Multi-Omics Database Analysis of Aminoacyl-Trna Synthetases in Cancer
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
WARS Recombinant Protein Description Product Info
9853 Pacific Heights Blvd. Suite D. San Diego, CA 92121, USA Tel: 858-263-4982 Email: [email protected] 32-2929: WARS Recombinant Protein Alternative GAMMA-2,IFI53,IFP53,WRS,WARS,TrpRS,hWRS,EC=6.1.1.2,Tryptophanyl-tRNA synthetase,Interferon- Name : induced protein 53,Tryptophan--tRNA ligase,GAMMA-2. Description Source : Escherichia Coli. WARS Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 491 amino acids (1-471 a.a.) and having a molecular mass of 55.3 kDa. The WARS is fused to a 20 amino acid His- Tag at N-terminus and purified by proprietary chromatographic techniques. WARS is part of the class I tRNA synthetase family. 2 types of tryptophanyl tRNA synthetase exist, a cytoplasmic form, called WARS, and a mitochondrial form, called WARS2. WARS catalyzes the aminoacylation of tRNA(trp) with tryptophan and is induced by interferon. WARS controls ERK, Akt, and eNOS activation pathways that are related with angiogenesis, cytoskeletal reorganization and shear stress-responsive gene expression. Product Info Amount : 25 µg Purification : Greater than 90.0% as determined by SDS-PAGE. 1mg/ml solution containing 20mM Tris-HCl pH-8, 1mM DTT, 0.1M NaCl, 1mM DTT & 10% Content : glycerol. Store at 4°C if entire vial will be used within 2-4 weeks. Store, frozen at -20°C for longer periods of Storage condition : time. For long term storage it is recommended to add a carrier protein (0.1% HSA or BSA).Avoid multiple freeze-thaw cycles. Amino Acid : MGSSHHHHHH SSGLVPRGSH MPNSEPASLL ELFNSIATQG ELVRSLKAGN ASKDEIDSAV KMLVSLKMSY KAAAGEDYKA DCPPGNPAPT SNHGPDATEA EEDFVDPWTV QTSSAKGIDY DKLIVRFGSS KIDKELINRI ERATGQRPHH FLRRGIFFSH RDMNQVLDAY ENKKPFYLYT GRGPSSEAMH VGHLIPFIFT KWLQDVFNVP LVIQMTDDEK YLWKDLTLDQ AYSYAVENAK DIIACGFDIN KTFIFSDLDY MGMSSGFYKN VVKIQKHVTF NQVKGIFGFT DSDCIGKISF PAIQAAPSFS NSFPQIFRDR TDIQCLIPCA IDQDPYFRMT RDVAPRIGYP KPALLHSTFF PALQGAQTKM SASDPNSSIF LTDTAKQIKT KVNKHAFSGG RDTIEEHRQF GGNCDVDVSF MYLTFFLEDD DKLEQIRKDY TSGAMLTGEL KKALIEVLQP LIAEHQARRK EVTDEIVKEF MTPRKLSFDF Q. -
Open Dogan Phdthesis Final.Pdf
The Pennsylvania State University The Graduate School Eberly College of Science ELUCIDATING BIOLOGICAL FUNCTION OF GENOMIC DNA WITH ROBUST SIGNALS OF BIOCHEMICAL ACTIVITY: INTEGRATIVE GENOME-WIDE STUDIES OF ENHANCERS A Dissertation in Biochemistry, Microbiology and Molecular Biology by Nergiz Dogan © 2014 Nergiz Dogan Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2014 ii The dissertation of Nergiz Dogan was reviewed and approved* by the following: Ross C. Hardison T. Ming Chu Professor of Biochemistry and Molecular Biology Dissertation Advisor Chair of Committee David S. Gilmour Professor of Molecular and Cell Biology Anton Nekrutenko Professor of Biochemistry and Molecular Biology Robert F. Paulson Professor of Veterinary and Biomedical Sciences Philip Reno Assistant Professor of Antropology Scott B. Selleck Professor and Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School iii ABSTRACT Genome-wide measurements of epigenetic features such as histone modifications, occupancy by transcription factors and coactivators provide the opportunity to understand more globally how genes are regulated. While much effort is being put into integrating the marks from various combinations of features, the contribution of each feature to accuracy of enhancer prediction is not known. We began with predictions of 4,915 candidate erythroid enhancers based on genomic occupancy by TAL1, a key hematopoietic transcription factor that is strongly associated with gene induction in erythroid cells. Seventy of these DNA segments occupied by TAL1 (TAL1 OSs) were tested by transient transfections of cultured hematopoietic cells, and 56% of these were active as enhancers. Sixty-six TAL1 OSs were evaluated in transgenic mouse embryos, and 65% of these were active enhancers in various tissues. -
DNA Sequencing and Sorting: Identifying Genetic Variations
