Establishment of Recombinant Adeno-Associated Virus Vector Integration Frequency in Vitro and in Vivo

ESTABLISHMENT OF RECOMBINANT ADENO-ASSOCIATED VIRUS VECTOR INTEGRATION FREQUENCY IN VITRO AND IN VIVO

THESIS

Presented in Partial Fulﬁllment of the Requirements for the Degree Master of

Science in the Graduate School of The Ohio State University

Mona Odeh, BS

Graduate Program in Molecular, Cellular, and Developmental Biology

The Ohio State University

2012

Thesis Committee:

Douglas McCarty, Ph.D., Advisor

Santiago Partida-Sanchez, Ph.D. c Copyright by

Mona Odeh

2012 ABSTRACT

Adeno-Associated virus (AAV) is a single-stranded (ss) DNA parvovirus, that is important for the development as a gene therapy vector. Recombinant AAV (rAAV) integration of a transgene into the host cell beneﬁts, since it remains in progeny cells.

However rAAV integrates randomly into pre-existing double-stranded breaks (DSB) which poses a risk for potential mutagenesis. Earlier experiments with rAAV vectors in cell culture showed that integration was ineﬃcient at 0.1-0.5% of infectious vector genomes, whether this happens in non-dividing cells of animal tissues (such as the liver) is unclear. Therefore to better evaluate the potential beneﬁt or risk a clearer understanding of AAV integration frequency is needed.

We wished to evaluate the frequency of rAAV vector integration in vitro as well as in vivo under the treatment of DNA damaging agents. In vitro comparison between single-stranded break (SSB) and double-stranded break (DSB) agents on viral integration were made using rAAV2-GFP transduced human lung ﬁbroblast (HFL-1) cells, additional comparison between non-dividing and dividing cells were made. We hypothesized that dividing HFL-1 cells treated with the DSB inducing agent, camptothecin (CPT), would have a higher integration frequency than the cells treated with a SSB inducing agent, hydrogen peroxide (H2O2), and/or were in a non-dividing state. In vivo 8 C3H/HeJ mice were transduced with rAAV8-GFP (targeting the liver) and 4 out of the 8 mice were treated with CPT. Here the hypothesis states that

ii if rAAV integrates readily into pre-existing DSB, then we should see an increase of viral vector integration in CPT treated mice.

Finally, we also investigated whether rAAV vector integration happens at an earlier or a later time point post-infection. It was previously suggested that most vector integration occurs 24-48 hrs post-infection, which is concurrent with the view that free DNA ends, i.e. from the virus, are rapidly cleared from the cell to protect the integrity of the genome. 20 C3H/HeJ mice were transduced with rAAV8-GFP and time points 2 weeks, 1 month and 6 months were investigated for rAAV integration frequency. We tested the hypothesis that viral vector integration would occur early, thus no increased vector integration frequency was expected throughout the course of the experiment.

A method was developed that detects small numbers of putative integrated molecules in excess of unintegrated viral DNA in the form of monomeric or concatemerized episomes. The rAAV vector harbors the GFP transgene, which contains an I-Ceu1 site and a LacZ1 fragment to be used as a QPCR target. I-Ceu1 site is used to cut out only unintegrated viral vectors, since it is not found in the mouse genome. We puri-

ﬁed out the unintegrated viral DNA through a low melting point (LMP) agarose gel and detected integration with QPCR.

In vitro no significant difference in virus integration was seen between cells treated with DNA damaging agents or not, nor was a difference seen between non-dividing and dividing cells. In vivo we detected as little as 1 integrated viral vector genome out of 1000 infectious viruses in the hepatocytes, resulting in an integration efficiency of 0.1%. Additionally there was no significant difference in integration efficiency e between CPT treated and untreated mice. Lastly, in the long-term experiment, we detected integration frequency ranging from 0.1-0.01%. Also no change in integration frequency was seen over the time course 2 weeks to 6 months. To conclude, a

iii valuable AAV integration detection method has been developed to evaluate integration frequency in vitro as well as in vivo. The results suggest that DNA damaging agents do not enhance the integration eﬃciency of rAAV in vitro nor in vivo. Finally observing no diﬀerence in integration frequency over 6 months suggests that indeed rAAV integration occurs early post-infection.

iv I dedicate this thesis to God, Lord of the Worlds, Most Magniﬁcent, Most Merciful

To my beloved husband, Dr. Shareef Dabdoub

To my loving parents, Said Faleh Falah Odeh and Etidal Ahmad Dalal Odeh

v ACKNOWLEDGMENTS

I would like to start out by praising and thanking Almighty God, for giving me this opportunity to grow in knowledge and experience in the ﬁeld of my dreams, Biology.

My thanks to my beloved husband, Shareef Dabdoub, are endless. Thank you, my love, for your constant support, for your help whenever I needed it and for always encouraging me to keep going when many times I wanted to quit.

Special thanks also to my mentor Dr. Douglas Mark McCarty, who with his endless patience and guidance made me the scientist I am today. Without his ﬁnancial, intellectual, and kind support I would have never made it far in the ﬁeld of Biology.

I would also like to thank each of my committee members; Dr. Partida-Sanchez, Dr.

Peeples, Dr. Clark and last but not least Dr. Justice for their advice, continued support and believing in me when I had doubts about my abilities as a scientist.

I would like to thank each member of the McCarty Lab and the Fu Lab for their invaluable input, assistance, and ideas on various research problems. Special thanks goes to Dr. Marcela Cataldi and Chelsea Bolyard who were always there to answer questions and discuss my project. Also special thanks to Kimberly Zaraspe who has helped me tremendously with tedious technical diﬃculties in the lab. These are the people who made the experience in the McCarty lab worthwhile. I want to thank Dave Dunaway for his help and technical support in ﬂow cytometry. I thank

Dr. David Bisaro, the Director of Molecular, Cellular and Developmental Biology

vi (MCDB) graduate program, for believing in my potential as a graduate student and giving me the courage to continue on and ﬁnish with a doctorate.

Lastly, a big thank you to my beautiful family. Especially to my parents, Said and Etidal Odeh for giving me a great head-start in life, stressing the importance of education and hard work, and for believing that I have the potential to make it great in this world. I thank each of my siblings; Faleh Odeh, Marwa Odeh, Marwan

Odeh, Senan Odeh and Ahmad Odeh. Though they never really understood what my research was about (this thesis should give them a clue!!), they recognized the hard work that was put in, always encouraged me to keep going and cheered me up when things became diﬃcult. I’m grateful for my family’s endless love and support for me; I could not have made it without them.

vii VITA

2002 - 2004 ...... A.S. in Biology, Cincinnati State

2004 - 2006 ...... B.S. in Biology, University of Cincinnati

2007 - Present ...... Graduate Research Associate, The Ohio State University MCDB Graduate Pro- gram

April 2011 ...... Poster Presentation, “Eﬀects of DNA Dou- ble Stranded Break Inducing Agent, Camp- tothecin, on rAAV Vector Integration in vivo”, OSU Molecular Life Sciences Inter- disciplinary Graduate Programs Annual Symposium, Columbus, OH

FIELDS OF STUDY

Major Field: Molecular, Cellular and Developmental Biology

Specialization: Gene Therapy and AAV Vector Biology

viii TABLE OF CONTENTS

Abstract ...... ii

Dedication ...... iv

Acknowledgments ...... vi

Vita...... viii

List of Figures ...... xi

List of Tables ...... xii

CHAPTER PAGE

1 Introduction/Background ...... 1

1.1 AAV Virion Genome Structure ...... 1 1.2 AAV Life Cycle ...... 5 1.3 Recombinant Adeno-Associated Virus (rAAV) ...... 8 1.4 rAAV and Gene Therapy ...... 9 1.5 rAAV Transgene Expression ...... 13 1.6 Self-Complementary Adeno-Associated Virus (scAAV) ...... 15 1.7 rAAV vector persistence in the host cell ...... 17 1.8 rAAV vector integration ...... 20 1.8.1 wt AAV ...... 20 1.8.2 rAAV ...... 23

2 Motivation and Thesis Goals ...... 26

3 Materials and Methods ...... 30

3.1 Maintenance of cells ...... 30 3.2 Plasmid construct ...... 30 3.3 Viral vector production and puriﬁcation ...... 31 3.4 Dose response of HFL-1 cells to camptothecin (CPT) and hydrogen

peroxide (H2O2)...... 33

ix 3.5 Viral infection and drug treatment for in vitro analysis of rAAV integration ...... 34

3.5.1 H2O2 experiment ...... 34 3.5.2 CPT experiment ...... 35 3.5.3 Quantifying integration by flow cytometry ...... 36 3.6 Mice ...... 37 3.7 Treatment, Infection and Tissue Collection for in vivo analysis of CPT effect on viral integration ...... 37 3.7.1 Statistical Analysis ...... 37 3.8 Infection and Tissue Collection for in vivo long-term integration analysis ...... 38 3.9 DNA isolation and gel purification assay ...... 38

4 Results ...... 41

4.1 A novel detection assay to measure integrated rAAV viral vector . 41 4.2 The eﬀect of DNA damaging agents on rAAV viral vector integration in vitro ...... 44 4.2.1 Dose Response Experiment ...... 44

4.2.2 H2O2 treatment of transduced HFL-1 cells to determine effects of rAAV integration ...... 50 4.2.3 CPT treatments of transduced HFL-1 cells to determine eﬀects of rAAV integration ...... 53 4.3 Eﬀects of DNA DSB inducing agent, camptothecin (CPT), on rAAV vector integration in vivo ...... 57 4.4 Long-term in vivo study of rAAV vectors integration frequency and longevity ...... 62

5 Discussion ...... 68

6 Future Directions ...... 75

Bibliography ...... 76

x LIST OF FIGURES

FIGURE PAGE

1.1 Secondary structure of the AAV-2 ITR ...... 3

1.3 Biology of wild-type and recombinant adeno-associated virus . . . . . 10

1.4 Adeno-associated virus (AAV) replication cycle and formation of dimeric inverted repeat (scAAV) genomes ...... 16

1.5 Elements required for site-speciﬁc integration of AAV ...... 22

3.1 Depiction of the GFP transgene carried by the viral vector ...... 31

3.2 Depiction of the gel puriﬁcation assay ...... 39

4.1 Successful separation of integrated viral vector DNA from monomer episomal DNA (LMW) and concatemerized episomal DNA (HMW) using the gel puriﬁcation assay ...... 42 µ 4.2 Dose response curve showing the HFL-1 cell survival at 500 m H2O2 andbelow...... 47

4.3 Dose response curve showing the maximum HFL-1 cell survival at 50 pm CPT and below ...... 49 4.4 Eﬀect of DNA damaging agents on the eﬃciency of rAAV vector integration in vitro ...... 54

4.5 Viral Vector Copies Present in Mouse Hepatocytes after Hirt-Extraction and Gel Puriﬁcation ...... 60

4.6 Comparison of integration events between untreated and CPT treated mice ...... 61

4.7 Long-term study of integrated vector presence in the mouse liver . . 64

4.8 Integrated vector presence in mouse liver: averaged mouse data . . . 65

xi LIST OF TABLES

TABLE PAGE

3.1 Summary of rAAV vector batches used in the study ...... 33

3.2 Experimental Scheme ...... 35

xii CHAPTER 1

INTRODUCTION/BACKGROUND

1.1 AAV Virion Genome Structure

Adeno-associated virus (AAV) is one of the smallest viruses with a non-enveloped icosahedral capsid of approximately 22 nm; it belongs to the parvoviridae family. The human AAV was discovered in 1965 as a contaminant of adenovirus (Ad) preparations.

A co-infecting helper virus is usually required for a productive AAV infection [37].

Since AAV is defective for replication on its own and depends on a helper virus to complete its life cycle, it is classiﬁed under the genus dependovirus.

AAVs are small viruses with limited coding capacity and are therefore highly re- liant on the cellular environment and machinery. Like all parvoviruses, the AAV genome consists of a single-stranded (ss) DNA molecule of 4.7kb in length. The plus e and minus strands are packaged with equal eﬃciency into separate preformed particles [125]. At either end of the genome are inverted terminal repeats (ITRs), a unique component of the AAV genome (Figure 1.1). Each ITR is palindromic, containing

CG-rich regions, and is 145 base pairs in length. ITRs form T-shaped, base-paired hairpin structures and contain cis-elements required for replication, packaging and integration [125]. More speciﬁcally AAV ITRs serve as replication origins, the encap- sidation signal, integration into the host chromosome, and priming sites for conversion

1 of ss vector genomic DNA to double-stranded (ds) DNA templates; allowing gene expression. Critical to the replication process are the Rep binding element (RBE) and a terminal resolution site (trs) located within the ITR. Viral regulatory protein, Rep, binds to the RBE and nicks at the trs to process dsAAV genome intermediates [20].

The AAV genome is composed of two major open-reading frames (ORF) encoding

Rep (replication) and Cap (capsid) proteins [111] (Figure 1.2). The Rep genes (left

ORF) encode four nonstructural proteins required for replication (Rep 78, Rep 68,

Rep 52, and Rep 40); the cap genes encode for three structural proteins that make up the capsid (VP1, VP2 and VP3). There are three viral promoters: p5, p19 and p40

[125, 56]. The larger Rep proteins (Rep 78 and Rep 68) are produced from transcripts using the p5 promoter, whereas the smaller Rep proteins (Rep 52 and Rep 40) are produced from the p19 promoter. Rep 78 and Rep 68 are produced from unspliced and spliced transcripts, and are important regulatory proteins that act in trans in all phases of the AAV life cycle. Specifically, they positively and negatively regulate AAV gene expression in the presence or absence of helper virus. They also play a role in viral DNA replication and site-specific integration into human chromosome 19. The larger Rep proteins possess strand- and site-specific endonuclease activity (nicking at the trs) and site-specific DNA binding activity (binding at the RBE) [20, 84]. Rep

52 and Rep 40 are produced from unspliced and spliced transcripts, and are involved in the accumulation of ss viral DNA as well as packaging into the preformed viral capsid within the nucleus [51, 12, 20].

The right ORF contains the Cap genes, which produces the viral capsid proteins

VP1, VP2 and VP3 using the p40 promoter. Through alternative mRNA splicing of the p40 transcript and translation initiation, these three viral proteins are produced. The unspliced transcript produces VP1 (87 kDa), the biggest of the capsid proteins. The spliced transcript produces VP2 (72 kDa) and VP3 (62 kDa). VP2 is

2 Figure 1.1: Secondary structure of the AAV-2 ITR. The AAV-2 ITR serves as origin of replication and is composed of two arm palindromes (B-B0 and C-C0) embedded in a large stem palindrome (A-A0). The D sequence, essential for AAV replication and packaging, is present only once at each end of the genome thus remaining single-stranded. AAV Rep78 and Rep68 proteins bind to the RBE. The

ATP-dependent DNA helicase activities of Rep78 and Rep68 remodel the A-A0 region generating a stem-loop that locates at the summit the terminal resolution site (trs) in a single-stranded form. Then the strand- and site-speciﬁc endonuclease catalytic domain of Rep78 and Rep68 introduces a nick at the trs. RBEs (RBE, GAGCGAGC-

GAGCGCGC; RBE0, CTTG) and the trs (GTTGG) are depicted here [37, 20].

3 Figure 1.2: M ap of the wild-type AAV-2 genomeMap of the wild-type AAV-2 genome. Rep and Cap ORFs are ﬂanked by ITRs. The diﬀerent Rep and Cap transcripts are produced from their respective promoters (p5, p19, and p40) through alternative splicing of the mRNA transcripts derived from each promoter [54]. The star indicates the alternative ACG codon used to produce VP3 [20].

4 produced using a nonconventional ACG start codon, whereas VP3 is produced using a downstream conventional AUG start codon [7, 20]. The AAV capsid comprises

60 viral capsid proteins arranged into an icosahedral structure and VP1, VP2 and

VP3 are present in a 1:1:10 molar ratio. VP3 is the most abundant subunit and its core consists of conserved β-barrel motifs that determine receptor usage and serology.

VP3 is critical in receptor recognition, which deﬁnes the tropism of AAV [125]. The

N-terminus of VP1 has a conserved phospholipase A2 sequence that has been implicated in virus escape from endosomes and is crucial for infectivity [36, 133]. The VP2 protein was shown not to be essential for assembly or infection [121].

Most of what we know of the AAV virus has been discovered from the most extensively studied serotype, AAV serotype 2. AAV2 was the ﬁrst AAV serotype to be cloned into bacterial plasmids after its discovery as a contaminant in an Adenovirus type 12 stock [43, 94]. Since the discovery of AAV2, eleven other serotypes have been discovered and cloned for the purpose of developing gene therapy vectors. Brieﬂy, they include AAV serotypes 2, 3, 5, and 6 discovered from human cells, while AAV serotypes 1, 4, and 7-11 have nonhuman primate origins [33, 32, 125, 99].

1.2 AAV Life Cycle

There are two stages of the wt AAV life cycle after it enters the cell nucleus, a lytic stage and a latent stage. As a dependovirus, AAV requires cellular factors and helper virus to enter the lytic stage. During this period, AAV undergoes productive infection characterized by a) genome replication b) viral gene expression and c) virion production [20]. Helper viruses that aid in the AAV’s lytic cycle include Adenovirus

(Ad), Herpes Simplex Virus (HSV), Vaccinia virus [98, 4, 34] and more recently discovered human papillomavirus (HPV) [83, 119].

One of the most extensively studied helper virus is Ad. The genes from Ad that

5 provide helper functions for AAV have been deﬁned as E1a, E1b55K, E2a and E4orf6; together with the viral associated RNA (VAI RNA). The E1a gene product relieves the repression for the AAV p5 promoter [105]. Chang et al. demonstrated that

AAV2 p5 promoter stayed repressed in the absence of Ad and that speciﬁcally the

E1a proteins relieved this repression and activated the promoter [11]. The E2a gene product is a ss DNA binding protein (DBP) that is found at AAV replication centers

[122] and stimulates processivity of AAV replication in vitro [120]. The Ad early protein, E2a can also activate transcription from the p5 promoter, like E1a. It has post-transcriptional eﬀects on AAV2 RNAs, such as enhancement of translation [49].

The E1b55K and E4orf6 proteins work together to promote AAV replication and second-strand synthesis [95]. The E1b55K/E4orf6 proteins function as an ubiquitin ligase, and targets of degradation include DNA repair proteins which limit rAAV transduction [102]. This protein duo has also been suggested to play a role in the transport and/or accumulation of AAV RNAs in the cytoplasm [95].

Essentially, the functions of Ad helper proteins are to enhance production of AAV proteins and to alter the cellular environment to promote AAV replication. In the context of Ad helper virus, it has been shown that cellular DNA polymerase performs

AAV replication. AAV replication takes place at discrete sites within the nucleus.

Some of the host cell proteins involved in AAV DNA replication include: DNA polymerase δ, proliferating cell nuclear antigen (PCNA), replication factor C (RFC), and the minichromosome maintenance complex (MCM). Ampliﬁcation of AAV DNA can be reconstituted in vitro with puriﬁed Rep proteins and the above named cellular enzymes [120, 113].

In the absence of helper virus, AAV enters into the latent stage. During this period

AAV undergoes a) limited AAV replication b) viral gene expression is repressed, and c) the AAV genome establishes latency by integrating into a 4-kb region on human

6 chromosome 19 (q13.4), termed the AAVS1 locus [50, 52]. Recently two additional integration loci termed AAVS2 present on chromosome 5 and AAVS3 located on chromosome 3, have been discovered [44]. This site-speciﬁc integration event is mediated by AAV Rep protein and recombination between the viral ITRs and the host genome

[53]. The AAV genome can stay in its latent state for years, until a subsequent infection with a helper virus will initiate the lytic stage of the virus. Integration of AAV into the host chromosome is a very important phenomena for this study and will be explained in more detail later on.

The AAV lytic life cycle requires several steps from entrance into the cell to the construction of new infectious viral particles. Those include:

1. Binding (Cell Attachment)

2. Entry (Endocytosis)

3. Viral Traﬃcking (Endosomal traﬃcking and escape from the late endosome)

4. Translocation to the nucleus (Nuclear Entry)

5. Uncoating

6. Second-Strand Synthesis (formation of ds DNA from the ss AAV genome)

7. Rep and Cap gene expression

8. AAV genome replication

9. AAV capsid assembly and AAV genome packaging

10. Exit from the cell

Some of these steps will be explained in more detail in section 1.5 “rAAV Trans- gene Expression”. 7 1.3 Recombinant Adeno-Associated Virus (rAAV)

80% of the human population are seropositive for the most common subtype, AAV2, and as of yet no known pathology is associated with this virus. The defective replication, non-pathogenic nature and its persistence of wt AAV encouraged the rapid development of recombinant AAV (rAAV) derived from AAV2 [116]. As mentioned previously the ITRs are the only cis-acting elements required for replication, packaging and integration of AAV. Therefore, rAAV vectors were generated in which the rep and cap ORFs are replaced with a promoter and a gene-expression cassette of interest. This allows a packaging capacity around the size of the AAV genome (4.1-4.9 kb)

[23, 54]. For vector production the rep and cap gene products as well as helper-virus elements are supplied in trans (Figure 1.3).

