacent Areas
    Int. J. Biosci. 2016 International Journal of Biosciences | IJB | ISSN: 2220-6655 (Print), 2222-5234 (Online) http://www.innspub.net Vol. 9, No. 5, p. 116-133, 2016 RESEARCH PAPER OPEN ACCESS Traditional, medicinal and food uses of Pteridophytes of district Mansehra (Pakistan) and their some adjacent areas Alia Gul1, Jan Alam1, Habib Ahmad2, Ghulam Mujtaba Shah1, Manzoor Hussain1, Yunus Dogan3, Khallil-Ur-Rahman4 1Department of Botany, Hazara University, Mansehra, Pakistan 2Department of Genetics, Hazara University, Mansehra, Pakistan 3Department of Biology Education, Buca Faculty of Education Dokuz Eylul University, Buca, Izmir, Turkey 4Department of Sociology, Hazara University, Mansehra, Pakistan Key words: Ethnobotany, Pteridophytes, Medicinal, Mansehra, Pakistan http://dx.doi.org/10.12692/ijb/9.5.116-133 Article published on November 28, 2016 Abstract Mansehra is one of the floristically rich and most varied districts of Pakistan, gifted with plentiful pteridophytes diversity. Various ethnic communities residing in district Mansehra and its adjacent localities exhibits unique tradition, dialect and culture. They collect pteridophytes from the wild especially for medicinal purposes, general healthcare, food uses and to meet daily life requirements. An inventory survey was conducted in order to assess the traditional uses of pteridophytes by the local inhabitants of the study area. Ethno botanical information and Ornamental potential of the taxa of wild pteridophytes was documented through field trips during 2013-2014. First-hand Information and data was collected through structured questionnaire and in-depth interviews were conducted from the natives in the hilly regions. A univariate level of analysis of the collected data such as percentage and frequency distribution was performed.
    [Show full text]
  • Descripción (Pdf)
    XXII. ATHYRIACEAE 121 2. Gymnocarpium generalmente emarginados; nervios secundarios acabando en el seno de las emarginaciones o en el ápice de dientes agudos. Soros discretos; indusio subor- bicular, frecuentemente glanduloso. Esporas 32-36 µm, verrucosas, con gruesas verrugas perforadas y superficie ligeramente granulosa. 2n = 84*, 168*; n = 84*. Bosques, matorrales y pedregales de montaña, húmedos y sombreados, en substratos preferen- temente calizos; 1100-2200 m. VII-VIII. Hemisferio Norte. Pirineos centrales. Esp.: Hu L. HÍBRIDOS C. dickieana × C. fragilis subsp. fragilis C. × montserratii Prada & Salvo in Anales Jard. Bot. Madrid 41: 466 (1985) Observaciones.–Se han observado formas intermedias que podrían corresponder a C. fragilis subsp. alpina × C. fragilis subsp. fragilis, C. fragilis subsp. fragilis × C. fragilis subsp. huteri y C. fra- gilis subsp. fragilis × C. viridula; todo este conjunto de formas requiere estudios en profundidad. 2. Gymnocarpium Newman * [Gymnocárpium n. – gr. gymnós = desnudo; gr. kárpion = fruto pequeño. Los soros carecen de indusio] Rizoma largamente rastrero, delgado, con páleas dispersas. Frondes de hasta 60 cm, esparcidas; lámina varias veces pinnada, deltoidea, glabra o glandulosa, con nervadura libre. Soros redondeados, submarginales, dispuestos sobre las venas, sin indusio. Esporas monoletas, elipsoidales. Bibliografía.–J. SARVELA in Ann. Bot. Fenn. 15: 101-106 (1978). 1. Raquis y envés glabros o con algunas glándulas sésiles; pinnas basales de longitud si- milar a la del resto de la lámina .......................................................... 1. G. dryopteris – Raquis y envés densamente glandulosos, con glándulas pediculadas; pinnas basales más cortas que el resto de la lámina ............................................... 2. G. robertianum 1. G. dryopteris (L.) Newman in Phytologist 4: 371 (1851) [Dryópteris] Polypodium dryopteris L., Sp.
    [Show full text]
  • State of New York City's Plants 2018
    STATE OF NEW YORK CITY’S PLANTS 2018 STATE OF NEW YORK CITY’S PLANTS 2018 Daniel Atha & Brian Boom © 2018 The New York Botanical Garden All rights reserved ISBN 978-0-89327-955-4 Center for Conservation Strategy The New York Botanical Garden 2900 Southern Boulevard Bronx, NY 10458 All photos NYBG staff Citation: Atha, D. and B. Boom. 2018. State of New York City’s Plants 2018. Center for Conservation Strategy. The New York Botanical Garden, Bronx, NY. 132 pp. 4 EXECUTIVE SUMMARY 6 INTRODUCTION 10 DOCUMENTING THE CITY’S PLANTS 10 The Flora of New York City 11 Rare Species 14 Focus on Specific Area 16 Botanical Spectacle: Summer Snow 18 CITIZEN SCIENCE 20 THREATS TO THE CITY’S PLANTS 24 NEW YORK STATE PROHIBITED AND REGULATED INVASIVE SPECIES FOUND IN NEW YORK CITY 26 LOOKING AHEAD 27 CONTRIBUTORS AND ACKNOWLEGMENTS 30 LITERATURE CITED 31 APPENDIX Checklist of the Spontaneous Vascular Plants of New York City 32 Ferns and Fern Allies 35 Gymnosperms 36 Nymphaeales and Magnoliids 37 Monocots 67 Dicots 3 EXECUTIVE SUMMARY This report, State of New York City’s Plants 2018, is the first rankings of rare, threatened, endangered, and extinct species of what is envisioned by the Center for Conservation Strategy known from New York City, and based on this compilation of The New York Botanical Garden as annual updates thirteen percent of the City’s flora is imperiled or extinct in New summarizing the status of the spontaneous plant species of the York City. five boroughs of New York City. This year’s report deals with the City’s vascular plants (ferns and fern allies, gymnosperms, We have begun the process of assessing conservation status and flowering plants), but in the future it is planned to phase in at the local level for all species.
    [Show full text]
  • FERNS and FERN ALLIES Dittmer, H.J., E.F
    FERNS AND FERN ALLIES Dittmer, H.J., E.F. Castetter, & O.M. Clark. 1954. The ferns and fern allies of New Mexico. Univ. New Mexico Publ. Biol. No. 6. Family ASPLENIACEAE [1/5/5] Asplenium spleenwort Bennert, W. & G. Fischer. 1993. Biosystematics and evolution of the Asplenium trichomanes complex. Webbia 48:743-760. Wagner, W.H. Jr., R.C. Moran, C.R. Werth. 1993. Aspleniaceae, pp. 228-245. IN: Flora of North America, vol.2. Oxford Univ. Press. palmeri Maxon [M&H; Wagner & Moran 1993] Palmer’s spleenwort platyneuron (Linnaeus) Britton, Sterns, & Poggenburg [M&H; Wagner & Moran 1993] ebony spleenwort resiliens Kunze [M&H; W&S; Wagner & Moran 1993] black-stem spleenwort septentrionale (Linnaeus) Hoffmann [M&H; W&S; Wagner & Moran 1993] forked spleenwort trichomanes Linnaeus [Bennert & Fischer 1993; M&H; W&S; Wagner & Moran 1993] maidenhair spleenwort Family AZOLLACEAE [1/1/1] Azolla mosquito-fern Lumpkin, T.A. 1993. Azollaceae, pp. 338-342. IN: Flora of North America, vol. 2. Oxford Univ. Press. caroliniana Willdenow : Reports in W&S apparently belong to Azolla mexicana Presl, though Azolla caroliniana is known adjacent to NM near the Texas State line [Lumpkin 1993]. mexicana Schlechtendal & Chamisso ex K. Presl [Lumpkin 1993; M&H] Mexican mosquito-fern Family DENNSTAEDTIACEAE [1/1/1] Pteridium bracken-fern Jacobs, C.A. & J.H. Peck. Pteridium, pp. 201-203. IN: Flora of North America, vol. 2. Oxford Univ. Press. aquilinum (Linnaeus) Kuhn var. pubescens Underwood [Jacobs & Peck 1993; M&H; W&S] bracken-fern Family DRYOPTERIDACEAE [6/13/13] Athyrium lady-fern Kato, M. 1993. Athyrium, pp.
