12/28/2018 Supplement R2.htm
Supplemental Table 1. Exome variant filtering strategy
Steps Strategy taken
Start Total variants called across family members with
Step 1 Excluding synonymous variants
Step 2 Excluding segmental duplica ons >2 a
Step 3 Excluding variants with MAF >3% in ExAC, 1000Genomes or ESP
Step 4 Excluding variants that appear >2 mes in an internal control popula on
Step 5 Excluding variants that do not appear in the DBA cases and obligate carriers
a Based on UCSC genomicSuperDups track Abbreviations: MAF: minor allele frequency; ESP: Exome sequencing project variant database Supplemental Table 2. Primer sequences used in variant validation by family and gene
Gene Chromosome Posi on Reference Variant Panel/Primers Forward primer Reference primer nucleo de nucleo de CAGCTTGTATTCCTCTTCTTTCCCT RPL35A chr3 197680960 T A Ion AmpliSeq Designer GATTCATCAGACGTCCATTTTGCTAAA
RPL15 chr3 23960685 A G Ion Torrent PGM Sequencer/IDT Primers AAAGACTCTTGTCTGGTGGTGAAC GACTCTCAGAGCCCCACAGTG
RPL5 chr1 93306307 T C Ion Torrent PGM Sequencer/IDT Primers GACTGTTGGTGTAATTGTGC TCTGAGGCTAACACATTTCCATC
RPL35 chr9 127620338 C G Ion Torrent PGM Sequencer/IDT Primers ATCAGTGGAAGTGCCAGGAAAC GGTCCTTGGATTCACCCTGC
RPL18 chr19 49120619 A G Ion AmpliSeq Designer CCTCCCTTCCAGACAGACAAG TCATCATGTGTTTGCCCCTTCA
RPS19 chr19 42365221 A C Ion AmpliSeq Designer GGCACAGCATAGTTGTGTTGAG CAGAGGAGACAGGGAAGTATGGT
RPL4 chr15 66791818 G C Ion AmpliSeq Designer AAAAATTCTAACCAAGCTTTACA GTGTTAAGAAGCAGAAGAAGCCTCT GAGCA
RPS10 chr6 34392470 C A Ion AmpliSeq Designer TTGTCCCTTACACAAAAGAAACTATCTTCA GCTTCTACTTAACGCCTTAACAGTAGT
RPS19 chr19 42365276 G T Ion AmpliSeq Designer GGCACAGCATAGTTGTGTTGAG CAGAGGAGACAGGGAAGTATGGT
RPS19 chr19 42375419 G T Ion AmpliSeq Designer GGGAATACCCACAGTGAGAATTAGAT AAAAAGAGACCCAGACCAGGATTAC
RPS26 chr12 56435951 A G Ion AmpliSeq Designer GTTCTTGAAGCCCGTCTCCTA CAAATGAAATGTACACTCGGTCCAC
Supplemental Table 3. Genes of interest in DBA included in array Comparative Genomic Hybridization (aCGH)
Genes of interest in Diamond-Blackfan Anemia BMS1 RPL21 RPL3L RPS23 EMG1 RPL22 RPL4 RPS24 FAU RPL22L1 RPL41 RPS25 FCF1 RPL23 RPL5 RPS26 IMP3 RPL23A RPL6 RPS27 IMP4 RPL24 RPL7 RPS27A LSG1 RPL26 RPL7A RPS27L NHP2L1 RPL26L1 RPL7L1 RPS28 NMD3 RPL27 RPL8 RPS29 NOB1 RPL27A RPL9 RPS3 RCL1 RPL28 RPLP0 RPS3A REXO1 RPL29 RPLP1 RPS4X REXO2 RPL3 RPLP2 RPS4Y1 RMRP RPL30 RPS10 RPS4Y2 RPL10 RPL31 RPS11 RPS5 RPL10A RPL32 RPS12 RPS6 RPL10L RPL34 RPS13 RPS7 RPL11 RPL35 RPS14 RPS8 RPL12 RPL35A RPS15 RPS9 RPL13 RPL36 RPS15A RPSA RPL13A RPL36A RPS16 RRP7 RPL14 RPL36AL RPS17L UBA52 RPL15 RPL37 RPS18 UTP14A RPL17 RPL37A RPS19 UTP14C RPL18 RPL38 RPS2 XRN1 RPL18A RPL39 RPS20 XRN2 RPL19 RPL39L RPS21 file:///X:/jmedgenet/Issue%20makeup/jmedgenet_54_6/Supplement%20R2.htm 1/6 12/28/2018 Supplement R2.htm
Supplemental Table 4A. Summary of novel mutations in known DBA ribosomal genes discovered by Whole Exome Sequencing mily ID, NCI-249, NCI-301, NCI-319, NCI-359, NCI-391, NCI-2, RPL35A NCI-56, RPL15 NCI-81, RPL5 RPS19 RPS10 RPS19 RPS19 RPS26 d 3q29 3p24.2 1p22.1 19q13.2 6p21.31 19q13.2 19q13.2 12q13.2 c a g.197680960T>A g.23960685A>G g.93306307T>C g.42365221A>C g.34392470G>T g.42365276G>T g.42375419G>T g.56435951A>G acid p.V84D p.V103A p.K38Q p.E100X p.R56L p.V138L p.M1V