The most commonly used protocol for the production of rAAV vectors involves transient transfection. Xiao et al. introduced a triple transfection method over ten years ago, which is still used to this day [130]. The triple-transfection method involves the co-transfection of cells (293 HEK cells) with a helper plasmid containing the wild-type (wt) AAV rep and cap genes, the vector DNA plasmid (transgene of interest); and an Ad helper plasmid containing helper elements necessary for rAAV production (i.e. Ad E1, E2 and E4orf6). Xiao et al. developed the Ad helper plasmid such that it lacked the genes necessary for Ad virion production and the ability to produce Ad structural proteins. This way, contaminations of Ad proteins or wt AAV from earlier methods was diminished. The virions can be puriﬁed and concentrated from the cellular lysate by density gradient centrifugation, ion exchange or aﬃnity chromatography [19, 107]. For large-scale production, when using column chromatography, one disadvantage is not being able to distinguish between virions that contain viral genomes from those that do not (empty capsids) as density gradient centrifugation allows. Several serotypes for example, AAV2 and AAV6, have the

8 capacity to bind heparan with a relatively high aﬃnity thus allowing puriﬁcation by heparan chromatography [38].

1.4 rAAV and Gene Therapy

There are several properties that make rAAV an attractive viral vector for gene therapy. These include ability to attach and enter the target cell, successful translocation to the nucleus, ability to express the therapeutic gene for a sustained period of time, general lack of toxicity and pathogenicity; and ﬁnally the incapability to replicate itself [20]. Additionally rAAV can infect both dividing and non-dividing cells [2] and has a wide range of tropism; transducing muscle, brain, liver and retina [16, 129, 106].

Data on safe and long lasting rAAV-mediated transgene expression in organs of animal models of human disease such as lung, liver, central nervous system (CNS) and eye have been shown [37]. More speciﬁcally rAAV transgene-expression longer than

1.5 years has been shown in dogs, mice, rabbits, hamsters and nonhuman primates

[18, 3, 63, 70].

rAAV is a popular viral vector system in clinical trials. A comprehensive source of information on worldwide gene therapy clinical trials is available at The Journal of

Gene Medicine Clinical Trial site1. A great majority of past and current clinical trials utilize AAV vectors based on serotype 2. These applications focus on the treatment of monogenic disorders such as Duchenne muscular dystrophy (DMD), hemophilia B and cystic ﬁbrosis [9]. Of course for the expression of a therapeutic protein using rAAV, there is the requirement of ﬂanking ITR’s, a promoter, a transgene and a polyadenylation signal (Figure 1.3).

rAAV gene therapy is used in Duchenne muscular dystrophy (DMD), which is

1http://www.wiley.co.uk/genmed/clinical

9 Figure 1.3: Biology of wild-type and recombinant adeno-associated virus. a) AAV integrates into the human genome at a speciﬁc locus on chromosome 19 (red) and persists in a latent form. It can exit this stage only if the cell is co- or super-infected with helper virus such as adenovirus (Ad) or herpes simplex virus (HSV), which provide factors necessary for active AAV replication. b) The generic gene-delivery vector based on AAV is depicted. The viral genome is replaced by an expression cassette, which usually consists of a promoter, transgene and a signal for polyA (pA) tail production. For production of the recombinant virus (rAAV), Rep and Cap proteins as well as Ad or HSV elements (Ad E1, E2 and E4orf6) have to be provided in trans. Examples of intracellular forms of the delivery vector that are responsible for transgene expression following transduction with rAAV (double-stranded circular episomes and randomly integrated vector genomes) are depicted in red [116].

10 a lethal genetic muscular disorder caused by recessive mutations in the dystrophin gene. Progressive myopathy of skeletal and cardiac muscle along with premature death due to a lack of expression of the dystrophin protein in muscle tissue ensues.

Transfer of the dystrophin gene into the myofibers of DMD patients will ideally mitigate this disease [82] and the success of DMD gene therapy depends upon efficient functional restoration of both skeletal and cardiac muscle pathology [5]. rAAV vectors support stable, long-term gene expression following infection of muscle cells, where they remain as episomes [87]. Serotypes that have demonstrated a particular tropism for the musculature include AAV1, 5, 6 and 8 [103, 135, 82]. These AAV serotypes had a transduction efficiency of up to 500 times greater than that of AAV2 [32, 8].

Long-term transgene expression of rAAV has been observed for over 5 years in dogs and rhesus macaques, and for 2 years in mice [29, 109, 129]. Very recently the ﬁrst clinical trial using chimeric AAV capsid variant was performed by Bowles et al.. rAAV genomes (containing the minidystrophin transgene) was detected in all DMD patients. Additionally there was no cellular immune response to the chimeric AAV capsid variant, AAV2.5. This trial established that rAAV vector (AAV2.5) was safe and well tolerated [10].

Another illness where this type of methodology has been used is Hemophilia B.

Hemophilia B is an X-linked bleeding disorder that results from a defect in the gene encoding coagulation factor IX (FIX). FIX is a serine protease critical for blood clotting and patients with severe hemophilia B have less than 1% normal values of functional FIX levels. Patients undergo frequent bleeding episodes which are associated to arthropathy (disease of the joints) and early death. Therefore somatic gene therapy with continuous endogenous FIX production from a single administration of vector oﬀers the potential for a cure. At present, gene transfer mediated by AAV vector shows long-term correction of hemophilia B in preclinical trials [79, 41, 80].

11 Davidoﬀ et al. infused a single dose of a serotype-8-pseudotyped, self complementary

AAV vector expressing a codon-optimized human factor IX transgene (scAAV2/8-

LP1-hFIXco) into six patients with severe hemophilia B. AAV-mediated expression of FIX at 2-11% of normal levels was observed in all participants, which were suﬃcient levels to improve the bleeding phenotype [81]. Furthermore none of the participants had an immunologic response to the FIX transgene product. This study showed that sustained therapeutic expression of a transferred factor IX gene via rAAV can be achieved in humans. This gene-therapy approach has the potential to convert the severe bleeding phenotype into a mild form of the disease or to reverse it entirely.

One of the ﬁrst patients to receive rAAV gene therapy were cystic ﬁbrosis patients.

Cystic fibrosis is the most common autosomal recessive disorder among Caucasians, in which the CF transmembrane regulator (CFTR) is inactivated by mutation. CFTR is a component of the Cl- channel and the lack of functional CFTR affects the transmembrane electrical potential. This leads to the accumulation of thick secretions in the lung coupled with a loss of the normal respiratory epithelial ciliary activity. The primary difficulty is pulmonary, with an increased incidence of pulmonary infection

[20]. Chronic inﬂammation results in lung tissue damage and loss of respiratory function, leading to early death [37]. New Zealand white rabbits [31] and rhesus monkeys

[17] constituted major preclinical models for rAAV-mediated CFTR cDNA transfer.

Again more than a decade ago, cystic ﬁbrosis patients were the ﬁrst human individuals subjected to rAAV administration [30]. After various modes of administration (i.e. direct bronchoscopic instillation and aerosol delivery) AAV2- based vector delivery lead to prolonged and dose-dependent CFTR cDNA expression in the respiratory tract.

Importantly, no overt signs of vector-associated inﬂammation or toxicity was observed in these studies. Initial clinical results showed rAAV2-mediated CFTR delivery to be well tolerated by human patients. Vector sequences persisted for up to 90 days at the

12 highest dose from phase I dose-escalation studies using aerosolized method of vector delivery throughout the whole lung [1]. A follow up placebo-controlled phase II study incorporated repeated administration of aerosolized vector particles. The treatment was well tolerated and at days 30 and 14, vector-treated patients showed evidence of improved lung function and reduced IL-8 (proinﬂammatory cytokine) concentrations when compared to placebo-treated individuals [71]. Thus 13 protocols have been approved for phase I and phase II clinical trials using rAAV vector. An important observation in early trials was the lack of measurable toxicity and a very modest immune response evoked by the route of pulmonary delivery [20]. Such promising results encourage new and expanded phase II clinical trials currently underway [37].

The development of immune responses to the AAV2 capsid likely hampers effective repeated delivery [72]. Thus one research effort is directed to modulating or avoiding these immune responses and another is focused on strategies for increasing the efficiency of gene delivery. Subsequent clinical trial programs have generally addressed this by targeting cells and tissues for which rAAV2 has a greater efficiency of gene transfer or most recently by switching to alternative serotypes that are intrinsically more efficient for gene transfer.

1.5 rAAV Transgene Expression

Before rAAV can successfully express a therapeutic transgene in the cell it has to go through a few steps. rAAV2 will be used as an example to brieﬂy explain the

AAV life cycle. AAV2 gains entry into target cells by using the cellular receptor heparan sulfate proteoglycan [114]. Co-receptors such as αvβ5 integrins, ﬁbroblast growth factor receptor 1, hepatocyte growth factor receptor, and laminin receptor enhance internalization [20]. Secondly AAV is endocytosed into a dynamin-dependent clathrin-coated vesicle [27]. Thirdly AAV particles escape these endocytic vesicles

13 when the endosome itself acidiﬁes (late endosome), releasing the virus [6]. AAV particles are believed to accumulate in a perinuclear compartment prior to having the

AAV genome enter the nucleus [39, 128, 96]. In the fourth step the virus must uncoat, whether this happens prior to nuclear entry or after is still a matter of discussion.

Theoretically AAV is small enough to enter the nucleus via the nuclear pore complex, and ﬂuorescent-labeled rAAV virions were detected in the nucleus [6, 96, 104]. There- fore it has been suggested that rAAV enters the nucleus prior to uncoating. On the other hand viral uncoating has been proposed to occur before or during nuclear entry

[128]. The ﬁfth step involves transcription of the viral genome. The single-stranded genome of AAV must be converted into double-stranded template for transcription of the transgene. The conventional replication scheme of AAV requires de novo synthesis of the complementary DNA strand by host DNA polymerase δ, where the AAV

ITR serves as the initiation point of synthesis. However there is a diﬀerent pathway to transgene expression which does not involve DNA synthesis. AAV is diﬀerent from the autonomous parvoviridae in that it can package either the plus or minus DNA strand, while the autonomous parvoirus can only package one strand. Thus the complementary base pairing of two complementary strands coming from two infecting viruses does not require DNA synthesis [76].

The transduction efficiency of rAAV is dependent upon the cumulative efficiency of each step described. A number of rate-limiting steps have been identified in the transduction process [22, 112], these obstacles include cytoplasmic trafficking to the nucleus, the rate of uncoating, vector genome instability and conversion of the single- stranded DNA vector genome into a transcriptionally competent double-stranded

DNA molecule [125].

14 1.6 Self-Complementary Adeno-Associated Virus (scAAV)

A particular rAAV that has been designed to bypass the limiting aspects of second- strand synthesis is the self-complementary AAV (scAAV) [60]. Any rAAV genome that reaches the nucleus will still require the synthesis, or recruitment, of a complementary strand in order to achieve gene expression. There is also a transient period of vector genome instability after dsDNA conversion that leads to a signiﬁcant loss of gene expression [61]. Thus the rationale underlying the scAAV vector is to shorten the lag time before transgene expression and potentially to increase the biological eﬃciency of the vector [20]. The scAAV vectors can be made by reducing the construct size to approximately 2.5 kb, equivalent to half the size of the regular rAAV genome ( 5 kb) [125]. This can be achieved by taking advantage of the tendency to e produce dimeric inverted repeat genomes during the AAV replication cycle (Figure

1.4). If these dimers are small enough, they can be packaged in the same manner as conventional AAV genomes, and the two halves of the ssDNA molecule can fold and base pair to form a dsDNA molecule of half length. In other words scAAV vectors can fold upon themselves, immediately forming transcriptionally competent dsDNA.

More speciﬁcally the production of scAAV vectors can be promoted by deleting a minor portion (28-145 nt) of one of the ITR sequences so that this partially deleted

ITR (δ ITR) no longer serves as a replication origin, but retains the secondary structure of a wtAAV ITR hairpin (HP) structure [60, 59]. Rolling HP replication from the remaining wt ITR creates single-stranded, dimeric inverted repeat genomes, with the δ ITR sequence situated in the middle of the DNA and a wt ITR at both ends.

When the DNA is folded into a double-stranded molecule, a closed HP end is formed from the mutated ITR, and an open end from the two wt ITRs [61] mimicking a conventional rAAV vector genome (Figure 1.3).

These scAAV vectors have a limited capacity for transgene load (up to 3.3 kb of

15 Figure 1.4: Adeno-associated virus (AAV) replication cycle and formation of dimeric inverted repeat (scAAV) genomes. Single-stranded virion DNA enters the host-cell nucleus and the 30-inverted terminal repeat (ITR) acts as a primer for host DNA polymerase. (1) The 30-ITR primer is elongated, displacing and replicating the ITR at the 50 end. (2) The duplex ITR is re- folded into a double-hairpin conﬁguration by host or viral DNA helicase, forming a new primer for DNA synthesis. (3) While the 30-ITR is elongated and the complementary strand displaced, AAV Rep protein recognizes and binds to the ITR at the downstream end. (4) To generate complete monomeric genomes, Rep endonuclease nicks the terminal resolution site (trs) of the downstream ITR, initiating a second DNA replication complex, to copy the ITR before being reached by the complex initiated at the other end. (5m) The original replication complex displaces the daughter strand, including the newly synthesized ITR, and completes replication to the end of the genome, recreating the template for isomerization in step 3. (6m) The displaced single-stranded genome is packaged into the AAV capsid. (7m) Dimeric genomes are generated when Rep fails to nick the trs before being reached by the replication complex from the other end. (5d) Replication continues through the ITR, and the displaced strand, to generate a dimeric dsDNA template (6d) which can initiate a new round of DNA synthesis either by isomerizing the open end (as in step 4) or by terminal resolution of the hairpin end. (7d) Isomerization allows priming of DNA synthesis from the resolved end (8d), and replication of the dimeric template displaces a single-strand dimeric inverted repeat genome (9d), which can then be packaged into the AAV virion (10 d). dsDNA; double-stranded DNA; ssDNA, single-stranded DNA [61].

16 DNA can be encapsidated) [127, 20] of an already small viral vector, but in return oﬀer a substantial premium in the eﬃciency and speed of onset of transgene expression.

Since dsDNA conversion rate is no longer dependent on host-cell DNA synthesis nor vector concentration for plus and minus complementary strand annealing. We have used the scAAV vectors extensively in this study, because of the advantage of eliminating the confounding eﬀects of conventional ssAAV reliance on host cell factors for second-strand synthesis.

1.7 rAAV vector persistence in the host cell

The persistence of the vector genomes in the host cell is highly important for successful use of rAAV in gene therapy. In the presence of viral Rep proteins, AAV is able to integrate its ITR flanked genome (or an ITR flanked transgene cassette) site- specifically into the host genome [9], however the rAAV Rep proteins are absent from the rAAV vector [54]. Nevertheless, transgene expression mediated by rAAV vectors can persist for months and up to several years in vivo (from 3.7 up to 6 years in humans and monkeys) [54, 31, 40, 88]. Recent studies have shown that ds episomal circular genomes are present in the form of ds circular monomers (LMW) and HMW concatemers, and are primarily responsible for stable rAAV transduction in the liver and muscle [54, 26, 58, 76, 78]. The episomes can be converted into multimeric HMW concatemers (as tandem repeats in a head-to-tail configuration) and can provide long-term transgene expression, particularly in non-dividing cells [21].

Nakai et al. in 2001 suggested that rAAV genomes most likely persist in non-dividing cells in vivo as episomal rAAV genomes and also as integrated concatemers albeit at a lower frequency [54]. Most rAAV transgene expression results from extrachromosomal viral genomes that persist as double-stranded circular or linear episomes [116] and integrated forms of the vector [57]. The persistence of wt AAV in humans and rAAV

17 in animals as episomal circles [100, 13, 101] is useful in gene therapy settings in which post-mitotic quiescent tissues are pursued. But suﬃcient episomal expression levels would not be sustained in rapidly dividing cells. Indeed in one mouse study, approximately 90% of the rAAV episomes were lost soon after hepatocyte proliferation induced by partial hepatectomy [116, 78].

Once released into the nucleus, the free DNA ends of rAAV genomes become targets for DNA recombination and repair pathways, leading to circularization or concatemerization and, infrequently, chromosomal DNA integration. More speciﬁ- cally duplex rAAV genomes convert to circular forms or linear concatemers through intra- or intermolecular recombination at the ITR’s [76, 132].

While the correlation between the long-term persistence of rAAV genomes and their conversion to circular and concatemeric forms has been noted in numerous studies [28, 118, 76, 78, 108, 110], it is not clear that the linear rAAV genome is inherently subject to loss of gene expression through DNA degradation or by other mechanisms. The linear form of the genome represents a transient episomal phase in normal cells due to the recombinogenic activity of the free DNA ends. It is not known whether a rAAV genome that has been converted to a circle, remains as a circle, or possibly converts to concatemers, or becomes integrated. Circular plasmid carrying an AAV ITR sequence gets linearized after transfection in a process that is dependent on host factors and also gets randomly integrated into the host genome

[131].

The free ends of rAAV genomes resemble a complex DSB. The two mechanisms known to attempt to repair a complete break in DNA in the cell, namely the Homol- ogous Recombination (HR) pathway and the Non-homologous End Joining (NHEJ) pathway, have been of great importance to the study of AAV ITR recombination.

Brieﬂy, HR is an error-free repair mechanism, where the transgene recombines with

18 its natural locus in the host genome, thereby ensuring correct transcription. In other words the transgene reacts with its specific host genomic target by DNA recombination between homologous sequences that are present on the vector and the target gene [116]. However, differentiated cells in higher vertebrates rarely use HR repair due to its inefficiency, but more importantly there is no sister chromatid available to be used as a template for repair in non-dividing cells. In a mammalian cell, instead of undergoing the complex task of finding the homologous chromosome sequence, vector DNA often enters into NHEJ repair pathway [116]. In contrast to HR, NHEJ is an error prone mechanism. In NHEJ, DNA breaks with little or no homology are repaired by a ’cut-and-paste’ type of process, regardless of sequence [116]. Zentilin,

Marcello et al. in 2001 have suggested that both DNA repair pathways, NHEJ and

HR, may be involved in processing the vector genome [134]. Additionally Choi et al. suggested that NHEJ pathway carries out circularization in mouse muscle cells, while HR pathways can perform this function in dividing cells in the absence of NHEJ factors [14].

In quick summary, in the nucleus, DNA repair pathway target the free DNA ends of rAAV genomes. The interaction mediates intramolecular and intermolecular recombination between the ends, leading to circularization and concatemerization of the episomal genomes in a head-to-tail fashion. Also, with less frequency, the interaction with DNA repair pathways mediates recombination between the vector ends and preexisting chromosomal DNA DSBs [67], leading to integration (Figure

1.3). While the role of the highly structured HP ITR in viral replication and AAV

Rep-mediated site-speciﬁc integration is well understood, their role in rAAV vector recombination and integration is not clear [74, 75].

19 1.8 rAAV vector integration

1.8.1 wt AAV

As mentioned earlier, the AAV genome is a ss linear DNA molecule with ITRs at both ends that are important for replication, packaging and of great signiﬁcance to this study; integration. In the rAAV vectors ITRs are the only cis-regulatory viral elements that become integrated into the host genome during transduction.

An interesting feature of wt AAV is that the genome can integrate in a site- speciﬁc manner, since the AAV Rep protein is required for site-speciﬁc integration of the vector. AAV wt has been known to integrate into the AAVS1 site (human chromosome 19q13.42), and more recently into AAVS2 (chromosome 5p13.3) and

AAVS3 (chromosome 3p24.3) sites [44]. Approximately 0.1% of infecting wt AAV genomes integrate at AAVS1 [62, 21]. However, as most rAAV vectors currently in use are deleted of viral genes (no Rep expression), they do not integrate in a targeted fashion. Therefore risks of insertional mutagenesis remain a concern. So in the absence of Rep (i.e. in the case of rAAV vectors), AAV integration occurs by a cellular recombination pathway without any speciﬁcity.