BioMath DNA Sequencing and Sorting: Identifying Genetic Variations Student Edition Funded by the National Science Foundation, Proposal No. ESI-06-28091 This material was prepared with the support of the National Science Foundation. However, any opinions, findings, conclusions, and/or recommendations herein are those of the authors and do not necessarily reflect the views of the NSF. At the time of publishing, all included URLs were checked and active. We make every effort to make sure all links stay active, but we cannot make any guaranties that they will remain so. If you find a URL that is inactive, please inform us at [email protected]. DIMACS Published by COMAP, Inc. in conjunction with DIMACS, Rutgers University. ©2015 COMAP, Inc. Printed in the U.S.A. COMAP, Inc. 175 Middlesex Turnpike, Suite 3B Bedford, MA 01730 www.comap.com ISBN: 1 933223 71 5 Front Cover Photograph: EPA GULF BREEZE LABORATORY, PATHO-BIOLOGY LAB. LINDA SHARP ASSISTANT This work is in the public domain in the United States because it is a work prepared by an officer or employee of the United States Government as part of that person’s official duties. DNA Sequencing and Sorting: Identifying Genetic Variations Overview Each of the cells in your body contains a copy of your genetic inheritance, your DNA which has been passed down to you, one half from your biological mother and one half from your biological father. This DNA determines physical features, like eye color and hair color, and can determine susceptibility to medical conditions like hypertension, heart disease, diabetes, and cancer. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Identifying Glaucoma Susceptibility Genes in Extended Families
Identifying Glaucoma Susceptibility Genes in Extended Families by Patricia Stacey Graham BSc(Hons), GradDipEd Menzies Institute for Medical Research | College of Health and Medicine Submitted in fulfilment of the requirements for the degree of Doctor of Philosophy (Medical Studies) University of Tasmania, March 2020 Declaration of Originality This thesis contains no material which has been accepted for a degree or diploma by the University or any other institution, except by way of background information and duly acknowledged in the thesis, and to the best of my knowledge and belief no material previously published or written by another person except where due acknowledgement is made in the text of the thesis, nor does the thesis contain any material that infringes copyright. 13/3/2020 i Authority of access This thesis may be made available for loan and limited copying and communication in accordance with the Copyright Act 1968. 13/3/2020 ii Statement of ethical conduct The research associated with this thesis abides by the international and Australian codes on human experimentation and the guidelines and the rulings of the Ethics Committee of the University. Ethics Approval Numbers: University of Tasmania Human Research Ethics Committee H0014085 Oregon Health and Science University Institutional Review Board #1306 13/3/2020 iii Dedication To my parents Susie and Micky Lowry Who instilled in me the love of learning and who would have been so proud iv Acknowledgements What a rollercoaster the last four years have been …. it’s been an amazing ride. Rollercoasters are no fun alone, and I would sincerely like to thank the following people who kept the ride rolling and to those who sat with me in the carriage and didn’t let me fall out. -
Evolution of the DAN Gene Family in Vertebrates
bioRxiv preprint doi: https://doi.org/10.1101/794404; this version posted June 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. RESEARCH ARTICLE Evolution of the DAN gene family in vertebrates Juan C. Opazo1,2,3, Federico G. Hoffmann4,5, Kattina Zavala1, Scott V. Edwards6 1Instituto de Ciencias Ambientales y Evolutivas, Facultad de Ciencias, Universidad Austral de Chile, Valdivia, Chile. 2David Rockefeller Center for Latin American Studies, Harvard University, Cambridge, MA 02138, USA. 3Millennium Nucleus of Ion Channels-Associated Diseases (MiNICAD). 4 Department of Biochemistry, Molecular Biology, Entomology, and Plant Pathology, Mississippi State University, Mississippi State, 39762, USA. Cite as: Opazo JC, Hoffmann FG, 5 Zavala K, Edwards SV (2020) Institute for Genomics, Biocomputing, and Biotechnology, Mississippi State Evolution of the DAN gene family in University, Mississippi State, 39762, USA. vertebrates. bioRxiv, 794404, ver. 3 peer-reviewed and recommended by 6 PCI Evolutionary Biology. doi: Department of Organismic and Evolutionary Biology, Harvard University, 10.1101/794404 Cambridge, MA 02138, USA. This article has been peer-reviewed and recommended by Peer Community in Evolutionary Biology Posted: 29 June 2020 doi: 10.24072/pci.evolbiol.100104 ABSTRACT Recommender: Kateryna Makova The DAN gene family (DAN, Differential screening-selected gene Aberrant in Neuroblastoma) is a group of genes that is expressed during development and plays fundamental roles in limb bud formation and digitation, kidney formation and morphogenesis and left-right axis specification. -