c.310-2A>G hangeb GTT>GaT predicted splice CTG>CcG AAG>cAG GAG>tAG CGA>CtA GTG>tTG ATG>gTG site llele Not reported Not reported Not reported Not reported Not reported Not reported Not reported Not reported cyc Probably Probably Probably Probably Possibly en-2 N/A N/A Benign damaging damaging damaging damaging damaging Deleterious N/A Deleterious Deleterious N/A Deleterious Tolerated Deleterious Disease-causing n Taster Disease-causing Disease-causing Disease-causing Disease-causing Disease-causing Disease-causing Disease-causing (automatic) M Deleterious N/A Tolerated Deleterious N/A Deleterious Deleterious Deleterious core 15.38 16.19 N/A 12.5 18.78 10.76 13.46 14.31 + score 5.35 5.83 5.68 4.57 5.19 4.57 4.52 5.92 on based on the reference human genome UCSC build hg19/Genome Reference Consortium GRCh37 ase letter indicates the mutant nucleotide ed in 1000Genomes, ESP and ExAC Supplemental Table 4B. Summary of deletions in known DBA ribosomal genes discovered by deletion analyses CI Family ID, NCI-418, NCI-51, RPS17del NCI-71, RPL35Adel NCI-76, RPS26del NCI-312, RPS17del ene RPL35Adel ne cytoband 15q25.2 3q29 12q13.2 15q25.2 3q29 undaries of chr15: 5:82,993,199- chr3:195,507,436- chr12: ~56,425,760- chr15: ~83,195,579- chr3: ~197,674,279- letiona 84,790,612 198,022,430 56,447,522 84,832,932 197,692,417 ze of deletion 1,797,413 bp* 2,514,994 bp* At least 23,698 bp* At least 1,614,662 bp* At least 18,138 bp* ne start position 83,205,501 197,677,052 56,435,686 83,205,501 197,677,052 ne end position 83,209,295 197,682,721 56,438,007 83,209,295 197,682,721 on based on the reference human genome UCSC build hg19/Genome Reference Consortium GRCh37 of the entire coding sequence Supplemental Table 5. Clinical characteristics of affected participants with causative genetic changes in known ribosomal genes
eADA Epo Initial Hb MCV elation Age† Dysmorphology and Other (IU/g HbF Gender Gene hematopoietic Treatment†† (gm/dL) (fL) (mU/ (years) Clinical Features Hb) (%)††† Ship symptoms ††† ††† ml) ††† ††† hypospadias, absent left kidney, steroid responsive until age 13, roband male 14.05 RPL35A anemia at birth 5.6 106 0.91 6.8 580.1 presacral dimple, snub nose then transfusion dependent short stature, shield chest, short anemia at age steroid responsive with roband female 28.21 RPS17 web neck, scoliosis, spine 10 105 0.77 6.3 1291 6 months intermittent transfusions compression fracture developmental delay, cerebral steroids and transfusions, in roband male 3.11 RPL15 anemia at birth palsy, radioulnar synostosis, 7.2 91 2.41 14.9 N/A remission horseshoe kidney anemia at age developmental delay, short steroid responsive, with roband female 24.75 RPL35A 10.9 95 0.91 4.1 124.5 1 year stature, failure to thrive neutropenia no dysmorphology reported. steroid responsive, stopped to anemia at age roband male 3.18 RPS26 Short stature secondary to allow for pubertal growth and 8.9 106 0.65 N/A N/A 3 months steroids then transfusion dependent bilaterally absent thumbs, small & fused radius/ulna; cardiac roband female 6.00 RPL5 anemia at birth steroid responsive 13.4 88.8 2.82 N/A N/A septal defect unspecified, missing ribs, imperforate anus roband female 8.87 RPS19 anemia at birth mild epicanthal folds steroid responsive 12.1 99.1 1.7 3.2 52.2
anemia at age duplication of renal collecting roband male 1.89 RPS10 steroid responsive 10.2 90.5 1.83 N/A N/A 1 year system roband male 1.97 RPS17 anemia at age failure to thrive, neutropenia transfusion dependent 7.2 86 N/A N/A N/A file:///X:/jmedgenet/Issue%20makeup/jmedgenet_54_6/Supplement%20R2.htm 2/6 12/28/2018 Supplement R2.htm 2 months 10/10 MUD HSCT at age 3 for steroid refractory, transfusion roband male 0.73 RPS19 anemia at birth no dysmorphology reported 7.9 82.2 N/A N/A N/A dependent anemia and iron overload steroid responsive, then steroids anemia at age roband male 31.26 RPS19 no dysmorphology reported and transfusion dependent from 10.5 126 1.33 14.5 762 3 months age 31 years bilateral epicanthal folds, broad anemia at age fspring male 6.10 RPS19 nasal root, webbed neck, low steroid responsive 9.6 103 2.51 7.5 669 3 months posterior hairline, clinodactyly anemia at age roband male 42 RPS26 no dysmorphology reported steroid responsive N/A N/A N/A N/A N/A 2 months metopic suture ridge, microcephaly, large eyes, roband male 0.83 RPL35A anemia at birth transfusion dependent since birth 8.5 83.5 0.3 N/A N/A asymmetric ears, atrial septal defect †: Age at study entry ††: Treatment last reported †††: Results prior to red blood cell transfusion, when applicable VSD: ventricular septal defect; HSCT: hematopoietic stem cell transplant; MUD: matched unrelated donor; Hb: hemoglobin; MCV: mean corpuscular volume; eADA: erythrocyte adenosine deaminase level; HbF: fetal hemoglobin; epo: erythropoietin; N/A: not available Supplemental Table 6A. Genes deleted in family NCI-51 with large deletion involving ribosomal genes RPS17 and RPS17L Family NCI-51 Deletion chr15:82,993,199-84,790,612 (1,797,413 bp)*
Gene Start position End position GOLGA6L10 83009406 83018198 UBE2Q2P2 83023772 83084341 UBE2Q2P3 83023772 83084729 GOLGA6L9 83098709 83108111 LOC440297 83130032 83145983 LOC727849 83140198 83182930 AGSK1 83140663 83182901 RPS17L** 83205503 83209208 RPS17** 83205503 83209208 CPEB1 83211950 83316728 LOC283692 83316520 83361572 AP3B2 83328032 83378635 LOC338963 83379222 83382745 LOC283693 83394649 83408532 SCARNA15 83424696 83424823 FSD2 83428023 83474806 WHAMM 83477972 83503613 HOMER2 83517728 83621476 FAM103A1 83654954 83659809 C15orf40 83657714 83680393 BTBD1 83685180 83736106 MIR4515 83736086 83736167 TM6SF1 83776323 83806111 HDGFRP3 83806803 83876770 BNC1 83924654 83953468 SH3GL3 84116090 84287493 ADAMTSL3 84322837 84708593 EFTUD1P1 84748938 84795353 *reported based on Genome Research Consortium GRCh37/hg19 assembly **Genes of interest Supplemental Table 6B. Genes deleted in family NCI-71 with large deletion involving ribosomal gene RPL35A Family NCI-71 Deletion chr3:195,507,436-198,022,430 (2,514,994 bp)*
Gene Start position End position file:///X:/jmedgenet/Issue%20makeup/jmedgenet_54_6/Supplement%20R2.htm 3/6 12/28/2018 Supplement R2.htm MUC4 195473637 195538844 TNK2 195590235 195635880 SDHAP1 195686791 195717150 TFRC 195776154 195809032 LOC401109 195869506 195887761 ZDHHC19 195924322 195938300 SLC51A 195943382 195960301 PCYT1A 195965252 196014584 TCTEX1D2 196018089 196045165 TM4SF19- TCTEX1D2 196042955 196065291 TM4SF19 196050416 196065291 UBXN7 196080368 196159345 RNF168 196195656 196230639 C3orf43 196233749 196242237 WDR53 196281058 196295413 FBXO45 196295724 196315930 LRRC33 196366655 196388874 CEP19 196433147 196439123 PIGX 196439244 196462876 PAK2 196466727 196559518 SENP5 196594726 196661584 NCBP2 196662272 196669464 LOC152217 196669493 196670884 PIGZ 196673213 196695704 MFI2-AS1 196729776 196731615 MFI2 196728611 196756687 DLG1 196769430 197025447 MIR4797 197020748 197020819 DLG1-AS1 197025117 197030621 BDH1 197236653 197300194 LOC220729 197340897 197354752 MIR922 197401366 197401447 KIAA0226 197398258 197476568 FYTTD1 197476423 197511317 LRCH3 197518144 197598456 IQCG 197615945 197686886 RPL35A** 197677051 197682721 LMLN 197687070 197770591 ANKRD18DP 197784403 197807542 FAM157A 197879236 197907728 *reported based on Genome Research Consortium GRCh37/hg19 assembly **Gene of interest Supplemental Figures Supplemental Figure 1. Northern blot analysis of pre-rRNA processing was performed with a hybridization probe to ITS2 (A and B) and ITS1 (C and D), shown as * above the schematic, using mononuclear cells recovered from the peripheral blood from the affected individuals in families with known causative genes for DBA and an unaffected control individual WT expression of the novel ribosomal genes. Figure 1A. Pre-rRNA processing analysis showing an increase in the 45S and 41S pre-rRNA intermediates with appearance of a 36S pre-rRNA band in family NCI-71 with mosaic deletion in RPL35A Figure 1B. Pre-rRNA processing analysis showing increase in 32S pre-rRNA intermediate in family NCI-56 with a splice site mutation in RPL15 Figure 1C. Pre-rRNA processing analysis showing characteristic strong increase in 30S and slight decrease in 21S pre-rRNA intermediates in family NCI-29 with single copy gene deletion in RPS24 Figure 1D. Pre-rRNA processing analysis showing increase in 21S and 41S pre-rRNA intermediates in family NCI-359 with a mutation in RPS19 Supplementary Methods Whole Exome Sequencing Briefly, genomic DNA libraries were prepared and amplified with the Bioo Scientific NEXTflex Pre-Capture combo kit (Bioo Scientific) and then cleaned with Agencourt AMPure XP reagent (Beckman Coulter, Inc.) according to the protocols. Amplified sample libraries were quantified using Quant-iT PicoGreen dsDNA reagent (Life Technologies, Carlsbad, CA, USA). Exome enrichment was performed with NimbleGen’s SeqCap EZ Human Exome Library v3.0, targeting 64 Mb of exonic sequence (Roche NimbleGen, Inc., Madison, WI, USA). The exome-enriched libraries were amplified by ligation-mediated PCR, purified, and evaluated as above. The resulting post-capture enriched multiplexed sequencing libraries were used in cluster formation on an Illumina cBOT and file:///X:/jmedgenet/Issue%20makeup/jmedgenet_54_6/Supplement%20R2.htm 4/6 12/28/2018 Supplement R2.htm paired-end sequencing was performed using an Illumina HiSeq. Approximately 90% of all targeted bases were covered at a depth of 15× or greater. This minimum threshold resulted in an average coding sequence coverage of 160 reads. The human reference genome and the “known gene” transcript annotation were downloaded from the UCSC database, version hg19 (GRCh37). Sequencing reads are first trimmed using the Trimmomatic program (v0.32), and only read pairs with both ends no shorter than 36 bp are used. Reads are then aligned to the hg19 reference genome using the Novoalign software (v3.00.05). We used only high-quality alignments for each individual, duplicate reads due to artifacts are removed, only reads properly aligned are included, and local realignment is refined around known and novel sites of insertion and deletion polymorphisms using the RealignerTargetCreator and IndelRealigner modules from the Genome Analysis Toolkit (GATK v3.1)[31]. Bam file level recalibration is also performed using BaseRecalibrator module from GATK. Variant discovery and genotype calling of multi-allelic substitutions, insertions and deletions are performed on all individuals globally using the UnifiedGenotyper and HaplotypeCaller modules from GATK as well as the FreeBayes variant caller (v9.9.2). The Ensemble variant calling pipeline (v0.2.2) is then implemented to integrate analysis results from above three callers. The Ensemble variant calling pipeline applies a machine learning algorithm, Support Vector Machine (SVM), to identify an optimal decision boundary based on the variant calling results out of multiple variant callers. In addition, insertions and deletions are left-aligned at both post-alignment (BAM) and post-variant-calling (VCF) levels using GATK’s LeftAlignIndels and LeftAlignVariants modules, respectively. Annotation and variant dissemination are performed using our in-house custom software annotation pipeline. This pipeline adds different types of functional annotations that range from DNA level, to RNA level and to protein/histone level through integration of multiple public-domain applications including SnpEff/SnpSift (http://snpeff.sourceforge.net/), ANNOVAR (http://www.openbioinformatics.org/annovar/), and the public databases UCSC GoldenPath http://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/), ESP6500 from the University of Washington’s Exome Sequencing Project (http://evs.gs.washington.edu/EVS/), the National Center for Biotechnology Information dbSNP database build 137[32], the 1,000 Genomes Project[33], the