The proviral structures of wt rAAV integrants are similar. They are typically arranged in head-to-tail concatemers, with microsequence homology at the viral- cellular junctions and possess variable deletions and rearrangements of the ITR and chromosome sequences [93]. The two elements within the AAV genome that are required for targeted integration are the Rep proteins and the ITR. The AAVS1 site contains an active Rep binding element (RBE) and a terminal resolution site (trs) resembling that of the AAV ITR (Figure 1.5). So when supplied in trans, Rep can target integration into AAVS1 by binding to a speciﬁc RBE within the AAVS1 DNA

[123]. The Rep proteins form a bridge between viral ITR and the binding site in

20 AAVS1, suggesting that tethering through specific DNA binding sites plays a crucial role [123]. In addition there is a trs motif that can be nicked by the endonuclease activity of Rep (Figure 1.5). A spacer sequence between the RBE and trs has been shown to be essential for site-specific recombination [65]. The Rep proteins, probably as a multimeric complex, facilitate targeted integration by tethering the AAV genome to the integration locus followed by a site-specific nick at the AAVS1 trs (Figure 1.5).

Exactly what sequence of events takes place after the nicking step is not entirely clear.

However, the general complexity of the junction sequences, and the rearrangements in both target and viral DNA suggest that the mechanism is not precise and has little in common with cut-and-paste type integration systems such as retrovirus or lambda phage [62].

It has been suggested that integration occurs through a non homologous recombination pathway (NHEJ), since no large regions of homology were found between the AAVS1 and the virus [62]. Partial deletion of sequences within the AAV ITRs, as well as large-scale rearrangements of the host sequences around the integration site, suggested the process was both complex and imprecise. Taken together, the characterization of the AAVS1 site on human chromosome 19 revealed a functional homologue to the replication origin in the AAV terminal repeat (ITR). The presence of this AAV Rep-dependent replication origin (RBE and trs) near the integration site implied that integration was associated with limited DNA replication of cellular sequences. This was consistent with the chromosomal rearrangements, including duplications and inversions, which were present at the host-virus junctions from the latently infected cells [53]. Thus AAV integration is not a simple insertion process, and large segments of target sequence can be deleted [53]. AAV sequences frequently included a head-to-tail viral junction suggesting that multiple copies in a tandem ar- ray had integrated. It has also been suggested that a circular form of the viral genome

21 Figure 1.5: Elements required for site-speciﬁc integration of AAV. The AAV

ITR in the hairpin configuration is shown on top and the relevant sequences of the integration locus AAVS1 on the bottom. The RBE, a tetrameric GAGC motif, and the trs, a CCAACY motif, are boxed. The CTTTG element, also named RBE, contributes to Rep binding affinity to the ITR. The Rep proteins, probably as a multimeric complex, facilitate targeted integration by tethering the AAV genome to the integration locus followed by a site-specific nick at the AAVS1 trs [57].

22 was a precursor to the integrated form, and that some degree of DNA replication of the viral sequence had occurred before or during integration [62].

1.8.2 rAAV

The concept of using AAV as a gene therapy vector was largely built on the idea that it was an integrating virus. Though transgenes can be expressed from either episomal or integrated vector genomes, integration is still a desirable property in that infected cells would pass the transgene to daughter cells and readministration of the vector would be unnecessary. While the advantage of vector integration applies to rapidly dividing cell types; they are not so clear for most tissues in the body, which divide slowly if at all.

rAAV vector integration can occur either through NHEJ or HR recombination pathway [42]. The eﬃciency of Rep-independent rAAV vector integration is within the same range as Rep-mediated integration. Early experiments with rAAV vectors in cell culture had established that integration was relatively ineﬃcient, at approximately

0.1-0.5% of infectious vector genomes [62]. It is not clear if the same eﬃciency is seen in non-dividing or slowly dividing cells of animal tissues. Thus we addressed this question in our study of integration eﬃciency in vivo. Granted that in vivo, rAAV integration does occur at some measurable frequency in dividing cells in the liver, but the exact frequency is unknown [73, 75].

Currently there is a growing body of evidence that supports the hypothesis that rAAV integration is largely a consequence of random interactions between the vector genome and regions of the host chromosome undergoing DNA damage repair; and more speciﬁcally, sites of chromosomal DSB [68, 86, 67]. The possibility that rAAV integrates through the cellular NHEJ DNA repair pathway was further explored by studies where DSB was induced. Miller et al. in 2004 used a retrovirus vector to create

23 a cell line with a unique I-SceI restriction site within a bacterial shuttle construct.

A second retrovirus construct was used to introduce the I-SceI enzyme gene, thereby creating DSB at the speciﬁc I-SceI site. The cells were then infected with an rAAV vector containing a selectable marker, and integration at the induced DSB was assayed in integration-positive cells. 4.2% of the positive clones contained the rAAV at the induced DSB site [67], suggesting that DSB created a target for rAAV integration.

The same authors also examined rAAV integration at DSBs induced by treatment of cells with etoposide or γ-irradiation. Both treatments resulted in an increased frequency of rAAV integration [62]. Together, these results suggested that rAAV integrates into pre-existing chromosomal breaks by NHEJ, and that the aberrations associated with rAAV junctions may be the result of inaccurate repair of previously generated deletions and insertions [62].

Preferred integration sites of AAV vectors include DNA break regions, segmen- tal duplications, satellite DNA, and palindromes. Also 3-8% of integrated vector proviruses were present in the ribosomal DNA repeats which encode ribosomal RNAs

[69, 77]. A preference was also noted for the integration of AAV vectors at CpG is- lands and within 1 kb of transcription start sites [69, 77, 46]. These data suggest that the non-homologous integration of AAV vectors may not be entirely random, and that the preferential integration at certain sites presumably reﬂects speciﬁc mechanisms of integration [21].

On one hand it has been noted that rAAV integrates randomly by interacting with

NHEJ repair pathways, but some researchers have proposed that it can also interact with repair pathways involving HR. This was characterized through studies of rAAV vector-mediated gene repair by HR, where previous reports showed that rAAV could mediate gene correction by HR driven by ﬂanking homologous sequences in the vector genome [62, 47, 48, 92]. Taken together there is a possibility that the rAAV genome

24 integrates into the host chromosome as a passive bystander rather than an initiator of recombination.

25 CHAPTER 2

MOTIVATION AND THESIS GOALS

The role of integration on the biology of AAV is highly relevant to the future use of this virus as a gene delivery tool, whether the focus is on Rep-mediated targeted integration or Rep-independent recombinant AAV (rAAV) vector integration. Most rAAV vectors will not include Rep and will not integrate speciﬁcally, therefore the potential for mutation and oncogenesis due to random integration still remains a concern. Thus the evaluation of the frequency of rAAV vector integration and its propensity for targeting certain regions of the genome is therefore an area of research that is currently pursued.

For the purpose of our research we have developed a detection method that allows for accurate rAAV vector integration frequency at any time point. Previous studies have undertaken the task of not only detecting rAAV vector integration but also measuring it in the following manner. Miao et al. demonstrated evidence of rAAV vector integration into mouse liver through pulse-field gel electrophoresis and fluores- cence in situ hybridization analysis of metaphase hepatocytes [66]. Southern blots of the pulse-field gels suggested that all the HMW vector DNA was associated with chromosomal DNA, supporting the conclusion that they were integrated. However subsequent studies put these results in doubt when a population of extrachromosomal vector DNA was discovered within the transduced hepatocytes [76]. A different way used by Nakai et al. was to identify vector integration sites through plasmid rescue of

26 vector containing bacterial oris [73]. And the ampliﬁcation of these plasmids in bacterial culture allowed for sequencing of the integration junction between vector and host genome. However because of the bacterial selection involved in this method, bias may occur against recovering integrants whose size or sequence may negatively aﬀect bacterial growth. This would result in incomplete mapping of the full spectrum of integrants. Afterward, Schnepp et al. in 2003 used a PCR based assay through interspersed repetitive B1 elements (exist every 15 kb) to investigate rAAV vector integration in mouse muscle [100]. Yet rAAV integration in non-dividing muscle cells was not observed, despite of the assay being sensitive enough to detect 0.05% vector integration. Other PCR based methods included inverse PCR to isolate ori-less integrated AAV vectors [25] and LM-PCR (Ligation-mediated PCR) to clone integrated

AAV vector genomes from tissue [55]. Authors that performed LM-PCR used pyrosequencing to determine genomic insertion sites of AAV vector integrants. Lastly, a current and accepted method of AAV vector integration is a serial passage method in which cells are made to divide until all viral episomes are released and only integrated vector remains to be measured. But this would not allow for viral integration measurements at early time points. Thus the ﬁrst goal of the thesis was to develop a detection method to measure small numbers of putative integrated molecules in excess of unintegrated viral DNA in the form of monomeric or concatemerized episomes.

Despite the overall inefficiency of rAAV integration, there remains a concern for genotoxicity. Preclinical studies have overwhelmingly supported the safety of rAAV treatment in numerous different tissues and animal models. To date, only a small number of studies have suggested genotoxicity associated with rAAV treatment. Don- sante et al. have reported a significant incidence of hepatocellular carcinomas (HCC) and angiosarcomas during the course of a study designed to determine the long-term efficacy of rAAV-mediated gene therapy for mice with the lysosomal storage disease,

27 mucopolysaccharidosis type VII (MPS VII) [24]. Later, the same group isolated

AAV vector-chromosome junctions from liver tumors [25]. The results implicated insertional mutagenesis by AAV vectors which contributed to the development of hepatocellular carcinomas; every isolated junction was present at the same locus in chromosome 12 and the insertion resulted in overexpression of gene adjacent to the

AAV vector provirus. Thus to better evaluate the potential beneﬁt or risk a clearer understanding of AAV integration frequency is needed.

The instances of chromosomal rearrangements at the junctions between vector

DNA and cellular genome suggests that the rAAV genome interacts with previously formed double-strand DNA breaks. Which further suggested a model for rAAV integration based on NHEJ between the hairpin ITR and the broken chromosome ends

[91]. Additionally, earlier it was mentioned that treatment with DNA damaging agents resulted in an increased frequency of rAAV integration. In our study we wanted to further investigate this phenomenon of increased rAAV integration through DSB induction in vitro and more importantly in vivo. This leads us to the second thesis goal where we wished to investigate whether increased frequency of vector integration was apparent in SSB (hydrogen peroxide) or DSB (camptothecin) induced cells in vitro. Also we wished to explore whether rAAV integration would increase in vivo when mice would be treated with a DSB agent, camptothecin (CPT). We wanted to know the exact integration frequency between CPT treated and untreated animals, which hasn’t been done before. So in the third thesis goal we evaluate the frequency of rAAV vector integration in mouse liver and test the hypothesis that inducing DSB

(with CPT) in hepatocytes increases the frequency of rAAV vector integration in vivo.

In the fourth and last goal we wished to conduct a long-term in vivo analysis to determine how soon and how frequent rAAV vector integration occurs. Circular

28 episomes can evolve into HMW concatemers in a time-dependent manner [132], but what about time-dependent integration? Huser et al. developed a rapid and efficient assay for AAVS1 (Chrom. 19)-specific integration based on PCR amplification using primers specific for the AAV and chromosome sequence [45] in HeLa cells. The time course of integration was evaluated in this study and found to plateau at approximately 24-48 hrs post-infection. However a time course evaluation of rAAV random integration in vivo has not been done before, and is of great importance for gene therapeutic applications. We hypothesize that rAAV integration happens soon after infection. But transient linearization of rAAV could contribute to integration into the host chromosome at later time points. And with additional integrations at later time points, comes the increased risk of insertional mutagenesis.

29 CHAPTER 3

MATERIALS AND METHODS

3.1 Maintenance of cells

For viral production, HEK 293 (Human Embryonic Kidney) cells were used. HEK 293 cells were cultured in Dulbecco’s modiﬁed Eagle’s medium (DMEM, GIBCO 11995) supplemented with 10% cosmic calf serum (CCS, HyClone SH 300087.03) and 1%

Penicillin/Streptomycin (Pen/Strep).

For the experiment, HFL-1 cells (primary human lung ﬁbroblast) were grown in

DMEM-F12 supplemented with 10% fetal bovine serum (FBS) and 1% Pen/Strep.

HFL-1 cells are fetal human lung diploid ﬁbroblasts that are not immortalized.

Both cell lines were obtained from ATCC R .

3.2 Plasmid construct

The GFP transgene expression cassette of the rAAV vectors used in all experiments contains a U1a promoter that drives the expression of a green ﬂuorescent protein

(GFP) (Figure 3.1). GFP expression is useful for monitoring transduction eﬃciency in mice; transduction eﬃciency in HFL-1 cells and viral vector integration in passaged HFL-1 cells. Upstream from the GFP, the transgene also contains a LacZ1 fragment, for determining viral vector copy number through quantitative polymerase chain reaction (QPCR), and a homing endonuclease restriction site, I-Ceu1. The

30 Figure 3.1: Depiction of the GFP transgene carried by the viral vector. The

GFP transgene consists of a LacZ1 gene fragment which is utilized to detect viral vector integration via quantitative PCR (QPCR). Downstream from the LacZ1 gene fragment is the homing endonuclease restriction site, I-Ceu1, which is important for the gel puriﬁcation assay. Further down-stream is a U1a promoter that drives the

GFP gene to monitor transduction eﬃciency of cells. The viral vector also harbors the promoters, Sp6 and T7, which are of less importance to the study.

I-Ceu1 restriction site is required for detecting integrated viral vectors in the host genome through the gel puriﬁcation method. The transgene is ﬂanked with inverted terminal repeat sequences (ITRs), one of which contains a mutation (deletion at the trs) to allow for scAAV virus production.

3.3 Viral vector production and puriﬁcation scAAV vectors were produced harboring the GFP transgene for the transduction of

HFL-1 cells and mice. All the scAAV vectors used in the study were produced by a three-plasmid transfection protocol as described elsewhere. scAAV2-GFP virus was produced for the transduction of HFL-1 cells. Brieﬂy, HEK293 cells were tri- transfected with the adenovirus helper plasmid pXX-680, a pACG packaging plasmid

31 expressing the rep and cap genes for AAV serotype-2 (and an additional p5 promoter element downstream of the Cap gene), and the relevant rAAV genome construct, pGFP. scAAV8-GFP virus was produced for the transduction of mice. Brieﬂy

HEK293 cells were also tri-transfected with the adenovirus helper plasmid pXX-680, the relevant rAAV genome construct, pGFP, and instead of the packaging plasmid for AAV2, the packaging plasmid expressing the rep and cap genes for AAV serotype-

8 (pAAV2/8) was used. HEK 293 cells were transfected using calcium phosphate precipitation methods.

scAAV2 viral vectors were purified by iodixanol step gradient and heparan affinity column [136]. Purified virus was collected using a fraction collector and viral concentrations (particles/ml) were calculated for each eluted fraction by dot blot hybridization, using a P32-labeled probe specific for the GFP sequence. Fractions containing more than one fourth of the most concentrated fraction were pooled together and stored at -80◦C. The concentration from this viral preparation was 1.1 × 1012 viral particles/ml (Table 3.1).

scAAV8 viral vectors were puriﬁed by double-cesium chloride ultracentrifugation.

Puriﬁed virus was collected using a fraction collector and viral concentrations (particles/ml) were calculated for each eluted fraction by dot blot hybridization, using

P32-labeled probe speciﬁc for the GFP sequence. The virus was then dialyzed and

ﬁnal viral concentrations were calculated by dot blot hybridization. Typical concentrations from this viral preparation were 1.5 - 5 × 1011 viral particles/ml (Table 3.1).

Fractions containing more than one fourth of the most concentrated fraction were pooled together and the virus was stored at -80◦C.

32 Vector Transgene Dialyzed Titers Experiment

Serotype (particles/ml)

12 scAAV2 Ptrs- No 1.1 × 10 Eﬀect of CPT and H2O2 treat- T7U1aGFPSp6LacZ1 ment of HFL-1 cells in viral

vector integration

scAAV8 Ptrs- Yes 1.5 × 1011 Eﬀect of CPT treatment of

T7U1aGFPSp6LacZ1 mice in viral vector integration

scAAV8 Ptrs- Yes 5 × 1011 Long-term mouse study on vi-

T7U1aGFPSp6LacZ1 ral vector integration

Table 3.1: Summary of rAAV vector batches used in the study

3.4 Dose response of HFL-1 cells to camptothecin (CPT) and

hydrogen peroxide (H2O2)

H2O2 and CPT dosage was characterized on HFL-1 cells by a dose-response experiment to prevent cells from dying at the concentrations used in the experiment. For the H2O2 cell viability investigation, HFL-1 cells were plated in a 96-well plate at a non-dividing state (90-95% conﬂuency) of 2.3 × 104 cells/well. Six hrs post-seeding

(by which time cells would be attached to the bottom of the well) the cells were treated µ µ with 100 m - 4 m of H2O2 (two-fold dilution series). At 18 hrs post-treatment the media was aspirated from the cells and replaced with fresh media, to allow cells to recover from the treatment. 24 hrs after changing the media, cell viability was determined using an MTT assay. The MTT assay is a colorimetric assay that measures the reduction of yellow MTT by mitochondrial succinate dehydrogenase. More speciﬁ- cally MTT enters the cell and passes into the mitochondria where it is reduced to an

33 insoluble, colored (dark purple) formazan product. The cells are solubilised with an organic solvent (isopropanol) and the released, solubilised formazan reagent is measured spectrophotometrically via ELISA. Since reduction of MTT can only occur in metabolically active cells the level of activity is a measure of the viability of the cells.

All dose response experiments were performed in triplicate.

For the CPT cell viability investigation, in one 96-well plate HFL-1 cells were seeded in a dividing state (at 50-60% conﬂuency) of 1.4 × 104 cells/well. In a second

96-well plate HFL-1 cells were seeded in a non-dividing state (at 90-95% conﬂuency) of 2.3 × 104 cells/well. Six hours post-seeding, cells were treated with 200 pm - 12.5 pm CPT (two-fold dilution series). At 18 hrs post-treatment the old media was aspirated and replaced with fresh media, to allow for cell recovery. 48 hours post-media change, an MTT assay was performed to determine cell viability.

3.5 Viral infection and drug treatment for in vitro analysis

of rAAV integration

3.5.1 H2O2 experiment

HFL-1 cells were thawed out at passage 6. They were expanded and split 1:5 for 1 passage before using them in the experiment. On day one HFL-1 cells were seeded at approximately 40% conﬂuency (3 × 105 cells/well) in a 6-well plate (8th passage), these represented the dividing group (Table 3.2). By day three, the non-dividing

(quiescent) group, seeded on day one, were at 100% conﬂuency and the dividing group, seeded on day two, were at approximately 60% conﬂuency. On day 3 both µ µ µ µ groups were treated with either 125 m, 63 m and 31 m, or 15 m H2O2. Six hrs post- treatment HFL-1 cells were transduced with scAAV2-GFP at 2,000 viral particles/cell

(Table 3.2). On day 4, 24 hrs post-H2O2 treatment, old medium was removed and

34 Day 1 Seed HFL-1 cells at 30% for conﬂuency (Non-Dividing Group)

Day 2 Seed HFL-1 cells at 30% for semi-conﬂuency (Dividing Group)

Day 3 Treat conﬂuent (100%) and semi-conﬂuent (60%) cells with DNA dam-

aging agents

6-hrs. p.t. Infect with 2000 particles/cell of scAAV2-GFP virus

Day 4 Cell recovery by changing media (24 hrs. post-treatment)

Day 5 Passaging cells, keep aliquots for ﬂow cytometry and for Hirt-

Extraction

Keep passaging cells until stable number of GFP positive cells remain.

Table 3.2: Experimental Scheme

replaced with fresh medium. Cells were allowed to recover for another 24 hrs after media change. On the same day GFP positive cells were counted under the ﬂuorescent microscope to monitor transduction eﬃciency. The viral transduction was deemed a success when more than 70% of HFL-1 cells were GFP positive. All experiments were performed in triplicate. Controls included a) non-treated cells that were transduced

(positive control) and b) non-treated and non-transduced cells (negative control).

3.5.2 CPT experiment

HFL-1 cells were thawed out at passage 5. They were expanded and split 1:5 for 1 passage before using them in the experiment. On day one HFL-1 cells were seeded at approximately 40% conﬂuency (3 × 105 cells/well) in a 6-well plate (7th passage), representing the non-dividing group (Table 3.2). On day two another batch of HFL-1 cells were seeded at approximately 40% conﬂuency (3 × 105 cells/well) in a 6-well

35 plate (7th passage), representing the dividing group. By day three, the non-dividing

(quiescent) group seeded on day one were at 100% conﬂuency and the dividing group seeded on day two were at approximately 60% conﬂuency. On day 3 both groups were treated with either 50 pm, 25 pm, 12.5 pm CPT. Six hours post-treatment HFL-1 cells were transduced with scAAV2-GFP at 2000 viral particles/cell (Table 3.2). On day

4, 24 hrs post-CPT treatment, old medium was removed and replaced with fresh medium. Cells were allowed to recover for another 24 hrs after media change. On the same day GFP positive cells were counted under the ﬂuorescent microscope to monitor transduction eﬃciency. The viral transduction was deemed a success when more than 70% of HFL-1 cells were GFP positive. All experiments were performed in triplicate. Controls included a) non-treated cells that were transduced (positive control) and b) non-treated and non-transduced cells (negative control).

3.5.3 Quantifying integration by ﬂow cytometry

On day 5 (24 hrs-post medium change) both non-dividing and dividing groups are at 100% conﬂuency. All cells were passed 1:5 every 4 to 5 days (Table 3.2). At each passage, cell samples were harvested, washed with ice-cold phosphate-buﬀered saline

(1xPBS), and fixed with cold 4% paraformaldehyde in phosphate-buffered saline one ice. GFP expression was detected by flow cytometry (Coulter XL cytometer). Cells were passed continuously until the percent GFP positive cells reached a plateau, representing the population of cells with integrated viral vector.

36 3.6 Mice

Male C3H/HeJ mice (Tlr4Lps-d) were purchased from Jackson Laboratory (Bar Har- bor, ME) at 5-6 weeks of age. Animals were housed in microisolator cages. All animal protocols were approved by the Institutional Animal Care and Use Committee

(IACUC) of Nationwide Children’s Hospital.

3.7 Treatment, Infection and Tissue Collection for in vivo

analysis of CPT eﬀect on viral integration scAAV8-GFP vectors were administered to 8 C3H/HeJ male mice at 8 weeks of age by tail vein injection at a dose of 2.4 × 1010 viral particles per mouse, which is equivalent to 9.6 × 1011 viral particles/kg. Half of the injected mice were treated with a single dose of CPT (Sigma-Aldrich, St. Louis, MO) through the intraperitoneal route (IP) at a dose of 625 µg per mouse (25 mg/kg), 7 hrs post-vector injection. Two weeks after vector transduction and CPT treatment mice were euthanized. Brieﬂy, mice were deeply anesthetized by intraperitoneal injection of avertin (2,2,2-Tribromoethanol,

Aldrich, St. Louis, MO), followed by a midline abdominal incision. Transcardial perfusion was performed with phosphate buﬀered saline (PBS) containing 10U/ml of heparin to prevent blood clot. Healthy liver and muscle samples (quadricep) were either snap frozen in liquid nitrogen for DNA analysis or ﬁxed in 4% paraformaldehyde.

3.7.1 Statistical Analysis

All statistical analyses were performed using unpaired t-test (GraphPad Prism 5 software), where signiﬁcance is represented by p ≤ 0.05.

37 3.8 Infection and Tissue Collection for in vivo long-term in-

tegration analysis scAAV8-GFP vectors were administered to 20 C3H/HeJ male mice at 6 weeks of age by tail vein injection at a dose of 2.4 × 1010 viral particles per mouse, which is equivalent to 9.6 × 1011 viral particles/kg. 5 mice were sacriﬁced at each of the following time points post-vector transduction: 1 month and 6 month. Brieﬂy, mice were deeply anesthetized by IP injection of 2.5% avertin (2,2,2-Tribromoethanol,

Aldrich, St. Louis, MO) followed by a midline abdominal incision. Transcardial perfusion was performed with PBS. Healthy liver and muscle (quadriceps) samples were either frozen in dry ice for DNA analysis or ﬁxed in 4% paraformaldehyde.

3.9 DNA isolation and gel puriﬁcation assay

Low molecular weight (LMW) DNA (monomeric episomes) gets separated from high molecular weight (HMW) DNA through hirt extraction using 60-70 mg of snap frozen e liver samples (Figure 3.2). The DNA concentrations from the HMW fractions were approximated by OD260/280. For the gel puriﬁcation assay 10 µg of HMW DNA (isolated via hirt extract from liver) was digested with homing endonuclease I-Ceu1, overnight at 37◦C (Figure 3.2). The next day I-Ceu1 was heat inactivated at 65◦C for 20 minutes. Then 2.5µg of the I-Ceu1 digested HMW DNA was run on a 1% low melting point (L.M.P.) agarose gel at 50 Volts for 3 hours (Figure 3.2). Genomic

DNA gel bands were then excised out of the gel under long-wave UV light (365 nm).

To purify out the HMW DNA from the gel, the gel slices were ﬁrst equilibrated with

1x β-agarase buffer (10 mm Bis-Tris-HCl, 1 mm EDTA, pH 6.5) for 1 hour (each 30 minutes old buffer was aspirated and fresh buffer was added). Then the gel slices were melted at 72◦C for 10 minutes and digested with 1U/200 µL of β-agarase. The

38 Figure 3.2: Depiction of the gel puriﬁcation assay. Transduction would occur in vivo or in vitro with a scAAV vector carrying the GFP transgene. Since viral episomes are present in the form of low-molecular-weight (LMW) ds circular monomers and high-molecular-weight (HMW) concatemers, they could contribute falsely to the detection of rAAV integration events in the mouse genome. Therefore a hirt extraction of total DNA would be performed to separate the LMW DNA (episomal monomers) from the HMW DNA (concatemerized episomes and gDNA). Yet this alone will not rid the gDNA (with a putative integrant) from the HMW concatemerized episomes; to remedy that the I-Ceu1 site is used to cut out concatemerized episomes that may or may not have integrated into the genome. This will greatly reduce the number of unintegrated viral vectors from the gDNA with a putative integrant. To purify out the unintegrated from the integrated viral vectors, the gDNA was run through a Low

Melting Point (LMP) agarose gel. The DNA containing gel fragments were excised and gDNA was freed from agar through β-agarase digestion. Finally the integration events in the gDNA were determined through the detection of the LacZ1 fragment embedded in the viral vector via Quantitative Polymerase Chain Reaction (QPCR).

39 β-agarase will digest the gels into smaller neo-oligosaccharide subunits thereby releasing the DNA from the gel (Figure 3.2). The DNA was further puriﬁed out from the neo-oligosaccharides through alcohol precipitation. To verify DNA recovery from the β-agarase procedure and alcohol precipitation, 4% from the sample was run on

1% agarose gel. To quantitate integrated vector genome, 0.5 µg of HMW DNA, that was either gel puriﬁed or not, along with equal amount of LMW DNA by volume, was subjected to Taqman Quantitative PCR (qPCR)(Applied Biosystems ABI Prism

7000 TaqMan sequence detection system) (Figure 3.2). To quantitate viral vector copy number primers and probes specific for the lacZ1 gene fragment were used: forward lacF- 50CCCGTATTTCGCGTAAGGAA-30 (300 nm final concentration), reverse lacR- 50GTTGATGTCATGTAGCCAAATCG-30 (300 nm final concentration), and probe lacP- 50[6 FAM]CTTTTACTTTTTTATCATGGGAGCC[TAMRA 6 FAM]- e e e 30 (100 nm final concentration). Vector genome amplification in liver DNA samples was compared against LacZ1 plasmid standards mixed with DNA from uninfected mouse liver (in duplicate). Cellular diploid genome copy numbers in DNA samples were determined in parallel reactions with primer and probe set specific to the cellular

β-actin gene using uninfected mouse liver DNA as standard (in duplicate): forward

β-actin-f- 50GTCATCACTATTGGCAACGA-30 (400 nm ﬁnal concentration), reverse

β-actin-r1- 50CTCAGGAGTTTTGTCACCTT-30 (400 nm ﬁnal concentration), and probe β-actin-probe 50 [6-FAM]TTCCGATGCCCTGAGGCTCT[TAMRA-Q]-30 (100 nm ﬁnal concentration).

40 CHAPTER 4

RESULTS

4.1 A novel detection assay to measure integrated rAAV vi-

ral vector

To evaluate the potential beneﬁt or risk involved in vector integration from a therapeutic standpoint or to better understand rAAV vector genome behavior in diﬀerent circumstances, it is crucial to be able to measure the frequency of viral vector integration. As mentioned before rAAV vector integration is a rare event, where 0.1-0.5% of infectious vector genomes integrate. Thus measuring rAAV vector integration can be challenging, especially when doing so amidst an excess of unintegrated viral DNA in the form of monomeric (LMW) or concatemeric (HMW) episomes. We developed a method that could detect viral vector integration without getting false detection from LMW vector DNA in the form of monomeric episomes or HMW vector DNA in the form of conatemerized episomes, from any organism or cell infected with rAAV vector.

First, DNA from an infected cell (such as hepatocytes from a rAAV transduced mouse liver) would be isolated via hirt extraction. The hirt extraction would allow the separation of LMW DNA from the HMW DNA which is composed of not only concatemerized viral vector episomes but also the host’s gDNA harboring putative viral integrant. Using the hirt extraction method we will be able to separate out a

41 20 HMW viral vector copies per cell

116.4 LMW viral vector copies per cell

0.058 integrated viral vector copies per cell

Figure 4.1: Successful separation of integrated viral vector DNA from monomer episomal DNA (LMW) and concatemerized episomal DNA (HMW) using the gel purification assay. This Figure depicts the gel purification assay performed on a mouse liver sample transduced with rAAV. First a hirt extraction would be performed on total DNA from the liver sample, which will separate out the LMW DNA forms (episomal monomers) from the HMW DNA forms (host gDNA with vector integrant and episomal concatemers). 116.4 LMW viral vector copies, which are not integrated, were separated out from a total of 136.458 viral vector copies per transduced hepatocyte, which comprises 85%. So from the hirt extraction only, 85% of unintegrated viral vector DNA is eliminated, which could falsely account for integration events. In addition, using the gel purification assay will remove the remainder of the unintegrated viral vector DNA, which are in the form of HMW viral vector concatemers. 20 HMW viral vector copies, which are not integrated, were removed from a total of 136.458 viral vector copies per hepatocyte, which comprises 15% of unintegrated viral vector DNA. In all, using the hirt extraction method in combination with the gel purification method we are capable of removing 99.9% of unintegrated LMW and HMW vector genomes. Additionally our gel purification assay is sensitive enough to detect very low frequency of integration, as low as 0.058 integrated vector copies/cell out of total 136.458 vector copies/cell. So 0.042% integrated viral vector was detected which is equivalent to 1 integrated viral vector genome out of 10,000 infectious viruses in the hepatocytes of an rAAV transduced mouse liver. LMW unintegrated viral vectors depicted in aqua, HMW unintegrated viral vectors in purple, integrated viral vectors in pink.

42 large percentage of LMW episomes (> 80%) from integrated viral DNA for detection purpose. Figure 4.1 shows the gel puriﬁcation assay from a liver sample transduced with rAAV. In this particular sample, 116.4 viral vector copies of monomeric episomal

(LMW) origin was separated out via hirt extraction from a total vector copy number of 136.458 per hepatocyte (116.4/136.458*100 = 85%). However a hirt extraction alone is not eﬃcient enough to remove other viral vector genomes (HMW) that remain with the host gDNA and thereby falsely contribute to integrated vector detection.

Therefore HMW DNA portion from the hirt extraction will undergo further processing to purify out the concatemerized viral vectors from integrated viral vectors via our newly developed gel puriﬁcation method.

First HMW DNA would be digested with the homing endonuclease, I-Ceu1. The viral vector transgene contains an I-Ceu1 site upstream from a lacZ1 fragment (Fig- ure 3.1), this would allow for cutting up uintegrated concatemerized episomes into monomeric units and cutting out any concatemerized vector genomes that integrated as a unit in a single locus. An I-Ceu1 homing endonuclease was used because of their high speciﬁcity to their recognition sites. The recognition sites are 12-40 bp long and are extremely rare in the mouse genome, where one such recognition site would be found in 20 mammalian-sized genomes. After I-Ceu1 digestion, what remains as the HMW DNA portion is the host’s gDNA with integrated vector genomes at various frequencies and loci. To purify out the HMW DNA from the digested, unintegrated, monomeric vector genomes, the mouse gDNA was run through a Low

Melting Point (LMP) agarose gel. The DNA containing gel fragments were then excised using long wave UV light to prevent DNA damage. The DNA was then freed from the agar through β-agarase digestion, which breaks down the agar into smaller neo-oligosaccharide subunits. The DNA was then alcohol re-precipitated from the

43 neo-oligosaccharides. Finally the integration events in the host’s gDNA were determined through the detection of the LacZ1 fragment embedded in the viral vector via quantitative PCR (qPCR). More speciﬁcally integration events out of total viral vectors per cell was detected by adding equal amounts of LMW DNA, gel unpuriﬁed

HMW DNA and gel puriﬁed HMW DNA. From a rAAV infected liver sample, we see

85% removal of the unintegrated LMW DNA and 15% removal of the unintegrated

HMW DNA (20/136.458*100 = 15%). In all, using the hirt extraction method in combination with the gel puriﬁcation method we are capable of removing 99.9% of unintegrated LMW and HMW vector genomes (Figure 4.1). Additionally our gel puriﬁcation assay is sensitive enough to detect very low frequency of integration, as low as 0.058 integrated vector copies/cell out of total 136.458 vector copies/cell. So

0.042% integrated viral vector was detected, which is equivalent to 1 integrated viral vector genome out of 10,000 infectious viruses in the hepatocytes of an rAAV transduced mouse liver.

4.2 The eﬀect of DNA damaging agents on rAAV viral vector

integration in vitro

4.2.1 Dose Response Experiment

It has been shown that several types of environmental damage, including UV, hy- droxyurea (HU) and ionizing irradiation augment rAAV transduction in cell types exhibiting ineﬃcient transduction [97]. Researchers also support the idea that rAAV integration is a chance interaction between vector genome and lesions in the host chromosome undergoing DNA damage repair [62]. Furthermore, AAV vectors were demonstrated to integrate at chromosomal double-stranded breaks generated by the endonuclease I-Sce or by treatment with etoposide and γ-irradiation [67]. Increasing

44 the level of DNA damage increased integration, suggesting that the formation of DSB was the rate limiting step. Thus, the preferred integration site of AAV vectors may represent chromosomal regions prone to DSB or other forms of DNA damage [21].

We wanted to investigate two different DNA damaging agents and their effect on rAAV vector integration in vitro using human lung fibroblast (HFL-1) cell line.

Furthermore we wanted to compare if integration of rAAV increases with HFL-1 cells being in the dividing stage or not at the time of drug treatment (DNA damaging agent). The two DNA damaging agents we chose were hydrogen peroxide (H2O2), which cause single-stranded breaks (SSB) and camptothecin (CPT) which produce double-stranded breaks (DSB).

H2O2 by itself is only slightly toxic, but its byproduct hydroxyl radical HO can oxidize DNA, proteins and membrane lipids leading to cellular injury [97]. H2O2 produces DNA SSB in cells such as human ﬁbroblasts via so-called Haber-Weiss reaction [64]. Since H2O2 can eﬀectively cause cell injury, we needed a dosage that was high enough to allow SSB formation, but low enough to prevent cells from dying of cell injury. Engelhardt et al. treated HeLa cells with 1 mm H2O2 when investigating enhanced rAAV transduction from DNA damage [97], while Teramoto et al. reported µ µ that H2O2 concentrations ranging from 10 m-100 m induce apoptosis in HFL-1 cells

[115]. We tested for HFL-1 cell viability using H2O2 concentrations that range from 1000 µm (1 mm) down to 4 µm in a 1:2 dilution. HFL-1 cells were treated with these various concentrations while at non-dividing state (90-95% conﬂuency). The experiment was performed in triplicate for each concentration. HFL-1 cells without H2O2 treatment was used as a negative control. H2O2 was left on the HFL-1 cells for 18 hrs, and then the media containing the drug was replaced with fresh media. 24 hrs after changing the media (day 3 since treating the cells) cell viability was determined using a colorimetric assay that measures the metabolic activity of the cells. More

45 specifically if cells are viable then the mitochondrial enzymes would be able to reduce yellow MTT to purple formazan. The absorbance of the purple colored solution can be quantified by measuring at a certain wavelength ( 500 to 600 nm) by a spec- e trophotometer. Since reduction of MTT can only occur in metabolically active cells the level of activity is a measure of cell viability. µ µ HFL-1 cells did not survive at 1 mm H2O2, and in the range of 125 m to 4 m not much variability in cell survival was seen (Figure 4.2). Therefore in our experiments µ µ we chose H2O2 concentrations ranging from 125 m to 15 m by 1:2 dilution. Through the course of the ‘Effect of H2O2 on rAAV integration in vitro’ experiment HFL-1 cells, belonging to the non-dividing and dividing group, that were treated with 125 µm

H2O2 did not survive (Figure 4.4a and 4.4b). The remainder of the HFL-1 cells that µ µ µ were treated with 63 m, 31 m and 15 m H2O2, belonging to both non-dividing and µ dividing groups, did survive. This indicates that at the highest dosage (125 m)H2O2 caused enough SS breaks in both dividing and non-dividing cells, such that repair was not suﬃcient for survival. µ Cells were able to survive for 3 days when treated with 125 m H2O2 in the dose response experiment, however they were unable to stay alive during 2 weeks in the

‘Effect of H2O2 on rAAV integration in vitro’ experiment. This also indicates that µ at the second highest dosage of H2O2 (63 m) we have potent SSB damage, but not potent enough to kill the cells over the course of the ‘Effect of H2O2 on rAAV integration in vitro’ experiment (approximately 40 days). It was observed that the µ HFL-1 cell group that was treated with 63 m H2O2 in a dividing stage had a slower recovery rate than the HFL-1 non-dividing group, more specifically they had a lower proliferation rate than normal. We expected the drug treatment to have a more potent effect on dividing cells than non-dividing cells, because cells still undergoing cell division will be more vulnerable to DNA damaging agents than cells that are in

46 H2O2 Dose Response Curve for HFL-1 Cells 150

100

50 CellViability in %

0 1 10 100 1000 10000

H2O2 [mM]

Figure 4.2: Dose response curve showing the HFL-1 cell survival at 500 µm

H2O2 and below. To determine at what H2O2 concentrations eﬀective, yet nonfatal, SSB to HFL-1 cells would be caused; a dose response experiment was performed.

HFL-1 cells, plated at 90-95% conﬂuency (non-dividing state), were treated with µ µ H2O2 concentrations ranging from 1000 m down to 4 m in a 1:2 dilution for 18 hrs. Cell viability was determined using an MTT assay 3 days post-treatment. The experiment was performed in triplicate for each concentration; untreated HFL-1 cells µ served as positive control. HFL-1 cells survived at H2O2 concentration range 500 m µ down to 4 m, they did not survive at 1 mm H2O2. There wasn’t much variability µ µ in cell survival from 125 m to 4 m H2O2. Thus for the ‘Eﬀect of SSB on rAAV vector integration frequency in HFL-1 cells’ experiment we used H2O2 concentrations ranging from 125 µm to 15 µm by 1:2 dilution. Negative control showed 100% viability; not shown on the graph.

47 a non-dividing state and are not replicating anymore. The negative control is not shown on the graph, but was at 100% cell viability.

Camptothecin (CPT) is a Topoisomerase I (TOPI) inhibitor, preventing TOPI to relax/unwind DNA supercoiling eﬃciently. Normally TOPI binds to the DNA, makes a SS nick which allows for unwinding and religating the DNA back together.

The state where TOPI binds to the DNA and makes a SS nick is called the cleavage complex (cc). CPT binds at the interface of the TOPI/DNA cc, where the SS nick is prevented from re-ligating. A DSB ensues when the replication fork comes across the fixed TOPI/DNA cc [85]. Here again an appropriate dosage was needed which is effective enough to form DSB, but maintain cell viability. Choi et al. treated HeLa cells with 25 nm of CPT when characterizing the recombination between different

DNA hairpin (HP) structures of AAV [15], while Miller et al. utilized 100 nm CPT on human ﬁbroblast cell cultures when investigating DNA damaging agent, CPT, on the increased rAAV transduction of non-dividing cells [89]. Based on this literature the response of HFL-1 cells on CPT dosage of 50 nm, 25 nm and 12.5 nm was investigated. And the HFL-1 cells from all concentrations whether treated at a dividing or non- dividing stage died after 4 days, based on previous response curve (data not shown).

We next tested for HFL-1 cell viability using CPT concentrations that range from

200 pm to 12.5 pm in a 1:2 dilution. One group of HFL-1 cells were treated with these various concentrations while in a non-dividing state (90-95%). A second group of

HFL-1 cells were treated with these various concentrations while in a dividing state

(50-60%). The experiment was performed in triplicate for each concentration. HFL-1 cells that were not treated with CPT were used as negative controls for each group.

HFL-1 cells were incubated with CPT for 18 hrs, then the old media was replaced with fresh media. 48 hrs after changing the media (day 4 since treating the cells) cell viability was determined using the colorimetric MTT assay. We see that cell viability

48 CPT Dose Response Curve of HFL-1 Dividing Cells CPT Dose Response Curve of HFL-1 Non-Dividing Cells 110 110 100 100 90 90 80 80 70 70 60 60 50 50 40 40 30 30 % Cell % Viability % Cell Viability % 20 20 10 10 0 0 0 50 100 150 200 250 0 50 100 150 200 250 CPT [pM] CPT [pM]

(a) (b)

Figure 4.3: Dose response curve showing the maximum HFL-1 cell survival at 50 pm CPT and below. To determine at what CPT concentrations eﬀective, yet nonfatal, DSB to HFL-1 cells would be caused; a dose response experiment was performed. Two HFL-1 cell groups, one plated at 90-95% conﬂuency (non-dividing state) the other at 50-60% (dividing state), were treated with CPT concentrations ranging from 200 pm to 12.5 pm in a 1:2 dilution for 18 hrs. Cell viability was determined using an MTT assay 4 days post-treatment. The experiment was performed in triplicate for each concentration; untreated HFL-1 cells served as negative control. There was >85% cell viability for both HFL-1 cell groups at CPT concentration range 50 pm to 12.5 pm. There was <80% cell viability for both HFL-1 cell groups at

CPT concentration range 200 pm to 100 pm. Thus for the ‘Eﬀect of CPT on rAAV integration in vitro’ experiment we used CPT concentrations ranging from 50 pm to

12.5 pm by 1:2 dilution. Negative control shown on the graph.

49 is above 85% when HFL-1 cells were treated with 50 pm to 12.5 pm CPT in the non-dividing group and dividing group at the time of treatment (Figure 4.3a 4.3b).

Thus in the ‘Eﬀect of CPT on rAAV integration in vitro’ experiments we chose CPT concentration ranging from 50 pm to 12.5 pm by a 1:2 dilution. Over the course of the ‘Eﬀect of CPT on rAAV integration in vitro’ experiment (approximately 40 days)

HFL-1 cells survived the CPT treatment at 50 pm, 25 pm and 12.5 pm concentrations from both groups (Figure 4.4c and 4.4d). No diﬀerence in cell viability between dividing and non-dividing groups at time of treatment, was observed over the course of the ‘Eﬀect of CPT on rAAV integration in vitro’ experiment. Both HFL-1 groups seemed to have recovered, after CPT treatment, in a similar manner.

4.2.2 H2O2 treatment of transduced HFL-1 cells to determine eﬀects of rAAV integration

We wanted to determine whether exposure to SSB agent, H2O2, will increase rAAV vector integration. Additionally we wished to compare rAAV vector integration ef-

ﬁciency between non-dividing and dividing cells at the time of H2O2 treatment. It has been known that rAAV vectors are capable of transducing both non-dividing and dividing cells and integrate into them. However the extent of integration is still poorly deﬁned in various replicating cells [126]. We hypothesize that vector integration should increase in cells that were treated with a DNA damaging agent such as

H2O2, in a dose dependent manner, since with increased drug concentration comes increased SSB. We also suspect a higher integration frequency in cells that were transduced with AAV and treated with a DNA damaging agent while in a dividing state.

The experiment was initiated by seeding 2 groups of HFL-1 cells such that by the day of transduction with scAAV2-GFP and treatment with H2O2 (day 3) we

50 would have the non-dividing group at 100% confluency and the dividing group at semi-confluency (60%). Both groups of cells were treated with various H2O2 concentrations ranging at 63 µm, 31 µm and 15 µm, as determined from the “Dose Response” experiment. At 6 hrs post-treatment HFL-1 cells from both groups were transduced with 2000 viral particles/cell of scAAV2-GFP virus, to ensure a transduction success of >70%. 24 hrs post-H2O2-treatment the old media containing the H2O2 was changed for fresh new media (day 4). On day 5 the non-dividing group have remained confluent for 4 days and the dividing group has reached confluency. The advantage of using HFL-1 cells is the fact that even after 100% confluency they remain viable for at least 3-4 days, which was important to this experiment. The infected and uninfected HFL-1 cells were passaged and an aliquot of cells was kept to monitor vector integration by detection of GFP transgene through flow cytometry. Cells were passaged 1:5 every 4-5 days, with passaging and therefore continued cell division, the transgene expression (GFP) would decrease if the vector DNA were episomal, and remain stable if the vector were integrated. As positive control we had a H2O2 non- treated group that was transduced with 2000 viral particles/cell scAAV2-GFP. And as negative control we had HFL-1 group that was neither treated nor transduced with scAAV2-GFP. All experiments were performed in triplicate.

In Figure 4.4a, passaging at 2 days post-transduction and treatment (passage 1) we see that about >10% of HFL-1 cells from the non-dividing group were transduced.

Although when counting by eye it appeared that more than 70% of HFL-1 cells were

GFP positive across all treatment groups, on day 1 post-transduction and treatment.

However on the second passage (5 days post-transduction and treatment) the ﬂow cytometer was able to pick up transduction eﬃciency of >80% GFP positive HFL-1 cells. It is not known why initially the high transduction rate was not picked up by

51 the ﬂow cytometer. Oddly enough the same discrepancy was seen in the HFL-1 non- dividing group during CPT treatment experiment. GFP detection of samples was normalized by subtracting the sample readings from the negative control (untreated and uninfected HFL-1 group). In the passage to follow GFP positive cells have sharply dropped from 80% down to <1%. A drop in GFP positive cells was expected, e since with each passage episomal viral vector genomes are released. From days 21-

37 however the GFP positive cells remained stable at ≤1%, this plateaued portion of the graph represents the GFP positive cells that possess viral vector integrants

(Figure 4.4a). The results show no significant difference in integration rate between any of the treated and non-treated groups, in other words only ≤1% of HFL-1 cells had rAAV integrations and the amount of HFL-1 cells that had integrations did not change with any dosage of H2O2 treatment. Thus treating non-replicating HFL-1 cells with a single-stranded break agent (H2O2) does not significantly increase rAAV integration.

In Figure 4.4b, passaging at 4 days post-transduction and treatment we see that more than 90% of HFL-1 cells were transduced, when infecting with 2,000 viral particles/cell. The graph plateaus off starting from 23-48 days post-transduction, the µ data points for the passaged cells that were treated with 63 m H2O2 was taken off, since we had some trouble growing them. Here again we see that ≤1% of HFL-1 cells harbored viral vector integrants, and this amount of cells did not significantly change between all treatment groups and between treated and untreated groups. The results indicate that treating replicating HFL-1 cells with H2O2 does not increase rAAV integration (Figure 4.4b). Also it seems that transducing HFL-1 cells at the time of replication does not increase rAAV integration either when compared to transduction of non-dividing cells.

We expected H2O2 to be more eﬀective in dividing cells, since it increases the

52 chance of replicating damaged DNA. We postulated that when introducing SSB’s to the DNA in replicating cells, it would lead to incorporation of wrong bases and possibly foreign DNA sequences such as our viral vector. However in non-dividing and dividing HFL-1 cells, SSB’s do not seem to allow for more eﬃcient vector integration, possibly because the mechanism for SSB-repair, which is base excision repair (BER), does not contribute to viral vector incorporation into the host genome. However it is important to note that the SSB’s from H2O2 are converted to DSB by the passing replication fork. Thus it may be that DSB repair mechanisms also do not enhance viral vector integration. But this will be more vigorously investigated in the next experiment below.

4.2.3 CPT treatments of transduced HFL-1 cells to determine eﬀects of

rAAV integration

We wanted to determine whether exposure to DSB agent, CPT, will increase rAAV vector integration. We also wanted to compare rAAV vector integration eﬃciency between HFL-1 cells in S-phase (dividing) or not (non-dividing) at the time of CPT treatment. rAAV vector integration has been implicated to occur in sites of chromosomal DSB sites [68, 86, 67], especially since the free ends of rAAV genomes resemble a DSB. Since SSB lesions did not enhance rAAV vector integration (Figure 4.4a and

4.4b), this suggests that rAAV may not integrate by way of BER. It may be that rAAV integration is more eﬃcient during DSB repair mechanisms, such as NHEJ and

HR. Therefore we hypothesize that vector integration should increase in cells treated with DSB agent, CPT. We also suspect a higher integration frequency in cells that were transduced with AAV and treated with CPT while in S-phase (replication of the cell’s DNA). Since rAAV vectors preferentially transduce actively proliferating

53 or CPT. HFL-1 cells 2 O 2 63uM 31uM 15uM NoTreatment (NT) 50pM 25pM 12.5pM NoTreatment (NT) Treatment Group Treatment 2 To determine the eﬀect of SSB O 2 . in vitro (b) (d) Dayspost-transduction Dayspost-transduction 62 748 37 23 16 4 62 748 37 23 16 4 1 1 10 10

0.1 0.1

100 100 0.01 0.01

% GFP+ HFL-1 cells HFL-1 GFP+ % % GFP+ HFL-1 cells HFL-1 GFP+ % of CPT. After 6 hrs of treatment all cell groups were transduced m 5 p . Flow Analysis of GFP+ HFL-1 cells in the Dividing Group Treatment CPT Flow Analysis of GFP+ HFL-1 cells in the Dividing H and 12 m 60% conﬂuency) at the time of treatment with either H e , 25 p 50pM 25pM 12.5pM NoTreatment (NT) m 63uM 31uM 15uM NoTreatment (NT) Treatment Group Treatment 2 O 2 ) or 50 p 2 O 2 of (H (c) (a) m µ Dayspost-transduction Dayspost-transduction 62 637 26 21 16 5 2 62 637 26 21 16 5 2 and 15 1 1 10 10 m 0.1 0.1

100 100 0.01 0.01

% GFP+ HFL-1 cells HFL-1 GFP+ % % GFP+ HFL-1 cells HFL-1 GFP+ % , 31 m µ Flow Analysis of GFP+ HFL-1 cells in the Non-Dividing Group Treatment CPT Flow Analysis of GFP+ HFL-1 cells in the Non-Dividing H Effect of DNA damaging agents on the efficiency of rAAV vector integration ) and DSB (CPT) inducing agents on rAAV vector integration in HFL-1 cells, HFL-1 cells were first treated with the DNA damaging 2 O 2 100% confluency) and another in a dividing state (plated at were treated with 63 with 2000 viral particles/cell ofaliquot scAAV2-GFP. When of all cells HFL-1 was cellcells groups kept served were to completely as monitor confluent, positive vector theyboth control, were integration treatment while continuously through groups passaged untreated GFP-transgene 1:5 the andvector; expression and graph untransduced an also by shows HFL-1 flow neither cells cells cytometry. SSBfrom with served Untreated nor both integrated as and vector treatment DSB negative transduced at groups control. inducingintegrated HFL-1 21 the agents vector In days graph genome; increase the post-transduction. shows recurrently non-dividing the cells neither Less HFL-1 efficiency with SSB than cells of integrated nor 1% from vector rAAV DSB of vector at inducing HFL-1 23 integration agents cells days significantly. significantly have post-transduction. increase In integrated the Again the efficiency less dividing of than HFL-1 rAAV 1% vector cells of integration. HFL-1 cells have (H agents then transduced with scAAV2-GFP. For each drug treatment 2 groups of HFL-1 cells were plated; one in a non-dividing state (plated at Figure 4.4: e 54 primary human fibroblast [90] and DSB occur from homologous recombination during and shortly after DNA replication (during S and G2 phases of the cell cycle).

Thus if the dividing HFL-1 cells get infected more, more viral genomes will be in the nucleus. Also the existing DSB from replicating cells along with the additional DSB from CPT should allow for increased rAAV integration in dividing HFL-1 cells.

Equivalent to the H2O2 experiment, two groups of HFL-1 cells were seeded such that on the day of transduction with scAAV2-GFP and treatment (day 3) with CPT the non-dividing group would be at 100% conﬂuency while the dividing group would be semi-conﬂuent (60%). Both groups of cells were treated with 50 pm, 25 pm and

12.5 pm CPT, as determined from the “Dose Response” experiment. At 6 hrs post- treatment HFL-1 cells from both groups were transduced with 2000 viral particles/cell of scAAV2-GFP. 24 hrs post-CPT-treatment the old media containing the CPT was exchanged with fresh new media (day 4). On day 5 the non-dividing group has remained conﬂuent (for 4 days) and the dividing group reached conﬂuency. On day

5, HFL-1 cells were passaged 1:5 and an aliquot of cells was kept to monitor vector integration through GFP-transgene expression by ﬂow cytometry.

In Figure 4.4c passaging at 2 days post-transduction and treatment (passage 1) we again see the unexplained phenomena of only detecting <10% GFP positive cells by

ﬂow, while counting >70% GFP positive cells 1 day post-transduction and treatment by eye. On the second passage (5 days post-transduction and treatment) we detected

>80% of HFL-1 cells being transduced with rAAV2, which is more representative of what was observed by eye. GFP detection of samples was again normalized by subtracting the sample readings from the negative controls (untreated and uninfected

HFL-1 group). Again in the passages that follow we see the expected drop in GFP positive cells until a plateau is reached (HFL-1 cells with rAAV integrations). Only

0.1% of HFL-1 cells had rAAV integrations, and this frequency did not change with e

55 the various dosage treatments of CPT. Neither was there a diﬀerence in integration between un-treated and treated HFL-1 cells. Therefore treating non-replicating HFL-

1 cells with a DSB agent (CPT) does not signiﬁcantly increase rAAV integration.

In Figure 4.4d passaging at 4 days post-transduction and treatment we see that

>30% of the dividing HFL-1 cells were GFP positive, when infected with 2000 viral particles/cell.

It is not quite clear why this group exhibited a lower transduction efficiency than all the other infected groups, but we do see an initial higher transduction rate in CPT treated HFL-1 cells than un-treated HFL-1 cells. Unfortunately this trend does not continue on as the graph plateaus off, and only the HFL-1 cells with integrating vectors are left. We again only see that 0.1% of HFL-1 cells harbored rAAV integrations. e There was no difference in integration frequency between treated and untreated cells and between non-dividing (Figure 4.4c) and dividing (Figure 4.4d) cells. Initially there was higher transduction efficiency of CPT-treated HFL-1 cells than untreated cells, but that did not give evidence to higher integration efficiency.

It is not surprising that CPT treated cells from the dividing group had a higher transduction eﬃciency at the beginning of the experiment (Figure 4.4d). Miller and

Russell in 1995 used stationary human fibroblast cultures to show that AAV vectors transduce dividing cells at 200x the frequency of non-dividing cells [89]. In 1994 e the same authors mentioned that AAV vector transduction in non-dividing fibroblast cells is increased up to 750-fold with DNA damaging agents [90]. Also transduction efficiency of AAV vectors in cultured human airway epithelial cells increased 1.5-10 fold when treated with CPT prior to AAV vector transduction [115]. We expected more cells to have integrated vector in the dividing HFL-1 group, because CPT would affect dividing cells more by introducing additional DSB. But from these results it seems that rAAV vector integration by DSB repair pathways may also not be the most effective way to increase rAAV vector integration as previously thought.

56 4.3 Eﬀects of DNA DSB inducing agent, camptothecin (CPT),

on rAAV vector integration in vivo

It has been suggested that rAAV randomly integrates into pre-existing DSB [67], which could pose a risk for potential mutagenesis. Also as mentioned earlier rAAV vectors in cell cultures showed an integration eﬃciency of 0.1-0.5% of infectious vector genomes (1 integrated viral vector genome out of 1000 infectious viruses). In vivo, rAAV integration occurs at some measurable frequency under assay conditions of dividing cells in the liver [73, 74]. However the exact frequency of rAAV integration in non-dividing cells (such as the liver) is not known in vivo.

Additionally researchers support the idea that rAAV integration is largely a consequence of chance interactions between the vector genome and regions of the host chromosome undergoing DNA damage repair from DSB [62]. And this ﬁts together with the fact that scAAV genome ends are palindromic hairpin-structured terminal repeats, resembling a DSB repair intermediate [14]. Therefore we wished to evaluate the frequency of rAAV vector integration in mouse liver and test the hypothesis that inducing DSB in hepatocytes increases the frequency of rAAV vector integration in vivo. Eight C3H/HeJ male mice were injected with scAAV8-GFP via tail vein (IV) at 8 weeks of age. Each mouse was injected with 2.4 × 1010 viral particles, a high enough dose to get 40-100 vector copies/cell in liver hepatocytes. Moreover, systemi- cally (IV) applied AAV vectors accumulate in the liver, thus reducing the transduction eﬃciency in non liver target tissues [9]. At 7 hrs post-transduction 4 out of the 8 mice were treated with a single dose of CPT through the intraperitoneal route (IP).

Two weeks later mice were sacriﬁced and their liver and muscle (left quadriceps) were collected and frozen. Hirt extraction and gel puriﬁcation was performed on 70mg e of frozen liver tissue to determine rAAV vector integration frequency. As a negative

57 control uninfected and untreated mouse liver tissue, that were frozen from previous experiments, were used.

Mouse liver serves as a good model for rAAV integration for the following rea- sons: a) it is readily infected by scAAV8 b) most extensive rAAV integration assays have been done on the liver c) an association between rAAV vector integration and hepatocellular carcinoma (HCC) was seen in the murine liver [25], ﬁnally d) HCC is the most common response to carcinogenic agents in mice. So if rAAV vector integration proves to be carcinogenic, then HCC nodules could appear in the liver.

The CPT treatment was designed to induce DSB early during vector infection to test the possibility of increased genotoxicity due to increased integration. At the time of sacriﬁce the livers were evaluated for the presence of gross tumors. None of the 8 livers from CPT treated and untreated mice had tumors. When liver sections were observed under the microscope there was >80% transduction of the tissue (data not shown).

Figure 4.5 shows the result from the liver samples, where we first hirt extracted to purify out episomal monomers. Then utilizing the gel purification method to further purify HMW unintegrated viral vector DNA from mouse liver gDNA, harboring a putative integration. Viral vector copy numbers were measured through vector probe lacZ fragment detection via QPCR. Mouse gDNA copy numbers were measured through genomic probe m-β-actin detection via QPCR. Viral vector copies/hepatocyte was calculated by dividing the genomic probe quantity (m-β-actin) by 2 to give the amount of cells. Then the vector probe quantity reading (LacZ1 fragment) was sub- tracted from the background detection (uninfected mouse liver DNA). Finally we divided the vector probe quantity by the cell amount to get the wanted viral vector copies/hepatocyte. Monomeric episomal (LMW) DNA from the hirt extraction, un- purified HMW DNA (mouse gDNA with integrated vectors plus concatemerized viral

58 vector DNA), puriﬁed HMW DNA (mouse gDNA with integrated vectors) were run in two parallel QPCR reactions, one to detect viral vector DNA (LacZ1 probe) and the other to detect host gDNA copy numbers (m-β-actin probe). All samples were run in triplicate. For background uninfected and untreated mouse liver DNA was used.

HMW vector DNA (concatemerized viral vectors in association with mouse gDNA) ranges from 2-6 viral vector copies/cell in CPT treated and untreated mice (mouse e #1-8). LMW vector DNA (episomal monomers) ranges from 2.4-5 viral vector copies/cell in CPT treated and untreated mice (mouse 1-8). Finally integrated viral vector DNA (gel puriﬁed HMW DNA(mouse gDNA with integrated vectors)) ranges from 0.02-0.2 viral vector copies/cell (Figure 4.5). First we can see that there are slightly more integrated viral vector copy numbers/cell in the CPT treated mouse samples. Also when combining LMW values with HMW values we see that there is as low as 100 fold less integrated viral vectors than there are unintegrated viral vectors. More speciﬁcally dividing integrated viral copies/cell by the total viral vector copies/cell (includes HMW+LMW viral DNA) gives us the percent integration events for each sample. Percent integration represent the number of integrated events/total virus present in the hepatocyte. Utilizing the percent integration value for each sample, it gave us a closer look as to whether CPT treated mice had more frequent viral vector integration events than untreated mice.

In Figure 4.6 there is indeed a greater viral vector integration frequency seen in CPT treated mice, but it was unfortunately statistically insigniﬁcant (p-value =

0.171). These results are comparable to the in vitro analysis of CPT treated HFL-

1 cells. In both experiments it was shown that DSB induction through CPT does not signiﬁcantly increase AAV viral vector integration in vivo or in vitro. Also the frequency of viral vector integration in mouse hepatocytes ranges from 0.3-2%. In

59 Vector Forms Present in the Mouse Liver LMW 10 HMW Integrated 1

0.1

Viralvector copies cellper 0.01 1 2 3 4 5 6 7 8

CPT untreated CPT treated

Mice at 2 weeks pi

Figure 4.5: Viral Vector Copies Present in Mouse Hepatocytes after Hirt-

Extraction and Gel Puriﬁcation. Eight C3H/HeJ mice were transduced with 2.4 × 1010 viral particles/mouse of scAAV8-GFP vector. Mice 5-8 were treated with DSB inducer,

CPT, 7 hrs post-transduction. Two weeks later mice were euthanized and their livers were collected. LMW DNA (monomeric episomal vector DNA) was separated from HMW DNA

(mouse hepatocyte genomic DNA and concatemerized episomal vectors) via hirt extraction. Utilizing the gel puriﬁcation method, HMW unintegrated vector DNA was further puriﬁed from mouse gDNA. Viral vector copy numbers were measured through vector probe lacZ fragment detection via QPCR. Mouse gDNA copy numbers were measured through genomic probe m-β-actin detection via QPCR. As a negative control uninfected and untreated mouse liver tissue were used. There was 2-6 viral vector copies/cell of HMW vector DNA e (concatemerized vectors), 2.4-5 viral vector copies/cell of LMW vector DNA and 0.02-0.2 viral vector copies/cell of integrated viral vector DNA in CPT treated and untreated mice

(mouse #1-8).

60 Percent Integration Comparing CPT vs. non-CPT Treated Mice

2.5

2.0

1.5

1.0

% integration % 0.5

0.0

CPT treated CPT untreated

P-value = 0.171 The difference is not significant.

Figure 4.6: Comparison of integration events between untreated and CPT treated mice. Percent integration represent the number of integrated events/total virus present in the hepatocyte and it was used to further assess diﬀerence in rAAV vector integration between CPT untreated and treated mice. The frequency of viral vector integration in mouse hepatocytes ranges from 0.3-2%. The increase in viral vector integration frequency seen in CPT treated mice is not signiﬁcant (p-value =

0.171). Statistical analysis was performed using Unpaired T-test to assess p-value

(p ≤ 0.05 is signiﬁcant).

61 other words, only 1 viral vector integrates out of 1000 infectious viral vectors (0.3%) or 100 infectious viral vectors (2%).

4.4 Long-term in vivo study of rAAV vectors integration

frequency and longevity

In the previous experiment we determined that as little as 1 viral vector genome out of 1000 infectious vector genomes integrates into the host chromosome in hepatocytes. This integration frequency is an analogy to the frequency seen in cultured cells in previous experiments. Though we have an idea about the integration frequency, it is not known how soon integration occurs and whether rAAV integration increases over time. Free DNA ends, such as rAAV ends, are rapidly cleared from the cell to protect the integrity of the host genome [124]. It was shown that the vast majority of active vector genomes are circularized very rapidly in cultured cells

(within the first 24 hrs post-infection); so circularization of vector DNA may compete with integration [14]. Also concatemer formation delays circularization long enough to increase the probability of integration, since there is a preference for integrating rAAV concatemers instead of monomers. More importantly integration has been observed to occur between 24-48 hrs post-infection, while some integration events were observed during the first 10 hrs in site-specific integration studies of AAV [35, 62].

Considering these points we hypothesize that vector integration happens soon after vector administration into animals rather than later. A reason for vector integration at later time points is the possibility that transient linearization of episomal forms could recombine with a second linear genome or a large concatemer. Such transient availability of rAAV ends could contribute to integration into host-chromosome at later time points.

62 Twenty C3H/HeJ male mice were injected with scAAV8-GFP via tail vein at 6 weeks of age. Each mouse was injected with 2.4 × 1010 viral particles. Five mice were to be sacrificed at each of the following time points: 1, 6, 12 and 18 months post-infection. Liver and muscle (quadriceps) were collected and frozen. Again hirt extraction and the gel purification assay was performed on 70 mg of liver tissue e to determine rAAV vector integration frequency. As a negative control uninfected and untreated mouse liver tissue were used. At the time of sacrifice the livers were evaluated for the presence of gross tumors. None of the livers from the sacrificed mice had tumors.

Figure 4.7 shows the results of the amount of LMW (episomal monomers), HMW

(mouse gDNA with viral vector integrants plus concatemerized viral vector DNA), and integrated (mouse gDNA with viral vector integrants) viral vector DNA across all the samples at time points 2 weeks, 1 month and 6 month post-infection. Mice sacrificed at 2 weeks post-infection (pi) have LMW vector DNA ranging from 10-19 viral vector copies/cell, HMW vector DNA ranging from 2-6 viral vector copies/cell and integrated vector DNA ranging from 0.016-0.13 viral vector copies/cell. Mice sacrificed at 1 month pi have LMW vector DNA ranging from 40-166 copies/cell, HMW vector DNA ranging from 6-35 viral vector copies/cell and integrated vector DNA ranging from 0.02-0.14 vector copies/cell. Finally mice sacrificed at 6 month mark have LMW vector DNA ranging from 463-1,135 viral vector copies/cell, HMW vector

DNA ranging from 7-20 viral vector copies/cell and integrated vector DNA ranging from 0.02-0.06 viral vector copies/cell. This is in conformity of studies in mouse model of liver transduction, where integrated AAV vector genomes were present at roughly 0.05 copies/cell [78].

At ﬁrst glance across all time points it seems that the integrated viral vector copies and the HMW viral vector copies do not highly diﬀer. However it seems that at each

63 LMW Integrated Vector Presence in Mouse Liver HMW 10000 Integrated 1000 100 10 1 0.1 0.01 0.001

Viralvector copies cellper 0.0001

M1 M2 M3 M4 M5 M6 M7 M8 M9 M10 M11 M12 M13 M14 Control

2 wks pi 1 month pi 6 month pi

Mice at 2 wk, 1 and 6 month pi

Figure 4.7: Long-term study of integrated vector presence in the mouse liver. C3H/HeJ mice were transduced with 2.4 × 1010 viral particles/mouse of scAAV8-GFP vector. Mice were sacrificed at time points: 2 weeks, 1 and 6 months post-infection. Using the liver tissue, LMW DNA was separated from HMW DNA via hirt extraction. During the gel purification method, HMW unintegrated vector DNA was further purified from mouse gDNA. Viral vector copy numbers were measured through vector probe lacZ fragment detection via QPCR. Mouse gDNA copy numbers were measured through genomic probe m-β-actin detection via QPCR. As a negative control uninfected mouse liver tissue was used. At 2 weeks post-infection (pi) LMW vector DNA was present at 10-19 viral vector copies/cell, HMW vector DNA was present at 2-6 viral vector copies/cell and integrated vector DNA ranged from 0.016-0.13 viral vector copies/cell. At 1 month pi LMW vector DNA ranged from 40-166 copies/cell, HMW vector DNA was present at 6-35 viral vector copies/cell and integrated vector DNA was present at 0.02-0.14 vector copies/cell. Finally at the 6 month mark LMW vector DNA ranged from 463-1,135 viral vector copies/cell, HMW vector DNA was ocurred at 7-20 viral vector copies/cell and integrated vector DNA was present at 0.02-0.06 viral vector copies/cell.

64 Integrated Vector Presence in Mouse Liver 1000 LMW 100 HMW 10 Integrated 1 0.1 0.01 0.001

Viralcopies vector cell per 0.0001

2 wk 1 month 6 month Control Averaged Mouse Data

Figure 4.8: To better visualize the diﬀerence in frequency of the various viral vector forms (monomers, concatemers or integrated) the liver samples at each time point were averaged. The frequency of integrated and HMW viral vector DNA did not change over time. However there is a log-fold increase of LMW viral vectors over time.

65 time point, the amount of LMW viral vector copies increases over time. To better visualize the diﬀerence in frequency of the various viral vector forms (monomers, concatemers or integrated) the mouse samples at each time point were averaged. In

Figure 4.8 the frequency of integrated viral vector DNA does not change over time.

The relative number of extrachromosomal concatemerized HMW viral vector DNA in the mouse livers also did not substantially change over this time period. However what is apparent is a signiﬁcant increase of monomeric episomal viral vectors over time (a log-fold increase over-time). We ascertained that recombination events between monomer forms to create concatemer forms did not occur, since the amount of

HMW concatemer vector forms did not substantially change with time and monomeric episome amount increased over time.

What we can conclude is that rAAV integrates indeed at an earlier time point such as within 2 weeks, rather than at a later time point (6 months) in non-dividing hepatocytes, since we see no increase in frequency of integrated viral vector over time. It appears that rAAV vectors integrate on average at 0.43% at the 2 week time point, 0.046% at the 1 month time point and 0.01% at the 6 month time point.

It was interesting to see a signiﬁcant increase in copies of episomal monomers over time. It has been noted that in mouse liver, a high dose of scAAV leads to the early formation of monomeric circles and linear concatemers at 1 day after injection, with the concatemers converting to concatemeric circles by 42 days after injection. So the vast majority of vector genomes persist as episomes, either circular monomers or circularized concatemers [61]. Engelhardt et al. sought to characterize the abundance and molecular structure of AAV circular intermediates in muscle tissue. (In their studies they have demonstrated that head-to-tail episomal circularized monomer and concatemer genomes represent a predominant molecular structure of rAAV following in vivo delivery to muscle tissue). Their results demonstrated prolonged persistence

66 of head-to-tail circular intermediates at 80 days post-infection (2.5 months) suggest that a large percentage of rAAV genomes remain episomal. Their observation of the conversion of monomer circularized genomes to larger circularized multimers was seen as an aspect associated with long-term persistence (80 days was the duration of the study), they postulated that recombinational events between monomer intermediate and/or rolling circle replication may have occurred [28]. More speciﬁcally, at 22 days post-infection in muscle tissue, the predominant form of circular intermediates occurred as monomer head-to-tail genomes. At 80 days post-infection the authors retrieved larger fractions of vector circular intermediates, which was indicative of recombination between monomer forms in the generation of large circular multimer genomes.

We have observed a diﬀerent outcome in our long-term experiment, rather than observing a decrease in monomeric episomal vector forms over time, we see an increase. We are unsure what environmental contribution allowed for increased viral monomer episomal forms over time, however we suspect that the host cell mechanisms may have replicated the vector genome. Since the total amount of virus per mouse at 6 months post-infection, exceeded the amount of viral particles that were administered to the mouse at transduction day.

67 CHAPTER 5

DISCUSSION

We analyzed the capacity of rAAV vector integration into the host chromosome in vitro, using HFL-1 ﬁbroblasts, and in vivo using C3H/HeJ mice. We took speciﬁc steps to increase the likelihood of insertional activation, including single-stranded

DNA damage induced with hydrogen peroxide (H2O2), double-stranded DNA damage induced with camptothecin (CPT) and a tumor prone mouse model (C3H/HeJ). The experiments were designed to test speciﬁc hypotheses regarding the ways on how rAAV vector genomes become increasingly integrated into the host chromosome.

We wished to investigate the behavior of rAAV when the cell undergoes single- stranded break damage to observe whether this would lead to increased vector integration. We compared vector integration between HFL-1 cells that were treated with

H2O2 and transduced with virus at a non-dividing vs. a dividing state. We used µ µ µ H2O2 concentrations ranging from 63 m, 31 m and 15 m, which we determined to be potent enough to cause SSB in the HFL-1 cells without inducing apoptosis (Figure

4.2). We hypothesized that HFL-1 cells treated with H2O2 will exhibit more rAAV vector integration than untreated cells. Additionally we suspect even higher rAAV vector integration in dividing cells than in non-dividing HFL-1 cells, since DNA damaging agents are more potent in replicating cells. Throughout the experiment HFL-1 cells where passaged and the viral integrants were monitored via GFP detection by

ﬂow cytometry. The observed decrease in transgene expression can be explained by

68 a ‘dilution eﬀect’, i.e. viral episomal vector DNA gets released during cell division thereby reducing the percentage of transduced cells, therefore any cells that have stable transgene expression are the ones with integrated vector in them (Figure 4.4).

Stable GFP transgene expression was observed 23 to 48 days post-transduction, where the graph plateaus oﬀ. In Figure 4.4a and 4.4b we see that ≤1% of HFL-1 cells had viral vector integrants across all conditions (dividing vs. non-dividing and treated vs. untreated). We postulated that when damaging the DNA in replicating cells, it would lead to incorporation of wrong bases and possibly foreign DNA sequences such as our viral vector. However the data suggests that SSB does not increase rAAV integration, whether cells are at S-phase or not. A possible reason may be that the free ends of the rAAV genomes resemble a complex DSB, which would require DSB repair mechanism rather than base excision repair (BER), which is the mechanisms for SSB-repair.

Next we investigated rAAV vector integration under DSB induction in HFL-1 cells using camptothecin (CPT). Similarly to the H2O2 experiment, we examined virus integration in an environment of CPT treated vs. untreated cells and dividing vs. non-dividing cells. We used CPT concentrations ranging from 50 pm, 25 pm and 12.5 pm, which we determined to be potent enough to cause DSB in the HFL-1 cells without inducing apoptosis (Figure 4.3). As mentioned earlier, rAAV vector integration has been implicated to occur in sites of chromosomal DSB sites [68, 86,

67]. Therefore we hypothesized that CPT treated HFL-1 cells will have more viral integrants than untreated cells. Also, most endogenous DSB occur during S-phase, when DNA replication forks encounter nicked or damaged DNA template [117]. Thus we expect CPT to have more eﬀect on dividing cells, leading to more damage and therefore we hypothesize that it may lead to higher rAAV vector integration in HFL-1 cells undergoing S-phase. On day 23 to 48 post-transduction we see the expected drop

69 in GFP positive cells until a stable plateau is reached, representing the HFL-1 cells with rAAV vector integrations (Figure 4.4c and 4.4d). In the dividing group, initially a higher transduction rate is seen in the CPT treated HFL-1 cells (Figure 4.4d). But this did not translate to higher integration eﬃciency as the experiment went on and induction of DNA damage to increase AAV vector transduction has been noted in several studies [89, 90]. Only 0.1% of HFL-1 cells had rAAV vector integrations, e and this frequency did not change between untreated cells or cells treated with the various concentrations of CPT. Neither was there a diﬀerence in integration frequency between dividing and non-dividing HFL-1 cells at the time of treatment (Figure 4.4c and 4.4d).

Treating non-replicating HFL-1 cells with a DSB agent (CPT) does not signiﬁ- cantly increase rAAV integration. Though it has been suggested before that induction of cell division leads to an increase in the number of integrations (unpublished data

Rosas and McCarty), this was not seen in our CPT experiments. All in all, it is suggested that increasing DSB does not enhance the integration eﬃciency of rAAV in vitro.

As a side, in Figures 4.4a and 4.4c at the beginning of the experiment we see a low detection (<10%) of GFP positive cells by ﬂow cytometry, though >70% of

GFP positive cells were counted on day 1 post-transduction and treatment by eye.

On day 6 post-transduction we detected >80% of HFL-1 cells being transduced with rAAV2, which is more representative of what was observed by eye. Perhaps technical difficulties in the flow cytometer were involved in this discrepancy, which did not allow for sufficient detection of GFP positive cells at the first passage.

Even-though we found that DSB do not enhance rAAV vector integration in vitro, as previously thought, it is of signiﬁcance to investigate that further in vivo. It is also important to us to identify the rAAV vector integration frequency in vivo, which

70 hasn’t been done before. Liver tumors are of particular concern because there have been previous reports of increased incidence of hepatomas in rAAV-treated animals and because liver tissue is subject to high rates of rAAV transduction. While targeting the liver, no tumor nodules were observed from the eight C3H/HeJ mice that were transduced with scAAV8-GFP vector and half of them treated with CPT. Using our newly developed gel puriﬁcation method to detect viral vector integrants in addition to hirt extraction, we detect 2-6 viral vector copies/cell of HMW vector DNA, e 2.4-5 viral vector copies/cell of LMW vector DNA and ﬁnally 0.02-0.2 viral vector copies/cell of integrated vector DNA in mice 1-8 (Figure 4.5). When combining the

LMW and HMW viral vector copies/cell, one can see that there is up to 100 fold less integrated than unintegrated viral vector. Thus we do not approach 1 copy of viral vector integrants per cell, rather we only detect as much as 0.2 viral integrant copies/cell in hepatocytes.

In the same study four out of the eight C3H/HeJ mice were transduced and treated with the DSB inducing agent, CPT. Looking at percent integration of the data from

Figure 4.5, we see in Figure 4.6 that the increased viral vector integration frequency in CPT treated mice is not statistically signiﬁcant (p-value = 0.171). This suggests that DSB induction through CPT also does not increase viral vector integration in vivo. Finally the frequency of viral vector integration in mouse hepatocytes ranges from 0.3-2%. In other words, only 1 viral vector integrates out of 1000 infectious viral vectors (0.3%) or 100 infectious viral vectors (2%).

In the previous experiment we determined the frequency of integration in vivo, but what is not known is how soon after transduction rAAV vector integrates in vivo.

Giruad et al. observed that integration occurred between 24-48 hrs and as soon as 10 hrs post-infection when using an episomal Epstein-Barr virus shuttle vector system to study AAV site-speciﬁc integration events in the AAVS1 locus (19q13.3-qter) [35, 62].

71 Also the free DNA ends of rAAV are rapidly cleared from the cell to protect the integrity of the host genome, often by converting them from ds linear vector DNA to ds circular vector DNA through recombination. Therefore we hypothesize that viral vector integration happens soon after infection rather than later. Mice sacriﬁced at

2 weeks post-infection (pi) have LMW vector DNA ranging from 10-19 viral vector copies/cell, HMW vector DNA ranging from 2-6 viral vector copies/cell and integrated vector DNA ranging from 0.016-0.13 viral vector copies/cell. Mice sacriﬁced at 1 month post-infection have LMW vector DNA ranging from 40-166 copies/cell,

HMW vector DNA ranging from 6-35 viral vector copies/cell and integrated vector

DNA ranging from 0.02-0.14 vector copies/cell. Finally mice sacriﬁced at 6 month mark have LMW vector DNA ranging from 463-1,135 viral vector copies/cell, HMW vector DNA ranging from 7-20 viral vector copies/cell and integrated vector DNA ranging from 0.02-0.06 viral vector copies/cell (Figure 4.7). This is in conformity of studies in mouse models of liver transduction, where integrated AAV vector genomes were present at roughly 0.05 copies/cell [78]. In Figure 4.8 the mouse data was averaged from Figure 4.7 data to conceptualize the frequency of each viral vector form

(monomers, concatemers or integrated) in the hepatocyte more easily. Over time the HMW and integrated viral vector DNA frequency do not change, but what does increase by a log-fold over time, is the monomeric episomal viral vector DNA (Figure

4.8). This suggests that rAAV integrates at an earlier time point such as within 2 weeks, rather than at a later time points (6 months) in hepatocytes, since we see no increase in frequency of integrated viral vector over time. We are unsure as to why we see a signiﬁcant increase in LMW vector DNA over time, since in earlier studies by Duan et al. it has been observed that monomer circularized genomes convert to larger concatemerized circular genomes to maintain long-term persistence in the host

[28]. More speciﬁcally, at 22 days post-infection in muscle tissue, the predominant

72 form of circular intermediates occurred as monomer head-to-tail genomes. At 80 days post-infection the authors retrieved larger fractions of vector circular intermediates, which was indicative of recombination between monomer forms in the generation of large circular multimer genomes.

The C3H/HeJ mouse model is a tumor prone mouse model where males at 14 months have 72-91% hepatomas. It is notable that in these mice rAAV vector integration did not lead to any tumors, despite treatment conditions to enhance vector integration. None of the mice reached 14 months of age during the study, thus it is conceivable that the vector integrants only pose a very low risk of HCC. That is not to say that tumors could have ensued had the virus increased in integration frequency from DSB induction or a long-term monitoring of rAAV vector integration

(12 to 18 months post-infection). Afterall with higher frequency of random rAAV vector integration comes a higher chance of oncogenicity.

Though the C3H/HeJ mouse model does not quantitatively predict the frequency of rAAV vector integration in humans, it can give us an idea of how the viral vector behaves when placed in different environmental circumstances. These studies will prove very beneficial in therapeutic applications. The safety of rAAV gene therapy is primarily determined in controlled clinical trials, the theoretical risks and their underlying mechanisms must continue to be part of active research. Among the questions to be answered would be the actual integration frequency in any given tissue or cell-type, under conditions that reflect the clinical situation. Though in our research we have answered the question regarding integration frequency in HFL-1

ﬁbroblasts and C3H/HeJ mice, it does not mean that it is the same in other animal models or cell-types. Some studies have taken the initiative to assess the consequences of rAAV integration-mediated mutagenesis in vivo, in terms of cell or tissue damage or transformation, by identifying locations of vector insertion in the host chromosome.

73 Additionally assessing the risks of rAAV vector integration frequency, if any, will also provide a useful framework for the evaluation of rAAV vector safety.

74 CHAPTER 6

FUTURE DIRECTIONS

It is important to verify the accuracy of our newly developed gel puriﬁcation method.

To do so we would perform the gel puriﬁcation assay on hirt extracted DNA from the

CPT and H2O2 treated HFL-1 cells and compare that to the integration frequency observed from the serial passage method performed on these cells. Furthermore observing a heightened abundance of monomeric episomal vector (LMW) DNA in transduced mouse hepatocytes in vivo over time was unexpected. It would be of interest to investigate whether the abundance of monomeric (LMW), concatemeric (HMW) and integrated vector DNA will change at time points 12 and 18 months. Finally to establish that we truly detect and measure integrated viral vector genomes, it would be beneﬁcial to see whether vector-chromosome junctions could be isolated by means of LM (Ligation Mediated) PCR and pyrosequencing from gel puriﬁed DNA samples.

75 BIBLIOGRAPHY

[1] M L Aitken, R B Moss, D A Waltz, M E Dovey, M R Tonelli, S C McNamara, R L Gibson, B W Ramsey, B J Carter, and T C Reynolds. A phase i study of aerosolized administration of tgAAVCF to cystic ﬁbrosis subjects with mild lung disease. Human Gene Therapy, 12(15):1907–1916, October 2001. PMID: 11589832.

[2] I E Alexander, D W Russell, A M Spence, and A D Miller. Eﬀects of gamma irradiation on the transduction of dividing and nondividing cells in brain and muscle of rats by adeno-associated virus vectors. Human Gene Therapy, 7(7):841– 850, May 1996. PMID: 8860836.

[3] B Asfour, H A Baba, H H Scheld, R H Hruban, D Hammel, and B J Byrne. Uniform long-term gene expression using adeno-associated virus (AAV) by ex vivo recirculation in rat-cardiac isografts. The Thoracic and Cardiovascular Surgeon, 50(6):347–350, December 2002. PMID: 12457311.

[4] Robert W Atchison, Bruce C Casto, and William McD Hammon. Adenovirus- Associated defective virus particles. Science, 149(3685):754–755, August 1965.

[5] T Athanasopoulos, I R Graham, H Foster, and G Dickson. Recombinant adeno- associated viral (rAAV) vectors as therapeutic tools for duchenne muscular dystrophy (DMD). Gene Therapy, 11 Suppl 1:S109–121, October 2004. PMID: 15454965.

[6] Jeﬀrey S Bartlett, Rose Wilcher, and R. Jude Samulski. Infectious entry pathway of Adeno-Associated virus and Adeno-Associated virus vectors. Journal of Virology, 74(6):2777–2785, March 2000.

[7] S P Becerra, F Koczot, P Fabisch, and J A Rose. Synthesis of adeno-associated virus structural proteins requires both alternative mRNA splicing and alternative initiations from a single transcript. Journal of Virology, 62(8):2745–2754, August 1988. PMID: 2839699 PMCID: 253708.

[8] Michael J Blankinship, Paul Gregorevic, James M Allen, Scott Q Harper, Hollie Harper, Christine L Halbert, A Dusty Miller, Dusty A Miller, and Jeﬀrey S Chamberlain. Eﬃcient transduction of skeletal muscle using vectors based

76 on adeno-associated virus serotype 6. Molecular Therapy: The Journal of the American Society of Gene Therapy, 10(4):671–678, October 2004. PMID: 15451451.

[9] Hildegard Bning, Luca Perabo, Oliver Coutelle, Sibille Quadt-Humme, and Michael Hallek. Recent developments in adeno-associated virus vector tech- nology. The Journal of Gene Medicine, 10(7):717–733, July 2008. PMID: 18452237.

[10] Dawn E Bowles, Scott W J McPhee, Chengwen Li, Steven J Gray, Jade J Samulski, Angelique S Camp, Juan Li, Bing Wang, Paul E Monahan, Joseph E Rabinowitz, Joshua C Grieger, Lakshmanan Govindasamy, Mavis Agbandje- McKenna, Xiao Xiao, and R Jude Samulski. Phase 1 gene therapy for duchenne muscular dystrophy using a translational optimized AAV vector. Molecular Therapy: The Journal of the American Society of Gene Therapy, 20(2):443– 455, February 2012. PMID: 22068425.

[11] L S Chang, Y Shi, and T Shenk. Adeno-associated virus p5 promoter contains an adenovirus E1A-inducible element and a binding site for the major late transcription factor. Journal of Virology, 63(8):3479–3488, August 1989. PMID: 2545917 PMCID: 250925.

[12] Nor Chejanovsky and Barrie J. Carter. Replication of a human parvovirus nonsense mutant in mammalian cells containing an inducible amber suppressor. Virology, 171(1):239–247, July 1989.

[13] Chun-Liang Chen, Ryan L Jensen, Bruce C Schnepp, Mary J Connell, Richard Shell, Thomas J Sferra, Jeﬀrey S Bartlett, K Reed Clark, and Philip R John- son. Molecular characterization of adeno-associated viruses infecting children. Journal of Virology, 79(23):14781–14792, December 2005. PMID: 16282478.

[14] Vivian W Choi, Douglas M McCarty, and R Jude Samulski. Host cell DNA repair pathways in adeno-associated viral genome processing. Journal of Vi- rology, 80(21):10346–10356, November 2006. PMID: 17041215.

[15] Vivian W Choi, R. Jude Samulski, and Douglas M McCarty. Eﬀects of Adeno- Associated virus DNA hairpin structure on recombination. Journal of Virology, 79(11):6801–6807, June 2005.

[16] K R Clark, T J Sferra, W Lo, G Qu, R Chen, and P R Johnson. Gene transfer into the CNS using recombinant adeno-associated virus: analysis of vector DNA forms resulting in sustained expression. Journal of Drug Targeting, 7(4):269– 283, December 1999. PMID: 10682906.

[17] C K Conrad, S S Allen, S A Aﬁone, T C Reynolds, S E Beck, M Fee-Maki, X Barrazza-Ortiz, R Adams, F B Askin, B J Carter, W B Guggino, and

77 T R Flotte. Safety of single-dose administration of an adeno-associated virus (AAV)-CFTR vector in the primate lung. Gene Therapy, 3(8):658–668, August 1996. PMID: 8854091.

[18] V Cottard, D Mulleman, P Bouille, M Mezzina, M C Boissier, and N Bessis. Adeno-associated virus-mediated delivery of IL-4 prevents collagen-induced arthri- tis. Gene Therapy, 7(22):1930–1939, November 2000. PMID: 11127581.

[19] Andrew M Davidoﬀ, Catherine Y C Ng, Susan Sleep, John Gray, Selina Azam, Yuan Zhao, Jenny H McIntosh, Morteza Karimipoor, and Amit C Nathwani. Puriﬁcation of recombinant adeno-associated virus type 8 vectors by ion exchange chromatography generates clinical grade vector stock. Journal of Viro- logical Methods, 121(2):209–215, November 2004. PMID: 15381358.

[20] Shyam Daya and Kenneth I Berns. Gene therapy using Adeno-Associated virus vectors. Clinical Microbiology Reviews, 21(4):583–593, October 2008.

[21] David R Deyle and David W Russell. Adeno-associated virus vector integration. Current Opinion in Molecular Therapeutics, 11(4):442–447, August 2009. PMID: 19649989.

[22] W. Ding, L. Zhang, Z. Yan, and J F Engelhardt. Intracellular traﬃcking of adeno-associated viral vectors. Gene Therapy, 12(11):873–880, April 2005.

[23] Jian-Yun Dong, Pei-Dong Fan, and Raymond A. Frizzell. Quantitative analysis of the packaging capacity of recombinant Adeno-Associated virus. Human Gene Therapy, 7(17):2101–2112, November 1996.

[24] A Donsante, C Vogler, N Muzyczka, J M Crawford, J Barker, T Flotte, M Campbell- Thompson, T Daly, and M S Sands. Observed incidence of tumorigenesis in long-term rodent studies of rAAV vectors. Gene Therapy, 8(17):1343–1346, September 2001. PMID: 11571571.

[25] Anthony Donsante, Daniel G Miller, Yi Li, Carole Vogler, Elizabeth M Brunt, David W Russell, and Mark S Sands. AAV vector integration sites in mouse hepatocellular carcinoma. Science, 317(5837):477–477, July 2007.

[26] D Duan, Y Yue, Z Yan, Jr McCray, P B, and J F Engelhardt. Polarity influences the efficiency of recombinant adenoassociated virus infection in differentiated airway epithelia. Human Gene Therapy, 9(18):2761–2776, December 1998. PMID: 9874274.

[27] Dongsheng Duan, Qiang Li, Aimee W Kao, Yongping Yue, Jeﬀrey E Pessin, and John F Engelhardt. Dynamin is required for recombinant Adeno-Associated virus type 2 infection. Journal of Virology, 73(12):10371–10376, December 1999.

78 [28] Dongsheng Duan, Prerna Sharma, Jusan Yang, Yongping Yue, Lorita Dudus, Yulong Zhang, Krishna J. Fisher, and John F. Engelhardt. Circular intermediates of recombinant Adeno-Associated virus have deﬁned structural characteristics responsible for Long-Term episomal persistence in muscle tissue. Journal of Virology, 72(11):8568–8577, November 1998. PMID: 9765395 PMCID: 110267.

[29] Krishna J. Fisher, Karin Jooss, James Alston, Yiping Yang, Sarah Ehlen Haecker, Katherine High, Ravindra Pathak, Steven E. Raper, and James M. Wilson. Recombinant adeno-associated virus for muscle directed gene therapy. Nature Medicine, 3(3):306–312, March 1997.

[30] T Flotte, B Carter, C Conrad, W Guggino, T Reynolds, B Rosenstein, G Taylor, S Walden, and R Wetzel. A phase i study of an adeno-associated virus-CFTR gene vector in adult CF patients with mild lung disease. Human Gene Therapy, 7(9):1145–1159, June 1996. PMID: 8773517.

[31] T R Flotte, S A Aﬁone, C Conrad, S A McGrath, R Solow, H Oka, P L Zeitlin, W B Guggino, and B J Carter. Stable in vivo expression of the cystic ﬁbrosis transmembrane conductance regulator with an adeno-associated virus vector. Proceedings of the National Academy of Sciences of the United States of America, 90(22):10613–10617, November 1993. PMID: 7504271 PMCID: 47827.

[32] Guang-Ping Gao, Mauricio R Alvira, Lili Wang, Roberto Calcedo, Julie John- ston, and James M Wilson. Novel Adeno-Associated viruses from rhesus monkeys as vectors for human gene therapy. Proceedings of the National Academy of Sciences, 99(18):11854–11859, September 2002.

[33] Guangping Gao, Luk H Vandenberghe, Mauricio R Alvira, You Lu, Roberto Calcedo, Xiangyang Zhou, and James M Wilson. Clades of Adeno-Associated viruses are widely disseminated in human tissues. Journal of Virology, 78(12):6381– 6388, June 2004.

[34] B Georg-Fries, S Biederlack, J Wolf, and H zur Hausen. Analysis of proteins, helper dependence, and seroepidemiology of a new human parvovirus. Virology, 134(1):64–71, April 1984. PMID: 6200995.

[35] C Giraud, E Winocour, and K I Berns. Site-speciﬁc integration by adeno- associated virus is directed by a cellular DNA sequence. Proceedings of the National Academy of Sciences of the United States of America, 91(21):10039– 10043, October 1994. PMID: 7937833.

[36] Anne Girod, Christiane E Wobus, Zoltn Zdori, Martin Ried, Kristin Leike, Peter Tijssen, Jrgen A Kleinschmidt, and Michael Hallek. The VP1 capsid protein of adeno-associated virus type 2 is carrying a phospholipase a2 domain

79 required for virus infectivity. The Journal of General Virology, 83(Pt 5):973– 978, May 2002. PMID: 11961250.

[37] Manuel AFV Gonalves. Adeno-associated virus: from defective virus to eﬀec- tive vector. Virology Journal, 2(1):43, May 2005.

[38] C L Halbert, J M Allen, and A D Miller. Adeno-associated virus type 6 (AAV6) vectors mediate eﬃcient transduction of airway epithelial cells in mouse lungs compared to that of AAV2 vectors. Journal of Virology, 75(14):6615–6624, July 2001. PMID: 11413329.

[39] Jonathan Hansen, Keyun Qing, Hyung-Joo Kwon, Cathryn Mah, and Arun Srivastava. Impaired intracellular trafficking of Adeno-Associated virus type 2 vectors limits efficient transduction of murine fibroblasts. Journal of Virology, 74(2):992–996, January 2000. PMID: 10623762 PMCID: 111620.

[40] William W Hauswirth and Laurent Beaufrere. Ocular gene therapy: Quo vadis? Investigative Ophthalmology & Visual Science, 41(10):2821–2826, September 2000.

[41] R W Herzog, E Y Yang, L B Couto, J N Hagstrom, D Elwell, P A Fields, M Bur- ton, D A Bellinger, M S Read, K M Brinkhous, G M Podsakoﬀ, T C Nichols, G J Kurtzman, and K A High. Long-term correction of canine hemophilia b by gene transfer of blood coagulation factor IX mediated by adeno-associated viral vector. Nature Medicine, 5(1):56–63, January 1999. PMID: 9883840.

[42] Roli Hirata, Joel Chamberlain, Rong Dong, and David W Russell. Targeted transgene insertion into human chromosomes by adeno-associated virus vectors. Nature Biotechnology, 20(7):735–738, July 2002. PMID: 12089561.

[43] M D Hoggan, N R Blacklow, and W P Rowe. Studies of small DNA viruses found in various adenovirus preparations: Physical, biological, and immunologi- cal characteristics. Proceedings of the National Academy of Sciences, 55(6):1467– 1474, June 1966.

[44] Daniela Hser, Andreas Gogol-Dring, Timo Lutter, Stefan Weger, Kerstin Win- ter, Eva-Maria Hammer, Toni Cathomen, Knut Reinert, and Regine Heilbronn. Integration preferences of wildtype AAV-2 for consensus Rep-Binding sites at numerous loci in the human genome. PLoS Pathog, 6(7):e1000985, July 2010.

[45] Daniela Hser, Stefan Weger, and Regine Heilbronn. Kinetics and frequency of Adeno-Associated virus Site-Speciﬁc integration into human chromosome 19 monitored by quantitative Real-Time PCR. Journal of Virology, 76(15):7554– 7559, August 2002.

80 [46] Katsuya Inagaki, Susanna M Lewis, Xiaolin Wu, Congrong Ma, David J Munroe, Sally Fuess, Theresa A Storm, Mark A Kay, and Hiroyuki Nakai. DNA palindromes with a modest arm length of greater, similar 20 base pairs are a significant target for recombinant adeno-associated virus vector integration in the liver, muscles, and heart in mice. Journal of Virology, 81(20):11290–11303, October 2007. PMID: 17686840. [47] N Inoue, R Dong, R K Hirata, and D W Russell. Introduction of single base substitutions at homologous chromosomal sequences by adeno-associated virus vectors. Molecular Therapy: The Journal of the American Society of Gene Therapy, 3(4):526–530, April 2001. PMID: 11319913. [48] N Inoue, R K Hirata, and D W Russell. High-fidelity correction of mutations at multiple chromosomal positions by adeno-associated virus vectors. Journal of Virology, 73(9):7376–7380, September 1999. PMID: 10438827. [49] J E Janik, M M Huston, K Cho, and J A Rose. Efficient synthesis of adeno- associated virus structural proteins requires both adenovirus DNA binding protein and VA i RNA. Virology, 168(2):320–329, February 1989. PMID: 2536986. [50] M A Kay, C S Manno, M V Ragni, P J Larson, L B Couto, A McClelland, B Glader, A J Chew, S J Tai, R W Herzog, V Arruda, F Johnson, C Scallan, E Skarsgard, A W Flake, and K A High. Evidence for gene transfer and expression of factor IX in haemophilia b patients treated with an AAV vector. Nature Genetics, 24(3):257–261, March 2000. PMID: 10700178. [51] Jason A. King, Ralf Dubielzig, Dirk Grimm, and J|[uuml]|rgen A. Kleinschmidt. DNA helicase-mediated packaging of adeno-associated virus type 2 genomes into preformed capsids. The EMBO Journal, 20(12):3282–3291, June 2001. [52] R. M. Kotin. Site-Specific integration by Adeno-Associated virus. Proceedings of the National Academy of Sciences, 87(6):2211–2215, March 1990. [53] R M Kotin, R M Linden, and K I Berns. Characterization of a preferred site on human chromosome 19q for integration of adeno-associated virus DNA by non- homologous recombination. The EMBO Journal, 11(13):5071–5078, December 1992. PMID: 1334463 PMCID: 556985. [54] Chooi May Lai, Yvonne K. Y. Lai, and P. Elizabeth Rakoczy. Adenovirus and Adeno-Associated virus vectors. DNA and Cell Biology, 21(12):895–913, December 2002. [55] Hojun Li, Nirav Malani, Shari R Hamilton, Alexander Schlachterman, Giulio Bussadori, Shyrie E Edmonson, Rachel Shah, Valder R Arruda, Federico Min- gozzi, J Fraser Wright, Frederic D Bushman, and Katherine A High. As- sessing the potential for AAV vector genotoxicity in a murine model. Blood, 117(12):3311–3319, March 2011. PMID: 21106988. 81 [56] E Lusby, K H Fife, and K I Berns. Nucleotide sequence of the inverted terminal repetition in adeno-associated virus DNA. Journal of Virology, 34(2):402–409, May 1980. PMID: 6246271 PMCID: 288718.

[57] Curtis A. Machida, Matthew D. Weitzman, Samuel M. Young, Toni Cathomen, and Richard Jude Samulski. Targeted integration by Adeno-Associated virus. In Viral Vectors for Gene Therapy, volume 76, pages 201–220. Humana Press, New Jersey.

[58] Ajay K Malik, Paul E Monahan, David L Allen, Bing-Guan Chen, R. Jude Samulski, and Kotoku Kurachi. Kinetics of recombinant Adeno-Associated Virus-Mediated gene transfer. Journal of Virology, 74(8):3555–3565, April 2000.

[59] D M McCarty, H Fu, P E Monahan, C E Toulson, P Naik, and R J Samulski. Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther- apy, 10(26):2112–2118, December 2003. PMID: 14625565.

[60] D M McCarty, P E Monahan, and R J Samulski. Self-complementary recombinant adeno-associated virus (scAAV) vectors promote eﬃcient transduction independently of DNA synthesis. Gene Therapy, 8(16):1248–1254, August 2001. PMID: 11509958.

[61] Douglas M McCarty. Self-complementary AAV vectors; advances and applications. Molecular Therapy: The Journal of the American Society of Gene Therapy, 16(10):1648–1656, October 2008. PMID: 18682697.

[62] Douglas M McCarty, Jr Young, Samuel M, and R Jude Samulski. Integration of adeno-associated virus (AAV) and recombinant AAV vectors. Annual Review of Genetics, 38:819–845, 2004. PMID: 15568995.

[63] T J McCown, X Xiao, J Li, G R Breese, and R J Samulski. Diﬀerential and persistent expression patterns of CNS gene transfer by an adeno-associated virus (AAV) vector. Brain Research, 713(1-2):99–107, March 1996. PMID: 8724980.

[64] Alberto C. Mello Filho and Rogerio Meneghini. In vivo formation of single- strand breaks in DNA by hydrogen peroxide is mediated by the Haber-Weiss reaction. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expres- sion, 781(12):56–63, February 1984.

[65] Patricio Meneses, Kenneth I Berns, and Ernest Winocour. DNA sequence motifs which direct Adeno-Associated virus Site-Speciﬁc integration in a model system. Journal of Virology, 74(13):6213–6216, July 2000.