1 Supporting Information for a Microrna Network Regulates
Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia. -
The Structure, Stability and Pheromone Binding of the Male Mouse Protein Sex Pheromone Darcin
The Structure, Stability and Pheromone Binding of the Male Mouse Protein Sex Pheromone Darcin Marie M. Phelan1, Lynn McLean2, Stuart D. Armstrong2, Jane L. Hurst3, Robert J. Beynon2, Lu-Yun Lian1* 1 NMR Centre for Structural Biology, Institute of Integrative Biology, University of Liverpool, Liverpool, United Kingdom, 2 Protein Function Group, Institute of Integrative Biology, University of Liverpool, Liverpool, United Kingdom, 3 Mammalian Behaviour & Evolution Group, Institute of Integrative Biology, University of Liverpool, Leahurst Campus, Neston, United Kingdom Abstract Mouse urine contains highly polymorphic major urinary proteins that have multiple functions in scent communication through their abilities to bind, transport and release hydrophobic volatile pheromones. The mouse genome encodes for about 20 of these proteins and are classified, based on amino acid sequence similarity and tissue expression patterns, as either central or peripheral major urinary proteins. Darcin is a male specific peripheral major urinary protein and is distinctive in its role in inherent female attraction. A comparison of the structure and biophysical properties of darcin with MUP11, which belongs to the central class, highlights similarity in the overall structure between the two proteins. The thermodynamic stability, however, differs between the two proteins, with darcin being much more stable. Furthermore, the affinity of a small pheromone mimetic is higher for darcin, although darcin is more discriminatory, being unable to bind bulkier ligands. These attributes are due to the hydrophobic ligand binding cavity of darcin being smaller, caused by the presence of larger amino acid side chains. Thus, the physical and chemical characteristics of the binding cavity, together with its extreme stability, are consistent with darcin being able to exert its function after release into the environment. -
[One Step]WARS Antibody Kit
Leader in Biomolecular Solutions for Life Science [One Step]WARS Antibody Kit Catalog No.: RK05722 Basic Information Background Catalog No. Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate RK05722 amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first Applications proteins that appeared in evolution. Two forms of tryptophanyl-tRNA synthetase exist, a WB cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. Tryptophanyl-tRNA synthetase (WARS) catalyzes the aminoacylation of tRNA(trp) with Cross-Reactivity tryptophan and is induced by interferon. Tryptophanyl-tRNA synthetase belongs to the Human, Mouse, Rat class I tRNA synthetase family. Four transcript variants encoding two different isoforms have been found for this gene. Observed MW 53-55kDa Calculated MW 48kDa/53kDa Category Antibody kit Product Information Component & Recommended Dilutions Source Catalog No. Product Name Dilutions Rabbit RK05722-1 WARS Rabbit pAb 1:1000 dilution Purification RK05722-2 HRP Goat Anti-Rabbit IgG (H+L) 1:10000 dilution Affinity purification Storage Store at -20℃. Avoid freeze / thaw Immunogen Information cycles. Buffer: PBS with 0.02% sodium azide, Gene ID Swiss Prot 50% glycerol, pH7.3. 7453 P23381 Avoid repeated freeze-thaw cycles. Immunogen Recombinant fusion protein containing a sequence corresponding to amino acids 1-270 Contact of human WARS (NP_776049.1). www.abclonal.com Synonyms WARS;GAMMA-2;IFI53;IFP53 Validation Data Western blot analysis of extracts of various cells, using WARS antibody (A5758) at 1:1000 dilution ratio through one-step method. Antibody | Protein | ELISA Kits | Enzyme | NGS | Service For research use only. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Supplementary Materials
Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine