Ukrainian Journal of Ecology Ukrainian Journal of Ecology, 2020, 10 (2), 177-183, doi: 10.15421/2020_82 ORIGINAL ARTICLE UDC 582.394.72 Phylogeny of the North Asian Cystopteridaceae (Polypodiopsida) based on trnG-R intergenic spacer I.I. Gureyeva1,2*, D.О. Ulko1**, R.S. Romanets1, A.A. Kuznetsov1 1Tomsk State University, Lenina ave. 36, 634050, Tomsk, Russia 2Tomsk Oil and Gas Design and Research Institute, Mira ave. 72, 634027, Tomsk, Russia *Corresponding author E-mail: [email protected]*, [email protected]** Received: 10.03.2020. Accepted: 26.04.2020 The molecular phylogenetic analysis of the Cystopteridaceae family based on sequencing of the plastid DNA intergenic spacer trnG-R is carried out. The dataset includes sequences mainly of North Asian samples of both widerspread species and species described from the former USSR and modern Russia. The use of trnG-R intergenic spacer showed more comprehensive results for Gymnocarpium, than for Cystopteris. Gymnocarpium phylogeny includes four well-supported clades: the dryopteris clade, the robertianum clade, the continentale clade, and the jessoense clade. Data from trnG-R support the divergence between species with glabrous fronds (G. dryopteris) and species with glandular-pubescent fronds. Among species having glandular-pubescent fronds, the robertianum clade is a sister to the remaining ones. Gymnocarpium fedtschenkoanum is more related to G. robertianum, than other glandular species. Our data confirmed the recognition of Gymnocarpium continentale and G. jessoense as distinct species. The topology of G. tenuipes has remained uncertain. Among Cystopteris species three highly supported clades are indicated: the montana clade, the sudetica clade and the Cystopteris fragilis complex. C. montana and C. sudetica occupy the clearest position in the phylogenetic tree. The topology of C. montana as sister to the remainder of the genus, and then the placement of C. sudetica as sister to the C. fragilis complex does not allow C. montana to be included together with C. sudetica in the same supraspecific taxon but allows to accept the genus Rhizomatopteris as distinct monotypic genus containing a single species – Rh. montana. Relationships among the taxa of C. fragilis complex including the species described from North Asia remain uncertain. Key words: Cystopteris; Gymnocarpium; Cystopteridaceae; Plastid DNA; trnG-R intergenic spacer; Phylogeny Introduction Cystopteris Bernh. and Gymnocarpium Newman are both the members of the fern family Cystopteridaceae (Payer) Shmakov, which was first treated as a separate family by A. I. Shmakov (2001), who included in it about 60 species. The family status was accepted and circumscription by M. J. M. Christenhusz et al. (2011), and they recognize 30 species in the family. Subsequent molecular phylogenetic studies provided by C. Rothfels et al. (2012, 2013, 2014) have yielded a clear understanding of this family, which led to the recircumscription of the Cystopteridaceae. In the modern sense, Cystopteridaceae includes of four genera and about 38 species: Acystopteris Nakai – 3 species, Cystoathyrium Ching – 1 species, Gymnocarpium (including Currania Copel.) – 7 species, and Cystopteris (including Rhizomatopteris A. P. Khokhr.) – about 27 species (Rothfels et al., 2013). Thus, the genera Cystopteris and Gymnocarpium are the largest genera in this family. Many taxonomists have expressed the complexity of the intrageneric taxonomy of Cystopteris and Gymnocarpium. As noted by V. N. Siplivinsky (1973: 353), “Difficulties in recognizing of Siberian Gymnocarpium are inversely related to their species diversity”. Opinion regarding Cystopteris is that the Cystopteris fragilis complex represents “perhaps the most formidable biosystematics problem in the ferns” (Lovis, 1978: 356). The molecular phylogenetic study of Cystopteridaceae by C. Rothfels et al. (2013) based on a three-locus plastid dataset (matK, rbcL, trnG-R) included multiple accessions of the most species from across their geographic ranges. Authors of that study have established, that all represented genera are supported as monophyletic, the Gymnocarpium is deeply divided into three major clades labeled the disjunctum clade, the robertianum clade, and core Gymnocarpium. Cystopteris features four deeply diverged clades: C. montana, the sudetica clade, the bulbifera clade, and the C. fragilis complex. Only two accessions in the dataset by C. Rothfels et al. (2013) originate from Russia. These accessions represent two species – Cystopteris sudetica A. Braun et Milde and Gymnocarpium jessoense (Koidz.) Koidz. subsp. parvulum Sarvela. C. Rothfels et al. (2013) did not involve several species of Cystopteridaceae described from the territory of the former USSR as well as accessions of widespread species from Russia in their study. Six species of Cystopteridaceae were described from the territory of the former USSR; these are Gymnocarpium continentale (Petrov) Pojark., G. fedtschenkoanum Pojark., G. tenuipes Pojark. ex Shmakov, Cystopteris almaatensis Kotukh., C. altajensis Gureeva, and C. gureevae Stepanov. V. A. Petrov (1930) described Gymnocarpium continentale from Yakutia (Russia) as Dryopteris pulchella (Salisb.) Hayek var. continentalis Petrov, and later A. V. Pojarkova (1950) included it in the genus Gymnocarpium. A. V. Pojarkova (1950) described Gymnocarpium fedtschenkoanum and G. tenuipes from different parts of Central Asia. Protolog of G. fedtschenkoanum was published by A. V. Pojarkova (1950) in Latin in compliance with the rules of the botanical nomenclature, the description of G. tenuipes was represented in the same publication only in Russian. A. I. Shmakov validated it in 1995 (Shmakov, 1995). Gymnocarpium fedtschenkoanum was described from the Hissar Ridge, Tajikistan and considered as endemic for Central Asia (Pamir-Alay, Tianshan, northwest Himalayas). Gymnocarpium tenuipes mentioned by A. V. Pojarkova (1950) as an endemic of the Kazakh Uplands, Central Kazakhstan. Afterwards, A. I. Shmakov (1995) indicated it for the Russian Altai. Cystopteris almaatensis was described from Zailiisky Alatau, Kazakhstan (Kotukhov, 1966). Latter, this species were found in the Russian Altai (Gureyeva et al., 2015), furthermore, as the authors know on the herbarium collections from LE, MW, and TK, it Ukrainian Journal of Ecology occurs also in the mountains of Northern Kyrgyzstan and Tajik Pamir. Cystopteris altajensis was described from the Russian Altai (Gureyeva, 1985); its geographic range covers the Altai-Sayan mountain system. And finally, Cystopteris gureevae is described recently from Western Sayan (South Siberia, Russia) and is still known only from locations indicated in protolog (Stepanov, 2015). The aim of this study is the molecular phylogenetic analysis of plastid DNA locus trnG-R of the most species of the Cystopteridaceae occurred in North Asia, including species, described from the territory of the former USSR. Materials and Methods Phylogenetic analysis was provided on the base of the sequencing of the intergenic spacer of plastid DNA trnG-R, which was used in the study by С. Rothfels et al. (2013). The most of the fern samples were collected in natural populations mainly in South Siberia on the Western Sayan (2015, I. I. Gureyeva, A. A. Kuznetsov, N. V. Stepanov) and Kuznetsk Alatau (2016, I. I. Gureyeva, D. O. Ulko, R. S. Romanets), samples outside Russia were collected by I. I. Gureyeva (Fig. 1). Vouchers are stored in the Herbarium of Tomsk State University (TK). Plastid DNA was extracted from silica-dried material or herbarium specimens using the protocol of the manufacturer of DNA isolation kits or by the standard CTAB method (Rogers & Bendich, 1989). The quality and quantity of DNA were checked on the Implen P330 spectrophotometer. To obtain comparable results, the amplification of chloroplast DNA locus trnG-R was carried out with the same primers used by C. Rothfels et al. (2013) (Table 1 and Figure 1). Figure 1. Some species of the family Cystopteridaceae. A – Cystopteris altajensis (Russia, Kuznetsk Alatau, near Tunguzhul village); B – Cystopteris gureevae (Russia, Western Sayan, Malyi Kebezh River); C – Cystopteris alpina (Austria, Arlberg, Formarinsee); D – Gymnocarpium continentale (Russia, basin of Podkamennaya Tunguska River, mouth of Lakura River). Photos by I. I. Gureyeva (A–C) and Yu. G. Raiskaya (D). Table 1. Primers used for trnG-R amplifications of the Cystopteridaceae members. Locus Direction Sequence (5'–3') References trnG-R F GCGGGTATAGTTTAGTGGTAA Nagalingum et al. (2007) trnG-R F GCTAYACGACCAARACGTAAGC Rothfels et al. (2013) trnG-R R GTGGCATCCATAAAATCYATGTCAG Rothfels et al. (2013) trnG-R R CTATCCATTAGACGATGGACG Nagalingum et al. (2007) Loci were amplified in 15 µl reactions consisting of 2 µl of DNA, 1 µl of each primer (10 µM), 1.5 PCR buffer, 1.6 µl of MgCl2, 0.12 µl of dNTP, 0.2 µl of taq polymerase and 7.58 µl of DI water. The PCR reaction was carried out using S1000 Thermal CyclerTM (BIO-RAD) and the thermal cycling program consisted of an initial denaturation step (94ºC for 3 min), 35 denaturation, annealing, and elongation cycles (94ºC for 45 sec, 50ºC for 30 sec, 72ºC for 1.5 min), and a final elongation step (72ºC for 10 min). The obtained amplification was checked for the presence of the target fragment by electrophoresis in 1.5% agarose gel stained with ethidium bromide. After confirming the target fragment for all samples, the purification procedure was carried out: PCR product was treated with a mixture of exonuclease I (to remove dNTP)