database of human nonsynonymous SNPs and function predictions dbNSFP (https://sites.google.com/site/jpopgen/dbNSFP), and the Molecular Signatures Database MSigDB (http://www.broadinstitute.org/gsea/msigdb/index.jsp).Variants were also annotated for their presence in our in-house database consisting of approximately 2,000 familial samples that underwent WES in parallel with our DBA families. Variants within each family were filtered as indicated in Supplemental Table 1. In silico analysis Polymorphism Phenotyping Version 2.2.2 (PolyPhen-2)[34], Sorting Intolerant From Tolerant (SIFT)[35], Mutation Taster[36], likelihood ratio test (LRT), MutationAssessor[37] and Functional Analysis through Hidden Markov Models (FATHMM)[38] were used to predict the functional impact of amino acid substitutions. SiPhy[39], the Genomic Evolutionary Rate Profiling (GERP++) method[40], and Phylogenetic Pvalues (PhyloP)[41] were used to estimate the level of conservation at these sites; the larger these scores, the more conservation at the site. DbNSFP was utilized to compile the prediction scores from the following programs: Polyphen-2, SIFT, MutationTaster, LRT, MutationAssessor, FATHHM, SiPhy, GERP++, and PhyloP.[42 43] I-Mutant Suite[44 45] was employed to predict the protein stability changes, the sign and the value of free energy stability change, from the each identified mutation. Variant validation Variants of interest were validated to rule out false positive findings using one of the following two similar methods. (1) Using an Ion 316 chip on the Ion Torrent PGM Sequencer (Life Technologies). Primers for sequencing were designed using Primer3 software (http://jura.wi.mit.edu/rozen/papers/rozen-and-skaletsky- 2000-primer3.pdf). The BLAT feature on the UCSC Genome Browser (ucsc.genome.edu) and NetPrimer software (http://www.premierbiosoft.com/netprimer/index.html) were used to evaluate sequence specificity and oligo folding irregularities. Primers were provided by IDT Technologies (Coralville, Iowa, USA). Samples were amplified using KAPA2 RobustHotstart Readymix (2X) (Kapa Biosystems, Johannesburg, South Africa). Amplicons were purified using Agencourt’s Ampure XP beads, then libraries were constructed and barcoded using the Ion Xpress Plus Fragment Library Kit (Life Technologies). Sample libraries were sequenced using Life Technologies’ OneTouch and run on the Ion Torrent PGM Sequencer (Life Technologies). (2) Using a targeted, multiplexed PCR primer panel designed using the Ion AmpliSeq Designer (Life Technologies). Sample DNA was amplified using this custom AmpliSeq primer pool, and libraries were prepared following the manufacturer’s Ion AmpliSeq Library Preparation protocol (Life Technologies). Individual sample libraries were barcoded, pooled, templated, and sequenced on the Ion Torrent PGM Sequencer using the Ion PGM Template OT2 200 and Ion PGM Sequencing 200v2 kits per manufacturer’s instructions. For both methods, the default TMAP aligner and variant caller were used to generate a variant list per sample. Primer sequences are given in Supplemental Table 2. Omniexpress Chip Genotyping High-throughput, genome-wide SNP genotyping, using Infinium HumanOmniExpress BeadChip technology (Illumina Inc. San Diego, CA), was performed at the NCI’s CGR laboratory. Genotyping was performed according to manufacturer’s guidelines using the Infinium HD Assay automated protocol.Samples were denatured and neutralized then isothermally amplified by whole-genome amplification. The amplified product was enzymatically fragmented, then precipitated and re-suspended before hybridization to the BeadChip. Single-base extension of the oligos on the BeadChip, using the captured DNA as a template, incorporates tagged nucleotides on the BeadChip, which were subsequently fluorophore labeled during staining. The fluorescent label determines the genotype call for the sample. The Illumina iScan scanned the BeadChips at two wavelengths to create image files. Copy number variation analysis The CNV analysis was performed between the test (patient) sample and a reference sample. A log based 2 ratio between test and reference sample was calculated based on ngCGH algorithm developed by Sean Davis at the NCI (https://github.com/seandavi/ngCGH). The algorithm takes as input two bam files, test and reference. The reference bam file was pooled from three control bam files (NA12877/NA12889/NA12890). A Genomic window is defined by reading blocks of 1000 reads in the reference sample. Within each defined genomic window, the number of reads in the test sample is quantified. For each genomic window, a ratio is made between the number of reads in the test sample and the number of reads in the reference sample. Finally, a log2 transformation is applied to each ratio and the entire vector of the results is then centered by subtracting the median to make the median of the log2 ratios zero. The log2 ratio was then imported to Nexus version 7.5 (http://www.biodiscovery.com/software/nexus-copy-number). REFERENCES FOR SUPPLEMENTARY METHODS 1. Shimamura A, Alter BP. Pathophysiology and management of inherited bone marrow failure syndromes. Blood reviews 2010;24(3):101-22 doi: 10.1016/j.blre.2010.03.002; 10.1016/j.blre.2010.03.002[published Online First: Epub Date]|. 2. Ball S. Diamond Blackfan anemia. Hematology Am Soc Hematol Educ Program 2011;2011:487-91 3. Gazda HT, Sheen MR, Vlachos A, et al. Ribosomal protein L5 and L11 mutations are associated with cleft palate and abnormal thumbs in Diamond-Blackfan anemia patients. American Journal of Human Genetics 2008;83(6):769-80 doi: 10.1016/j.ajhg.2008.11.004; 10.1016/j.ajhg.2008.11.004[published Online First: Epub Date]|. 4. Vlachos A, Rosenberg P, Atsidaftos E, Alter B, Lipton J. The incidence of neoplasia in Diamond Blackfan Anemia: A report from the Diamond Blackfan anemia registry. Blood 2012;119(16):3815-9 5. Alter BP, Giri N, Savage SA, et al. Malignancies and survival patterns in the National Cancer Institute inherited bone marrow failure syndromes cohort study. British journal of haematology 2010;150(2):179-88 doi: 10.1111/j.1365-2141.2010.08212.x; 10.1111/j.1365-2141.2010.08212.x[published Online First: Epub Date]|. 6. Campagnoli M, Garelli E, Quarello P, et al. Molecular basis of Diamond-Blackfan anemia: new findings from the Italian registry and a review of the literature. Haematologica 2004;89(4):480-9 7. Farrar JE, Dahl N. Untangling the phenotypic heterogeneity of Diamond Blackfan anemia. Seminars in Hematology 2011;48:124-35 8. Narla A, Ebert B. Ribosomopathies: human disorders of ribosome dysfunction. Blood. 2010;115(16):3196-205 9. Draptchinskaia N, Gustavsson P, Andersson B, et al. The gene encoding ribosomal protein S19 is mutated in Diamond-Blackfan anaemia. Nat Genet 1999;21:169-75 10. Campagnoli M, Ramenghi U, Armiraglio M, et al. RPS19 mutations in patients with Diamond-Blackfan anemia. Hum Mutat 2008;29:911-20 11. Farrar JE, Vlachos A, Atsidaftos E, et al. Ribosomal protein gene deletions in Diamond-Blackfan anemia. Blood 2011;118:6943-51 12. Boria I, Garelli E, Gazda HT, et al. The ribosomal basis of diamond-blackfan anemia: mutation and database update. Human Mutation 2010;31(12):1269-79 doi: 10.1002/humu.21383[published Online First: Epub Date]|. file:///X:/jmedgenet/Issue%20makeup/jmedgenet_54_6/Supplement%20R2.htm 5/6 12/28/2018 Supplement R2.htm 13. Gazda HT, Preti M, Sheen MR, et al. Frameshift mutation in p53 regulator RPL26 is associated with multiple physical abnormalities and a specific pre- ribosomal RNA processing defect in diamond-blackfan anemia. Human Mutation 2012;33:1037-44 14. Mirabello L, Macari ER, Jessop L, et al. Whole-exome sequencing and functional studies identify RPS29 as a novel gene mutated in multicase Diamond- Blackfan anemia families. Blood 2014;124(1):24-32 doi: 10.1182/blood-2013-11-540278[published Online First: Epub Date]|. 