82 [66] C H Miao, R O Snyder, D B Schowalter, G A Patijn, B Donahue, B Winther, and M A Kay. The kinetics of rAAV integration in the liver. Nature Genetics, 19(1):13–15, May 1998. PMID: 9590280. [67] Daniel G Miller, Lisa M Petek, and David W Russell. Adeno-associated virus vectors integrate at chromosome breakage sites. Nature Genetics, 36(7):767– 773, July 2004. PMID: 15208627. [68] Daniel G Miller, Elizabeth A Rutledge, and David W Russell. Chromosomal effects of adeno-associated virus vector integration. Nature Genetics, 30(2):147– 148, February 2002. PMID: 11799395. [69] Daniel G Miller, Grant D Trobridge, Lisa M Petek, Michael A Jacobs, Ra- jinder Kaul, and David W Russell. Large-scale analysis of adeno-associated virus vector integration sites in normal human cells. Journal of Virology, 79(17):11434–11442, September 2005. PMID: 16103194. [70] P E Monahan, R J Samulski, J Tazelaar, X Xiao, T C Nichols, D A Bellinger, M S Read, and C E Walsh. Direct intramuscular injection with recombinant AAV vectors results in sustained expression in a dog model of hemophilia. Gene Therapy, 5(1):40–49, January 1998. PMID: 9536263. [71] Richard B Moss, David Rodman, L Terry Spencer, Moira L Aitken, Pamela L Zeitlin, David Waltz, Carlos Milla, Alan S Brody, John P Clancy, Bonnie Ramsey, Nicole Hamblett, and Alison E Heald. Repeated adeno-associated virus serotype 2 aerosol-mediated cystic fibrosis transmembrane regulator gene transfer to the lungs of patients with cystic fibrosis: a multicenter, double- blind, placebo-controlled trial. Chest, 125(2):509–521, February 2004. PMID: 14769732. [72] C Mueller and T R Flotte. Clinical gene therapy using recombinant adeno- associated virus vectors. Gene Therapy, 15(11):858–863, June 2008. PMID: 18418415. [73] H Nakai, Y Iwaki, M A Kay, and L B Couto. Isolation of recombinant adeno- associated virus vector-cellular DNA junctions from mouse liver. Journal of Virology, 73(7):5438–5447, July 1999. PMID: 10364291. [74] Hiroyuki Nakai, Eugenio Montini, Sally Fuess, Theresa A Storm, Markus Grompe, and Mark A Kay. AAV serotype 2 vectors preferentially integrate into active genes in mice. Nature Genetics, 34(3):297–302, July 2003. PMID: 12778174. [75] Hiroyuki Nakai, Eugenio Montini, Sally Fuess, Theresa A Storm, Leonard Meuse, Milton Finegold, Markus Grompe, and Mark A Kay. Helper-independent and AAV-ITR-independent chromosomal integration of double-stranded linear DNA vectors in mice. Molecular Therapy: The Journal of the American Society of Gene Therapy, 7(1):101–111, January 2003. PMID: 12573623. 83 [76] Hiroyuki Nakai, Theresa A. Storm, and Mark A. Kay. Recruitment of Single- Stranded recombinant Adeno-Associated virus vector genomes and intermolecular recombination are responsible for stable transduction of liver in vivo. Jour- nal of Virology, 74(20):9451–9463, October 2000. PMID: 11000214 PMCID: 112374. [77] Hiroyuki Nakai, Xiaolin Wu, Sally Fuess, Theresa A Storm, David Munroe, Eugenio Montini, Shawn M Burgess, Markus Grompe, and Mark A Kay. Large- Scale molecular characterization of Adeno-Associated virus vector integration in mouse liver. Journal of Virology, 79(6):3606–3614, March 2005. [78] Hiroyuki Nakai, Stephen R Yant, Theresa A Storm, Sally Fuess, Leonard Meuse, and Mark A Kay. Extrachromosomal recombinant adeno-associated virus vector genomes are primarily responsible for stable liver transduction in vivo. Jour- nal of Virology, 75(15):6969–6976, 2001. [79] A C Nathwani, A M Davidoff, and E G D Tuddenham. Prospects for gene therapy of haemophilia. Haemophilia: The Official Journal of the World Federation of Hemophilia, 10(4):309–318, July 2004. PMID: 15230943. [80] Amit C Nathwani, Cecilia Rosales, Jenny McIntosh, Ghasem Rastegarlari, Devhrut Nathwani, Deepak Raj, Sushmita Nawathe, Simon N Waddington, Roderick Bronson, Scott Jackson, Robert E Donahue, Katherine A High, Fed- erico Mingozzi, Catherine Y C Ng, Junfang Zhou, Yunyu Spence, M Beth McCarville, Marc Valentine, James Allay, John Coleman, Susan Sleep, John T Gray, Arthur W Nienhuis, and Andrew M Davidoff. Long-term safety and efficacy following systemic administration of a self-complementary AAV vector encoding human FIX pseudotyped with serotype 5 and 8 capsid proteins. Molecular Therapy: The Journal of the American Society of Gene Therapy, 19(5):876–885, May 2011. PMID: 21245849. [81] Amit C. Nathwani, Edward G.D. Tuddenham, Savita Rangarajan, Cecilia Ros- ales, Jenny McIntosh, David C. Linch, Pratima Chowdary, Anne Riddell, Ar- nulfo Jaquilmac Pie, Chris Harrington, James O’Beirne, Keith Smith, John Pasi, Bertil Glader, Pradip Rustagi, Catherine Y.C. Ng, Mark A. Kay, Jun- fang Zhou, Yunyu Spence, Christopher L. Morton, James Allay, John Cole- man, Susan Sleep, John M. Cunningham, Deokumar Srivastava, Etiena Basner- Tschakarjan, Federico Mingozzi, Katherine A. High, John T. Gray, Ulrike M. Reiss, Arthur W. Nienhuis, and Andrew M. Davidoff. Adenovirus-Associated virus VectorMediated gene transfer in hemophilia b. New England Journal of Medicine, 365(25):2357–2365, December 2011. [82] Guy L Odom, Paul Gregorevic, and Jeffrey S Chamberlain. Viral-mediated gene therapy for the muscular dystrophies: successes, limitations and recent advances. Biochimica Et Biophysica Acta, 1772(2):243–262, February 2007. PMID: 17064882. 84 [83] Phyllis Ogston, Kenneth Raj, and Peter Beard. Productive replication of Adeno-Associated virus can occur in human papillomavirus type 16 (HPV-16) Episome-Containing keratinocytes and is augmented by the HPV-16 e2 protein. Journal of Virology, 74(8):3494–3504, April 2000. [84] D J Pereira, D M McCarty, and N. Muzyczka. The Adeno-Associated virus (AAV) rep protein acts as both a repressor and an activator to regulate AAV transcription during a productive infection. Journal of Virology, 71(2):1079– 1088, February 1997. [85] Yves Pommier. Topoisomerase i inhibitors: camptothecins and beyond. Nature Reviews. Cancer, 6(10):789–802, October 2006. PMID: 16990856. [86] Matthew H Porteus, Toni Cathomen, Matthew D Weitzman, and David Balti- more. Efficient gene targeting mediated by Adeno-Associated virus and DNA Double-Strand breaks. Molecular and Cellular Biology, 23(10):3558–3565, May 2003. [87] J E Rabinowitz and J Samulski. Adeno-associated virus expression systems for gene transfer. Current Opinion in Biotechnology, 9(5):470–475, October 1998. PMID: 9821274. [88] Victor M Rivera, Guang-ping Gao, Rebecca L Grant, Michael A Schnell, Philip W Zoltick, Leonard W Rozamus, Tim Clackson, and James M Wilson. Long-term pharmacologically regulated expression of erythropoietin in primates following AAV-mediated gene transfer. Blood, 105(4):1424–1430, February 2005. PMID: 15507527. [89] D W Russell, I E Alexander, and A D Miller. DNA synthesis and topoisomerase inhibitors increase transduction by adeno-associated virus vectors. Proceedings of the National Academy of Sciences of the United States of Amer- ica, 92(12):5719–5723, June 1995. PMID: 7777575 PMCID: PMC41768. [90] D W Russell, A D Miller, and I E Alexander. Adeno-associated virus vectors preferentially transduce cells in s phase. Proceedings of the National Academy of Sciences of the United States of America, 91(19):8915–8919, September 1994. PMID: 8090744. [91] David W Russell. AAV loves an active genome. Nature Genetics, 34(3):241– 242, July 2003. PMID: 12833043. [92] David W. Russell and Roll K. Hirata. Human gene targeting by viral vectors. Nature Genetics, 18(4):325–330, April 1998. [93] E A Rutledge and D W Russell. Adeno-associated virus vector integration junctions. Journal of Virology, 71(11):8429–8436, November 1997. PMID: 9343199. 85 [94] R J Samulski, K I Berns, M Tan, and N Muzyczka. Cloning of adeno-associated virus into pBR322: rescue of intact virus from the recombinant plasmid in human cells. Proceedings of the National Academy of Sciences of the United States of America, 79(6):2077–2081, March 1982. PMID: 6281795. [95] R J Samulski and T Shenk. Adenovirus E1B 55-Mr polypeptide facilitates timely cytoplasmic accumulation of adeno-associated virus mRNAs. Journal of Virology, 62(1):206–210, January 1988. PMID: 2824848 PMCID: 250520. [96] S Sanlioglu, P K Benson, J Yang, E M Atkinson, T Reynolds, and J F En- gelhardt. Endocytosis and nuclear trafficking of adeno-associated virus type 2 are controlled by rac1 and phosphatidylinositol-3 kinase activation. Journal of Virology, 74(19):9184–9196, October 2000. PMID: 10982365. [97] S Sanlioglu and J F Engelhardt. Cellular redox state alters recombinant adeno- associated virus transduction through tyrosine phosphatase pathways. Gene Therapy, 6(8):1427–1437, August 1999. PMID: 10467367. [98] J R Schlehofer, M Ehrbar, and H zur Hausen. Vaccinia virus, herpes simplex virus, and carcinogens induce DNA amplification in a human cell line and support replication of a helpervirus dependent parvovirus. Virology, 152(1):110– 117, July 1986. PMID: 3012864. [99] Michael Schmidt, Antonis Voutetakis, Sandra Afione, Changyu Zheng, Danielle Mandikian, and John A. Chiorini. Adeno-Associated virus type 12 (AAV12): a novel AAV serotype with sialic acid- and heparan sulfate Proteoglycan-Independent transduction activity. Journal of Virology, 82(3):1399–1406, February 2008. PMID: 18045941 PMCID: 2224443. [100] Bruce C Schnepp, K. Reed Clark, Dori L Klemanski, Christina A Pacak, and Philip R Johnson. Genetic fate of recombinant Adeno-Associated virus vector genomes in muscle. Journal of Virology, 77(6):3495–3504, March 2003. [101] Bruce C Schnepp, Ryan L Jensen, Chun-Liang Chen, Philip R Johnson, and K Reed Clark. Characterization of adeno-associated virus genomes isolated from human tissues. Journal of Virology, 79(23):14793–14803, December 2005. PMID: 16282479. [102] Rachel A Schwartz, Jose Alejandro Palacios, Geoffrey D Cassell, Sarah Adam, Mauro Giacca, and Matthew D Weitzman. The Mre11/Rad50/Nbs1 complex limits Adeno-Associated virus transduction and replication. Journal of Virol- ogy, 81(23):12936–12945, December 2007. [103] Jeannine M Scott, Sheng Li, Scott Q Harper, Robert Welikson, Daniel Bourque, Christiana DelloRusso, Stephen D Hauschka, and Jeffrey S Chamberlain. Viral vectors for gene transfer of micro-, mini-, or full-length dystrophin. Neuromus- cular Disorders: NMD, 12 Suppl 1:S23–29, October 2002. PMID: 12206791. 86 [104] Georg Seisenberger, Martin U Ried, Thomas Endre, Hildegard Bning, Michael Hallek, and Christoph Bruchle. Real-Time Single-Molecule imaging of the infection pathway of an Adeno-Associated virus. Science, 294(5548):1929–1932, November 2001.

[105] Y Shi, E Seto, L S Chang, and T Shenk. Transcriptional repression by YY1, a human GLI-Krppel-related protein, and relief of repression by adenovirus E1A protein. Cell, 67(2):377–388, October 1991. PMID: 1655281.

[106] R O Snyder, C H Miao, G A Patijn, S K Spratt, O Danos, D Nagy, A M Gown, B Winther, L Meuse, L K Cohen, A R Thompson, and M A Kay. Persistent and therapeutic concentrations of human factor IX in mice after hepatic gene transfer of recombinant AAV vectors. Nature Genetics, 16(3):270–276, July 1997. PMID: 9207793.

[107] Jrg M Sommer, Peter H Smith, Sumathy Parthasarathy, Jesse Isaacs, Sharmila Vijay, Jane Kieran, Sharon K Powell, Alan McClelland, and J Fraser Wright. Quantiﬁcation of adeno-associated virus particles and empty capsids by optical density measurement. Molecular Therapy: The Journal of the American Society of Gene Therapy, 7(1):122–128, January 2003. PMID: 12573625.

[108] S Song, J Embury, P J Laipis, K I Berns, J M Crawford, and T R Flotte. Stable therapeutic serum levels of human alpha-1 antitrypsin (AAT) after portal vein injection of recombinant adeno-associated virus (rAAV) vectors. Gene Therapy, 8(17):1299–1306, September 2001. PMID: 11571566.

[109] S Song, M Morgan, T Ellis, A Poirier, K Chesnut, J Wang, M Brantly, N Muzy- czka, B J Byrne, M Atkinson, and T R Flotte. Sustained secretion of human alpha-1-antitrypsin from murine muscle transduced with adeno-associated virus vectors. Proceedings of the National Academy of Sciences of the United States of America, 95(24):14384–14388, November 1998. PMID: 9826709.

[110] Sihong Song, Philip J. Laipis, Kenneth I. Berns, and Terence R. Flotte. Eﬀect of DNA-dependent protein kinase on the molecular fate of the rAAV2 genome in skeletal muscle. Proceedings of the National Academy of Sciences of the United States of America, 98(7):4084–4088, March 2001. PMID: 11274433 PMCID: 31183.

[111] A Srivastava, E W Lusby, and K I Berns. Nucleotide sequence and organization of the adeno-associated virus 2 genome. Journal of Virology, 45(2):555–564, February 1983. PMID: 6300419 PMCID: 256449.

[112] Arun Srivastava. Adenoassociated virusmediated gene transfer. Journal of Cellular Biochemistry, 105(1):17–24, September 2008.

87 [113] Travis H Stracker, Geoffrey D Cassell, Peter Ward, Yueh-Ming Loo, Bas Van Breuke- len, Stacy D Carrington-Lawrence, Robert K Hamatake, Peter C Van Der Vliet, Sandra K Weller, Thomas Melendy, and Matthew D Weitzman. The rep protein of Adeno-Associated virus type 2 interacts with Single-Stranded DNA-Binding proteins that enhance viral replication. Journal of Virology, 78(1):441–453, January 2004. [114] Candace Summerford and Richard Jude Samulski. Membrane-Associated heparan sulfate proteoglycan is a receptor for Adeno-Associated virus type 2 virions. Journal of Virology, 72(2):1438–1445, February 1998. [115] S Teramoto, T Tomita, H Matsui, E Ohga, T Matsuse, and Y Ouchi. Hydrogen peroxide-induced apoptosis and necrosis in human lung fibroblasts: protective roles of glutathione. Japanese Journal of Pharmacology, 79(1):33–40, January 1999. PMID: 10082315. [116] Ana Vasileva and Rolf Jessberger. Precise hit: adeno-associated virus in gene targeting. Nature Reviews Microbiology, 3(11):837–847, October 2005. [117] Michael M Vilenchik and Alfred G Knudson. Endogenous DNA double-strand breaks: production, fidelity of repair, and induction of cancer. Proceed- ings of the National Academy of Sciences of the United States of America, 100(22):12871–12876, October 2003. PMID: 14566050. [118] Nathalie Vincent-Lacaze, Richard O Snyder, Rgis Gluzman, Delphine Bohl, Catherine Lagarde, and Olivier Danos. Structure of Adeno-Associated virus vector DNA following transduction of the skeletal muscle. Journal of Virology, 73(3):1949–1955, March 1999. [119] C Walz, A Deprez, T Dupressoir, M Drst, M Rabreau, and J R Schlehofer. Interaction of human papillomavirus type 16 and adeno-associated virus type 2 co-infecting human cervical epithelium. The Journal of General Virology, 78 ( Pt 6):1441–1452, June 1997. PMID: 9191942. [120] Peter Ward, Frank B. Dean, Michael E. ODonnell, and Kenneth I. Berns. Role of the adenovirus DNA-Binding protein in in vitro Adeno-Associated virus DNA replication. Journal of Virology, 72(1):420–427, January 1998. PMID: 9420241 PMCID: 109390. [121] Kenneth H Warrington, Oleg S Gorbatyuk, Jeffrey K Harrison, Shaun R Opie, Sergei Zolotukhin, and Nicholas Muzyczka. Adeno-Associated virus type 2 VP2 capsid protein is nonessential and can tolerate large peptide insertions at its n terminus. Journal of Virology, 78(12):6595–6609, June 2004. [122] M D Weitzman, K J Fisher, and J M Wilson. Recruitment of wild-type and recombinant adeno-associated virus into adenovirus replication centers. Journal of Virology, 70(3):1845–1854, March 1996. PMID: 8627709. 88 [123] M D Weitzman, S R Kysti, R M Kotin, and R A Owens. Adeno-associated virus (AAV) rep proteins mediate complex formation between AAV DNA and its integration site in human DNA. Proceedings of the National Academy of Sciences of the United States of America, 91(13):5808–5812, June 1994. PMID: 8016070 PMCID: 44086.

[124] Matthew D Weitzman, Christian T Carson, Rachel A Schwartz, and Caroline E Lilley. Interactions of viruses with the cellular DNA repair machinery. DNA Repair, 3(8-9):1165–1173, September 2004. PMID: 15279805.

[125] Matthew D Weitzman and R Michael Linden. Adeno-associated virus biology. Methods in Molecular Biology (Clifton, N.J.), 807:1–23, 2011. PMID: 22034024.

[126] J. Weltner, A. Anisimov, K. Alitalo, T. Otonkoski, and R. Trokovic. iPSC clones reprogrammed via rAAV-Mediated transduction contain integrated vector sequences. Journal of Virology, February 2012.

[127] Jianqing Wu, Weihong Zhao, Li Zhong, Zongchao Han, Baozheng Li, Wenqin Ma, Kirsten A Weigel-Kelley, Kenneth H Warrington, and Arun Srivastava. Self-complementary recombinant adeno-associated viral vectors: packaging capacity and the role of rep proteins in vector purity. Human Gene Therapy, 18(2):171–182, February 2007. PMID: 17328683.

[128] Wu Xiao, Jr Warrington, Kenneth H, Patrick Hearing, Jeﬀrey Hughes, and Nicholas Muzyczka. Adenovirus-facilitated nuclear translocation of adeno- associated virus type 2. Journal of Virology, 76(22):11505–11517, November 2002. PMID: 12388712.

[129] X Xiao, J Li, and R J Samulski. Eﬃcient long-term gene transfer into muscle tissue of immunocompetent mice by adeno-associated virus vector. Journal of Virology, 70(11):8098–8108, November 1996. PMID: 8892935 PMCID: 190884.

[130] X Xiao, J Li, and R J Samulski. Production of high-titer recombinant adeno- associated virus vectors in the absence of helper adenovirus. Journal of Virol- ogy, 72(3):2224–2232, March 1998. PMID: 9499080.

[131] X Xiao, W Xiao, J Li, and R J Samulski. A novel 165-base-pair terminal repeat sequence is the sole cis requirement for the adeno-associated virus life cycle. Journal of Virology, 71(2):941–948, February 1997. PMID: 8995611.

[132] Jusan Yang, Weihong Zhou, Yulong Zhang, Terese Zidon, Terry Ritchie, and John F Engelhardt. Concatamerization of Adeno-Associated virus circular genomes occurs through intermolecular recombination. Journal of Virology, 73(11):9468–9477, November 1999.

89 [133] Z Zdori, J Szelei, M C Lacoste, Y Li, S Garipy, P Raymond, M Allaire, I R Nabi, and P Tijssen. A viral phospholipase a2 is required for parvovirus infectivity. Developmental Cell, 1(2):291–302, August 2001. PMID: 11702787.

[134] L Zentilin, A Marcello, and M Giacca. Involvement of cellular double-stranded DNA break binding proteins in processing of the recombinant adeno-associated virus genome. Journal of Virology, 75(24):12279–12287, December 2001. PMID: 11711618.

[135] Tong Zhu, Liqiao Zhou, Satsuki Mori, Zhong Wang, Charles F McTiernan, Chunping Qiao, Chunlian Chen, Dao Wen Wang, Juan Li, and Xiao Xiao. Sustained whole-body functional rescue in congestive heart failure and muscular dystrophy hamsters by systemic gene transfer. Circulation, 112(17):2650–2659, October 2005. PMID: 16230483.

[136] S Zolotukhin, B J Byrne, E Mason, I Zolotukhin, M Potter, K Chesnut, C Sum- merford, R J Samulski, and N Muzyczka. Recombinant adeno-associated virus puriﬁcation using novel methods improves infectious titer and yield. Gene Therapy, 6(6):973–985, June 1999. PMID: 10455399.