    [Show full text]
  • Natural Hybridization Between Genera That Diverged from Each Other Approximately 60 Million Years Ago
    http://www.jstor.org/stable/10.1086/679662 . Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at . http://www.jstor.org/page/info/about/policies/terms.jsp . JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms of scholarship. For more information about JSTOR, please contact [email protected]. The University of Chicago Press, The American Society of Naturalists, The University of Chicago are collaborating with JSTOR to digitize, preserve and extend access to The American Naturalist. http://www.jstor.org This content downloaded from 128.104.46.196 on Mon, 9 Mar 2015 14:05:37 PM All use subject to JSTOR Terms and Conditions vol. 185, no. 3 the american naturalist march 2015 Natural History Note Natural Hybridization between Genera That Diverged from Each Other Approximately 60 Million Years Ago Carl J. Rothfels,1,*AnneK.Johnson,2 Peter H. Hovenkamp,3 David L. Swofford,2,4 Harry C. Roskam,3,5 Christopher R. Fraser-Jenkins,6 Michael D. Windham,2 and Kathleen M. Pryer2 1. Department of Zoology, University of British Columbia, Vancouver, British Columbia V6T 1Z4, Canada; 2. Department of Biology, Duke University, Durham, North Carolina 27708; 3. Botany Section, Naturalis Biodiversity Center, PO Box 9517, Leiden, 2300 RA, the Netherlands; 4. National Evolutionary Synthesis Center, Durham, North Carolina 27705; 5. Hortus Botanicus Leiden, Leiden University, PO Box 9500, Leiden, 2300 RA, the Netherlands; 6.
    [Show full text]
  • Habitats of North Carolina Ferns
    North Carolina Ferns and “Fern Allies”: a survey Ferns of North Carolina • 122 species, in 46 genera, in 22 families • from sea level to tops of Mount Mitchell • in nearly all habitats (under water and dry sands and rocks) Lycopodiaceae • 14 species Selaginellaceae • 6 species (2 aliens) Isoetaceae • 9 species – more on the way Psilotaceae • 1 species (alien?, new to NC) Equisetaceae • 3 species (1 alien, newly documented for NC) Azollaceae • 1 species Salviniaceae • 1 species (alien) Marsileaceae • 1 species (alien) Hymenophyllaceae • Filmy ferns (Trichomanes petersii) Ophioglossaceae • 16 species New Yorker cartoon by Charles Saxon, Sept. 12, 1983 Osmundaceae • 3 species Dennstaedtiaceae • 3 species Pteridaceae • 8 species Aspleniaceae • 12 species Dryopteridaceae • 24 species (1 alien) Thelypteridaceae • 6 species Blechnaceae • 2 species Polypodiaceae • 3 species Schizaeaceae • 1 species Lygodiaceae • 2 species (1 alien) Grammitidaceae • 1 species Vittariaceae • 1 species Changes -- 1 • New systematics – monographs, revisions, studies using traditional approaches – cladistic approaches – molecular systematics • New nomenclature – continued “nontaxonomic” changes in nomenclature Changes -- 2 • New discoveries – new natives are found to be (and to have been) in the Carolinas – new aliens become established in the Carolinas • differing criteria for inclusion in floras Changes -- 4 • Additions to the flora – by description (new circumscription) [+250] – re-elevation from synonymy [net +250] • New discoveries and new arrivals – “finds” (natives new to the flora area) [+250] – naturalization [+250] • Rearrangements of lower taxa [plenty] • New nomenclature [plenty] New species and infrataxa • Gymnocarpium appalachianum Pryer & Haufler • Huperzia appalachiana Beitel & Mickel • Hymenophyllum tayloriae Farrar & Raine • Isoetes appalachiana Brunton & Britton • Isoetes hyemalis Brunton • Lycopodium hickeyi W.H. Wagner, Beitel, & R.C.
    [Show full text]