15. Landowski M, O'Donohue MF, Buros C, et al. Novel deletion of RPL15 identified by array-comparative genomic hybridization in Diamond-Blackfan anemia. Hum Genet 2013 doi: 10.1007/s00439-013-1326-z[published Online First: Epub Date]|. 16. Gripp KW, Curry C, Olney AH, et al. Diamond-Blackfan anemia with mandibulofacial dystostosis is heterogeneous, including the novel DBA genes TSR2 and RPS28. Am J Med Genet A 2014;164A(9):2240-9 doi: 10.1002/ajmg.a.36633[published Online First: Epub Date]|. 17. Wang R, Yoshida K, Toki T, et al. Loss of function mutations in RPL27 and RPS27 identified by whole-exome sequencing in Diamond-Blackfan anaemia. Br J Haematol 2015;168(6):854-64 doi: 10.1111/bjh.13229[published Online First: Epub Date]|. 18. Sankaran VG, Ghazvinian R, Do R, et al. Exome sequencing identifies GATA1 mutations resulting in Diamond-Blackfan anemia. The Journal of clinical investigation 2012;122(7):2439-43 doi: 10.1172/JCI63597; 10.1172/JCI63597[published Online First: Epub Date]|. 19. Fargo JH, Kratz CP, Giri N, et al. Erythrocyte adenosine deaminase: diagnostic value for Diamond-Blackfan anaemia. British Journal of Haematology 2013;160(4):547-54 doi: 10.1111/bjh.12167[published Online First: Epub Date]|. 20. Ballew BJ, Yeager M, Jacobs K, et al. Germline mutations of regulator of telomere elongation helicase 1, RTEL1, in Dyskeratosis congenita. Human Genetics 2013;132(4):473-80 doi: 10.1007/s00439-013-1265-8[published Online First: Epub Date]|. 21. Berndt SI, Skibola CF, Joseph V, et al. Genome-wide association study identifies multiple risk loci for chronic lymphocytic leukemia. Nat Genet 2013;45(8):868-76 doi: 10.1038/ng.2652[published Online First: Epub Date]|. 22. Chandrasekharappa SC, Lach FP, Kimble DC, et al. Massively parallel sequencing, aCGH, and RNA-Seq technologies provide a comprehensive molecular diagnosis of Fanconi anemia. Blood 2013;121(22):e138-48 doi: 10.1182/blood-2012-12-474585; 10.1182/blood-2012-12-474585[published Online First: Epub Date]|. 23. Jacobs KB, Yeager M, Zhou W, et al. Detectable clonal mosaicism and its relationship to aging and cancer. Nat Genet 2012;44(6):651-8 doi: 10.1038/ng.2270[published Online First: Epub Date]|. 24. Farrar JE, Quarello P, Fisher R, et al. Exploiting pre-rRNA processing in Diamond Blackfan anemia gene discovery and diagnosis. Am J Hematol 2014;89(10):985-91 doi: 10.1002/ajh.23807[published Online First: Epub Date]|. 25. Babiano R, de la Cruz J. Ribosomal protein L35 is required for 27SB pre-rRNA processing in Saccharomyces cerevisiae. Nucleic acids research 2010;38(15):5177-92 doi: 10.1093/nar/gkq260[published Online First: Epub Date]|. 26. Gazda HT, Preti M, Sheen MR, et al. Frameshift mutation in p53 regulator RPL26 is associated with multiple physical abnormalities and a specific pre- ribosomal RNA processing defect in diamond-blackfan anemia. Human mutation 2012;33(7):1037-44 doi: 10.1002/humu.22081; 10.1002/humu.22081[published Online First: Epub Date]|. 27. Henras AK, Plisson-Chastang C, O'Donohue MF, Chakraborty A, Gleizes PE. An overview of pre-ribosomal RNA processing in eukaryotes. Wiley interdisciplinary reviews. RNA 2015;6(2):225-42 doi: 10.1002/wrna.1269[published Online First: Epub Date]|. 28. Gazda HT, Grabowska A, Merida-Long LB, et al. Ribosomal protein S24 gene is mutated in Diamond-Blackfan anemia. American Journal of Human Genetics 2006;79(6):1110-18 doi: 10.1086/510020[published Online First: Epub Date]|. 29. Ban N, Beckmann R, Cate JH, et al. A new system for naming ribosomal proteins. Curr Opin Struct Biol 2014;24:165-9 doi: 10.1016/j.sbi.2014.01.002[published Online First: Epub Date]|. 30. Clinton C, Gazda HT. Diamond-Blackfan Anemia. In: Pagon RA, Adam MP, Bird TD, Dolan CR, Fong CT, Stephens K, eds. GeneReviews. Seattle (WA): University of Washington, Seattle, 1993. 31. DePristo MA, Banks E, Poplin R, et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nature genetics 2011;43(5):491-8 doi: 10.1038/ng.806[published Online First: Epub Date]|. 32. Sherry ST, Ward MH, Kholodov M, et al. dbSNP: the NCBI database of genetic variation. Nucleic acids research 2001;29(1):308-11 33. A map of human genome variation from population-scale sequencing. Nature 2010;467(7319):1061-73 doi: 10.1038/nature09534[published Online First: Epub Date]|. 34. Adzhubei IA, Schmidt S, Peshkin L, et al. A method and server for predicting damaging missense mutations. Nat Meth 2010;7(4):248-49 doi: http://www.nature.com/nmeth/journal/v7/n4/suppinfo/nmeth0410-248_S1.html[published Online First: Epub Date]|. 35. Kumar P, Henikoff S, Ng PC. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat. Protocols 2009;4(8):1073-81 36. Schwarz JM, Rodelsperger C, Schuelke M, Seelow D. MutationTaster evaluates disease-causing potential of sequence alterations. Nat Meth 2010;7(8):575- 76 doi: http://www.nature.com/nmeth/journal/v7/n8/abs/nmeth0810-575.html#supplementary-information[published Online First: Epub Date]|. 37. Reva B, Antipin Y, Sander C. Determinants of protein function revealed by combinatorial entropy optimization. Genome biology 2007;8(11):R232 doi: 10.1186/gb-2007-8-11-r232[published Online First: Epub Date]|. 38. Shihab HA, Gough J, Cooper DN, et al. Predicting the functional, molecular, and phenotypic consequences of amino acid substitutions using hidden Markov models. Hum Mutat 2013;34(1):57-65 doi: 10.1002/humu.22225[published Online First: Epub Date]|. 39. Garber M, Guttman M, Clamp M, Zody MC, Friedman N, Xie X. Identifying novel constrained elements by exploiting biased substitution patterns. Bioinformatics 2009;25(12):i54-i62 doi: 10.1093/bioinformatics/btp190[published Online First: Epub Date]|. 40. Davydov EV, Goode DL, Sirota M, Cooper GM, Sidow A, Batzoglou S. Identifying a High Fraction of the Human Genome to be under Selective Constraint Using GERP++. PLoS Comput Biol 2010;6(12):e1001025 doi: 10.1371/journal.pcbi.1001025[published Online First: Epub Date]|. 41. Siepel A, Pollard K, Haussler D. New Methods for Detecting Lineage-Specific Selection. In: Apostolico A, Guerra C, Istrail S, Pevzner P, Waterman M, eds. Research in Computational Molecular Biology: Springer Berlin Heidelberg, 2006:190-205. 42. Liu X, Jian X, Boerwinkle E. dbNSFP v2.0: A Database of Human Non-synonymous SNVs and Their Functional Predictions and Annotations. Human Mutation 2013;34(9):E2393-E402 doi: 10.1002/humu.22376[published Online First: Epub Date]|. 43. Liu X, Jian X, Boerwinkle E. dbNSFP: A lightweight database of human nonsynonymous SNPs and their functional predictions. Human Mutation 2011;32(8):894-99 doi: 10.1002/humu.21517[published Online First: Epub Date]|. 44. Capriotti E, Fariselli P, Calabrese R, Casadio R. Predicting protein stability changes from sequences using support vector machines. Bioinformatics 2005;21(suppl 2):ii54-ii58 doi: 10.1093/bioinformatics/bti1109[published Online First: Epub Date]|. 45. Capriotti E, Fariselli P, Casadio R. I-Mutant2.0: predicting stability changes upon mutation from the protein sequence or structure. Nucleic Acids Research 2005;33(suppl 2):W306-W10 doi: 10.1093/nar/gki375[published Online First: Epub Date]|.
file:///X:/jmedgenet/Issue%20makeup/jmedgenet_54_6/Supplement%20R2.htm 6/6